Detection of Dirofilaria immitis and other arthropod-borne filarioids by an HRM real-time qPCR, blood-concentrating techniques and a serological assay in dogs from Costa Rica.

Science.gov (United States)

Rojas, Alicia; Rojas, Diana; Montenegro, Víctor M; Baneth, Gad

2015-03-23

Canine filarioids are important nematodes transmitted to dogs by arthropods. Diagnosis of canine filariosis is accomplished by the microscopic identification of microfilariae, serology or PCR for filarial-DNA. The aim of this study was to evaluate a molecular assay for the detection of canine filariae in dog blood, to compare its performance to other diagnostic techniques, and to determine the relationship between microfilarial concentration and infection with other vector-borne pathogens. Blood samples from 146 dogs from Costa Rica were subjected to the detection of canine filarioids by four different methods: the microhematocrit tube test (MCT), Knott's modified test, serology and a high resolution melt and quantitative real-time PCR (HRM-qPCR). Co-infection with other vector-borne pathogens was also evaluated. Fifteen percent of the dogs were positive to Dirofilaria immitis by at least one of the methods. The HRM-qPCR produced distinctive melting plots for the different filarial worms and revealed that 11.6% of dogs were infected with Acanthocheilonema reconditum. The latter assay had a limit of detection of 2.4x10⁻⁴ mf/μl and detected infections with lower microfilarial concentrations in comparison to the microscopic techniques and the serological assay. The MCT and Knott's test only detected dogs with D. immitis microfilaremias above 0.7 mf/μl. Nevertheless, there was a strong correlation between the microfilarial concentration obtained by the Knott's modified test and the HRM-qPCR (r = 0.906, p HRM-qPCR showed the most sensitive and reliable performance in the detection of blood filaroids in comparison to the Knott's modified test, the MCT test and a serological assay.

Performances of Four Helicobacter pylori Serological Detection Kits Using Stool Antigen Test as Gold Standard.

Science.gov (United States)

Biranjia-Hurdoyal, Susheela D; Seetulsingh-Goorah, Sharmila P

2016-01-01

The aim was to determine the performances of four Helicobacter pylori serological detection kits in different target groups, using Amplified IDEIA™ Hp StAR™ as gold standard. Kits studied were Rapid Immunochromatoghraphic Hexagon, Helicoblot 2.1, an EIA IgG kit and EIA IgA kit. Stool and blood samples were collected from 162 apparently healthy participants (control) and 60 Type 2 diabetes mellitus (T2DM) patients. The performances of the four serological detection kits were found to be affected by gender, age, health status and ethnicity of the participants. In the control group, the Helicoblot 2.1 kit had the best performance (AUC = 0.85; ppoor performances. In the T2DM subgroup, the kits H2.1 and EIA IgG had best performances, with accuracies of 96.5% and 93.1% respectively. The performance of EIA IgG improved with adjustment of its cut-off value. The performances of the detection kits were affected by various factors which should be taken into consideration.

Assessment of serology and spirometry and the combination of both to complement microbiological isolation for earlier detection of Pseudomonas aeruginosa infection in children with cystic fibrosis.

Science.gov (United States)

Kotnik Pirš, Ana; Krivec, Uroš; Simčič, Saša; Seme, Katja

2016-11-25

The aim of this study was to assess whether serology and spirometry and the combination of both can complement culture-based detection for earlier recognition of Pseudomonas aeruginosa infection in children with cystic fibrosis. A 4 year longitudinal prospective study that included 67 Slovenian children with cystic fibrosis with a mean age of 10.5 years was conducted. Serology, spirometry and a scoring system combining serology and spirometry were assessed and compared. Infection was confirmed with isolation of Pseudomonas aeruginosa from respiratory samples. There was a significantly positive correlation between serology and the combination of serology and spirometry and Pseudomonas aeruginosa isolation (P spirometry and Pseudomonas aeruginosa isolation (P spirometry the highest sensitivity (0.90). Both had a high negative predictive value (0.93 and 0.79 respectively). Using serology and the combination of serology and lung function measurement can be beneficial for earlier detection of infection with Pseudomonas aeruginosa in children with cystic fibrosis when done simultaneously with standard culture-based detection from respiratory samples.

Evaluation of a New and Rapid Serologic Test for Detecting Brucellosis: Brucella Coombs Gel Test.

Science.gov (United States)

Hanci, Hayrunisa; Igan, Hakan; Uyanik, Muhammet Hamidullah

2017-01-01

Many serological tests have been used for the diagnosis of human brucellosis. A new serological method is identified as Brucella Coombs gel test based on the principle of centrifugation gel system similar to the gel system used in blood group determination. In this system, if Brucella antibodies were present in the serum, antigen and antibody would remain as a pink complex on the gel. Otherwise, the pink Brucella antigens would precipitate at the bottom of the gel card system. In this study, we aimed to compare the Brucella Coombs gel test, a new, rapid screen and titration method for detection of non-agglutinating IgG with the Brucella Coombs test. For this study, a total of 88 serum samples were obtained from 45 healthy persons and 43 individuals who had clinical signs and symptoms of brucellosis. For each specimen, Rose Bengal test, standard agglutination test, Coombs test and Brucella Coombs gel test were carried out. Sensitivity and specificity of Brucella Coombs gel test were found as 100.0 and 82.2%, respectively. Brucella Coombs gel test can be used as a screening test with high sensitivity. By the help of pink Brucella antigen precipitation, the tests' evaluation is simple and objective. In addition, determination of Brucella antibody by rapid titration offers another important advantage.

Comparison of radioimmunology and serology methods for LH determination

International Nuclear Information System (INIS)

Szymanski, W.; Jakowicki, J.

1976-01-01

A comparison is presented of LH determinations by immunoassay and radioimmunoassay using the 125 I-labelled HCG double antibody system. The results obtained by both methods are well comparable and in normal and elevated LH levels the serological determinations may be used for estimating concentration levels found by RIA. (L.O.)

The use of serological tests in combination with the intradermal tuberculin test maximizes the detection of tuberculosis infected goats.

Science.gov (United States)

Bezos, Javier; Roy, Álvaro; Infantes-Lorenzo, José Antonio; González, Isabel; Venteo, Ángel; Romero, Beatriz; Grau, Anna; Mínguez, Olga; Domínguez, Lucas; de Juan, Lucía

2018-05-01

The diagnosis of tuberculosis (TB) in goats is based mainly on the single and comparative intradermal tuberculin (SIT and CIT) tests and, exceptionally, on the interferon-gamma (IFN-γ) assay, however they are not perfect in terms of sensitivity and specificity. Nevertheless, various serological assays that provide a potential cost-effective approach for the control of TB are also available or under development, and a variety of results have been reported regarding the ability of these tests to detect infected animals, particularly in the early stages of infection. In the present study, SIT/CIT and IFN-γ tests and three different serological assays were evaluated during two consecutive herd testing events in a recently infected caprine herd (n = 447) with a high prevalence of infection in order to evaluate their performance and provide field data with which to improve the TB control programs in this species. The proportion of infected animals that tested positive among all the infected goats (T+/I+ value) in the last herd testing event ranged from 26.2% (IC95%; 19.3-34.5) to 85.7% (IC95%; 78.5-90.7) using cell-based diagnostic tests. The SIT/SCIT tests detected more infected goats than the IFN-γ test, regardless of the interpretation criteria. The T+/I+ value of serology was 83.2 (IC95%; 75.2-89), although it increased significantly (P test (100%, IC95%; 97-100). In general, a parallel interpretation of intradermal tests with serology maximized the detection of infected goats. These results demonstrate that serological tests are valuable diagnostic tools to maximize the detection of TB infected goats, even in recent outbreaks, accelerating the eradication process. Copyright © 2018 Elsevier B.V. All rights reserved.

Development of in-house serological methods for diagnosis and surveillance of chikungunya

Directory of Open Access Journals (Sweden)

Saira Saborío Galo

2017-08-01

Full Text Available ABSTRACT Objective To develop and evaluate serological methods for chikungunya diagnosis and research in Nicaragua. Methods Two IgM ELISA capture systems (MAC-ELISA for diagnosis of acute chikungunya virus (CHIKV infections, and two Inhibition ELISA Methods (IEM to measure total antibodies against CHIKV were developed using monoclonal antibodies (mAbs and hyperimmune serum at the National Virology Laboratory of Nicaragua in 2014–2015. The sensitivity, specificity, predictive values, and agreement of the MAC-ELISAs were obtained by comparing the results of 198 samples (116 positive; 82 negative with the Centers for Disease Control and Prevention’s IgM ELISA (Atlanta, Georgia, United States; CDC-MAC-ELISA. For clinical evaluation of the four serological techniques, 260 paired acute and convalescent phase serum samples of suspected chikungunya cases were used. Results All four assays were standardized by determining the optimal concentrations of the different reagents. Processing times were substantially reduced compared to the CDC-MAC-ELISA. For the MAC-ELISA systems, a sensitivity of 96.6% and 97.4%, and a specificity of 98.8% and 91.5% were obtained using mAb and hyperimmune serum, respectively, compared with the CDC method. Clinical evaluation of the four serological techniques versus the CDC real-time RT-PCR assay resulted in a sensitivity of 95.7% and a specificity of 88.8%–95.9%. Conclusion Two MAC-ELISA and two IEM systems were standardized, demonstrating very good quality for chikungunya diagnosis and research demands. This will achieve more efficient epidemiological surveillance in Nicaragua, the first country in Central America to produce its own reagents for serological diagnosis of CHIKV. The methods evaluated here can be applied in other countries and will contribute to sustainable diagnostic systems to combat the disease.

Development of in-house serological methods for diagnosis and surveillance of chikungunya.

Science.gov (United States)

Galo, Saira Saborío; González, Karla; Téllez, Yolanda; García, Nadezna; Pérez, Leonel; Gresh, Lionel; Harris, Eva; Balmaseda, Ángel

2017-08-21

To develop and evaluate serological methods for chikungunya diagnosis and research in Nicaragua. Two IgM ELISA capture systems (MAC-ELISA) for diagnosis of acute chikungunya virus (CHIKV) infections, and two Inhibition ELISA Methods (IEM) to measure total antibodies against CHIKV were developed using monoclonal antibodies (mAbs) and hyperimmune serum at the National Virology Laboratory of Nicaragua in 2014-2015. The sensitivity, specificity, predictive values, and agreement of the MAC-ELISAs were obtained by comparing the results of 198 samples (116 positive; 82 negative) with the Centers for Disease Control and Prevention's IgM ELISA (Atlanta, Georgia, United States; CDC-MAC-ELISA). For clinical evaluation of the four serological techniques, 260 paired acute and convalescent phase serum samples of suspected chikungunya cases were used. All four assays were standardized by determining the optimal concentrations of the different reagents. Processing times were substantially reduced compared to the CDC-MAC-ELISA. For the MAC-ELISA systems, a sensitivity of 96.6% and 97.4%, and a specificity of 98.8% and 91.5% were obtained using mAb and hyperimmune serum, respectively, compared with the CDC method. Clinical evaluation of the four serological techniques versus the CDC real-time RT-PCR assay resulted in a sensitivity of 95.7% and a specificity of 88.8%-95.9%. Two MAC-ELISA and two IEM systems were standardized, demonstrating very good quality for chikungunya diagnosis and research demands. This will achieve more efficient epidemiological surveillance in Nicaragua, the first country in Central America to produce its own reagents for serological diagnosis of CHIKV. The methods evaluated here can be applied in other countries and will contribute to sustainable diagnostic systems to combat the disease.

[Serological diagnosis of congenital infections and algorithms to improve diagnostic efficacy].

Science.gov (United States)

García-Bermejo, Isabel; de Ory-Manchón, Fernando

2015-07-01

Congenital infection is those transmitted by the mother to the fetus before delivery. It can occur transplacentally or by direct contact with the pathogen during birth or in the immediate postnatal period. Congenital infection can be due to viruses (rubella, cytomegalovirus, herpes simplex, varicella-zoster, hepatitis B and C virus, human inunodeficiencia, erythrovirus B19) as bacteria (Treponema pallidum) and parasites (Toxoplasma gondii and Trypanosoma cruzi). Serological diagnosis of congenital infection is based on both the knowledge of infectious serology in the mother, including the systematic serological screening and diagnostic aspects of the determination of IgM and confirmatory methods, IgG avidity tests, establishment of antibody profiles, and in the diagnosis the neonate. Serological diagnosis of congenital infection in the newborn is mainly based on the detection of specific IgM usually by immunoenzymatic assays or immunochemiluminescence techniques. In some instances it is important to perform the serological follow up of the newborn to confirm the congenital infection. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

Performances of Four Helicobacter pylori Serological Detection Kits Using Stool Antigen Test as Gold Standard.

Directory of Open Access Journals (Sweden)

Susheela D Biranjia-Hurdoyal

Full Text Available The aim was to determine the performances of four Helicobacter pylori serological detection kits in different target groups, using Amplified IDEIA™ Hp StAR™ as gold standard. Kits studied were Rapid Immunochromatoghraphic Hexagon, Helicoblot 2.1, an EIA IgG kit and EIA IgA kit.Stool and blood samples were collected from 162 apparently healthy participants (control and 60 Type 2 diabetes mellitus (T2DM patients.The performances of the four serological detection kits were found to be affected by gender, age, health status and ethnicity of the participants. In the control group, the Helicoblot 2.1 kit had the best performance (AUC = 0.85; p<0.05, accuracy = 86.4%, followed by EIA IgG (AUC = 0.75; p<0.05, accuracy = 75.2%. The Rapid Hexagon and EIA IgA kits had relatively poor performances. In the T2DM subgroup, the kits H2.1 and EIA IgG had best performances, with accuracies of 96.5% and 93.1% respectively. The performance of EIA IgG improved with adjustment of its cut-off value.The performances of the detection kits were affected by various factors which should be taken into consideration.

21 CFR 866.3310 - Hepatitis A virus (HAV) serological assays.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hepatitis A virus (HAV) serological assays. 866... Hepatitis A virus (HAV) serological assays. (a) Identification. HAV serological assays are devices that consist of antigens and antisera for the detection of hepatitis A virus-specific IgM, IgG, or total...

Current status and future perspectives on molecular and serological methods in diagnostic mycology.

Science.gov (United States)

Lau, Anna; Chen, Sharon; Sleiman, Sue; Sorrell, Tania

2009-11-01

Invasive fungal infections are an important cause of infectious morbidity. Nonculture-based methods are increasingly used for rapid, accurate diagnosis to improve patient outcomes. New and existing DNA amplification platforms have high sensitivity and specificity for direct detection and identification of fungi in clinical specimens. Since laboratories are increasingly reliant on DNA sequencing for fungal identification, measures to improve sequence interpretation should support validation of reference isolates and quality control in public gene repositories. Novel technologies (e.g., isothermal and PNA FISH methods), platforms enabling high-throughput analyses (e.g., DNA microarrays and Luminex xMAP) and/or commercial PCR assays warrant further evaluation for routine diagnostic use. Notwithstanding the advantages of molecular tests, serological assays remain clinically useful for patient management. The serum Aspergillus galactomannan test has been incorporated into diagnostic algorithms of invasive aspergillosis. Both the galactomannan and the serum beta-D-glucan test have value for diagnosing infection and monitoring therapeutic response.

Improved reliability of serological tools for the diagnosis of West Nile fever in horses within Europe.

Directory of Open Access Journals (Sweden)

Cécile Beck

2017-09-01

Full Text Available West Nile Fever is a zoonotic disease caused by a mosquito-borne flavivirus, WNV. By its clinical sensitivity to the disease, the horse is a useful sentinel of infection. Because of the virus' low-level, short-term viraemia in horses, the primary tools used to diagnose WNV are serological tests. Inter-laboratory proficiency tests (ILPTs were held in 2010 and 2013 to evaluate WNV serological diagnostic tools suited for the European network of National Reference Laboratories (NRLs for equine diseases. These ILPTs were designed to evaluate the laboratories' and methods' performances in detecting WNV infection in horses through serology. The detection of WNV immunoglobulin G (IgG antibodies by ELISA is widely used in Europe, with 17 NRLs in 2010 and 20 NRLs in 2013 using IgG WNV assays. Thanks to the development of new commercial IgM capture kits, WNV IgM capture ELISAs were rapidly implemented in NRLs between 2010 (4 NRLs and 2013 (13 NRLs. The use of kits allowed the quick standardisation of WNV IgG and IgM detection assays in NRLs with more than 95% (20/21 and 100% (13/13 of satisfactory results respectively in 2013. Conversely, virus neutralisation tests (VNTs were implemented in 33% (7/21 of NRLs in 2013 and their low sensitivity was evidenced in 29% (2/7 of NRLs during this ILPT. A comparison of serological diagnostic methods highlighted the higher sensitivity of IgG ELISAs compared to WNV VNTs. They also revealed that the low specificity of IgG ELISA kits meant that it could detect animals infected with other flaviviruses. In contrast VNT and IgM ELISA assays were highly specific and did not detect antibodies against related flaviviruses. These results argue in favour of the need for and development of new, specific serological diagnostic assays that could be easily transferred to partner laboratories.

Leishmania serology in the diagnosis of cutaneous leishmaniasis

International Nuclear Information System (INIS)

Mashood, A.H.; Malik, N.; Abbasi, S.

2013-01-01

Background: The gold standard to diagnose cutaneous leishmaniasis is histopathology, but there has always been a need of a rapid, reliable, cheap and convenient laboratory investigation. Serological tests fulfill the above criteria. Objective: The objective of the study was to determine the sensitivity and specificity of enzyme linked immunosorbent assay (ELISA) in detection of leishmania antibodies, in comparison with the histopathology. Place and duration of study: The study was conducted in Military Hospital Rawalpindi from 1st November 2010 to 30th June 2011. Patients and methods: The study population included the patients who were clinically diagnosed with cutaneous leishmaniasis. All of them were biopsied and serum was sent for leishmania serology. Results: A total of 47 patients were included. They were all adult males. The histopathology was positive in 31/47 patients (65.95%), while the leishmania serology was positive in 36/47 cases (76.59%). The sensitiuites was 74.19%, specificity was 18.75%, positive predictive value has 63.88%, negative predicative value was 27% and accuracy was 55%. Conclusion: In the light of sensitivity analysis, it may be concluded that leishmania serology has moderate sensitivity and low specificity; hence it is not a reliable test for cutaneous leishmaniasis. (author)

Evaluation of different analysis and identification methods for Salmonella detection in surface drinking water sources

Energy Technology Data Exchange (ETDEWEB)

Hsu, Bing-Mu, E-mail: bmhsu@ccu.edu.tw [Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC (China); Huang, Kuan-Hao; Huang, Shih-Wei [Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC (China); Tseng, Kuo-Chih [Department of Internal Medicine, Buddhist Dalin Tzu Chi General Hospital, Chiayi, Taiwan, ROC (China); Su, Ming-Jen [Department of Clinical Pathology, Buddhist Dalin Tzu Chi General Hospital, Chiayi, Taiwan, ROC (China); Lin, Wei-Chen; Ji, Dar-Der [Research and Diagnostic Center, Centers for Disease Control, Taipei, Taiwan, ROC (China); Shih, Feng-Cheng; Chen, Jyh-Larng [Department of Environmental Engineering and Health, Yuanpei University of Science and Technology, HsinChu, Taiwan, ROC (China); Kao, Po-Min [Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC (China)

2011-09-15

The standard method for detecting Salmonella generally analyzes food or fecal samples. Salmonella often occur in relatively low concentrations in environmental waters. Therefore, some form of concentration and proliferation may be needed. This study compares three Salmonella analysis methods and develops a new Salmonella detection procedure for use in environmental water samples. The new procedure for Salmonella detection include water concentration, nutrient broth enrichment, selection of Salmonella containing broth by PCR, isolation of Salmonella strains by selective culture plates, detection of possible Salmonella isolate by PCR, and biochemical testing. Serological assay and pulsed-field gel electrophoresis (PFGE) can be used to identify Salmonella serotype and genotype, respectively. This study analyzed 116 raw water samples taken from 18 water plants and belonging to 5 watersheds. Of these 116, 10 water samples (8.6%) taken from 7 water plants and belonging to 4 watersheds were positive for a Salmonella-specific polymerase chain reaction targeting the invA gene. Guided by serological assay results, this study identified 7 cultured Salmonella isolates as Salmonella enterica serovar: Alnaby, Enteritidis, Houten, Montevideo, Newport, Paratyphi B var. Java, and Victoria. These seven Salmonella serovars were identified in clinical cases for the same geographical areas, but only one of them was 100% homologous with clinical cases in the PFGE pattern. - Research highlights: {yields} A new Salmonella detecting procedure for environmental water is developed. {yields} Salmonella isolates are identified by serological assay and PFGE. {yields} A total of seven Salmonella serovars is isolated from environmental water.

Evaluation of different analysis and identification methods for Salmonella detection in surface drinking water sources

International Nuclear Information System (INIS)

Hsu, Bing-Mu; Huang, Kuan-Hao; Huang, Shih-Wei; Tseng, Kuo-Chih; Su, Ming-Jen; Lin, Wei-Chen; Ji, Dar-Der; Shih, Feng-Cheng; Chen, Jyh-Larng; Kao, Po-Min

2011-01-01

The standard method for detecting Salmonella generally analyzes food or fecal samples. Salmonella often occur in relatively low concentrations in environmental waters. Therefore, some form of concentration and proliferation may be needed. This study compares three Salmonella analysis methods and develops a new Salmonella detection procedure for use in environmental water samples. The new procedure for Salmonella detection include water concentration, nutrient broth enrichment, selection of Salmonella containing broth by PCR, isolation of Salmonella strains by selective culture plates, detection of possible Salmonella isolate by PCR, and biochemical testing. Serological assay and pulsed-field gel electrophoresis (PFGE) can be used to identify Salmonella serotype and genotype, respectively. This study analyzed 116 raw water samples taken from 18 water plants and belonging to 5 watersheds. Of these 116, 10 water samples (8.6%) taken from 7 water plants and belonging to 4 watersheds were positive for a Salmonella-specific polymerase chain reaction targeting the invA gene. Guided by serological assay results, this study identified 7 cultured Salmonella isolates as Salmonella enterica serovar: Alnaby, Enteritidis, Houten, Montevideo, Newport, Paratyphi B var. Java, and Victoria. These seven Salmonella serovars were identified in clinical cases for the same geographical areas, but only one of them was 100% homologous with clinical cases in the PFGE pattern. - Research highlights: → A new Salmonella detecting procedure for environmental water is developed. → Salmonella isolates are identified by serological assay and PFGE. → A total of seven Salmonella serovars is isolated from environmental water.

Strategies for detection of transfusion-transmitted viruses eluding identification by conventional serologic tests. I

International Nuclear Information System (INIS)

Neurath, A.R.; Strick, N.

1983-01-01

The unavailability of serological tests for detection of several not yet characterized infectious agents transmitted by blood transfusion or by blood products prompted the development of alternative tests based on utilization of labeled nucleic acid probes specific for genomes of each of these agents. The prerequisite for the preparation of such probes is the demonstration in human plasma of nucleic acid sequences distinct from those present in host DNA or in genes of already characterized viruses occurring in plasma of infected individuals. To accomplish this, ultrasensitive tests for nucleic acids not dependent on their base sequence are needed. The authors describe a radioimmunoassay (RIA) for picogram quantities of DNA. Plasma (serum) specimens are treated with proteinase K in the presence of sodium dodecyl sulfate and extracted with phenol. Nucleic acids are precipitated with ethanol in the presence of dextran (mol.wt. approx. 5X10 5 ) as carrier. Subsequently, DNA from the redissolved samples is adsorbed onto polylysine-coated wells of microtiter plates and detected by a double-antibody RIA using anti-DNA autoantibodies from NZB/NZW mice and 125 I-labelled antibodies to mouse immunoglobulins. DNA which did not hybridize with human DNA was detected by this method in sera containing hepatitis B virus used as a model system. (Auth.)

Serological profile of incidentally detected asymptomatic HBsAg positive subjects (IDAHS)

International Nuclear Information System (INIS)

Khokhar, N.; Gill, M.L.

2004-01-01

Objective: To evaluate the serological profile of patients with incidentally detected positive hepatitis-B surface antigen (HBsAg) and to asses the risk factors. Design: An observational study. Place and Duration of Study: This study was conducted at Shifa International Hospital, Islamabad from 1999 to 2003. Patients and Methods: All patients who presented to gastroenterology clinic of Shifa Intentional Hospital, Islamabad with positive HBsAg, detected incidentally, were tested for alamine transaminase (ALT), hepatitis Beantigen (HBeAg) and in certain cases hepatitis-B virus DNA (HBV DNA) by polymerase chain reaction (PCR). Their risk factors for acquisition of infection were assessed with specific questions. Results: A total of 224 patients were examined. One hundred sixty-four (73.2%) were male and 60 (26.8%) female. Mean age of all the subjects was 32.45 plus minus 11.85 years. Out of 224 patients, 48 (21.4%) were positive for HBeAg and 176 (78.6%) were negative. Out of 48 subjects who were positive for HBeAg, 36 underwent HBV DNA determination and 32 (88.8%) were positive for HBV DNA. Out of 176 subjects who had negative HBeAg, 46 had elevated ALT and in those HBV DNA was performed and 14 had positive HBV DNA. Most common risk factors detected in these patients were intramuscular injections and surgery, however, in a large number, risk factors were unknown. Conclusion: Twenty-one percent asymptomatic subjects with positive HBsAg were found to be HBeAg positive. A large number of subjects with negative HBeAg had HBV DNA positive suggesting presence of precore mutants. Intramuscular injections and surgery were noted to be frequent risk factors in these subjects. (author)

Serological diagnosis of brucellosis.

Science.gov (United States)

Nielsen, K; Yu, W L

2010-01-01

To present a review and to describe the most widely used laboratory tests for serology diagnosis of brucellosis along with their pros and cons. Review the recent literature on brucellosis serology diagnostic tests. The choice of the testing strategy depends on the prevailing brucellosis epidemiological situation and the goal of testing. The 'gold standard' for the diagnosis of brucellosis is isolation and identification of the causative bacterium, a member of Brucella sp. Isolation of Brucella sp. requires high security laboratory facilities (biological containment level 3), highly skilled personnel, an extended turnaround time for results and it is considered a hazardous procedure. Hence brucellosis is generally diagnosed by detection of an elevated level of antibody in serum or other body fluid. This is a presumptive diagnosis as other microorganisms and perhaps environmental factors can also cause increased antibody levels. A large number of serological tests for brucellosis have been devised over the 100+ years since its initial isolation, starting with a simple agglutination test and progressing to sophisticated primary binding assays available today. However, no test devised to date is 100% accurate so generally serological diagnosis consists of testing sera by several tests, usually a screening test of high sensitivity, followed by a confirmatory test of high specificity.

Conventional and serological detection of Fasciolosis in ruminants ...

African Journals Online (AJOL)

The study was conducted to determined seasonal prevalence of fasciolosis and compare between its conventional diagnosis and serological identification in ruminants slaughtered at Maiduguri abattoir, northeastern Nigeria. Nine hundred samples each of faeces and blood; that is 300 each from cattle, sheep and goats was ...

Comparison between DNA Detection in Trigeminal Nerve Ganglia and Serology to Detect Cattle Infected with Bovine Herpesviruses Types 1 and 5.

Directory of Open Access Journals (Sweden)

Rodrigo Puentes

Full Text Available Bovine herpesviruses (BoHVs types 1 (BoHV-1 and 5 (BoHV-5 are alphaherpesviruses of major importance to the bovine production chain. Such viruses are capable of establishing latent infections in neuronal tissues. Infected animals tend to develop a serological response to infection; however, such response-usually investigated by antibody assays in serum-may eventually not be detected in laboratory assays. Nevertheless, serological tests such as virus neutralization (VN and various enzyme-linked immunosorbent assays (ELISAs are widely employed to check individual or herd status of BoHV infections. The correlation between detection of antibodies and the presence of viral nucleic acids as indicatives of infection in infected cattle has not been deeply examined. In order to investigate such correlation, 248 bovine serum samples were tested by VN to BoHV-1 and BoHV-5, as well as in a widely employed (though not type-differential gB ELISA (IDEXX IBR gB X2 Ab Test in search for antibodies to BoHVs. Immediately after blood withdrawal, cattle were slaughtered and trigeminal ganglia (TG excised for DNA extraction and viral nucleic acid detection (NAD by nested PCR. Neutralizing antibodies to BoHV-1 and/or BoHV-5 were detected in 44.8% (111/248 of sera, whereas the gB ELISA detected antibodies in 51.2% (127/248 of the samples. However, genomes of either BoHV-1, BoHV-5, or both, were detected in TGs of 85.9% (213/248 of the animals. These findings reveal that the assays designed to detect antibodies to BoHV-1 and/or BoHV-5 employed here may fail to detect a significant number of latently infected animals (in this study, 35.7%. From such data, it is clear that antibody assays are poorly correlated with detection of viral genomes in BoHV-1 and BoHV-5-infected animals.

Shedding and serological patterns of dairy cows following abortions associated with Coxiella burnetii DNA detection.

Science.gov (United States)

Guatteo, R; Joly, A; Beaudeau, F

2012-03-23

To describe both shedding and serological patterns following abortions detected as being associated with Coxiella burnetii (Cb), 24 cows experiencing an abortion due to Cb were followed over a one month period. Samples taken on the day of abortion (D0) were followed 3-fold by weekly samplings from day 14 (D14) to D28 after the abortion. Milk and vaginal mucus were collected at each weekly sampling and tested using real-time PCR while blood samples were collected 2-fold on D21 and D28 and tested using ELISA. We found a very short duration of C. burnetii shedding in vaginal mucus after abortion, highlighting the need to collect samples as rapidly as possible following an abortion to avoid false negative results. In contrast with previous results, concomitancy of vaginal and mucus shedding was frequent, especially for cows shedding a high bacterial load on DO leading to the hypothesis that the clinical onset of the infection influences the modalities of Cb shedding. Lastly, serological results indicating a lack of sensitivity to detect Cb shedder cows (especially for cows for which Ct values were high) suggest that ELISA is not a useful tool to diagnose abortions at the individual level. Copyright © 2011 Elsevier B.V. All rights reserved.

Serological profile of HSV-2 in patients attending STI clinic: Evaluation of diagnostic utility of HSV-2 IgM detection

Directory of Open Access Journals (Sweden)

Choudhry Shilpee

2009-07-01

Full Text Available Objective: The present study was done to evaluate the serological profile of herpes simplex virus-2 (HSV-2 among patients attending sexually transmitted infections (STI clinic and to determine the utility of detecting HSV-2 IgM antibodies in such patients. A correlation of HSV-2 infection with other STI including HIV has also been attempted. Materials and Methods: Hundred consecutive patients who attended STI clinic, with one or more of the complaints as enunciated by WHO in syndromic approach for the diagnosis of STI, were included as subjects. All subjects were screened for common STI by standard laboratory procedures/ commercially available kits. HSV-1 and HSV-2 IgM antibody was detected by commercially available enzyme immuno assay kit in all patient′s sera. Sera were also tested for other STI, namely HIV, Hepatitis B virus, Hepatitis C virus and Treponema pallidum. Antigen detection for Chlamydia trachomatis was done in genital swabs of all patients by Bio-Rad Chlamydia Microplate EIA 31189 (United States kit. Results: Thirty patients were found to have genital herpes. In 17/30 (56.6% patients, HSV-2 serology was found to correlate with the clinical diagnosis. The coexistence of other infection in HSV-2 seropositive patients was detected in 8/30 patients. None of the patients having concomitant infections were clinically diagnosed accurately. Sensitivity, specificity, positive predictive value and negative predictive value of IgM antibodies for the diagnosis of genital herpes was 73.91%, 90.91%, 70.83% and 92.91% respectively. Conclusion: HSV-2 IgM detection could only be used as a supportive test for the diagnosis of genital herpes . It needs to be emphasized that the sensitivity and positive predictive value scores are pointers for further improvement in the commercial assay systems and a large sample size may determine the broader utility of such systems.

Correlation and agreement between eplet mismatches calculated using serological, low-intermediate and high resolution molecular human leukocyte antigen typing methods.

Science.gov (United States)

Fidler, Samantha; D'Orsogna, Lloyd; Irish, Ashley B; Lewis, Joshua R; Wong, Germaine; Lim, Wai H

2018-03-02

Structural human leukocyte antigen (HLA) matching at the eplet level can be identified by HLAMatchmaker, which requires the entry of four-digit alleles. The aim of this study was to evaluate the agreement between eplet mismatches calculated by serological and two-digit typing methods compared to high-resolution four-digit typing. In a cohort of 264 donor/recipient pairs, the evaluation of measurement error was assessed using intra-class correlation to confirm the absolute agreement between the number of eplet mismatches at class I (HLA-A, -B, C) and II loci (HLA-DQ and -DR) calculated using serological or two-digit molecular typing compared to four-digit molecular typing methods. The proportion of donor/recipient pairs with a difference of >5 eplet mismatches between the HLA typing methods was also determined. Intra-class correlation coefficients between serological and four-digit molecular typing methods were 0.969 (95% confidence intervals [95% CI] 0.960-0.975) and 0.926 (95% CI 0.899-0.944), respectively; and 0.995 (95% CI 0.994-0.996) and 0.993 (95% CI 0.991-0.995), respectively between two-digit and four-digit molecular typing methods. The proportion of donor/recipient pairs with a difference of >5 eplet mismatches at class I and II loci was 4% and 16% for serological versus four-digit molecular typing methods, and 0% and 2% for two-digit versus four-digit molecular typing methods, respectively. In this small predominantly Caucasian population, compared with serology, there is a high level of agreement in the number of eplet mismatches calculated using two-compared to four-digit molecular HLA-typing methods, suggesting that two-digit typing may be sufficient in determining eplet mismatch load in kidney transplantation.

Serological diagnosis of Besnoitia bennetti infection in donkeys (Equus asinus).

Science.gov (United States)

Ness, SallyAnne L; Schares, Gereon; Peters-Kennedy, Jeanine; Mittel, Linda D; Dubey, Jitender P; Bowman, Dwight D; Mohammed, Hussni O; Divers, Thomas J

2014-11-01

Besnoitiosis is an emerging infectious disease of donkeys (Equus asinus) in the United States for which there are currently no serologic methods of diagnosis. A study was performed to evaluate physical examination findings and 3 serologic assays for the detection of Besnoitia bennetti infection in donkeys. A prospective study of 416 donkeys from 6 privately owned herds across 5 U.S. states (New York, Pennsylvania, Vermont, Oregon, and Washington) was performed. Donkeys were examined for clinical lesions suggestive of besnoitiosis and evaluated for antibodies against B. bennetti using a fluorescent antibody test (FAT) and 2 immunoblot assays specific for bradyzoite and tachyzoite antigens, respectively. Donkeys were confirmed to be infected with B. bennetti by histology (cases; n = 32) and were compared to those with no clinical signs of besnoitiosis (controls; n = 384). Identifying clinical lesions in 2 or more locations correctly identified infected donkeys 83% of the time. Donkeys with besnoitiosis had significantly higher FAT titers (P donkeys. The sensitivity and specificity of the serologic assays for detecting besnoitiosis was 88% and 96% for FAT, 81% and 91% for bradyzoite immunoblot, and 91% and 92% for tachyzoite immunoblot, respectively. Fluorescent antibody and immunoblot assays are effective at identifying donkeys with besnoitiosis and provide a more efficient and less invasive diagnostic alternative to histology. © 2014 The Author(s).

Serological detection of Brucella suis antibodies amongst pigs in ...

African Journals Online (AJOL)

Increasing reports of poor production associated with swine brucellosis necessitated this serological study. This study was carried out to establish the prevalence of swine brucellosis in Kaduna state, Nigeria. Three hundred (300) sera were randomly collected from porcine species between July – December, 2012 from ...

Standardization of serological tests for detecting anti-Trypanosoma cruzi antibodies in dogs

Directory of Open Access Journals (Sweden)

M. A. Lauricella

1993-09-01

Full Text Available This paper reports on the standardization of four serological reactions currently used in human serodiagnosis for the detection of anti-Trypanosoma cruzi antibodies in naturally and experimentally infected dogs. Indirect immunofluorescence test (IFAT and hemagglutination test (IHAT were standardized, and complement fixation test (CFT and direct agglutination test (DAT were used for diagnostic confirmation. Four hundred and eighty one mongrel dogs that were studied by xenodiagnosis were used: (1 parasitemic dogs of two localities of endemic area (EA of Santiago del Estero province in Argentina (n = 134; (2 non-parasitemic dogs of the same area (n = 285; (3 dogs experimentally infected with T. cruzi in the patent period (n = 6; (4 non-infected dogs (n = 56 which were born in the city of Buenos Aires (BA, one non-EA for Chagas' disease. For IFAT, parasitemic dogs EA showed 95% of reactive sera. Non parasitemic dogs EA showed 77% of non reactive sera. None sera from BA were reactive for dilutions higher than four. For IHAT, 84% of sera of parasitemic dogs EA showed serological reactivity and among non parasitemic dogs BA, 61% were non reactive, while the remainder showed at most titres of 1/16. The cut-off titres for IFAT and IHAT were 1/16 and 1/32 respectively, and for CFT and DAT 1/1 and 1/128 respectively. Sensitivity for IFAT, IHAT, CF and DAT were 95%, 84%, 97% and 95% respectively.

Serological diagnosis of Chlamydia infections: proposal of a cost-effective approach

Directory of Open Access Journals (Sweden)

Gino Ciarrocchi

2008-06-01

Full Text Available Infections caused by genus Chlamydia are challenging for phisicians, as a results of a complicated pathogenesis and a variable clinical picture. Furthermore, potential sequelae following Chlamydia trachomatis, Chlamydia pneumoniae, Chlamydia psittaci infections are of clinical relevant interest. Serodiagnosis is a clue tool when the direct antigen research or the bacteria fragments detection is impaired. Some serological tests such as the ELISA or the indirect micro-immunofluorescence methods are routinely performed. To improve the diagnostic efficiency of these tests, a selective coating of specie-specific reactive antigens on microwells or on microscopic slides is proposed.A highly selective coating is essential to generate a specific immune response for each Chlamydia species and high levels of distinct IgA, IgG, IgM antibody classes.The goal of serology is the diagnostic value of results, therefore the correct choice of the best screening and confirmation test is of extreme relevance due to the clinical impact of results for the therapeutical approach and management of acute and chronic infections. In conclusion, a quantitative specific anti-Chlamydia IgG and IgA antibody detection is a useful method to improve the follow up of complicated chronic clinical sequelae.

Swine cysticercosis in the Karangasem district of Bali, Indonesia: An evaluation of serological screening methods.

Science.gov (United States)

Swastika, Kadek; Dharmawan, Nyoman Sadra; Suardita, I Ketut; Kepeng, I Nengah; Wandra, Toni; Sako, Yasuhito; Okamoto, Munehiro; Yanagida, Tetsuya; Sasaki, Mizuki; Giraudoux, Patrick; Nakao, Minoru; Yoshida, Takahiko; Eka Diarthini, Luh Putu; Sudarmaja, I Made; Purba, Ivan Elisabeth; Budke, Christine M; Ito, Akira

2016-11-01

A serological assessment was undertaken on pigs from the Kubu and Abang sub-districts of Karangasem on the island of Bali, Indonesia, where earlier studies had detected patients with cysticercosis. Antigens purified from Taenia solium cyst fluid by cation-exchange chromatography were used to evaluate antibody responses in the pigs and the serological tests were also evaluated using sera from pigs experimentally infected with T. solium eggs. A total of 392 serum samples from naturally exposed pigs were tested using an ELISA that could be read based on both a colour change perceptible by the naked eye and an ELISA based on absorbance values. Twenty six (6.6%) pigs were found seropositive by the naked-eye ELISA and were categorized into three groups: strongly positive (absorbance values >0.8, n=6), moderately positive (absorbance values between 0.2 and 0.8, n=7), and weakly positive (absorbance values Bali were tested using the same ELISA. All 60 pigs were seronegative with no evidence of Taenia infection at necropsy. The results confirm the presence of porcine cysticercosis on Bali and, while the serological responses seen in T. solium infected animals were much stronger than those infected with T. hydatigena, the diagnostic antigens are clearly not species specific. Further studies are necessary to confirm if it is possible to draw a cut off line for differentiation of pig infected with T. solium from those infected with T. hydatigena. Copyright © 2016 Elsevier B.V. All rights reserved.

Mycological and serological study of pulmonary aspergillosis in central India

Directory of Open Access Journals (Sweden)

Kurhade A

2002-01-01

Full Text Available PURPOSE: To study the prevalence and predisposing factors of Aspergillus infection and correlate microscopic, culture and serological findings along with drug sensitivity. METHODS: Sputum samples from 123 patients of pulmonary disease with clinical suspicion of having fungal, especially Aspergillus infections, were examined microscopically and for culture. Minimum inhibitory concentration (MIC of itraconazole was tested against the isolates. Serum samples from these patients were tested for precipitin against Aspergillus antigen using immunodiffusion (ID technique. RESULTS: Aspergillus species were isolated in 20 (16.26% cases and Aspergillus fumigatus was the predominant species isolated in 16 (80% cases. Precipitins were detected in 29 (23.58% cases. Serum samples collected from 50 healthy individuals to serve as controls showed no precipitin against Aspergillus antigen galactomannan. This fungus was found to be sensitive to itraconazole with MIC range 0.125-1µg/mL. CONCLUSIONS: Serological tests have an edge over routine smear and culture methods for the diagnosis of pulmonary aspergillosis. Itraconazole is more effective than amphotericin B and fluconazole in the treatment of aspergillosis.

Barriers impeding serologic screening for celiac disease in clinically high-prevalence populations

Science.gov (United States)

2014-01-01

Background Celiac disease is present in ~1% of the general population in the United States and Europe. Despite the availability of inexpensive serologic screening tests, ~85% of individuals with celiac disease remain undiagnosed and there is an average delay in diagnosis of symptomatic individuals with celiac disease that ranges from ~5.8-11 years. This delay is often attributed to the use of a case-based approach for detection rather than general population screening for celiac disease, and deficiencies at the level of health care professionals. This study aimed to assess if patient-centered barriers have a role in impeding serologic screening for celiac disease in individuals from populations that are clinically at an increased risk for celiac disease. Methods 119 adults meeting study inclusion criteria for being at a higher risk for celiac disease were recruited from the general population. Participants completed a survey/questionnaire at the William K. Warren Medical Research Center for Celiac Disease that addressed demographic information, celiac disease related symptoms (gastrointestinal and extraintestinal), family history, co-morbid diseases and conditions associated with celiac disease, and patient-centered barriers to screening for celiac disease. All participants underwent serologic screening for celiac disease using the IgA tissue transglutaminase antibody (IgA tTG) and, if positive, testing for IgA anti-endomysial antibody (IgA EMA) as a confirmatory test. Results Two barriers to serologic testing were significant across the participant pool. These were participants not knowing they were at risk for celiac disease before learning of the study, and participants not knowing where to get tested for celiac disease. Among participants with incomes less than $25,000/year and those less than the median age, not having a doctor to order the test was a significant barrier, and this strongly correlated with not having health insurance. Symptoms and co

21 CFR 866.3940 - West Nile virus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3940 West Nile... detection aids in the clinical laboratory diagnosis of viral meningitis/encephalitis caused by West Nile...

COMPARATIVE STUDY OF FILARIAL DETECTION BY MICROSCOPIC EXAMINATION AND SEROLOGICAL ASSAY UTILIZING BMR1 AND BMXSP RECOMBINANT ANTIGENS FOR EVALUATION OF FILARIASIS ELIMINATION PROGRAM AT KAMPUNG SAWAH AND PAMULANG, SOUTH TANGERANG DISTRICT, BANTEN, INDONESIA

Directory of Open Access Journals (Sweden)

Silvia F. Nasution

2015-09-01

Full Text Available South Tangerang district is one of the endemic areas for filariasis; and based on an evaluation study in 2008-2009 which covered several subdistricts, the prevalence of microfilaria was between 1–2.4%. Nevertheless, the evaluation by serological assay has never been reported. A cross-sectional study was conducted to detect the microfilaremia and anti-filarial IgG4 antibody status in Kp Sawah and Pamulang subdistricts. Cluster sampling was performed in Kp Sawah by collecting finger-prick blood (FPB and venous blood samples from inhabitants who lived with and nearby the four elephantiasis subjects in the area. The FPB were only collected in Pamulang area by consecutive sampling method. The detection method included microscopic evaluation of FPB and serological detection using recombinant antigens BmR1 and BmSXP by ELISA and lateral flow rapid tests. Symptomatic patients who had 2nd and 3rd degree of elephantiasis were clinically determined in 10% (4/40 subjects. Among those with elephantiasis, 2 were positive serologically but their microscopic results were all negative (40/40. Meanwhile, the microscopic result for 107 subjects from Pamulang were all negative. The results of the rapid tests showed that 15% (6/40 of the positive cases were detected by Brugia Rapid and 27.5% (11/40 by PanLF. Meanwhile, the ELISA showed that 20% (8/40 of the cases were positive with BmSXP, whereas only 2.5% or 1/40 sample was found to be positive with BmR1. Even though the sensitivity of the Rapid test was lower when compared to microscopic examination for these samples, the assay showed good specificity ranging from 72.5 to 97.5%. The optical density (OD values of ELISA has ranged between 0.3–3.045.

SEROLOGICAL DETECTION AND MOLECULAR CHARACTERIZATION OF A BEGOMOVIRUS ISOLATE OBTAINED FROM Macroptilium lathyroides

Directory of Open Access Journals (Sweden)

JOSÉ ALBERSIO DE ARAUJO LIMA

2012-01-01

Full Text Available The viruses from the genus Begomovirus, family Geminiviridae are considered emergent pathogens, mainly because of the population explosion of their insect vectors. For this reason, more attention needs to be directed to the correct virus species identification inside the genus. The present paper had the objectives of serologically detecting a begomovirus in Macroptilium lathyroides plants in the State of Ceará, and developing biological, serological and molecular studies with a virus isolate obtained from M. lathyroides. Indirect ELISA with antiserum for Macroptilium golden mosaic virus (MaGMV demonstrated that the samples collected from M. lathyroides showing golden mosaic in the field were infected with a begomovirus. The virus isolate obtained was transmitted by grafting to eight species of the family Leguminosae, four species of Solonaceae, and one species in the family Amaranthaceae. The virus also was transmitted from M. lathyroides to M. lathyroides by the whitefly Bemisia tabaci biotype B. A DNA fragment of 1.2 kb was obtained by PCR with the primers PAL1v 1978 and PAR1c 496 for component A, and a DNA fragment of 0.5 kb was obtained with the primers PBL1v 2040 and PCR cl for component B, confirming the presence of a begomovirus infecting M. lathyroides. Molecular studies indicated that the begomovirus isolate showed 77% genomic similarity with Bean golden mosaic virus and 75% with Cowpea golden mosaic virus for their cp and rep genes, indicating the possibility that the isolate is a distinct virus species of the Begomovirus genus.

Second International Diagnostic Accuracy Study for the Serological Detection of West Nile Virus Infection

OpenAIRE

Sanchini, Andrea; Donoso-Mantke, Oliver; Papa, Anna; Sambri, Vittorio; Teichmann, Anette; Niedrig, Matthias

2013-01-01

Background: In recent decades, sporadic cases and outbreaks in humans of West Nile virus (WNV) infection have increased. Serological diagnosis of WNV infection can be performed by enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay (IFA) neutralization test (NT) and by hemagglutination-inhibition assay. The aim of this study is to collect updated information regarding the performance accuracy of WNV serological diagnostics. Methodology/Principal findings: In 2011, the E...

Challenges for molecular and serological ZIKV infection confirmation.

Science.gov (United States)

de Vasconcelos, Zilton Farias Meira; Azevedo, Renata Campos; Thompson, Nathália; Gomes, Leonardo; Guida, Letícia; Moreira, Maria Elisabeth Lopes

2018-01-01

Zika Virus (ZIKV), member of Flaviviridae family and Flavivirus genus, has recently emerged as international public health emergency after its association with neonatal microcephaly cases. Clinical diagnosis hindrance involves symptom similarities produced by other arbovirus infections, therefore laboratory confirmation is of paramount importance. The most reliable test available is based on ZIKV RNA detection from body fluid samples. However, short viremia window periods and asymptomatic infections diminish the success rate for RT-PCR positivity. Beyond molecular detection, all serology tests in areas where other Flavivirus circulates proved to be a difficult task due to the broad range of cross-reactivity, especially with dengue pre-exposed individuals. Altogether, lack of serological diagnostic tools brings limitations to any retrospective evaluation. Those studies are central in the context of congenital infection that could occur asymptomatically and mask prevalence and risk rates.

Serological survey of the infectious disease status of Old English Game fowl in the lower North Island, New Zealand.

Science.gov (United States)

Christensen, N H

2006-08-01

To investigate the serological status of Old English Game (OEG) cockerels for a range of infectious diseases of poultry. Standard methods were used to screen serum collected from approximately 200 birds during routine dubbing operations, in 2004 and 2005. There was no serological evidence of infection with Newcastle disease, infectious bursal disease, or Salmonella Pullorum. Antibodies to infectious bronchitis virus, avian encephalomyelitis (AE) virus, Mycoplasma gallisepticum and Mycoplasma synoviae were detected. The disease status of OEG birds is similar to that of commercial poultry.

[Comparative characterization of cultured methane-oxidizing bacteria by serological and molecular methods].

Science.gov (United States)

Slobodova, N V; Kolganova, T V; Bulygina, E S; Kuznetsov, B B; Turova, T P; Kravchenko, I K

2006-01-01

Three stable methane-oxidizing enrichment cultures, SB26, SB31, and SB31A were analyzed by transmission electron microscopy and by serological and molecular techniques. Electron microscopy revealed the presence of both type I and type II methanotrophs in SB31 and SB31A enrichments; only type II methanotrophs were found in SB26 enrichment. Methylosinus trichosporium was detected in all three enrichments by the application of species-specific antibodies. Additionally, Methylocystis echinoides was found in SB26 culture; Methylococcus capsulatus, in SB31 and SB31A; and Methylomonas methanica, in SB31. The analysis with pmoA and nifH gene sequences as phylogenetic markers revealed the presence of Methylosinus/Methylocystis group in all communities. Moreover, the analysis of pmoA sequences revealed the presence of Methylomonas in SB31. Methylocella was detected in SB31 and SB31A enrichments only by nifH analysis. It was concluded that the simultaneous application of different approaches reveals more reliable information on the diversity of methanotrophs.

Retrospective investigation of serological finding in diagnosis of parasite agents caused mass in liver

Directory of Open Access Journals (Sweden)

Safinaz Demirkaya

2014-06-01

Full Text Available Objective: Many of parasite agent cause diseases damaging the liver. The parasite infections settled the liver give rise to focal mass named as reactive hyperplasia or granulomatous reactions in this organ. Some of parasites caused focal mass in liver are cystic echinococ, Fasciola hepatica and Entamoeba histolytica. The diagnoses of these parasites which are localized to liver have been carried out with serological methods (Indirect hemagglutination (IHA, Indirect Fluorescent Antibody Technic (IFAT and ELISA (Enzyme Linked Immunosorbent Assay and radiological imaging. In this study, we was aimed to investigating of prevalence with serological methods of parasite diseases like cystic echinococcosis, fascioliasis and amebic liver abscess in patients determined preliminary diagnosis mass with radiological imaging Methods: For this study, One hundred patient’s sera were included to investigation. It were investigated E.histolytica antibody with IHA method, anti-echinococcus IgG antibody with IFAT method and anti-fasciolia hepatica IgG antibody with ELISA method in sera of patient’s determined mass preliminary diagnosis with radiological imaging. Results: It were encountered these parasite in 27% of patients who determined mass preliminary diagnosis. It was determined in 1% E.histolytica, 13% Cystic echinococcus and 13% Fasciola hepatica seropositive of patients. Conclusion: The patients detected mass preliminary in liver should be evaluated for these parasites. We believe that will not be enough only radiological imaging in identification of these parasitic infections and should definitely need to be supported with a serological test.

Detection of Toxoplasma gondii DNA in horse meat from supermarkets in France and performance evaluation of two serological tests

Directory of Open Access Journals (Sweden)

Aroussi Abdelkrim

2015-01-01

Full Text Available In France, some cases of severe toxoplasmosis have been linked to the consumption of horse meat that had been imported from the American continent where atypical strains of Toxoplasma gondii are more common than in Europe. Many seroprevalence studies are presented in the literature but risk assessment of T. gondii infection after horse meat consumption is not possible in the absence of validated serological tests and the unknown correlation between detection of antibodies against T. gondii and presence of tissue cysts. We performed magnetic-capture polymerase chain reaction (MC-PCR to detect T. gondii DNA in 231 horse meat samples purchased in supermarkets in France and evaluated the performance and level of agreement of the modified agglutination test (MAT and enzyme-linked immunosorbent assay (ELISA in the meat juices. The serological tests lacked sensitivity, specificity, and agreement between them, and there was no correlation with the presence of T. gondii DNA in horse meat, raising concerns about the reliability of T. gondii seroprevalence data in horses from the literature. T. gondii DNA was detected in 43% of horse meat samples but the absence of strain isolation in mice following inoculation of more than 100 horse meat samples suggests a low distribution of cysts in skeletal muscles and a low risk of T. gondii infection associated with horse meat consumption. However, to avoid any risk of toxoplasmosis, thorough cooking of horse meat is recommended.

Detection of Toxoplasma gondii DNA in horse meat from supermarkets in France and performance evaluation of two serological tests.

Science.gov (United States)

Aroussi, Abdelkrim; Vignoles, Philippe; Dalmay, François; Wimel, Laurence; Dardé, Marie-Laure; Mercier, Aurélien; Ajzenberg, Daniel

2015-01-01

In France, some cases of severe toxoplasmosis have been linked to the consumption of horse meat that had been imported from the American continent where atypical strains of Toxoplasma gondii are more common than in Europe. Many seroprevalence studies are presented in the literature but risk assessment of T. gondii infection after horse meat consumption is not possible in the absence of validated serological tests and the unknown correlation between detection of antibodies against T. gondii and presence of tissue cysts. We performed magnetic-capture polymerase chain reaction (MC-PCR) to detect T. gondii DNA in 231 horse meat samples purchased in supermarkets in France and evaluated the performance and level of agreement of the modified agglutination test (MAT) and enzyme-linked immunosorbent assay (ELISA) in the meat juices. The serological tests lacked sensitivity, specificity, and agreement between them, and there was no correlation with the presence of T. gondii DNA in horse meat, raising concerns about the reliability of T. gondii seroprevalence data in horses from the literature. T. gondii DNA was detected in 43% of horse meat samples but the absence of strain isolation in mice following inoculation of more than 100 horse meat samples suggests a low distribution of cysts in skeletal muscles and a low risk of T. gondii infection associated with horse meat consumption. However, to avoid any risk of toxoplasmosis, thorough cooking of horse meat is recommended. © A. Aroussi et al., published by EDP Sciences, 2015.

Development and performance of prototype serologic and molecular tests for hepatitis delta infection.

Science.gov (United States)

Coller, Kelly E; Butler, Emily K; Luk, Ka-Cheung; Rodgers, Mary A; Cassidy, Michael; Gersch, Jeffrey; McNamara, Anne L; Kuhns, Mary C; Dawson, George J; Kaptue, Lazare; Bremer, Birgit; Wedemeyer, Heiner; Cloherty, Gavin A

2018-02-01

Worldwide, an estimated 5% of hepatitis B virus (HBV) infected people are coinfected with hepatitis delta virus (HDV). HDV infection leads to increased mortality over HBV mono-infection, yet HDV diagnostics are not widely available. Prototype molecular (RNA) and serologic (IgG) assays were developed for high-throughput testing on the Abbott m2000 and ARCHITECT systems, respectively. RNA detection was achieved through amplification of a ribozyme region target, with a limit of detection of 5 IU/ml. The prototype serology assay (IgG) was developed using peptides derived from HDV large antigen (HDAg), and linear epitopes were further identified by peptide scan. Specificity of an HBV negative population was 100% for both assays. A panel of 145 HBsAg positive samples from Cameroon with unknown HDV status was tested using both assays: 16 (11.0%) had detectable HDV RNA, and 23 (15.7%) were sero-positive including the 16 HDV RNA positive samples. Additionally, an archival serial bleed panel from an HDV superinfected chimpanzee was tested with both prototypes; data was consistent with historic testing data using a commercial total anti-Delta test. Overall, the two prototype assays provide sensitive and specific methods for HDV detection using high throughput automated platforms, allowing opportunity for improved diagnosis of HDV infected patients.

Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

Science.gov (United States)

Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

2017-06-01

Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

Serological Tests for Acquired Syphilis in Immuno-competent Patients

Directory of Open Access Journals (Sweden)

Golušin Zoran

2016-06-01

Full Text Available Serological tests represent a valuable tool for the diagnosis and monitoring the syphilis treatment. Non-treponemal antibodies are nonspecific to detect the infection, but antibody titers are used to monitor the effects of syphilis treatment. A definitive diagnosis of syphilis is made using treponemal tests, because they detect specific antibodies to the treponemal strains or treponemal fragments, which cause syphilis. These tests may remain reactive for years, sometimes for life, regardless of the therapy outcome. Even after successful treatment, approximately 85% of patients remain positive for treponemal antibodies for the rest of their lives. However, treponemal tests cannot differentiate past infections from a current infection. Therefore, we use a combination of specific and non-specific tests, the two most frequently used diagnostic algorithms. The traditional algorithm begins with a non-treponemal assay, and if it is positive, the treponemal test is done. A positive treponemal test indicates syphilis. The reverse serology algorithm detects early, primary, and treated syphilis that may be missed with traditional screening. However, non-treponemal test is necessary to detect patients with active syphilis.

[Serological Characteristics and Family Survey of 3 Cases of H-deficient Blood Group].

Science.gov (United States)

Geng, Wei; Gao, Huan-Huan; Zhang, Lin-Wei

2016-06-01

To investigate the serological characteristics and the genetic status of the family of H-deficient blood group in Jining area of Shandong province in China. ABO, H, and Lewis blood groups in 3 probands were screened out by the serological method, and saliva testing was performed on all the individuals. The presence of weak A or B on the RBC was confirmed by using the adsorption-elution procedure. Three cases of H-deficient blood group were identified to be para-Bombay blood group (secretor), out of 3 cases, 2 cases were Bh, 1 case was Ah, and anti-H or anti-HI antibody was detected in their serum. Three cases of H-deficerent blood group are para-Bombay phenotype, among them one proband's parents have been confirmed to be consanguineous relationship.

THE SEARCH OF OPTIMAL COMBINATION OF ANTIGENS FOR SEROLOGICAL DIAGNOSTICS OF TUBERCULOSIS

Directory of Open Access Journals (Sweden)

E. V. Vasilyeva

2013-01-01

Full Text Available Abstract. The four chimeric recombinant antigens CBD-CFP10, CBD-ESAT6, ESAT6-CFP10 and CBD-P38 contained aminoacid sequences of full-size proteins ESAT6, CFP10 and matured protein P38 of M. tuberculosis, joined with aminoacid sequences of cellulose bind domain of endogluconase A (CBD from Cellumonas fimi have been obtained by gene engineering methods. Recombinant proteins were purified by affine chromatography in column with Ni-NTA-sepharose 6В-CL and as PPDN-3 were used for detection of their antigenic activity in indirect ELISA for TB serological diagnostics. The sera from patients with lung tuberculosis (n = 321, from persons who had professional contacts with TB patients (n = 42, from healthy blood donors (n = 366 and from patients with lung diseases of non-TB etiology were tested. It was detected that there was positive correlation between antibodies level for all studied antigens compared by pair. It has been demonstrated that although antigens were different by antigenic and immunobiological characteristics they add each other in the content of antigenic diagnostics compositions. Thus, all these antigens can be used in the test kits for serological diagnostics of TB. Using of these antigens will allow to detect persons infected by TB and patients with active tuberculosis. 

A comparison of clinical diagnosis and serological diagnosis in an epidemic of Crimean-Congo Hemorrhagic Fever

International Nuclear Information System (INIS)

Nadeem, M.; Ali, N.; Anwar, M.

2003-01-01

Crimean Congo Hemorrhagic Fever (CCHF) is the life-threatening disease caused by Nairovirus of genus Bunya virus caused by tick bite of Hayalomma species or by direct contact of the blood/sera of the patient and animals suffering from this disease. Epidemics have been occurring in Balochistan province of Pakistan and neighboring Afghanistan and Iran from time to time with this mortality. Aim: In the absence of facilities for detection of serological markers of CCHF (IgM Et IgG antibodies and PCR for viral RNA), a study was designed to diagnose and treat cases of CCHF reporting to a specialist unit hospital situated at Quetta, Pakistan. The aim was to compare the clinical features, complications and outcome of both groups of patients: one detecting the disease clinically only and the other depending upon serological tests for the diagnosis. Methods: Thirty-four patients having fever of less than two weeks of duration with features of bleeding from the skin and various orifices were included in this study from June 2001 to September 2001 after hospitalization. Index case and some of the consecutive cases were subjected to detection of serological markers. Rest of the cases were diagnosed on clinical ground and baseline laboratory investigations only. Difference in both the group was noted carefully. All the patients were given Ribavirin and blood products as and when required. Results: Statistically there was no obvious difference in clinical manifestations (fever, body aches, purpuric spots, ecchymosis, epistaxis, gum bleed etc. ) and laboratory findings (blood picture, serum ALT, serum urea and electrolytes, PT, APTT, etc). There was also no difference in mortality of the two groups studied. Conclusion: In an on ongoing outbreak of CCHF, history, clinical findings and supportive baseline, laboratory investigations may be sufficient for early detection and treatment of CCHF cases. However for documentation of start of epidemic, serological markers should be done

Detection of Toxoplasma gondii DNA in horse meat from supermarkets in France and performance evaluation of two serological tests

OpenAIRE

Aroussi Abdelkrim; Vignoles Philippe; Dalmay François; Wimel Laurence; Dardé Marie-Laure; Mercier Aurélien; Ajzenberg Daniel

2015-01-01

In France, some cases of severe toxoplasmosis have been linked to the consumption of horse meat that had been imported from the American continent where atypical strains of Toxoplasma gondii are more common than in Europe. Many seroprevalence studies are presented in the literature but risk assessment of T. gondii infection after horse meat consumption is not possible in the absence of validated serological tests and the unknown correlation between detection of antibodies against T. gondii an...

Comparison Of Clinical, Parasitological And Serological Diagnostic ...

African Journals Online (AJOL)

Comparison Of Clinical, Parasitological And Serological Diagnostic Methods For The Definitive ... Consideringthe relative significance of these methods in the diagnosis of onchocerciasis, we ... http://dx.doi.org/10.4314/ari.v1i3.40835.

Clinical values of multiple Epstein-Barr virus (EBV serological biomarkers detected by xMAP technology

Directory of Open Access Journals (Sweden)

Chen Li-Zhen

2009-08-01

Full Text Available Abstract Background Serological examination of Epstein-Barr virus (EBV antibodies has been performed for screening nasopharyngeal carcinoma (NPC and other EBV-associated diseases. Methods By using xMAP technology, we examined immunoglobulin (Ig A antibodies against Epstein-Barr virus (EBV VCA-gp125, p18 and IgA/IgG against EA-D, EBNA1 and gp78 in populations with distinct diseases, or with different genetic or geographic background. Sera from Cantonese NPC patients (n = 547 and healthy controls (n = 542, 90 members of high-risk NPC families and 52 non-endemic healthy individuals were tested. Thirty-five of NPC patients were recruited to observe the kinetics of EBV antibody levels during and after treatment. Patients with other EBV-associated diseases were collected, including 16 with infectious mononucleosis, 28 with nasal NK/T cell lymphoma and 14 with Hodgkin's disease. Results Both the sensitivity and specificity of each marker for NPC diagnosis ranged 61–84%, but if combined, they could reach to 84.5% and 92.4%, respectively. Almost half of NPC patients displayed decreased EBV immunoactivities shortly after therapy and tumor recurrence was accompanied with high EBV antibody reactivates. Neither the unaffected members from high-risk NPC families nor non-endemic healthy population showed statistically different EBV antibody levels compared with endemic controls. Moreover, elevated levels of specific antibodies were observed in other EBV-associated diseases, but all were lower than those in NPC. Conclusion Combined EBV serological biomarkers could improve the diagnostic values for NPC. Diverse EBV serological spectrums presented in populations with different EBV-associated diseases, but NPC patients have the highest EBV activity.

Molecular and serological detection of Ehrlichia canis and Babesia vogeli in dogs in Colombia.

Science.gov (United States)

Vargas-Hernández, G; André, M R; Faria, J L M; Munhoz, T D; Hernandez-Rodriguez, M; Machado, R Z; Tinucci-Costa, M

2012-05-25

Ehrlichiosis and babesiosis are tick-borne diseases, caused mainly by Ehrlichia canis and Babesia canis, respectively, with a worldwide occurrence in dogs, whose main vector is the brown-dog tick, Rhipicephalus sanguineus. The present work aimed to detect the presence of E. canis and Babesia sp. in 91 dog blood samples in Colombia, by molecular and serological techniques. We also performed sequence alignment to indicate the identity of the parasite species infecting these animals. The present work shows the first molecular detection of E. canis and B. vogeli in dogs from Colombia. Immunoglobulin-G (IgG) antibodies to E. canis and Babesia vogeli were found in 75 (82.4%) and 47 (51.6%) sampled dogs, respectively. Thirty-seven (40.6%) and 5 (5.5%) dogs were positive in PCR for E. canis and Babesia sp., respectively. After sequencing, amplicons showed 99% of identity with isolates of E. canis and B. vogeli. The phylogenetic trees based on 16S rRNA-Anaplasmataceae sequences and 18S rRNA-piroplasmid sequences supported the identity of the found E. canis and B. vogeli DNAs, respectively. The present work shows the first molecular detection of E. canis and B. vogeli in dogs in Colombia. Copyright © 2011 Elsevier B.V. All rights reserved.

Performance of an ELISA and Indirect Immunofluorescence Assay in Serological Diagnosis of Zoonotic Cutaneous Leishmaniasis in Iran

Directory of Open Access Journals (Sweden)

Bahador Sarkari

2014-01-01

Full Text Available Serological assays have been extensively evaluated for diagnosis of visceral leishmaniasis (VL and considered as a routine method for diagnosis of VL while these methods are not properly evaluated for diagnosis of cutaneous leishmaniasis (CL. This study aimed to assess the performance of indirect immunofluorescent-antibody test (IFA and enzyme-linked immunosorbent assay (ELISA for serodiagnosis of cutaneous leishmaniasis in Iran. Sixty-one sera samples from parasitologically confirmed CL patients and 50 sera from healthy controls along with 50 sera from non-CL patients were collected. Antigen was prepared from promastigotes and amastigotes of Leishmania major. IFA was used to detect anti-Leishmania IgG while ELISA was used to detect anti-Leishmania IgM, total IgG, or IgG subclasses (IgG1 and 4. ELISA, for detection of total IgG and IgM, showed sensitivity of 83.6% and 84.7% and specificity of 62.7% and 54.6%, respectively. Sensitivity and specificity of ELISA for detecting IgG1 and IgG4 were 64%, 75% and 85%, 49%, respectively. Sensitivity and specificity of IFA were 91.6% and 81%. Conclusion. Findings of this study demonstrated that serological test, especially IFA, can be used for proper diagnosis of CL.

Serological Detection of Foot and Mouth Disease Virus (Fmdv) Sat 1 ...

African Journals Online (AJOL)

The prevalence of Foot and Mouth Disease virus (FMDV) serotypes SAT 1 and SAT 2 antibodies among Nigerian cattle was determined using complement fixation (CF) and neutralization tests (NT) in 2000 cattle sera obtained from nine northern states. The two serological tests were very specific and sensitive enough to ...

21 CFR 866.3510 - Rubella virus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3510 Rubella virus... Clinical Laboratory Standards': (i) 1/LA6 “Detection and Quantitation of Rubella IgG Antibody: Evaluation... Products in the Clinical Laboratory, October 1997,” (ii) 1/LA18 “Specifications for Immunological Testing...

Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

Science.gov (United States)

Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

2016-01-01

　Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

Serological and molecular detection of Theileria equi in sport horses of northeastern Brazil.

Science.gov (United States)

Ferreira, Edlainne P; Vidotto, Odilon; Almeida, Jonatas C; Ribeiro, Luana P S; Borges, Marcos V; Pequeno, Walter H C; Stipp, Danilo T; de Oliveira, Celso J B; Biondo, Alexander W; Vieira, Thállitha S W J; Vieira, Rafael F C

2016-08-01

Theileriosis is a worldwide protozoal tick-borne disease caused by Theileria equi, which may produce a variety of clinical signs and turn infected horses into lifetime carriers. This study has aimed to perform a serological and molecular detection of T. equi and associated factors in sports horses from six areas of northeastern Brazil. In overall, 59.6% horses were positive by indirect immunofluorescence assay and 50.4% by polymerase chain reaction. No significant association was found when presence of ticks, age, gender, anemia or total plasma proteins was analyzed with seropositivity and molecular techniques. Although a significant association of infection was found in two cities. Thus, local risk factors other than presence of ticks, horse age, gender, anemia and total plasmatic proteins may dictate prevalence of T. equi infection in sports horses, even in highly endemic areas with no control of infection prior to horse competitions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sensitivity and specificity of parallel or serial serological testing for detection of canine Leishmania infection

Directory of Open Access Journals (Sweden)

Mauro Maciel de Arruda

2016-01-01

Full Text Available In Brazil, human and canine visceral leishmaniasis (CVL caused byLeishmania infantum has undergone urbanisation since 1980, constituting a public health problem, and serological tests are tools of choice for identifying infected dogs. Until recently, the Brazilian zoonoses control program recommended enzyme-linked immunosorbent assays (ELISA and indirect immunofluorescence assays (IFA as the screening and confirmatory methods, respectively, for the detection of canine infection. The purpose of this study was to estimate the accuracy of ELISA and IFA in parallel or serial combinations. The reference standard comprised the results of direct visualisation of parasites in histological sections, immunohistochemical test, or isolation of the parasite in culture. Samples from 98 cases and 1,327 noncases were included. Individually, both tests presented sensitivity of 91.8% and 90.8%, and specificity of 83.4 and 53.4%, for the ELISA and IFA, respectively. When tests were used in parallel combination, sensitivity attained 99.2%, while specificity dropped to 44.8%. When used in serial combination (ELISA followed by IFA, decreased sensitivity (83.3% and increased specificity (92.5% were observed. Serial testing approach improved specificity with moderate loss in sensitivity. This strategy could partially fulfill the needs of public health and dog owners for a more accurate diagnosis of CVL.

Detection of Leishmania spp. using parasitological, serological and molecular assays in asymptomatic and sick cats from an endemic area of visceral leishmaniosis in Brazil

Directory of Open Access Journals (Sweden)

Maria Fernanda Alves-Martin

2017-11-01

Full Text Available Objective: To analyze the prevalence of feline leishmaniosis in 55 asymptomatic cats or assess clinical disease in a visceral leishmaniasis-endemic area using parasitological, serological and molecular techniques. Methods: Fifty-five adult domestic and non-purebred cats held at an animal shelter in a rural area of the municipality of Ilha Solteira, São Paulo, Brazil, a region endemic for canine visceral leishmaniosis, were evaluated. A total of 5 mL of blood was collected from each animal, for blood culture, serological (indirect fluorescent antibody test, soluble extract ELISA, ELISA recombinant K39 antigen and molecular tests (PCR. At the time of blood collection, the cats underwent clinical evaluation for the presence of clinical signs. Results: Flagellate protozoa were found in nine blood cultures (16.4%. Seropositivity by indirect fluorescent antibody test was observed in 32 serum samples (62.7%. ELISA-SE showed seropositivity in 37 cats (72.5%, while ELISA-rK39 revealed positive results in 11 cats (21.6%. Leishmania spp. was detected by PCR in whole blood samples from five cats (9.1%. Based on clinical evaluation, it was possible to detect the presence of clinical signs (alopecia, emaciation, pinna lesions, nose lesions, skin lesions in 30 animals (54.5%. Conclusions: To the knowledge of the authors, this is the first report of Leishmania spp. in domestic cats in the epidemiological cycle of leishmaniosis in the studied area, requiring more attention in the establishment of preventive steps to control this disease.

Factors affecting the serological testing of cadaveric donor cornea

Directory of Open Access Journals (Sweden)

Anuradha Raj

2018-01-01

Full Text Available Purpose: The purpose of this study was to evaluate the serological profile of the eye donors and to study the influence of various factors on serological test results. Methods: A cross-sectional, observational study was conducted, and data of 509 donors were reviewed from the records of eye bank from December 2012 to June 2017. Various details of donors analyzed included the age, sex of the donor, cause of death, source of tissue, time since blood collection after death, macroscopic appearance of blood sample, and details of discarded tissues. Serological examination of blood was performed for human immunodeficiency virus (HIV, hepatitis B virus, hepatitis C virus (HCV, venereal disease research laboratory (VDRL, and serology reports reactive or nonreactive were analyzed. Results: Among the 509 donors, 295 (58% were male, and 420 (82.50% belonged to age group ≥60 years. Most donors (354, 69.5% died due to cardiac arrest. Macroscopically, sera were normal in the majority of 488 (95.9% cases. Among 509 donors, 475 (93.3% were nonreactive, 12 (2.4% donors were found to be reactive to hepatitis B surface antigen (HBsAg, and 1 (0.2% was reactive to HCV, but no donor serology was reactive to HIV or VDRL. Twenty-one (4.12% donors' sera were not fit for serological testing. Among all donors, 475 (93.32% donors were accepted and 34 (6.67% were rejected or discarded on the basis of serological testing. Cause of death and macroscopic aspect of sera influenced the serological results in a highly significant manner (P = 0.00. Acceptance or rejection of the donor was significantly influenced by the serological results of the donor (P = 0.00. Conclusion: The seroprevalence among eye donor for HBsAg and HCV was 12 (2.4% and 1 (0.2%, respectively. Factors such as cause of death and macroscopic aspect of sera influence the serological results. Time since blood collection or sampling will not show any impact on viral serological results if postmortem sampling

Clinical evaluation and validation of laboratory methods for the diagnosis of Bordetella pertussis infection: Culture, polymerase chain reaction (PCR) and anti-pertussis toxin IgG serology (IgG-PT).

Science.gov (United States)

Lee, Adria D; Cassiday, Pamela K; Pawloski, Lucia C; Tatti, Kathleen M; Martin, Monte D; Briere, Elizabeth C; Tondella, M Lucia; Martin, Stacey W

2018-01-01

The appropriate use of clinically accurate diagnostic tests is essential for the detection of pertussis, a poorly controlled vaccine-preventable disease. The purpose of this study was to estimate the sensitivity and specificity of different diagnostic criteria including culture, multi-target polymerase chain reaction (PCR), anti-pertussis toxin IgG (IgG-PT) serology, and the use of a clinical case definition. An additional objective was to describe the optimal timing of specimen collection for the various tests. Clinical specimens were collected from patients with cough illness at seven locations across the United States between 2007 and 2011. Nasopharyngeal and blood specimens were collected from each patient during the enrollment visit. Patients who had been coughing for ≤ 2 weeks were asked to return in 2-4 weeks for collection of a second, convalescent blood specimen. Sensitivity and specificity of each diagnostic test were estimated using three methods-pertussis culture as the "gold standard," composite reference standard analysis (CRS), and latent class analysis (LCA). Overall, 868 patients were enrolled and 13.6% were B. pertussis positive by at least one diagnostic test. In a sample of 545 participants with non-missing data on all four diagnostic criteria, culture was 64.0% sensitive, PCR was 90.6% sensitive, and both were 100% specific by LCA. CRS and LCA methods increased the sensitivity estimates for convalescent serology and the clinical case definition over the culture-based estimates. Culture and PCR were most sensitive when performed during the first two weeks of cough; serology was optimally sensitive after the second week of cough. Timing of specimen collection in relation to onset of illness should be considered when ordering diagnostic tests for pertussis. Consideration should be given to including IgG-PT serology as a confirmatory test in the Council of State and Territorial Epidemiologists (CSTE) case definition for pertussis.

21 CFR 866.3500 - Rickettsia serological reagents.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Rickettsia serological reagents. 866.3500 Section... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3500 Rickettsia serological reagents. (a) Identification. Rickettsia serological reagents are devices that consist of antigens...

21 CFR 866.3405 - Poliovirus serological reagents.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Poliovirus serological reagents. 866.3405 Section... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3405 Poliovirus serological reagents. (a) Identification. Poliovirus serological reagents are devices that consist of antigens...

Serologic evidence of exposure to Rift Valley fever virus detected in Tunisia

Directory of Open Access Journals (Sweden)

A. Bosworth

2016-01-01

Full Text Available Rift Valley fever virus (RVFv is capable of causing dramatic outbreaks amongst economically important animal species and is capable of causing severe symptoms and mortality in humans. RVFv is known to circulate widely throughout East Africa; serologic evidence of exposure has also been found in some northern African countries, including Mauritania. This study aimed to ascertain whether RVFv is circulating in regions beyond its known geographic range. Samples from febrile patients (n=181 and nonfebrile healthy agricultural and slaughterhouse workers (n=38 were collected during the summer of 2014 and surveyed for exposure to RVFv by both serologic tests and PCR. Of the 219 samples tested, 7.8% of nonfebrile participants showed immunoglobulin G reactivity to RVFv nucleoprotein and 8.3% of febrile patients showed immunoglobulin M reactivity, with the latter samples indicating recent exposure to the virus. Our results suggest an active circulation of RVFv and evidence of human exposure in the population of Tunisia.

Serological variability of the Pellia endiviifolia-P. megaspora complex

Directory of Open Access Journals (Sweden)

Wiesław Prus-Głowacki

2014-01-01

Full Text Available Analysis of antigenic proteins in populations of terrestrial and aquatic forms of P. endiviifolia and populations from Japan revealed the antigenic differentiation of the examined samples into two distinct groups. Pellia megaspora from the eastern part of the USA also exhibits a significant antigenic devergence and bears the most resemblance to the group of populations of the aquatic form of P. endiviifolia from Poland and samples from Japan. The observed serological distances between terrestrial and aquatic forms of P. endiviifolia are of the same rank as differences between remaining species of the genus Pellia. Clarification of the nature of the detected serological differentiation in the Pellia megaspora-P, endiviifoliacomplex will require further studies.

Microcapillary blood sampling for serological examinations by radioimmunoassay (RIA) and enzyme immunoassay (ELISA)

Energy Technology Data Exchange (ETDEWEB)

Rodak, L; Smid, B; Valicek, L; Jurak, E [Vyzkumny Ustav Veterinarniho Lekarstvi, Brno-Medlanky (Czechoslovakia)

1984-01-01

Methods were tested of sampling blood and blood serum for serological examinations on filtration paper and into heparinized glass capillaries with transfer into the dilution solution of the given composition. Samples were also examined for ACH virus antibodies. The suitability of the sampling was verified by an examination of samples using ELISA and RIA methods. The results showed the suitability of sampling using microcapillaries. The titres of virus antibodies found using the ELISA and RIA methods were identical and the sensitivity of antibody detection was not reduced even after the sample had been stored for 60 days at a temperature of 20 degC.

Microcapillary blood sampling for serological examinations by radioimmunoassay (RIA) and enzyme immunoassay (ELISA)

International Nuclear Information System (INIS)

Rodak, L.; Smid, B.; Valicek, L.; Jurak, E.

1984-01-01

Methods were tested of sampling blood and blood serum for serological examinations on filtration paper and into heparinized glass capillaries with transfer into the dilution solution of the given composition. Samples were also examined for ACH virus antibodies. The suitability of the sampling was verified by an examination of samples usiOg ELISA and RIA methods. The results showed the suitability of sampling using microcapillaries. The titres of virus antibodies found using the ELISA and RIA methods were identical and the sensitivity of antibody detection was not reduced even after the sample had been stored for 60 days at a temperature of 20 degC. (B.S.)

Standardized Methods for Detection of Poliovirus Antibodies.

Science.gov (United States)

Weldon, William C; Oberste, M Steven; Pallansch, Mark A

2016-01-01

Testing for neutralizing antibodies against polioviruses has been an established gold standard for assessing individual protection from disease, population immunity, vaccine efficacy studies, and other vaccine clinical trials. Detecting poliovirus specific IgM and IgA in sera and mucosal specimens has been proposed for evaluating the status of population mucosal immunity. More recently, there has been a renewed interest in using dried blood spot cards as a medium for sample collection to enhance surveillance of poliovirus immunity. Here, we describe the modified poliovirus microneutralization assay, poliovirus capture IgM and IgA ELISA assays, and dried blood spot polio serology procedures for the detection of antibodies against poliovirus serotypes 1, 2, and 3.

42 CFR 493.923 - Syphilis serology.

Science.gov (United States)

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Syphilis serology. 493.923 Section 493.923 Public... Proficiency Testing Programs by Specialty and Subspecialty § 493.923 Syphilis serology. (a) Program content and frequency of challenge. To be approved for proficiency testing in syphilis serology, a program...

A Serological Survey for Newcastle Disease Virus Antibobies in ...

African Journals Online (AJOL)

Abstract. A serological survey to detect the presence of antibodies to Newcastle disease virus (NDV) in village poultry was conducted in 17 villages of Yobe State, Nigeria. The aim of the study was to investigate the prevalence of NDV using haemaggluttination inhibition test. Ten households were sampled from each village.

Comparison of 2 molecular assays and a serologic test in diagnosing Mycoplasma pneumoniae infection in paediatrics patients.

Science.gov (United States)

Blanco, Silvia; Fuenzalida, Loreto; Bas, Albert; Prat, Cristina; Ramírez, Aida; Matas, Lurdes; Rodrigo, Carlos; Ausina, Vicente

2011-12-01

Two commercial polymerase chain reaction (PCR) assays (a real-time PCR [Cepheid] and an oligochromatographic test [Speed-oligo]) and 1 serology test (Serodia-Myco II) for detecting Mycoplasma pneumoniae in nasopharyngeal aspirates and serum samples were studied. Among the 145 samples, 32 serum pairs were serologically positive for M. pneumoniae. Of these, in 30 nasopharyngeal aspirates, M. pneumoniae was detected using the real-time PCR assay and 25 using Speed-oligo, corresponding to a sensitivity of 93.7% and 78.1%, respectively. Among the 94 samples with negative serology, we only obtained 1 positive result by real-time PCR assay. In the group of samples from healthy children, no positive results were obtained. Copyright © 2011 Elsevier Inc. All rights reserved.

Serological and Virological Study of Newcastle Disease and Avian ...

African Journals Online (AJOL)

Serological survey on the prevalence of Newcastle disease (NCD) virus antibodies using haemagglutination inhibition test (HI) and virological detection by RT-PCR of highly pathogenic avian influenza (HPAI) H5N1, were carried out in 6 regions of Senegal from June to November 2008. Rural chickens were raised in free ...

21 CFR 866.3350 - Leptospira spp. serological reagents.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Leptospira spp. serological reagents. 866.3350... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3350 Leptospira spp. serological reagents. (a) Identification. Leptospira spp. serological reagents are devices that...

21 CFR 866.3200 - Echinococcus spp. serological reagents.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Echinococcus spp. serological reagents. 866.3200... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3200 Echinococcus spp. serological reagents. (a) Identification. Echinococcus spp. serological reagents are devices that...

21 CFR 866.3415 - Pseudomonas spp. serological reagents.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Pseudomonas spp. serological reagents. 866.3415... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3415 Pseudomonas spp. serological reagents. (a) Identification. Pseudomonas spp. serological reagents are devices that...

21 CFR 866.3255 - Escherichia coli serological reagents.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Escherichia coli serological reagents. 866.3255... coli serological reagents. (a) Identification. Escherichia coli serological reagents are devices that consist of antigens and antisera used in serological tests to identify Escherichia coli from cultured...

Serological diagnosis of avian influenza in poultry

DEFF Research Database (Denmark)

Comin, Arianna; Toft, Nils; Stegeman, Arjan

2013-01-01

Background The serological diagnosis of avian influenza (AI) can be performed using different methods, yet the haemagglutination inhibition (HI) test is considered the gold standard' for AI antibody subtyping. Although alternative diagnostic assays have been developed, in most cases, their accuracy...

Influenza serological studies to inform public health action: best practices to optimise timing, quality and reporting.

Science.gov (United States)

Laurie, Karen L; Huston, Patricia; Riley, Steven; Katz, Jacqueline M; Willison, Donald J; Tam, John S; Mounts, Anthony W; Hoschler, Katja; Miller, Elizabeth; Vandemaele, Kaat; Broberg, Eeva; Van Kerkhove, Maria D; Nicoll, Angus

2013-03-01

Serological studies can detect infection with a novel influenza virus in the absence of symptoms or positive virology, providing useful information on infection that goes beyond the estimates from epidemiological, clinical and virological data. During the 2009 A(H1N1) pandemic, an impressive number of detailed serological studies were performed, yet the majority of serological data were available only after the first wave of infection. This limited the ability to estimate the transmissibility and severity of this novel infection, and the variability in methodology and reporting limited the ability to compare and combine the serological data.   To identify best practices for conduct and standardisation of serological studies on outbreak and pandemic influenza to inform public policy. An international meeting was held in February 2011 in Ottawa, Canada, to foster the consensus for greater standardisation of influenza serological studies. Best practices for serological investigations of influenza epidemiology include the following: classification of studies as pre-pandemic, outbreak, pandemic or inter-pandemic with a clearly identified objective; use of international serum standards for laboratory assays; cohort and cross-sectional study designs with common standards for data collection; use of serum banks to improve sampling capacity; and potential for linkage of serological, clinical and epidemiological data. Advance planning for outbreak studies would enable a rapid and coordinated response; inclusion of serological studies in pandemic plans should be considered. Optimising the quality, comparability and combinability of influenza serological studies will provide important data upon emergence of a novel or variant influenza virus to inform public health action. © 2012 Blackwell Publishing Ltd.

[Evaluation of the Recombinant Protein Tp0965 of Treponema Pallidum as Perspective Antigen for the Improved Serological Diagnosis of Syphilis].

Science.gov (United States)

Runina, A V; Starovoitova, A S; Deryabin, D G; Kubanov, A A

2016-01-01

BACKGRAUND. Treponemal tests based on the detection of antibodies against the Treponema pallidum antigens are the most specific methods for serological diagnosis of syphilis. Due to the inability to cultivate this bacterium in vitro, the most promising sources of antigens for diagnostics are recombinant proteins of T. pallidum. Evaluation of the analytical value of certain T. pallidum proteins is the approach to improve sensitivity, specificity, and reproducibility of syphilis serological tests, including possibilities of differential diagnosis of various forms of the disease. The aim of the research was to evaluate the analytical values (sensitivity and specificity) of recombinant protein Tp0965 of T. pallidum as a candidate antigen for serological diagnosis of syphilis. tp0965 gene was cloned into the expression vector pET28a and the construct was used for the transformation of E. coli BL-21 (DE3) cells and further expression and purification of the recombinant protein. The collected protein was used as T. pallidum antigen for serum analysis (ELISA) of groups of patients with various forms of syphilis (n=84) and the group of healthy donors (n = 25). High frequency of positive ELISA results was shown with serum of patients with syphilis, compared to the group of healthy donors. The sensitivity of serological reactions using recombinant protein Tp0965 was 98.8%, specificity--87.5%. The highest sensitivity (100%) was detected in the groups of patients with primary, secondary and early latent syphilis while in the group of patients with late latent syphilis it decreased to 95.2%. We concluded that due to its specificity T. pallidum recombinant protein Tp0965 can be used as a novel perspective antigen for development of syphilis serological diagnostic assays (for primary and early latent forms).

Prevalence of hepatitis A, B and C serological markers in children from western Mexico.

Science.gov (United States)

Escobedo-Meléndez, Griselda; Fierro, Nora A; Roman, Sonia; Maldonado-González, Monserrat; Zepeda-Carrillo, Eloy; Panduro, Arturo

2012-01-01

Viral hepatitis in children is a major public health problem worldwide. To evaluate the prevalence of serological markers for hepatitis A, B and C infections in Mexican children diagnosed with hepatitis during a five-year period. A total of 31,818 children admitted to a tertiary level hospital in Mexico from 2005 to 2009 were evaluated for hepatitis. Hepatitis was found in 215 (0.7%) of the children. Serum samples from hepatitis-positive children were screened for anti-HAV IgM, HBsAg, total anti-HBc and anti-HCV. HAV was the leading cause of viral hepatitis (81%), followed by HBV and HCV (3.1 and 2%, respectively), whereas no serological marker was observed in 13.9% of the analyzed samples. Furthermore, when children were categorized by age, a significant increase in anti-HAV detection was observed in school-aged children (7-11 years old) (p hepatitis A is the most prevalent viral hepatitis infection detected in children, followed by HBV and HCV. In addition, the high percentage of hepatitis infections without a known etiological agent and the serological test limitations require the detection of occult HBV, HCV and hepatitis E infections. The age-dependent vulnerability of groups with HAV infections emphasizes the importance of HAV vaccination in young children in Mexico.

Serologic survey for selected arboviruses and other potential pathogens in wildlife from Mexico.

Science.gov (United States)

Aguirre, A A; McLean, R G; Cook, R S; Quan, T J

1992-07-01

During 1988 and 1989, a serologic survey of wildlife was conducted in northeastern Mexico to determine the presence, prevalence, and distribution of arboviruses and other selected disease agents. Eighty mammal specimens were tested. Antibodies to vesicular stomatitis-Indiana, Venezuelan equine encephalitis-Mena II, Rio Grande virus, and vesicular stomatitis-New Jersey were detected predominantly in small mammals. Deer and mouflon (Ovis musimon) had antibodies to bluetongue and epizootic hemorrhagic disease. Two species had serologic evidence of recent exposure to Francisella tularensis. A white-tailed deer (Odocoileus virginianus) had antibodies to Anaplasma marginale. All specimens tested for antibodies against Yersinia pestis and Brucella abortus were negative. Sera from 315 birds were tested for antibody against five equine encephalitis viruses and six avian pathogens. During 1988, antibodies to Venezuelan equine encephalitis-Mena II, Venezuelan equine encephalitis-TC83, St. Louis encephalitis, eastern equine encephalitis, and western equine encephalitis were detected in birds of several species. Antibodies to Pasteurella multocida and Newcastle disease virus were also detected. Birds from five species presented antibodies to Mycoplasma meleagridis. Specimens tested for M. gallisepticum, M. synoviae, and Chlamydia psittaci were negative. To the best of our knowledge, this survey represents the first serologic evidence of bluetongue, Cache Valley virus, epizootic hemorrhagic disease, Jamestown Canyon virus, vesicular stomatitis-Indiana, vesicular stomatitis-New Jersey, Rio Grande virus, and tularemia reported among wildlife in Mexico.

Rapid Quantitative Serological Test for Detection of Infection with Mycobacterium leprae, the Causative Agent of Leprosy

Science.gov (United States)

Balagon, Marivic F.; Maghanoy, Armi; Orcullo, Florenda M.; Cang, Marjorie; Dias, Ronaldo Ferreira; Collovati, Marco; Reed, Steven G.

2014-01-01

Leprosy remains an important health problem in a number of regions. Early detection of infection, followed by effective treatment, is critical to reduce disease progression. New sensitive and specific tools for early detection of infection will be a critical component of an effective leprosy elimination campaign. Diagnosis is made by recognizing clinical signs and symptoms, but few clinicians are able to confidently identify these. Simple tests to facilitate referral to leprosy experts are not widely available, and the correct diagnosis of leprosy is often delayed. In this report, we evaluate the performance of a new leprosy serological test (NDO-LID). As expected, the test readily detected clinically confirmed samples from patients with multibacillary (MB) leprosy, and the rate of positive results declined with bacterial burden. NDO-LID detected larger proportions of MB and paucibacillary (PB) leprosy than the alternative, the Standard Diagnostics leprosy test (87.0% versus 81.7% and 32.3% versus 6.5%, respectively), while also demonstrating improved specificity (97.4% versus 90.4%). Coupled with a new cell phone-based test reader platform (Smart Reader), the NDO-LID test provided consistent, objective test interpretation that could facilitate wider use in nonspecialized settings. In addition, results obtained from sera at the time of diagnosis, versus at the end of treatment, indicated that the quantifiable nature of this system can also be used to monitor treatment efficacy. Taken together, these data indicate that the NDO-LID/Smart Reader system can assist in the diagnosis and monitoring of MB leprosy and can detect a significant number of earlier-stage infections. PMID:24478496

Comparison of diagnostic methods to detect Histoplasma capsulatum in serum and blood samples from AIDS patients

Science.gov (United States)

da Silva, Marcos Vinicius; Criado, Paulo Ricardo; Luiz, Olinda do Carmo; Vicentini, Adriana Pardini

2018-01-01

Background Although early and rapid detection of histoplasmosis is essential to prevent morbidity and mortality, few diagnostic tools are available in resource-limited areas, especially where it is endemic and HIV/AIDS is also epidemic. Thus, we compared conventional and molecular methods to detect Histoplasma capsulatum in sera and blood from HIV/AIDS patients. Methodology We collected a total of 40 samples from control volunteers and patients suspected of histoplasmosis, some of whom were also infected with other pathogens. Samples were then analyzed by mycological, serological, and molecular methods, and stratified as histoplasmostic with (group I) or without AIDS (group II), uninfected (group III), and infected with HIV and other pathogens only (group IV). All patients were receiving treatment for histoplasmosis and other infections at the time of sample collection. Results Comparison of conventional methods with nested PCR using primers against H. capsulatum 18S rRNA (HC18S), 5.8S rRNA ITS (HC5.8S-ITS), and a 100 kDa protein (HC100) revealed that sensitivity against sera was highest for PCR with HC5.8S-ITS, followed by immunoblotting, double immunodiffusion, PCR with HC18S, and PCR with HC100. Specificity was equally high for double immunodiffusion, immunoblotting and PCR with HC100, followed for PCR with HC18S and HC5.8-ITS. Against blood, sensitivity was highest for PCR with HC5.8S-ITS, followed by PCR with HC18S, Giemsa staining, and PCR with HC100. Specificity was highest for Giemsa staining and PCR with HC100, followed by PCR with HC18S and HC5.8S-ITS. PCR was less efficient in patients with immunodeficiency due to HIV/AIDS and/or related diseases. Conclusion Molecular techniques may detect histoplasmosis even in cases with negative serology and mycology, potentially enabling early diagnosis. PMID:29342162

Comparison of diagnostic methods to detect Histoplasma capsulatum in serum and blood samples from AIDS patients.

Directory of Open Access Journals (Sweden)

Katia Cristina Dantas

Full Text Available Although early and rapid detection of histoplasmosis is essential to prevent morbidity and mortality, few diagnostic tools are available in resource-limited areas, especially where it is endemic and HIV/AIDS is also epidemic. Thus, we compared conventional and molecular methods to detect Histoplasma capsulatum in sera and blood from HIV/AIDS patients.We collected a total of 40 samples from control volunteers and patients suspected of histoplasmosis, some of whom were also infected with other pathogens. Samples were then analyzed by mycological, serological, and molecular methods, and stratified as histoplasmostic with (group I or without AIDS (group II, uninfected (group III, and infected with HIV and other pathogens only (group IV. All patients were receiving treatment for histoplasmosis and other infections at the time of sample collection.Comparison of conventional methods with nested PCR using primers against H. capsulatum 18S rRNA (HC18S, 5.8S rRNA ITS (HC5.8S-ITS, and a 100 kDa protein (HC100 revealed that sensitivity against sera was highest for PCR with HC5.8S-ITS, followed by immunoblotting, double immunodiffusion, PCR with HC18S, and PCR with HC100. Specificity was equally high for double immunodiffusion, immunoblotting and PCR with HC100, followed for PCR with HC18S and HC5.8-ITS. Against blood, sensitivity was highest for PCR with HC5.8S-ITS, followed by PCR with HC18S, Giemsa staining, and PCR with HC100. Specificity was highest for Giemsa staining and PCR with HC100, followed by PCR with HC18S and HC5.8S-ITS. PCR was less efficient in patients with immunodeficiency due to HIV/AIDS and/or related diseases.Molecular techniques may detect histoplasmosis even in cases with negative serology and mycology, potentially enabling early diagnosis.

[Molecular typing methods for Pasteurella multocida-A review].

Science.gov (United States)

Peng, Zhong; Liang, Wan; Wu, Bin

2016-10-04

Pasteurella multocida is an important gram-negative pathogenic bacterium that could infect wide ranges of animals. Humans could also be infected by P. multocida via animal bite or scratching. Current typing methods for P. multocida include serological typing methods and molecular typing methods. Of them, serological typing methods are based on immunological assays, which are too complicated for clinical bacteriological studies. However, the molecular methods including multiple PCRs and multilocus sequence typing (MLST) methods are more suitable for bacteriological studies of P. multocida in clinic, with their simple operation, high efficiency and accurate detection compared to the traditional serological typing methods, they are therefore widely used. In the current review, we briefly describe the molecular typing methods for P. multocida. Our aim is to provide a knowledge-foundation for clinical bacteriological investigation especially the molecular investigation for P. multocida.

Diagnostic impact of routine Lyme serology in recent-onset arthritis: results from the ESPOIR cohort

Science.gov (United States)

Guellec, Dewi; Narbonne, Valérie; Cornec, Divi; Marhadour, Thierry; Varache, Sophie; Dougados, Maxime; Daurès, Jean Pierre; Jousse-Joulin, Sandrine; Devauchelle-Pensec, Valérie; Saraux, Alain

2016-01-01

Objectives Lyme disease may be considered by rheumatologists in patients with recent-onset arthritis, even in the absence of suggestive symptoms. The aim of this study was to determine the diagnostic impact of routine Lyme serology in a French cohort of patients with recent-onset arthritis affecting at least 2 joints. Methods We performed an ancillary study of a French prospective multicentre cohort established to monitor clinical, biological and radiographic data in patients with inflammatory arthritis in at least 2 joints, lasting for 6 weeks to 6 months. Borrelia IgM and IgG antibodies were sought routinely at baseline, using ELISA tests, independently from the physician's strategy for detecting a spirochetal infection. We recorded the proportion of patients with a final diagnosis of Lyme arthritis and evaluated the diagnostic performance of Lyme serology in this particular context. The clinical and biological characteristics of patients according to the Lyme serology results were analysed. Results Of 810 patients, 657 (81.1%) were negative for IgM and IgG antibodies, 91 (11.2%) had only IgM antibodies, 49 (6%) had only IgG antibodies, and 13 (1.6%) had IgG and IgM antibodies. Thus, 7.6% had IgG positivity, consistent with exposure to Borrelia infection. IgG positivity was significantly more prevalent in the North and North-East regions of France (χ2=14.6, pLyme arthritis. Conclusions This study does not support routine Lyme serological testing in patients with recent-onset inflammatory arthritis affecting more than 1 joint. PMID:26819751

21 CFR 866.3305 - Herpes simplex virus serological assays.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Herpes simplex virus serological assays. 866.3305... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3305 Herpes simplex virus serological assays. (a) Identification. Herpes simplex virus serological assays are devices...

Systematic screening for novel, serologically reactive Hepatitis E Virus epitopes

Directory of Open Access Journals (Sweden)

Osterman Andreas

2012-01-01

Full Text Available Abstract Background The National Institutes of Health classified Hepatitis E as an emerging disease since Hepatitis E Virus (HEV is the major cause of acute hepatitis in developing countries. Interestingly, an increasing number of sporadic cases of HEV infections are described in industrialized countries as zoonosis from domestic livestock. Despite the increasing relevance of this pathogen in clinical virology, commercial antibody assays are mainly based on fragments of HEV open reading frame (ORF 2 and ORF3. The largest ORF1 (poly-protein, however, is not part of current testing formats. Methods From a synthesized full length HEV genotype 1 cDNA-bank we constructed a complete HEV gene library consisting of 15 respective HEV ORF domains. After bacterial expression and purification of nine recombinant HEV proteins under denaturating conditions serum profiling experiments using 55 sera from patients with known infection status were performed in microarray format. SPSS software assessed the antigenic potential of these nine ORF domains in comparison to seven commercial HEV antigens (genotype 1 and 3 by performing receiver operator characteristics, logistic regression and correlation analysis. Results HEV antigens produced with our method for serum profiling experiments exhibit the same quality and characteristics as commercial antigens. Serum profiling experiments detected Y, V and X domains as ORF1-antigens with potentially comparable diagnostic significance as the well established epitopes of ORF2 and ORF3. However no obvious additional increase in sensitivity or specificity was achieved in diagnostic testing as revealed by bioinformatic analysis. Additionally we found that the C-terminal domain of the potential transmembrane protein ORF3 is responsible for IgG and IgM seroreactivity. Data suggest that there might be a genotype specific seroreactivity of homologous ORF2-antigens. Conclusions The diagnostic value of identified ORF1 epitopes might

Can serological methods help distinguish between prophylactic and alloimmune anti-D?

Science.gov (United States)

Irving, C; Crennan, M; Vanniasinkam, T

2017-10-01

Enzyme indirect antiglobulin test (EIAT) and polyethylene glycol IAT (PIAT) were evaluated for their potential use as tests to distinguish between prophylactic and alloimmune anti-D in plasma by comparing with a tube variation of the standard low ionic strength solution-IAT (LISS-IAT). Laboratories performing the screening of RhD-negative pregnant women are required to provide clinicians with guidance as to the source of detected RhD antibodies. Currently, this is derived from RhIg immunoprophylaxis history, agglutination scores and titration results, where performed. A serological test that can differentiate between prophylactic and alloimmune anti-D would be useful in the diagnosis of RhD alloimmunisation in pregnant women. Plasma samples (n = 273) [fresh (collected from April 2014 to February 2015) and frozen (up to 2 years)] from antenatal females, preoperative males and females over child-bearing age were used in this study. Samples were identified as containing anti-D by routine column agglutination (CAT) and were tested by tube LISS-IAT, EIAT and PIAT, and a score difference was calculated. A total of 32% of alloimmune anti-D samples demonstrated an increase in agglutination score (+2 or +3) when tested by EIAT. A significant increase in agglutination score for alloimmune samples using EIAT compared with LISS-IAT was observed. EIAT had a sensitivity (Sn) of 59%, positive predictive value (PPV) of 100% and specificity (Sp) of 100% for alloimmune anti-D. EIAT is capable of confirming but not excluding the presence of alloimmune anti-D in samples where anti-D is detected in routine antibody screening. © 2017 British Blood Transfusion Society.

Serologic activity of G immunoglobulin of irradiated rabbits

International Nuclear Information System (INIS)

Ivanov, A.A.; Nevinnaya, A.P.; Mozhajskij, A.M.; Snisar', N.A.

1977-01-01

Serologic immunochemical properties of immunoglobulins G (IgG) isolated from blood serum of normal rabbits and those given lethal and midlethal doses of radiation have been comparatively studied. A marked increase in the IgG level was detected in the recovery period of radiation sickness. The number of complement-binding antitissue antibodies in IgG grew in that period, and the anticomplementary activity and the catabolism rate of IgG increased in normal organism

Identification of HLA Class I Misreads/Dropouts Using Serological Typing, in Comparison with DNA-based Typing.

Science.gov (United States)

Tipu, Hamid Nawaz; Bashir, Muhammad Mukarram; Noman, Muhammad

2016-10-01

Serology and DNA techniques are employed for Human Leukocyte Antigen (HLA) typing in different transplant centers. Results may not always correlate well and may need retyping with different technique. All the patients (with aplastic anemia, thalassemia, and immunodeficiency) and their donors, requiring HLA typing for bone marrow transplant were enrolled in the study. Serological HLA typing was done by complement-dependent lymphocytotoxicity while DNA-based typing was done with sequence specific primers (SSP). Serology identified 167 HLA A and 165 HLA B antigens while SSP in same samples identified 181 HLA A and 184 HLA B alleles. A11 and B51 were the commonest antigens/alleles by both methods. There were a total of 21 misreads and 32 dropouts on serology, for both HLA A and B loci with HLA A32, B52 and B61 being the most ambiguous antigens. Inherent limitations of serological techniques warrant careful interpretation or use of DNA-based methods for resolution of ambiguous typing.

Optimization and evaluation of an influenza A (H5) pseudotyped lentiviral particle-based serological assay

NARCIS (Netherlands)

Garcia, Jean-Michel; Lagarde, Nadège; Ma, Edward S. K.; de Jong, Menno D.; Peiris, J. S. Malik

2010-01-01

BACKGROUND: Novel serological methods provide alternative options for sero-diagnosis, sero-epidemiology and for determining evidence of naturally acquired or vaccine induced immunity. Micro-neutralization tests are currently the gold standard for serological studies of highly pathogenic avian

Serological diagnosis of Taenia solium in pigs: No measurable circulating antigens and antibody response following exposure to Taenia saginata oncospheres.

Science.gov (United States)

Dorny, P; Dermauw, V; Van Hul, A; Trevisan, C; Gabriël, S

2017-10-15

Taenia solium taeniasis/cysticercosis is a zoonosis included in the WHO's list of neglected tropical diseases. Accurate diagnostic tools for humans and pigs are needed to monitor intervention outcomes. Currently used diagnostic tools for porcine cysticercosis all have drawbacks. Serological tests are mainly confronted with problems of specificity. More specifically, circulating antigen detecting tests cross-react with Taenia hydatigena and the possibility of transient antigens as a result of aborted infections is suspected. Furthermore, the hypothesis has been raised that hatched ingested eggs of other Taenia species may lead to a transient antibody response or to the presence of circulating antigen detectable by serological tests used for porcine cysticercosis. Here we describe the results of a study that consisted of oral administration of Taenia saginata eggs to five piglets followed by serological testing during five weeks and necropsy aiming at studying possible cross reactions in serological tests used for porcine cysticercosis. The infectivity of the eggs was verified by in vitro hatching and by experimental infection of a calf. One piglet developed acute respiratory disease and died on day 6 post infection. The remaining four piglets did not show any clinical signs until euthanasia. None of the serum samples from four piglets collected between days 0 and 35 post infection gave a positive reaction in the B158/B60 Ag-ELISA and in a commercial Western blot for antibody detection. In conclusion, this study showed that experimental exposure of four pigs to T. saginata eggs did not result in positive serologies for T. solium. These results may help interpreting serological results in monitoring of T. solium control programmes. Copyright © 2017 Elsevier B.V. All rights reserved.

Serological detection and molecular characterization of piroplasmids in equids in Brazil.

Science.gov (United States)

Vieira, Maria Isabel Botelho; Costa, Márcio Machado; de Oliveira, Mateus Tonial; Gonçalves, Luiz Ricardo; André, Marcos Rogério; Machado, Rosangela Zacarias

2018-03-01

Equine piroplasmosis is a disease caused by the hemoparasites Babesia caballi and Theileria equi and is considered to be the most important parasitic infection affecting Equidae. The objective of the present study was to carry out an epidemiological molecular and serological survey for the presence of these two protozoal organisms in equids from the northwestern region of the State of Rio Grande do Sul (RS), south Brazil. For this purpose, blood samples were collected from 90 equids in the city of Passo Fundo, RS, Brazil. Those were animals used for sport activities, outdoor recreational riding, and work including cattle herding and mounted patrol. Anti-T. equi and anti-B. caballi IgG antibodies were detected in the sera of those animals by commercial ELISA kits. The molecular diagnosis of equine piroplasmosis due to T. equi or B. caballi (or both) consisted in the amplification of the 18S rRNA gene by nested PCR followed by sequencing of the amplified PCR product and sequence comparison and phylogenetic analysis of the isolates; 17 (18.9%) and 5 (5.55%) out of the 90 serum samples tested in this study were positive for T. equi and B. caballi, respectively. Piroplasmid 18S rRNA gene fragments were detected by PCR in 24.4% (22/90) of the samples analysed and shared 99-100% identity with sequences of T. equi by BLASTn. Samples for the phylogenetic analysis were divided into 2 groups. In group A, there was close phylogenetic relationship between 4 sequences and sequences previously reported along the US-Mexico border, in South Africa, and in Brazil. There was a phylogenetic proximity between 5 samples from group B and samples tested by other authors in the US and Spain. Variation of the 18S rRNA gene allowed the identification of 9 new T. equi genotypes in the geographical region studied. Copyright © 2017 Elsevier B.V. All rights reserved.

Serological diagnosis of bovine brucellosis using B. melitensis strain B115.

Science.gov (United States)

Corrente, Marialaura; Desario, Costantina; Parisi, Antonio; Grandolfo, Erika; Scaltrito, Domenico; Vesco, Gesualdo; Colao, Valeriana; Buonavoglia, Domenico

2015-12-01

Bovine brucellosis is diagnosed by official tests, such as Rose Bengal plate test (RBPT) and Complement Fixation test (CFT). Both tests detect antibodies directed against the lipolysaccharide (LPS) of Brucella cell wall. Despite their good sensitivity, those tests do not discriminate between true positive and false positive serological reactions (FPSR), the latter being generated by animals infected with other Gram negative microorganisms that share components of Brucella LPS. In this study, an antigenic extract from whole Brucella melitensis B115 strain was used to set up an ELISA assay for the serological diagnosis of bovine brucellosis. A total of 148 serum samples from five different groups of animals were tested: Group A: 28 samples from two calves experimentally infected with Yersinia enterocolitica O:9; Group B: 30 samples from bovines infected with Brucella abortus; Group C: 50 samples from brucellosis-free herds; Group D: 20 samples RBPT positive and CFT negative; Group E: 20 samples both RBPT and CFT positive. Group D and Group E serum samples were from brucellosis-free herds. Positive reactions were detected only by RBPT and CFT in calves immunized with Y. enterocolitica O:9. Sera from Group B animals tested positive also in the ELISA assay, whereas sera from the remaining groups were all negative. The results obtained encourage the use of the ELISA assay to implement the serological diagnosis of brucellosis. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of IgM Capture Enzyme- Linked Immunosorbent Assay (ELISA) using Inhouse method and commercially available MRL kit for serological confirmation of dengue infection

International Nuclear Information System (INIS)

Hapugoda, D.M.; De Silva R, Nilanthi; Abeywickreme, W.; Gunasena, Sunethra; Prithimala, L.D.; Jayawardene, S.L.G.J.; Kumari, Thamara

2003-01-01

Laboratory diagnosis of dengue infection is important for the management of the patients. In this study igM capture ELISA using an inhouse method and commercially available kit (MRL diagnostics,USA) was compared to detect diagnostic capability of Inhouse IgM ELISA for provision of diagnostic facilities to the public at an affordable cost. Eighty acute and convalescent serum samples were collected from serologically confirmed dengue patients. Serological confirmation of patients were performed by Haemagglutination Inhibition (HI) assay, gold standard assay for dengue on paired serum samples. All collected acute and convalescent sera were tested by IgM ELISA using the inhouse method and MRL kit. Antigen and conjugate for the inhouse IgM method were prepared in the laboratory. A cocktail of four dengue antigens containing 25 Antigen ELISA units of each type was prepared and used as the assay antigen. Conjugate was prepared using a serum sample with high dengue Anti flavi IgG antibody titre conjugated with Horseradish peroxidase. A prospective study of both IgM ELISA assays were performed using 113 acute sera collected from dengue suspected cases. Overall results showed that 46% and 52% acute sera collected from dengue confirmed patients were positive by inhouse ELISA assay and MRL kits respectively. In the prospective study done using acute sera collected from dengue suspected patients showed that 44% and 52% were positive by inhouse ELISA assay and MRL kits. There was no significant difference in positivity between these two assays. (P=0.18). Inhouse IgM ELISA can be used for provision of laboratory diagnosis of dengue virus infection more than 5 days. The assay is 10 times less costly than using MRL kits as assay antigen and conjugate can be prepared easily in the laboratory

21 CFR 866.3120 - Chlamydia serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3120 Chlamydia... and antisera used in serological tests to identify antibodies to chlamydia in serum. Additionally...

21 CFR 866.3490 - Rhinovirus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3490 Rhinovirus... and antisera used in serological tests to identify antibodies to rhinovirus in serum. The...

Pre-screening of crude peptides in a serological bead-based suspension array

NARCIS (Netherlands)

Jelsma, Tinka; wal, van der Fimme J.; Fijten, Helmi; Dailly, Nicolas; Dijk, van Evert; Loeffen, Willie L.

2017-01-01

Most serological assays detect antibody responses in biological samples through affinity of serum antibodies for antigens provided in the assay. Certain antigens, however, may be difficult to produce and/or may contain unwanted epitopes. In these cases, a practical alternative may be the use of

Evaluation of a novel enzyme-linked immunosorbent assay for serological diagnosis of porcine proliferative enteropathy

DEFF Research Database (Denmark)

Boesen, Henriette Toft; Jensen, Tim Kåre; Møller, Kristian

2005-01-01

was a specific and sensitive method for detecting specific antibodies, and may be a good alternative to the existing serological tests for L intracellularis. It may be usable for diagnosis of proliferative enteropathy and for determination of a herd's epidemiologic status....... experimentally infected pigs and 62 serum samples from naturally infected pigs the sensitivity of the ELISA was calculated to 98.0%. The specificity of the test was 99.3%, calculated on the basis of 273 serum samples collected in six herds free of L. intracellularis after medicated eradication. The novel ELISA...

21 CFR 866.3470 - Reovirus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3470 Reovirus... and antisera used in serological tests to identify antibodies to reovirus in serum. The identification...

Application of reflectance spectroscopies (FTIR-ATR & FT-NIR) coupled with multivariate methods for robust in vivo detection of begomovirus infection in papaya leaves

Science.gov (United States)

Haq, Quazi M. I.; Mabood, Fazal; Naureen, Zakira; Al-Harrasi, Ahmed; Gilani, Sayed A.; Hussain, Javid; Jabeen, Farah; Khan, Ajmal; Al-Sabari, Ruqaya S. M.; Al-khanbashi, Fatema H. S.; Al-Fahdi, Amira A. M.; Al-Zaabi, Ahoud K. A.; Al-Shuraiqi, Fatma A. M.; Al-Bahaisi, Iman M.

2018-06-01

Nucleic acid & serology based methods have revolutionized plant disease detection, however, they are not very reliable at asymptomatic stage, especially in case of pathogen with systemic infection, in addition, they need at least 1-2 days for sample harvesting, processing, and analysis. In this study, two reflectance spectroscopies i.e. Near Infrared reflectance spectroscopy (NIR) and Fourier-Transform-Infrared spectroscopy with Attenuated Total Reflection (FT-IR, ATR) coupled with multivariate exploratory methods like Principle Component Analysis (PCA) and Partial least square discriminant analysis (PLS-DA) have been deployed to detect begomovirus infection in papaya leaves. The application of those techniques demonstrates that they are very useful for robust in vivo detection of plant begomovirus infection. These methods are simple, sensitive, reproducible, precise, and do not require any lengthy samples preparation procedures.

Serological tests in venereal syphilis

OpenAIRE

Notowicz, Alfred

1981-01-01

textabstractApart from identification of the causative microorganism, serological blood testing is still the principal aid in the diagnosis of venereal syphilis. In latent syphilis it is in fact the only diagnostic aid. In the diagnosis of late symptomatic syphilis, additional organ-specific diagnostic procedures are indispensable. Interpretation of the results of serological syphilis tests often poses problems in actual practice. Apart from possibly inadequate knowledge of the natural histor...

Development of a Sensitive and Specific Serological Assay Based on Luminex Technology for Detection of Antibodies to Zaire Ebola Virus.

Science.gov (United States)

Ayouba, Ahidjo; Touré, Abdoulaye; Butel, Christelle; Keita, Alpha Kabinet; Binetruy, Florian; Sow, Mamadou S; Foulongne, Vincent; Delaporte, Eric; Peeters, Martine

2017-01-01

The recent Zaire Ebola virus (EBOV) outbreak in West Africa illustrates clearly the need for additional studies with humans and animals to elucidate the ecology of Ebola viruses (EBVs). In this study, we developed a serological assay based on the Luminex technology. Nine recombinant proteins representing different viral regions (nucleoprotein [NP], 40-kDa viral protein [VP40], and glycoprotein [GP]) from four of the five EBV lineages were used. Samples from 94 survivors of the EBOV outbreak in Guinea and negative samples from 108 patients in France were used to calculate test performance for EBOV detection and cross-reaction with other Ebola virus lineages. For EBOV antibody detection, sensitivities of 95.7%, 96.8%, and 92.5% and specificities of 94.4%, 95.4%, and 96.3% for NP, GP, and VP40, respectively, were observed. All EBOV-negative samples that presented a reaction, except for one, interacted with a single antigen, whereas almost all samples from EBOV survivors were simultaneously reactive with NP and GP (90/94) or with NP, GP, and VP40 (87/94). Considering as positive for past EBOV infection only samples that reacted with EBOV NP and GP, sensitivity was 95.7% and specificity increased to 99.1%. Comparing results with commercial EBOV NP and GP enzyme-linked immunosorbent assays (ELISAs; Alpha Diagnostic, San Antonio, TX), lower sensitivity (92.5%) and high specificity (100%) were observed with the same positivity criteria. Samples from EBOV survivors cross-reacted with GP from Sudan Ebola virus (GP-SUDV) (81.9%), GP from Bundibugyo Ebola virus (GP-BDBV) (51.1%), GP from Reston Ebola virus (GP-RESTV) (9.6%), VP40-SUDV (76.6%), and VP40-BDBV (38.3%). Overall, we developed a sensitive and specific high-throughput serological assay, and defined an algorithm, for epidemiological surveys with humans. Copyright © 2016 American Society for Microbiology.

Microbiological and serological monitoring in hooded crow (Corvus corone cornix in the Region Lombardia, Italy

Directory of Open Access Journals (Sweden)

Guido Grilli

2010-01-01

Full Text Available The health status of 276 hooded crows (Corvus corone cornix from various provinces of Lombardy was monitored for three years. Bacteriological examination detected E. coli (76%, Campylobacter jejuni (17%, Salmonella typhimurium (11.6%, Yersinia spp. (6.5%, Clamydophila abortus and C. psittaci (2.6%; from six birds showing severe prostration Pasteurella multocida was isolated. Virological and serological tests were negative for Avian Influenza virus (AIV, West Nile virus (WNV and only three samples were positive for Newcastle disease virus (NDV but only at serology (titre 1:16.

Toxoplasmosis serology: an efficient hemagglutination procedure to detect IgG and IgM antibodies

Directory of Open Access Journals (Sweden)

M.E. Camargo

1989-08-01

Full Text Available In search of an efficient but simple, low cost procedure for the serodiagnosis of Toxoplasmosis, especially suited for routine laboratories facing technical and budget limitations as in less developed countries, the diagnostic capability of Hematoxo® , an hemagglutination test for toxoplasmosis, was evaluated in relation to a battery of tests including IgG- and IgM-immunofluorescence tests, hemagglutination and an IgM-capture enzymatic assay. Detecting a little as 5 I.U. of IgG antitoxoplasma antibodies, Hematoxo® showed a straight agreement as to reactivity and non-reactivity for the 443 non-reactive and the 387 reactive serum samples, included in this study. In 23 cases presenting a serological pattern of acute toxoplasmosis and showing IgM antibodies, Hematoxo® could detect IgM antibodies in 18, indicated by negativation or a significant decrease in titers as a result of treating samples with 2-mercapto-ethanol. However, a neat increase in sensitivity for IgM specific antibodies could be achieved by previously removing IgG from the sample, as demonstrated in a series of acute toxoplasmosis sera. A simple procedure was developed for this purpose, by reconstituting a lyophilized suspension of Protein A - rich Staphylococcus with the lowest serum dilution to be tested. Of low cost and easy to perform, Hematoxo® affords not only a practical qualitative procedure for screening reactors and non-reactors, as in prenatal services, but also quantitative assays that permit to titrate antibodies as well as to identify IgM antibodies.

VIRAL TESTING USING BIOLOGICAL AND SEROLOGICAL ASSAY FOR MOST IMPORTANT VIRUSES TO PLUM

Directory of Open Access Journals (Sweden)

Catita Plopa

2014-12-01

Full Text Available Establishing an accurate diagnosis in terms of viral for propagation of fruit tree is very important, it represents the most effective method of protection against viruses. Based on these considerations the primary objective of this study is to detect viruses with the highest incidence in plum by biological and ELISA serological methods, to a number of 85 samples taken from 17 varieties. Serologic testing on DAS-ELISA diagnosed 3 positive samples to Plum pox virus (PPV, 2 positives sample to Prunus necrotic ring spot virus (PNRSV and one positive sample to Prune dwarf virus (PDV. There were not positive samples to Apple chlorotic leaf spot virus (ACLSV. The tests conducted on woody indicator plants by grafting on protect conditions and after 3-24 months assured of diagnosis for PPV, PDV, PNRSV and ACLSV viruses. The biological indicators: ‘GF 305’, ‘Tuleu dulce’ and ‘Vânăt de Italia’, have shown symptoms for PNRSV for two samples.On biological indicator ‘Vânăt de Italia’ and ‘Tuleu dulce’ not appeared symptoms for ‘Centenar’variety tested for PPV, although the symptoms were obvious on ‘GF 305’ indicator, but viral infection was confirmed by ELISA test. Symptoms that indicate the presence of PDV occurred by ‘Vânăt de Italia’ biological indicator.

Factors affecting the serological testing of cadaveric donor cornea.

Science.gov (United States)

Raj, Anuradha; Mittal, Garima; Bahadur, Harsh

2018-01-01

The purpose of this study was to evaluate the serological profile of the eye donors and to study the influence of various factors on serological test results. A cross-sectional, observational study was conducted, and data of 509 donors were reviewed from the records of eye bank from December 2012 to June 2017. Various details of donors analyzed included the age, sex of the donor, cause of death, source of tissue, time since blood collection after death, macroscopic appearance of blood sample, and details of discarded tissues. Serological examination of blood was performed for human immunodeficiency virus (HIV), hepatitis B virus, hepatitis C virus (HCV), venereal disease research laboratory (VDRL), and serology reports reactive or nonreactive were analyzed. Among the 509 donors, 295 (58%) were male, and 420 (82.50%) belonged to age group ≥60 years. Most donors (354, 69.5%) died due to cardiac arrest. Macroscopically, sera were normal in the majority of 488 (95.9%) cases. Among 509 donors, 475 (93.3%) were nonreactive, 12 (2.4%) donors were found to be reactive to hepatitis B surface antigen (HBsAg), and 1 (0.2%) was reactive to HCV, but no donor serology was reactive to HIV or VDRL. Twenty-one (4.12%) donors' sera were not fit for serological testing. Among all donors, 475 (93.32%) donors were accepted and 34 (6.67%) were rejected or discarded on the basis of serological testing. Cause of death and macroscopic aspect of sera influenced the serological results in a highly significant manner (P = 0.00). Acceptance or rejection of the donor was significantly influenced by the serological results of the donor (P = 0.00). The seroprevalence among eye donor for HBsAg and HCV was 12 (2.4%) and 1 (0.2%), respectively. Factors such as cause of death and macroscopic aspect of sera influence the serological results. Time since blood collection or sampling will not show any impact on viral serological results if postmortem sampling will be done in donor cornea.

21 CFR 866.3520 - Rubeola (measles) virus serological reagents.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Rubeola (measles) virus serological reagents. 866... Rubeola (measles) virus serological reagents. (a) Identification. Rubeola (measles) virus serological... to rubeola virus in serum. The identification aids in the diagnosis of measles and provides...

Clinical Application Of Serological Tests For Syphilis

OpenAIRE

Lawee, David

1980-01-01

This article differentiates and describes the serological tests for syphilis— antitreponemal antibody tests (TPI, FTA-ABS, TPHA), non-treponemal antigen test (VDRL)—their clinical and serological correlation, the responses to therapy and the biologically false positive syndrome.

Using standard serology blood tests to diagnose latent syphilis

Directory of Open Access Journals (Sweden)

G. L. Katunin

2016-01-01

Full Text Available Goal. To conduct a comparative assessment of the results of regulated serological tests obtained as a result of blood tests in patients suffering from latent syphilis. Materials and methods. The authors examined 187 patient medical records with newly diagnosed latent syphilis in FGBU GNTsDK (State Research Center for Dermatology, Venereology and Cosmetology, Health Ministry of the Russian Federation, in 2006-2015. The results of patient blood tests were analyzed with the use of non-treponemal (microprecipitation test/RPR and treponemal (passive hemagglutination test, immune-enzyme assay (IgA, IgM, IgG, IFabs, immunofluorescence test and Treponema pallidum immobilization test serology tests. Results. According to the results of blood tests of latent syphilis patients, the largest number of positive results was obtained as a result of treponemal serology tests such as immune-enzyme assay (100%, passive hemagglutination test (100% and IFabs (100%. The greatest number of negative results was observed in non-treponemal (microprecipitation test/RPR serology tests: in 136 (72.7% patients; evidently positive results (4+ test results were obtained in 8 (4.3% patients only. According to the results of a comparative analysis of blood tests in patients suffering from latent syphilis obtained with the use of treponemal serology tests, the greatest number of evidently positive results (4+ was noted for the passive hemagglutination test (67.9%. Negative treponemal test results were obtained with the use of the immunofluorescence test and Treponema pallidum immobilization test (21.9% and 11.8% of cases, respectively. Moreover, weakly positive results prevailed for the immunofluorescence test: in 65 (34.7% patients. Conclusion. These data confirm that the following treponemal tests belong to the most reliable ones for revealing patients suffering from latent syphilis: immune-enzyme assay, passive hemagglutination test and IFabs.

Application of reflectance spectroscopies (FTIR-ATR & FT-NIR) coupled with multivariate methods for robust in vivo detection of begomovirus infection in papaya leaves.

Science.gov (United States)

Haq, Quazi M I; Mabood, Fazal; Naureen, Zakira; Al-Harrasi, Ahmed; Gilani, Sayed A; Hussain, Javid; Jabeen, Farah; Khan, Ajmal; Al-Sabari, Ruqaya S M; Al-Khanbashi, Fatema H S; Al-Fahdi, Amira A M; Al-Zaabi, Ahoud K A; Al-Shuraiqi, Fatma A M; Al-Bahaisi, Iman M

2018-06-05

Nucleic acid & serology based methods have revolutionized plant disease detection, however, they are not very reliable at asymptomatic stage, especially in case of pathogen with systemic infection, in addition, they need at least 1-2days for sample harvesting, processing, and analysis. In this study, two reflectance spectroscopies i.e. Near Infrared reflectance spectroscopy (NIR) and Fourier-Transform-Infrared spectroscopy with Attenuated Total Reflection (FT-IR, ATR) coupled with multivariate exploratory methods like Principle Component Analysis (PCA) and Partial least square discriminant analysis (PLS-DA) have been deployed to detect begomovirus infection in papaya leaves. The application of those techniques demonstrates that they are very useful for robust in vivo detection of plant begomovirus infection. These methods are simple, sensitive, reproducible, precise, and do not require any lengthy samples preparation procedures. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular and serological detection of tick-borne pathogens in dogs from an area endemic for Leishmania infantumin Mato Grosso do Sul, Brazil

Directory of Open Access Journals (Sweden)

Keyla Carstens Marques de Sousa

Full Text Available Tick-borne pathogens affect a wide range of vertebrate hosts. To identify tick-borne pathogens among dogs from Campo Grande, MS, Brazil testing seropositive for Leishmania infantum (syn. L. chagasi, a serological and molecular study was conducted to detectEhrlichia canis, Anaplasma platys and Babesia vogeli in 60 serum and spleen samples. A confirmatory diagnosis ofL. infantum based on serological and molecular assays was also performed, as was sequence alignment and phylogenetic analysis to assess the identity of the parasite species infecting these animals. IgG antibodies toEhrlichia spp., B. vogeli and L. infantum were found, respectively, in 39 (65%, 49 (81.6% and 60 (100% of the sampled dogs. Twenty-seven (45%, fifty-four (90%, fifty-three (88.3%, two (3.3% and one (1.6% dog were positive, respectively, forE. canis, Leishmania spp., Leishmania donovani complex, Babesia sp. and Anaplasma sp. in PCR assays. After sequencing, the amplicons showed 99% of identity with E. canis, B. vogeli, A. platys andLeishmania chagasi isolates. The findings of this study indicate that L. infantum-seropositive dogs from Campo Grande are exposed to multiple tick-borne pathogens, which should therefore be included in the differential diagnosis of dogs with clinical suspicion of leishmaniasis.

Serologic and molecular biomarkers for recurrence of hepatocellular carcinoma after liver transplantation

DEFF Research Database (Denmark)

Pommergaard, Hans-Christian; Burcharth, Jakob Hornstrup Frølunde; Rosenberg, Jacob

2016-01-01

INTRODUCTION: Recurrence after liver transplantation (LT) for hepatocellular carcinoma (HCC) is a major cause of mortality. Knowledge on biomarkers may contribute to better surveillance based on the patients' risk of recurrence. Reviewing the literature, we aimed to identify serological...... and molecular biomarkers for recurrence of hepatocellular carcinoma after liver transplantation. METHODS: A literature search was performed in the databases PubMed and Scopus to identify observational studies evaluating serological or molecular biomarkers for recurrence of HCC after LT using adjusted analysis...

A serological survey for brucellosis in reindeer in Finnmark county, northern Norway

Directory of Open Access Journals (Sweden)

Kjetil Åsbakk

1999-04-01

Full Text Available During September-December, 1990 to 1994, serum samples from a total of 5792 semi-domesticated reindeer (Rangifer tarandm tarandm from Finnmark county, northern Norway, were screened for brucellosis on an indirect ELISA. There were no serologically positive animals. Twenty six of the animals had levels of antibodies detectable on the ELISA and were classed as suspicious, but the ELISA optical density readings were low compared to the readings for reindeer that were both culture positive and seropositive for Brucella suis biovar 4. When assayed on the standard tube agglutination test (STAT, all the 26 animals were seronegative. When absorbed with cells of Yersinia enterocolitica 0-9, the antibody detectable on the ELISA could be removed to a great extent from most of the sera, indicating previous or ongoing exposure to bacteria serologically cross-reacting with Brucella in these animals. We concluded that brucellosis was not present among reindeer in Finnmark during this study. This is supported by the absence of any reports of brucellosis among reindeer in Norway.

COMPARATIVE STUDY ON SPECIFIC AND EARLY DETECTION ...

African Journals Online (AJOL)

The objective of this study was to compare the sensitivity and specificity of smear and culture methods with rapid serological EIA myco kits manufactured by Omega diagnostics, for the early detection of Mycobacterium tuberculosis (MTB) complex. Sera from various categories of smear and culture results were compared ...

21 CFR 866.3850 - Trichinella spiralis serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3850... devices that consist of antigens and antisera used in serological tests to identify antibodies to...

21 CFR 866.3680 - Sporothrix schenckii serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3680... devices that consist of antigens and antisera used in serological tests to identify antibodies to...

21 CFR 866.3400 - Parainfluenza virus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3400 Parainfluenza... that consist of antigens and antisera used in serological tests to identify antibodies to parainfluenza...

21 CFR 866.3040 - Aspergillus spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3040 Aspergillus... consist of antigens and antisera used in various serological tests to identify antibodies to Aspergillus...

21 CFR 866.3065 - Bordetella spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3065 Bordetella... serological tests to identify Bordetella spp. from cultured isolates or directly from clinical specimens. The...

Integrative literature review of the reported uses of serological tests in leprosy management.

Science.gov (United States)

Fabri, Angélica da Conceição Oliveira Coelho; Carvalho, Ana Paula Mendes; Vieira, Nayara Figueiredo; Bueno, Isabela de Caux; Rodrigues, Rayssa Nogueira; Monteiro, Thayenne Barrozo Mota; Correa-Oliveira, Rodrigo; Duthie, Malcolm S; Lana, Francisco Carlos Félix

2016-04-01

An integrative literature review was conducted to synthesize available publications regarding the potential use of serological tests in leprosy programs. We searched the databases Literatura Latino-Americana e do Caribe em Ciências da Saúde, Índice Bibliográfico Espanhol em Ciências da Saúde, Acervo da Biblioteca da Organização Pan-Americana da Saúde, Medical Literature Analysis and Retrieval System Online, Hanseníase, National Library of Medicine, Scopus, Ovid, Cinahl, and Web of Science for articles investigating the use of serological tests for antibodies against phenolic glycolipid-I (PGL-I), ML0405, ML2331, leprosy IDRI diagnostic-1 (LID-1), and natural disaccharide octyl-leprosy IDRI diagnostic-1 (NDO-LID). From an initial pool of 3.514 articles, 40 full-length articles fulfilled our inclusion criteria. Based on these papers, we concluded that these antibodies can be used to assist in diagnosing leprosy, detecting neuritis, monitoring therapeutic efficacy, and monitoring household contacts or at-risk populations in leprosy-endemic areas. Thus, available data suggest that serological tests could contribute substantially to leprosy management.

21 CFR 866.3870 - Trypanosoma spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3870 Trypanosoma... consist of antigens and antisera used in serological tests to identify antibodies to Trypanosoma spp. in...

21 CFR 866.3630 - Serratia spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3630 Serratia spp... antigens and antisera used in serological tests to identify Serratia spp. from cultured isolates. The...

21 CFR 866.3660 - Shigella spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3660 Shigella spp...), used in serological tests to identify Shigella spp. from cultured isolates. The identification aids in...

21 CFR 866.3330 - Influenza virus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3330 Influenza... consist of antigens and antisera used in serological tests to identify antibodies to influenza in serum...

21 CFR 866.3380 - Mumps virus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3380 Mumps virus... serological tests to identify mumps viruses from tissue culture isolates derived from clinical specimens. The...

Evaluation of serological tests for detecting tick-borne encephalitis virus (TBEV) antibodies in animals.

Science.gov (United States)

Klaus, Christine; Beer, Martin; Saier, Regine; Schubert, Harald; Bischoff, Sabine; Süss, Jochen

2011-01-01

Tick-borne encephalitis (TBE) in animals is not well understood yet. TBE virus (TBEV) serology in several host species could be valuable for epidemiological analyses in the field as well as for the detection of clinical cases. However, performance and suitability of the available test systems are not well assessed. Therefore, we evaluated two commercial TBEV-ELISA kits in a pilot study and compared them for their suitability in veterinary applications. For this purpose, we tested 163 field collected goat sera and evaluated the results by serum neutralization test (SNT) as "gold standard". Twenty-eight SNT positive sera (17.2%) were detected. The best suited ELISA kit was used for determination of a species-specific cutoff for horses, cattle, sheep, goats, pigs, mice, dogs, rabbits and monkeys with defined sera from animals without known or with improbable contact to TBEV. The level of non-specific ELISA results does not only differ between animal species but may also be influenced by the age of the tested animals. The number of sera which tested false positive by ELISA was higher in older than in young sheep. In order to obtain defined polyclonal sera as references, two dogs, cattle, goats, sheep, rabbits and pigs each, as well as one horse and 90 mice were immunized four times with a commercially available TBEV vaccine. In conclusion, our results demonstrated that commercial TBEV-ELISA kits are suitable for application in veterinary medicine for both, verification of clinical TBE cases and epidemiological screening. However, positive ELISA results should be verified by SNT. Only a very low number of false negative ELISA-results were found.

Evaluating enzootic bovine leukemia virus infection by means of molecular probe compared with the results of serological tests

International Nuclear Information System (INIS)

Reichert, M.; Grundbock, J.; Rulka, J.; Kozaczynska, B.; Stec, J.

1994-01-01

The present studies were aimed at determining the relation between the finding obtained by means of serological tests and the specific molecular probe. Serological tests were performed according to the methods recommended by the Polish Ministry of Agriculture; ELISA was run with ''Bioveta'' and ''Rhone Merieux'' kits and the AGID test was performed with EBL antigen made in our laboratory. The molecular probe was prepared from the previously cloned provirus DNA of EBL virus. The EBL provirus was detected in 28 samples taken from 44 randomly selected cows in three herds on which a leukemia eradication programme was in process. Three sera out of 28 positive reacting animals were negative in AGID test and only one serum in ELISA. The results indicate that the use of a specific molecular probe has some advantages in the diagnosis of latent virus infections. Besides, it can be applied in the studies on the pathogenesis of enzootic bovine leukemia. (author). 13 refs, 1 fig., 1 tab

42 CFR 493.1207 - Condition: Syphilis serology.

Science.gov (United States)

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Syphilis serology. 493.1207 Section 493.1207 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES....1207 Condition: Syphilis serology. If the laboratory provides services in the subspecialty of Syphilis...

Molecular and Serological Survey of Selected Viruses in Free-Ranging Wild Ruminants in Iran.

Directory of Open Access Journals (Sweden)

Farhid Hemmatzadeh

Full Text Available A molecular and serological survey of selected viruses in free-ranging wild ruminants was conducted in 13 different districts in Iran. Samples were collected from 64 small wild ruminants belonging to four different species including 25 Mouflon (Ovis orientalis, 22 wild goat (Capra aegagrus, nine Indian gazelle (Gazella bennettii and eight Goitered gazelle (Gazella subgutturosa during the national survey for wildlife diseases in Iran. Serum samples were evaluated using serologic antibody tests for Peste de petits ruminants virus (PPRV, Pestiviruses [Border Disease virus (BVD and Bovine Viral Diarrhoea virus (BVDV], Bluetongue virus (BTV, Bovine herpesvirus type 1 (BHV-1, and Parainfluenza type 3 (PI3. Sera were also ELISA tested for Pestivirus antigen. Tissue samples including spleen, liver, lung, tonsils, mesenteric and mediastinal lymph nodes and white blood cells (WBCs were tested using polymerase chain reaction (PCR for PPRV, Foot and Mouth Disease virus (FMDV, Pestivirus, BTV, Ovine herpesvirus type 2 (OvHV-2 and BHV-1. Serologic tests were positive for antibodies against PPRV (17%, Pestiviruses (2% and BTV (2%. No antibodies were detected for BHV-1 or PI3, and no Pestivirus antigen was detected. PCR results were positive for PPRV (7.8%, FMDV (11%, BTV (3%, OvHV-2 (31% and BHV-1 (1.5%. None of the samples were positive for Pestiviruses.

42 CFR 493.835 - Standard; Syphilis serology.

Science.gov (United States)

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Standard; Syphilis serology. 493.835 Section 493.835 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... These Tests § 493.835 Standard; Syphilis serology. (a) Failure to attain an overall testing event score...

Immunodiagnosis of Human Fascioliasis: An Update of Concepts and Performances of the Serological Assays

Science.gov (United States)

Khabisi, Samaneh Abdolahi

2017-01-01

Human Fascioliasis (HF) is a foodborne neglected parasitic disease caused by Fasciola hepatica and Fasciola gigantica. New epidemiological data suggest that the endemic areas of the disease are expanding and HF is being reported from areas where it was previously not observed. Diagnosis of HF is challenging. Performances of parasitological approaches, based on the detection of parasite’s egg in the stool, are not satisfactory. Currently serological methods for the diagnosis of HF are mainly based on detection of anti-Fasciola antibodies in serum. Although, there have been some improvement in the development of immunological diagnostic tests for the diagnosis of HF, yet these tests suffer from insufficiency in sensitivity or/and specificity. Detection of antigens, rather than antibodies, seems to be a suitable approach in the diagnosis of HF. Antigen can be detected in sera or stool of the fascioliasis patients. Circulating antigen in serum disappears within a short time and most of the circulating antigens are in immune complex forms which are not freely available to be detected. Therefore, antigenemia might not be an appropriate method for the diagnosis of HF. Detection of antigen in stool (coproantigens) seems to be a suitable alternative method for the diagnosis of HF. Recent data provided convincing evidence that detection of coproantigen improved and simplified the diagnosis of HF. The present review highlights the new achievements in designing and improvement of diagnostic approaches for the immunodiagnosis of HF. Moreover, current status of the available immunodiagnostic techniques for the diagnosis of HF, their strengths and weaknesses has been discussed. PMID:28764235

Anti-Trypanosoma cruzi antibody detection in eastern Andalusia (Spain).

Science.gov (United States)

Marín, Clotilde; Concha-Valdez, Fanny; Cañas, Rocío; Gutiérrez-Sánchez, Ramón; Sánchez-Moreno, Manuel

2014-03-01

Chagas disease caused by the protozoan haemoflagellate Trypanosoma cruzi is no longer found exclusively in Latin America; the disease is occurring in Europe, and Spain is the country with the highest prevalence. Our aim was to detect anti-T. cruzi antibodies in blood donors from southeast Spain, and we performed eight serological diagnostic assays on each of 550 blood samples collected in March-June 2010. Two in-house ELISA methods were used to test against a parasite lysate (ELISA-H) and the semi-purified superoxide dismutase excreted by T. cruzi (ELISA-SODe); we also used the Western blot technique against the same antigen (WB-SODe), indirect immunofluorescence (IFA) and four commercial tests. The serological test results showed a range of seroprevalence values, the lowest being 1.1%, determined by IFA and two commercial tests (Ab rapid and Chagascreen); other values were: 1.3% (commercial ELISA [Chagas ELISA IgG+IgM]); 2.1% (immunochromatographic test [Stick Chagas]); 2.7% (ELISA-H); 4.0% (WB-SODe); and 4.2%, the highest value (ELISA-SODe). The excellent specificity of SODe antigen for the detection of antibodies to T. cruzi in donors lead us to affirm that the serological test performed with this biomarker could provide a useful screening and confirmatory test method for cases of Chagas disease.

Correlation between serology and genetics of weak D types in Denmark

DEFF Research Database (Denmark)

Christiansen, Mette; Samuelsen, Betina; Christiansen, Lene

2008-01-01

BACKGROUND: To date more than 100 variant D types have been reported and the frequencies vary among populations. Blood donor typing should reveal all donors expressing D antigens, while patient typing should prevent the development of anti-D in patients with a D- or variant D blood type. Serotyping...... is the standard method to assign transfusion strategies, whereas molecular classification offers a more specific grouping of weak and partial D. STUDY DESIGN AND METHODS: Blood donor and patient samples with discrepant results of D phenotyping were collected to investigate the frequency of weak D subtypes...... in Denmark and to evaluate currently used serologic methods. RESULTS: Nine different weak D types were identified among the 101 samples. Weak D Types 1, 2, and 3 constituted 80 percent of the analyzed samples and 10 percent of the samples identified as weak D from serology were actually partial D. CONCLUSION...

Commercial serological antibody detection tests for the diagnosis of pulmonary tuberculosis: a systematic review.

Directory of Open Access Journals (Sweden)

Karen R Steingart

2007-06-01

Full Text Available BACKGROUND: The global tuberculosis epidemic results in nearly 2 million deaths and 9 million new cases of the disease a year. The vast majority of tuberculosis patients live in developing countries, where the diagnosis of tuberculosis relies on the identification of acid-fast bacilli on unprocessed sputum smears using conventional light microscopy. Microscopy has high specificity in tuberculosis-endemic countries, but modest sensitivity which varies among laboratories (range 20% to 80%. Moreover, the sensitivity is poor for paucibacillary disease (e.g., pediatric and HIV-associated tuberculosis. Thus, the development of rapid and accurate new diagnostic tools is imperative. Immune-based tests are potentially suitable for use in low-income countries as some test formats can be performed at the point of care without laboratory equipment. Currently, dozens of distinct commercial antibody detection tests are sold in developing countries. The question is "do they work?" METHODS AND FINDINGS: We conducted a systematic review to assess the accuracy of commercial antibody detection tests for the diagnosis of pulmonary tuberculosis. Studies from all countries using culture and/or microscopy smear for confirmation of pulmonary tuberculosis were eligible. Studies with fewer than 50 participants (25 patients and 25 control participants were excluded. In a comprehensive search, we identified 68 studies. The results demonstrate that (1 overall, commercial tests vary widely in performance; (2 sensitivity is higher in smear-positive than smear-negative samples; (3 in studies of smear-positive patients, Anda-TB IgG by enzyme-linked immunosorbent assay shows limited sensitivity (range 63% to 85% and inconsistent specificity (range 73% to 100%; (4 specificity is higher in healthy volunteers than in patients in whom tuberculosis disease is initially suspected and subsequently ruled out; and (5 there are insufficient data to determine the accuracy of most

Serological cross-reactivity of Trypanosoma cruzi, Ehrlichia canis, Toxoplasma gondii, Neospora caninum and Babesia canis to Leishmania infantum chagasi tests in dogs

Directory of Open Access Journals (Sweden)

Maurício Franco Zanette

2014-01-01

Full Text Available Introduction: The aim of this study was to evaluate the serological cross-reactivity between Leishmania sp. and other canine pathogens. Methods: Positive serum samples for Ehrlichia canis, Babesia canis, Toxoplasma gondii, Neospora caninum and Trypanosoma cruzi were tested using three serological methods enzyme linked immunosorbent assay (ELISA, indirect immunofluorescent antibody test (IFAT and Kalazar Detect™, for canine visceral leishmaniasis. Results: Of the 57 dog samples tested, 24 (42.1% tested positive using one of the three serological methods: 10/57 (17.5% for ELISA, 11/57 (19.3% for IFAT and 3/57 (5.3% for Kalazar Detect™. Conclusions: Our results demonstrated that the presence of other infectious agents may lead to cross-reactivity on leishmaniasis serological tests.

Quantitative serology assays for determination of antibody responses to Ebola virus glycoprotein and matrix protein in nonhuman primates and humans.

Science.gov (United States)

Vu, Hong; Shulenin, Sergey; Grolla, Allen; Audet, Jonathan; He, Shihua; Kobinger, Gary; Unfer, Robert C; Warfield, Kelly L; Aman, M Javad; Holtsberg, Frederick W

2016-02-01

The West Africa Ebola virus disease (EVD) outbreak has reached unprecedented magnitude and caused worldwide concerns for the spread of this deadly virus. Recent findings in nonhuman primates (NHPs) demonstrate that antibodies can be protective against EVD. However, the role of antibody response in vaccine-mediated protection is not fully understood. To address these questions quantitative serology assays are needed for measurement of the antibody response to key Ebola virus (EBOV) proteins. Serology enzyme-linked immunosorbent assays (ELISA's), using a reference detection antibody, were developed in order to standardize the quantitation of antibody levels in vaccinated NHPs or in humans exposed to EBOV or immunized with an EBOV vaccine. Critical reagents were generated to support the development of the serology ELISAs. Recombinant EBOV matrix protein (VP40) was expressed in Escherichia coli and purified. Two variants of the glycoprotein (GP), the ectodomain lacking the transmembrane domain (GPΔTM), and an engineered GP lacking the mucin-like domain (GPΔmuc) were expressed and purified from mammalian cell systems. Using these proteins, three ELISA methods were developed and optimized for reproducibility and robustness, including stability testing of critical reagents. The assay was used to determine the antibody response against VP40, GPΔTM, and GPΔmuc in a NHP vaccine study using EBOV virus-like particles (VLP) vaccine expressing GP, VP40 and the nucleoprotein. Additionally, these ELISAs were used to successfully detect antibody responses to VP40, GPΔTM and GPΔmuc in human sera from EBOV infected individuals. Copyright © 2015 Elsevier B.V. All rights reserved.

Fecal Gluten Peptides Reveal Limitations of Serological Tests and Food Questionnaires for Monitoring Gluten-Free Diet in Celiac Disease Patients

Science.gov (United States)

Comino, Isabel; Fernández-Bañares, Fernando; Esteve, María; Ortigosa, Luís; Castillejo, Gemma; Fambuena, Blanca; Ribes-Koninckx, Carmen; Sierra, Carlos; Rodríguez-Herrera, Alfonso; Salazar, José Carlos; Caunedo, Ángel; Marugán-Miguelsanz, J M; Garrote, José Antonio; Vivas, Santiago; lo Iacono, Oreste; Nuñez, Alejandro; Vaquero, Luis; Vegas, Ana María; Crespo, Laura; Fernández-Salazar, Luis; Arranz, Eduardo; Jiménez-García, Victoria Alejandra; Antonio Montes-Cano, Marco; Espín, Beatriz; Galera, Ana; Valverde, Justo; Girón, Francisco José; Bolonio, Miguel; Millán, Antonio; Cerezo, Francesc Martínez; Guajardo, César; Alberto, José Ramón; Rosinach, Mercé; Segura, Verónica; León, Francisco; Marinich, Jorge; Muñoz-Suano, Alba; Romero-Gómez, Manuel; Cebolla, Ángel; Sousa, Carolina

2016-01-01

Objectives: Treatment for celiac disease (CD) is a lifelong strict gluten-free diet (GFD). Patients should be followed-up with dietary interviews and serology as CD markers to ensure adherence to the diet. However, none of these methods offer an accurate measure of dietary compliance. Our aim was to evaluate the measurement of gluten immunogenic peptides (GIP) in stools as a marker of GFD adherence in CD patients and compare it with traditional methods of GFD monitoring. Methods: We performed a prospective, nonrandomized, multicenter study including 188 CD patients on GFD and 84 healthy controls. Subjects were given a dietary questionnaire and fecal GIP quantified by enzyme-linked immunosorbent assay (ELISA). Serological anti-tissue transglutaminase (anti-tTG) IgA and anti-deamidated gliadin peptide (anti-DGP) IgA antibodies were measured simultaneously. Results: Of the 188 celiac patients, 56 (29.8%) had detectable GIP levels in stools. There was significant association between age and GIP in stools that revealed increasing dietary transgressions with advancing age (39.2% in subjects ≥13 years old) and with gender in certain age groups (60% in men ≥13 years old). No association was found between fecal GIP and dietary questionnaire or anti-tTG antibodies. However, association was detected between GIP and anti-DGP antibodies, although 46 of the 53 GIP stool-positive patients were negative for anti-DGP. Conclusions: Detection of gluten peptides in stools reveals limitations of traditional methods for monitoring GFD in celiac patients. The GIP ELISA enables direct and quantitative assessment of gluten exposure early after ingestion and could aid in the diagnosis and clinical management of nonresponsive CD and refractory CD. Trial registration number NCT02711397. PMID:27644734

Serological monitoring of ornitobacteriosis in broilers in South Banat district

Directory of Open Access Journals (Sweden)

Gavrilović Pavle

2014-01-01

Full Text Available Ornithobacterium rhinotracheale is a relatively recently discovered bacterium and its role in the pathology of avian respiratory infections has not yet been clarified. Since there was no data relating to the prevalence of this infection in Serbia at the time of carrying out our investigations, we decided to explore the prevalence of the infection in broilers and its influence on clinical manifestations at the selected apizootiological area with developed poultry industry. A total of 430 blood samples from 26 flocks of broilers of different ages, from five municipalities were taken for examination. The serum samples were tested by ELISA for the presence of specific antibodies to the agent. Epizootiological investigation was carried out based on the results obtained with serological testing and epizootiological data, collected from the farms. The data were analyzed statistically to identify association between the infection and manifestation of clinical symptoms by Fisher’s exact test. Seropositive chickens were detected in 16 out of 26 examined broiler flocks at the age of 3 to 56 days. The percentage of seropositive samples per flock was 5-30%. The titer values of specific antibodies ranged from 946 to 6886. Serological response to O. rhinotracheale was evidenced in five flocks which had clinical symptoms in the form of respiratory tract disorders or stunting. However, specific antibodies against the agent were discovered in 11 flocks which did not show clinical symptoms. Statistical analysis revealed no association between the presence of infection and the appearance of clinical symptoms (p = 0.1213. The results are in agreement with those of other authors who investigated the prevalence of this infection and its manifestations in other countries. The present investigation determined indirectly, serologically a presence of O. rhinotracheale in the majority of examined broiler flocks (61,54% and a small average number of individual

Use of serological diagnostic techniques in the control and eradication of caprine arthritis encephalitis: an update

Directory of Open Access Journals (Sweden)

Jamili Maria Suhet Mussi

2015-12-01

Full Text Available Caprine arthritis encephalitis (CAE is a chronic disease caused by a small ruminant lentivirus (SRLV, which causes significant losses in goat breeding. The actual state of animal infection with SRLV is difficult to determine due to a complex pathogenesis of the virus, including factors such as delayed or intermittent seroconversion in serological tests. Several serological techniques are available for disease diagnosis, such as screening or confirmation tests, which are different in sensitivity and specificity. Regarding the choice of the test to be applied, availability of commercial immunoreagents, team training, antigen used, and cost of techniques must be considered. This review presents the serological methods available for use in different stages of CAE control and eradication programs, and management measures to be adopted in conjunction with serological diagnosis of the disease.

Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

NARCIS (Netherlands)

Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

1998-01-01

OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

Detection of colorectal neoplasia

DEFF Research Database (Denmark)

Wilhelmsen, Michael; Christensen, Ib J; Rasmussen, Louise

2017-01-01

Serological biomarkers may be an option for early detection of colorectal cancer (CRC). The present study assessed eight cancer-associated protein biomarkers in plasma from subjects undergoing first time ever colonoscopy due to symptoms attributable to colorectal neoplasia. Plasma AFP, CA19-9, CEA...... value was 18% and the negative predictive value was 97%. Combinations of serological protein biomarkers provided a significant identification of subjects with high risk of the presence of colorectal neoplasia. The present set of biomarkers could become important adjunct in early detection of CRC....

Integrative literature review of the reported uses of serological tests in leprosy management

Directory of Open Access Journals (Sweden)

Angélica da Conceição Oliveira Coelho Fabri

2016-04-01

Full Text Available Abstract: An integrative literature review was conducted to synthesize available publications regarding the potential use of serological tests in leprosy programs. We searched the databases Literatura Latino-Americana e do Caribe em Ciências da Saúde, Índice Bibliográfico Espanhol em Ciências da Saúde, Acervo da Biblioteca da Organização Pan-Americana da Saúde, Medical Literature Analysis and Retrieval System Online, Hanseníase, National Library of Medicine, Scopus, Ovid, Cinahl, and Web of Science for articles investigating the use of serological tests for antibodies against phenolic glycolipid-I (PGL-I, ML0405, ML2331, leprosy IDRI diagnostic-1 (LID-1, and natural disaccharide octyl-leprosy IDRI diagnostic-1 (NDO-LID. From an initial pool of 3.514 articles, 40 full-length articles fulfilled our inclusion criteria. Based on these papers, we concluded that these antibodies can be used to assist in diagnosing leprosy, detecting neuritis, monitoring therapeutic efficacy, and monitoring household contacts or at-risk populations in leprosy-endemic areas. Thus, available data suggest that serological tests could contribute substantially to leprosy management.

[Evaluation of modern epizootic activity of natural tularemia foci in Voronezh region using immune-serological and molecular-genetic study of main carriers of the disease].

Science.gov (United States)

Meshcheriakova, I S; Trankvilevskiĭ, D V; Kvasov, D A; Mikhaĭlova, T V; Kormilitsina, M I; Demidova, T N; Stepkin, Iu I; Zhukov, V I

2015-01-01

Improvement of monitoring and prognosis of epidemic manifestations of natural foci of tularemia on the territory of Voronezh region using immune-serological and molecular-genetic study of main carriers of the disease. 539 small mammals captured during summer period of 2011 in 4 districts of North-Eastern part of Voronezh region were studied. Animal organs were studied by serologic (search for Francisella tularensis antigens) and molecular-biologic (detection of F. tularensis DNA) methods. Tularemia antigen was detected using passive hemagglutination reaction (PHAR) with erythrocytic tularemia immunoglobulin diagnosticum. Real-time polymerase chain reaction (RT-PCR) was applied for detection of tularemia causative agent DNA. Complex study revealed epizootic activity of natural foci of tularemia in the examined territory. F. tularensis antigen and/or DNA were detected in 82 objects (15.2%). Use of RT-PCR allowed to additionally detect samples with relatively low content of F. tularensis DNA substrate, when antigen was not detected in samples. High sensitivity and specificity of the RT-PCR was ensured by inclusion of specific probes (tu14-PR2 and ISFTu2P). The results obtained give evidence on functioning and epizootic activity of natural foci of tularemia in Voronezh region that requires constant monitoring of the territory and prophylaxis measures, first of all vaccination of risk groups by live tularemia vaccine.

Validation of HAV biomarker 2A for differential diagnostic of hepatitis A infected and vaccinated individuals using multiplex serology.

Science.gov (United States)

Bohm, Katrin; Filomena, Angela; Schneiderhan-Marra, Nicole; Krause, Gérard; Sievers, Claudia

2017-10-13

Worldwide about 1.5 million clinical cases of hepatitis A virus (HAV) infections occur every year and increasingly countries are introducing HAV vaccination into the childhood immunization schedule with a single dose instead of the originally licenced two dose regimen. Diagnosis of acute HAV infection is determined serologically by anti-HAV-IgM detection using ELISA. Additionally anti-HAV-IgG can become positive during the early phase of symptoms, but remains detectable after infection and also after vaccination against HAV. Currently no serological marker allows the differentiation of HAV vaccinated individuals and those with a past infection with HAV. Such differentiation would greatly improve evaluation of vaccination campaigns and risk assessment of HAV outbreaks. Here we tested the HAV non-structural protein 2A, important for the capsid assembly, as a biomarker for the differentiation of the immune status in previously infected and vaccinated individuals. HAV antigens were recombinantly expressed as glutathione-S-transferase (GST) fusion proteins. Using glutathione tagged, magnetic fluorescent beads (Luminex®), the proteins were affinity purified and used in a multiplex serological assay. The multiplex HAV assay was validated using 381 reference sera in which the immune status HAV negative, vaccinated or infected was established using the Abbott ARCHITECT® HAVAb-IgM or IgG, the commercial HAV ELISA from Abnova and documentation in vaccination cards. HAV multiplex serology showed a sensitivity of 99% and specificity of 95% to detect anti-HAV IgG/IgM positive individuals. HAV biomarker 2A allowed the differentiation between previously infected and vaccinated individuals. HAV vaccinated individuals and previously infected individuals could be identified with 92% accuracy. HAV biomarker 2A can be used to differentiate between previously HAV-vaccinated and naturally infected individuals. Within a multiplex serological approach this assay can provide valuable

Prevalence of Bartonella spp. by culture, PCR and serology, in veterinary personnel from Spain

Directory of Open Access Journals (Sweden)

José A. Oteo

2017-11-01

Full Text Available Abstract Background The genus Bartonella includes fastidious, facultative intracellular bacteria mainly transmitted by arthropods and distributed among mammalian reservoirs. Bartonella spp. implicated as etiological agents of zoonoses are increasing. Apart from the classical Bartonella henselae, B. bacilliformis or B. quintana, other species (B. elizabethae, B. rochalimae, B. vinsonii arupensis and B. v. berkhoffii, B. tamiae or B. koehlerae, among others have also been associated with human and/or animal diseases. Laboratory techniques for diagnosis (culture, PCR assays and serology usually show lack of sensitivity. Since 2005, a method based on a liquid enrichment Bartonella alphaproteobacteria growth medium (BAPGM followed by PCRs for the amplification of Bartonella spp. has been developed. We aimed to assess culture, molecular and serological prevalence of Bartonella infections in companion animal veterinary personnel from Spain. Methods Each of 89 participants completed a questionnaire. Immunofluorescence assays (IFA using B. vinsonii berkhoffii (genotypes I, II and III, B. henselae, B. quintana and B. koehlerae as antigens were performed. A cut-off of 1:64 was selected as a seroreactivity titer. Blood samples were inoculated into BAPGM and subcultured onto blood agar plates. Bartonella spp. was detected using conventional and quantitative real-time PCR assays and DNA sequencing. Results Among antigens corresponding to six Bartonella spp. or genotypes, the lowest seroreactivity was found against B. quintana (11.2% and the highest, against B. v. berkhoffii genotype III (56%. A total of 27% of 89 individuals were not seroreactive to any test antigen. Bartonella spp. IFA seroreactivity was not associated with any clinical sign or symptom. DNA from Bartonella spp., including B. henselae (n = 2, B. v. berkhoffii genotypes I (n = 1 and III (n = 2, and B. quintana (n = 2 was detected in 7/89 veterinary personnel. PCR and DNA sequencing

Serology and anthrax in humans, livestock and Etosha National Park wildlife.

Science.gov (United States)

Turnbull, P C; Doganay, M; Lindeque, P M; Aygen, B; McLaughlin, J

1992-04-01

Results are presented from a number of epidemiological studies using enzyme immunoassays (EIA) based on the purified anthrax toxin antigens, protective antigen, lethal factor and oedema factor. Studies on sera from a group of 62 human anthrax patients in Turkey and from cattle in Britain following two unrelated outbreaks of anthrax show that EIA using protective antigen can be a useful diagnostic aid and will detect subclinical infections in appropriate circumstances. A serological survey on wildlife in the Etosha National Park, Namibia, where anthrax is endemic, showed that naturally acquired anthrax-specific antibodies are rare in herbivores but common in carnivores; in carnivores, titres appear to reflect the prevalence of anthrax in their ranges. Problems, as yet unresolved, were encountered in studies on sera from pigs following an outbreak of anthrax on a farm in Wales. Clinical details, including treatment, of the human and one of the bovine outbreaks are summarized and discussed in relation to the serological findings.

Multiplex detection of plant pathogens through the luminex magplex bead system

NARCIS (Netherlands)

Vlugt, van der R.A.A.; Raaij, van H.M.G.; Weerdt, de M.; Bergervoet, J.H.W.

2015-01-01

Here we describe a versatile multiplex method for both the serological and molecular detection of plant pathogens. The Luminex MagPlex bead system uses small paramagnetic microspheres (“beads”), either coated with specific antibodies or oligonucleotides, which capture respectively viruses and/or

21 CFR 866.3235 - Epstein-Barr virus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3235 Epstein-Barr... consist of antigens and antisera used in serological tests to identify antibodies to Epstein-Barr virus in...

CORRELATION OF ULTRASOUND (USG FINDINGS WITH SEROLOGICAL TESTS IN DENGUE FEVER

Directory of Open Access Journals (Sweden)

Dayanand

2016-02-01

Full Text Available INTRODUCTION Dengue is an endemic and epidemic disease of the tropical and subtropical regions. Between September & October 2012, there was an established outbreak of dengue in Hoskote, near Bangalore. Dengue results in serositis, which can be imaged by ultrasonography. OBJECTIVE To correlate the USG findings with the serological tests in paediatric and adult patients. MATERIALS AND METHODS 110 patients with clinical suspicion of dengue fever during the above period underwent serological tests-NS1, IgM and IgG and were evaluated with USG of the abdomen and thorax. The USG findings were correlated with serological tests. RESULTS 67 Patients were seropositive, 43 were seronegative. The USG findings in seropositive paediatric patients (n=32 and adult patients (n=35 respectively were gall bladder (GB wall edema-27 & 31, hepatomegaly-12 &14, ascites-16 & 12, splenomegaly- 15 & 9, right pleural effusion-14 & 13, left and bilateral pleural effusion-7 & 5. CONCLUSION In our study GB wall edema significantly correlated with seropositivity (p value=0.032. Thus ultrasound is an efficient screening tool in a case of dengue outbreak.

Serology for human papillomavirus Serología para el virus del papiloma humano

Directory of Open Access Journals (Sweden)

Pierre Coursaget

2003-01-01

Full Text Available Difficulties with serology for papillomavirus are associated with the large number of human papillomavirus, cross-reactions between papillomavirus, and to the diversity of lesions and target sites for infection. In addition, the expression of the papillomavirus in the superficial layers of the epithelium gives rise to the weak presentation to immunocompetent cells of viral antigens, which in turn gives rise to a weak serological response. Distinct efforts have been made in previous decades to develop more specific and sensitive serological assays. These former studies use fusion proteins and synthetic peptides, although they remain on the whole uninteresting, due to their lack of sensitivity and specificity. Only in the last few years, and principally due to the advent of various virus-like particles (VLP, have more sensitive and specific assays become available.Las limitaciones para la utilización de la serología para el estudio del virus del papiloma humano con fines clínicos están asociadas con la gran variedad de subtipos humanos, con las reacciones cruzadas que existen entre diversos genotipos, la diversidad de lesiones precursoras de cáncer y con los sitios blancos de infección. Asimismo, la expresión del virus del papiloma humano en las capas superficiales del epitelio dan origen a una débil presentación de células inmunocompetentes de antígenos virales, lo cual origina una elevación de la respuesta serológica. Distintos esfuerzos se han realizado en décadas previas para desarrollar ensayos serológicos más específicos y sensibles. En muchas investigaciones se ha utilizado una fusión de proteínas y péptidos sintéticos que tienen como principal limitación su escasa sensibilidad y especificidad. Sólo en los últimos años, y principalmente debido al arribo de partículas parecidas a este virus, tenemos disponibles ensayos más sensibles y específicos, ampliamente descritos en este artículo.

Meat juice serology for Toxoplasma gondii infection in chickens

Directory of Open Access Journals (Sweden)

Alice Vismarra

2016-01-01

Full Text Available Toxoplasma gondii is an important foodborne zoonosis. Free-range chickens are at particularly high risk of infection and are also excellent indicators of soil contamination by oocysts. In the present study, hearts of 77 freerange chickens were collected at slaughter. T. gondii meat juice enzyme-linked immunosorbent assay was performed with a commercial kit, following validation with positive controls, from experimentally infected chickens, and negative ones. Out of 77 samples, only 66 gave sufficient meat juice for serology. Of these, 24 (36.4% were positive for T. gondii considering the 5*standard deviation values (calculated on the optical density of negative controls, while all the samples were negative considering sample/positive% values. Parasite-specific polymerase chain reaction was carried out on all samples obtained from heart tissue and none were positive for the presence of T. gondii DNA. Results would suggest that further study on the use of meat juice with a validated serological test to detect T. gondii in chickens could lead to widespread epidemiological studies in this important intermediate host. However, sample collection and test specificity require further evaluation.

Serological and molecular evidence of hepadnavirus infection in swine

Directory of Open Access Journals (Sweden)

Yasmine R Vieira

2015-02-01

Full Text Available [b]Introduction and objective[/b]. Recently, investigations in a swine herd identified evidence of the existence of a novel member of the Hepadnavirus family endemic in swine. The aim of this study was to investigate the serological and molecular markers of Hepadnavirus circulation in Brazilian domestic swine and wild boar herds, and to evaluate the identity with HBV and other Hepadnaviruses reported previously. [b]Materials and methods[/b]. For the study, 376 swine were screened for hepatitis B virus serological markers. Analyses were performed in serum samples using commercial enzyme-linked immunosorbent assay (ELISA kits (DiaSorin® for anti-HBc, HBsAg and anti-HBs. Reactive and undetermined swine serum samples were selected to perform DNA viral extraction (QIAamp DNA Mini Kit, Qiagen®, partial genome amplification and genome sequencing. [b]Results[/b]. From 376 swine samples analysed, 28 (7.45% were reactive to anti-HBc, 3 (0.80% to HBsAg and 6 (1.6% to anti-HBs. Besides, more 17 (4.52% swine samples analyzed were classified in the grey zone of the EIA test to anti-HBc and 2 (0.53% to HBsAg. From 49 samples molecularly analyzed after serological trial, 4 samples showed a positive result for the qualitative PCR for Hepadnavirus. Phylogenetic reconstruction using partial genome sequencing (360 bp of 3 samples showed similarity with HBV with 90.8–96.3% of identity. [b]Conclusions.[/b] Serological and molecular data showed evidence of the circulation of a virus similar to hepatitis B virus in swine.

Serological testing versus other strategies for diagnosis of active tuberculosis in India: a cost-effectiveness analysis.

Directory of Open Access Journals (Sweden)

David W Dowdy

2011-08-01

Full Text Available Undiagnosed and misdiagnosed tuberculosis (TB drives the epidemic in India. Serological (antibody detection TB tests are not recommended by any agency, but widely used in many countries, including the Indian private sector. The cost and impact of using serology compared with other diagnostic techniques is unknown.Taking a patient cohort conservatively equal to the annual number of serological tests done in India (1.5 million adults suspected of having active TB, we used decision analysis to estimate costs and effectiveness of sputum smear microscopy (US$3.62 for two smears, microscopy plus automated liquid culture (mycobacterium growth indicator tube [MGIT], US$20/test, and serological testing (anda-tb ELISA, US$20/test. Data on test accuracy and costs were obtained from published literature. We adopted the perspective of the Indian TB control sector and an analysis frame of 1 year. Our primary outcome was the incremental cost per disability-adjusted life year (DALY averted. We performed one-way sensitivity analysis on all model parameters, with multiway sensitivity analysis on variables to which the model was most sensitive. If used instead of sputum microscopy, serology generated an estimated 14,000 more TB diagnoses, but also 121,000 more false-positive diagnoses, 102,000 fewer DALYs averted, and 32,000 more secondary TB cases than microscopy, at approximately four times the incremental cost (US$47.5 million versus US$11.9 million. When added to high-quality sputum smears, MGIT culture was estimated to avert 130,000 incremental DALYs at an incremental cost of US$213 per DALY averted. Serology was dominated by (i.e., more costly and less effective than MGIT culture and remained less economically favorable than sputum smear or TB culture in one-way and multiway sensitivity analyses.In India, sputum smear microscopy remains the most cost-effective diagnostic test available for active TB; efforts to increase access to quality-assured microscopy

Serological response and diagnostic value of recombinant candida cell wall protein enolase, phosphoglycerate kinase and β- glucosidase

Directory of Open Access Journals (Sweden)

Zhengxin eHe

2015-09-01

Full Text Available There are no specific signs and symtoms for invasive candidiasis (IC, which makes its diagnosis a challenge. Efforts have been made for decades to establish serological assays for rapid diagnosis of invasive candidiasis, but none of them have found widespread clinical use. Using a systemic candiasis murine model, serological response to recombinant proteins of enolase (rEno1, phosphoglycerate kinase (rPgk1 and β-glucosidase (rBgl2 were evaluated and rEno1 was found to possess the strongest immunoreactivity, followed by rPgk1 and rBgl2. Likewise, IgG antibody titers to rEno1, rPgk1 and rBgl2 in the positive sera of proven IC patients were determined by ELISA. Results show anti-rEno1 antibody possesses the highest titer, followed by rPgk1 and rBgl2. Antibodies against rEno1, rPgk1 and rBgl2 were detected by ELISA tests in a group of 52 proven IC patients or 50 healthy subjects, The sensitivity, specificity, positive and negative predictive values were 88.5%, 90.0%, 90.2%, and 88.2% for anti-rEno1 detection, 86.5%, 92.0%, 91.8% and 86.8% for anti-rPgk1 detection, and 80.8%, 90.0%, 89.4% and 81.8% for anti-rBgl2 detection, respectively. The data clearly demonstrate that the recombinant proteins of Eno1, Pgk1 and Bgl2 are promising candidates for IC serodiagnosis. There’s great possibility that the recombinant Eno1 will be more applicable in serodiagnosis and vaccine research on account of its strong serological response.

Diagnosis of Lyme-associated uveitis: value of serological testing in a tertiary centre.

Science.gov (United States)

Bernard, Alexia; Kodjikian, Laurent; Abukhashabh, Amro; Roure-Sobas, Chantal; Boibieux, Andre; Denis, Philippe; Broussolle, Christiane; Seve, Pascal

2018-03-01

To determine the frequency and clinical presentation of Lyme disease in patients with uveitis and to assess the value of Borrelia burgdorferi serological testing. Retrospective study on all patients with uveitis who were referred to our tertiary hospital were serologically tested for Lyme in our laboratory between 2003 and 2016. Screening consisted of determining B. burgdorferi serum IgG and IgM by ELISA method. The patient's serology was considered as positive if the ELISA-positive result in IgM and/or IgG was confirmed by an immunoblot positive in IgM and/or IgG. Lyme-associated uveitis was diagnosed based on serological results as well as response to antibiotics and exclusion of other diagnosis. Of the 430 patients with uveitis (60% women, mean age 49 years) fulfilling inclusion criteria, 63 (14.7%) had an ELISA-positive serology, confirmed by immunoblot for 34 patients (7.9%). The diagnosis of Lyme-associated uveitis was finally retained in seven patients (1.6%). These patients reported either a previous exposure including tick bite or forest walks (n=5), symptoms suggestive of Lyme disease (n=5) and resistance to local and/or systemic steroids (n=7). Among the remaining 27 positive patients, 22 had other established aetiologies and 5 other were unclassified. The seroprevalence of B. burgdorferi among our patients with uveitis was 7.9% compared with 6 to 8.5% in the general French population which leads to a low predictive value of serological testing. Its use should be reserved for patients with unexplained uveitis, an exposure history, systemic findings suggestive of Lyme disease and steroids resistance. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Internal quality control in serological tests for syphilis.

OpenAIRE

Wasley, G D

1985-01-01

The importance of syphilis serological tests demands that laboratory reports are reliable. Internal quality control applied to the organisation of a syphilis serology service improves laboratory bench performance and reporting. Described here are internal quality control procedures of a department that serves a genitourinary medicine clinic and conducts 70 000 tests a year to investigate for syphilis.

Serological follow-up of infants born to mothers with positive syphilis serology - real-world experiences.

Science.gov (United States)

Wallace, Harriet E; Broomhall, Harriet M; Isitt, Catherine E; Miall, Lawrence S; Wilson, Janet D

2016-11-01

The 2008 UK syphilis guideline recommends infants born to women with any positive syphilis serology be followed up until both treponemal and nontreponemal tests are negative to exclude congenital syphilis, whereas Centers for Disease Control and Prevention guidelines recommend using only nontreponemal tests. Historically, we had low infant follow-up rates with no coherent pathways. We initiated a change in multidisciplinary team practice of infant testing for syphilis in 2011 and evaluated the results before and after by retrospective review of testing of infants born to women with positive syphilis serology between 2005 and 2012. A total of 28 infants' mothers were treated in pregnancy (termed 'high risk'); 26 had adequate treatment prior to pregnancy (termed 'low risk'). There was a significant increase in serological testing after 2011 compared with before (83% versus 48%; OR 5.07 [95% CI 1.22-22.77] p = 0.01) but mainly in low risk infants with no significant improvement in high risk infants who are the priority group. Using nontreponemal tests only in the infants would have reduced the tests required by at least 50%, allowing health resources to be concentrated on achieving adequate follow-up for those infants most at risk. © The Author(s) 2015.

Isolation and serological identification of enteropathogenic Escherichia coli in pasteurized milk in Brazil

Directory of Open Access Journals (Sweden)

Zoraide N da Silva

2001-08-01

Full Text Available OBJECTIVE: To evaluate the microbiological quality of pasteurized milk commercialized in Rio de Janeiro, Brazil, and determine serologically enteropathogenic Escherichia coli (EPEC strains in E. coli isolates obtained from milk samples. METHODS: Ninety samples of pasteurized milk -- types B and C -- of three different commercial brands, purchased in supermarkets and bakeries in Rio de Janeiro, were examined. The amount of total and fecal coliform bacteria was estimated using the Most Probable Number technique. Mesophilic, psychrotrophic, and thermoduric microorganism counts were determined by the Standard Plate Count technique. Isolation and identification of E. coli were carried out using conventional physiological tests. Commercial antisera were used for serological characterization of EPEC. RESULTS: The three milk brands analyzed revealed bacterial counts above the regulated values of the Brazilian government. It was found that among 208 strains of E. coli isolated, 46 (22.1% were serologically classified as EPEC. The most common EPEC serogroup was O55 (15.2%. CONCLUSIONS: Though recent studies on virulence factors indicate that not all strains serologically classified as EPEC are able to attaching/effacing lesion, it is believed that the isolation of EPEC serogroups from pasteurized milk represent a potential risk for children, as well as an indicative of the presence of other enteropathogens.

Weighing serological evidence of human exposure to animal influenza viruses - a literature review.

Science.gov (United States)

Sikkema, Reina Saapke; Freidl, Gudrun Stephanie; de Bruin, Erwin; Koopmans, Marion

2016-11-03

Assessing influenza A virus strains circulating in animals and their potential to cross the species barrier and cause human infections is important to improve human influenza surveillance and preparedness. We reviewed studies describing serological evidence of human exposure to animal influenza viruses. Comparing serological data is difficult due to a lack of standardisation in study designs and in laboratory methods used in published reports. Therefore, we designed a scoring system to assess and weigh specificity of obtained serology results in the selected articles. Many studies report reliable evidence of antibodies to swine influenza viruses among persons occupationally exposed to pigs. Most avian influenza studies target H5, H7 and H9 subtypes and most serological evidence of human exposure to avian influenza viruses is reported for these subtypes. Avian influenza studies receiving a low grade in this review often reported higher seroprevalences in humans compared with studies with a high grade. Official surveillance systems mainly focus on avian H5 and H7 viruses. Swine influenza viruses and avian subtypes other than H5 and H7 (emphasising H9) should be additionally included in official surveillance systems. Surveillance efforts should also be directed towards understudied geographical areas, such as Africa and South America. This article is copyright of The Authors, 2016.

A Review of Methods for Detection of Hepatozoon Infection in Carnivores and Arthropod Vectors.

Science.gov (United States)

Modrý, David; Beck, Relja; Hrazdilová, Kristýna; Baneth, Gad

2017-01-01

Vector-borne protists of the genus Hepatozoon belong to the apicomplexan suborder Adeleorina. The taxonomy of Hepatozoon is unsettled and different phylogenetic clades probably represent evolutionary units deserving the status of separate genera. Throughout our review, we focus on the monophyletic assemblage of Hepatozoon spp. from carnivores, classified as Hepatozoon sensu stricto that includes important pathogens of domestic and free-ranging canine and feline hosts. We provide an overview of diagnostic methods and approaches from classical detection in biological materials, through serological tests to nucleic acid amplification tests (NAATs). Critical review of used primers for the 18S rDNA is provided, together with information on individual primer pairs. Extension of used NAATs target to cover also mitochondrial genes is suggested as a key step in understanding the diversity and molecular epidemiology of Hepatozoon infections in mammals.

Virological and serological analysis of a recent Middle East respiratory syndrome coronavirus infection case on a triple combination antiviral regimen.

Science.gov (United States)

Spanakis, Nikolaos; Tsiodras, Sotirios; Haagmans, Bart L; Raj, V Stalin; Pontikis, Kostantinos; Koutsoukou, Antonia; Koulouris, Nikolaos G; Osterhaus, Albert D M E; Koopmans, Marion P G; Tsakris, Athanassios

2014-12-01

Serological, molecular and phylogenetic analyses of a recently imported case of Middle East respiratory syndrome coronavirus (MERS-CoV) in Greece are reported. Although MERS-CoV remained detectable in the respiratory tract secretions of the patient until the fourth week of illness, viraemia was last detected 2 days after initiation of triple combination therapy with pegylated interferon, ribavirin and lopinavir/ritonavir, administered from Day 13 of illness. Phylogenetic analysis of the virus showed close similarity with other human MERS-CoVs from the recent Jeddah outbreak in Saudi Arabia. Immunoglobulin G (IgG) titres peaked 3 weeks after the onset of illness, whilst IgM levels remained constantly elevated during the follow-up period (second to fifth week of illness). Serological testing confirmed by virus neutralisation assay detected an additional case that was a close contact of the patient. Copyright © 2014. Published by Elsevier B.V.

[Membrane-filtration immunoassay: reagents, methods and the diagnostic and technical means for detection].

Science.gov (United States)

Khramov, E N; Osin, N S; Pomelova, V G; Vikha, I V; Bychenkova, T A; Smirnova, V G; Grakina, G I; Kas'ianova, T A

1999-01-01

The comprehensive development of dot-EIA made at the State Research Institute of Biological Instrument-Making Industry has provided devices KIMF-02 and KIMF-03), a base of chemical reagents, immunoassays, test systems for detection of a wide range of causative agents of viral and bacterial infections, that of serodiagnosis of their related diseases. The KIMF-02 kit has undergone engineering and medical tests and recommended for the Ministry of Health of the Russian Federation to produce them in stock. The kit includes all required for analysis even in an ill-equipped laboratory, a set of attached agents ensures a valid visual recording of results. The developed procedures and test systems allow the immunoassay to be as sensitive as TIFA; however, they are laborious and much simpler in design. The simple and rapid procedures of dot-EIA are recommended for incorporation into the a package of laboratory methods for verification of the accumulation of virus-specific antigens in various biological substrata, environmental samples, for control of the activity of antigens and antibodies used in serological tests, for detection of specific antigens in the clinical samples, and for serodiagnosis of infections.

Serologic survey in animals of 'Q' fever in Nuevo Leon.

Science.gov (United States)

Salinas-Melédez, J A; Avalos-Ramírez, R; Riojas-Valdez, V; Kawas-Garza, J; Fimbres-Durazo, H; Hernández-Vidal, G

2002-01-01

The serological prevalence of Q fever in Mexico is unknown. A serological survey for Coxiella burnetii was undertaken on a randomly selected population of dairy cattle, beef cattle, goats and sheep flocks. Serological examination of animal sera for antibodies against Coxiella burnetii was carried out by the ELISA technique. The 28% of the dairy cattle and 10% of beef cattle examinated were antibody positive. Sera from goats and sheep also had antibodies against this rickettsia, 35% and 40% respectively.

First TBEV serological screening in Flemish wild boar

Directory of Open Access Journals (Sweden)

Sophie Roelandt

2016-04-01

Full Text Available In the frame of a Flemish wildlife surveillance in 2013, a serological screening was performed on sera from wild boar (Sus scrofa; n=238 in order to detect tick-borne encephalitis virus (TBEV-specific antibodies. Neutralising antibodies were titrated with a seroneutralisation test (SNT, using two cut-off titres (1/10–1/15. Seven wild boars were found TBEV-seropositive and showed moderate (>1/15 to high (>1/125 SNT-titres; three individuals had borderline results (1/10–1/15. This study demonstrated the presence of TBEV-specific antibodies in wild boar and highlighted potential TBEV-foci in Flanders. Additional surveillance including direct virus testing is now recommended.

Barriers impeding serologic screening for celiac disease in clinically high-prevalence populations

OpenAIRE

Barbero, Erika M; McNally, Shawna L; Donohue, Michael C; Kagnoff, Martin F

2014-01-01

Background Celiac disease is present in ~1% of the general population in the United States and Europe. Despite the availability of inexpensive serologic screening tests, ~85% of individuals with celiac disease remain undiagnosed and there is an average delay in diagnosis of symptomatic individuals with celiac disease that ranges from ~5.8-11 years. This delay is often attributed to the use of a case-based approach for detection rather than general population screening for celiac disease, and ...

Serological evidence of Hobi-like virus circulation in Argentinean water buffaloes

Science.gov (United States)

Objectives: The aim of this work was to determine the serological levels of BVDV-1, BVDV-2 and Hobi-like Virus in non-vaccinated water buffaloes from three northeast provinces of Argentina, in order to have an update of the circulation of pestiviruses in that region. Materials and methods: Mediter...

Symptoms and signs in individuals with serology positive for celiac disease but normal mucosa

Directory of Open Access Journals (Sweden)

Brandt Lena

2009-07-01

Full Text Available Abstract Background Antibody serology is an important tool in the investigation of celiac disease (CD, but does not always correlate with mucosal appearance in the small intestine. Patients with positive CD serology but normal mucosa (Marsh 0 are at increased risk of future CD. In this study we describe a model for identifying and characterizing individuals with normal mucosa but positive CD serology. Such individuals are sometimes referred to as having latent CD. Methods The records of ten Swedish pathology departments were used to identify individuals with biopsies indicating normal duodenal/jejunal mucosa. Using the national personal identification number, these data were linked with CD serology data (antigliadin, antiendomysial and tissue transglutaminase antibodies; and we thereby identified 3,736 individuals with normal mucosa but positive CD serology. Two independent reviewers then manually reviewed their biopsy reports to estimate comorbidity. We also randomly selected 112 individuals for validation through patient chart review. Results The majority of the 3,736 individuals were females (62%. Children (0–15 years made up 21.4%. The median number of biopsy specimen was 3. Our review of biopsy reports found that other gastrointestinal comorbidity was rare (inflammatory bowel disease: 0.4%; helicobacter pylori infection: 0.2%. Some 22% individuals selected for patient chart review had a relative with CD. The most common symptoms among these individuals were diarrhea (46% and abdominal pain (45%, while 26% had anemia. Although 27% of the individuals selected for validation had been informed about gluten-free diet, only 13% were adhering to a gluten-free diet at the end of follow-up. Conclusion Individuals with positive CD serology but normal mucosa often have CD-like symptoms and a family history of CD.

[Serological detection of Brucella suis, influenza virus and Aujeszky's disease virus in backyard and small swine holders in Argentina].

Science.gov (United States)

Dibarbora, Marina; Cappuccio, Javier A; Aznar, María N; Bessone, Fernando A; Piscitelli, Hernán; Pereda, Ariel J; Pérez, Daniel R

Farmers raising less than 100 sows represent more than 99% of swine producers in Argentina, although little is known about their sanitary status and productive characteristics in the country. Sanitary and productive information was obtained. Furthermore, samples for serological studies were taken to detect antibodies against Brucella suis (Bs), Aujeszky's disease virus (AV) and influenza virus (IV) in 68 backyard and small producers with less than 100 sows located in the north, central and south regions of Argentina. Antibodies against H1 pandemic were detected in 80% of the farms while 11%, 11.7% and 6.0% of the producers were positive to influenza H3 cluster 2, AV and Bs, respectively. None of the producers was aware of the risk factors concerning the transmission of diseases from pigs to humans. A percentage of 47% of them buy pigs for breeding from other farmers and markets. With regard to biosecurity measures, only 16% of the farms had perimeter fences. The results of this study demonstrate that productive characterization and disease surveys are important to improve productivity and to reduce the risk of disease transmission among animals and humans. The study of sanitary status and risk factors is necessary for better control and eradication of diseases in backyard or small producers. More representative studies at country level should be carried out to detect the pathogensthat circulate and, with this knowledge, to implement prevention and control measures. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Long-Term Serological Follow-Up of Acute Q-Fever Patients after a Large Epidemic.

Directory of Open Access Journals (Sweden)

Cornelia C H Wielders

Full Text Available Serological follow-up of acute Q-fever patients is important for detection of chronic infection but there is no consensus on its frequency and duration. The 2007-2009 Q-fever epidemic in the Netherlands allowed for long-term follow-up of a large cohort of acute Q-fever patients. The aim of this study was to validate the current follow-up strategy targeted to identify patients with chronic Q-fever.A cohort of adult acute Q-fever patients, diagnosed between 2007 and 2009, for whom a twelve-month follow-up sample was available, was invited to complete a questionnaire and provide a blood sample, four years after the acute episode. Antibody profiles, determined by immunofluorescence assay in serum, were investigated with a special focus on high titres of IgG antibodies against phase I of Coxiella burnetii, as these are considered indicative for possible chronic Q-fever.Of the invited 1,907 patients fulfilling inclusion criteria, 1,289 (67.6% were included in the analysis. At any time during the four-year follow-up period, 58 (4.5% patients were classified as possible, probable, or proven chronic Q-fever according to the Dutch Q-fever Consensus Group criteria (which uses IgG phase I ≥1:1,024 to as serologic criterion for chronic Q-fever. Fifty-two (89.7% of these were identified within the first year after the acute episode. Of the six patients that were detected for the first time at four-year follow-up, five had an IgG phase I titre of 1:512 at twelve months.A twelve-month follow-up check after acute Q-fever is recommended as it adequately detects chronic Q-fever in patients without known risk factors. Additional serological and clinical follow-up is recommended for patients with IgG phase I ≥1:512, as they showed the highest risk to progress to chronic Q-fever.

Weighing serological evidence of human exposure to animal influenza viruses − a literature review

Science.gov (United States)

Sikkema, Reina Saapke; Freidl, Gudrun Stephanie; de Bruin, Erwin; Koopmans, Marion

2016-01-01

Assessing influenza A virus strains circulating in animals and their potential to cross the species barrier and cause human infections is important to improve human influenza surveillance and preparedness. We reviewed studies describing serological evidence of human exposure to animal influenza viruses. Comparing serological data is difficult due to a lack of standardisation in study designs and in laboratory methods used in published reports. Therefore, we designed a scoring system to assess and weigh specificity of obtained serology results in the selected articles. Many studies report reliable evidence of antibodies to swine influenza viruses among persons occupationally exposed to pigs. Most avian influenza studies target H5, H7 and H9 subtypes and most serological evidence of human exposure to avian influenza viruses is reported for these subtypes. Avian influenza studies receiving a low grade in this review often reported higher seroprevalences in humans compared with studies with a high grade. Official surveillance systems mainly focus on avian H5 and H7 viruses. Swine influenza viruses and avian subtypes other than H5 and H7 (emphasising H9) should be additionally included in official surveillance systems. Surveillance efforts should also be directed towards understudied geographical areas, such as Africa and South America. PMID:27874827

Effect of 25-Hydroxyvitamin D Status on Serological Response to Influenza Vaccine in Prostate Cancer Patients

Science.gov (United States)

Chadha, Manpreet K.; Fakih, Marwan; Muindi, Josephia; Tian, Lili; Mashtare, Terry; Johnson, Candace S.; Trump, Donald

2015-01-01

BACKGROUND Epidemiologic data suggest that there is an association between vitamin D deficiency and influenza infection. We conducted a prospective influenza vaccination study to determine the influence of vitamin D status on serological response to influenza vaccine in prostate cancer (CaP) patients. METHODS During the 2006–2007 influenza season, CaP patients treated at Roswell Park Cancer Institute were offered vaccination with the trivalent influenza vaccine (Fluzone®, 2006–2007) and sera collected for hemagglutination inhibition (HI) assay titers before and 3 months after vaccination. Response to vaccination was defined as ≥1:40 titer ratio or a fourfold increase in titer at 3 months, against any of the three strains. Serum 25-hydroxyvitamin D (25-D3) levels were measured using DiaSorin 125I radioimmunoassay kits. RESULTS Thirty-five patients with CaP participated in the study. Median baseline 25-D3 level was 44.88 ng/ml (range: 9.16–71.98 ng/ml) Serological response against any of the three strains was noted in 80%. There was a significant effect of baseline 25-D3 level when tested as a continuous variable in relation to serological response (P = 0.0446). All patients in the upper quartile of 25-D3 level responded by mounting a serological response (P = 0.0344). None of the other baseline variables (age, race, chemotherapy status, or white cell count) had an effect on serological response. CONCLUSIONS In this study in CaP patients, a replete vitamin D status was associated with more frequent serological response to influenza vaccine. PMID:20812224

Relevance of and New Developments in Serology for Toxoplasmosis.

Science.gov (United States)

Dard, Céline; Fricker-Hidalgo, Hélène; Brenier-Pinchart, Marie-Pierre; Pelloux, Hervé

2016-06-01

Toxoplasmosis is a widespread parasitic disease caused by the intracellular parasite Toxoplasma gondii with a wide spectrum of clinical outcomes. The biological diagnosis of toxoplasmosis is often difficult and of paramount importance because clinical features are not sufficient to discriminate between toxoplasmosis and other illnesses. Serological tests are the most widely used biological tools for the diagnosis of toxoplasmosis worldwide. This review focuses on the crucial role of serology in providing answers to the most important questions related to the epidemiology and diagnosis of toxoplasmosis in human pathology. Notwithstanding their undeniable importance, serological tools need to be continuously improved and the interpretation of the ensuing results remains complex in many circumstances. Copyright © 2016 Elsevier Ltd. All rights reserved.

Authentication of food allergen quality by physicochemical and immunological methods

DEFF Research Database (Denmark)

Sancho, A I; Hoffmann-Sommergruber, K; Alessandri, S

2010-01-01

Purified allergens are required to detect cross-contamination with other allergenic foods and to understand allergen interaction with other components of the food matrix. Pure allergens are also used for the diagnosis and treatment of food allergies. For example, serological methods are being dev...

Commercial serological tests for the diagnosis of active pulmonary and extrapulmonary tuberculosis: an updated systematic review and meta-analysis.

Directory of Open Access Journals (Sweden)

Karen R Steingart

2011-08-01

Full Text Available BACKGROUND: Serological (antibody detection tests for tuberculosis (TB are widely used in developing countries. As part of a World Health Organization policy process, we performed an updated systematic review to assess the diagnostic accuracy of commercial serological tests for pulmonary and extrapulmonary TB with a focus on the relevance of these tests in low- and middle-income countries. METHODS AND FINDINGS: We used methods recommended by the Cochrane Collaboration and GRADE approach for rating quality of evidence. In a previous review, we searched multiple databases for papers published from 1 January 1990 to 30 May 2006, and in this update, we add additional papers published from that period until 29 June 2010. We prespecified subgroups to address heterogeneity and summarized test performance using bivariate random effects meta-analysis. For pulmonary TB, we included 67 studies (48% from low- and middle-income countries with 5,147 participants. For all tests, estimates were variable for sensitivity (0% to 100% and specificity (31% to 100%. For anda-TB IgG, the only test with enough studies for meta-analysis, pooled sensitivity was 76% (95% CI 63%-87% in smear-positive (seven studies and 59% (95% CI 10%-96% in smear-negative (four studies patients; pooled specificities were 92% (95% CI 74%-98% and 91% (95% CI 79%-96%, respectively. Compared with ELISA (pooled sensitivity 60% [95% CI 6%-65%]; pooled specificity 98% [95% CI 96%-99%], immunochromatographic tests yielded lower pooled sensitivity (53%, 95% CI 42%-64% and comparable pooled specificity (98%, 95% CI 94%-99%. For extrapulmonary TB, we included 25 studies (40% from low- and middle-income countries with 1,809 participants. For all tests, estimates were variable for sensitivity (0% to 100% and specificity (59% to 100%. Overall, quality of evidence was graded very low for studies of pulmonary and extrapulmonary TB. CONCLUSIONS: Despite expansion of the literature since 2006, commercial

Commercial Serological Tests for the Diagnosis of Active Pulmonary and Extrapulmonary Tuberculosis: An Updated Systematic Review and Meta-Analysis

Science.gov (United States)

Steingart, Karen R.; Flores, Laura L.; Dendukuri, Nandini; Schiller, Ian; Laal, Suman; Ramsay, Andrew; Hopewell, Philip C.; Pai, Madhukar

2011-01-01

Background Serological (antibody detection) tests for tuberculosis (TB) are widely used in developing countries. As part of a World Health Organization policy process, we performed an updated systematic review to assess the diagnostic accuracy of commercial serological tests for pulmonary and extrapulmonary TB with a focus on the relevance of these tests in low- and middle-income countries. Methods and Findings We used methods recommended by the Cochrane Collaboration and GRADE approach for rating quality of evidence. In a previous review, we searched multiple databases for papers published from 1 January 1990 to 30 May 2006, and in this update, we add additional papers published from that period until 29 June 2010. We prespecified subgroups to address heterogeneity and summarized test performance using bivariate random effects meta-analysis. For pulmonary TB, we included 67 studies (48% from low- and middle-income countries) with 5,147 participants. For all tests, estimates were variable for sensitivity (0% to 100%) and specificity (31% to 100%). For anda-TB IgG, the only test with enough studies for meta-analysis, pooled sensitivity was 76% (95% CI 63%–87%) in smear-positive (seven studies) and 59% (95% CI 10%–96%) in smear-negative (four studies) patients; pooled specificities were 92% (95% CI 74%–98%) and 91% (95% CI 79%–96%), respectively. Compared with ELISA (pooled sensitivity 60% [95% CI 6%–65%]; pooled specificity 98% [95% CI 96%–99%]), immunochromatographic tests yielded lower pooled sensitivity (53%, 95% CI 42%–64%) and comparable pooled specificity (98%, 95% CI 94%–99%). For extrapulmonary TB, we included 25 studies (40% from low- and middle-income countries) with 1,809 participants. For all tests, estimates were variable for sensitivity (0% to 100%) and specificity (59% to 100%). Overall, quality of evidence was graded very low for studies of pulmonary and extrapulmonary TB. Conclusions Despite expansion of the literature since 2006

Serological and molecular tools to diagnose visceral leishmaniasis: 2-years' experience of a single center in Northern Italy.

Directory of Open Access Journals (Sweden)

Stefania Varani

Full Text Available The diagnosis of visceral leishmaniasis (VL remains challenging, due to the limited sensitivity of microscopy, the poor performance of serological methods in immunocompromised patients and the lack of standardization of molecular tests. The aim of this study was to implement a combined diagnostic workflow by integrating serological and molecular tests with standardized clinical criteria. Between July 2013 and June 2015, the proposed workflow was applied to specimens obtained from 94 in-patients with clinical suspicion of VL in the Emilia-Romagna region, Northern Italy. Serological tests and molecular techniques were employed. Twenty-one adult patients (22% had a confirmed diagnosis of VL by clinical criteria, serology and/or real-time polymerase chain reaction; 4 of these patients were HIV-positive. Molecular tests exhibited higher sensitivity than serological tests for the diagnosis of VL. In our experience, the rK39 immunochromatographic test was insufficiently sensitive for use as a screening test for the diagnosis of VL caused by L. infantum in Italy. However, as molecular tests are yet not standardized, further studies are required to identify an optimal screening test for Mediterranean VL.

Serological and molecular tools to diagnose visceral leishmaniasis: 2-years’ experience of a single center in Northern Italy

Science.gov (United States)

Ortalli, Margherita; Attard, Luciano; Vanino, Elisa; Gaibani, Paolo; Vocale, Caterina; Rossini, Giada; Cagarelli, Roberto; Pierro, Anna; Billi, Patrizia; Mastroianni, Antonio; Di Cesare, Simona; Codeluppi, Mauro; Franceschini, Erica; Melchionda, Fraia; Gramiccia, Marina; Scalone, Aldo; Gentilomi, Giovanna A.; Landini, Maria P.

2017-01-01

The diagnosis of visceral leishmaniasis (VL) remains challenging, due to the limited sensitivity of microscopy, the poor performance of serological methods in immunocompromised patients and the lack of standardization of molecular tests. The aim of this study was to implement a combined diagnostic workflow by integrating serological and molecular tests with standardized clinical criteria. Between July 2013 and June 2015, the proposed workflow was applied to specimens obtained from 94 in-patients with clinical suspicion of VL in the Emilia-Romagna region, Northern Italy. Serological tests and molecular techniques were employed. Twenty-one adult patients (22%) had a confirmed diagnosis of VL by clinical criteria, serology and/or real-time polymerase chain reaction; 4 of these patients were HIV-positive. Molecular tests exhibited higher sensitivity than serological tests for the diagnosis of VL. In our experience, the rK39 immunochromatographic test was insufficiently sensitive for use as a screening test for the diagnosis of VL caused by L. infantum in Italy. However, as molecular tests are yet not standardized, further studies are required to identify an optimal screening test for Mediterranean VL. PMID:28832646

Socioepidemiological screening of serologically ineligible blood donors due to Chagas disease for the definition of inconclusive cases

Directory of Open Access Journals (Sweden)

Márcia M Ferreira-Silva

2010-09-01

Full Text Available Epidemiological screening combined with serological tests has become an important tool at blood banks for the characterization of donors with or without Trypanosoma cruzi infection. Thus, the objective of the present study was to describe the sociodemographic and epidemiological characteristics of blood donors with non-negative serology for T. cruzito determine possible risk factors associated with serological ineligibility. Sociodemographic and epidemiological data were collected by analysis of patient histories and interviews. The data were analyzed descriptively using absolute and relative frequencies and odds ratio (OR evaluation. The frequency of serological ineligibility was 0.28%, with a predominance of inconclusive reactions (52% and seropositivity among first-time donors (OR = 607, donors older than 30 years (OR = 3.7, females (OR = 1.9, donors from risk areas (OR = 4 and subjects living in rural areas (OR = 1.7. The risk of seropositivity was higher among donors who had contact with the triatomine vector (OR = 11.7 and those with a family history of Chagas disease (OR = 4.8. The results demonstrate the value of detailed clinical-epidemiological screening as an auxiliary tool for serological definition that, together with more specific and more sensitive laboratory methods, will guarantee a higher efficacy in the selection of donors at blood centres.

Serological and molecular detection of spotted fever group Rickettsia in a group of pet dogs from Luanda, Angola.

Science.gov (United States)

Barradas, Patrícia F; Vilhena, Hugo; Oliveira, Ana Cristina; Granada, Sara; Amorim, Irina; Ferreira, Paula; Cardoso, Luís; Gärtner, Fátima; de Sousa, Rita

2017-05-31

Infections with tick-borne rickettsiae can cause diseases well known in humans but still not so well characterized in dogs. Susceptibility to infection depends on the virulence of Rickettsia spp. and only a few of them have been described to cause disease in dogs. The aim of this study was to investigate the exposure to Rickettsia spp. among a group of pet dogs from Luanda, Angola. Out of 103 dogs included in the study, 62 (60.2%) were infested with ticks. Plasma specimens tested for serology by an immunofluorescence assay (IFA) revealed that six (5.8%) dogs had detectable immunoglobulin G (IgG) antibodies to spotted fever group Rickettsia (SFGR), with endpoint titers of 64 for two dogs, 128 for three dogs and 1024 for one dog. From the seropositive group of dogs, five (83%) of them were males, with their age ranging from 1 to 8 years old. Among the seropositive dogs, four (66.7%) were parasitized with ticks and no breed (or cross) was found to be associated with specific antibodies. Rickettsia spp. DNA was detected by nested-polymerase chain reaction (PCR) in two (1.9%) dogs that were found to be seronegative. Seroprevalence and molecular detection of Rickettsia spp. infection in this group of pet dogs from Luanda is low compared with other studies performed in the same type of hosts in other areas. Although many dogs were parasitized with ticks, a low prevalence of Rickettsia spp. could be related with the hypothesis of a low rickettsial prevalence in the infesting ticks. This study provides evidence that dogs in Luanda are exposed to Rickettsia spp., but further studies are needed to better characterize the bacterial infections in dogs and in their ectoparasites.

The diagnostic accuracy of serological tests for Lyme borreliosis in Europe

DEFF Research Database (Denmark)

Leeflang, M M G; Ang, C W; Berkhout, J

2016-01-01

-eight studies evaluating an Enzyme-Linked ImmunoSorbent assay (ELISA) or an immunoblot assay against a reference standard of clinical criteria were included. None of the studies had low risk of bias for all QUADAS-2 domains. Sensitivity was highly heterogeneous, with summary estimates: erythema migrans 50 % (95......BACKGROUND: Interpretation of serological assays in Lyme borreliosis requires an understanding of the clinical indications and the limitations of the currently available tests. We therefore systematically reviewed the accuracy of serological tests for the diagnosis of Lyme borreliosis in Europe....... We used a hierarchical summary ROC meta-regression method for the meta-analyses. Potential sources of heterogeneity were test-type, commercial or in-house, Ig-type, antigen type and study quality. These were added as covariates to the model, to assess their effect on test accuracy. RESULTS: Seventy...

Evolution of hepatitis B serological markers in HIV coinfected patients: a case study

Directory of Open Access Journals (Sweden)

Ana Luiza de Castro Conde Toscano

Full Text Available ABSTRACT OBJECTIVE To describe the evolution of serological markers among HIV and hepatitis B coinfected patients, with emphasis on evaluating the reactivation or seroreversion of these markers. METHODS The study population consisted of patients met in an AIDS Outpatient Clinic in São Paulo State, Brazil. We included in the analysis all HIV-infected and who underwent at least two positive hepatitis B surface antigen serological testing during clinical follow up, with tests taken six months apart. Patients were tested with commercial kits available for hepatitis B serological markers by microparticle enzyme immunoassay. Clinical variables were collected: age, sex, CD4+ T-cell count, HIV viral load, alanine aminotransferase level, exposure to antiretroviral drugs including lamivudine and/or tenofovir. RESULTS Among 2,242 HIV positive patients, we identified 105 (4.7% patients with chronic hepatitis B. Follow up time for these patients varied from six months to 20.5 years. All patients underwent antiretroviral therapy during follow-up. Among patients with chronic hepatitis B, 58% were hepatitis B “e” antigen positive at the first assessment. Clearance of hepatitis B surface antigen occurred in 15% (16/105 of patients with chronic hepatitis B, and 50% (8/16 of these patients presented subsequent reactivation or seroreversion of hepatitis B surface antigen. Among hepatitis B “e” antigen positive patients, 57% (35/61 presented clearance of this serologic marker. During clinical follow up, 28.5% (10/35 of those who initially cleared hepatitis B “e” antigen presented seroreversion or reactivation of this marker. CONCLUSIONS Among HIV coinfected patients under antiretroviral therapy, changes of HBV serological markers were frequently observed. These results suggest that frequent monitoring of these serum markers should be recommended.

Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method

Directory of Open Access Journals (Sweden)

H Ansari

2010-02-01

Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.

Development and Validation of a Genotype 3 Recombinant Protein based Immunoassay for Hepatitis E Virus Serology in Swine

NARCIS (Netherlands)

Poel, van der W.H.M.; Pavio, N.; Goot, van der J.; Es, van M.; Martin, M.; Engel, B.

2014-01-01

Hepatitis E virus (HEV) is classified within the family Hepeviridae, genus Hepevirus. HEV genotype 3 (Gt3) infections are endemic in pigs in Western Europe and in North and South America and cause zoonotic infections in humans. Several serological assays to detect HEV antibodies in pigs have been

Serological tests in venereal syphilis

NARCIS (Netherlands)

A. Notowicz (Alfred)

1981-01-01

textabstractApart from identification of the causative microorganism, serological blood testing is still the principal aid in the diagnosis of venereal syphilis. In latent syphilis it is in fact the only diagnostic aid. In the diagnosis of late symptomatic syphilis, additional organ-specific

Screening for celiac disease in a North American population: sequential serology and gastrointestinal symptoms.

Science.gov (United States)

Katz, Kent D; Rashtak, Shahrooz; Lahr, Brian D; Melton, L Joseph; Krause, Patricia K; Maggi, Kristine; Talley, Nicholas J; Murray, Joseph A

2011-07-01

The prevalence of diagnosed celiac disease is celiac disease and the utility of screening in the general adult population of a geographically isolated area. Serum tissue transglutaminase antibodies (tTG-IgA) were measured in volunteer health-care participants aged ≥ 18 years at the annual Casper, Wyoming, Blue Envelope Health Fair blood draw. Subjects with positive tTG-IgA tests had their endomysial IgA antibodies checked. Double positives were offered endoscopy with small bowel biopsy. All subjects completed a short gastrointestinal (GI) symptom questionnaire. A total of 3,850 residents of the Natrona County had serologic evaluation for celiac disease, 34 of whom tested positive for both tTG and endomysial antibody (EMA) IgA. Excluding three individuals with previous diagnosis of celiac disease, the overall prevalence of positive celiac serology in this community sample was 0.8%. All 31 subjects were offered a small bowel biopsy. Of the 18 biopsied subjects, 17 (94%) had at least partial villous atrophy. Symptoms that were reported by the fair attendees did not predict positivity. Screening for celiac disease was widely accepted in this preventative health-care setting. Undiagnosed celiac disease affects 1 in 126 individuals in this Wyoming community. Most were asymptomatic or had atypical presentations. Serologic testing can readily detect this disease in a general population.

Chlamydia trachomatis Serology in Women with and without Ovarian Cancer

Directory of Open Access Journals (Sweden)

Roberta B. Ness

2008-01-01

Full Text Available Pelvic inflammation has been implicated in the genesis of ovarian cancer. We conducted serologic measurements of Chlamydia trachomatis antibodies as a surrogate marker of chlamydial pelvic inflammatory disease. Women with ovarian cancer (n=521 and population-based controls (n=766 were tested. IgG antibodies to serovar D of chlamydia elementary bodies (EBs were detected using an ELISA assay. The odds of having ovarian cancer among women with the highest titers (≥0.40 OD units were 0.6 (95% CI 0.4–0.9. These data do not support our earlier finding of elevated titers for antibodies to C. trachomatis among women with ovarian cancer.

[Blood Test Patterns for Blood Donors after Nucleic Acid Detection in the Blood Center].

Science.gov (United States)

Men, Shou-Shan; Lv, Lian-Zhi; Chen, Yuan-Feng; Han, Chun-Hua; Liu, Hong-Yu; Yan, Yan

2017-12-01

To investigate the blood test patterns for blood donors after nucleic acid detection in blood center. The collected blood samples after voluntary blood donors first were detected by conventional ELISA, then 31981 negative samples were detected via HBV/HCV/HIV combined nucleic acid test of 6 mixed samples(22716 cases) or single samples(9265 cases) by means of Roche cobas s201 instrument. The combined detection method as follows: the blood samples were assayed by conventional nucleic acid test of 6 mixed samples, at same time, 6 mixed samples were treated with polyethylene glycol precipitation method to concentrate the virus, then the nucleic acid test of blood samples was performed; the single detection method as follows: firstly the conventional nucleic acid test of single sample was performed, then the positive reactive samples after re-examination were 6-fold diluted to simulate the nucleic acid test of 6-mixed samples. The positive rate of positive samples detected by combined nucleic acid test, positive samples detected by nucleic acid test of mixed virus concentration and positive samples detected by single nucleic acid test was statistically analyzed. In addition, for HBV + persons the serological test yet should be performed. In 22 716 samples detected by nucleic acid test of 6 mixed samples (MP-6-NAT) , 9 cases were HBV + (0.40‰, 9/22716); at same time, the detection of same samples by nucleic acid test of mixed sample virus concentration showed 29 cases of HBV + (1.28‰, 29/22716). In 9265 samples detected by single nucleic acid test(ID-NAT) 12 cases showed HBV + (1.30‰, 12/9265), meanwhile the detection of these 12 samples with HBV + by 6-fold dilution for virus concentration found only 4 samples with HBV + . In serological qualified samples, ID-NAT unqualified rate was 1.28‰, which was higher than that of MP-6-NAT(0.4‰) (χ 2 =8.11, P0.05). In 41 samples with HBsAg - HBV DNA + detected by ELISA, 36 samples were confirmed to be occult HBV

Positive serology for viral hepatitis and donor self-exclusion in Southern Brazil

Directory of Open Access Journals (Sweden)

Julia De Luca Maccarini

2013-07-01

Full Text Available Introduction Despite the great advances in serological testing for transfusion-transmitted infections, the selection of blood donors by blood bank operators remains the only way to avoid transmission within the testing window period. Part of this selection is the self-exclusion form, on which the donors can exclude their blood from donation without any explanation. This study assessed the clinical and epidemiological characteristics related to positivity for viral hepatitis and to the use of the confidential self-exclusion (CSE form. Methods This transversal study analyzed the data collected from blood donors' files in a hospital in Southern Brazil. Univariate and multivariate analyses identified the clinical and epidemiological variables related to positive serologies of viral hepatitis and to whether the donor was self-excluded. Results Of the 3,180 donors included in this study, 0.1% tested positive for HBsAg, 2.1% for anti-HBc, and 0.9% for anti-HCV. When the 93 donors with positive serologies for viral hepatitis were compared with those who were negative, a greater proportion of the positive serology group was found to have had a history of blood transfusions (OR=4.908; 95%CI=1.628 - 14.799; p<0.01, had repeatedly donated (OR=2.147; 95%CI=1.236 - 3.729; p<0.01, and used the CSE form for self-exclusion (OR=7.139; 95%CI=2.045 - 24.923; p<0.01. No variables were independently associated with self-exclusion. Conclusions A history of blood transfusion, repeated donations, and self-exclusion are factors that should be considered during viral hepatitis screenings in blood banks.

Utility of the microculture method for Leishmania detection in non-invasive samples obtained from a blood bank.

Science.gov (United States)

Ates, Sezen Canim; Bagirova, Malahat; Allahverdiyev, Adil M; Kocazeybek, Bekir; Kosan, Erdogan

2013-10-01

In recent years, the role of donor blood has taken an important place in epidemiology of Leishmaniasis. According to the WHO, the numbers of patients considered as symptomatic are only 5-20% of individuals with asymptomatic leishmaniasis. In this study for detection of Leishmania infection in donor blood samples, 343 samples from the Capa Red Crescent Blood Center were obtained and primarily analyzed by microscopic and serological methods. Subsequently, the traditional culture (NNN), Immuno-chromatographic test (ICT) and Polymerase Chain Reaction (PCR) methods were applied to 21 samples which of them were found positive with at least one method. Buffy coat (BC) samples from 343 blood donors were analyzed: 15 (4.3%) were positive by a microculture method (MCM); and 4 (1.1%) by smear. The sera of these 343 samples included 9 (2.6%) determined positive by ELISA and 7 (2%) positive by IFAT. Thus, 21 of (6.1%) the 343 subjects studied by smear, MCM, IFAT and ELISA techniques were identified as positive for leishmaniasis at least one of the techniques and the sensitivity assessed. According to our data, the sensitivity of the methods are identified as MCM (71%), smear (19%), IFAT (33%), ELISA (42%), NNN (4%), PCR (14%) and ICT (4%). Thus, with this study for the first time, the sensitivity of a MCM was examined in blood donors by comparing MCM with the methods used in the diagnosis of leishmaniasis. As a result, MCM was found the most sensitive method for detection of Leishmania parasites in samples obtained from a blood bank. In addition, the presence of Leishmania parasites was detected in donor bloods in Istanbul, a non-endemic region of Turkey, and these results is a vital importance for the health of blood recipients. Copyright © 2013 Elsevier B.V. All rights reserved.

Impact of Vaccination History on Serological Testing in Pregnant Women.

Science.gov (United States)

Desjardins, Michaël; Boucoiran, Isabelle; Paquet, Caroline; Laferrière, Céline; Gosselin-Brisson, Anne; Labbé, Annie-Claude; Martel-Laferrière, Valérie

2018-04-01

Serological testing guidelines for vaccine-preventable infectious diseases in pregnant women are heterogeneous. It is unclear how vaccination history influences health care workers' (HCWs) attitudes about testing. The aim of this study was to describe current practices in screening for rubella, hepatitis B, and varicella-zoster virus (VZV) in pregnant women in the province of Québec. In 2015, an electronic survey was distributed to HCWs who followed the case of at least one pregnant woman in the previous year and who could be contacted by email by their professional association. A total of 363 of 1084 (33%) participants were included in the analysis: general practitioners (57%), obstetrician-gynaecologists (20%), midwives (41%), and nurse practitioners (31%). For rubella, 48% of participants inquired about vaccination status, and of these, 98% offered serological testing for unvaccinated women versus 44% for vaccinated women. Similarly, of the 48% of participants who asked about hepatitis B vaccination status before offering testing, 96% ordered testing for hepatitis B surface antigen, 28% ordered testing for hepatitis B surface antibody, and 1% ordered no serological testing to unvaccinated women versus 72%, 46%, and 8%, respectively, for vaccinated women. Among the 81% of respondents who discussed VZV during prenatal care, 13% ordered serological testing if patients had a history of VZV infection, 87% if the VZV history was uncertain, and 19% if patients had a positive history of vaccination. Asking about vaccination status influences HCWs' attitudes about serological testing for rubella, hepatitis B, and VZV. In the context of increasing vaccination coverage in women of child-bearing age, it is important to clarify the impact of vaccination status in serological screening guidelines in pregnant women. Copyright © 2018 Society of Obstetricians and Gynaecologists of Canada. Published by Elsevier Inc. All rights reserved.

Diagnostic performance of serological tests to detect antibodies against acute scrub typhus infection in central India

Directory of Open Access Journals (Sweden)

Kiran Pote

2018-01-01

Full Text Available Background: Differentiating scrub typhus from other acute febrile illness is difficult due to non specificity of clinical symptoms and relative absence of eschar in Indian population. The diagnosis thus relies mainly on laboratory tests. Antibody based serological tests are mainstay of scrub typhus diagnosis. Here, we evaluated the diagnostic performance of IgM ELISA, IgM IFA and ICT to detect antibodies against O. tsutsugamushi in acute serum of febrile patients. Methodology: The serum samples from 600 randomly selected patients suffering from acute undifferentiated fever were tested by all the three tests mentioned above. We used latent class analysis to generate unbiased results as all the tests for scrub typhus diagnosis are imperfect and none of them can be considered as reference standard. Results: We found that IgM ELISA with cutoff titer 0.5 OD has high diagnostic accuracy (sensitivity 99.9% and specificity 99.15 than IgM IFA (sensitivity 96.8% and specificity 99.7% for scrub typhus diagnosis. ICT used in our study had very high specificity 100% but low sensitivity (38% which would limit its use for acute serum samples. ICT being a screening or point of care test, has to be more sensitive while some compromise with specificity is affordable. Hence, optimal cutoff for ICT should be evaluated under different settings. Conclusion: IgM ELISA being simple and affordable could be an alternative diagnostic test to IgM IFA which is subjective and costly.

Diagnostic performance of serological tests to detect antibodies against acute scrub typhus infection in central India.

Science.gov (United States)

Pote, Kiran; Narang, Rahul; Deshmukh, Pradeep

2018-01-01

Differentiating scrub typhus from other acute febrile illness is difficult due to non specificity of clinical symptoms and relative absence of eschar in Indian population. The diagnosis thus relies mainly on laboratory tests. Antibody based serological tests are mainstay of scrub typhus diagnosis. Here, we evaluated the diagnostic performance of IgM ELISA, IgM IFA and ICT to detect antibodies against O. tsutsugamushi in acute serum of febrile patients. The serum samples from 600 randomly selected patients suffering from acute undifferentiated fever were tested by all the three tests mentioned above. We used latent class analysis to generate unbiased results as all the tests for scrub typhus diagnosis are imperfect and none of them can be considered as reference standard. We found that IgM ELISA with cutoff titer 0.5 OD has high diagnostic accuracy (sensitivity 99.9% and specificity 99.15) than IgM IFA (sensitivity 96.8% and specificity 99.7%) for scrub typhus diagnosis. ICT used in our study had very high specificity 100% but low sensitivity (38%) which would limit its use for acute serum samples. ICT being a screening or point of care test, has to be more sensitive while some compromise with specificity is affordable. Hence, optimal cutoff for ICT should be evaluated under different settings. IgM ELISA being simple and affordable could be an alternative diagnostic test to IgM IFA which is subjective and costly.

Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Faggioli, F; Pasquini, G; Barba, M

1998-09-01

The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

Old and new diagnostic approaches for Q fever diagnosis: correlation among serological (CFT, ELISA) and molecular analyses.

Science.gov (United States)

Natale, A; Bucci, G; Capello, K; Barberio, A; Tavella, A; Nardelli, S; Marangon, S; Ceglie, L

2012-07-01

The objective of this study was to evaluate the performance of the complement fixation test (CFT) with respect to ELISA for the serological diagnosis of Q fever and to assess the role of serology as a tool for the identification of the shedder status. During 2009-2010, sera from 9635 bovines and 3872 small ruminants (3057 goats and 815 sheep) were collected and analyzed with CFT and ELISA. In addition, 2256 bovine, 139 caprine and 72 ovine samples (individual and bulk tank milk samples, fetuses, vaginal swabs and placentae) were analyzed with a real-time PCR kit. The relative sensitivity (Se) and specificity (Sp) of CFT with respect to ELISA were Se 26.56% and Sp 99.71% for cattle and Se 9.96% and Sp 99.94% for small ruminants. To evaluate the correlation between serum-positive status and shedder status, the ELISA, CFT and real-time PCR results were compared. Due to the sampling method and the data storage system, the analysis of individual associations between the serological and molecular tests was possible only for some of the bovine samples. From a statistical point of view, no agreement was observed between the serological and molecular results obtained for fetus and vaginal swab samples. Slightly better agreement was observed between the serological and molecular results obtained for the individual milk samples and between the serological (at least one positive in the examined group) and molecular results for the bulk tank milk (BTM) samples. The CFT results exhibited a better correlation with the shedder status than did the ELISA results. Copyright © 2012 Elsevier Ltd. All rights reserved.

Evaluation of clinical and serological findings for diagnosis of cutaneous anthrax infection after an outbreak.

Science.gov (United States)

Gulseren, Duygu; Süzük-Yıldız, Serap; Çelebi, Bekir; Kılıç, Selçuk

2017-09-01

Anthrax, caused by the bacterium Bacillus anthracis, is one of the oldest documented infectious diseases in both livestock and humans. We aimed to evaluate clinical findings and risk factors of patients with cutaneous anthrax infection and report anti-lethal factor (LF) IgG and anti-protective antigen (PA) IgG titers in the serologic diagnosis of disease. In this study, serum samples of 18 cutaneous anthrax patients were collected and anti-LF IgG and anti-PA IgG titers were measured by enzyme-linked immunosorbent assay (ELISA). Twelve (67%) males and 6 (33%) females, with a mean age of 36.06 ± 16.58 years were included in the study. Risk factors identified in the patient population studied were slaughtering (28%), flaying (56%), chopping meat (67%), burying diseased animal corpses (17%) and milking (6%) livestock. Black eschar formation (94%), pruritus (78%) and painful lymphadenopathy (61%) were first three common clinical signs and symptoms, respectively. Fourteen (78%) patients produced a positive IgG response against PA, 11 (61%) patients produced against LF. Three (17%) patients had no response to either antigen. A detailed history of contact with sick animals or animal products along with clinical findings should be taken at the first step for the diagnosis of cutaneous anthrax infection. Serologic detection of anti-LF IgG and anti-PA IgG with ELISA may be useful auxillary method for establishing the diagnosis.

Retrospective Review of Treponema pallidum PCR and Serology Results: Are Both Tests Necessary?

Science.gov (United States)

Brischetto, Anna; Gassiep, Ian; Whiley, David; Norton, Robert

2018-05-01

There has been a resurgence of syphilis diagnoses in Australia. We investigated whether our Treponema pallidum PCR test provides any additional diagnostic information over syphilis serology (chemiluminescence immunoassay [CMIA], Treponema pallidum particle agglutination [TPPA] assay, and the rapid plasma reagin [RPR] flocculation test). A retrospective audit of all T. pallidum PCR requests that came through our laboratory from January 2010 to June 2017 was conducted; data collected included age, gender, site of swab, and results from T. pallidum PCR, syphilis serology, and herpes simplex virus 1 (HSV-1) and HSV-2 PCRs. A total of 441 T. pallidum PCR tests were performed; on average, 3 T. pallidum PCRs per month were requested in 2011, and this rate increased to 17.2 requests per month in 2017. A total of 323 patients had both T. pallidum PCR and syphilis serology performed, with 67% of swabs taken from the genitals. T. pallidum PCR gave positive results for 61/323 (19%) patients; of these 61 patients, 59 (97%) also had positive syphilis serology results ( T. pallidum PCR sensitivity, 68%; specificity, 99%; positive predictive value, 97%; negative predictive value, 89%). Syphilis serology was positive for 91/323 patients (28%); of these 91 patients, 61 (66%) were also T. pallidum PCR positive (syphilis serology sensitivity, 97%; specificity, 88%; positive predictive value, 60%; negative predictive value, 99%). The Cohen's kappa value was 0.74, indicating substantial agreement between the two tests. Our results show that most patients with positive T. pallidum PCR results also had positive syphilis serology. Therefore, T. pallidum PCR adds little clinical value over serology for the diagnosis of syphilis in certain clinical settings. Copyright © 2018 American Society for Microbiology.

Parasite detection in patients with post kala-azar dermal leishmaniasis in India: a comparison between molecular and immunological methods

Science.gov (United States)

Salotra, P; Sreenivas, G; Beena, K R; Mukherjee, A; Ramesh, V

2003-01-01

Aims: To evaluate the sensitivity and specificity of serological, immunohistochemical, and molecular methods in the diagnosis of post kala-azar dermal leishmaniasis (PKDL). Methods: Twenty five patients with confirmed PKDL and 25 controls were included in the study. G2D10, a monoclonal antibody against Leishmania, was used for the immunohistochemical (IHC) staining of lesion sections to visualise anti-Leishmania donovani antibodies. The diagnostic usefulness of IHC was compared with enzyme linked immunosorbent assay (ELISA) with a recombinant (rk39) antigen, and a species specific polymerase chain reaction (PCR) assay, amplifying a kinetoplast minicircle DNA sequence. Results: IHC detected 22 of 25 PKDL cases, giving a sensitivity of 88%. The diagnostic sensitivity of both the ELISA and PCR tests was higher (96%). All of the 25 controls examined were negative in PCR, indicating 100% specificity of the test, whereas ELISA showed 96% specificity. Conclusions: IHC with G2D10 significantly enhances the sensitivity of detection of PKDL over routine haematoxylin and eosin staining. ELISA with a recombinant antigen is an economical and practical assay. PCR is the most sensitive and specific diagnostic method for PKDL. The tests described would facilitate the recognition of patients with PKDL, enabling timely treatment, which would contribute greatly to the control of kala-azar. PMID:14600129

Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

OpenAIRE

Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

2009-01-01

Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

21 CFR 866.3020 - Adenovirus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3020 Adenovirus... identify adenoviruses directly from clinical specimens. The identification aids in the diagnosis of disease...

21 CFR 866.3205 - Echovirus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3205 Echovirus... echoviruses from clinical specimens or from tissue culture isolates derived from clinical specimens. The...

Prenatal diagnosis of congenital toxoplasmosis: comparative value of fetal blood and amniotic fluid using serological techniques and cultures.

Science.gov (United States)

Fricker-Hidalgo, H; Pelloux, H; Muet, F; Racinet, C; Bost, M; Goullier-Fleuret, A; Ambroise-Thomas, P

1997-09-01

The prenatal diagnosis of congenital toxoplasmosis is mainly based on biological tests performed on fetal blood and amniotic fluid. We studied the performance of neonatal diagnosis procedures and the results of fetal blood and amniotic fluid analysis. Of 127 women who contracted toxoplasmosis and underwent prenatal diagnosis, the postnatal serological follow-up was long enough to definitively diagnose congenital toxoplasmosis in 19 cases and to exclude it in 27 cases. Prenatal diagnosis allowed the detection of 94.7 per cent (18/19) of the infected fetuses. The sensitivities of tests in amniotic fluid and fetal blood were equivalent, 88.2 per cent (15/17) and 87.5 per cent (14/16), respectively. In fetal blood, biological techniques were positive in 12/16 cases and in 2/16 cases, serological tests were the only positive sign. The specificities of tests in amniotic fluid and fetal blood were respectively 100 per cent (23/23) and 86.3 per cent (19/22) (three false-positive serological results). These results, added to the lower morbidity of amniocentesis compared with cordocentesis, might lead to cordocentesis being abandoned in the prenatal diagnosis of congenital toxoplasmosis.

Recent Trends in the Serologic Diagnosis of Syphilis

Science.gov (United States)

Singh, Ameeta E.

2014-01-01

Complexities in the diagnosis of syphilis continue to challenge clinicians. While direct tests (e.g., microscopy or PCR) are helpful in early syphilis, the mainstay of diagnosis remains serologic tests. The traditional algorithm using a nontreponemal test (NTT) followed by a treponemal test (TT) remains the standard in many parts of the world. More recently, the ability to automate the TT has led to the increasingly widespread use of reverse algorithms using treponemal enzyme immunoassays (EIAs). Rapid, point-of-care TTs are in widespread use in developing countries because of low cost, ease of use, and reasonable performance. However, none of the current diagnostic algorithms are able to distinguish current from previously treated infections. In addition, the reversal of traditional syphilis algorithms has led to uncertainty in the clinical management of patients. The interpretation of syphilis tests is further complicated by the lack of a reliable gold standard for syphilis diagnostics, and the newer tests can result in false-positive reactions similar to those seen with older tests. Little progress has been made in the area of serologic diagnostics for congenital syphilis, which requires assessment of maternal treatment and serologic response as well as clinical and laboratory investigation of the neonate for appropriate management. The diagnosis of neurosyphilis continues to require the collection of cerebrospinal fluid for a combination of NTT and TT, and, while newer treponemal EIAs look promising, more studies are needed to confirm their utility. This article reviews current tests and discusses current controversies in syphilis diagnosis, with a focus on serologic tests. PMID:25428245

Serological and molecular detection of Bean leaf roll and Chickpea chlorotic stunt luteoviruses in chickpea from Iran

Directory of Open Access Journals (Sweden)

Hajiyusef Tara

2017-06-01

Full Text Available Chickpea (Cicer arietinum L. is an important legume crop and widely cultivated in northwestern provinces of Iran. During a survey in the 2015 growing season a total of 170 selected chickpea plants with general yellowing symptoms including stunting and leaf bronzing were collected. Serological Elisa and tissue blot immunoassay (TIBA tests revealed the presence of Bean leaf roll virus (BLRV and Chickpea chlorotic stunt virus (CpCSV as the predominant viruses in the region. Some serologically positive samples of BLRV and CpCSV were selected and rechecked by RT-PCR. The results of amplified PCR products using a specific pair of primers towards the Cp gene region of the viruses were approximately 413 bp for CpCSV and 391 bp for BLRV. Results obtained from sequence comparison of BLRV (IR-F-Lor-5 isolate form two subgroups with eight other BLRV isolates from GeneBank indicating a high homology of 96% with isolates from Argentina, Germany, Tunisia, USA, Spain, and Colombia. An isolate from Norabad (Iran (IR-Nor had 98% homology with HQ840727 Libyan isolate. CpCSV sequence comparison with six other GeneBank isolates indicated 98% homology with isolates from Tunisia and Azerbaijan. The overall results of this research revealed the CpCSV and BLRV (luteoviruses associated with the yellowing disease syndrome of chickpea crops in the surveyed region.

Multiplex serology of paraneoplastic antineuronal antibodies.

Science.gov (United States)

Maat, Peter; Brouwer, Eric; Hulsenboom, Esther; VanDuijn, Martijn; Schreurs, Marco W J; Hooijkaas, Herbert; Smitt, Peter A E Sillevis

2013-05-31

Paraneoplastic neurological syndromes (PNS) are devastating neurological disorders secondary to cancer, associated with onconeural autoantibodies. Such antibodies are directed against neuronal antigens aberrantly expressed by the tumor. The detection of onconeural antibodies in a patient is extremely important in diagnosing a neurological syndrome as paraneoplastic (70% is not yet known to have cancer) and in directing the search for the underlying neoplasm. At present six onconeural antibodies are considered 'well characterized' and recognize the antigens HuD, CDR62 (Yo), amphiphysin, CRMP-5 (CV2), NOVA-1 (Ri), and Ma2. The gold standard of detection is the characteristic immunohistochemical staining pattern on brain tissue sections combined with confirmation by immunoblotting using recombinant purified proteins. Since all six onconeural antibodies are usually analyzed simultaneously and objective cut-off values for these analyses are warranted, we developed a multiplex assay based on Luminex technology. Reaction of serial dilutions of six onconeural standard sera with microsphere-bound antigens showed lower limits of detection than with Western blotting. Using the six standard sera at a dilution of 1:200, the average within-run coefficient of variation (CV) was 4% (range 1.9-7.3%). The average between-run within-day CV was 5.1% (range 2.9-6.7%) while the average between-day CV was 8.1% (range 2.8-11.6%). The shelf-life of the antigen coupled microspheres was at least two months. The sensitivity of the multiplex assay ranged from 83% (Ri) to 100% (Yo, amphiphysin, CV2) and the specificity from 96% (CV2) to 100% (Ri). In conclusion, Luminex-based multiplex serology is highly reproducible with high sensitivity and specificity for the detection of onconeural antibodies. Conventional immunoblotting for diagnosis of onconeural antibodies in the setting of a routine laboratory may be replaced by this novel, robust technology. Copyright © 2013 Elsevier B.V. All rights

The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria

NARCIS (Netherlands)

Chitarra, L.G.; Bulk, van den R.W.

2003-01-01

Conventional methods to detect and assess the viability of plant pathogenic bacteria are usually based on plating assays or serological techniques. Plating assays provide information about the number of viable cells, expressed as colony-forming units, but are time-consuming and laborious.

Indirect enzyme-linked immunosorbent assay method based on Streptococcus agalactiae rSip-Pgk-FbsA fusion protein for detection of bovine mastitis.

Science.gov (United States)

Bu, Ri-E; Wang, Jin-Liang; Wu, Jin-Hua; Xilin, Gao-Wa; Chen, Jin-Long; Wang, Hua

2017-03-01

The aim of this study was to establish a rapid and accurate method for the detection of the Streptococcus agalactiae antibody (SA-Ab) to determine the presence of the bovine mastitis (BM)-causative pathogen. The multi-subunit fusion protein rSip-Pgk-FbsA was prokaryotically expressed and purified. The triple activities of the membrane surface-associated proteins Sip, phosphoglycerate kinase (Pgk), and fibronectin (FbsA) were used as the diagnostic antigens to establish an indirect enzyme-linked immunosorbent assay (ELISA) method for the detection of SA-Ab in BM. The optimal antigen coating concentration was 2 μg/mL, the optimal serum dilution was 1:160, and the optimal dilution of the enzyme-labeled secondary antibody was 1:6000. The sensitivity, specificity, and repeatability tests showed that the method established in this study had no cross-reaction with antibodies to Streptococcus pyogenes, Escherichia coli, Staphylococcus aureus, and Staphylococcus epidermidis in the sera. The results of the sensitivity test showed that a positive result could be obtained even if the serum dilution reached 1:12,800, indicating the high sensitivity and good repeatability of the method. The positive coincidence rate of this method was 98.6%, which is higher than that of previous tests established with the Sip or Pgk mono-antigen fusion protein, respectively, demonstrating the relatively higher sensitivity of this newly established method. The detection rate for 389 clinical samples was 46.53%. The indirect ELISA method established in this study could provide a more accurate and reliable serological method for the rapid detection of S. agalactiae in cases of BM.

Molecular and serological investigation of border disease virus infection in sheep in the Kars District of Turkey

Directory of Open Access Journals (Sweden)

Volkan Yilmaz

2014-01-01

Full Text Available This study is a serological and virological examination of the border disease virus (BDV in sheep at 1–5 years of age from private small scale production units of less than 20 sheep per unit, in the Kars District of Turkey. For this purpose, blood sera from 460 sheep were tested for antibodies against BDV using a commercial enzyme-linked immunosorbent assay (ELISA. Since BDV causes persistent infection, antigen-ELISA was also performed for this agent. Seropositivity rate was detected to be 74.57%. In addition, the BDV antigen was detected in one sample of seronegative sera (0.85%. Reverse transcription polymerase chain reaction (RT-PCR technique was used to determine the presence of pestivirus nucleic acid by using 5’UTR primer pair. Pestivirus nucleic acid was found in 2 of 117 seronegative samples (1.71% by RT-PCR. The results suggest that the infection was spreading in private small scale production units. Furthermore, recommendations for the control of BDV infection are presented. This study is the first molecular and serological study to determine viroprevalence and seroprevalence of BDV infection in sheep in the Kars District of Turkey.

Serological survey of Rhodococcus equi infection in horses in Hokkaido.

Science.gov (United States)

Sanada, Y; Noda, H; Nagahata, H

1992-08-01

Serological survey of Rhodococcus equi infection in horses in Hokkaido was performed using ELISA. Of 2,879 horse sera, 318 (11.0%) gave antibody-positive (OD greater than or equal to 0.3) reactions. The antibody-positive rate of female was significantly higher (p less than 0.01) than that of male, and no statistical difference between Anglo-Arab and thoroughbred was detected in the antibody-positive rate. The maximum antibody-positive rate (27.1%) was shown at 14 years of age. The antibody-positive rates on the 160 farms were found to vary widely from 0 to 78.9%. A significant difference (p less than 0.01) in the antibody-positive rate was detected among horse farms. It was elucidated that 100 (62.5%) out of 160 horse farms had an antibody-positive horse. These results indicate that R. equi was widespread on horse farms, and the level of environmental contamination with R. equi differed among horse farms.

Serological Survey of Toxoplasmosis Transvaal

African Journals Online (AJOL)

Serological Survey of Toxoplasmosis. Transvaal. P. R. MASON, M. R. JACOBS, P. J. FRIPP. •. In the. SUMMARY. Thirty-seven per cent of 605 samples of human sera col- lected from four ethnic groups in South Africa gave a positive Toxoplasma indir~ct fluorescent antibody test at a dilution 01 1/16 or higher. The incidences ...

Serological study of brucellosis in Argentine Creole sheep.

Science.gov (United States)

López, Gustavo E; Peña, Sabrina; Escobar, Gabriela I; Hasan, Déborah B; Lucero, Nidia E

2018-01-05

Ovine cattle was introduced into America during the Spanish conquest with the second journey of Columbus to the Antilles and was disseminated throughout the region. In 1587, sheep were introduced into Argentina, later developing into the "Creole" breed. We selected 486 animals from different Argentine provinces with the aim of determining the serological status of brucellosis caused by Brucella melitensis and Brucella ovis. For the detection of antibodies against smooth Brucella spp., the Rose Bengal test (RBT) was performed as screening test while the serum agglutination test (SAT) and 2 mercapto-ethanol (2ME) were run as a confirmatory technique. Moreover, for the detection of antibodies against rough Brucella spp., we used the rapid slide agglutination test (RSAT) for screening and an indirect ELISA (IELISA) as confirmatory assay. This study showed that the total positive percentage of brucellosis due to B. ovis was 2.9%. Excluding the animals mixed with the Suffolk breed; seropositivity would be 0.6%. All animals tested negative for brucellosis caused by B. melitensis. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Radionuclide-labelled antigens in serological epidemiology

International Nuclear Information System (INIS)

Felsenfeld, O.; Parrott, M.W.

1977-01-01

The feasibility of tests using radionuclide-labelled antigens in serological surveys was studied, with particular attention to the likely availability of facilities and personnel in the tropics and arctics, where measurements may be disturbed by climatic influences. The methodology required was to be simple, rapid and suitable for examining large numbers of sera, as for epidemological surveys. In the introduction, limitations of labelled antigen tests are discussed, the choice of radionuclide and measurement methods, test procedures and evaluation of results. Collection, preservation and shipment of speciments (serum, faeces, cerebrospinal fluid, sputum, etc.) are described. Experiments with bacteria and bacterial toxins (Enterobacteriaceae, vibrios, staphylococci, meningococci, etc.), with protozoa and metazoa (Entamoeba hystolytica, Schistosoma mansoni, Trypanosoma cruzi, Plasmodia and other parasites), with viruses (vaccinia, adeno-, polio-, and influenza viruses, etc.), and with fungi are discussed

Serological diagnosis of paracoccidioidomycosis: high rate of inter-laboratorial variability among medical mycology reference centers.

Directory of Open Access Journals (Sweden)

Monica Scarpelli Martinelli Vidal

2014-09-01

Full Text Available Serological tests have long been established as rapid, simple and inexpensive tools for the diagnosis and follow-up of PCM. However, different protocols and antigen preparations are used and the few attempts to standardize the routine serological methods have not succeeded.We compared the performance of six Brazilian reference centers for serological diagnosis of PCM. Each center provided 30 sera of PCM patients, with positive high, intermediate and low titers, which were defined as the "reference" titers. Each center then applied its own antigen preparation and serological routine test, either semiquantitative double immunodifusion or counterimmmunoelectrophoresis, in the 150 sera from the other five centers blindly as regard to the "reference" titers. Titers were transformed into scores: 0 (negative, 1 (healing titers, 2 (active disease, low titers and 3 (active disease, high titers according to each center's criteria. Major discordances were considered between scores indicating active disease and scores indicating negative or healing titers; such discordance when associated with proper clinical and other laboratorial data, may correspond to different approaches to the patient's treatment. Surprisingly, all centers exhibited a high rate of "major" discordances with a mean of 31 (20% discordant scores. Alternatively, when the scores given by one center to their own sera were compared with the scores given to their sera by the remaining five other centers, a high rate of major discordances was also found, with a mean number of 14.8 sera in 30 presenting a discordance with at least one other center. The data also suggest that centers that used CIE and pool of isolates for antigen preparation performed better.There are inconsistencies among the laboratories that are strong enough to result in conflicting information regarding the patients' treatment. Renewed efforts should be promoted to improve standardization of the serological diagnosis of PCM.

Detection of cucumber green mottle mosaic virus-infected watermelon seeds using short wave infrared (SWIR) hyperspectral imaging system

Science.gov (United States)

The cucurbit diseases caused by cucumber green mottle mosaic virus (CGMMV) have led to a serious problem to growers and seed producers because it is difficult to prevent spreading through causal agent of seeds. Conventional detection methods for infected seed such as a biological, serological, and m...

Evaluation of serological and molecular tests used to identify Toxoplasma gondii infection in pregnant women attended in a public health service in São Paulo state, Brazil.

Science.gov (United States)

Murata, Fernando Henrique Antunes; Ferreira, Marina Neves; Pereira-Chioccola, Vera Lucia; Spegiorin, Lígia Cosentino Junqueira Franco; Meira-Strejevitch, Cristina da Silva; Gava, Ricardo; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

2017-09-01

Toxoplasmosis during pregnancy can have severe consequences. The use of sensitive and specific serological and molecular methods is extremely important for the correct diagnosis of the disease. We compared the ELISA and ELFA serological methods, conventional PCR (cPCR), Nested PCR and quantitative PCR (qPCR) in the diagnosis of Toxoplasma gondii infection in pregnant women without clinical suspicion of toxoplasmosis (G1=94) and with clinical suspicion of toxoplasmosis (G2=53). The results were compared using the Kappa index, and the sensitivity, specificity, positive predictive value and negative predictive value were calculated. The results of the serological methods showed concordance between the ELISA and ELFA methods even though ELFA identified more positive cases than ELISA. Molecular methods were discrepant with cPCR using B22/23 primers having greater sensitivity and lower specificity compared to the other molecular methods. Copyright © 2017 Elsevier Inc. All rights reserved.

Remote detection device and detection method therefor

International Nuclear Information System (INIS)

Kogure, Sumio; Yoshida, Yoji; Matsuo, Takashiro; Takehara, Hidetoshi; Kojima, Shinsaku.

1997-01-01

The present invention provides a non-destructive detection device for collectively, efficiently and effectively conducting maintenance and detection for confirming the integrity of a nuclear reactor by way of a shielding member for shielding radiation rays generated from an objective portion to be detected. Namely, devices for direct visual detection using an under water TV camera as a sensor, an eddy current detection using a coil as a sensor and each magnetic powder flow detection are integrated and applied collectively. Specifically, the visual detection by using the TV camera and the eddy current flaw detection are adopted together. The flaw detection with magnetic powder is applied as a means for confirming the results of the two kinds of detections by other method. With such procedures, detection techniques using respective specific theories are combined thereby enabling to enhance the accuracy for the evaluation of the detection. (I.S.)

Recent trends in the serologic diagnosis of syphilis.

Science.gov (United States)

Morshed, Muhammad G; Singh, Ameeta E

2015-02-01

Complexities in the diagnosis of syphilis continue to challenge clinicians. While direct tests (e.g., microscopy or PCR) are helpful in early syphilis, the mainstay of diagnosis remains serologic tests. The traditional algorithm using a nontreponemal test (NTT) followed by a treponemal test (TT) remains the standard in many parts of the world. More recently, the ability to automate the TT has led to the increasingly widespread use of reverse algorithms using treponemal enzyme immunoassays (EIAs). Rapid, point-of-care TTs are in widespread use in developing countries because of low cost, ease of use, and reasonable performance. However, none of the current diagnostic algorithms are able to distinguish current from previously treated infections. In addition, the reversal of traditional syphilis algorithms has led to uncertainty in the clinical management of patients. The interpretation of syphilis tests is further complicated by the lack of a reliable gold standard for syphilis diagnostics, and the newer tests can result in false-positive reactions similar to those seen with older tests. Little progress has been made in the area of serologic diagnostics for congenital syphilis, which requires assessment of maternal treatment and serologic response as well as clinical and laboratory investigation of the neonate for appropriate management. The diagnosis of neurosyphilis continues to require the collection of cerebrospinal fluid for a combination of NTT and TT, and, while newer treponemal EIAs look promising, more studies are needed to confirm their utility. This article reviews current tests and discusses current controversies in syphilis diagnosis, with a focus on serologic tests. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

BIOANALYTICAL STANDARDIZING FOR SEROLOGICAL DIAGNOSTIC MEDICAL DEVICES

Directory of Open Access Journals (Sweden)

A. Yu. Galkin

2015-04-01

Full Text Available In article we analyzed national and international regulations concerning the quality and safety of medical devices for in vitro diagnostics. We discussed the possibility of a partial application of the recommendations of the State Pharmacopoeia of Ukraine to this type of product. The main guiding regulatory documents establishing requirements for quality and safety tools for the serological diagnosis products are The technical regulation on medical devices for the diagnosis in vitro, DSTU ISO 13485 “Medical devices. Quality management system. Regulatory requirements”, and DSTU ISO/IEC 17025 “General requirements for the competence of testing and calibration laboratories”. Similar requirements of the State Pharmacopoeia of Ukraine which are used for drug standardization can not be directly applied to the medical devises for in vitro diagnostics due to a number of features, namely, the serological diagnosis products pre-designed to determine the unknown concentration of a particular analyte in a biological material, the diagnostic kits has to include the control samples (internal standard systems that need to be calibrated. It was determined following parameters of bioanalytical standardization and validation characterization for of qualitative (semi quantitative test-kits for serological diagnosis: precision (convergence, intralaboratory precision and reproducibility, diagnostic and analytical specificity, diagnostic sensitivity. It’s necessary to inspect additional parameters for quantitative test-kits such as accuracy (precision, linearity, analytical sensitivity and range.

Accuracy of serological testing for the diagnosis of prevalent neurocysticercosis in outpatients with epilepsy, Eastern Cape Province, South Africa.

Directory of Open Access Journals (Sweden)

Humberto Foyaca-Sibat

2009-12-01

Full Text Available Few studies have estimated prevalence of neurocysticercosis (NCC among persons with epilepsy in sub-Saharan Africa. While the limitations of serological testing in identification of NCC are well known, the characteristics of persons who are misdiagnosed based on serology have not been explored. The first objective of this pilot study was to estimate the prevalence of NCC in epilepsy outpatients from an area of South Africa endemic for cysticercosis. The second objective was to estimate the accuracy of serological testing in detecting NCC in these outpatients and characterize sources of disagreement between serology and neuroimaging.All out-patients aged 5 or older attending the epilepsy clinic of St. Elizabeth's Hospital in Lusikisiki, Eastern Cape Province, between July 2004 and April 2005 were invited to participate. Epidemiological data were collected by local study staff using a standardized questionnaire. Blood samples were tested by ELISA for antibody and antigen for Taenia solium. Four randomly chosen, consenting participants were transported each week to Mthatha for brain CT scan. The proportion of persons with epilepsy attending St. Elizabeth clinic with CT-confirmed NCC was 37% (95% CI: 27%-48%. Using CT as the gold standard, the sensitivity and specificity of antibody testing for identifying NCC were 54.5% (36.4%-71.9% and 69.2% (52.4%-83.0%, respectively. Sensitivity improved to 78.6% (49.2%-95.3% for those with active lesions. Sensitivity and specificity of antigen testing were considerably poorer. Compared to false negatives, true positives more often had active lesions. False positives were more likely to keep pigs and to have seizure onset within the past year than were true negatives.The prevalence of NCC in South African outpatients with epilepsy is similar to that observed in other countries where cysticercosis is prevalent. Errors in classification of NCC using serology alone may reflect the natural history of NCC.

Serologic Evaluation of Cornea Donors and Microbiologic Evaluation of Cornea Storage Media in an Eye Bank from Izmir, Turkey.

Science.gov (United States)

Palamar, Melis; Degirmenci, Cumali; Sertoz, Ruchan; Aydemir, Sohret; Egrilmez, Sait; Yagci, Ayse

2017-12-01

Our objective was to evaluate the serologic positivity of cornea donors and microbiologic positivity of cornea storage media at the Ege University Tissue and Cornea Bank, Izmir, Turkey. We retrospectively investigated the serologic blood sample and microbiological culture media analysis results of all cornea donors at Ege University Tissue and Cornea Bank between 2007 and 2015 with reference to age, sex, and cause of death of each donor. Mean age of the 955 deceased donors was 43.19 ± 15.89 years (range, 2-65 y). The mean postmortem time to blood sample removal and excision of the cornea tissue was 8.4 hours (range, 4-12 h). Serologic analyses showed that 855 donors (89.5%) were seronegative. The remaining donors were seropositive for hepatitis B (54 donors; 5.7%), human immunodeficiency (27 donors; 2.8%), hepatitis C (14 donors; 1.5%), and syphilis (5 donors; 0.5%) virus infections. Microbiologic analyses of the storage media were negative, with no microorganisms shown in 855 samples (89.5%). Candida species (32 donors; 3.4%), Escherichia coli (14 donors; 1.5%), Pseudomonas aeruginosa (11 donors; 1.2%), methicillin-resistant Staphylococcus aureus (11 donors; 1.2%), Enterobacter species (11 donors; 1.2%), Klebsiella pneumoniae (7 donors; 0.7%), Acinetobacter baumannii (6 donors; 0.6%), Proteus species (5 donors; 0.5%), and Corynebacterium species (3 donors; 0.3%) were the detected microorganisms in the infected storage media. False-positive serologic results among cornea donors were high. The incidence of false-positive results might be decreased by earlier blood removal from deceased donors and testing of all potential donors in intensive care units. Although rare, endophthalmitis after keratoplasty might be a devastating problem. In addition to serologic testing, microbiologic analyses of cornea storage media before transplant may be an effective way to prevent postoperative infectious complications.

Assessment of performance of selected serological tests for diagnosing brucellosis in pigs.

NARCIS (Netherlands)

Munoz, P.M.; Blasco, J.M.; Engel, B.; Miguel, de M.J.; Marín, C.M.; Dieste, L.; Mainar-Jaime, R.C.

2012-01-01

Swine brucellosis due to Brucella suis is considered an emerging zoonotic disease whose control is based on serological testing and the subsequent culling of seropositive animals or the full depopulation of affected flocks. Here we assessed the performance of several serological tests (Rose Bengal

Longitudinal survey of two serotine bat (Eptesicus serotinus maternity colonies exposed to EBLV-1 (European Bat Lyssavirus type 1: Assessment of survival and serological status variations using capture-recapture models.

Directory of Open Access Journals (Sweden)

Emmanuelle Robardet

2017-11-01

Full Text Available This study describes two longitudinal serological surveys of European Bat Lyssavirus type 1 (EBLV-1 antibodies in serotine bat (Eptesicus serotinus maternity colonies located in the North-East of France. This species is currently considered as the main EBLV-1 reservoir. Multievent capture-recapture models were used to determine the factors influencing bat rabies transmission as this method accounts for imperfect detection and uncertainty in disease states. Considering the period of study, analyses revealed that survival and recapture probabilities were not affected by the serological status of individuals, confirming the capacity of bats to be exposed to lyssaviruses without dying. Five bats have been found with EBLV-1 RNA in the saliva at the start of the study, suggesting they were caught during virus excretion period. Among these bats, one was interestingly recaptured one year later and harbored a seropositive status. Along the survey, some others bats have been observed to both seroconvert (i.e. move from a negative to a positive serological status and serorevert (i.e. move from a positive to a negative serological status. Peak of seroprevalence reached 34% and 70% in site A and B respectively. On one of the 2 sites, global decrease of seroprevalence was observed all along the study period nuanced by oscillation intervals of approximately 2-3 years supporting the oscillation infection dynamics hypothesized during a previous EBLV-1 study in a Myotis myotis colony. Seroprevalence were affected by significantly higher seroprevalence in summer than in spring. The maximum time observed between successive positive serological statuses of a bat demonstrated the potential persistence of neutralizing antibodies for at least 4 years. At last, EBLV-1 serological status transitions have been shown driven by age category with higher seroreversion frequencies in adults than in juvenile. Juveniles and female adults seemed indeed acting as distinct drivers

Longitudinal survey of two serotine bat (Eptesicus serotinus) maternity colonies exposed to EBLV-1 (European Bat Lyssavirus type 1): Assessment of survival and serological status variations using capture-recapture models.

Science.gov (United States)

Robardet, Emmanuelle; Borel, Christophe; Moinet, Marie; Jouan, Dorothée; Wasniewski, Marine; Barrat, Jacques; Boué, Franck; Montchâtre-Leroy, Elodie; Servat, Alexandre; Gimenez, Olivier; Cliquet, Florence; Picard-Meyer, Evelyne

2017-11-01

This study describes two longitudinal serological surveys of European Bat Lyssavirus type 1 (EBLV-1) antibodies in serotine bat (Eptesicus serotinus) maternity colonies located in the North-East of France. This species is currently considered as the main EBLV-1 reservoir. Multievent capture-recapture models were used to determine the factors influencing bat rabies transmission as this method accounts for imperfect detection and uncertainty in disease states. Considering the period of study, analyses revealed that survival and recapture probabilities were not affected by the serological status of individuals, confirming the capacity of bats to be exposed to lyssaviruses without dying. Five bats have been found with EBLV-1 RNA in the saliva at the start of the study, suggesting they were caught during virus excretion period. Among these bats, one was interestingly recaptured one year later and harbored a seropositive status. Along the survey, some others bats have been observed to both seroconvert (i.e. move from a negative to a positive serological status) and serorevert (i.e. move from a positive to a negative serological status). Peak of seroprevalence reached 34% and 70% in site A and B respectively. On one of the 2 sites, global decrease of seroprevalence was observed all along the study period nuanced by oscillation intervals of approximately 2-3 years supporting the oscillation infection dynamics hypothesized during a previous EBLV-1 study in a Myotis myotis colony. Seroprevalence were affected by significantly higher seroprevalence in summer than in spring. The maximum time observed between successive positive serological statuses of a bat demonstrated the potential persistence of neutralizing antibodies for at least 4 years. At last, EBLV-1 serological status transitions have been shown driven by age category with higher seroreversion frequencies in adults than in juvenile. Juveniles and female adults seemed indeed acting as distinct drivers of the rabies

Clinical and Serological Predictors of Suicide in Schizophrenia and Major Mood Disorders.

Science.gov (United States)

Dickerson, Faith; Origoni, Andrea; Schweinfurth, Lucy A B; Stallings, Cassie; Savage, Christina L G; Sweeney, Kevin; Katsafanas, Emily; Wilcox, Holly C; Khushalani, Sunil; Yolken, Robert

2018-03-01

Persons with serious mental illness are at high risk for suicide, but this outcome is difficult to predict. Serological markers may help to identify suicide risk. We prospectively assessed 733 persons with a schizophrenia spectrum disorder, 483 with bipolar disorder, and 76 with major depressive disorder for an average of 8.15 years. The initial evaluation consisted of clinical and demographic data as well as a blood samples from which immunoglobulin G antibodies to herpes viruses and Toxoplasma gondii were measured. Suicide was determined using data from the National Death Index. Cox proportional hazard regression models examined the role of baseline variables on suicide outcomes. Suicide was associated with male sex, divorced/separated status, Caucasian race, and elevated levels of antibodies to Cytomegalovirus (CMV). Increasing levels of CMV antibodies were associated with increasing hazard ratios for suicide. The identification of serological variables associated with suicide might provide more personalized methods for suicide prevention.

The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

Directory of Open Access Journals (Sweden)

MarkéŽta Vaňkov‡á

2016-01-01

Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

Diagnostic significance of measurements of specific IgG antibodies to Pseudomonas aeruginosa by three different serological methods

DEFF Research Database (Denmark)

Pressler, T.; Karpati, F.; Granstrom, M.

2008-01-01

to characterize patients with different infection status. Elevated levels of specific anti-Pseudomonas antibodies showed to be the risk factor for developing chronic Pa infection. Due to the specificity of the tests, antibiotic treatment based on serology might be considered in selected cases. There is a window...... of opportunity for suppression and eradication of initial P. aeruginosa infection making measurement of specific anti-Pseudomonas antibodies helpful Udgivelsesdato: 2009/1...

Serological evidence for Saint Louis encephalitis virus in free-ranging New World monkeys and horses within the upper Paraná River basin region, Southern Brazil

Directory of Open Access Journals (Sweden)

Walfrido Kühl Svoboda

2014-06-01

Full Text Available Introduction Saint Louis encephalitis virus (SLEV primarily occurs in the Americas and produces disease predominantly in humans. This study investigated the serological presence of SLEV in nonhuman primates and horses from southern Brazil. Methods From June 2004 to December 2005, sera from 133 monkeys (Alouatta caraya, n=43; Sapajus nigritus, n=64; Sapajus cay, n=26 trap-captured at the Paraná River basin region and 23 blood samples from farm horses were obtained and used for the serological detection of a panel of 19 arboviruses. All samples were analyzed in a hemagglutination inhibition (HI assay; positive monkey samples were confirmed in a mouse neutralization test (MNT. Additionally, all blood samples were inoculated into C6/36 cell culture for viral isolation. Results Positive seroreactivity was only observed for SLEV. A prevalence of SLEV antibodies in sera was detected in Alouatta caraya (11.6%; 5/43, Sapajus nigritus (12.5%; 8/64, and S. cay (30.8%; 8/26 monkeys with the HI assay. Of the monkeys, 2.3% (1/42 of A. caraya, 6.3% 94/64 of S. nigritus, and 15.4% (4/26 of S. cay were positive for SLEV in the MNT. Additionally, SLEV antibodies were detected by HI in 39.1% (9/23 of the horses evaluated in this study. Arboviruses were not isolated from any blood sample. Conclusions These results confirmed the presence of SLEV in nonhuman primates and horses from southern Brazil. These findings most likely represent the first detection of this virus in nonhuman primates beyond the Amazon region. The detection of SLEV in animals within a geographical region distant from the Amazon basin suggests that there may be widespread and undiagnosed dissemination of this disease in Brazil.

21 CFR 866.3220 - Entamoeba histolytica serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3220... fluorescent dye (immunofluorescent reagents) used to identify Entamoeba histolytica directly from clinical...

Validate or falsify: Lessons learned from a microscopy method claimed to be useful for detecting Borrelia and Babesia organisms in human blood.

Science.gov (United States)

Aase, Audun; Hajdusek, Ondrej; Øines, Øivind; Quarsten, Hanne; Wilhelmsson, Peter; Herstad, Tove K; Kjelland, Vivian; Sima, Radek; Jalovecka, Marie; Lindgren, Per-Eric; Aaberge, Ingeborg S

2016-01-01

A modified microscopy protocol (the LM-method) was used to demonstrate what was interpreted as Borrelia spirochetes and later also Babesia sp., in peripheral blood from patients. The method gained much publicity, but was not validated prior to publication, which became the purpose of this study using appropriate scientific methodology, including a control group. Blood from 21 patients previously interpreted as positive for Borrelia and/or Babesia infection by the LM-method and 41 healthy controls without known history of tick bite were collected, blinded and analysed for these pathogens by microscopy in two laboratories by the LM-method and conventional method, respectively, by PCR methods in five laboratories and by serology in one laboratory. Microscopy by the LM-method identified structures claimed to be Borrelia- and/or Babesia in 66% of the blood samples of the patient group and in 85% in the healthy control group. Microscopy by the conventional method for Babesia only did not identify Babesia in any samples. PCR analysis detected Borrelia DNA in one sample of the patient group and in eight samples of the control group; whereas Babesia DNA was not detected in any of the blood samples using molecular methods. The structures interpreted as Borrelia and Babesia by the LM-method could not be verified by PCR. The method was, thus, falsified. This study underlines the importance of doing proper test validation before new or modified assays are introduced.

Detection and Identification of Salmonella spp. in Surface Water by Molecular Technology in Taiwan

Science.gov (United States)

Tseng, S. F.; Hsu, B. M.; Huang, K. H.; Hsiao, H. Y.; Kao, P. M.; Shen, S. M.; Tsai, H. F.; Chen, J. S.

2012-04-01

Salmonella spp. is classified to gram-negative bacterium and is one of the most important causal agents of waterborne diseases. The genus of Salmonella comprises more than 2,500 serotypes and its taxonomy is also very complicated. In tradition, the detection of Salmonella in environmental water samples by routines culture methods using selective media and characterization of suspicious colonies based on biochemical tests and serological assay are generally time and labor consuming. To overcome this disadvantage, it is desirable to use effective method which provides a higher discrimination and more rapid identification about Salmonella in environmental water. The aim of this study is to investigate the occurrence of Salmonella using novel procedures of detection method and to identify the serovars of Salmonella isolates from 157 surface water samples in Taiwan. The procedures include membrane filtration, non-selective pre-enrichment, selective enrichment of Salmonella, and then isolation of Salmonella strains by selective culture plates. The selective enrichment and culture plates were both detected by PCR. Finally, we used biochemical tests and serological assay to confirm the serovars of Salmonella and also used Pulsed-field gel electrophoresis (PFGE) to identify their sarovar catagories by the genetic pattern. In this study, 44 water samples (28%) were indentified as Salmonella. The 44 positive water samples by culture method were further identified as S. Agona(1/44), S. Albany (10/44), S. Bareilly (13/44),S. Choleraesuis (2/44),S. Derby (4/44),S. Isangi (3/44),S.Kedougou(3/44),S. Mbandaka(1/44),S.Newport (3/44), S. Oranienburg(1/44), S. Potsdam (1/44),S. Typhimurium (1/44), andS. Weltevreden(1/44) by PFGE. The presence of Salmonella in surface water indicates the possibility of waterborne transmission in drinking watershed if water is not adequately treated. Therefore, the authorities need to have operating systems that currently provide adequate source

Doppler method leak detection for LMFBR steam generators. Pt. 3. Investigation of detection sensitivity and method

International Nuclear Information System (INIS)

Kumagai, Hiromichi; Kinoshita, Izumi

2001-01-01

To prevent the expansion of tube damage and to maintain structural integrity in the steam generators (SGs) of a fast breeder reactor (FBR), it is necessary to detect precisely and immediately any leakage of water from heat transfer tubes. Therefore, the Doppler method was developed. Previous studies have revealed that, in the SG full-sector model that simulates actual SGs, the Doppler method can detect bubbles of 0.4 l/s within a few seconds. However in consideration of the dissolution rate of hydrogen generated by a sodium-water reaction even from a small water leak, it is necessary to detect smaller leakages of water from the heat transfer tubes. The detection sensitivity of the Doppler method and the influence of background noise were experimentally investigated. In-water experiments were performed using the SG model. The results show that the Doppler method can detect bubbles of 0.01 l/s (equivalent to a water leak rate of about 0.01 g/s) within a few seconds and that the background noise has little effect on water leak detection performance. The Doppler method thus has great potential for the detection of water leakage in SGs. (author)

21 CFR 866.3375 - Mycoplasma spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3375 Mycoplasma... fluorescent dye (immunofluorescent reagents) used to identify Mycoplasma spp. directly from clinical specimens...

21 CFR 866.3250 - Erysipelothrix rhusiopathiae serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3250... Erysipelothrix rhusiopathiae from cultured isolates derived from clinical specimens. The identification aids in...

21 CFR 866.3270 - Flavobacterium spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3270.... from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of...

21 CFR 866.3320 - Histoplasma capsulatum serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3320... capsulatum from clinical specimens or cultured isolates derived from clinical specimens. The identification...

Seroprevalence of human brucellosis in and around Jammu, India, using different serological tests

Directory of Open Access Journals (Sweden)

H. K. Sharma

2016-07-01

Full Text Available Aim: Brucellosis is a disease of zoonotic importance as it affects both human as well as animal’s health, and therefore, directly affects animal productivity and human efficiency. Therefore, a study was conducted to estimate the seroprevalence of brucellosis in humans in Jammu and surrounding areas. Materials and Methods: A total of 121 sera samples from humans occupied with professional related to animals were collected and tested for anti-Brucella antibodies by Rose Bengal plate test (RBPT, modified RBPT (mRBPT, standard tube agglutination test (STAT, and indirect enzyme-linked immunosorbent assay (I-ELISA. Sampling was done keeping in view with the occupation, sex, and age. Results: The overall seroprevalence of brucellosis recorded was 4.96%. The test-wise seroprevalence was 9.91% by RBPT, 9.91% by mRBPT, 9.09% by STAT, and 16.52% by I-ELISA. The prevalence of brucellosis was higher in >35-50 years age group compared to >20-35 years and >50-65 years. Sex-wise seroprevalence was higher in males than females. Taking I-ELISA as standard, the relative sensitivities of mRBPT, RBPT, and I-ELISA were in the order of mRBPT=RBPT>STAT. All the tests revealed high specificity values; however, among different serological tests, I-ELISA detected a maximum number of positive sera samples. Conclusions: The prevalence of brucellosis was found to be approximately 5%. The adult (>35-50 years age male group was most vulnerable. The routine diagnosis of brucellosis involved the conventional serological tests, viz., RBPT and STAT, but each was associated with drawbacks which could give either false-positive or false-negative interpretation. Therefore, it is always recommended to use a battery of tests in the diagnosis of brucellosis.

21 CFR 866.3780 - Toxoplasma gondii serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3780 Toxoplasma... (immunofluorescent reagents) used to identify Toxoplasma gondii from clinical specimens. The identification aids in...

21 CFR 866.3165 - Cryptococcus neoformans serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3165... clinical specimens or from cultured isolates derived from clinical specimens. The identification aids in...

21 CFR 866.3140 - Corynebacterium spp. serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3140.... from clinical specimens. The identification aids in the diagnosis of disease caused by bacteria...

21 CFR 866.3110 - Campylobacter fetus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3110 Campylobacter... clinical specimens or cultured isolates derived from clinical specimens. The identification aids in the...

21 CFR 866.3340 - Klebsiella spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella... from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria...

21 CFR 866.3930 - Vibrio cholerae serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3930 Vibrio... from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of...

21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3010... this bacterium from cultured isolates derived from clinical specimens. The identification aids in the...

Celiac disease: Serologic prevalence in patients with irritable bowel syndrome

Directory of Open Access Journals (Sweden)

Zobeiri Mehdi

2012-01-01

Full Text Available Background: The prevalence of irritable bowel syndrome (IBS in the community is 10%-20% and have symptom based diagnostic criteria. Many symptoms of celiac disease (CD with 1% prevalence in some communities can mimic IBS. Sensitive and specific serologic tests of CD can detect asymptomatic cases. The purpose of this study was to compare the level of anti-tissue-transglutaminase (tTG IgA in IBS patients and controls group. Materials and Methods: This case-control study was performed at a University hospital in which 107 patients with IBS who met the Rome II criteria for their diagnosis were compared with 126 healthy age and sex-matched controls. Both groups were investigated for CD by analysis of their serum tTG IgA antibody with human recombinant antigen. Titers were positive containing over 10u/ml and borderline if they were between 4 and 10 u/ml. Result: 86 percent of IBS patients were female. The mean antibody level was 0.837 u/ml in IBS group and 0.933 u/ml in control group without any significant difference. Discussion and Conclusion: Results of this study may intensify disagreement on the situation of CD in IBS patients.

Autoantibodies in renal diseases – clinical significance and recent developments in serological detection

Directory of Open Access Journals (Sweden)

Gianna eKirsztajn

2015-05-01

Full Text Available Autoimmune dysfunctions are the bête noire in a range of debilitating nephropathies. Autoimmune-mediated damage to the kidneys can be triggered by autoantibodies directed against specific proteins or renal structures, for example the phospholipase A2 receptor or the glomerular basement membrane, resulting in glomerular diseases such as primary membranous nephropathy or Goodpasture’s disease. Moreover, secondary damage to the kidney can be part of the wide-reaching effects of systemic autoimmune diseases such as vasculitis or systemic lupus erythematosus (SLE – the latter counts lupus nephritis among its most severe manifestations. Systemic autoimmune diseases are characterized by non-organ-specific autoantibodies, directed for example against neutrophil cytoplasmic antigens in systemic vasculitis and against double-stranded DNA and nucleosomes in SLE.A large variety of innovative and highly specific and sensitive autoantibody tests have been developed in the last years that are available to identify autoimmune kidney diseases at an early stage. Thus, serological in vitro diagnostics allow for appropriate interventional therapy in order to prevent disease progression often resulting in need of dialysis and transplantation.

21 CFR 866.3125 - Citrobacter spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3125 Citrobacter... isolates derived from clinical specimens. The identification aids in the diagnosis of disease caused by...

21 CFR 866.3740 - Streptococcus spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3740 Streptococcus... derived from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria...

Trans-sialidase inhibition assay detects Trypanosoma cruzi infection in different wild mammal species.

Science.gov (United States)

Sartor, Paula A; Ceballos, Leonardo A; Orozco, Marcela M; Cardinal, Marta V; Gürtler, Ricardo E; Leguizamón, María S

2013-08-01

The detection of Trypanosoma cruzi infection in mammals is crucial for understanding the eco-epidemiological role of the different species involved in parasite transmission cycles. Xenodiagnosis (XD) and hemoculture (HC) are routinely used to detect T. cruzi in wild mammals. Serological methods are much more limited because they require the use of specific antibodies to immunoglobulins of each mammalian species susceptible to T. cruzi. In this study we detected T. cruzi infection by trans-sialidase (TS) inhibition assay (TIA). TIA is based on the antibody neutralization of a recombinant TS that avoids the use of anti-immunoglobulins. TS activity is not detected in the co-endemic protozoan parasites Leishmania spp and T. rangeli. In the current study, serum samples from 158 individuals of nine wild mammalian species, previously tested by XD, were evaluated by TIA. They were collected from two endemic areas in northern Argentina. The overall TIA versus XD co-reactivity was 98.7% (156/158). All 18 samples from XD-positive mammals were TIA-positive (co-positivity, 100%) and co-negativity was 98.5% (138/140). Two XD-negative samples from a marsupial (Didelphis albiventris) and an edentate (Dasypus novemcinctus) were detected by TIA. TIA could be used as a novel tool for serological detection of Trypanosoma cruzi in a wide variety of sylvatic reservoir hosts.

21 CFR 866.3035 - Arizona spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3035 Arizona spp... antisera and antigens used to identify Arizona spp. in cultured isolates derived from clinical specimens...

Serological documentation of maternal influenza exposure and bipolar disorder in adult offspring.

Science.gov (United States)

Canetta, Sarah E; Bao, Yuanyuan; Co, Mary Dawn T; Ennis, Francis A; Cruz, John; Terajima, Masanori; Shen, Ling; Kellendonk, Christoph; Schaefer, Catherine A; Brown, Alan S

2014-05-01

The authors examined whether serologically confirmed maternal exposure to influenza was associated with an increased risk of bipolar disorder in the offspring and with subtypes of bipolar disorder, with and without psychotic features. The study used a nested case-control design in the Child Health and Development Study birth cohort. In all, 85 individuals with bipolar disorder were identified following extensive ascertainment and diagnostic assessment and matched to 170 comparison subjects in the analysis. Serological documentation of maternal exposure to influenza was determined using the hemagglutination inhibition assay. No association was observed between serologically documented maternal exposure to influenza and bipolar disorder in offspring. However, maternal serological influenza exposure was related to a significant fivefold greater risk of bipolar disorder with psychotic features. The results suggest that maternal influenza exposure may increase the risk for offspring to develop bipolar disorder with psychotic features. Taken together with earlier associations between prenatal influenza exposure and schizophrenia, these results may suggest that prenatal influenza is a risk factor for psychosis rather than for a specific psychotic disorder diagnosis.

21 CFR 866.3145 - Coxsackievirus serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3145... fluorescent dye that are used to identify coxsackievirus from clinical specimens or from tissue culture isolates derived from clinical specimens. The identification aids in the diagnosis of coxsackievirus...

Nectin-4 is a new histological and serological tumor associated marker for breast cancer

Directory of Open Access Journals (Sweden)

Sauvan Richard

2007-05-01

Full Text Available Abstract Introduction Breast cancer is a complex and heterogeneous disease at the molecular level. Evolution is difficult to predict according to classical histoclinical prognostic factors. Different studies highlight the importance of large-scale molecular expression analyses to improve taxonomy of breast cancer and prognostic classification. Identification of new molecular markers that refine this taxonomy and improve patient management is a priority in the field of breast cancer research. Nectins are cell adhesion molecules involved in the regulation of epithelial physiology. We present here Nectin-4/PVRL4 as a new histological and serological tumor associated marker for breast carcinoma. Methods Expression of Nectin-4 protein was measured on a panel of 78 primary cells and cell lines from different origins and 57 breast tumors by FACS analysis and immunohistochemistry (IHC, respectively. mRNA expression was measured by quantitative PCR. Serum Nectin-4 was detected by ELISA and compared with CEA and CA15.3 markers, on panels of 45 sera from healthy donors, 53 sera from patients with non-metastatic breast carcinoma (MBC at diagnosis, and 182 sera from patients with MBC. Distribution of histological/serological molecular markers and histoclinical parameters were compared using the standard Chi-2 test. Results Nectin-4 was not detected in normal breast epithelium. By contrast, Nectin-4 was expressed in 61% of ductal breast carcinoma vs 6% in lobular type. Expression of Nectin-4 strongly correlated with the basal-like markers EGFR, P53, and P-cadherin, and negatively correlated with the luminal-like markers ER, PR and GATA3. All but one ER/PR-negative tumors expressed Nectin-4. The detection of Nectin-4 in serum improves the follow-up of patients with MBC: the association CEA/CA15.3/Nectin-4 allowed to monitor 74% of these patients compared to 67% with the association CEA/CA15.3. Serum Nectin-4 is a marker of disease progression, and levels

Development and validation of a genotype 3 recombinant protein-based immunoassay for hepatitis E virus serology in swine

Directory of Open Access Journals (Sweden)

W.H.M. van der Poel

2014-04-01

Full Text Available Hepatitis E virus (HEV is classified within the family Hepeviridae, genus Hepevirus. HEV genotype 3 (Gt3 infections are endemic in pigs in Western Europe and in North and South America and cause zoonotic infections in humans. Several serological assays to detect HEV antibodies in pigs have been developed, at first mainly based on HEV genotype 1 (Gt1 antigens. To develop a sensitive HEV Gt3 ELISA, a recombinant baculovirus expression product of HEV Gt3 open reading frame-2 was produced and coated onto polystyrene ELISA plates. After incubation of porcine sera, bound HEV antibodies were detected with anti-porcine anti-IgG and anti-IgM conjugates. For primary estimation of sensitivity and specificity of the assay, sets of sera were used from pigs experimentally infected with HEV Gt3. For further validation of the assay and to set the cutoff value, a batch of 1100 pig sera was used. All pig sera were tested using the developed HEV Gt3 assay and two other serologic assays based on HEV Gt1 antigens. Since there is no gold standard available for HEV antibody testing, further validation and a definite setting of the cutoff of the developed HEV Gt3 assay were performed using a statistical approach based on Bayes' theorem. The developed and validated HEV antibody assay showed effective detection of HEV-specific antibodies. This assay can contribute to an improved detection of HEV antibodies and enable more reliable estimates of the prevalence of HEV Gt3 in swine in different regions.

Serologic evidence of influenza A (H14) virus introduction into North America

Science.gov (United States)

Latorre-Margalef, Neus; Ramey, Andy M.; Fojtik, Alinde; Stallknecht, David E.

2015-01-01

Although a diverse population of influenza A viruses (IAVs) is maintained among ducks, geese, shorebirds, and gulls, not all of the 16 avian hemagglutinin (HA) subtypes are equally represented (1). The 14th HA subtype, commonly known as the H14 subtype, was historically limited to isolates from the former Soviet Union in the 1980s (2) and was not subsequently detected until 2010, when isolated in Wisconsin, USA from long-tailed ducks and a white-winged scoter (3–5). In the United States, the H14 subtype has since been isolated in California (6), Mississippi, and Texas (7); and has been reported in waterfowl in Guatemala (7). In this study, we examined whether there was serologic evidence of H14 spread among ducks in North America before (2006–2010) and after (2011–2014) the initial detection of the H14 subtype virus on this continent.

Comparison of Methods for Oscillation Detection

DEFF Research Database (Denmark)

Odgaard, Peter Fogh; Trangbæk, Klaus

2006-01-01

This paper compares a selection of methods for detecting oscillations in control loops. The methods are tested on measurement data from a coal-fired power plant, where some oscillations are occurring. Emphasis is put on being able to detect oscillations without having a system model and without...... using process knowledge. The tested methods show potential for detecting the oscillations, however, transient components in the signals cause false detections as well, motivating usage of models in order to remove the expected signals behavior....

Serological differentiation of microsporidia with special reference to Trachipleistophora hominis

Directory of Open Access Journals (Sweden)

Cheney S.A.

2001-06-01

Full Text Available Myositis is a common clinical syndrome in advanced stages of AIDS. Trachipleistophora hominis (phylum Microspora has been detected in several cases of painful, immobilising myositis in AIDS patients. Enzyme linked immunosorbent assays (ELISAs and Western blotting of protein profiles separated by SDS PAGE were used to determine whether this species could be detected and differentiated by serology. Sixteen microsporidia, including several species known to infect man and species infecting fish, crustaceans and a mosquito, were used as antigen. Each species had a unique profile of SDS PAGE-separated proteins. In Western blots, mouse antiserum, raised to T. hominis and selected for its high ELISA specificity, bound to antigens ranging from less than 25 kDa to greater than 250 kDa with major bands at 39-44 kDa and 98-150 kDa on T. hominis protein profiles. The serum also recognised some high molecular weight antigens in the profiles of Vavraia culicis, Heterosporis anguillarum, and three species of Pleistophora but none in the remaining genera examined. It was concluded that ELISA and Western blotting could be used to detect and differentiate T. hominis in muscle biopsy tissue from patients with myositis. However, sera from T. hominis infected patients in the terminal stages of AIDS would not be useful for detection of infections because of a sharp decline in antibody level.

A Voltage Quality Detection Method

DEFF Research Database (Denmark)

Chen, Zhe; Wei, Mu

2008-01-01

This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

Molecular and serological detection of occult hepatitis B virus ...

African Journals Online (AJOL)

hepatitis B surface antigen-negative blood donors in Malaysia. ... Objective: This study aimed to detect occult hepatitis B virus in hepatitis B surface .... of the standard HBV-positive serum and the detection ... in general population ranges from 1.5 to 9.8% but report- .... Putra, Malaysia for their financial support of this research.

Serological diagnosis of hepatocellular carcinoma: challenges and opportunities

Directory of Open Access Journals (Sweden)

LU Fengmin

2017-07-01

Full Text Available Serological markers have the features of noninvasiveness and simple operation and thus have become a research hotspot in the diagnosis of hepatocellular carcinoma. This article briefly introduces the role of the conventional serological marker alpha-fetoprotein (AFP in assisting the diagnosis and predicting the prognosis of HBV-related liver cancer, as well as the clinical value of new markers such as alpha-fetoprotein-L3 and abnormal prothrombin/des-γ-carboxy prothrombin. Based on literature review, the possibility of serum Golgi protein 73 used for laboratory auxiliary diagnosis of hepatocellular carcinoma has been denied. The results of the author′s experiment suggest that serum GP73 measurement can be used as a laboratory diagnostic index for progressive liver fibrosis and liver cirrhosis.

Serologic surveillance of wild and pen-reared ring-necked pheasants (Phasianus colchicus) as a method of understanding disease reservoirs

Science.gov (United States)

Dwight, Ian; Coates, Peter S.; Stoute, Simone T.; Senties-Cue, C. Gabriel; Gharpure, Radhika V.; Pitesky, Maurice E.

2018-01-01

We investigated exposure to infectious diseases in wild (n=33) and pen-reared (n=12) Ring-necked Pheasants (Phasianus colchicus) in the Central Valley of California during 2014 and 2015. Serologic tests were positive for antibodies against hemorrhagic enteritis (HE), infectious bursal disease (IBD), and Newcastle disease (ND) viruses in both wild and pen-reared pheasants.

Leak detection by vibrational diagnostic methods

International Nuclear Information System (INIS)

Siklossy, P.

1983-01-01

The possibilities and methods of leak detection due to mechanical failures in nuclear power plants are reviewed on the basis of the literature. Great importance is attributed to vibrational diagnostic methods for their adventageous characteristics which enable them to become final leak detecting methods. The problems of noise analysis, e.g. leak detection by impact sound measurements, probe characteristics, gain problems, probe selection, off-line analysis and correlation functions, types of leak noises etc. are summarized. Leak detection based on noise analysis can be installed additionally to power plants. Its maintenance and testing is simple. On the other hand, it requires special training and measuring methods. (Sz.J.)

Serology of Typhoid Fever in an Area of Endemicity and Its Relevance to Diagnosis

Science.gov (United States)

House, Deborah; Wain, John; Ho, Vo A.; Diep, To S.; Chinh, Nguyen T.; Bay, Phan V.; Vinh, Ha; Duc, Minh; Parry, Christopher M.; Dougan, Gordon; White, Nicholas J.; Hien, Tran Tinh; Farrar, Jeremy J.

2001-01-01

Currently, the laboratory diagnosis of typhoid fever is dependent upon either the isolation of Salmonella enterica subsp. enterica serotype Typhi from a clinical sample or the detection of raised titers of agglutinating serum antibodies against the lipopolysaccharide (LPS) (O) or flagellum (H) antigens of serotype Typhi (the Widal test). In this study, the serum antibody responses to the LPS and flagellum antigens of serotype Typhi were investigated with individuals from a region of Vietnam in which typhoid is endemic, and their usefulness for the diagnosis of typhoid fever was evaluated. The antibody responses to both antigens were highly variable among individuals infected with serotype Typhi, and elevated antibody titers were also detected in a high proportion of serum samples from healthy subjects from the community. In-house enzyme-linked immunosorbent assays (ELISAs) for the detection of specific classes of anti-LPS and antiflagellum antibodies were compared with other serologically based tests for the diagnosis of typhoid fever (Widal TO and TH, anti-serotype Typhi immunoglobulin M [IgM] dipstick, and IDeaL TUBEX). At a specificity of ≥0.93, the sensitivities of the different tests were 0.75, 0.55, and 0.52 for the anti-LPS IgM, IgG, and IgA ELISAs, respectively; 0.28 for the antiflagellum IgG ELISA; 0.47 and 0.32 for the Widal TO and TH tests, respectively; and 0.77 for the anti-serotype Typhi IgM dipstick assay. The specificity of the IDeaL TUBEX was below 0.90 (sensitivity, 0.87; specificity, 0.76). The serological assays based on the detection of IgM antibodies against either serotype Typhi LPS (ELISA) or whole bacteria (dipstick) had a significantly higher sensitivity than the Widal TO test when used with a single acute-phase serum sample (P ≤ 0.007). These tests could be of use for the diagnosis of typhoid fever in patients who have clinical typhoid fever but are culture negative or in regions where bacterial culturing facilities are not available

Serological evidence of herpesvirus infection in gibbons

Directory of Open Access Journals (Sweden)

Ratanakorn Parntep

2002-05-01

Full Text Available Abstract Background Herpesviruses are not only infectious agents of worldwide distribution in humans, but have also been demonstrated in various non-human primates as well. Seventy-eight gibbons were subjected to serological tests by ELISA for herpes simplex virus type 1 (HSV-1, herpes simplex virus type 2 (HSV-2, Epstein-Barr virus (EBV and cytomegalovirus (CMV. Results The prevalence of IgG antibodies against HSV-1, HSV-2, EBV and CMV was 28.2%, 28.2%, 14.1% and 17.9%, respectively. Conclusions Antigenic cross-reactivity is expected to exist between the human herpesviruses and gibbon herpesviruses. Gibbons have antibodies to human herpesviruses that may reflect zoonotic infection with human herpesviruses or infection with indigenous gibbon herpesviruses. Therefore, it is difficult to draw concrete conclusions from serological studies alone. Identification should be based on further isolation and molecular characterization of viruses from seropositive animals.

A fast and highly sensitive blood culture PCR method for clinical detection of Salmonella enterica serovar Typhi

Directory of Open Access Journals (Sweden)

Zhou Liqing

2010-04-01

Full Text Available Abstract Background Salmonella Typhi causes an estimated 21 million new cases of typhoid fever and 216,000 deaths every year. Blood culture is currently the gold standard for diagnosis of typhoid fever, but it is time-consuming and takes several days for isolation and identification of causative organisms. It is then too late to initiate proper antibiotic therapy. Serological tests have very low sensitivity and specificity, and no practical value in endemic areas. As early diagnosis of the disease and prompt treatment are essential for optimal management, especially in children, a rapid sensitive detection method for typhoid fever is urgently needed. Although PCR is sensitive and rapid, initial research indicated similar sensitivity to blood culture and lower specificity. We developed a fast and highly sensitive blood culture PCR method for detection of Salmonella Typhi, allowing same-day initiation of treatment after accurate diagnosis of typhoid. Methods An ox bile tryptone soy broth was optimized for blood culture, which allows the complete lysis of blood cells to release intracellular bacteria without inhibiting the growth of Salmonella Typhi. Using the optimised broth Salmonella Typhi bacteria in artificial blood samples were enriched in blood culture and then detected by a PCR targeting the fliC-d gene of Salmonella Typhi. Results Tests demonstrated that 2.4% ox bile in blood culture not only lyzes blood cells completely within 1.5 hours so that the intracellular bacteria could be released, but also has no inhibiting effect on the growth of Salmonella Typhi. Three hour enrichment of Salmonella Typhi in tryptone soya broth containing 2.4% ox bile could increase the bacterial number from 0.75 CFU per millilitre of blood which is similar to clinical typhoid samples to the level which regular PCR can detect. The whole blood culture PCR assay takes less than 8 hours to complete rather than several days for conventional blood culture

A Serological Protein Microarray for Detection of Multiple Cross-Reactive Flavivirus Infections in Horses for Veterinary and Public Health Surveillance.

Science.gov (United States)

Cleton, N B; van Maanen, K; Bergervoet, S A; Bon, N; Beck, C; Godeke, G-J; Lecollinet, S; Bowen, R; Lelli, D; Nowotny, N; Koopmans, M P G; Reusken, C B E M

2017-12-01

The genus Flavivirus in the family Flaviviridae includes some of the most important examples of emerging zoonotic arboviruses that are rapidly spreading across the globe. Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV) and Usutu virus (USUV) are mosquito-borne members of the JEV serological group. Although most infections in humans are asymptomatic or present with mild flu-like symptoms, clinical manifestations of JEV, WNV, SLEV, USUV and tick-borne encephalitis virus (TBEV) can include severe neurological disease and death. In horses, infection with WNV and JEV can lead to severe neurological disease and death, while USUV, SLEV and TBEV infections are mainly asymptomatic, however, and induce antibody responses. Horses often serve as sentinels to monitor active virus circulation in serological surveillance programmes specifically for WNV, USUV and JEV. Here, we developed and validated a NS1-antigen protein microarray for the serological differential diagnosis of flavivirus infections in horses using sera of experimentally and naturally infected symptomatic as well as asymptomatic horses. Using samples from experimentally infected horses, an IgG and IgM specificity of 100% and a sensitivity of 95% for WNV and 100% for JEV was achieved with a cut-off titre of 1 : 20 based on ROC calculation. In field settings, the microarray identified 93-100% of IgG-positive horses with recent WNV infections and 87% of TBEV IgG-positive horses. WNV IgM sensitivity was 80%. Differentiation between closely related flaviviruses by the NS1-antigen protein microarray is possible, even though we identified some instances of cross-reactivity among antibodies. However, the assay is not able to differentiate between naturally infected horses and animals vaccinated with an inactivated WNV whole-virus vaccine. We showed that the NS1-microarray can potentially be used for diagnosing and distinguishing flavivirus infections in horses and for public

Toxoplasmosis: Seroprevalence in pregnant women, and serological and molecular screening in neonatal umbilical cord blood.

Science.gov (United States)

Shieh, Mahshad; Didehdar, Mojtaba; Hajihossein, Reza; Ahmadi, Farzam; Eslamirad, Zahra

2017-10-01

Toxoplasmosis is a common zoonotic disease that can also be transmitted from the mother to the embryo, with the risk of congenital infection varying around the world. The aim of this study was to screen pregnant women and their neonates for toxoplasmosis by serologic and molecular methods and assess the impact of risk factors associated with toxoplasmosis on the rate of congenital infection. This study was conducted at a regional maternity hospital in Arak, the capital of the Markazi Province in Iran, during a period of six months. All selected pregnant women (n=261) and the corresponding cord blood samples were serologically screened for toxoplasmosis, with seropositive samples also undergoing molecular testing. Demographic data, as well as information related to the risk factors associated with the transmission of the disease, were collected from mothers and their neonates. The detection of anti-Toxoplasma antibodies and the extraction of DNA from blood samples were conducted using commercial kits. Results showed that the sera of 87 maternal blood samples (33.3%) and 40 cord blood samples (15.3%) were positive for anti-Toxoplasma antibodies (IgG and/or IgM). Molecular screening of the seropositive samples only identified one positive cord blood sample. In other words, the diagnosis of congenital toxoplasmosis was definitive in only one neonate. There was no significant association between the risk of parasite transmission and neonatal seropositivity (p >0.05). Therefore, the results showed that the prevalence of congenital toxoplasmosis in the studied area was consistent with the global rate and suggest that the implementation of newborn screening and follow-up testing could help reduce the disease risk. Copyright © 2017 Elsevier B.V. All rights reserved.

Advances in Candida detection platforms for clinical and point-of-care applications

Science.gov (United States)

Safavieh, Mohammadali; Coarsey, Chad; Esiobu, Nwadiuto; Memic, Adnan; Vyas, Jatin Mahesh; Shafiee, Hadi; Asghar, Waseem

2016-01-01

Invasive candidiasis remains one of the most serious community and healthcare-acquired infections worldwide. Conventional Candida detection methods based on blood and plate culture are time-consuming and require at least 2–4 days to identify various Candida species. Despite considerable advances for candidiasis detection, the development of simple, compact and portable point-of-care diagnostics for rapid and precise testing that automatically performs cell lysis, nucleic acid extraction, purification and detection still remains a challenge. Here, we systematically review most prominent conventional and nonconventional techniques for the detection of various Candida species, including Candida staining, blood culture, serological testing and nucleic acid-based analysis. We also discuss the most advanced lab on a chip devices for candida detection. PMID:27093473

Diagnostic Value of Culture and Serological Tests in the Diagnosis of Histoplasmosis in HIV and non-HIV Colombian Patients

Science.gov (United States)

Arango-Bustamante, Karen; Restrepo, Angela; Cano, Luz Elena; de Bedout, Catalina; Tobón, Angela Maria; González, Angel

2013-01-01

We determined the value of culture and serological tests used to diagnose histoplasmosis. The medical records of 391 histoplasmosis patients were analyzed. Diagnosis of the mycosis was assessed by culture, complement fixation, and immunodiffusion tests; 310 patients (79.5%) were male, and 184 patients (47.1%) were infected with human immunodeficiency virus (HIV). Positivity value for cultures was 35.7% (74/207), reactivity of serological tests was 95.2% (160/168), and a combination of both methodologies was 16.9% (35/207) for non-HIV patients. Positivity value for cultures was 75.0% (138/184), reactivity of serological tests was 92.4% (85/92), and a combination of both methodologies was 26.0% (48/184) for HIV/acquired immunodeficiency syndrome (AIDS) patients; 48.1% (102/212) of extrapulmonary samples from HIV/AIDS patients yielded positive cultures compared with 23.1% (49/212) in non-HIV patients. Lymphocyte counts made for 33.1% (61/184) of HIV/AIDS patients showed a trend to low CD4+ numbers and higher proportion of positive cultures. These results indicate that culture is the most reliable fungal diagnostic method for HIV/AIDS patients, and contrary to what is generally believed, serological assays are useful for diagnosing histoplasmosis in these patients. PMID:24043688

Serological comparison of selected isolates of Aeromonas salmonicida ssp. Salmonicida

Science.gov (United States)

Hahnel, G.B.; Gould, R.W.; Boatman, E.S.

1983-01-01

Eight isolates of Acronionus salmonicida ssp. salmonicida were collected during furunculosis epizootics in North American Pacific coast states and provinces. Both virulent and avirulent forms of each isolate, confirmed by challenge and electron microscopy, were examined. Serological comparisons by cross-absorption agglutination tests revealed no serological differences between isolates. Using the double diffusion precipitin test, a single band was observed when antigen from a sonicated virulent strain was reacted with antiserum against a sonicated, virulent strain absorbed with homologous, avirulent strain. The presence of the single band was eliminated by excess sonication.

Development and evaluation of a blocking enzyme-linked immunosorbent assay and virus neutralization assay to detect antibodies to viral hemorrhagic septicemia virus

Science.gov (United States)

Wilson, Anna; Goldberg, Tony; Marcquenski, Susan; Olson, Wendy; Goetz, Frederick; Hershberger, Paul; Hart, Lucas M.; Toohey-Kurth, Kathy

2014-01-01

Viral hemorrhagic septicemia virus (VHSV) is a target of surveillance by many state and federal agencies in the United States. Currently, the detection of VHSV relies on virus isolation, which is lethal to fish and indicates only the current infection status. A serological method is required to ascertain prior exposure. Here, we report two serologic tests for VHSV that are nonlethal, rapid, and species independent, a virus neutralization (VN) assay and a blocking enzyme-linked immunosorbent assay (ELISA). The results show that the VN assay had a specificity of 100% and sensitivity of 42.9%; the anti-nucleocapsid-blocking ELISA detected nonneutralizing VHSV antibodies at a specificity of 88.2% and a sensitivity of 96.4%. The VN assay and ELISA are valuable tools for assessing exposure to VHSV.

Serum 14-3-3η is a novel marker that complements current serological measurements to enhance detection of patients with rheumatoid arthritis

NARCIS (Netherlands)

Maksymowych, Walter P.; Naides, Stanley J.; Bykerk, Vivian; Siminovitch, Katherine A.; van Schaardenburg, Dirkjan; Boers, Maarten; Landewé, Robert; van der Heijde, Désirée; Tak, Paul-P.; Genovese, Mark C.; Weinblatt, Michael E.; Keystone, Edward C.; Zhukov, Olga S.; Abolhosn, Rania W.; Popov, Joanna M.; Britsemmer, Karin; van Kuijk, Arno W.; Marotta, Anthony

2014-01-01

Serum 14-3-3η is a novel joint-derived proinflammatory mediator implicated in the pathogenesis of rheumatoid arthritis (RA). In our study, we assessed the diagnostic utility of 14-3-3η and its association with standard clinical and serological measures. A quantitative ELISA was used to assess

Detection of IgM and IgG antibodies to Chlamydophila pneumoniae in pediatric community-acquired lower respiratory tract infections

Directory of Open Access Journals (Sweden)

Surinder Kumar

2011-01-01

Full Text Available Context: Chlamydophila pneumoniae (C. pneumoniae is an emerging infectious agent with a spectrum of clinical manifestations including lower and upper respiratory tract infections. Aims: To investigate the role of C. pneumoniae in community-acquired lower respiratory tract infections (LRTIs in children using serological tests. Settings and Design: Two hundred children, age 2 months to 12 years, hospitalized for community-acquired LRTIs were investigated for C. pneumoniae etiology. Materials and Methods: We investigated 200 children hospitalized for community-acquired LRTIs, using ELISA for detecting anti-C. pneumoniae IgM and IgG antibodies. The demographic, clinical and radiological findings for C. pneumoniae antibody positive and C. pneumoniae antibody negative cases were compared. Statistical Analysis Used: Data analysis was performed by Chi-square test and Fisher′s exact tests using Epi Info (2002. Results: Clinical and radiological findings in both the groups were comparable. Serological evidence of C. pneumoniae infection was observed in 12 (6% patients; specific IgM antibodies were detected in 11 (91.67%; specific IgG antibodies in 1 (8.33% patients, while 4-fold rise in C. pneumoniae IgG antibody titers were noted in none of the patients. Conclusions: C. pneumoniae has a role in community-acquired LRTIs, even in children aged < 5 years. Serological detection using ELISA would enable pediatricians in better management of C. pneumoniae infections.

HSV Serologic Testing for Pregnant Women: Willingness to Be Tested and Factors Affecting Testing

Directory of Open Access Journals (Sweden)

David A. Baker

2011-01-01

Full Text Available Objective. This prospective study was undertaken to evaluate pregnant women's willingness to undergo HSV type-specific serologic testing and factors affecting willingness in an obstetrics/gynecology ambulatory unit. Methods. At prenatal Visit 1, pregnant women (n=303 with no history of HSV-2 were tested for HSV-1/HSV-2 before and after they received counseling on genital and neonatal herpes. Results. In both the Unwilling Subgroup and the group that changed from being willing to being unwilling, the most common reasons for choosing not to be tested were not being at risk for genital herpes, being tested is too personal, and concern about what will be done with the results. Of the 134 participants in the Willing/Tested Subgroup, 27 (20% were HSV-2 seropositive and 81 (60% were HSV-1 seropositive. Conclusions. These results support the feasibility of HSV serologic testing and counseling in pregnant women.

A comparison of moving object detection methods for real-time moving object detection

Science.gov (United States)

Roshan, Aditya; Zhang, Yun

2014-06-01

Moving object detection has a wide variety of applications from traffic monitoring, site monitoring, automatic theft identification, face detection to military surveillance. Many methods have been developed across the globe for moving object detection, but it is very difficult to find one which can work globally in all situations and with different types of videos. The purpose of this paper is to evaluate existing moving object detection methods which can be implemented in software on a desktop or laptop, for real time object detection. There are several moving object detection methods noted in the literature, but few of them are suitable for real time moving object detection. Most of the methods which provide for real time movement are further limited by the number of objects and the scene complexity. This paper evaluates the four most commonly used moving object detection methods as background subtraction technique, Gaussian mixture model, wavelet based and optical flow based methods. The work is based on evaluation of these four moving object detection methods using two (2) different sets of cameras and two (2) different scenes. The moving object detection methods have been implemented using MatLab and results are compared based on completeness of detected objects, noise, light change sensitivity, processing time etc. After comparison, it is observed that optical flow based method took least processing time and successfully detected boundary of moving objects which also implies that it can be implemented for real-time moving object detection.

Sensitivity and specificity of various serologic tests for detection of Toxoplasma gondii infection in naturally infected sows

DEFF Research Database (Denmark)

Dubey, J.P.; Thulliez, P.; Weigel, R.M.

1995-01-01

antibodies by use of the modified agglutination test (MAT), latex agglutination test (LAT), indirect hemagglutination test (IHAT), and ELISA. Toxoplasma gondii was isolated from 170 hearts of 1,000 sows by bioassays in mice and cats. The percentage of samples diagnosed as positive for each of the serologic......, 29.4 and 98.3% for IHAT, 45.9 and 96.9% for LAT, and 72.9 and 85.9% for ELISA. The dye test was run at 1:20 dilution on only 893 sera because of bacterial contamination and presence of anticomplement substances. Dye test antibodies were found in 17.8% of the sera, and sensitivity and specificity were...

Helicobacter Pylori : Serological Testing and Treatment in ...

African Journals Online (AJOL)

Purpose: Helicobacter pylori has been strongly associated with dyspepsia and eradication of H. pylori after a non-invasive testing is an integral part of most management guidelines. This study evaluated the benefit of serological testing and treatment of H. pylori in Nigerian patients presenting with uninvestigated dyspepsia.

Sklerodermi--systemisk sklerose. Serologi, lungefunktion og overlevelse

DEFF Research Database (Denmark)

Ullman, S; Halberg, P; Wiik, A

1999-01-01

%, anti-Scl-70 antibodies in 13% and anti-U1-RNP antibodies in 6.5%. These serological groups were associated with limited SSc, diffuse SSc, and myositis/arthritis, respectively. The most prevalent finding at first lung function test was isolated reduction of diffusion capacity (47%). Further...

Raman Hyperspectral Imaging for Detection of Watermelon Seeds Infected with Acidovorax citrulli

OpenAIRE

Lee, Hoonsoo; Kim, Moon S.; Qin, Jianwei; Park, Eunsoo; Song, Yu-Rim; Oh, Chang-Sik; Cho, Byoung-Kwan

2017-01-01

The bacterial infection of seeds is one of the most important quality factors affecting yield. Conventional detection methods for bacteria-infected seeds, such as biological, serological, and molecular tests, are not feasible since they require expensive equipment, and furthermore, the testing processes are also time-consuming. In this study, we use the Raman hyperspectral imaging technique to distinguish bacteria-infected seeds from healthy seeds as a rapid, accurate, and non-destructive det...

Diagnostic Methods of Helicobacter pylori Infection for Epidemiological Studies: Critical Importance of Indirect Test Validation.

Science.gov (United States)

Miftahussurur, Muhammad; Yamaoka, Yoshio

2016-01-01

Among the methods developed to detect H. pylori infection, determining the gold standard remains debatable, especially for epidemiological studies. Due to the decreasing sensitivity of direct diagnostic tests (histopathology and/or immunohistochemistry [IHC], rapid urease test [RUT], and culture), several indirect tests, including antibody-based tests (serology and urine test), urea breath test (UBT), and stool antigen test (SAT) have been developed to diagnose H. pylori infection. Among the indirect tests, UBT and SAT became the best methods to determine active infection. While antibody-based tests, especially serology, are widely available and relatively sensitive, their specificity is low. Guidelines indicated that no single test can be considered as the gold standard for the diagnosis of H. pylori infection and that one should consider the method's advantages and disadvantages. Based on four epidemiological studies, culture and RUT present a sensitivity of 74.2-90.8% and 83.3-86.9% and a specificity of 97.7-98.8% and 95.1-97.2%, respectively, when using IHC as a gold standard. The sensitivity of serology is quite high, but that of the urine test was lower compared with that of the other methods. Thus, indirect test validation is important although some commercial kits propose universal cut-off values.

Isolation and serological differentiation of a herpesvirus from bobwhite quail (Colinus virginianus, L. 1758).

Science.gov (United States)

Kaleta, E F; Marschall, H J; Glünder, G; Stiburek, B

1980-01-01

An infectious agent was isolated from the liver of bobwhite quails (Colinus virginianus, L. 1758). The agent was sensitive to chloroform and its multiplication was inhibited by 5-iodine-2-deoxy-uridine. It passed filters with a pore diameter of 220 nm and more but not 100 nm filters. Electron microscopic examination revealed numerous nucleocapsids with hollow capsomeres and few enveloped particles in the supernatant fluids of infected cultures. The nucleocapsids were calculated to have 162 capsomeres on their surface. Using the plaque reduction method for neutralization tests no serological cross reactions could be detected between the quail isolate and sera against Marek's disease virus, turkey herpes-virus (HV), duck enteritis HV, infectious laryngotracheitis HV, amazon parrot HV, great horned owl HV, eagle owl HV, snowy owl HV, falcon HV, pigeon HV, Lake Victoria Cormorant HV, and stork HV. The isolate from bobwhite quail did only cross-react with antiserum against crane HV. It is concluded that the isolated virus is a member of the avian herpesvirus group and it is proposed to tentatively term it herpesvirus colinum (from Colinus virginianus = bobwhite quail).

21 CFR 866.3240 - Equine encephalomyelitis virus serological reagents.

Science.gov (United States)

2010-04-01

... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents... these viruses. Equine encephalomyelitis viruses are transmitted to humans by the bite of insects, such...

Rapid methods for detection of bacteria

DEFF Research Database (Denmark)

Corfitzen, Charlotte B.; Andersen, B.Ø.; Miller, M.

2006-01-01

Traditional methods for detection of bacteria in drinking water e.g. Heterotrophic Plate Counts (HPC) or Most Probable Number (MNP) take 48-72 hours to give the result. New rapid methods for detection of bacteria are needed to protect the consumers against contaminations. Two rapid methods...

Detection of oral HPV infection - Comparison of two different specimen collection methods and two HPV detection methods.

Science.gov (United States)

de Souza, Marjorie M A; Hartel, Gunter; Whiteman, David C; Antonsson, Annika

2018-04-01

Very little is known about the natural history of oral HPV infection. Several different methods exist to collect oral specimens and detect HPV, but their respective performance characteristics are unknown. We compared two different methods for oral specimen collection (oral saline rinse and commercial saliva kit) from 96 individuals and then analyzed the samples for HPV by two different PCR detection methods (single GP5+/6+ PCR and nested MY09/11 and GP5+/6+ PCR). For the oral rinse samples, the oral HPV prevalence was 10.4% (GP+ PCR; 10% repeatability) vs 11.5% (nested PCR method; 100% repeatability). For the commercial saliva kit samples, the prevalences were 3.1% vs 16.7% with the GP+ PCR vs the nested PCR method (repeatability 100% for both detection methods). Overall the agreement was fair or poor between samples and methods (kappa 0.06-0.36). Standardizing methods of oral sample collection and HPV detection would ensure comparability between future oral HPV studies. Copyright © 2017 Elsevier Inc. All rights reserved.

21 CFR 866.3480 - Respiratory syncytial virus serological reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3480... respiratory syncytial viruses from clinical specimens or from tissue culture isolates derived from clinical...

SEROLOGICAL DIAGNOSIS OF MODERN CHOLERA USING LIPOSOMAL ENTEROTOXIC DIAGNOSTICUM IN COMPLEMENT FIXATION TEST

Directory of Open Access Journals (Sweden)

I. V. Savelyeva

2013-01-01

Full Text Available Abstract. The possibility of serological diagnosis of cholera using cholera enterotoxic diagnostics kit in complement fixation test to detect anti-enterotoxic antibodies in sera of patients with cholera caused by hybrid variants of the El Tor biovar has been demonstrated. In patients with mild course of cholera anti-enterotoxic antibodies were detected in titres 1:50 and 1:200 in paired sera obtained on the 7th and 14th days of disease, respectively (fourfold titre increase. In patients with the course of medium severity 32-fold titre increase was recorded from the titre 1:100 in serum obtained on the fifth day of disease till the titre 1:3200 — on the twelfth day of disease. Antibodies titers reached 1:1600 and 1:800 were revealed in two medium course patients (adult and infant of 10 months on the sixth day of disease.

Serological Response to Treatment of Syphilis with Doxycycline Compared with Penicillin in HIV-infected Individuals

DEFF Research Database (Denmark)

Salado-Rasmussen, Kirsten; Hoffmann, Steen; Cowan, Susan

2016-01-01

Serological response to treatment of syphilis with orally administered doxycycline or intramuscularly administered penicillin was assessed in patients with concurrent HIV. All HIV-infected individuals diagnosed with syphilis attending 3 hospitals in Copenhagen, Denmark were included. Odds ratios...... (ORs) with 95% confidence intervals (CI) associated with serological outcome were modelled using propensity-score-adjusted logistic regression analysis. In total, 202 cases were treated with doxycycline or intramuscular penicillin. At 12 months, serological failure was observed in 12 cases (15......%) treated with doxycycline and in 8 cases (17%) treated with penicillin (OR 0.78 (95% CI 0.16-3.88), p = 0.76). The serological cure rate at 12 months was highest in patients with primary syphilis (100%), followed by patients with secondary (89%), early latent (71%) and late latent (67%) syphilis (p = 0...

Clinical Significance on the Serologic Profiles of HBV Markers in Various Liver Diseases

Energy Technology Data Exchange (ETDEWEB)

Yu, Byung Hee; Lee, Choong Kyu; Kim, Jong Hwa; Kim, Kwang Ill; Lee, Chong Suk [National Medical Canter, Seoul (Korea, Republic of)

1983-09-15

By radioimmunoassay, serologic markers of Hepatitis B Virus were studied in 44 patients with acute viral hepatitis, 10 patients with chronic persistent hepatitis, 10 patients with chronic active hepatitis, 44 patients with liver cirrhosis and 25 patients with primary hepatocellular carcinoma. The results were follows: 1) HBsAg was present in 77.2% of AVH, 40% of CPH, 80% of CAH, 55.1% of LC and 68% of PHC. In this HBsAg positive groups, all but one in liver cirrhosis had Anti-HBc. 2) Anti-HBs was most commonly detected in CPH and accompanied by Anti-HBc except one case in AVH. 3) Anti-HBc was the only marker detected in 11.4% of AVH, 20% of CPH, 20% of CAH, 16.3% of LC and 8% of PHC. 4) HBeAg was most commonly found in HBsAg-positive CPH but Anti-HBe was most frequently detected in PHC. 5) The absence of HBV markers was noted in 2.3% of AVH, 10% of CPH, 8% of PHC except CAH and LC.

Molecular, Serological And Microbiological Profiling Evidence Of ...

African Journals Online (AJOL)

All items that the boy had contact with including a laboratory coat, bunch of keys and shoes were swabbed. Finally samples of all the boy's food and drinks were taken. Microbiological, Serological and Polymerase Chain Reaction (PCR) Profiling Assays. l the samples were cultured on Sorbitol - MacConkey (SMAC) agar, ...

Serological pregnancy diagnosis of syphilis in pregnancy ...

African Journals Online (AJOL)

S.N. Naicker, J. Moodley, A. Van Middelkoop, R.C. Cooper. Abstract. Three different serological screening tests for syphilis were performed at the 'booking' visit of 500 antenatal patients at the King Edward VIII Hospital, Durban. The prevalence of ... The TPHA test is therefore advocated for screening patients for syphilis.

Characterization of the serological biomarkers associated with Sjögren’s syndrome in patients with recalcitrant dry eye disease

Directory of Open Access Journals (Sweden)

Matossian C

2016-07-01

Full Text Available Cynthia Matossian,1,2 Joan Micucci1 1Matossian Eye Associates, Doylestown, PA, USA; 2Department of Ophthalmology, Temple University School of Medicine, Philadelphia, PA, USA Purpose: The purpose was to characterize the biomarkers associated with Sjögren’s syndrome (SS identified in the serological samples of patients with recalcitrant dry eye disease; additionally, the modalities utilized in the treatment of dry eye disease were evaluated for subsets of patients with and without SS. Patients and methods: Data for this retrospective, single-center, pilot study were based on a chart review of 48 sequential patients with recalcitrant dry eye who were evaluated for SS via serological analysis. Data presented include the presence of the autoantibodies identified through the serological biomarker analysis and identification of the concurrent dry eye treatment modalities. Results: Eleven out of 48 patients (23% tested positive for biomarkers associated with SS. Autoantibodies for salivary protein-1, parotid secretory protein 1, and carbonic anhydrase VI, markers associated with the early development of SS, were detected in 91% (ten out of eleven of the patients who tested positive for SS, whereas 27% (three out of eleven of patients tested positive for the traditional SS markers, SS-A and/or SS-B. Common treatment modalities utilized in SS patients included omega-3 supplements (82%, topical cyclosporine (74%, and artificial tear solutions (64%, as compared to omega-3 supplements (80%, hot-mask therapy (77%, and artificial tear solutions (77%, in SS-negative patients. Conclusion: Evaluation for salivary protein-1, parotid secretory protein 1, and carbonic anhydrase VI biomarkers allows for identification of a subset of patients with biomarkers associated with SS that may not be identified through the traditional assessments (SS-A/SS-B. Earlier recognition of SS biomarkers allows for a confirmatory diagnosis and appropriate management of this

Some methods for the detection of fissionable matter; Quelques methodes de detection des corps fissiles

Energy Technology Data Exchange (ETDEWEB)

Guery, M [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1967-03-01

A number of equipments or processes allowing to detect uranium or plutonium in industrial plants, and in particular to measure solution concentrations, are studied here. Each method has its own field of applications and has its own performances, which we have tried to define by calculations and by experiments. The following topics have been treated: {gamma} absorptiometer with an Am source, detection test by neutron multiplication, apparatus for the measurement of the {alpha} activity of a solution, fissionable matter detection by {gamma} emission, fissionable matter detection by neutron emission. (author) [French] On examine ici plusieurs appareils ou procedes qui permettent de detecter l'uranium ou le plutonium dans les installations industrielles, et en particulier de mesurer les concentrations de solutions. Chacune des methodes a son domaine d'application et ses performances, qu'on a tente de definir par le calcul et par des experiences. Les sujets traites sont les suivants: absorptiometre {gamma} a source d'americium, essais de detection par multiplication neutronique, appareil de mesure de l'activite {alpha} d'une solution, detection des matieres fissiles par leur emission {gamma}, detection des matieres fissiles par leur emission neutronique. (auteur)

An Entropy-Based Network Anomaly Detection Method

Directory of Open Access Journals (Sweden)

Przemysław Bereziński

2015-04-01

Full Text Available Data mining is an interdisciplinary subfield of computer science involving methods at the intersection of artificial intelligence, machine learning and statistics. One of the data mining tasks is anomaly detection which is the analysis of large quantities of data to identify items, events or observations which do not conform to an expected pattern. Anomaly detection is applicable in a variety of domains, e.g., fraud detection, fault detection, system health monitoring but this article focuses on application of anomaly detection in the field of network intrusion detection.The main goal of the article is to prove that an entropy-based approach is suitable to detect modern botnet-like malware based on anomalous patterns in network. This aim is achieved by realization of the following points: (i preparation of a concept of original entropy-based network anomaly detection method, (ii implementation of the method, (iii preparation of original dataset, (iv evaluation of the method.

Detection of Yersinia enterocolitica serotype O:9 in the faeces of cattle with false positive reactions in serological tests for brucellosis in Ireland.

Science.gov (United States)

O'Grady, Don; Kenny, Kevin; Power, Seamus; Egan, John; Ryan, Fergus

2016-10-01

Intestinal infection by Yersinia enterocolitica serotype O:9 (YeO9) in cattle has been linked to false positive serological reactivity (FPSR) in diagnostic tests for brucellosis. Although eradicated in Ireland, brucellosis monitoring still identifies seropositive animals, usually one or two (termed singletons) per herd, which are classed as FPSR. To investigate a link between FPSR and YeO9, faeces and blood were collected from singleton FPSR cattle, and from companion animals, in eight selected herds with more than one FPSR animal, for YeO9 culture and Brucella serology. YeO9 was isolated from 76/474 (16%) FPSR singletons in 309 herds, but not from any of 621 animals in 122 control non-FPSR herds. In the FPSR herds 52/187 (27.8%) animals were culture positive, and 17% of the isolates were from seronegative animals. Seropositive animals were more likely to have a rising antibody titre when culture positive. Copyright © 2016 Elsevier Ltd. All rights reserved.

DIAGNOSTIC VALUE OF SEROLOGICAL MARKERS OF RHEUMATOID ARTHRITIS

Directory of Open Access Journals (Sweden)

Aleksei Leonidovich Maslaynski

2012-01-01

Full Text Available Rheumatoid arthritis (RA is a classic autoimmune disease associated with the production of wide range of autoantibodies, and their detection has diagnostic and prognostic implication. The objective of this study was to estimate the diagnostic value of antibodies against modified citrullinated vimentin (AMCV and nuclear antigen RA33 of the IgA rheumatoid factor (RF versus the value of routinely used profile of autoantibodies in diagnostic work-up of RA. Material and methods. 253 patients with RA prehistory of varying duration were included into the study group. The control group was comprised of 92 patients, including patients with seronegative spondyloarthropathies and diffuse connective tissue diseases, as well as sex and age matched healthy controls. Serum levels of IgM and IgA RF, antibodies against cyclic citrullinated peptide (ACCP, ACMV, anti-keratin antibodies (AKA, antibodies against RA33 antigen (ARA33 and antinuclear factor (ANF were measured in all patients and controls. Results and discussion. Diagnostic sensitivity of AMCV equaled 78%, ACCP — 77%, IgM RF — 71%, IgA RF — 43%, AKA — 43%, ARA33 — 31% and ANF — 31%. All anti-citrullinic antibodies (AKA, ACCP, ACMV were significantly more commonly associated with IgM RF. Among RF and ACCP seronegative patients ACMV were found in 24% cases with 20 IU/Ml detection threshold, and in 21% — with 30 IU/Ml, allowing to increase diagnostic specificity of the test up to 91% with the increment of diagnostic threshold. Incidence of ARA33 was not significantly different among the RF and ACCP positive or negative subgroups, thus making ARA33 an independent RA marker. Specificity of this marker was 87,9%, thus making it inferior to RF and ACCP by a composite of diagnostic characteristics. Conclusions. Integrated measurement of ACMV and ARA33 is a rational approach at the second stage of serologic testing work-up in suspected cases of RA onset, when initial RF and ACCP tests were negative.

empiric treatment based on helicobacter pylori serology cannot ...

African Journals Online (AJOL)

EMPIRIC TREATMENT BASED ON. HELICOBACTER PYLORI SEROLOGY. CANNOT SUBSTITUTE FOR EARLY. ENDOSCOPY IN THE. MANAGEMENT OF DYSPEPTIC. RURAL BLACK AFRICANS. Stephen JD O'Keefe, B Salvador, J Nainkin, S Majikir H. Stevens, A Atherstone. Background_ Evidence that chronic gastric ...

21 CFR 866.3550 - Salmonella spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3550 Salmonella... isolates derived from clinical specimens. Additionally, some of these reagents consist of antisera... clinical specimens or cultured isolates derived from clinical specimens. The identification aids in the...

Request for HIV serology in primary care: A survey of medical and nursing professionals.

Science.gov (United States)

Pichiule-Castañeda, Myrian; Domínguez-Berjón, M Felicitas; Esteban-Vasallo, María D; García-Riolobos, Carmen; Álvarez-Castillo, M Carmen; Astray-Mochales, Jenaro

2018-01-15

In the Community of Madrid there is 42.7% late HIV diagnosis. Primary care is the gateway to the health system and the frequency of serological tests requested by these professionals is unknown. The objectives were to establish the frequency of requests for HIV serology by medical and nursing primary care professionals in the Community of Madrid and the factors associated with these requests. An 'on-line' survey was conducted, asking professionals who participated in the evaluation study of strategies to promote early diagnosis of HIV in primary care in the Community of Madrid (ESTVIH) about the number of HIV-serology tests requested in the last 12 months. The association between HIV-serology requesting and the sociodemographic and clinical practice characteristics of the professionals was quantified using adjusted odds ratios (aOR) according to logistic regression. 264 surveys (59.5% physicians). Eighty-two point two percent of medical and 18.7% of nursing professionals reported requesting at least one HIV-serology in the last 12 months (median: 15 and 2 HIV-serology request, respectively). The doctors associated the request with: being male (aOR: 2.95; 95% CI: 0.82-10.56), being trained in pre-post HIV test counselling (aOR: 2.42; 95% CI: 0.84-6.93) and the nurses with: age (13 years; aOR: 3.02; 95% CI: 1.07-8.52). It is necessary to promote HIV testing and training in pre-post HIV test counselling for medical and nursing professionals in primary care centres. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Diagnosis Infeksi Streptococcus suis serotipe-2 pada Babi Secara Serologi dengan Muramidase Released Protein (SEROLOGICALLY DIAGNOSE OF STREPTOCOCCUS SUIS SEROTYPE-2 INFECTION IN PIGS BASED ON MURAMIDASE RELEASED PROTEIN

Directory of Open Access Journals (Sweden)

Siti Isrina Oktavia Salasia

2016-01-01

Full Text Available Streptococcus suis is a bacterial pathogen causing disease of pigs that characterized by meningitis,bronchopneumonia, arthritis, pericarditis, polyserositis and septicaemia. S. suis especially serotype 2 caninfect human (zoonotic with a special symptom of meningitis. The aim of this research was to detect S.suis infection based on muramidase released protein (MRP, as an important virulence marker of S. suis.S. suis serotype 2 strain P171 with phenotype of MRP+EF+ was used in this research. The MRP antigen wasextracted using lysozyme and separated by using sodium dodecyl sulphate-polyacrylamide gel electrophoresis(SDS-PAGE. Balb/c mice were imunized with 136 kDa MRP to produce antibody against MRP. Theantibody was evaluated by using enzyme linkage immunosorbent assay (ELISA. The results of the researchshowed that the antibody against MRP with molecular weight of 136 kDa could be produced on Balb/Cmice with the highest absorbance of 3,889 and could be used to detect field sera from infected pigs with200x dilution using ELISA antigen capture. Antibody against MRP could detect serologically of S. suisinfection in pigs in Papua with 50% seropositivy by using ELISA antigen capture and 40% by using dot blot.

The effect of HCV serological status on Doxorubicin based ...

African Journals Online (AJOL)

Karim Yousri Welaya

2014-09-10

Sep 10, 2014 ... Pretreatment evaluation included serological testing for HCV. FAC Adjuvant ... National Cancer Institute; IRB, Institutional Research Board; LVEF, ..... Mild Skin changes, including skin discoloration and nail changes, not ...

GMDD: a database of GMO detection methods.

Science.gov (United States)

Dong, Wei; Yang, Litao; Shen, Kailin; Kim, Banghyun; Kleter, Gijs A; Marvin, Hans J P; Guo, Rong; Liang, Wanqi; Zhang, Dabing

2008-06-04

Since more than one hundred events of genetically modified organisms (GMOs) have been developed and approved for commercialization in global area, the GMO analysis methods are essential for the enforcement of GMO labelling regulations. Protein and nucleic acid-based detection techniques have been developed and utilized for GMOs identification and quantification. However, the information for harmonization and standardization of GMO analysis methods at global level is needed. GMO Detection method Database (GMDD) has collected almost all the previous developed and reported GMOs detection methods, which have been grouped by different strategies (screen-, gene-, construct-, and event-specific), and also provide a user-friendly search service of the detection methods by GMO event name, exogenous gene, or protein information, etc. In this database, users can obtain the sequences of exogenous integration, which will facilitate PCR primers and probes design. Also the information on endogenous genes, certified reference materials, reference molecules, and the validation status of developed methods is included in this database. Furthermore, registered users can also submit new detection methods and sequences to this database, and the newly submitted information will be released soon after being checked. GMDD contains comprehensive information of GMO detection methods. The database will make the GMOs analysis much easier.

21 CFR 866.3300 - Haemophilus spp. serological reagents.

Science.gov (United States)

2010-04-01

... serological tests to identify Haemophilus spp. directly from clinical specimens or tissue culture isolates derived from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria belonging to the genus Haemophilus and provides epidemiological information on diseases cause by these...

21 CFR 866.3355 - Listeria spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3355 Listeria spp... from clinical specimens. Additionally, some of these reagents consist of Listeria spp. antisera... clinical specimens. The identification aids in the diagnosis of listeriosis, a disease caused by bacteria...

21 CFR 866.3085 - Brucella spp. serological reagents.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3085 Brucella spp... from clinical specimens or to identify antibodies to Brucella spp. in serum. Additionally, some of... to identify Brucella spp. directly from clinical specimens or cultured isolates derived from clinical...

Molecular and serological detection of bovine babesiosis in Indonesia

Directory of Open Access Journals (Sweden)

Azirwan Guswanto

2017-11-01

Full Text Available Abstract Background Bovine babesiosis, mainly caused by Babesia bovis and B. bigemina, is a huge threat to the livestock industry. In Indonesia, the current distribution of the disease is unknown due to a lack of scientific study. Methods In the present study, 487 blood samples were collected from cattle with different breeding and age groups in a broad geographical area across the archipelago. The presence of antibodies and current infections of B. bovis and B. bigemina were determined using enzyme-linked immunosorbent assay (ELISA, immunochromatographic test (ICT, and nested PCR (nPCR targeting B. bovis SBP-4 and B. bigemina RAP-1a genes. Sequence analysis was performed to the amplicon of B. bovis SBP-4, B. bigemina RAP-1a, and internal transcribed spacer (ITS region of ribosomal RNA of both Babesia species. Results In total, B. bovis positives were detected by ELISA, single-ICT, dual-ICT and nPCR in 340 (69.8%, 317 (65.1%, 307 (63.0% and 247 (50.7% samples, respectively. For B. bigemina, the positive samples were detected in 134 (27.5%, 130 (26.7%, 127 (26.1% and 93 (19.1%, respectively. Furthermore, mixed infections were found in 125 (25.7%, 113 (23.2%, 109 (22.4% and 52 (10.7% samples, respectively, which occurred only by chance and were not influenced by additional factors. The obtained nucleotide sequences of B. bovis SBP-4 and B. bigemina RAP-1a genes showed a high homology with other isolates from different countries. Further nucleotide sequence analysis using ITS region showed a great genetic diversity of B. bovis isolates among sampling locations; a lower diversity was found in B. bigemina ITS isolates. Conclusions These data revealed the current distribution of B. bovis and B. bigemina infection in cattle in Indonesia. The rate of infection varied among sampling locations, cattle breeds and age groups. Furthermore, B. bovis ITS isolates from Indonesia were found to be more genetically diverse than B. bigemina ITS isolates. The data

Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Radji, M.

2010-01-01

Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

A new fault detection method for computer networks

International Nuclear Information System (INIS)

Lu, Lu; Xu, Zhengguo; Wang, Wenhai; Sun, Youxian

2013-01-01

Over the past few years, fault detection for computer networks has attracted extensive attentions for its importance in network management. Most existing fault detection methods are based on active probing techniques which can detect the occurrence of faults fast and precisely. But these methods suffer from the limitation of traffic overhead, especially in large scale networks. To relieve traffic overhead induced by active probing based methods, a new fault detection method, whose key is to divide the detection process into multiple stages, is proposed in this paper. During each stage, only a small region of the network is detected by using a small set of probes. Meanwhile, it also ensures that the entire network can be covered after multiple detection stages. This method can guarantee that the traffic used by probes during each detection stage is small sufficiently so that the network can operate without severe disturbance from probes. Several simulation results verify the effectiveness of the proposed method

Comparison of three diagnostic methods for the detection of Toxoplasma gondii in free range chickens.

Science.gov (United States)

Hamidinejat, H; Nabavi, L; Mayahi, M; Ghourbanpoor, M; Pourmehdi Borojeni, M; Norollahi Fard, S; Shokrollahi, M

2014-09-01

Detection of Toxoplasma gondii in free range chickens is an indicator of the prevalence and distribution pattern of T. gondii in the environment. For this purpose, serologic assays especially modified agglutination test (MAT) is the main approach in the literature. The main goal of this study was to compare the polymerase chain reaction (PCR) based on amplification of first internal transcribed spacer (ITS-1) of ribosomal DNA gene, ELISA, and MAT to demonstrate T. gondii infection in free range chicken. A total of 106 adult free - range chickens were killed. Blood, whole heart and brain samples were taken. Sera were examined for the presence of T. gondii antibodies by ELISA and MAT as well. Selected tissues were used for PCR and bioassay in mice. The results revealed that 48.11%, 51.89%, 46.23% and 27.36% of chickens were positive in ELISA, MAT, PCR and bioassay in mice respectively. Good correlation between the results of PCR, ELISA and MAT were detected, but not with bioassay in mice. Compared with PCR, the sensitivity and specificity of ELISA were 92.16% and 96.36% respectively and also for MAT, the sensitivity was 81.81% and the specificity was 92.15%. The specific diagnosis of T. gondii infection in chickens is central to a better understanding of the epidemiology and dynamics of transmission among the various host population and is particularly important for planning effective optimal prevention and control programs. Our data in the present study demonstrated that PCR, ELISA and the MAT are helpful and precise methods to detect T. gondii in naturally infected free-range chickens.

Evaluation of a colloidal gold immunochromatography assay in the detection of Treponema pallidum specific IgM antibody in syphilis serofast reaction patients: a serologic marker for the relapse and infection of syphilis.

Science.gov (United States)

Lin, Li-Rong; Tong, Man-Li; Fu, Zuo-Gen; Dan, Bing; Zheng, Wei-Hong; Zhang, Chang-Gong; Yang, Tian-Ci; Zhang, Zhong-Ying

2011-05-01

patients was 34.55% and 36.01%, respectively. However, in serum cure group A, the positive rate of TP-IgM was 10.36% and 11.16%, respectively. The χ(2) test revealed that there is a significant difference in the positive rate between these 2 groups (P FTA-Abs method, had no significant difference in statistics. However, as detected by the GICA method and the FTA-Abs method, all the samples in serum cure group B and the control group were negative for TP-IgM. The TP-IgM-positive result demonstrated that active T. pallidum remained in the bodies of SSR patients. In summary, the characteristics of GICA TP-IgM correspond to that of FTA-Abs TP-IgM; this can be used as a serologic marker for the relapse and infection of syphilis in place of the conventional FTA-Abs IgM test. Copyright © 2011 Elsevier Inc. All rights reserved.

Empiric treatment based on Helicobacter Pylori serology cannont ...

African Journals Online (AJOL)

Background: Evidence that chronic gastric Helicobacter pylori (HP) infection is an aetiological factor in dyspepsia, peptic ulcer disease, gastric carcinoma and lymphoma has led to the suggestion that all serologically positive dyspeptic patients should be treated empirically with antibiotics to eradicate the infection, without ...

Differential distribution of age and HBV serological markers in liver cirrhosis and non-cirrhotic patients with primary liver cancer

Directory of Open Access Journals (Sweden)

XU Xiuhua

2013-03-01

Full Text Available ObjectiveTo compare the age distributions and presence of hepatitis B virus (HBV serological markers between primary hepatic cancer (PHC patients with and without liver cirrhosis. MethodsA total of 547 PHC cases were analyzed retrospectively. After dividing into two groups according to liver cirrhosis status, the between-group differences in age and HBV serological markers, such as hepatitis B e antigen (HBeAg status, were statistically compared using the Chi-squared test. ResultsThe number of cirrhotic and non-cirrhotic PHC patients was 265 and 282, respectively. HBV infection was present in 221 cirrhotic PHC patients and 256 non-cirrhotic PHC patients (834% vs. 90.8%. There was a substantial bias in the proportion of males to females in the cirrhotic PHC patients (7.83∶1. The number of PHC patients ＜60 years old was similar between the cirrhotic and non-cirrhotic groups, but the non-cirrhotic group had significantly more patients ＞60 years old (P＜0.005. In cirrhotic PHC patients, the HBV infection rate was highest in the ＜40 years old age group (96.7% and the HBeAg serological conversion rate was highest in the 40-60 years old age group (89.5%. In non-cirrhotic PHC patients, the 40-60 years old age group showed the highest HBV infection rate (90.3% but the lowest HBeAg serological conversion rate (80.0%. ConclusionPHC with liver cirrhosis mainly occurred in males, with the HBV infection rate being higher in individuals ＜60 years old. Non-cirrhotic PHC patients were more often ＞60 years old. Many of the HBV-infected PHC patients with cirrhosis had high HBeAg serological conversion rate.

Development and Validation of a Serologic Test Panel for Detection of Powassan Virus Infection in U.S. Patients Residing in Regions Where Lyme Disease Is Endemic.

Science.gov (United States)

Thomm, Angela M; Schotthoefer, Anna M; Dupuis, Alan P; Kramer, Laura D; Frost, Holly M; Fritsche, Thomas R; Harrington, Yvette A; Knox, Konstance K; Kehl, Sue C

2018-01-01

Powassan virus (POWV) is an emerging tick-borne arbovirus presenting a public health threat in North America. POWV lineage II, also known as deer tick virus, is the strain of the virus most frequently found in Ixodes scapularis ticks and is implicated in most cases of POWV encephalitis in the United States. Currently, no commercial tests are available to detect POWV exposure in tick-borne disease (TBD) patients. We describe here the development and analytical validation of a serologic test panel to detect POWV infections. The panel uses an indirect enzyme immunoassay (EIA) to screen. EIA-positive samples reflex to a laboratory-developed, POWV-specific immunofluorescence assay (IFA). The analytical sensitivity of the test panel was 89%, and the limit of detection was a plaque reduction neutralization test (PRNT) titer of 1:20. The analytical specificity was 100% for the IgM assay and 65% for the IgG assay when heterologous-flavivirus-positive samples were tested. On samples collected from regions where Lyme disease is endemic, seroprevalence for POWV in TBD samples was 9.4% (10 of 106) versus 2% when tested with non-TBD samples (2 of 100, P = 0.034). No evidence of POWV infection was seen in samples collected from a region where Lyme disease was not endemic (0 of 22). This test panel provides a sensitive and specific platform for detecting a serologic response to POWV early in the course of infection when neutralizing antibodies may not be detectable. Combined with clinical history, the panel is an effective tool for identifying acute POWV infection. IMPORTANCE Approximately 100 cases of POWV disease were reported in the United States over the past 10 years. Most cases have occurred in the Northeast (52) and Great Lakes (45) regions (https://www.cdc.gov/powassan/statistics.html). The prevalence of POWV in ticks and mammals is increasing, and POWV poses an increasing threat in a greater geographical range. In areas of the Northeast and Midwest where Lyme disease is

Raman Hyperspectral Imaging for Detection of Watermelon Seeds Infected with Acidovorax citrulli.

Science.gov (United States)

Lee, Hoonsoo; Kim, Moon S; Qin, Jianwei; Park, Eunsoo; Song, Yu-Rim; Oh, Chang-Sik; Cho, Byoung-Kwan

2017-09-23

The bacterial infection of seeds is one of the most important quality factors affecting yield. Conventional detection methods for bacteria-infected seeds, such as biological, serological, and molecular tests, are not feasible since they require expensive equipment, and furthermore, the testing processes are also time-consuming. In this study, we use the Raman hyperspectral imaging technique to distinguish bacteria-infected seeds from healthy seeds as a rapid, accurate, and non-destructive detection tool. We utilize Raman hyperspectral imaging data in the spectral range of 400-1800 cm -1 to determine the optimal band-ratio for the discrimination of watermelon seeds infected by the bacteria Acidovorax citrulli using ANOVA. Two bands at 1076.8 cm -1 and 437 cm -1 are selected as the optimal Raman peaks for the detection of bacteria-infected seeds. The results demonstrate that the Raman hyperspectral imaging technique has a good potential for the detection of bacteria-infected watermelon seeds and that it could form a suitable alternative to conventional methods.

A comparative study of an elisa test and an indirect immunofluorescence test for serological diagnosis of Babesia bovis infection

International Nuclear Information System (INIS)

Martins, J.R.; Cheong, F.H.; Correa, B.L.; Radley, D.E.; Cereser, V.H.

1998-01-01

Detection of antibodies to Babesia bovis in cattle is essential for the understanding of the epidemiology of babesiosis and this study was concerned with comparing the indirect fluorescent antibody with the ELISA. Both assays gave rise to 100% sensitivity whilst the ELISA was shown to be marginally more specific at 98%. The ease of use and low cost of the ELISA would make it the more obvious choice in conducting future serological surveys for this parasite. (author)

Isolation of Salmonella enterica and serologic reactivity to Leptospira interrogans in opossums (Didelphis virginiana) from Yucatán, México.

Science.gov (United States)

Ruiz-Pina, Hugo Antonio; Puc-Franco, Miguel Angel; Flores-Abuxapqui, Javier; Vado-Solis, Ignacio; Cardenas-Marrufo, María Fidelia

2002-01-01

The presence of Salmonella enterica and serologic evidence of infection by Leptospira interrogans, were detected in the opossum Didelphis virginiana in a semi-urban locality of the Yucatán State, México. Ninety-one opossums were captured during the period April 1996 and May 1998. From a total of 17 feces samples, four Salmonella enterica subsp. enterica serotypes (Sandiego, Newport, Anatum, and Minnesota), and one Salmonella enterica subsp. arizonae serovar O44:Z4,Z23:- were isolated. Some opossums presented mixed infections. From 81 sera samples, four (4.9%) were positive to antibodies to Leptospira serovars pomona and wolfii. Both animals infected with Salmonella enterica and those serologically positive to Leptospira interrogans were captured in peridomestic habitat. Opossums infected with Salmonella enterica, were captured in dry season, and those seropositive to Leptospira interrogans during the rainy season. The implications of infection and reactivity of these zoonotic pathogens in D. virginiana in the Yucatan state are briefly discussed.

Serological screening for cysticercosis in mentally altered individuals.

Science.gov (United States)

Sanzón, Fernando; Osorio, Ana M; Morales, José P; Isaza, Rodrigo; Cardona, Edgar; Moncayo, Luis C; Villota, Guido E; Zapata, Olga T; Palacio, Carlos A; Arbeláez, María P; Restrepo, Blanca I

2002-06-01

The parasitic infection neurocysticercosis may give rise to a variety of psychiatric manifestations that resemble, but are different from, primary psychiatric disorders. The aim of this study was to determine if among individuals from a neurocysticercosis-endemic area of Colombia who apparently had a psychiatric manifestation with associated neurological finding ('cases'), some could have been infected with Taenia solium cysticerci. This case-control study was done in individuals hospitalized in two mental institutions. The control-1 individuals were those classified with primary psychiatric disease, and the control-2 group consisted of healthy, non-hospitalized individuals. A serological test for cysticercosis was positive in 5/96 (5.1%) cases, 4/153 (2.6%) psychiatric controls, and 5/246 (2%) healthy controls. The data analysis indicated a weak association between the cases and a positive serology for neurocysticercosis (odds ratio > 2; P > 0.05). The lower education level of the cases influenced this association.

Case of rhesus antigen weak D type 4.2. (DAR category detection

Directory of Open Access Journals (Sweden)

L. L. Golovkina

2015-01-01

Full Text Available Serological methods of Rhesus antigens identification in humans cannot identify D-antigen variants. In this article the serological characteristics of Rhesus antigen D weak type 4.2. (Category DAR are described.

The importance of serological tests implementation in disseminated candidiasis diagnose.

Science.gov (United States)

Gegić, Merima; Numanović, Fatima; Delibegović, Zineta; Tihić, Nijaz; Nurkić, Mahmut; Hukić, Mirsada

2013-03-01

Candidiasis is defined as an infection or disease caused by a fungus of the genus Candida. Rate of disseminated candidiasis increases with the growth of the number of immunocompromised patients. In the the last few decades the incidence of disseminated candidiasis is in growth as well as the mortality rate. The aim of this survey is to show the importance of serological tests implementation in disseminated candidiasis diagnose. This is a prospective study involving 60 patients with malign diseases with and without clinical signs of disseminated candidiasis and 30 healthy people who represent the control group. Apart from hemoculture, detection of circulating mannan antigen and adequate antibodies of Candida species applying comercial ELISA test was determined in each patient. This survey deals with relevant factors causing disseminated candidiasis. This survey showed that the group of patients with clinical signs of disseminated candidiasis had more patients with positive hemoculture to Candida species, then the group of patients without clinical signs of disseminated candidiasis. The number of patients being examined and positive to antigens and antibodies was higher (p candidiasis (7/30; 23.3%), then in the group of patients without clinical signs of disseminated candidiasis (0/30; 0%): Average value of titra antigen was statistically higher (p candidiasis 6/30 (20%) of patients had Candida spp.positive hemocultures while in the group of patients without clinical signs of disseminated candidiasis 1/30 (3.3%) of patients had Candida spp. positive hemocultures, which was considerably higher (p candidiasis were statistically significant, while correlation of results of hemoculture and antibodies was insignificant. Because of low sensitivity of hemoculture and time needed for isolation of Candida spp., introducing serological tests in regular procedures would speed disseminated candidiasis diagnose.

Clinical benefit of gluten-free diet in screen-detected older celiac disease patients

Directory of Open Access Journals (Sweden)

Vilppula Anitta

2011-12-01

Full Text Available Abstract Background The utility of serologic screening for celiac disease is still debatable. Evidence suggests that the disorder remains undetected even in the older population. It remains obscure whether screening makes good or harm in subjects with long-standing gluten ingestion. We evaluated whether older subjects benefit from active detection and subsequent gluten free dietary treatment of celiac disease. Methods Thirty-five biopsy-proven patients aged over 50 years had been detected by serologic mass screening. We examined the disease history, dietary compliance, symptoms, quality of life and bone mineral density at baseline and 1-2 years after the commencement of a gluten-free diet. Symptoms were evaluated by gastrointestinal symptom rating scale and quality of life by psychological general well-being questionnaires. Small bowel biopsy, serology, laboratory parameters assessing malabsorption, and bone mineral density were investigated. Results Dietary compliance was good. The patients had initially low mean serum ferritin values indicating subclinical iron deficiency, which was restored by a gluten-free diet. Vitamin B12, vitamin D and erythrocyte folic acid levels increased significantly on diet. Celiac patients had a history of low-energy fractures more often than the background population, and the diet had a beneficial effect on bone mineral density. Alleviation in gastrointestinal symptoms was observed, even though the patients reported no or only subtle symptoms at diagnosis. Quality of life remained unchanged. Of all the cases, two thirds would have been diagnosed even without screening if the family history, fractures or concomitant autoimmune diseases had been taken carefully into account. Conclusions Screen-detected patients benefited from a gluten-free diet. We encourage a high index of suspicion and active case-finding in celiac disease as an alternative to mass screening in older patients.

Serologic Screening for Genital Herpes Infection: US Preventive Services Task Force Recommendation Statement.

Science.gov (United States)

Bibbins-Domingo, Kirsten; Grossman, David C; Curry, Susan J; Davidson, Karina W; Epling, John W; García, Francisco A R; Kemper, Alex R; Krist, Alex H; Kurth, Ann E; Landefeld, C Seth; Mangione, Carol M; Phillips, William R; Phipps, Maureen G; Pignone, Michael P; Silverstein, Michael; Tseng, Chien-Wen

2016-12-20

Genital herpes is a prevalent sexually transmitted infection in the United States, occurring in almost 1 in 6 persons aged 14 to 49 years. Infection is caused by 2 subtypes of the herpes simplex virus (HSV), HSV-1 and HSV-2. Antiviral medications may provide symptomatic relief from outbreaks but do not cure HSV infection. Neonatal herpes infection, while uncommon, can result in substantial morbidity and mortality. To update the 2005 US Preventive Services Task Force (USPSTF) recommendation on screening for genital herpes. The USPSTF reviewed the evidence on the accuracy, benefits, and harms of serologic screening for HSV-2 infection in asymptomatic persons, including those who are pregnant, as well as the effectiveness and harms of preventive medications and behavioral counseling interventions to reduce future symptomatic episodes and transmission to others. Based on the natural history of HSV infection, its epidemiology, and the available evidence on the accuracy of serologic screening tests, the USPSTF concluded that the harms outweigh the benefits of serologic screening for genital HSV infection in asymptomatic adolescents and adults, including those who are pregnant. The USPSTF recommends against routine serologic screening for genital HSV infection in asymptomatic adolescents and adults, including those who are pregnant. (D recommendation).

Hepatitis C prevalence and risk factors in hemodialysis patients in Central Brazil: a survey by polymerase chain reaction and serological methods

Directory of Open Access Journals (Sweden)

Carneiro Megmar AS

2001-01-01

Full Text Available An hemodialysis population in Central Brazil was screened by polymerase chain reaction (PCR and serological methods to assess the prevalence of hepatitis C virus (HCV infection and to investigate associated risk factors. All hemodialysis patients (n=428 were interviewed in eight dialysis units in Goiânia city. Blood samples were collected and serum samples screened for anti-HCV antibodies by an enzyme-linked immunosorbent assay (ELISA. Positive samples were retested for confirmation with a line immunoassay (LIA. All samples were also tested for HCV RNA by the PCR. An overall prevalence of 46.7% (CI 95%: 42-51.5 was found, ranging from 20.7% (CI 95%: 8.8-38.1 to 90.4% (CI 95%: 79.9-96.4 depending on the dialysis unit. Of the 428 patients, 185 were found to be seropositive by ELISA, and 167 were confirmed positive by LIA, resulting in an anti-HCV prevalence of 39%. A total of 131 patients were HCV RNA-positive. HCV viremia was present in 63.5% of the anti-HCV-positive patients and in 10.3% of the anti-HCV-negative patients. Univariate analysis of risk factors showed that the number of previous blood transfusions, transfusion of blood before mandatory screening for anti-HCV, length of time on hemodialysis, and treatment in multiple units were associated with HCV positivity. However, multivariate analysis revealed that blood transfusion before screening for anti-HCV and length of time on hemodialysis were significantly associated with HCV infection in this population. These data suggest that nosocomial transmission may play a role in the spread of HCV in the dialysis units studied. In addition to anti-HCV screening, HCV RNA detection is necessary for the diagnosis of HCV infection in hemodialysis patients.

Application of radioimmunoassay methods for malaria detection in two selected endemic areas in the Philippines

International Nuclear Information System (INIS)

Salazar, N.P.; Natera, E.S.; Pasay, C.J.; Tiu, W.U.

1995-01-01

Radioimmunoassay (RIA) technique was used with the synthetic peptide, (NANP)3 in detecting anti-sporozoite antibody (against Plasmodium falcifarum) in serum of persons residing in two (2) endimic areas in the Philippines. entomological surveys for sporozoite detection in mosquito vectors utilizing monoclonal antibodies (2A10 for P. falciparum and 2F2 for P. vivax) were likewise conducted in the same areas where serological surveys were performed. These two areas are located on separate islands, with varying malaria transmission seasons and levels of endemicity. Initial findings showed positive response to the CSP antigen (NANP)3 in detecting anti - P. falciparum antibodies in sera. Infection with sporozoites of P. falciparum and P. vivax in mosquito vectors were detected using monoclonal antibodies 2A10 and 2F2 respectively. The latter procedure was shown to be more sensitive than dissection of mosquito salivary glands. Initial study shows a heightened level of anti-(NANP)3 antibodies in both populations prior to the generally accepted peak of malaria season indicating that RIA with CSP antigen and specific MAbs can be a useful epidemiological tool for understanding the dynamics of malaria transmission as well as in monitoring control programmes based on reducing manvector contact. (author) 15 refs.,12 tabs

Microbiological and Serological Studies of some Poultry Pathogens ...

African Journals Online (AJOL)

Microbiological and Serological surveillance of 24 different species of wild water birds living around water sewage plants and fresh wetland water area in Khartoum state (Sudan) were carried out in the period from September 2011 to March 2012 during ringing operation. The presence of selected avian diseases including ...

21 CFR 866.3390 - Neisseria spp. direct serological test reagents.

Science.gov (United States)

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3390... Neisseria spp. directly from clinical specimens. The identification aids in the diagnosis of disease caused...

Serology of Patients with Ulcerative Colitis After Pouch Surgery Is More Comparable with that of Patients with Crohn's Disease.

Science.gov (United States)

Goren, Idan; Yahav, Lior; Tulchinsky, Hagit; Dotan, Iris

2015-10-01

The serologic status of patients with ulcerative colitis (UC) who develop postoperative pouchitis was compared with that of patients with Crohn's disease (CD) and unoperated patients with UC. Pouch patients were stratified into normal pouch, acute/recurrent acute pouchitis, and chronic pouchitis/Crohn's-like disease of the pouch groups. Antibodies against glycans associated with CD (anti-Saccharomyces cerevisiae, anti-laminaribioside, anti-chitobioside, and anti-mannobioside carbohydrate antibodies [ASCA, ALCA, ACCA, and AMCA, respectively]) were detected and correlated with type of inflammatory bowel disease and pouch behavior. A total of 501 patients with inflammatory bowel diseases were recruited: 250 (50%) CD, 124 (24.7%) unoperated UC, and 127 (25.3%) UC-pouch. At least 1 positive antibody was detected in 77.6% CD, 52.0% UC-pouch and 33.1% unoperated UC (P ACCA and AMCA prevalence in CD, UC-pouch and unoperated patients with UC were 33.2%, 24.4%, and 16.9% (P = 0.003 for all) and 35.2%, 26.8%, and 7.3%, respectively (P ACCA and AMCA is significantly increased in UC-pouch patients, suggesting that pouch surgery may trigger differential immune responses to glycans. The finding that the serology of UC-pouch patients shares similarities with that of patients with CD supports the notion that those 2 inflammatory bowel diseases share a common pathogenic pathway.

Performance of a Multiplex Serological Helicobacter pylori Assay on a Novel Microfluidic Assay Platform

Directory of Open Access Journals (Sweden)

Angela Filomena

2017-10-01

Full Text Available Infection with Helicobacter pylori (H. pylori occurs in 50% of the world population, and is associated with the development of ulcer and gastric cancer. Serological diagnostic tests indicate an H. pylori infection by detecting antibodies directed against H. pylori proteins. In addition to line blots, multiplex assay platforms provide smart solutions for the simultaneous analysis of antibody responses towards several H. pylori proteins. We used seven H. pylori proteins (FliD, gGT, GroEL, HpaA, CagA, VacA, and HP0231 and an H. pylori lysate for the development of a multiplex serological assay on a novel microfluidic platform. The reaction limited binding regime in the microfluidic channels allows for a short incubation time of 35 min. The developed assay showed very high sensitivity (99% and specificity (100%. Besides sensitivity and specificity, the technical validation (intra-assay CV = 3.7 ± 1.2% and inter-assay CV = 5.5 ± 1.2% demonstrates that our assay is also a robust tool for the analysis of the H. pylori-specific antibody response. The integration of the virulence factors CagA and VacA allow for the assessment of the risk for gastric cancer development. The short assay time and the performance of the platform shows the potential for implementation of such assays in a clinical setting.

[The results of serological studies in different foci of tropical and tertiary malaria].

Science.gov (United States)

Suleĭmanov, G D; Doan, Kh N; Le, T T; Chan, B; Chan, T U

1991-01-01

Attempt was made to determine the value of serologic indices of malaria surveys. Following uniformed methodological and technical approaches 3 foci of P. vivax and 6 foci of P. falciparum malaria were surveyed in different endemic zones of Vietnam and the USSR. It was shown that the most objective criteria for a foci classification is its serologic mean geometric titre. The latter in its turn directly depends of transmission longevity in a foci.

SPECIFICITY OF MANIFACTURING PROCESS VALIDATION FOR DIAGNOSTIC SEROLOGICAL DEVICES

Directory of Open Access Journals (Sweden)

O. Yu. Galkin

2018-02-01

Full Text Available The aim of this research was to analyze recent scientific literature, as well as national and international legislature on manifacturing process validation of biopharmaceutical production, in particular devices for serological diagnostics. Technology validation in the field of medical devices for serological diagnostics is most influenced by the Technical Regulation for Medical Devices for in vitro Diagnostics State Standards of Ukraine – SSU EN ISO 13485:2015 “Medical devices. Quality management system. Requirements for regulation”, SSU EN ISO 14971:2015 “Medical devices. Instructions for risk management”, Instruction ST-N of the Ministry of Healthcare of Ukraine 42-4.0:2014 “Medications. Suitable industrial practice”, State Pharmacopoeia of Ukraine and Instruction ICH Q9 on risk management. Current recommendations for validations of drugs manufacturing process, including biotechnological manufacturing, can not be directly applied to medical devices for in vitro diagnostics. It was shown that the specifics of application and raw materials require individual validation parameters and process validations for serological diagnostics devices. Critical parameters to consider in validation plans were provided for every typical stage of production of in vitro diagnostics devices on the example of immunoassay kits, such as obtaining protein antigens, including recombinant ones, preparations of mono- and polyclonal antibodies, immunoenzyme conjugates and immunosorbents, chemical reagents etc. The bottlenecks of technologies for in vitro diagnostics devices were analyzed from the bioethical and biosafety points of view.

Serology, molecular detection and risk factors of Ehrlichia canis infection in dogs in Costa Rica.

Science.gov (United States)

Barrantes-González, Alexander V; Jiménez-Rocha, Ana E; Romero-Zuñiga, Juan José; Dolz, Gaby

2016-10-01

A cross-sectional study combining different serological and molecular techniques for the detection of Ehrlichia species in dogs and their ticks was carried out with data from all regions of Costa Rica. A seroprevalence of 32.1% (131/408), and infection with E. canis of 3.2% (13/407) was found, whereas 6.9% (9/130) of ticks attached to the dogs were PCR positive to E. canis. Higher prevalences were found outside the Greater Metropolitan Area (GMA). Risk factors associated with E. canis seropositivity were age, between 2 and 7 years (RR: 1.6, 95% CI: 1.2-2.2) and 8-15 years (RR: 1.8, 95% CI: 1.2-3.0), number of dogs/total of households [Dogs per Household Ratio (DHR) ≥3.1 (RR: 2.0; 95% CI: 1.4-3.0)], number of dogs infested with at least one tick/total of dogs sampled [Tick Infestation Prevalence (TIP)≥31% (RR: 2.1; 95% CI:1.3-3.3)] and living outside the GMA (RR: 1.7; 95% CI: 1.2-2.4) and being a mixed-breed dog (RR: 1.5; 95% CI: 1.1-2.1). Risk factors for E. canis PCR positive dogs were a depressive attitude (OR: 11.2; 95% CI: 1.1-115.9), fever (OR:4.8; 95% CI:1.2-19.3), DHR≥3.1 (OR: 5.7; 95% CI:1.7-19.2)], number of ticks/total of dogs sampled [Tick Distribution Ratio (TDR) ≥2.1 (OR: 6.5; 95% CI: 1.3-31.8)], and TIP≥40% (OR: 5.7; 95% CI: 1.7-19.2). This paper describes E. canis seroprevalence, PCR prevalence and tick analysis in dogs from Costa Rica, with associated clinical signs and owner perceptions. In summary, most of the E. canis infections in dogs in our country seemed to pass unnoticed by owners. Since most of the seropositive dogs (97.7%, 131/134) were negative for E. canis DNA in their blood, it is important to determine in future studies if these dogs recovered from the E. canis infection without any medication, or are persistently infected, and will develop chronic disease. Copyright © 2016 Elsevier GmbH. All rights reserved.

Leak detection method

International Nuclear Information System (INIS)

1978-01-01

This invention provides a method for removing nuclear fuel elements from a fabrication building while at the same time testing the fuel elements for leaks without releasing contaminants from the fabrication building or from the fuel elements. The vacuum source used, leak detecting mechanism and fuel element fabrication building are specified to withstand environmental hazards. (UK)

Serological cross-reactivity between Merkel cell polyomavirus and two closely related chimpanzee polyomaviruses.

Directory of Open Access Journals (Sweden)

Jérôme T J Nicol

Full Text Available Phylogenetic analyses based on the major capsid protein sequence indicate that Merkel cell polyomavirus (MCPyV and chimpanzee polyomaviruses (PtvPyV1, PtvPyV2, and similarly Trichodysplasia spinulosa-associated polyomavirus (TSPyV and the orangutan polyomavirus (OraPyV1 are closely related. The existence of cross-reactivity between these polyomaviruses was therefore investigated. The findings indicated serological identity between the two chimpanzee polyomaviruses investigated and a high level of cross-reactivity with Merkel cell polyomavirus. In contrast, cross-reactivity was not observed between TSPyV and OraPyV1. Furthermore, specific antibodies to chimpanzee polyomaviruses were detected in chimpanzee sera by pre-incubation of sera with the different antigens, but not in human sera.

Exploiting serological data to understand the epidemiology of foot ...

African Journals Online (AJOL)

Exploiting serological data to understand the epidemiology of foot-and-mouth disease virus serotypes circulating in Libya. Ibrahim Eldaghayes, Abdunaser Dayhum, Abdulwahab Kammon, Monier Sharif, Giancarlo Ferrari, Christianus Bartels, Keith Sumption, Donald P. King, Santina Grazioli, Emiliana Brocchi ...

Near-infrared Raman spectroscopy to detect anti-Toxoplasma gondii antibodies in blood sera of domestic cats

Science.gov (United States)

Duarte, Janaina; Pacheco, Marcos T. T.; Silveira, Landulfo, Jr.; Machado, Rosangela Z.; Martins, Rodrigo A. L.; Zangaro, Renato A.; Villaverde, Antonio G. J. B.

2001-05-01

Near-infrared (NIR) Raman spectroscopy has been studied for the last years for many biomedical applications. It is a powerful tool for biological materials analysis. Toxoplasmosis is an important zoonosis in public health, cats being the principal responsible for the transmission of the disease in Brazil. The objective of this work is to investigate a new method of diagnosis of this disease. NIR Raman spectroscopy was used to detect anti Toxoplasma gondii antibodies in blood sera from domestic cats, without sample preparation. In all, six blood serum samples were used for this study. A previous serological test was done by the Indirect Immunoenzymatic Assay (ELISA) to permit a comparative study between both techniques and it showed that three serum samples were positive and the other three were negative to toxoplasmosis. Raman spectra were taken for all the samples and analyzed by using the principal components analysis (PCA). A diagnosis parameter was defined from the analysis of the second and third principal components of the Raman spectra. It was found that this parameter can detect the infection level of the animal. The results have indicated that NIR Raman spectroscopy, associated to the PCA can be a promising technique for serological analysis, such as toxoplasmosis, allowing a fast and sensitive method of diagnosis.

Epstein-Barr virus and human immunodeficiency virus serological responses and viral burdens in HIV-infected patients treated with HAART

Science.gov (United States)

O'Sullivan, Cathal E.; Peng, RongSheng; Cole, Kelly Stefano; Montelaro, Ronald C.; Sturgeon, Timothy; Jenson, Hal B.; Ling, Paul D.; Butel, J. S. (Principal Investigator)

2002-01-01

Epstein-Barr virus (EBV) associated non-Hodgkin lymphoma is recognized as a complication of human immunodeficiency virus (HIV) infection. Little is known regarding the influence of highly active antiretroviral therapy (HAART) on the biology of EBV in this population. To characterize the EBV- and HIV-specific serological responses together with EBV DNA levels in a cohort of HIV-infected adults treated with HAART, a study was conducted to compare EBV and HIV serologies and EBV DNA copy number (DNAemia) over a 12-month period after the commencement of HAART. All patients were seropositive for EBV at baseline. Approximately 50% of patients had detectable EBV DNA at baseline, and 27/30 had detectable EBV DNA at some point over the follow-up period of 1 year. Changes in EBV DNA copy number over time for any individual were unpredictable. Significant increases in the levels of Epstein-Barr nuclear antigen (EBNA) and Epstein-Barr early antigen (EA) antibodies were demonstrated in the 17 patients who had a good response to HAART. Of 29 patients with paired samples tested, four-fold or greater increases in titers were detected for EA in 12/29 (41%), for EBNA in 7/29 (24%), for VCA-IgG in 4/29 (14%); four-fold decreases in titers were detected in 2/29 (7%) for EA and 12/29 (41%) for EBNA. A significant decline in the titer of anti-HIV antibodies was also demonstrated. It was concluded that patients with advanced HIV infection who respond to HAART have an increase in their EBV specific antibodies and a decrease in their HIV-specific antibodies. For the cohort overall, there was a transient increase in EBV DNA levels that had declined by 12 months. Copyright 2002 Wiley-Liss, Inc.

Serological evidence of influenza A viruses in frugivorous bats from Africa.

Directory of Open Access Journals (Sweden)

Gudrun Stephanie Freidl

Full Text Available Bats are likely natural hosts for a range of zoonotic viruses such as Marburg, Ebola, Rabies, as well as for various Corona- and Paramyxoviruses. In 2009/10, researchers discovered RNA of two novel influenza virus subtypes--H17N10 and H18N11--in Central and South American fruit bats. The identification of bats as possible additional reservoir for influenza A viruses raises questions about the role of this mammalian taxon in influenza A virus ecology and possible public health relevance. As molecular testing can be limited by a short time window in which the virus is present, serological testing provides information about past infections and virus spread in populations after the virus has been cleared. This study aimed at screening available sera from 100 free-ranging, frugivorous bats (Eidolon helvum sampled in 2009/10 in Ghana, for the presence of antibodies against the complete panel of influenza A haemagglutinin (HA types ranging from H1 to H18 by means of a protein microarray platform. This technique enables simultaneous serological testing against multiple recombinant HA-types in 5 μl of serum. Preliminary results indicate serological evidence against avian influenza subtype H9 in about 30% of the animals screened, with low-level cross-reactivity to phylogenetically closely related subtypes H8 and H12. To our knowledge, this is the first report of serological evidence of influenza A viruses other than H17 and H18 in bats. As avian influenza subtype H9 is associated with human infections, the implications of our findings from a public health context remain to be investigated.

Serological IgG avidity test for ocular toxoplasmosis

Directory of Open Access Journals (Sweden)

Suresh S

2012-01-01

Full Text Available Subramaniam Suresh1, Saidin Nor-Masniwati1, Muhd Nor Nor-Idahriani1, Wan-Hitam Wan-Hazabbah1, Mohamed Zeehaida2, Embong Zunaina11Department of Ophthalmology, 2Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Kelantan, MalaysiaBackground: The purpose of this study was to evaluate the immunoglobulin (Ig G avidity of serological toxoplasmosis testing in patients with ocular inflammation and to determine the clinical manifestations of ocular toxoplasmosis.Methods: A retrospective review of all patients presenting with ocular inflammation to the Hospital Universiti Sains Malaysia, Kelantan, Malaysia between 2005 and 2009 was undertaken. Visual acuity, clinical manifestations at presentation, toxoplasmosis antibody testing, and treatment records were analyzed.Results: A total of 130 patients with ocular inflammation were reviewed retrospectively. The patients had a mean age of 38.41 (standard deviation 19.24, range 6–83 years. Seventy-one patients (54.6% were found to be seropositive, of whom five (3.8% were both IgG and IgM positive (suggestive of recently acquired ocular toxoplasmosis while one (0.8% showed IgG avidity ≤40% (suggestive of recently acquired ocular toxoplasmosis and 65 patients (50.0% showed IgG avidity >40% (suggestive of reactivation of toxoplasmosis infection. Chorioretinal scarring as an ocular manifestation was significantly more common in patients with seropositive toxoplasmosis (P = 0.036. Eighteen patients (13.8% were diagnosed as having recent and/or active ocular toxoplasmosis based on clinical manifestations and serological testing.Conclusion: Ocular toxoplasmosis is a clinical diagnosis, but specific toxoplasmosis antibody testing helps to support the diagnosis and to differentiate between reactivation of infection and recently acquired ocular toxoplasmosis.Keywords: ocular toxoplasmosis, chorioretinal scar, toxoplasmosis antibody, IgG avidity test

Longitudinal assessment of anti-PGL-I serology in contacts of leprosy patients in Bangladesh.

Science.gov (United States)

Richardus, Renate A; van der Zwet, Konrad; van Hooij, Anouk; Wilson, Louis; Oskam, Linda; Faber, Roel; van den Eeden, Susan J F; Pahan, David; Alam, Khorshed; Richardus, Jan Hendrik; Geluk, Annemieke

2017-12-01

Despite elimination efforts, the number of Mycobacterium leprae (M. leprae) infected individuals who develop leprosy, is still substantial. Solid evidence exists that individuals living in close proximity to patients are at increased risk to develop leprosy. Early diagnosis of leprosy in endemic areas requires field-friendly tests that identify individuals at risk of developing the disease before clinical manifestation. Such assays will simultaneously contribute to reduction of current diagnostic delay as well as transmission. Antibody (Ab) levels directed against the M.leprae-specific phenolic glycolipid I (PGL-I) represents a surrogate marker for bacterial load. However, it is insufficiently defined whether anti-PGL-I antibodies can be utilized as prognostic biomarkers for disease in contacts. Particularly, in Bangladesh, where paucibacillary (PB) patients form the majority of leprosy cases, anti-PGL-I serology is an inadequate method for leprosy screening in contacts as a directive for prophylactic treatment. Between 2002 and 2009, fingerstick blood from leprosy patients' contacts without clinical signs of disease from a field-trial in Bangladesh was collected on filter paper at three time points covering six years of follow-up per person. Analysis of anti-PGL-I Ab levels for 25 contacts who developed leprosy during follow-up and 199 contacts who were not diagnosed with leprosy, was performed by ELISA after elution of bloodspots from filter paper. Anti-PGL-I Ab levels at intake did not significantly differ between contacts who developed leprosy during the study and those who remained free of disease. Moreover, anti-PGL-I serology was not prognostic in this population as no significant correlation was identified between anti-PGL-I Ab levels at intake and the onset of leprosy. In this highly endemic population in Bangladesh, no association was observed between anti-PGL-I Ab levels and onset of disease, urging the need for an extended, more specific biomarker

Serologic answer to the papillomavirus oncogenic capsid types 16, 18, 31, 33, 39, 58 and 59 in Colombian women with cervix cancer

International Nuclear Information System (INIS)

Combita, Alba Lucia; Touze, Antoine; Coursaget, Pierre; Bravo, Maria Mercedes

2003-01-01

The carcinoma of the uterine cervix is the first cause of cancer mortality among young Colombian women. An etiological association between infection with high risk HPV and cervical cancer has been demonstrated. L1 proteins from HPV have the ability to assemble into virus-like particles (VLP) numerous serologic studies using HPV16 or HPV18 VLP have shown that infection with genital HPV is followed by a serologic immune response to viral capsid proteins. Our results confirm (i) the high rate of HPV infections in Colombia, both in cervical cancer patients and in the general population, and the particularly high rate of infections due to HPV 31 and 58; and (ii) the validity of anti-VLP antibodies as markers of present or past infections. The simultaneous appearance or disappearance of antibodies against multiple HPV VLP suggests that the antibodies detected by ELISA are not always type-specific

Label-free virus detection using silicon photonic microring resonators.

Science.gov (United States)

McClellan, Melinda S; Domier, Leslie L; Bailey, Ryan C

2012-01-15

Viruses represent a continual threat to humans through a number of mechanisms, which include disease, bioterrorism, and destruction of both plant and animal food resources. Many contemporary techniques used for the detection of viruses and viral infections suffer from limitations such as the need for extensive sample preparation or the lengthy window between infection and measurable immune response, for serological methods. In order to develop a method that is fast, cost-effective, and features reduced sample preparation compared to many other virus detection methods, we report the application of silicon photonic microring resonators for the direct, label-free detection of intact viruses in both purified samples as well as in a complex, real-world analytical matrix. As a model system, we demonstrate the quantitative detection of Bean pod mottle virus, a pathogen of great agricultural importance, with a limit of detection of 10 ng/mL. By simply grinding a small amount of leaf sample in buffer with a mortar and pestle, infected leaves can be identified over a healthy control with a total analysis time of less than 45 min. Given the inherent scalability and multiplexing capability of the semiconductor-based technology, we feel that silicon photonic microring resonators are well-positioned as a promising analytical tool for a number of viral detection applications. Copyright © 2011 Elsevier B.V. All rights reserved.

Serological evidence of egg drop syndrome’1976 (EDS’76) in free-range chickens at chicken market sites in Jos, Nigeria

OpenAIRE

SALIHU, A. Elayo; JOANNIS, T. Mamuela; ONWULIRI, F. Chukwuemeka; IBU, J. Okpabi

2010-01-01

Serological evidence of EDS'76 virus in free-range chickens at the various chicken markets (Kasuwan kaji, New market, Gada biyu, and Kugiya) located in Jos and its environs was investigated through antibody detection. The serum samples randomly collected from chickens were assayed for antibodies against EDS'76 virus by haemagglutination-inhibition (HI) test. It was observed that 292 (15.2%) of the 1920 sera tested were positive for EDS'76 antibodies with HI titres r...

[Analysis for serological diagnostic results of syphilis among entry personnel in Beijing port during 2012-2014].

Science.gov (United States)

Feng, M X; Sun, F J; Wang, F; Wang, K L; Liu, M

2016-06-18

To analyze the results of syphilis specific serological tests among entry personnel in Beijing port during year 2012-2014 in order to provide evidence for the prevention and control of syphilis. Demographics data and syphilis specific test results of entry personnel were obtained from the information system of Beijing International Travel Healthcare Center and input into Excel 2016. Database for entry personnel was built up accordingly and was analyzed by IBM SPSS22.0. The number of entry personnel in Beijing port during year 2012-2014 was 106 302 person-time. According to the evaluation criteria, 71 308 persons were recruited and analyzed, of whom 277 were tested serologically positive and the total prevalence was 0.39% (95% CI: 0.34%-0.43%). The prevalence was highest in the persons aged 40-49 years (0.81%) and was higher in males (0.50%) than in females (0.23%). The persons from Africa held higher prevalence (1.27%) than from other five regions. As multivariate logical regression analysis indicated that the risk of syphilis infection was 10.38 times more in the persons aged 40-49 years than in the persons 0.05). Twenty-seven seropositive cases were found within 6 246 entry persons who were tested repeatedly during the research period, 9 of which were seroconversion cases so that the cumulative conversion rate was 0.14% (9/6 228). The average conversion time was (6.3±3.0) months. There was no statistical significance between the cumulative seroconversion rates of the persons with different genders and nationalities (P of Fisher's exact test>0.05). Serological detection of syphilis for entry personnel in Beijing port and syphilis-related health education should be reinforced to reduce the risk of disease importing and spreading, protect susceptible subjects and promote health.

Agreement between ultrasonography and computed tomography in detecting intracranial calcifications in congenital toxoplasmosis

Energy Technology Data Exchange (ETDEWEB)

Lago, E.G. [Department of Pediatrics, Pontificia Universidade Catolica do Rio Grande do Sul School of Medicine, Sao Lucas Hospital, Porto Alegre (Brazil)], E-mail: eglago@pucrs.br; Baldisserotto, M.; Hoefel Filho, J.R.; Santiago, D. [Department of Radiology, Pontificia Universidade Catolica do Rio Grande do Sul School of Medicine, Sao Lucas Hospital, Porto Alegre (Brazil); Jungblut, R. [Department of Pediatrics, Pontificia Universidade Catolica do Rio Grande do Sul School of Medicine, Sao Lucas Hospital, Porto Alegre (Brazil)

2007-10-15

Aim: To evaluate the agreement between ultrasound (US) and computed tomography (CT) in detecting intracranial calcification in infants with congenital toxoplasmosis. Materials and methods: Forty-four infants referred for investigation of congenital toxoplasmosis were prospectively evaluated, and the diagnosis was confirmed or ruled out by serological testing and by follow-up in the first year of life. The investigation protocol included cranial US and cranial CT, and examinations were conducted and interpreted by two radiologists blinded to the results of the other imaging test and to the diagnostic confirmation. Results: The diagnosis of congenital toxoplasmosis was confirmed in 33 patients, and agreement between US and CT findings was found in 31 of these cases. Both methods detected calcifications in 18 patients, and neither detected calcifications in 13 patients. Overall agreement was 94% and the kappa coefficient was 0.88 (95% confidence interval: 0.71, 1; p < 0.001), which revealed almost perfect agreement between the two diagnostic methods. Conclusion: In this study, US and CT demonstrated equal sensitivity in the detection of intracranial calcification in infants with congenital toxoplasmosis.

Detection methods of irradiated foodstuffs

Energy Technology Data Exchange (ETDEWEB)

Ponta, C C; Cutrubinis, M; Georgescu, R [IRASM Center, Horia Hulubei National Institute for Physics and Nuclear Engineering, PO Box MG-6, RO-077125 Magurele-Bucharest (Romania); Mihai, R [Life and Environmental Physics Department, Horia Hulubei National Institute for Physics and Nuclear Engineering, PO Box MG-6, RO-077125 Magurele-Bucharest (Romania); Secu, M [National Institute of Materials Physics, Bucharest (Romania)

2005-07-01

food is marketed as irradiated or if irradiated goods are sold without the appropriate labeling, then detection tests should be able to prove the authenticity of the product. For the moment in Romania there is not any food control laboratory able to detect irradiated foodstuffs. The Technological Irradiation Department coordinates and co finances a research project aimed to establish the first Laboratory of Irradiated Foodstuffs Detection. The detection methods studied in this project are the ESR methods (for cellulose EN 1787/2000, bone EN 1786/1996 and crystalline sugar EN 13708/2003), the TL method (EN 1788/2001), the PSL method (EN 13751/2002) and the DNA Comet Assay method (EN 13784/2001). The above detection methods will be applied on various foodstuffs such: garlic, onion, potatoes, rice, beans, wheat, maize, pistachio, sunflower seeds, raisins, figs, strawberries, chicken, beef, fish, pepper, paprika, thyme, laurel and mushrooms. As an example of the application of a detection method there are presented the ESR spectra of irradiated and nonirradiated paprika acquired according to ESR detection method for irradiated foodstuffs containing cellulose. First of all it can be noticed that the intensity of the signal of cellulose is much higher for the irradiated sample than that for the nonirradiated one and second that appear two radiation specific signals symmetrical to the cellulose signal. These two radiation specific signals prove the irradiation treatment of paprika. (author)

The diagnostic accuracy of serological tests for Lyme borreliosis in Europe: a systematic review and meta-analysis.

Science.gov (United States)

Leeflang, M M G; Ang, C W; Berkhout, J; Bijlmer, H A; Van Bortel, W; Brandenburg, A H; Van Burgel, N D; Van Dam, A P; Dessau, R B; Fingerle, V; Hovius, J W R; Jaulhac, B; Meijer, B; Van Pelt, W; Schellekens, J F P; Spijker, R; Stelma, F F; Stanek, G; Verduyn-Lunel, F; Zeller, H; Sprong, H

2016-03-25

Interpretation of serological assays in Lyme borreliosis requires an understanding of the clinical indications and the limitations of the currently available tests. We therefore systematically reviewed the accuracy of serological tests for the diagnosis of Lyme borreliosis in Europe. We searched EMBASE en MEDLINE and contacted experts. Studies evaluating the diagnostic accuracy of serological assays for Lyme borreliosis in Europe were eligible. Study selection and data-extraction were done by two authors independently. We assessed study quality using the QUADAS-2 checklist. We used a hierarchical summary ROC meta-regression method for the meta-analyses. Potential sources of heterogeneity were test-type, commercial or in-house, Ig-type, antigen type and study quality. These were added as covariates to the model, to assess their effect on test accuracy. Seventy-eight studies evaluating an Enzyme-Linked ImmunoSorbent assay (ELISA) or an immunoblot assay against a reference standard of clinical criteria were included. None of the studies had low risk of bias for all QUADAS-2 domains. Sensitivity was highly heterogeneous, with summary estimates: erythema migrans 50% (95% CI 40% to 61%); neuroborreliosis 77% (95% CI 67% to 85%); acrodermatitis chronica atrophicans 97% (95% CI 94% to 99%); unspecified Lyme borreliosis 73% (95% CI 53% to 87%). Specificity was around 95% in studies with healthy controls, but around 80% in cross-sectional studies. Two-tiered algorithms or antibody indices did not outperform single test approaches. The observed heterogeneity and risk of bias complicate the extrapolation of our results to clinical practice. The usefulness of the serological tests for Lyme disease depends on the pre-test probability and subsequent predictive values in the setting where the tests are being used. Future diagnostic accuracy studies should be prospectively planned cross-sectional studies, done in settings where the test will be used in practice.

Long-term sera storage does not significantly modify the interpretation of toxoplasmosis serologies.

Science.gov (United States)

Dard, C; Bailly, S; Drouet, T; Fricker-Hidalgo, H; Brenier-Pinchart, M P; Pelloux, H

2017-03-01

Serological investigation of Toxoplasma gondii can answer many questions about toxoplasmosis in human pathology. Along these lines, studies on serum storage in biobanks need to be performed especially in terms of determining the impact of storage on relevance of sera analysis after freezing. This study assessed the impact of long-term sera storage on the stability of anti-Toxoplasma immunoglobulins. The stability of anti-Toxoplasma IgG and IgM was studied in 244 and 242 sera respectively, stored at -20°C from one month to ten years. ELISA-immunoassay (Vidas®, bioMérieux) was used for initial and post-storage analyses. Linear models for repeated measures and subgroup analyses were performed to assess the effect of storage duration and sample characteristics on immunoglobulins stability. Until ten years, the variability attributed to storage (maximum 8.07% for IgG, 13.17% for IgM) was below the variations inherent to the serological technique and allowed by quality assurance systems (15%). Subgroup analysis reported no variation attributed to sera storage. Serological interpretation was modified for 3 sera (1.2%) tested for IgM, all stored more than seven years. Anti-Toxoplasma immunoglobulins can reliably be measured for at least up to six years of storage with no modification of interpretation of toxoplasmosis serologies. Copyright © 2017 Elsevier B.V. All rights reserved.

Spices, irradiation and detection methods

International Nuclear Information System (INIS)

Sjoeberg, A.M.; Manninen, M.

1991-01-01

This paper is about microbiological aspects of spices and microbiological methods to detect irradiated food. The proposed method is a combination of the Direct Epifluorescence Filter Technique (DEFT) and the Aerobic Plate Count (APC). The evidence for irradiation of spices is based on the demonstration of a higher DEFT count than the APC. The principle was first tested in our earlier investigation in the detection of irradiation of whole spices. The combined DEFT+APC procedure was found to give a fairly reliable indication of whether or not a whole spice sample had been irradiated. The results are given (8 figs, 22 refs)

Pros and Cons of serological testing in syphilis diagnosis and follow up

Directory of Open Access Journals (Sweden)

Gino Ciarrocchi

2010-03-01

Full Text Available Since a proper diagnosis of syphilis is often difficult due to the wide variability of both clinical picture and laboratory test results, early recognition of infection caused by Treponema pallidum is crucial for a timely and effective treatment. In most cases, definitive diagnosis relies upon serological testing. A screening ELISA test, coupled with a quantitative RPR test and specific IgM antibodies detection, is currently regarded as the basic diagnostic procedure. In addition, a quantitative particle agglutination TP-PA test, FTA-abs IgG test and, eventually, a western-blot IgG and IgM test, allow to achieve a whole serological pattern for each patient at the time of first diagnosis. In this study, a group of serum samples (n=107 and cerebro-spinal fluid (n=3 were retrospectively analyzed using the above mentioned tests. A population of 19 patients whose clinical picture was unremarkable for syphilis, showed border-line values at screening and negative results on confirmation tests. Thirty-three out of 91 luetic patients were diagnosed as primary or early secondary syphilis, 36 as latent syphilis, 3 as neurosyphilis, and 3 were neonates with passive specific immunization. Quantitative RPR test and detection of specific IgM antibodies exhibited extremely high values in all 33 primary syphilis patients; a whole positive luetic pattern was also obtained by confirmation tests. Searching for IgM antibodies, a capture elisa test compared with a single device rapid elisa test showed an overall concordance of 98.1%. In luetic patients other than primary syphilis, quantitative RPR test and detection of specific IgM antibodies provided less relevant values and a low prevalence pattern, whereas TP-PA and FTA-abs tests showed persistent positives results. In the follow up of 19 initially treated patients, quantitative RPR values and specific IgM antibodies index showed a slow, progressive decrease until negative. Conclusion: a comprehensive initial

Evaluating the utility of serological testing in laryngotracheal stenosis.

Science.gov (United States)

Hall, S Ryan; Allen, Clint T; Merati, Albert L; Mayerhoff, Ross M

2017-06-01

Whereas mechanical (traumatic) causes of laryngotracheal stenosis (LTS) are identified based on history, autoimmune laryngotracheal stenosis (aLTS) and idiopathic laryngotracheal stenosis (iLTS) are often more difficult to differentiate. The objective of this study was to evaluate serologic testing in a large cohort of nonmechanical LTS patients to determine which tests, if any, lead clinicians to the etiology of the LTS. Retrospective chart review. This study reviewed nonmechanical LTS patients seen at a tertiary medical center from 2007 to 2014. Data were obtained on patient demographics, associated preexisting autoimmune conditions, comorbidities, intubation history, and serologic testing. Ninety-two records were reviewed. Twenty-three (25%) patients were found to have autoimmune disease; 69 (75%) met criteria for iLTS. A history of cigarette smoking was more significant in the aLTS group than the iLTS group (P testing was equivocal between the two cohorts. Differentiating iLTS from aLTS has proven difficult. The lack of information about the two entities has resulted in variability in the diagnostic workup to distinguish them. This study's finding of a more significant smoking history in the aLTS group correlates with the literature, which suggests an inflammatory effect of smoking cigarettes and an association with autoimmune disease. The only significant cohort of patients in this study found to have positive serological testing correlated with a diagnosable condition responsible for LTS was GPA patients with positive ANCA. 4. Laryngoscope, 127:1408-1412, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Clinical and serological characterization of cold agglutinin syndrome in a Tertiary Care Hospital in Eastern India

Directory of Open Access Journals (Sweden)

Sudipta Sekhar Das

2015-01-01

Full Text Available Background and Aim: Cold agglutinin syndrome (CAS primary or secondary represents approximately 16-32% of autoimmune hemolytic anemia cases. Most patients present with mild, chronic hemolytic anemia with exacerbation of the condition in the cold environment. Red cell transfusions are only indicated when there is a life-threatening anemia causing crisis. We studied the clinical and serological characterization of CAS with the aim that the information gained from this study would help in proper diagnosis and management of these patients. Materials and Methods: The prospective study included nine patients who were admitted with severe anemia. Detailed work-up were conducted to establish the diagnosis, severity of in vivo hemolysis and transfusion management. Results: All patients presented with pallor, weakness, fatigue and painful fingers and toes with exacerbation of symptoms in winter months. Secondary CAS was observed in three patients suffering from malignant lymphoma. Red cells of all patients were coated with complements (C3 more specifically C3d. In one patient suffering from malignant lymphoma, the cold autoagglutinin titer was as high as 4096. Autoantibody in seven patients was specific to "I" antigen and one to "i" antigen. Conclusions: We conclude that detailed clinical and serological characterization is needed to diagnose and manage CAS. Whereas avoidance of cold exposure is the primary therapy, but no critical patient should be denied blood transfusion due to serological complications. All transfusion services should follow the correct protocol to maximize blood safety in CAS.

Near-infrared Raman spectroscopy to detect anti-Toxoplasma gondii antibody in blood sera of domestic cats: quantitative analysis based on partial least-squares multivariate statistics

Science.gov (United States)

Duarte, Janaína; Pacheco, Marcos T. T.; Villaverde, Antonio Balbin; Machado, Rosangela Z.; Zângaro, Renato A.; Silveira, Landulfo

2010-07-01

Toxoplasmosis is an important zoonosis in public health because domestic cats are the main agents responsible for the transmission of this disease in Brazil. We investigate a method for diagnosing toxoplasmosis based on Raman spectroscopy. Dispersive near-infrared Raman spectra are used to quantify anti-Toxoplasma gondii (IgG) antibodies in blood sera from domestic cats. An 830-nm laser is used for sample excitation, and a dispersive spectrometer is used to detect the Raman scattering. A serological test is performed in all serum samples by the enzyme-linked immunosorbent assay (ELISA) for validation. Raman spectra are taken from 59 blood serum samples and a quantification model is implemented based on partial least squares (PLS) to quantify the sample's serology by Raman spectra compared to the results provided by the ELISA test. Based on the serological values provided by the Raman/PLS model, diagnostic parameters such as sensitivity, specificity, accuracy, positive prediction values, and negative prediction values are calculated to discriminate negative from positive samples, obtaining 100, 80, 90, 83.3, and 100%, respectively. Raman spectroscopy, associated with the PLS, is promising as a serological assay for toxoplasmosis, enabling fast and sensitive diagnosis.

Novel serologic biomarkers provide accurate estimates of recent Plasmodium falciparum exposure for individuals and communities.

Science.gov (United States)

Helb, Danica A; Tetteh, Kevin K A; Felgner, Philip L; Skinner, Jeff; Hubbard, Alan; Arinaitwe, Emmanuel; Mayanja-Kizza, Harriet; Ssewanyana, Isaac; Kamya, Moses R; Beeson, James G; Tappero, Jordan; Smith, David L; Crompton, Peter D; Rosenthal, Philip J; Dorsey, Grant; Drakeley, Christopher J; Greenhouse, Bryan

2015-08-11

Tools to reliably measure Plasmodium falciparum (Pf) exposure in individuals and communities are needed to guide and evaluate malaria control interventions. Serologic assays can potentially produce precise exposure estimates at low cost; however, current approaches based on responses to a few characterized antigens are not designed to estimate exposure in individuals. Pf-specific antibody responses differ by antigen, suggesting that selection of antigens with defined kinetic profiles will improve estimates of Pf exposure. To identify novel serologic biomarkers of malaria exposure, we evaluated responses to 856 Pf antigens by protein microarray in 186 Ugandan children, for whom detailed Pf exposure data were available. Using data-adaptive statistical methods, we identified combinations of antibody responses that maximized information on an individual's recent exposure. Responses to three novel Pf antigens accurately classified whether an individual had been infected within the last 30, 90, or 365 d (cross-validated area under the curve = 0.86-0.93), whereas responses to six antigens accurately estimated an individual's malaria incidence in the prior year. Cross-validated incidence predictions for individuals in different communities provided accurate stratification of exposure between populations and suggest that precise estimates of community exposure can be obtained from sampling a small subset of that community. In addition, serologic incidence predictions from cross-sectional samples characterized heterogeneity within a community similarly to 1 y of continuous passive surveillance. Development of simple ELISA-based assays derived from the successful selection strategy outlined here offers the potential to generate rich epidemiologic surveillance data that will be widely accessible to malaria control programs.

Utilization of serology for the diagnosis of suspected Lyme borreliosis in Denmark: Survey of patients seen in general practice

Directory of Open Access Journals (Sweden)

Skarphedinsson Sigurdur

2010-11-01

Full Text Available Abstract Background Serological testing for Lyme borreliosis (LB is frequently requested by general practitioners for patients with a wide variety of symptoms. Methods A survey was performed in order to characterize test utilization and clinical features of patients investigated for serum antibodies to Borrelia burgdorferi sensu lato. During one calendar year a questionnaire was sent to the general practitioners who had ordered LB serology from patients in three Danish counties (population 1.5 million inhabitants. Testing was done with a commercial ELISA assay with purified flagella antigen from a Danish strain of B. afzelii. Results A total of 4,664 patients were tested. The IgM and IgG seropositivity rates were 9.2% and 3.3%, respectively. Questionnaires from 2,643 (57% patients were available for analysis. Erythema migrans (EM was suspected in 38% of patients, Lyme arthritis/disseminated disease in 23% and early neuroborreliosis in 13%. Age 0-15 years and suspected EM were significant predictors of IgM seropositivity, whereas suspected acrodermatitis was a predictor of IgG seropositivity. LB was suspected in 646 patients with arthritis, but only 2.3% were IgG seropositive. This is comparable to the level of seropositivity in the background population indicating that Lyme arthritis is a rare entity in Denmark, and the low pretest probability should alert general practitioners to the possibility of false positive LB serology. Significant predictors for treating the patient were a reported tick bite and suspected EM. Conclusions A detailed description of the utilization of serology for Lyme borreliosis with rates of seropositivity according to clinical symptoms is presented. Low rates of seropositivity in certain patient groups indicate a low pretest probability and there is a notable risk of false positive results. 38% of all patients tested were suspected of EM, although this is not a recommended indication due to a low sensitivity of

Detection, identification and differentiation of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: a review.

Science.gov (United States)

Czajkowski, R; Pérombelon, McM; Jafra, S; Lojkowska, E; Potrykus, M; van der Wolf, Jm; Sledz, W

2015-01-01

The soft rot Enterobacteriaceae (SRE) Pectobacterium and Dickeya species (formerly classified as pectinolytic Erwinia spp.) cause important diseases on potato and other arable and horticultural crops. They may affect the growing potato plant causing blackleg and are responsible for tuber soft rot in storage thereby reducing yield and quality. Efficient and cost-effective detection and identification methods are essential to investigate the ecology and pathogenesis of the SRE as well as in seed certification programmes. The aim of this review was to collect all existing information on methods available for SRE detection. The review reports on the sampling and preparation of plant material for testing and on over thirty methods to detect, identify and differentiate the soft rot and blackleg causing bacteria to species and subspecies level. These include methods based on biochemical characters, serology, molecular techniques which rely on DNA sequence amplification as well as several less-investigated ones.

Improved GLR method to instrument failure detection

International Nuclear Information System (INIS)

Jeong, Hak Yeoung; Chang, Soon Heung

1985-01-01

The generalized likehood radio(GLR) method performs statistical tests on the innovations sequence of a Kalman-Buchy filter state estimator for system failure detection and its identification. However, the major drawback of the convensional GLR is to hypothesize particular failure type in each case. In this paper, a method to solve this drawback is proposed. The improved GLR method is applied to a PWR pressurizer and gives successful results in detection and identification of any failure. Furthmore, some benefit on the processing time per each cycle of failure detection and its identification can be accompanied. (Author)

Thermoelectric SQUID method for the detection of segregations

Science.gov (United States)

Hinken, Johann H.; Tavrin, Yury

2000-05-01

Aero engine turbine discs are most critical parts. Material inhomogeneities can cause disc fractures during the flight with fatal air disasters. Nondestructive testing (NDT) of the discs in various machining steps is necessary and performed as well as possible. Conventional NDT methods, however, like eddy current testing and ultrasonic testing have unacceptable limits. For example, subsurface segregations often cannot be detected directly but only indirectly in such cases when cracks already have developed from them. This may be too late. A new NDT method, which we call the Thermoelectric SQUID Method, has been developed. It allows for the detection of metallic inclusions within non-ferromagnetic metallic base material. This paper describes the results of a feasibility study on aero engine turbine discs made from Inconel® 718. These contained segregations that had been detected before by anodic etching. With the Thermoelectric SQUID Method, these segregations were detected again, and further segregations below the surfaces have been found, which had not been detected before. For this new NDT method the disc material is quasi-transparent. The Thermoelectric SQUID Method is also useful to detect distributed and localized inhomogeneities in pure metals like niobium sheets for particle accelerators.

Rapid detection, characterization, and enumeration of foodborne pathogens.

Science.gov (United States)

Hoorfar, J

2011-11-01

As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

Distance Measurement Methods for Improved Insider Threat Detection

Directory of Open Access Journals (Sweden)

Owen Lo

2018-01-01

Full Text Available Insider threats are a considerable problem within cyber security and it is often difficult to detect these threats using signature detection. Increasing machine learning can provide a solution, but these methods often fail to take into account changes of behaviour of users. This work builds on a published method of detecting insider threats and applies Hidden Markov method on a CERT data set (CERT r4.2 and analyses a number of distance vector methods (Damerau–Levenshtein Distance, Cosine Distance, and Jaccard Distance in order to detect changes of behaviour, which are shown to have success in determining different insider threats.

Comparison of a Recombinant-antigen Enzyme Immunoassay with Treponema pallidum Hemagglutination Test for Serological Confirmation of Syphilis

Directory of Open Access Journals (Sweden)

Rodríguez Islay

2002-01-01

Full Text Available A recombinant-antigen enzyme immunoassay (EIA, BioSCREEN TM anti-Treponema pallidum, was compared favorably with the T. pallidum hemagglutination test, in the detection of specific antibodies in different groups of sera from patients with primary (n = 38, secondary (n = 10, early latent (n = 28 and congenital syphilis (n = 2, patients with leptospirosis ( n= 8, infectious mononucleosis (n = 7, hepatitis (n = 9, diabetes mellitus (n = 11, rheumatoid arthritis (n = 13, leprosy (n = 11, tuberculosis (n = 9, HIV/Aids ( n= 12, systemic lupus erythematosus (n = 4, rheumatic fever (n = 3, old-persons (n = 9, pregnant women (n = 29 and blood donors (n = 164. The coincidence between them was 95.1%. The sensitivity and specificity of the EIA were 93.3% and 95.5%, respectively. Fifteen serum specimens belonging to old-persons, pregnant women, blood donors, and patients with human leptospirosis, hepatitis, diabetes mellitus, tuberculosis and rheumatic fever gave false-positive results by Venereal Disease Research Laboratory and/or Rapid Plasma Reagin. The EIA can be used as alternative method for the serological confirmation of syphilis.

Detection of Epstein Barr virus in formalin-fixed paraffin tissues by fluorescent direct in situ PCR

Directory of Open Access Journals (Sweden)

N Marziliano

2009-06-01

Full Text Available Specific viral laboratory diagnosis of primary Epstein-Barr Virus (EBV infection is usually based on antibody-detection assays. However, molecular detection is also considered the reference standard assay for diagnosis of central nervous system infections and of most cases of nasopharyngeal carcinoma (NPC. One-step or nested polymerase chain reaction (PCR has rapidly replaced immunological assays based on virus-specific Ig antibodies for the laboratory diagnosis of Herpesvirus infections, even if serological methods are considered an additional tool for defining clinical diagnosis. In this article, we will present a rapid, sensitive and robust molecular tool for the viral detection of EBV (EBNA-1 within tissue specimens by making use of in situ PCR (IS-PCR.

Comparative analysis of methods for detecting interacting loci.

Science.gov (United States)

Chen, Li; Yu, Guoqiang; Langefeld, Carl D; Miller, David J; Guy, Richard T; Raghuram, Jayaram; Yuan, Xiguo; Herrington, David M; Wang, Yue

2011-07-05

Interactions among genetic loci are believed to play an important role in disease risk. While many methods have been proposed for detecting such interactions, their relative performance remains largely unclear, mainly because different data sources, detection performance criteria, and experimental protocols were used in the papers introducing these methods and in subsequent studies. Moreover, there have been very few studies strictly focused on comparison of existing methods. Given the importance of detecting gene-gene and gene-environment interactions, a rigorous, comprehensive comparison of performance and limitations of available interaction detection methods is warranted. We report a comparison of eight representative methods, of which seven were specifically designed to detect interactions among single nucleotide polymorphisms (SNPs), with the last a popular main-effect testing method used as a baseline for performance evaluation. The selected methods, multifactor dimensionality reduction (MDR), full interaction model (FIM), information gain (IG), Bayesian epistasis association mapping (BEAM), SNP harvester (SH), maximum entropy conditional probability modeling (MECPM), logistic regression with an interaction term (LRIT), and logistic regression (LR) were compared on a large number of simulated data sets, each, consistent with complex disease models, embedding multiple sets of interacting SNPs, under different interaction models. The assessment criteria included several relevant detection power measures, family-wise type I error rate, and computational complexity. There are several important results from this study. First, while some SNPs in interactions with strong effects are successfully detected, most of the methods miss many interacting SNPs at an acceptable rate of false positives. In this study, the best-performing method was MECPM. Second, the statistical significance assessment criteria, used by some of the methods to control the type I error rate

Comparative analysis of methods for detecting interacting loci

Directory of Open Access Journals (Sweden)

Yuan Xiguo

2011-07-01

Full Text Available Abstract Background Interactions among genetic loci are believed to play an important role in disease risk. While many methods have been proposed for detecting such interactions, their relative performance remains largely unclear, mainly because different data sources, detection performance criteria, and experimental protocols were used in the papers introducing these methods and in subsequent studies. Moreover, there have been very few studies strictly focused on comparison of existing methods. Given the importance of detecting gene-gene and gene-environment interactions, a rigorous, comprehensive comparison of performance and limitations of available interaction detection methods is warranted. Results We report a comparison of eight representative methods, of which seven were specifically designed to detect interactions among single nucleotide polymorphisms (SNPs, with the last a popular main-effect testing method used as a baseline for performance evaluation. The selected methods, multifactor dimensionality reduction (MDR, full interaction model (FIM, information gain (IG, Bayesian epistasis association mapping (BEAM, SNP harvester (SH, maximum entropy conditional probability modeling (MECPM, logistic regression with an interaction term (LRIT, and logistic regression (LR were compared on a large number of simulated data sets, each, consistent with complex disease models, embedding multiple sets of interacting SNPs, under different interaction models. The assessment criteria included several relevant detection power measures, family-wise type I error rate, and computational complexity. There are several important results from this study. First, while some SNPs in interactions with strong effects are successfully detected, most of the methods miss many interacting SNPs at an acceptable rate of false positives. In this study, the best-performing method was MECPM. Second, the statistical significance assessment criteria, used by some of the

Serological response to Epstein-Barr virus early antigen is ...

African Journals Online (AJOL)

Serological response to Epstein-Barr virus early antigen is associated with gastric cancer and human immunodeficiency virus infection in Zambian adults: a ... EBV exposure is common among Zambian adults and that EBV EA seropositivity is associated with gastric cancer and HIV infection, but not premalignant lesions.

Molecular and serological detection of occult hepatitis B virus ...

African Journals Online (AJOL)

Background: Occult hepatitis B infections are becoming a major global threat, but the available data on its prevalence in various parts of the world are often divergent. Objective: This study aimed to detect occult hepatitis B virus in hepatitis B surface antigen-negative serum using anti-HBc as a marker of previous infection.

Gastrointestinal symptoms and quality of life in screen-detected celiac disease.

Science.gov (United States)

Paavola, Aku; Kurppa, Kalle; Ukkola, Anniina; Collin, Pekka; Lähdeaho, Marja-Leena; Huhtala, Heini; Mäki, Markku; Kaukinen, Katri

2012-10-01

Active serological screening has proved an effective means of increasing the diagnostic rate in celiac disease. The effects of a long-term gluten-free diet on possible gastrointestinal symptoms and psychological well-being in screen-detected patients have nevertheless remained obscure. Abdominal symptoms and quality of life were measured in a large cohort of treated screen-detected celiac adults. Comparisons were made with corresponding symptom-detected patients and with non-celiac controls. Dietary adherence was assessed both by structured interview and by serological testing. In both screen- and symptom-detected celiac groups, 88% of the patients were adherent. On a diet, both screen- and symptom-detected patients reported significantly more gastrointestinal symptoms than non-celiac controls. Those screen-detected patients who reported having no symptoms at the time of diagnosis, also remained asymptomatic during the diet. Despite persistent symptoms, psychological well-being in screen-detected patients was comparable with that in non-celiac controls, whereas the symptom-detected patients showed lower quality of life. Long-term treated screen-detected celiac patients, especially women, suffer from gastrointestinal symptoms on a gluten free diet similarly to symptom-detected patients. However, despite a similar frequency of persistent symptoms, the quality of life was unimpaired in the screen found, but remained low in the symptom-detected group. Copyright © 2012 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

The serological profile of the autoimmune hepatitis/primary biliary cirrhosis overlap syndrome.

Science.gov (United States)

Muratori, Paolo; Granito, Alessandro; Pappas, Georgios; Pendino, Gaspare M; Quarneti, Chiara; Cicola, Ronny; Menichella, Rita; Ferri, Silvia; Cassani, Fabio; Bianchi, Francesco B; Lenzi, Marco; Muratori, Luigi

2009-06-01

During the last decade patients with concomitant clinical, biochemical, immunoserological, and histological features of both autoimmune hepatitis (AIH) and primary biliary cirrhosis (PBC) were sporadically described, but definite diagnostic criteria and specific serological markers to support the diagnosis of AIH/PBC overlap syndrome (AIH/PBC OS) are still lacking. Clinical, biochemical, and histological features, autoantibody profile, and treatment response of 15 patients with coexistent hepatitic and cholestatic liver damage, all fulfilling strict diagnostic criteria for both AIH and PBC, were compared with those of 120 patients with pure PBC and 120 patients with pure AIH. At diagnosis, the AIH/PBC OS patients' median age was 51 years, similar to that of the PBC patients (52 years, P=NS), but significantly higher than that of the AIH patients (40 years, P=0.04). Anti-dsDNA antibodies were detected in 60% of AIH/PBC OS patients, but only in 4% of PBC patients and 26% of AIH patients (P<0.0001 and 0.01, respectively). Double positivity for antimitochondrial antibodies (AMA) and anti-dsDNA was present in 47% of those with AIH/PBC OS, but only in 2% of the pathological controls (P<0.0001; specificity: 98; 95% confidence interval (CI): 97-99.2; positive likelihood ratio: 28; 95% CI: 9.8-79.4). Combined therapy (ursodeoxycholic acid (UDCA) plus steroids) achieved biochemical response in 77% of AIH/PBC OS patients. Concomitant AMA/anti-dsDNA seropositivity can be considered the serological profile of AIH/PBC OS. The combination of UDCA and steroids is effective in achieving persistent biochemical amelioration in most AIH/PBC OS patients.

BIOANALYTICAL STANDARDIZING FOR SEROLOGICAL DIAGNOSTIC MEDICAL DEVICES

OpenAIRE

A. Yu. Galkin; A. G. Komar; A. A. Grigorenko

2015-01-01

In article we analyzed national and international regulations concerning the quality and safety of medical devices for in vitro diagnostics. We discussed the possibility of a partial application of the recommendations of the State Pharmacopoeia of Ukraine to this type of product. The main guiding regulatory documents establishing requirements for quality and safety tools for the serological diagnosis products are The technical regulation on medical devices for the diagnosis in vitro, DSTU ISO...

Health screening of migrant workers- serological investigations

International Nuclear Information System (INIS)

Mustafa, M.

2009-01-01

The paper review the serological investigations for parasitic infection among migrant workers. The tests were performed on serum samples for parasitic infection. The serum samples were found to be positive for antibody for Ameobiasis [28%], Malaria [27 percentage], Echonococcus [18 percentage] and Schistosomiasis [12 percentage]. Female samples were positive for Ameobiasis [39 percentage], and Filariasis [W.b] 33.3 percentage. Foreign workers from Bangladesh showed the highest percentage on seropositive for most parasitic diseases. (author)

Molecular detection and isolation of avian metapneumovirus in Mexico.

Science.gov (United States)

Rivera-Benitez, José Francisco; Martínez-Bautista, Rebeca; Ríos-Cambre, Francisco; Ramírez-Mendoza, Humberto

2014-01-01

We conducted a longitudinal study to detect and isolate avian metapneumovirus (aMPV) in two highly productive poultry areas in Mexico. A total of 968 breeder hens and pullets from 2 to 73 weeks of age were analysed. Serology was performed to detect aMPV antibodies and 105 samples of tracheal tissue were collected, pooled by age, and used for attempted virus isolation and aMPV nested reverse transcriptase-polymerase chain reaction (nRT-PCR). The serological analysis indicated that 100% of the sampled chickens showed aMPV antibodies by 12 weeks of age. Five pools of pullet samples collected at 3 to 8 weeks of age were positive by nRT-PCR and the sequences obtained indicated 98 to 99% similarity with the reported sequences for aMPV subtype A. Virus isolation of nRT-PCR-positive samples was successfully attempted using chicken embryo lung and trachea mixed cultures with subsequent adaptation to Vero cells. This is the first report of detection and isolation of aMPV in Mexico.

New serological markers in pediatric patients with inflammatory bowel disease

Science.gov (United States)

Kovács, Márta; Müller, Katalin Eszter; Papp, Mária; Lakatos, Péter László; Csöndes, Mihály; Veres, Gábor

2014-01-01

The spectrum of serological markers associated with inflammatory bowel disease (IBD) is rapidly growing. Due to frequently delayed or missed diagnoses, the application of non-invasive diagnostic tests for IBD, as well as differentiation between ulcerative colitis (UC) and Crohn’s disease (CD), would be useful in the pediatric population. In addition, the combination of pancreatic autoantibodies and antibodies against Saccharomyces cerevisiae antibodies/perinuclear cytoplasmic antibody (pANCA) improved the sensitivity of serological markers in pediatric patients with CD and UC. Some studies suggested that age-associated differences in the patterns of antibodies may be present, particularly in the youngest children. In CD, most patients develop stricturing or perforating complications, and a significant number of patients undergo surgery during the disease course. Based on recent knowledge, serum antibodies are qualitatively and quantitatively associated with complicated CD behavior and CD-related surgery. Pediatric UC is characterized by extensive colitis and a high rate of colectomy. In patients with UC, high levels of anti-CBir1 and pANCA are associated with the development of pouchitis after ileal pouch-anal anastomosis. Thus, serologic markers for IBD can be applied to stratify IBD patients into more homogeneous subgroups with respect to disease progression. In conclusion, identification of patients at an increased risk of rapid disease progression is of great interest, as the application of early and more aggressive pharmaceutical intervention could have the potential to alter the natural history of IBD, and reduce complications and hospitalizations. PMID:24803798

A simple and rapid molecular method for Leptospira species identification

NARCIS (Netherlands)

Ahmed, Ahmed; Anthony, Richard M.; Hartskeerl, Rudy A.

2010-01-01

Serological and DNA-based classification systems only have little correlation. Currently serological and molecular methods for characterizing Leptospira are complex and costly restricting their world-wide distribution and use. Ligation mediated amplification combined with microarray analysis

Applicability of the Filter Paper Technique for Detection of AntifilarialIgG4 Antibodies Using the Bm14 Filariasis CELISA

Directory of Open Access Journals (Sweden)

Hayley M. Joseph

2010-01-01

Full Text Available Demonstration of successful elimination of lymphatic filariasis (LF in endemic countries requires sensitive diagnostics for accurate definitions of endpoints and future surveillance. There has been interest in complementing available diagnostics with antibody serology testing in children, since negative serology would correspond with cessation of LF transmission. The Filariasis CELISA detects antifilarial IgG4 and has favourable results with serum samples but field application requires an easier sampling method. Ninety-four paired plasma and filter paper samples were assayed with promising results. The filter paper method resulted in a sensitivity of 92% and a specificity of 77% when compared to the paired plasma. One hundred and one filter paper samples were assessed for storage effects. Following 10-month storage at −20∘C there was a significant reduction in reactivity (<.001. Overall the results indicated that filter paper sampling would be a favourable sensitive and specific alternative for blood collection in surveys.

Development and Establishment of Detection Method of Irradiated Foods

International Nuclear Information System (INIS)

Byun, Myung Woo; Lee, Ju Woon; Kim, Dong Ho; Jo, Cheo Run; Kim, Jang Ho; Kim, Kyong Su

2004-12-01

The present project was related to the development and establishment of the detection techniques for the safety management of gamma-irradiated food and particularly conducted for the establishment of standard detection method for gamma-irradiated dried spices and raw materials, dried meat and fish powder for processed foods, bean paste powder, red pepper paste powder, soy sauce powder, and starch for flavoring ingredients described in 3, 6, 7 section of Korean Food Standard. Since the approvement of gamma-irradiated food items will be enlarged due to the international tendency for gamma-irradiated food, it was concluded that the establishment of detailed detection methods for each food group is not efficient for the enactment and enforcement of related regulations. For this reason, in order to establish the standard detection method, a detection system for gamma-irradiated food suitable for domestic operation was studied using comparative analysis of domestic and foreign research data classified by items and methods and European Standard as a reference. According to the comparative analyses of domestic and foreign research data and regulations of detection for gamma-irradiated food, it was concluded to be desirable that the optimal detection method should be decided after principal detection tests such as physical, chemical, and biological detection methods are established as standard methods and that the specific descriptions such as pre-treatment of raw materials, test methods, and the evaluation of results should be separately prescribed

Development and Establishment of Detection Method of Irradiated Foods

Energy Technology Data Exchange (ETDEWEB)

Byun, Myung Woo; Lee, Ju Woon; Kim, Dong Ho; Jo, Cheo Run; Kim, Jang Ho; Kim, Kyong Su

2004-12-15

The present project was related to the development and establishment of the detection techniques for the safety management of gamma-irradiated food and particularly conducted for the establishment of standard detection method for gamma-irradiated dried spices and raw materials, dried meat and fish powder for processed foods, bean paste powder, red pepper paste powder, soy sauce powder, and starch for flavoring ingredients described in 3, 6, 7 section of Korean Food Standard. Since the approvement of gamma-irradiated food items will be enlarged due to the international tendency for gamma-irradiated food, it was concluded that the establishment of detailed detection methods for each food group is not efficient for the enactment and enforcement of related regulations. For this reason, in order to establish the standard detection method, a detection system for gamma-irradiated food suitable for domestic operation was studied using comparative analysis of domestic and foreign research data classified by items and methods and European Standard as a reference. According to the comparative analyses of domestic and foreign research data and regulations of detection for gamma-irradiated food, it was concluded to be desirable that the optimal detection method should be decided after principal detection tests such as physical, chemical, and biological detection methods are established as standard methods and that the specific descriptions such as pre-treatment of raw materials, test methods, and the evaluation of results should be separately prescribed.

Serological tests fail to discriminate dogs with visceral leishmaniasis that transmit Leishmania infantum to the vector Lutzomyia longipalpis.

Science.gov (United States)

Mendonça, Ivete Lopes de; Batista, Joilson Ferreira; Werneck, Guilherme Loureiro; Soares, Maria Regiane Araújo; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

2017-01-01

The control of reservoirs for Leishmania infantum -induced zoonotic visceral leishmaniasis requires the identification of dogs posing a population risk. Here, we assessed the performance of several assays to identify Lutzomyia longipalpis infectious dogs. We evaluated 99 dogs that were positive for visceral leishmaniasis based on parasite identification. Serological analyses were performed using an enzyme-linked immunosorbent assay, immunofluorescence antibody tests in 1:40 and 1:80 dilutions, rapid dual path platform tests, immunochromatographic assay with a recombinant rK39 antigen, fast agglutination screening tests, and direct agglutination tests. We also performed PCR to analyze peripheral blood and xenodiagnosis. Forty-six dogs infected at least one L. longipalpis specimen. Although the serological test sensitivities were above 85% for detecting L. longipalpis infectious dogs, none showed a satisfactory performance, as both specificity (0.06 to 13%) and the area under the receiver operating characteristic curve (45 to 53%) were low. The PCR results were also weak, with a sensitivity of 30%, specificity of 72%, and an area under the receiver operating characteristic curve of 51%. The infected L. longipalpis proportion was higher among asymptomatic dogs than symptomatic dogs. Among the symptomatic dogs, those with ulceration-free skin diseases were more infectious, with an odds ratio of 9.3 (confidence interval of 1.10 - 428.5). The larger the number of insects fed, the greater the detected infectiousness. Our study supports the imperative to develop novel technologies for identifying the infectious dogs that transmit L. infantum for the benefit of public health.

Adventure tourism and schistosomiasis: serology and clinical findings in a group of Danish students after white-water rafting in Uganda.

Science.gov (United States)

Röser, Dennis; Bjerrum, Stephanie; Helleberg, Marie; Nielsen, Henrik Vedel; David, Kim Peter; Thybo, Søren; Stensvold, Christen Rune

2018-04-01

Diagnosis of schistosomiasis in travellers is a clinical challenge, since cases may present with no symptoms or a few non-specific symptoms. Here, we report on the laboratory and clinical findings in Danish travellers exposed to Schistosoma -infested water during white-water rafting on the Ugandan part of the upper Nile River in July 2009. Forty travellers were offered screening for Schistosoma -specific antibodies. Serological tests were performed 6-65 weeks after exposure. A self-reporting questionnaire was used to collect information on travel activity and health history, fresh water exposure, and symptoms. Seropositive cases were referred to hospitals where clinical and biochemical data were collected. Schistosoma -specific antibodies were detected in 13/35 (37 %) exposed participants, with 4/13 (31 %) seroconverting later than 2 months following exposure. Four of thirteen (31 %) cases reported ≥3 symptoms compatible with schistosomiasis, with a mean onset of 41 days following exposure. No Schistosoma eggs were detected in stool or urine in any of the cases. Peripheral eosinophilia (>0.45×10 9 cells l -1 ) was seen in 4/13 cases, while IgE levels were normal in all cases. Schistosomiasis in travellers is not necessarily associated with specific signs or symptoms, eosinophilia, raised IgE levels, or detection of eggs. The only prognostic factor for infection was exposure to freshwater in a Schistosoma -endemic area. Seroconversion may occur later than 2 months after exposure and therefore - in the absence of other diagnostic evidence - serology testing should be performed up to at least 2-3 months following exposure to be able to rule out schistosomiasis.

Image Processing Methods Usable for Object Detection on the Chessboard

Directory of Open Access Journals (Sweden)

Beran Ladislav

2016-01-01

Full Text Available Image segmentation and object detection is challenging problem in many research. Although many algorithms for image segmentation have been invented, there is no simple algorithm for image segmentation and object detection. Our research is based on combination of several methods for object detection. The first method suitable for image segmentation and object detection is colour detection. This method is very simply, but there is problem with different colours. For this method it is necessary to have precisely determined colour of segmented object before all calculations. In many cases it is necessary to determine this colour manually. Alternative simply method is method based on background removal. This method is based on difference between reference image and detected image. In this paper several methods suitable for object detection are described. Thisresearch is focused on coloured object detection on chessboard. The results from this research with fusion of neural networks for user-computer game checkers will be applied.

Serological analysis and therapy in patients with early syphilis

International Nuclear Information System (INIS)

Wu Zhifen

2000-01-01

Sixty one patients with early syphilis were treated with benzathine penicillin under guide of serological analysis, the results showed that benzathine penicilline was able to cure indurated chancre and skin rashes in a month, flat condyloma in one and a half month, and PRP were all negative in 18 month

Evaluation of In-House and Commercial Serological Tests for Diagnosis of Human Tularemia

Science.gov (United States)

Yanes, Hadjila; Hennebique, Aurélie; Pelloux, Isabelle; Boisset, Sandrine; Bicout, Dominique J.; Caspar, Yvan

2017-01-01

ABSTRACT Tularemia is a zoonosis caused by the bacterium Francisella tularensis. Its specific diagnosis remains based on serological methods, while F. tularensis is rarely detected in clinical samples by culture or PCR. The aim of the present study was to evaluate the performance of the Serion enzyme-linked immunosorbent assay (ELISA) classic Francisella tularensis IgG and IgM tests (Virion/Serion GmbH Institute, Würzburg, Germany) and the VIRapid tularemia immunochromatographic test (ICT) (Vircell, Granada, Spain) compared to that of the in-house microagglutination test (MAT) and indirect immunofluorescence assay (IFA) currently used at the French National Reference Center for Francisella. We evaluated 256 consecutive sera from 208 patients, including 51 confirmed and 23 probable tularemia cases, and 134 control patients not infected with F. tularensis. The IFA tests displayed 72.5% sensitivity for IgM (cutoff titer ≥80) and 74.5% for IgG (cutoff titer ≥160), and 99.3% specificity for both IgM and IgG. Using cutoffs advocated by the manufacturer, the Serion ELISAs displayed 88.2% sensitivity for IgM and 86.3% for IgG antibodies; specificity was 94.8% for IgM and 95.5% for IgG. Compared to MAT and IFA tests, the Serion ELISAs allowed earlier detection of specific antibodies (1 to 2 weeks versus 2 to 3 weeks after the onset of symptoms). The ICT sensitivity and specificity were 90% and 83.6%, respectively, when considering the cutoff advocated by the manufacturer. In conclusion, the Serion ELISAs are useful as screening tests for tularemia diagnosis, but additional confirmatory tests (such as MAT and IFA) are needed, especially in areas of low endemicity. PMID:29118164

Detection methods for irradiated food

International Nuclear Information System (INIS)

Stevenson, M.H.

1993-01-01

The plenary lecture gives a brief historical review of the development of methods for the detection of food irradiation and defines the demands on such methods. The methods described in detail are as follows: 1) Physical methods: As examples of luminescence methods, thermoluminescence and chermoluminescence are mentioned; ESR spectroscopy is discussed in detail by means of individual examples (crustaceans, frutis and vegetables, spieces and herbs, nuts). 2) Chemical methods: Examples given for these are methods that make use of alterations in lipids through radiation (formation of long-chain hydrocarbons, formation of 2-alkyl butanones), respectively radiation-induced alterations in the DNA. 3) Microbiological methods. An extensive bibliography is appended. (VHE) [de

Detection of Mycobacterium avium subsp. paratuberculosis from cattle and buffaloes in Egypt using traditional culture, serological and molecular based methods

Directory of Open Access Journals (Sweden)

G. S. Abdellrazeq

2014-08-01

-positive animals were 63/340 (18.5%. No serum positive were detected in the samples from culture-negative animals. DNA extractions from colonies of 34 culture-positive pooled samples were tested with the PCR targeted to IS900 and revealed 18 isolates (52.94% were positive. Conclusion: The present study has succeeded in isolating and identifying of MAP from Egyptian cattle and buffaloes in five governorates. The results confirm the epizoology of JD in Egypt and encourage the decision-makers to start creating a program to control it. Pooling procedure for MAP culture is an efficient and reliable method. However, the findings suggest the importance of using both ELISA and fecal culture in MAP diagnosis and control.

Detection and zoonotic potential of Trichinella spp. from free-range pig farming in Greece.

Science.gov (United States)

Papatsiros, V G; Boutsini, S; Ntousi, D; Stougiou, D; Mintza, D; Bisias, A

2012-06-01

Trichinellosis is a serious parasitic zoonosis, which is widely distributed around the world. Pork meat is still the predominant source of outbreaks of human trichinellosis in many countries. The aim of this study is to examine the impact of Trichinella spp. as an important risk factor on the free-range pig farming sector in Greece. In 2009, during routine testing for the detection of Trichinella larvae at slaughterhouses and the National Reference Laboratory for Parasites (NRL), a total of 826,426 pigs were tested with the magnetic stirrer method for Trichinella spp. at slaughterhouses, including 2,892 samples from free-range pigs. Two positive samples were detected: one positive for Trichinella britovi and one positive for Trichinella spp. (unspecified) in the samples from wild farmed free-range pigs. It is alarming that one of these cases was connected with clinical signs of trichinellosis in five persons of the same family in northeastern Greece, who consumed undercooked pork meat from a free-range pig farm. During 2010, a total number of 1,295,034 pigs were tested with same method, including 4,159 samples from free-range pig farms. Five positive samples for Trichinella spp. (unspecified) were detected from 4,159 free-range pigs tested by the Greek NRL. Moreover, 363 serum samples from free-range pigs were serologically tested with enzyme-linked immunosorbent assay (ELISA). Moreover, 363 serum samples from farmed free-range pigs were serologically tested with ELISA, and 15 samples were found positive. Finally, the present study is the first report of detection of T. britovi in Greece. In conclusion, based on the results of the present study, Trichinella spp. is a high-risk factor for the free-range pig farming in Greece.

Elaboration and quality control of the inoculum of the experimental vaccine Brucella S19-tn7-GFP for use in white animals and associated serological test for the detection of anti-GFP antibodies

International Nuclear Information System (INIS)

Salas Alfaro, Dariana

2014-01-01

The preparation of the inoculum of the experimental vaccine Brucella S19-Tn7-GFP is optimized for application in white animals. An associated serological test has allowed differentiating infected animals from those vaccinated with the experimental strain. The same bacteriological and biological properties of the B. abortus S19-Tn7-GFP strain have maintained in the parental vaccine strain S19 and is stable over time. A protocol for the inoculums of strain S19-Tn7-GFP is established for its preparation and use in white animals and quality control. The inoculum stability is evaluated through the simulation of conditions that can be presented in the transportation and application process in the field. An enzyme immunoassay ELISA is optimized for the detection of anti-GFP antibodies in cattle [es

Radioimmunological and serological assay of the urinary excretion of the luteinizing hormone in women with amenorrhea

International Nuclear Information System (INIS)

Szymanski, W.

1975-01-01

The radioimmunological and serological assay of the urinary excretion of the luteinizing hormone (LH) was performed in 6 women treated with monopausal gonadotropin - because of amenorrhoe. The observations of the course of treatment demonstrated different concentration of LH in women treated because of primary and secondary amenorrhoe. In cases of primary amenorrhoe increase of the LH concentration appeared in the form of ovulation peak being closely correlated with the first injection of Biogonadyl (HCG) preparation. Different observations were made in the secondary amenorrhoe group, where urinary LH increase proceeded for some hours the adminstration of the exogenous chrionic gonadotropin. This may prove the induction of ovulation without the participation of HCG, as an effect of the menopausal gonadotropin (Menogonadyl) with established 1:1 ratio of FSH:LH. In the examined group of women with secondary amenorrhoe the radioimmunologic assay demonstrated persisting through several days high levels of urinary LH - undetectable by serological methods. In 4 cases corpus luteum appeared in the course of treatment - confirmed by cytologic examination and by determination of urainary pregnandiol activity. (author)

Development of a serology-based assay for efficacy evaluation of a lactococcicosis vaccine in Seriola fish.

Science.gov (United States)

Nakajima, Nao; Kawanishi, Michiko; Imamura, Saiki; Hirano, Fumiya; Uchiyama, Mariko; Yamamoto, Kinya; Nagai, Hidetaka; Futami, Kunihiko; Katagiri, Takayuki; Maita, Masashi; Kijima, Mayumi

2014-05-01

Lactococcicosis is an infection caused by the bacterium Lactococcus garvieae and creates serious economic damage to cultured marine and fresh water fish industries. The use of the assay currently applied to evaluate the potency of the lactococcicosis vaccine is contingent upon meeting specific parameters after statistical analysis of the percent survival of the vaccinated yellowtail or greater amberjack fish after challenge with a virulent strain of L. garvieae. We found that measuring the serological response with a quantitative agglutinating antibody against the L. garvieae antigen (phenotype KG+) was an effective method of monitoring the potency of lactococcicosis vaccines. Vaccinated fish had significantly higher antibody titers than control fish when the L. garvieae Lg2-S strain was used as an antigen. Furthermore, the titer of the KG + agglutinating antibody was correlated with vaccine potency, and the cut-off titer was determined by comparing the data with those from the challenge test. An advantage of the proposed serology-based potency assay is that it will contribute to reduced numbers of animal deaths during vaccine potency evaluations. Copyright © 2014 Elsevier Ltd. All rights reserved.

Serological evidence for human cystic echinococcosis in Slovenia

Directory of Open Access Journals (Sweden)

Kotar Tadeja

2008-05-01

Full Text Available Abstract Background Cystic echinococcosis (CE is caused by the larva of tapeworm Echinococcus granulosus. Dogs and other canids are the primary definitive hosts for this parasite. CE may develop after accidental ingestion of tapeworm eggs, excreted with the feces of these animals. In the intestine, the larvae released from the eggs are nested in the liver, lungs or other organs of livestock as intermediate hosts and humans as aberrant hosts. The aim of this study was to examine serologically whether some of the patients in Slovenia, suspected of CE by imaging findings in the liver or lungs had been infected with the larva of Echinococcus granulosus. Methods Between January 1, 2002 and the end of December 2006, 1323 patients suspected of having echinococcosis were screened serologically by indirect haemagglutination assay (IHA. For confirmation and differentiation of Echinococcus spp. infection, the sera of IHA-positive patients were then retested by western blot (WB. Results Out of 127 IHA-positive sera, 34 sera were confirmed by WB and considered specific for CE. Of 34 sera of CE-positive patients sera, 32 corresponded to the characteristic imaging findings of a liver cysts and 2 to those of lung cysts. The mean age of CE-positive patients was 58.3 years. No significant differences were found between the CE-positive patients in regard to their sex. Conclusion In the study, it was found out that CE was mostly spread in the same area of Slovenia as in the past, but its prevalence decreased from 4.8 per 105 inhabitants in the period 1956–1968 to 1.7 per 105 inhabitants in the period 2002–2006. In spite of the decreased prevalence of CE in the last years, it is suggested that clinicians and public health authorities, especially in the eastern parts of Slovenia where the most CE patients come from, should pay greater attention to this disease in the future.

A comparision of intestinal biopsies and serologic anti-tissue transglutaminase in children with seliac disease in Ahvaz city in 2015

Directory of Open Access Journals (Sweden)

Somayeh NiyaPak

2016-09-01

Full Text Available Background: CD or gluten-sensitive enteropathy is caused by dietary gluten ingestion in geneticallysusceptible individuals.The aim of the study was to compare the current diagnostic methods of CD and relationship between these methods. Material and Method: In this study 50 patients suspicious to have celiac disease were studied. After IgA anti-TTG test using Eliza method, the patients went under upper endoscopy, then  histopathologic findings were grouped by Marsh classification. Results:  Fifty patients, 23 males and 27 females with mean age of 8.36 were included in the study. TTG-IgA test was positive in 45 patients. Most pattients were categorized as Marsh stage III ( 28 cases by histopathologic examination, which can be seen in other studies. We found significant correlation between histopathologic and serologic findings (p-valu=0.014. no significant correlation was found between histopathological test and patients age. Conclusion: Based on the results obtained in this study between histopathologic findings and serologic findings were significant relationship, The diagnostic approach presented in this study may also be useful in the assessment of CD. In the end, for a definitive diagnosis of celiac disease, molecular tests and also determination of haplotype HLADQ are recommended

A Serological Survey for Newcastle Disease Virus Antibobies in ...

African Journals Online (AJOL)

A Serological Survey for Newcastle Disease Virus Antibobies in Village Poultry in Yobe State, Nigeria. ... The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more information about how to print, save, ...

Novel Method For Low-Rate Ddos Attack Detection

Science.gov (United States)

Chistokhodova, A. A.; Sidorov, I. D.

2018-05-01

The relevance of the work is associated with an increasing number of advanced types of DDoS attacks, in particular, low-rate HTTP-flood. Last year, the power and complexity of such attacks increased significantly. The article is devoted to the analysis of DDoS attacks detecting methods and their modifications with the purpose of increasing the accuracy of DDoS attack detection. The article details low-rate attacks features in comparison with conventional DDoS attacks. During the analysis, significant shortcomings of the available method for detecting low-rate DDoS attacks were found. Thus, the result of the study is an informal description of a new method for detecting low-rate denial-of-service attacks. The architecture of the stand for approbation of the method is developed. At the current stage of the study, it is possible to improve the efficiency of an already existing method by using a classifier with memory, as well as additional information.

A Novel Unscheduled Islanding Detection Method for Microgrid

Directory of Open Access Journals (Sweden)

Li Hui

2018-01-01

Full Text Available Microgrid with its intelligent and flexible control characteristics conform to the trend of sustainable development of electricity, and when the microgrid in the unplanned island state, the successful detection of the island is a prerequisite, energy storage inverter as the key equipment in the microgrid system, island protection is one of the necessary functions. In this paper, an improved islanding detection method based on active frequency drift and q-axis reactive power perturbation is proposed. The method has the advantages of faster detection speed and minor influence on power quality, which makes the energy storage inverter with better output power quality when it works on grid-connected state, and can be detected the islanding state quickly from grid-connected mode to islanded mode. Finally, the validity and superiority of the improved island detection method are verified by simulation experiments.

Accuracy of chimeric proteins in the serological diagnosis of chronic chagas disease - a Phase II study.

Directory of Open Access Journals (Sweden)

Fred Luciano Neves Santos

2017-03-01

Full Text Available The performance of current serologic tests for diagnosing chronic Chagas disease (CD is highly variable. The search for new diagnostic markers has been a constant challenge for improving accuracy and reducing the number of inconclusive results.Here, four chimeric proteins (IBMP-8.1 to -8.4 comprising immunodominant regions of different Trypanosoma cruzi antigens were tested by enzyme-linked immunosorbent assay. The proteins were used to detect specific anti-T. cruzi antibodies in the sera of 857 chagasic and 689 non-chagasic individuals to evaluate their accuracy for chronic CD diagnosis. The antigens were recombinantly expressed in Escherichia coli and purified by chromatographic methods. The sensitivity and specificity values ranged from 94.3% to 99.3% and 99.4% to 100%, respectively. The diagnostic odds ratio (DOR values were 6,462 for IBMP-8.1, 3,807 for IBMP-8.2, 32,095 for IBMP-8.3, and 283,714 for IBMP-8.4. These chimeric antigens presented DORs that were higher than the commercial test Pathozyme Chagas. The antigens IBMP-8.3 and -8.4 also showed DORs higher than the Gold ELISA Chagas test. Mixtures with equimolar concentrations were tested in order to improve the diagnosis accuracy of negative samples with high signal and positive samples with low signal. However, no gain in accuracy was observed relative to the individual antigens. A total of 1,079 additional sera were used to test cross-reactivity to unrelated diseases. The cross-reactivity rates ranged from 0.37% to 0.74% even for Leishmania spp., a pathogen showing relatively high genome sequence identity to T. cruzi. Imprecision analyses showed that IBMP chimeras are very stable and the results are highly reproducible.Our findings indicate that the IBMP-8.4 antigen can be safely used in serological tests for T. cruzi screening in blood banks and for chronic CD laboratory diagnosis.

Detecting Android Malwares with High-Efficient Hybrid Analyzing Methods

Directory of Open Access Journals (Sweden)

Yu Liu

2018-01-01

Full Text Available In order to tackle the security issues caused by malwares of Android OS, we proposed a high-efficient hybrid-detecting scheme for Android malwares. Our scheme employed different analyzing methods (static and dynamic methods to construct a flexible detecting scheme. In this paper, we proposed some detecting techniques such as Com+ feature based on traditional Permission and API call features to improve the performance of static detection. The collapsing issue of traditional function call graph-based malware detection was also avoided, as we adopted feature selection and clustering method to unify function call graph features of various dimensions into same dimension. In order to verify the performance of our scheme, we built an open-access malware dataset in our experiments. The experimental results showed that the suggested scheme achieved high malware-detecting accuracy, and the scheme could be used to establish Android malware-detecting cloud services, which can automatically adopt high-efficiency analyzing methods according to the properties of the Android applications.

Prevalence of viral hepatitis (B and C serological markers in healthy working population

Directory of Open Access Journals (Sweden)

José Luis Calleja-Panero

2013-06-01

Full Text Available Introduction and objectives: prevalence of viral hepatitis (B and C changes geographically. Our aim was to determinate the prevalence of hepatitis B (HBV and hepatitis C virus (HCV serological markers in healthy working population and to describe the epidemiological characteristics associated to its presence. Methods: blood samples and epidemiological data of 5,017 healthy workers from Murcia and Madrid were recorded prospectively. Results: a total of 5,017 healthy volunteers participated. Mean age 39 ± 11 years, men predominance (73 %. Prevalence of serological markers of HCV and HBV was 0.6 % and 0.7 %. Age of patients with HCV antibody was significantly higher (43 ± 9 years vs. 39 ± 11 years; p = 0.03. We observed significant differences in liver test values (alanine aminotransferase [ALT] 64 ± 56 IU/L vs. 28 ± 20 IU/L; p < 0.001; aspartate aminotransferase [AST] (51 ± 45 IU/L vs. 23 ± 12 IU/L; p < 0.001 and in gamma-glutamyltransferase (GGT value (104 ± 122 IU/L vs. 37 ± 46 IU/L; p < 0.001. The presence of HCV antibody was related significantly to previous transfusion (13 % vs. 5 %; p = 0.03, tattoos (29 % vs. 13 %; p < 0.01, intravenous drug addiction (13 % vs. 0.2 %; p < 0.001 and coexistence with people with positive HCV antibody (16 % vs. 4 %; p < 0.001. In HBV no differences in basal characteristics were observed with exception in AST values (29 ± 15 IU/L vs. 23 ± 12 IU/L; p < 0.01. Hepatitis B surface antigen (HBsAg was related significantly to previous transfusion (15 % vs. 5 %; p < 0.01, tattoos (26 % vs. 14 %; p = 0.04 and coexistence with people with positive HBsAg (17 % vs. 4 %; p < 0.001. Conclusions: prevalence of serological markers in healthy working population is low. Risk factors for infection were previous transfusion and tattoos. Intravenous drug addiction was only a risk factor in HCV.

Cancer Detection and Diagnosis Methods - Annual Plan

Science.gov (United States)

Early cancer detection is a proven life-saving strategy. Learn about the research opportunities NCI supports, including liquid biopsies and other less-invasive methods, for detecting early cancers and precancerous growths.

Usefulness of serological ELISA assay forTaenia saginata to detect naturally infected bovines

Directory of Open Access Journals (Sweden)

Silvana de Cássia Paulan

Full Text Available Bovine cysticercosis, a cosmopolitan disease caused by Taenia saginata, leads to economic losses due to carcass devaluation at slaughter. Sanitary inspection at slaughterhouses, the routine diagnostic method in Brazil, lacks the necessary sensitivity to detect the mildly infected cattle that are typically encoutered in Brazil. In this study we have tested cattle sera from animals diagnosed as positive and negative by veterianry inspection for (1 anti-parasite antibodies using metacestodes antigens (T. solium vesicular fluid and T. saginata secretions and (2 the HP10 secreted antigen of viable metacestodes. The cut-off values were calculated by ROC curve for intense and mild infections conditions, and by the classical method ( for negative samples. The sensitivity and specificity of these diagnostic tests were different depending on the assumed cut-off value and, importantly, whether the infection was mild or intense. In spite of these observations, however, such ELISA assays for serum antibodies and parasite antigens constitute an important tool for epidemiological porposes, and in establishing priorities for the control of bovine cysticercosis.

Testing for Gluten-Related Disorders in Clinical Practice: The Role of Serology in Managing the Spectrum of Gluten Sensitivity

Directory of Open Access Journals (Sweden)

David Armstrong

2011-01-01

Full Text Available Immunoglobulin A tissue transglutaminase is the single most efficient serological test for the diagnosis of celiac disease. It is well known that immunoglobulin A tissue transglutaminase levels correlate with the degree of intestinal damage, and that values can fluctuate in patients over time. Serological testing can be used to identify symptomatic individuals that need a confirmatory biopsy, to screen at-risk populations or to monitor diet compliance in patients previously diagnosed with celiac disease. Thus, interpretation of serological testing requires consideration of the full clinical scenario. Antigliadin tests are no longer recommended for the diagnosis of classical celiac disease. However, our understanding of the pathogenesis and spectrum of gluten sensitivity has improved, and gluten-sensitive irritable bowel syndrome patients are increasingly being recognized. Studies are needed to determine the clinical utility of antigliadin serology in the diagnosis of gluten sensitivity.

Serological Follow up in 50 Brucellosis Cases in a Rural Area

Directory of Open Access Journals (Sweden)

Semra Özgümüş

2015-06-01

Full Text Available Aim: Brucellosis is an endemic and zoonotic disease in livestock farming areas. Patients may exhibit relapses, reinfections and multi-system complications. Therefore, early diagnosis, appropriate treatment as well as serological follow-up are extremely important in the management of this disease. Methods: We aimed to investigate the demographic characteristics, clinical and laboratory findings and risk factors in 50 brucellosis cases (14 males, 36 females who were treated in Hakkari State Hospital. All patients were evaluated for post-treatment serological results. Results: The mean age of the patients was 35 years. The main clinical symptoms were arthralgia, fatigue, sweating, back pain, and headache. Fever, hepatomegaly, splenomegaly and arthritis were the most common signs. Anemia, high level of AST and ALT, leukopenia, thrombocytopenia, high sedimentation rate, and leukocytosis were found in laboratory tests. The Wright agglutination test was positive at titers of 1/160 in 18 cases, 1/320 in 22 cases, 1/640 in 3 cases, and 1/1280 in 7 cases. Twelve patients had relapse. One patient, who was a veterinarian, was infected via splashing live brucella vaccine into the eyes. Two women transmitted the disease to their babies through breast milk. At the end of the treatment, Wright agglutination test results were negative in all patients. Conclusion: The average duration of symptoms before the diagnosis was 4 months in our study. Therefore, brucellosis should be considered in all individuals who present with fever and arthralgia in endemic areas (The Medical Bulletin of Haseki 2015; 53:139-42

A novel method of selective removal of human DNA improves PCR sensitivity for detection of Salmonella Typhi in blood samples.

Science.gov (United States)

Zhou, Liqing; Pollard, Andrew J

2012-07-27

Enteric fever is a major public health problem, causing an estimated 21million new cases and 216,000 or more deaths every year. Current diagnosis of the disease is inadequate. Blood culture only identifies 45 to 70% of the cases and is time-consuming. Serological tests have very low sensitivity and specificity. Clinical samples obtained for diagnosis of enteric fever in the field generally have blood, so that even PCR-based methods, widely used for detection of other infectious diseases, are not a straightforward option in typhoid diagnosis. We developed a novel method to enrich target bacterial DNA by selective removal of human DNA from blood samples, enhancing the sensitivity of PCR tests. This method offers the possibility of improving PCR assays directly using clinical specimens for diagnosis of this globally important infectious disease. Blood samples were mixed with ox bile for selective lysis of human blood cells and the released human DNA was then digested with addition of bile resistant micrococcal nuclease. The intact Salmonella Typhi bacteria were collected from the specimen by centrifugation and the DNA extracted with QIAamp DNA mini kit. The presence of Salmonella Typhi bacteria in blood samples was detected by PCR with the fliC-d gene of Salmonella Typhi as the target. Micrococcal nuclease retained activity against human blood DNA in the presence of up to 9% ox bile. Background human DNA was dramatically removed from blood samples through the use of ox bile lysis and micrococcal nuclease for removal of mammalian DNA. Consequently target Salmonella Typhi DNA was enriched in DNA preparations and the PCR sensitivity for detection of Salmonella Typhi in spiked blood samples was enhanced by 1,000 fold. Use of a combination of selective ox-bile blood cell lysis and removal of human DNA with micrococcal nuclease significantly improves PCR sensitivity and offers a better option for improved typhoid PCR assays directly using clinical specimens in diagnosis of

Detection method of internal leakage from valve using acoustic method

International Nuclear Information System (INIS)

Kumagai, Horomichi

1990-01-01

The purpose of this study is to estimate the availability of acoustic method for detecting the internal leakage of valves at power plants. Experiments have been carried out on the characteristics of acoustic noise caused by the leak simulated flow. From the experimental results, the mechanism of the acoustic noisegenerated from flow, the relation between acoustic intensity and leak flow velocity, and the characteristics of the acoustic frequency spectrum were clarified. The acoustic method was applied to valves at site, and the background noises were measured in abnormal plant conditions. When the background level is higher than the acoustic signal, the difference between the background noise frequency spectrum and the acoustic signal spectrum provide a very useful leak detection method. (author)

Cross-Sectional Serological Survey of Human Fascioliasis in Canutama Municipality in Western Amazon, Brazil

Directory of Open Access Journals (Sweden)

Marcel Gonçalves Maciel

2018-01-01

Full Text Available Background. Fascioliasis is an important parasitic disease. In the northern region of Brazil, a human parasite infection has been reported through a coprological survey. Eggs of Fasciola hepatica were found in fecal samples of 11 individuals. Knowledge of the infection in animals or the presence of snails is necessary to address the possibility of the parasite cycle occurrence in that region. The aim of this study was to describe the transmission of human fascioliasis in Canutama, Amazonas, in Western Amazonia, Brazil. Methods. Serological (ELISA and Western Blot, WB and parasitological analyses were carried out in humans. In addition, the presence of the intermediate snail host within the community was examined. Results. A total of 434 human samples were included in the study, of which 36 (8.3% were reactive by ELISA and 8 (1.8% were reactive by WB. Fasciola hepatica eggs were found in one human sample. The occurrence of the intermediated host was recorded and 31/43 specimens were identified as Lymnaea columella. Conclusion. Canutama constitutes a focus of transmission of human fascioliasis. This study describes the first serological survey for human fascioliasis, as well as its simultaneous occurrence in human hosts and possible intermediates performed in northern Brazil.

Multi-epitope chimeric antigen used as a serological marker to estimate Plasmodium falciparum transmission intensity in the border area of China-Myanmar.

Science.gov (United States)

Yao, Mei-Xue; Sun, Xiao-Dong; Gao, Yu-Hui; Cheng, Zhi-Bin; Deng, Wei-Wei; Zhang, Jia-Jia; Wang, Heng

2016-09-07

Following the decline of malaria transmission in many countries and regions, serological parameters have become particularly useful for estimating malaria transmission in low-intensity areas. This study evaluated a novel serological marker, Malaria Random Constructed Antigen-1 (M.RCAg-1), which contains 11 epitopes from eight Plasmodium falciparum antigens, as a tool for assessing malaria transmission intensity along the border area of China-Myanmar. Serum from Plasmodium falciparum and P. vivax patients was used to detect the properties of M.RCAg-1 and antibody responses. Cross-sectional surveys were conducted at the China-Myanmar border and in Hainan province in 2012 and 2013 using cluster sampling. Filter blood spot papers were collected from all participants. Antibodies against M.RCAg-1 were detected using indirect ELISA. The Mann-Whitney test and Spearman's rank correlation test were performed to analyze antibody data. P. falciparum malaria transmission intensity was estimated using a catalytic conversion model based on the maximum likelihood of generating a community seroconversion rate (SCR). M.RCAg-1 was well-recognized by the naturally acquired anti-malaria antibodies in P. falciparum patients and had very limited cross-reactivity with P. vivax infection. The total amount of IgG antibodies was decreased with the decrease in parasitemia after taking medication and lasted several weeks. In a population survey, the antibody levels were higher in residents living close to the China-Myanmar border than those living in non-epidemic areas (P < 0.0001), but no significant difference was observed between residents from Hainan and non-epidemic areas. The calculated SCR was 0.0128 for Jieyangka, 0.004 for Susuzhai, 0.0047 for Qiushan, and 0.043 for Kayahe. The estimated exposure rate obtained from the anti-M.RCAg-1 antibody level correlated with traditional measures of transmission intensity derived from altitude. Our study demonstrates that M.RCAg-1 is

Method of detecting failed fuels

International Nuclear Information System (INIS)

Ishizaki, Hideaki; Suzumura, Takeshi.

1982-01-01

Purpose: To enable the settlement of the temperature of an adequate filling high temperature pure water by detecting the outlet temperature of a high temperature pure water filling tube to a fuel assembly to control the heating of the pure water and detecting the failed fuel due to the sampling of the pure water. Method: A temperature sensor is provided at a water tube connected to a sipping cap for filling high temperature pure water to detect the temperature of the high temperature pure water at the outlet of the tube, and the temperature is confirmed by a temperature indicator. A heater is controlled on the basis of this confirmation, an adequate high temperature pure water is filled in the fuel assembly, and the pure water is replaced with coolant. Then, it is sampled to settle the adequate temperature of the high temperature coolant used for detecting the failure of the fuel assembly. As a result, the sipping effect does not decrease, and the failed fuel can be precisely detected. (Yoshihara, H.)

First international collaborative study to evaluate rabies antibody detection method for use in monitoring the effectiveness of oral vaccination programmes in fox and raccoon dog in Europe

DEFF Research Database (Denmark)

Wasniewski, M; Almeida, I; Baur, A

2016-01-01

The most effective and sustainable method to control and eliminate rabies in wildlife is the oral rabies vaccination (ORV) of target species, namely foxes and raccoon dogs in Europe. According to WHO and OIE, the effectiveness of oral vaccination campaigns should be regularly assessed via disease...... surveillance and ORV antibody monitoring. Rabies antibodies are generally screened for in field animal cadavers, whose body fluids are often of poor quality. Therefore, the use of alternative methods such as the enzyme-linked immunosorbent assay (ELISA) has been proposed to improve reliability of serological...... results obtained on wildlife samples. We undertook an international collaborative study to determine if the commercial BioPro ELISA Rabies Ab kit is a reliable and reproducible tool for rabies serological testing. Our results reveal that the overall specificity evaluated on naive samples reached 96...

Estimating loss of Brucella abortus antibodies from age-specific serological data in elk

Science.gov (United States)

Benavides, J. A.; Caillaud, D.; Scurlock, B. M.; Maichak, E. J.; Edwards, W.H.; Cross, Paul C.

2017-01-01

Serological data are one of the primary sources of information for disease monitoring in wildlife. However, the duration of the seropositive status of exposed individuals is almost always unknown for many free-ranging host species. Directly estimating rates of antibody loss typically requires difficult longitudinal sampling of individuals following seroconversion. Instead, we propose a Bayesian statistical approach linking age and serological data to a mechanistic epidemiological model to infer brucellosis infection, the probability of antibody loss, and recovery rates of elk (Cervus canadensis) in the Greater Yellowstone Ecosystem. We found that seroprevalence declined above the age of ten, with no evidence of disease-induced mortality. The probability of antibody loss was estimated to be 0.70 per year after a five-year period of seropositivity and the basic reproduction number for brucellosis to 2.13. Our results suggest that individuals are unlikely to become re-infected because models with this mechanism were unable to reproduce a significant decline in seroprevalence in older individuals. This study highlights the possible implications of antibody loss, which could bias our estimation of critical epidemiological parameters for wildlife disease management based on serological data.

System and Method for Multi-Wavelength Optical Signal Detection

Science.gov (United States)

McGlone, Thomas D. (Inventor)

2017-01-01

The system and method for multi-wavelength optical signal detection enables the detection of optical signal levels significantly below those processed at the discrete circuit level by the use of mixed-signal processing methods implemented with integrated circuit technologies. The present invention is configured to detect and process small signals, which enables the reduction of the optical power required to stimulate detection networks, and lowers the required laser power to make specific measurements. The present invention provides an adaptation of active pixel networks combined with mixed-signal processing methods to provide an integer representation of the received signal as an output. The present invention also provides multi-wavelength laser detection circuits for use in various systems, such as a differential absorption light detection and ranging system.

Steam leak detection method in pipeline using histogram analysis

Energy Technology Data Exchange (ETDEWEB)

Kim, Se Oh; Jeon, Hyeong Seop; Son, Ki Sung; Chae, Gyung Sun [Saean Engineering Corp, Seoul (Korea, Republic of); Park, Jong Won [Dept. of Information Communications Engineering, Chungnam NationalUnversity, Daejeon (Korea, Republic of)

2015-10-15

Leak detection in a pipeline usually involves acoustic emission sensors such as contact type sensors. These contact type sensors pose difficulties for installation and cannot operate in areas having high temperature and radiation. Therefore, recently, many researchers have studied the leak detection phenomenon by using a camera. Leak detection by using a camera has the advantages of long distance monitoring and wide area surveillance. However, the conventional leak detection method by using difference images often mistakes the vibration of a structure for a leak. In this paper, we propose a method for steam leakage detection by using the moving average of difference images and histogram analysis. The proposed method can separate the leakage and the vibration of a structure. The working performance of the proposed method is verified by comparing with experimental results.

A review on automated pavement distress detection methods

NARCIS (Netherlands)

Coenen, Tom B.J.; Golroo, Amir

2017-01-01

In recent years, extensive research has been conducted on pavement distress detection. A large part of these studies applied automated methods to capture different distresses. In this paper, a literature review on the distresses and related detection methods are presented. This review also includes

Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

Science.gov (United States)

Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey

2018-06-01

Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

Serological Evidence of Immune Priming by Group A Streptococci in Patients with Acute Rheumatic Fever

Directory of Open Access Journals (Sweden)

Jeremy M Raynes

2016-07-01

Full Text Available Acute rheumatic fever (ARF is an autoimmune response to Group A Streptococcus (GAS infection. Repeated GAS exposures are proposed to ‘prime’ the immune system for autoimmunity. This notion of immune-priming by multiple GAS infections was first postulated in the 1960s, but direct experimental evidence to support the hypothesis has been lacking. Here we present novel methodology, based on antibody responses to GAS T‑antigens, that enables previous GAS exposures to be mapped in patient sera. T-antigens are surface expressed, type specific antigens and GAS strains fall into 18 major clades or T-types. A panel of recombinant T-antigens was generated and immunoassays were performed in parallel with serum depletion experiments allowing type-specific T‑antigen antibodies to be distinguished from cross-reactive antibodies. At least two distinct GAS exposures were detected in each of the ARF sera tested. Furthermore, no two sera had the same T-antigen reactivity profile suggesting that each patient was exposed to a unique series of GAS T‑types prior to developing ARF. The methods have provided much-needed experimental evidence to substantiate the immune-priming hypothesis, and will facilitate further serological profiling studies that explore the multifaceted interactions between GAS and the host.

Use of pre-travel vaccine-preventable disease serology as a screening tool to identify patients in need of pre-travel vaccination: a retrospective audit.

Science.gov (United States)

Turner, David P; McGuinness, Sarah L; Cohen, Jonathan; Waring, Lynette J; Leder, Karin

2017-05-01

Vaccination is a safe and effective public health intervention that not only protects individual travellers from vaccine-preventable diseases (VPDs), but prevents them from becoming a source of disease in their destination and on their return. Obtaining an accurate vaccination history from travellers during a pre-travel review can be difficult; serology may be used to identify patients who are non-immune to specific diseases in order to guide vaccination requirements. Clinically relevant data about the usefulness of serology in this setting are lacking. We performed a retrospective audit of pre-travel VPD serology requested by practitioners of a busy community-based travel clinic. All serological results for measles, mumps, rubella, varicella zoster virus, hepatitis A and B requested over a 5-year period were extracted and analysed. Results were stratified by gender and year of birth and compared using Stata. Four thousand four hundred and fifty-one serological assays from 1445 individual were assessed. Overall, 47% of patients tested had at least one negative serological result. High rates of seropositivity for measles, mumps and rubella were seen in those born prior to 1966 but >10% of travellers born after 1966 lacked serological evidence of protection against these diseases. Hepatitis A and B serological results revealed broadly lower rates of immunity in our community likely reflecting the absence of these vaccines from historical vaccine protocols. Serology can be a useful tool in the identification of non-immune travellers to enable targeted vaccination prior to travel. We recommend that travel health clinicians assess patients' vaccination and infection histories, and strongly consider serology or vaccination where there is doubt about immunity. This will help protect the traveller and prevent importation of disease into destination or home communities. © International Society of Travel Medicine, 2017. Published by Oxford University Press. All rights

Method for predicting peptide detection in mass spectrometry

Science.gov (United States)

Kangas, Lars [West Richland, WA; Smith, Richard D [Richland, WA; Petritis, Konstantinos [Richland, WA

2010-07-13

A method of predicting whether a peptide present in a biological sample will be detected by analysis with a mass spectrometer. The method uses at least one mass spectrometer to perform repeated analysis of a sample containing peptides from proteins with known amino acids. The method then generates a data set of peptides identified as contained within the sample by the repeated analysis. The method then calculates the probability that a specific peptide in the data set was detected in the repeated analysis. The method then creates a plurality of vectors, where each vector has a plurality of dimensions, and each dimension represents a property of one or more of the amino acids present in each peptide and adjacent peptides in the data set. Using these vectors, the method then generates an algorithm from the plurality of vectors and the calculated probabilities that specific peptides in the data set were detected in the repeated analysis. The algorithm is thus capable of calculating the probability that a hypothetical peptide represented as a vector will be detected by a mass spectrometry based proteomic platform, given that the peptide is present in a sample introduced into a mass spectrometer.

Serological Reactivity and Identification of Immunoglobulin E-Binding Polypeptides of Ganoderma applanatum Crude Spore Cytoplasmic Extract in Puerto Rican Subjects.

Science.gov (United States)

Vilá-Héreter, Frances; Rivera-Mariani, Félix E; Bolaños-Rosero, Benjamín

2017-01-01

The allergenic potential of Ganoderma applanatum basidiospores has been demonstrated previously in Puerto Rico. However, basidiomycete allergens are not available for inclusion in allergy diagnostic panels. Therefore, we sought to confirm allergic sensitization to G. applanatum crude spore cytoplasmic extract through reactivity in serological assays and detection of immunoglobulin E (IgE)-binding polypeptides. Via an indirect ELISA, serological reactivity was compared between groups of individuals with different allergic profiles. Group 1 (n = 51) consisted of individuals with sIgE to the allergens included in the diagnostic panels; group 2 (n = 14) comprised individuals with no sIgE to the allergens tested; and group 3 (n = 22) included individuals with no allergic history. To visualize IgE-binding polypeptides, group 1 sera were examined via Western blotting (WB). Polypeptide bands with the highest reactivity were analyzed by mass spectrometry (MS) for putative identification. The serological reactivity of group 1 was significantly higher than that of group 3 in an indirect ELISA (p = 0.03). Sixty-five percent of group 1 individuals showed reactivity to polypeptide bands in WB. Bands of 81 and 56 kDa had the highest reactivity proportions among the reactive sera, followed by a 45-kDa band. MS analysis of these 3 polypeptides suggests that they are basidiomycete-derived enzymes with aconitate hydratase, catalase, and enolase functions. G. applanatum spores have allergenic components recognized by Puerto Rican individuals, which could eventually be considered as markers in cases of fungal allergy and be included in diagnostic allergen panels in Puerto Rico and tropical regions. © 2017 S. Karger AG, Basel.

Comparison the diagnostic value of serological and molecular methods for screening and detecting Chlamydia trachomatis in semen of infertile men: A cross-sectional study

Directory of Open Access Journals (Sweden)

Amin Khoshakhlagh

2017-12-01

Full Text Available Background: Chlamydia trachomatis (CT with damaging effects on sperm quality parameters can often cause infertility in men. Objective: The main objective of this study was to determine the diagnostic value of polymerase chain reaction (PCR and enzyme linked immuno sorbent assay (ELISA for screening and detecting CT in semen samples of infertile men. Materials and Methods: In this cross-sectional study, 465 men referring to the clinical laboratory of Royan Institute were chosen for primary screening and detection of the presence of CT. 93 samples were normozoospermia with normal sperm parameters i.e. sperm number, motility and morphology (Asymptomatic and 372 had abnormal sperm parameters (Symptomatic in semen analysis. ELISA test was performed as the screening test. Samples with optical density (OD >0.200 were selected as the case and asymptomatic samples with OD 0.400 as the ELISA positive, the diagnostic value of CT-ELISA positive in symptomatic and asymptomatic infertile patients were 0.019 (7 of 372 and 0.021 (2 of 93, respectively. There was no relationship between the presence of CT infection and different sperm abnormalities. Conclusion: The anti-CT IgA ELISA test may be introduced as an appropriate tool for screening purpose in the seminal plasma to select suspicious samples for PCR confirmatory tests.

9 CFR 130.16 - User fees for veterinary diagnostic serology tests performed at NVSL (excluding FADDL) or at...

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false User fees for veterinary diagnostic serology tests performed at NVSL (excluding FADDL) or at authorized sites. 130.16 Section 130.16 Animals... USER FEES § 130.16 User fees for veterinary diagnostic serology tests performed at NVSL (excluding...

Canine leishmaniosis caused by Leishmania major and Leishmania tropica: comparative findings and serology.

Science.gov (United States)

Baneth, Gad; Yasur-Landau, Daniel; Gilad, Matan; Nachum-Biala, Yaarit

2017-03-13

Infection and clinical disease associated with Leishmania major and Leishmania tropica, two common agents of human cutaneous leishmaniosis, have rarely been reported in dogs. This study describes dogs infected with these Leishmania spp. prevalent in the Middle East and North Africa, and compares the serological response of dogs infected with Leishmania infantum, L. major or L. tropica to whole promastigote antigen enzyme-linked immunosorbent assay (ELISA) of each species and to rK39 dipstick. Leishmania major infection in a 5-month-old male dog was associated with alopecic and ulcerative periocular and limb skin lesions which responded to allopurinol treatment. Infection was detected by skin and blood polymerase chain reaction (PCR) and confirmed by DNA sequencing but the dog was seronegative. Leishmania tropica infection was detected in a 3-month-old female dog co-infected with Babesia vogeli and Anaplasma platys and with no skin lesions. PCR and DNA sequencing of the blood and parasite culture were positive for L. tropica. Sera from 11 dogs infected with L. infantum, L. major or L. tropica were reactive with all three Leishmania spp. antigens except for sera from a dog with L. major infection. No significant differences were found between reactivity of dog sera to the antigen of the infecting species, or to the other Leishmania spp. antigens. Sera from dogs infected with L. infantum and L. tropica were positive with the rK39 antigen kit, while dogs with L. major infection were seronegative. Skin lesions in L. major infected dogs from this study and previous reports (n = 2) were ulcerative and located on the muzzle, feet and foot pads and not associated with generalized lymphadenomegaly and splenomegaly. In previous L. tropica infections, skin lesions were proliferative mucocutaneous in young dogs (n = 2), or associated with widespread dermatitis, lymphadenomegaly and splenomegaly in older dogs with similarity to L. infantum infection (n = 2). This

Surveillance and laboratory detection system of Crimean-Congo haemorrhagic fever in Iran

DEFF Research Database (Denmark)

Chinikar, S; Goya, M M; Shirzadi, M R

2008-01-01

Crimean-Congo haemorrhagic fever (CCHF) is a viral zoonotic disease with a high mortality rate in humans. The CCHF virus (CCHFV) is transmitted to humans through the bite of Ixodid ticks or by contact with blood or tissues of infected livestock. In addition to zoonotic transmission, CCHFV can be ....... After two decades and observations of CCHF in some provinces of Iran, a CCHF surveillance and detection system was established in 1999, leading to a dramatically decreased mortality rate from 20% (year 2000) to 2% (year 2007)....... symptoms, the diagnosis of CCHF is based on the use of serological tests for the detection of immunoglobulin M and immunoglobulin G antibodies and on the use of molecular tools such as RT-PCR. From 1970 to 1978, serological and epidemiological studies were performed in humans and in livestock of Iran...

Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

OpenAIRE

Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

2009-01-01

Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

Development and evaluation of modern enzyme immunoassays for comprehensive syphilis serology

NARCIS (Netherlands)

O.E. IJsselmuiden

1989-01-01

textabstractIn the previous Chapters of this dissertation the major shortcomings of the current serological tests for syphilis were investigated. These include an insufficient sensitivity and specificity, reactivity of a diagnostic test long after the syphilitic infection had been

Nectin-4 is a new histological and serological tumor associated marker for breast cancer

International Nuclear Information System (INIS)

Fabre-Lafay, Stéphanie; Geneix, Jeannine; Lecocq, Eric; Popovici, Cornel; Dubreuil, Patrice; Viens, Patrice; Gonçalves, Anthony; Charafe-Jauffret, Emmanuelle; Jacquemier, Jocelyne; Birnbaum, Daniel; Lopez, Marc; Monville, Florence; Garrido-Urbani, Sarah; Berruyer-Pouyet, Carole; Ginestier, Christophe; Reymond, Nicolas; Finetti, Pascal; Sauvan, Richard; Adélaïde, José

2007-01-01

Breast cancer is a complex and heterogeneous disease at the molecular level. Evolution is difficult to predict according to classical histoclinical prognostic factors. Different studies highlight the importance of large-scale molecular expression analyses to improve taxonomy of breast cancer and prognostic classification. Identification of new molecular markers that refine this taxonomy and improve patient management is a priority in the field of breast cancer research. Nectins are cell adhesion molecules involved in the regulation of epithelial physiology. We present here Nectin-4/PVRL4 as a new histological and serological tumor associated marker for breast carcinoma. Expression of Nectin-4 protein was measured on a panel of 78 primary cells and cell lines from different origins and 57 breast tumors by FACS analysis and immunohistochemistry (IHC), respectively. mRNA expression was measured by quantitative PCR. Serum Nectin-4 was detected by ELISA and compared with CEA and CA15.3 markers, on panels of 45 sera from healthy donors, 53 sera from patients with non-metastatic breast carcinoma (MBC) at diagnosis, and 182 sera from patients with MBC. Distribution of histological/serological molecular markers and histoclinical parameters were compared using the standard Chi-2 test. Nectin-4 was not detected in normal breast epithelium. By contrast, Nectin-4 was expressed in 61% of ductal breast carcinoma vs 6% in lobular type. Expression of Nectin-4 strongly correlated with the basal-like markers EGFR, P53, and P-cadherin, and negatively correlated with the luminal-like markers ER, PR and GATA3. All but one ER/PR-negative tumors expressed Nectin-4. The detection of Nectin-4 in serum improves the follow-up of patients with MBC: the association CEA/CA15.3/Nectin-4 allowed to monitor 74% of these patients compared to 67% with the association CEA/CA15.3. Serum Nectin-4 is a marker of disease progression, and levels correlate with the number of metastases (P = 0.038). Serum

A Bayesian method for detecting stellar flares

Science.gov (United States)

Pitkin, M.; Williams, D.; Fletcher, L.; Grant, S. D. T.

2014-12-01

We present a Bayesian-odds-ratio-based algorithm for detecting stellar flares in light-curve data. We assume flares are described by a model in which there is a rapid rise with a half-Gaussian profile, followed by an exponential decay. Our signal model also contains a polynomial background model required to fit underlying light-curve variations in the data, which could otherwise partially mimic a flare. We characterize the false alarm probability and efficiency of this method under the assumption that any unmodelled noise in the data is Gaussian, and compare it with a simpler thresholding method based on that used in Walkowicz et al. We find our method has a significant increase in detection efficiency for low signal-to-noise ratio (S/N) flares. For a conservative false alarm probability our method can detect 95 per cent of flares with S/N less than 20, as compared to S/N of 25 for the simpler method. We also test how well the assumption of Gaussian noise holds by applying the method to a selection of `quiet' Kepler stars. As an example we have applied our method to a selection of stars in Kepler Quarter 1 data. The method finds 687 flaring stars with a total of 1873 flares after vetos have been applied. For these flares we have made preliminary characterizations of their durations and and S/N.

Serological evidence of asymptomatic infections during Escherichia coli O104:H4 outbreak in Germany in 2011.

Directory of Open Access Journals (Sweden)

Yanina Balabanova

Full Text Available INTRODUCTION: The largest known outbreak caused by a rare hybrid strain of Shiga toxin-producing E.coli (STEC and enteroaggregative E. coli (EAEC (E.coli O104:H4 of serotype O104:H4 occurred in Germany in 2011. Fenugreek sprouts acted as a transmission vehicle and were widely consumed in the outbreak area at the time of the epidemic. In total 3,842 people developed a clinical illness caused by this strain; however the rates of asymptomatic infections remain unclear. We aimed to develop a serological assay for detection of E.coli O104 LPS specific antibodies and to establish the post-outbreak levels of seropositivity among people with documented exposure to contaminated sprouts. RESULTS AND DISCUSSION: Developed serological assays (ELISA with 84% sensitivity, 63% specificity and Western Blot with 100% sensitivity, 82.5% specificity identified 33% (16/49 level of asymptomatic infection. Relatively small sample size and a significant time- lapse between the onset of symptoms and serum samples collection (appr. 8 weeks might explain the assay variability. No association was found between clinical or demographic characteristics and assay positivity. Larger studies are needed to understand the complexity of human immune response and factors influencing development of clinical symptoms. Development of intra-outbreak research plans will substantially aid the conduct of more thorough scientific investigation during an outbreak period.

Poor Positive Predictive Value of Lyme Disease Serologic Testing in an Area of Low Disease Incidence.

Science.gov (United States)

Lantos, Paul M; Branda, John A; Boggan, Joel C; Chudgar, Saumil M; Wilson, Elizabeth A; Ruffin, Felicia; Fowler, Vance; Auwaerter, Paul G; Nigrovic, Lise E

2015-11-01

Lyme disease is diagnosed by 2-tiered serologic testing in patients with a compatible clinical illness, but the significance of positive test results in low-prevalence regions has not been investigated. We reviewed the medical records of patients who tested positive for Lyme disease with standardized 2-tiered serologic testing between 2005 and 2010 at a single hospital system in a region with little endemic Lyme disease. Based on clinical findings, we calculated the positive predictive value of Lyme disease serology. Next, we reviewed the outcome of serologic testing in patients with select clinical syndromes compatible with disseminated Lyme disease (arthritis, cranial neuropathy, or meningitis). During the 6-year study period 4723 patients were tested for Lyme disease, but only 76 (1.6%) had positive results by established laboratory criteria. Among 70 seropositive patients whose medical records were available for review, 12 (17%; 95% confidence interval, 9%-28%) were found to have Lyme disease (6 with documented travel to endemic regions). During the same time period, 297 patients with a clinical illness compatible with disseminated Lyme disease underwent 2-tiered serologic testing. Six of them (2%; 95% confidence interval, 0.7%-4.3%) were seropositive, 3 with documented travel and 1 who had an alternative diagnosis that explained the clinical findings. In this low-prevalence cohort, fewer than 20% of positive Lyme disease tests are obtained from patients with clinically likely Lyme disease. Positive Lyme disease test results may have little diagnostic value in this setting. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

First serologic evidence of human hantavirus infection in Alagoas State in Northeastern Brazil

Directory of Open Access Journals (Sweden)

José Alfredo dos Santos-Júnior

Full Text Available Abstract INTRODUCTION: Hantavirus cardiopulmonary syndrome (HCPS is rare in Northeastern Brazil. METHODS: Prospective surveillance was conducted over a two-year period in Alagoas State, Northeastern Brazil. The prevalence of anti-hantavirus N-antigen IgM and IgG in human serum samples was determined by enzyme-linked immunosorbent assay testing. RESULTS: High avidity IgG was found in nine of 476 serum samples tested (from 102 patients with clinical manifestations compatible with HCPS, 124 patients with leptospirosis, and 250 healthy rural workers. CONCLUSIONS: Serologic evidence of past hantavirus infection in residents of Alagoas State indicates that hantaviruses are present in northeastern Brazil, even in areas silent for HCPS.

Serological diagnosis of Toxoplasma gondii infection: Recommendations from the French National Reference Center for Toxoplasmosis.

Science.gov (United States)

Villard, O; Cimon, B; L'Ollivier, C; Fricker-Hidalgo, H; Godineau, N; Houze, S; Paris, L; Pelloux, H; Villena, I; Candolfi, E

2016-01-01

Toxoplasmosis manifests no clinical signs in 80% of cases in immunocompetent patient, causing immunization characterized by the persistence of cysts, particularly in brain, muscles, and retina. Assessing the serological status, based on testing for serum toxoplasma IgG and IgM antibodies, is essential in cases that are increasingly at risk for the more severe disease forms, such as congenital or ocular toxoplasmosis. This disease also exposes immunosuppressed patients to reactivation, which can lead to more widespread forms and increased mortality. By interpreting the serological results, we can estimate the risk of contamination or reactivation and define appropriate prophylactic and preventive measures, such as hygienic and dietetic, therapeutic, biological, and clinical follow-up, according to the clinical context. We hereby propose practical approaches based on serological data, resulting from a consensus of a group of experts from the French National Reference Center Network for Toxoplasmosis, according to both routine and specific clinical situations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Mobile/android application for QRS detection using zero cross method

Science.gov (United States)

Rizqyawan, M. I.; Simbolon, A. I.; Suhendra, M. A.; Amri, M. F.; Kusumandari, D. E.

2018-03-01

In automatic ECG signal processing, one of the main topics of research is QRS complex detection. Detecting correct QRS complex or R peak is important since it is used to measure several other ECG metrics. One of the robust methods for QRS detection is Zero Cross method. This method uses an addition of high-frequency signal and zero crossing count to detect QRS complex which has a low-frequency oscillation. This paper presents an application of QRS detection using Zero Cross algorithm in the Android-based system. The performance of the algorithm in the mobile environment is measured. The result shows that this method is suitable for real-time QRS detection in a mobile application.

Serological Survey of Zoonotic Viruses in Invasive and Native Commensal Rodents in Senegal, West Africa.

Science.gov (United States)

Diagne, Christophe A; Charbonnel, Nathalie; Henttonen, Heikki; Sironen, Tarja; Brouat, Carine

2017-10-01

Increasing studies on rodent-borne diseases still highlight the major role of rodents as reservoirs of numerous zoonoses of which the frequency is likely to increase worldwide as a result of accelerated anthropogenic changes, including biological invasions. Such a situation makes pathogen detection in rodent populations important, especially in the context of developing countries characterized by high infectious disease burden. Here, we used indirect fluorescent antibody tests to describe the circulation of potentially zoonotic viruses in both invasive (Mus musculus domesticus and Rattus rattus) and native (Mastomys erythroleucus and Mastomys natalensis) murine rodent populations in Senegal (West Africa). Of the 672 rodents tested, we reported 22 seropositive tests for Hantavirus, Orthopoxvirus, and Mammarenavirus genera, and no evidence of viral coinfection. This study is the first to report serological detection of Orthopoxvirus in rodents from Senegal, Mammarenavirus in R. rattus from Africa, and Hantavirus in M. m. domesticus and in M. erythroleucus. Further specific identification of the viral agents highlighted here is urgently needed for crucial public health concerns.

Serological IgG Testing to Diagnose Alimentary Induced Diseases and Monitoring Efficacy of an Individual Defined Diet in Dogs

OpenAIRE

Anne-Margré C. Vink

2014-01-01

Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human ...

Advantages and disadvantages of current diagnostic tests for the detection of Helicobacter pylori.

Science.gov (United States)

Mégraud, F

1996-01-01

Current tests used to detect Helicobacter pylori are either invasive (histological detection, culture, the polymerase chain reaction (PCR), smear examination) or non-invasive (serology, 13C-urea breath test). These tests vary in their sensitivity and specificity, and the choice of test will depend on the situation, for example, whether the test is to detect infection or the success of eradication treatment. The accuracy of histological tests depends, to a large degree, on the expertise of the pathologist, while the accuracy of culture can depend on the conditions in which the specimen is transported and processed. When performed under optimal conditions, both techniques give very good results. The PCR test has similar sensitivity and specificity to histological and culture tests but a strict protocol must be followed to avoid contamination with H. pylori DNA. The rapid urease test (with a reading taken 1 hour later) is suitable for diagnosis before treatment but its sensitivity decreases after treatment. Smear examination has limited sensitivity. The urea breath test and serology (specific IgG detected by enzyme-linked immunosorbent assay with purified antigens) have sensitivities close to those using the best of the biopsy methods. Other points to consider when selecting a test are its availability, the rapidity of the results (which can range from a few minutes to 2 weeks), possibilities for retrospective analysis, quantification and the detection of pathogenic properties, the globality of certain tests that present an overall picture of the stomach, thus avoiding errors in sampling, and the cost of the test. Important added value can be gained from certain tests: histology allows evaluation of the status of the mucosa, culture allows strain typing and tests for antibiotic susceptibility, and the breath test can confirm successful eradication without endoscopy. When the diagnostic tests are performed correctly, most of them are highly accurate.

Heterogeneous clinical spectrum of anti-SRP myositis and importance of the methods of detection of anti-SRP autoantibodies: a multicentric study.

Science.gov (United States)

Picard, Cécile; Vincent, Thierry; Lega, Jean-Christophe; Hue, Sophie; Fortenfant, Françoise; Lakomy, Daniela; Humbel, René-Louis; Goetz, Joelle; Molinari, Nicolas; Bardin, Nathalie; Bertin, Daniel; Johanet, Catherine; Chretien, Pascale; Dubucquoi, Sylvain; Streichenberger, Nathalie; Desplat-Jégo, Sophie; Bossuyt, Xavier; Sibilia, Jean; Abreu, Isabelle; Chevailler, Alain; Fabien, Nicole

2016-06-01

Anti-signal recognition particle (SRP) antibodies are important serological markers for the diagnosis and the prognosis of idiopathic inflammatory myopathy (IIM), especially to distinguish immune-mediated necrotizing myopathy (IMNM). This study was set up to investigate the phenotype associated with anti-SRP antibodies and to evaluate the methods for detecting these antibodies. Clinical and biological data were retrospectively obtained from 60 adult patients with anti-SRP antibodies detected by a dot immunoassay from 12 centers. Thirty-six (60 %) out of these 60 patients suffered from an IIM, and among them, 21 patients were diagnosed as IMNM. Among patients with a definite IIM, proximal weakness and myalgia were prominent symptoms at the time of diagnosis. Only few patients displayed severe extra-muscular symptoms such as cardiac involvement or severe myositis. Mean creatine kinase levels were high for all patients except for two of them. When testing by indirect immunofluorescence (IIF) on HEp2 cells, the fraction of patients displaying the typical anti-SRP fine speckled staining of the cytoplasm was higher in patients with IIM (30/36) (83 %) than in patients with non-IIM (3/24) (12.5 %) (p myositis, whereas only 6 (22 %) out of 27 patients with a positive immunodot but a negative cytoplasmic pattern suffered from a myositis (p myositis.

Association of serologic and hematologic test results in dengue infant patients in RSUP. Dr. Hasan Sadikin Bandung

Science.gov (United States)

Alam, A.; Handayani, I.; Indrati, A. R.

2018-03-01

The incidence of Dengue virus infection is increasing every year,and the progression of the disease is faster towards severe manifestations in infants than in children and adults.The clinical appearance is still challenging to make for the diagnosis of dengue fever, so routine blood examination becomes one of thefurther enforcement efforts. The gold standard isconfirmatory tests for dengue, but this examination would be difficult in remote areas and also cost more. Research on serological testing and its association with routine blood testing in infant dengue-infected patients is still less publicized. The purpose of this study was to describe theconnection between serological and routine blood test results of infant dengue infection patients in RSUP Dr. Hasan Sadikin. Observational design in dengue 56 infants with 2-12 months age range examined serologic test and routine blood examination. The results showed that serological testing tended to be on routine blood tests. It can be from differences in routine blood tests such as hemoglobin, hematocrit, and platelets. Also, there was also no difference in routine blood profile between reactive and non-reactive IgM groups. It suggests that routine blood examination results are still lacking for the diagnosis of dengue.

Adjunct methods for caries detection

DEFF Research Database (Denmark)

Twetman, Svante; Axelsson, Susanna Bihari; Dahlén, Gunnar

2012-01-01

Abstract Objective. To assess the diagnostic accuracy of adjunct methods used to detect and quantify dental caries. Study design. A systematic literature search for relevant papers was conducted with pre-determined inclusion and exclusion criteria. Abstracts and full text articles were assessed...

Support system and method for detecting neurodegenerative disorder

DEFF Research Database (Denmark)

2013-01-01

The present invention relates to a system and a method for detection of abnormal motor activity during REM sleep, and further to systems and method for assisting in detecting neurodegenerative disorders such as Parkinson's. One embodiment relates to a method for detection of abnormal motor activity...... during REM sleep comprising the steps of: performing polysomnographic recordings of a sleeping subject, thereby obtaining one or more electromyography (EMG) derivations, preferably surface EMG recordings, and one or more EEG derivations, and/or one or more electrooculargraphy (EOG) derivations, detecting...... one or more REM sleep stages, preferably based on the one or more EEG and/or EOG derivations, determining the level of muscle activity during the one or more REM sleep stages based on the one or more EMG derivations, wherein a subject having an increased level of muscle activity during REM sleep...

Concrete deterioration: detection by ultrasonic pulse velocity method

International Nuclear Information System (INIS)

Sutan, N.M.; Jaafar, M.S.; Hamdan, S.

2003-01-01

Tests were performed to evaluate the feasibility of using Ultrasonic Pulse Velocity Method (UPVM) in detecting defect and determining its depth during the early age concrete. Five reinforced concrete (RC) slabs of grade 30, 40 and 50 specimens at day 3, 7,14 and 28 with a fabricated void at a known location were used. The results obtained were compared to determine the accuracy of the method hence the effectiveness of the method with different strength and as the concrete matures. This method detects defects in specimens during the early age The accuracy varies with concrete strength and as the concrete mature. The test results indicate the method can be used to assess the in-situ properties of concrete or for quality control on site. The method showed better accuracy with stronger concrete detects defects with the accuracy ranging from 55.75-99.62% from day 3-28 (full strength) respectively. (author)

Research on Quality Detection Methods for Automotive Transmission

Directory of Open Access Journals (Sweden)

Sheng FU

2014-04-01

Full Text Available Given the problems in intelligent diagnosis methods for automotive transmission, it is difficult to obtain the fault signal features and a large enough sample size to study. To solve these problems, a method integrating order tracking, cepstrum, support vector machine (SVM and extremal curve is proposed in this paper. Order tracking and cepstrum are combined for processing the non- stationary vibration signal emitted by automotive transmission. As conventional intelligent methods cannot produce true results for insufficient samples, a method that combines SVM and extremal curve is presented. Input the vector acquired from the feature signals into the SVM model for the first detection, and then do the second detection by means of extremal curve which in turn can enrich the training samples in SVM model thus making the SVM model be more perfect. Analytical description and experimental studies are presented for the methods of signal processing and quality detection. The experimental results demonstrate the effectiveness and practicability of the proposed method.

Serologic and molecular characteristics of hepatitis B virus among school children in East Java, Indonesia.

Science.gov (United States)

Utsumi, Takako; Yano, Yoshihiko; Lusida, Maria Inge; Amin, Mochamad; Soetjipto; Hotta, Hak; Hayashi, Yoshitake

2010-07-01

Universal childhood hepatitis B vaccination was introduced in Indonesia in 1997; by 2008, coverage was estimated to be 78%. This study aimed to investigate the serologic status and virologic characteristics of hepatitis B virus (HBV) among the children in East Java. A total of 229 healthy children born during 1994-1999 were enrolled in this study. Overall, 3.1% were positive for hepatitis B surface antigen (HBsAg) and 23.6% were positive for antibody to HBsAg (anti-HBs). HBV DNA was detected in 5 of 222 HBsAg-negative carriers, which were suggested to be cases of occult HBV infection. A single amino substitution (T126I) in the S region was frequently found. HBV infection remains endemic, and the prevalence of anti-HBs remains insufficient among children in East Java, Indonesia.

Development of a metabolic biosignature for detection of early Lyme disease.

Science.gov (United States)

Molins, Claudia R; Ashton, Laura V; Wormser, Gary P; Hess, Ann M; Delorey, Mark J; Mahapatra, Sebabrata; Schriefer, Martin E; Belisle, John T

2015-06-15

Early Lyme disease patients often present to the clinic prior to developing a detectable antibody response to Borrelia burgdorferi, the etiologic agent. Thus, existing 2-tier serology-based assays yield low sensitivities (29%-40%) for early infection. The lack of an accurate laboratory test for early Lyme disease contributes to misconceptions about diagnosis and treatment, and underscores the need for new diagnostic approaches. Retrospective serum samples from patients with early Lyme disease, other diseases, and healthy controls were analyzed for small molecule metabolites by liquid chromatography-mass spectrometry (LC-MS). A metabolomics data workflow was applied to select a biosignature for classifying early Lyme disease and non-Lyme disease patients. A statistical model of the biosignature was trained using the patients' LC-MS data, and subsequently applied as an experimental diagnostic tool with LC-MS data from additional patient sera. The accuracy of this method was compared with standard 2-tier serology. Metabolic biosignature development selected 95 molecular features that distinguished early Lyme disease patients from healthy controls. Statistical modeling reduced the biosignature to 44 molecular features, and correctly classified early Lyme disease patients and healthy controls with a sensitivity of 88% (84%-95%), and a specificity of 95% (90%-100%). Importantly, the metabolic biosignature correctly classified 77%-95% of the of serology negative Lyme disease patients. The data provide proof-of-concept that metabolic profiling for early Lyme disease can achieve significantly greater (P Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Method of detecting irradiated pepper

International Nuclear Information System (INIS)

Doumaru, Takaaki; Furuta, Masakazu; Katayama, Tadashi; Toratani, Hirokazu; Takeda, Atsuhiko

1989-01-01

Spices represented by pepper are generally contaminated by microorganisms, and for using them as foodstuffs, some sterilizing treatment is indispensable. However, heating is not suitable to spices, accordingly ethylene oxide gas sterilization has been inevitably carried out, but its carcinogenic property is a problem. Food irradiation is the technology for killing microorganisms and noxious insects which cause the rotting and spoiling of foods and preventing the germination, which is an energy-conserving method without the fear of residual chemicals, therefore, it is most suitable to the sterilization of spices. In the irradiation of lower than 10 kGy, the toxicity test is not required for any food, and the irradiation of spices is permitted in 20 countries. However, in order to establish the international distribution organization for irradiated foods, the PR to consumers and the development of the means of detecting irradiation are the important subjects. The authors used pepper, and examined whether the hydrogen generated by irradiation remains in seeds and it can be detected or not. The experimental method and the results are reported. From the samples without irradiation, hydrogen was scarcely detected. The quantity of hydrogen generated was proportional to dose. The measuring instrument is only a gas chromatograph. (K.I.)

Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology.

Science.gov (United States)

Huhtamo, Eili; Hasu, Essi; Uzcátegui, Nathalie Y; Erra, Elina; Nikkari, Simo; Kantele, Anu; Vapalahti, Olli; Piiparinen, Heli

2010-01-01

The increased traveling to dengue endemic regions and the numerous epidemics have led to a rise in imported dengue. The laboratory diagnosis of acute dengue requires several types of tests and often paired samples are needed for obtaining reliable results. Although several diagnostic methods are available, proper comparative data on their performance are lacking. To compare the performance of novel methods including a novel pan-DENV real-time RT-PCR and a commercially available NS1 capture-EIA in regard to IgM detection for optimizing the early diagnosis of DENV in travelers. A panel of 99 selected early phase serum samples of dengue patients was studied by real-time RT-PCR, NS1 antigen ELISA, IgM-EIA, IgG-IFA and cell culture virus isolation. The novel real-time RT-PCR was shown specific and sensitive for detection of DENV-1-4 RNA and suitable for diagnostic use. The diagnostic rate using combination of RNA and IgM detection was 99% and using NS1 and IgM detection 95.9%. The results of RNA and NS1 antigen detection disagreed in 15.5% of samples that had only RNA or NS1 antigen detected. The diagnostic rates of early samples are higher when either RNA or NS1 antigen detection is combined with IgM detection. Besides the differences in the RNA and NS1 detection assays, the observed discrepancy of results could suggest individual variation or differences in timing of these markers in patient serum. Copyright (c) 2009 Elsevier B.V. All rights reserved.

Evaluation of efficacy of some serological tests used for diagnosis of ...

African Journals Online (AJOL)

These samples were subjected to the different serological tests including Rose Bengal plate antigen test, Tube Agglutination test, Rivanol test, Indirect Enzyme Linked Immunosorbent Assay and Competitive Enzyme Linked Immunosorbent Assay. Statistical analysis of the obtained results in different cattle groups was ...

Rapid radiometric method for detection of Salmonella in foods

International Nuclear Information System (INIS)

Stewart, B.J.; Eyles, M.J.; Murrell, W.G.

1980-01-01

A radiometric method for the detection of Salmonella in foods has been developed which is based on Salmonella poly H agglutinating serum preventing Salmonella from producing 14CO2 from [14C] dulcitol. The method will detect the presence or absence of Salmonella in a product within 30 h compared to 4 to 5 days by routine culture methods. The method has been evaluated against a routine culture method using 58 samples of food. The overall agreement was 91%. Five samples negative for Salmonella by the routine method were positive by the radiometric method. These may have been false positives. However, the routine method may have failed to detect Salmonella due to the presence of large numbers of lactose-fermenting bacteria which hindered isolation of Salmonella colonies on the selective agar plates

Multiple-Features-Based Semisupervised Clustering DDoS Detection Method

Directory of Open Access Journals (Sweden)

Yonghao Gu

2017-01-01

Full Text Available DDoS attack stream from different agent host converged at victim host will become very large, which will lead to system halt or network congestion. Therefore, it is necessary to propose an effective method to detect the DDoS attack behavior from the massive data stream. In order to solve the problem that large numbers of labeled data are not provided in supervised learning method, and the relatively low detection accuracy and convergence speed of unsupervised k-means algorithm, this paper presents a semisupervised clustering detection method using multiple features. In this detection method, we firstly select three features according to the characteristics of DDoS attacks to form detection feature vector. Then, Multiple-Features-Based Constrained-K-Means (MF-CKM algorithm is proposed based on semisupervised clustering. Finally, using MIT Laboratory Scenario (DDoS 1.0 data set, we verify that the proposed method can improve the convergence speed and accuracy of the algorithm under the condition of using a small amount of labeled data sets.

Serologic survey for brucellosis in feral swine, wild ruminants, and black bear of California, 1977 to 1989.

Science.gov (United States)

Drew, M L; Jessup, D A; Burr, A A; Franti, C E

1992-07-01

A retrospective analysis of brucellosis serologic testing results in eight wildlife species in California from 1977 to 1989 was done. Samples were collected from 5,398 live-captured or hunter-killed animals and tested by combinations of up to six serologic tests for antibodies to Brucella spp. Twenty-three of 611 (3.8%) feral swine (Sus scrofa), one of 180 (0.6%) black bear (Ursus americanus), one of 355 (0.3%) California mule deer (Odocoileus hemionus californicus), and one of 1,613 (0.06%) blacktail deer (Odocoileus hemionus columbianus) samples were considered reactors. Suspect serologic reactions occurred in three of 619 (0.5%) desert bighorn sheep (Ovis canadensis nelsoni) and one of 355 (0.3%) California mule deer samples. Brucellosis is not considered an important wildlife health problem in California except in feral swine.

Detection methods for irradiated foods

International Nuclear Information System (INIS)

Dyakova, A.; Tsvetkova, E.; Nikolova, R.

2005-01-01

In connection with the ongoing world application of irradiation as a technology in Food industry for increasing food safety, it became a need for methods of identification of irradiation. It was required to control international trade of irradiated foods, because of the certain that legally imposed food laws are not violated; supervise correct labeling; avoid multiple irradiation. Physical, chemical and biological methods for detection of irradiated foods as well principle that are based, are introducing in this summary

[Serological and nutritional outcome of infants born to HIV positive mothers undergoing option B + therapy in Guédiawaye].

Science.gov (United States)

Baptiste, Diouf Jean; Djibril, Diallo; Assane, Sylla; Ngagne, Mbaye; Baly, Ouattara; Ousmane, Ndiaye

2016-01-01

As part of its Plan to eliminate mother-to-child transmission of HIV, Senegal has adopted, since 2012, WHO's B + option, which consists of systematic triple therapy for HIV-positive pregnant women associated with breastfeeding and antiretroviral (ARV) prophylaxis for their infants. Our study aims to analyze the risks of mother-to-child transmission of HIV and the nutritional outcome of infants undergoing B + option. We conducted a descriptive, retrospective study at the King Baudouin health center in Guédiaway from 1 September 2012 to 30 April 2015. All infants whose mothers were on triple therapy, undergoing protected breastfeeding, ARV prophylaxis and serological test at 14th months were included in the study. The parameters studied were mother's age and serological profile, father's serological status, the sharing of the status within the couple, infant nourishing, infant ARV prophylaxis, nutritional status at 6 and 12 months and serological status of the infant at 14 months. Out of the 126 infants undergoing PMTCT program, 42 or 33.33% of infants following the B + guidelines were included in the study. The age of mothers ranged from 15 to 42 years, with an average age of 31 years. The majority of mothers (88.1%) carried type 1 virus and 11.9% carried type 2 virus; 20 couples (47.62%) were sero-concordant, 14 were serodifferent, while the serological status was unknown or not investigated in 8 fathers (19.05%). A significant difference between fathers' serological profile and the sharing status (p option is an effective strategy to reduce the MTCT rate. However, early malnutrition in children requires nutritional support for breastfeeding mothers as well as a good psychosocial support.