WorldWideScience

Sample records for sequential lr test

  1. Multi-agent sequential hypothesis testing

    KAUST Repository

    Kim, Kwang-Ki K.; Shamma, Jeff S.

    2014-01-01

    incorporate costs of taking private/public measurements, costs of time-difference and disagreement in actions of agents, and costs of false declaration/choices in the sequential hypothesis testing. The corresponding sequential decision processes have well

  2. Sequential Probability Ration Tests : Conservative and Robust

    NARCIS (Netherlands)

    Kleijnen, J.P.C.; Shi, Wen

    2017-01-01

    In practice, most computers generate simulation outputs sequentially, so it is attractive to analyze these outputs through sequential statistical methods such as sequential probability ratio tests (SPRTs). We investigate several SPRTs for choosing between two hypothesized values for the mean output

  3. Multi-agent sequential hypothesis testing

    KAUST Repository

    Kim, Kwang-Ki K.

    2014-12-15

    This paper considers multi-agent sequential hypothesis testing and presents a framework for strategic learning in sequential games with explicit consideration of both temporal and spatial coordination. The associated Bayes risk functions explicitly incorporate costs of taking private/public measurements, costs of time-difference and disagreement in actions of agents, and costs of false declaration/choices in the sequential hypothesis testing. The corresponding sequential decision processes have well-defined value functions with respect to (a) the belief states for the case of conditional independent private noisy measurements that are also assumed to be independent identically distributed over time, and (b) the information states for the case of correlated private noisy measurements. A sequential investment game of strategic coordination and delay is also discussed as an application of the proposed strategic learning rules.

  4. A one-sided sequential test

    Energy Technology Data Exchange (ETDEWEB)

    Racz, A.; Lux, I. [Hungarian Academy of Sciences, Budapest (Hungary). Atomic Energy Research Inst.

    1996-04-16

    The applicability of the classical sequential probability ratio testing (SPRT) for early failure detection problems is limited by the fact that there is an extra time delay between the occurrence of the failure and its first recognition. Chien and Adams developed a method to minimize this time for the case when the problem can be formulated as testing the mean value of a Gaussian signal. In our paper we propose a procedure that can be applied for both mean and variance testing and that minimizes the time delay. The method is based on a special parametrization of the classical SPRT. The one-sided sequential tests (OSST) can reproduce the results of the Chien-Adams test when applied for mean values. (author).

  5. On Locally Most Powerful Sequential Rank Tests

    Czech Academy of Sciences Publication Activity Database

    Kalina, Jan

    2017-01-01

    Roč. 36, č. 1 (2017), s. 111-125 ISSN 0747-4946 R&D Projects: GA ČR GA17-07384S Grant - others:Nadační fond na podporu vědy(CZ) Neuron Institutional support: RVO:67985807 Keywords : nonparametric test s * sequential ranks * stopping variable Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 0.339, year: 2016

  6. Sequential test procedures for inventory differences

    International Nuclear Information System (INIS)

    Goldman, A.S.; Kern, E.A.; Emeigh, C.W.

    1985-01-01

    By means of a simulation study, we investigated the appropriateness of Page's and power-one sequential tests on sequences of inventory differences obtained from an example materials control unit, a sub-area of a hypothetical UF 6 -to-U 3 O 8 conversion process. The study examined detection probability and run length curves obtained from different loss scenarios. 12 refs., 10 figs., 2 tabs

  7. A minimax procedure in the context of sequential mastery testing

    NARCIS (Netherlands)

    Vos, Hendrik J.

    1999-01-01

    The purpose of this paper is to derive optimal rules for sequential mastery tests. In a sequential mastery test, the decision is to classify a subject as a master or a nonmaster, or to continue sampling and administering another random test item. The framework of minimax sequential decision theory

  8. On Locally Most Powerful Sequential Rank Tests

    Czech Academy of Sciences Publication Activity Database

    Kalina, Jan

    2017-01-01

    Roč. 36, č. 1 (2017), s. 111-125 ISSN 0747-4946 R&D Projects: GA ČR GA17-07384S Grant - others:Nadační fond na podporu vědy(CZ) Neuron Institutional support: RVO:67985556 Keywords : nonparametric test s * sequential ranks * stopping variable Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 0.339, year: 2016 http://library.utia.cas.cz/separaty/2017/SI/kalina-0474065.pdf

  9. Applying the minimax principle to sequential mastery testing

    NARCIS (Netherlands)

    Vos, Hendrik J.

    2002-01-01

    The purpose of this paper is to derive optimal rules for sequential mastery tests. In a sequential mastery test, the decision is to classify a subject as a master, a nonmaster, or to continue sampling and administering another random item. The framework of minimax sequential decision theory (minimum

  10. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann

    1981-01-01

    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  11. Sequential Analysis: Hypothesis Testing and Changepoint Detection

    Science.gov (United States)

    2014-07-11

    maintains the flexibility of deciding sooner than the fixed sample size procedure at the price of some lower power [13, 514]. The sequential probability... markets , detection of signals with unknown arrival time in seismology, navigation, radar and sonar signal processing, speech segmentation, and the... skimming cruise missile can yield a significant increase in the probability of raid annihilation. Furthermore, usually detection systems are

  12. Hybrid Computerized Adaptive Testing: From Group Sequential Design to Fully Sequential Design

    Science.gov (United States)

    Wang, Shiyu; Lin, Haiyan; Chang, Hua-Hua; Douglas, Jeff

    2016-01-01

    Computerized adaptive testing (CAT) and multistage testing (MST) have become two of the most popular modes in large-scale computer-based sequential testing. Though most designs of CAT and MST exhibit strength and weakness in recent large-scale implementations, there is no simple answer to the question of which design is better because different…

  13. Further comments on the sequential probability ratio testing methods

    Energy Technology Data Exchange (ETDEWEB)

    Kulacsy, K. [Hungarian Academy of Sciences, Budapest (Hungary). Central Research Inst. for Physics

    1997-05-23

    The Bayesian method for belief updating proposed in Racz (1996) is examined. The interpretation of the belief function introduced therein is found, and the method is compared to the classical binary Sequential Probability Ratio Testing method (SPRT). (author).

  14. A sequential hypothesis test based on a generalized Azuma inequality

    NARCIS (Netherlands)

    Reijsbergen, D.P.; Scheinhardt, Willem R.W.; de Boer, Pieter-Tjerk

    We present a new power-one sequential hypothesis test based on a bound for the probability that a bounded zero-mean martingale ever crosses a curve of the form $a(n+k)^b$. The proof of the bound is of independent interest.

  15. Sequential Computerized Mastery Tests--Three Simulation Studies

    Science.gov (United States)

    Wiberg, Marie

    2006-01-01

    A simulation study of a sequential computerized mastery test is carried out with items modeled with the 3 parameter logistic item response theory model. The examinees' responses are either identically distributed, not identically distributed, or not identically distributed together with estimation errors in the item characteristics. The…

  16. Programme for test generation for combinatorial and sequential systems

    International Nuclear Information System (INIS)

    Tran Huy Hoan

    1973-01-01

    This research thesis reports the computer-assisted search for tests aimed at failure detection in combinatorial and sequential logic circuits. As he wants to deal with complex circuits with many modules such as those met in large scale integrated circuits (LSI), the author used propagation paths. He reports the development of a method which is valid for combinatorial systems and for several sequential circuits comprising elementary logic modules and JK and RS flip-flops. This method is developed on an IBM 360/91 computer in PL/1 language. The used memory space is limited and adjustable with respect to circuit dimension. Computing time is short when compared to that needed by other programmes. The solution is practical and efficient for failure test and localisation

  17. Safeguarding a Lunar Rover with Wald's Sequential Probability Ratio Test

    Science.gov (United States)

    Furlong, Michael; Dille, Michael; Wong, Uland; Nefian, Ara

    2016-01-01

    The virtual bumper is a safeguarding mechanism for autonomous and remotely operated robots. In this paper we take a new approach to the virtual bumper system by using an old statistical test. By using a modified version of Wald's sequential probability ratio test we demonstrate that we can reduce the number of false positive reported by the virtual bumper, thereby saving valuable mission time. We use the concept of sequential probability ratio to control vehicle speed in the presence of possible obstacles in order to increase certainty about whether or not obstacles are present. Our new algorithm reduces the chances of collision by approximately 98 relative to traditional virtual bumper safeguarding without speed control.

  18. MUF residuals tested by a sequential test with power one

    International Nuclear Information System (INIS)

    Sellinschegg, D.; Bicking, U.

    1983-01-01

    Near-real-time material accountancy is an ongoing safeguards development to extend the current capability of IAEA safeguards. The evaluation of the observed ''Material Unaccounted For'' (MUF) time series is an important part in a near-real-time material accountancy regime. The maximum capability of a sequential data evaluation procedure is demonstrated by applying this procedure to the material balance area of the chemical separation process of a reference reprocessing facility with a throughput of 1000 tonnes heavy metal per year, as an example. It is shown that, compared to a conventional material accountancy approach, the detection time as well as the detection probability is significantly improved. (author)

  19. Comments on the sequential probability ratio testing methods

    Energy Technology Data Exchange (ETDEWEB)

    Racz, A. [Hungarian Academy of Sciences, Budapest (Hungary). Central Research Inst. for Physics

    1996-07-01

    In this paper the classical sequential probability ratio testing method (SPRT) is reconsidered. Every individual boundary crossing event of the SPRT is regarded as a new piece of evidence about the problem under hypothesis testing. The Bayes method is applied for belief updating, i.e. integrating these individual decisions. The procedure is recommended to use when the user (1) would like to be informed about the tested hypothesis continuously and (2) would like to achieve his final conclusion with high confidence level. (Author).

  20. Wald Sequential Probability Ratio Test for Space Object Conjunction Assessment

    Science.gov (United States)

    Carpenter, James R.; Markley, F Landis

    2014-01-01

    This paper shows how satellite owner/operators may use sequential estimates of collision probability, along with a prior assessment of the base risk of collision, in a compound hypothesis ratio test to inform decisions concerning collision risk mitigation maneuvers. The compound hypothesis test reduces to a simple probability ratio test, which appears to be a novel result. The test satisfies tolerances related to targeted false alarm and missed detection rates. This result is independent of the method one uses to compute the probability density that one integrates to compute collision probability. A well-established test case from the literature shows that this test yields acceptable results within the constraints of a typical operational conjunction assessment decision timeline. Another example illustrates the use of the test in a practical conjunction assessment scenario based on operations of the International Space Station.

  1. A Bayesian Optimal Design for Sequential Accelerated Degradation Testing

    Directory of Open Access Journals (Sweden)

    Xiaoyang Li

    2017-07-01

    Full Text Available When optimizing an accelerated degradation testing (ADT plan, the initial values of unknown model parameters must be pre-specified. However, it is usually difficult to obtain the exact values, since many uncertainties are embedded in these parameters. Bayesian ADT optimal design was presented to address this problem by using prior distributions to capture these uncertainties. Nevertheless, when the difference between a prior distribution and actual situation is large, the existing Bayesian optimal design might cause some over-testing or under-testing issues. For example, the implemented ADT following the optimal ADT plan consumes too much testing resources or few accelerated degradation data are obtained during the ADT. To overcome these obstacles, a Bayesian sequential step-down-stress ADT design is proposed in this article. During the sequential ADT, the test under the highest stress level is firstly conducted based on the initial prior information to quickly generate degradation data. Then, the data collected under higher stress levels are employed to construct the prior distributions for the test design under lower stress levels by using the Bayesian inference. In the process of optimization, the inverse Gaussian (IG process is assumed to describe the degradation paths, and the Bayesian D-optimality is selected as the optimal objective. A case study on an electrical connector’s ADT plan is provided to illustrate the application of the proposed Bayesian sequential ADT design method. Compared with the results from a typical static Bayesian ADT plan, the proposed design could guarantee more stable and precise estimations of different reliability measures.

  2. Decision-making in research tasks with sequential testing.

    Directory of Open Access Journals (Sweden)

    Thomas Pfeiffer

    Full Text Available BACKGROUND: In a recent controversial essay, published by JPA Ioannidis in PLoS Medicine, it has been argued that in some research fields, most of the published findings are false. Based on theoretical reasoning it can be shown that small effect sizes, error-prone tests, low priors of the tested hypotheses and biases in the evaluation and publication of research findings increase the fraction of false positives. These findings raise concerns about the reliability of research. However, they are based on a very simple scenario of scientific research, where single tests are used to evaluate independent hypotheses. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we present computer simulations and experimental approaches for analyzing more realistic scenarios. In these scenarios, research tasks are solved sequentially, i.e. subsequent tests can be chosen depending on previous results. We investigate simple sequential testing and scenarios where only a selected subset of results can be published and used for future rounds of test choice. Results from computer simulations indicate that for the tasks analyzed in this study, the fraction of false among the positive findings declines over several rounds of testing if the most informative tests are performed. Our experiments show that human subjects frequently perform the most informative tests, leading to a decline of false positives as expected from the simulations. CONCLUSIONS/SIGNIFICANCE: For the research tasks studied here, findings tend to become more reliable over time. We also find that the performance in those experimental settings where not all performed tests could be published turned out to be surprisingly inefficient. Our results may help optimize existing procedures used in the practice of scientific research and provide guidance for the development of novel forms of scholarly communication.

  3. Simultaneous Versus Sequential Presentation in Testing Recognition Memory for Faces.

    Science.gov (United States)

    Finley, Jason R; Roediger, Henry L; Hughes, Andrea D; Wahlheim, Christopher N; Jacoby, Larry L

    2015-01-01

    Three experiments examined the issue of whether faces could be better recognized in a simul- taneous test format (2-alternative forced choice [2AFC]) or a sequential test format (yes-no). All experiments showed that when target faces were present in the test, the simultaneous procedure led to superior performance (area under the ROC curve), whether lures were high or low in similarity to the targets. However, when a target-absent condition was used in which no lures resembled the targets but the lures were similar to each other, the simultaneous procedure yielded higher false alarm rates (Experiments 2 and 3) and worse overall performance (Experi- ment 3). This pattern persisted even when we excluded responses that participants opted to withhold rather than volunteer. We conclude that for the basic recognition procedures used in these experiments, simultaneous presentation of alternatives (2AFC) generally leads to better discriminability than does sequential presentation (yes-no) when a target is among the alterna- tives. However, our results also show that the opposite can occur when there is no target among the alternatives. An important future step is to see whether these patterns extend to more realistic eyewitness lineup procedures. The pictures used in the experiment are available online at http://www.press.uillinois.edu/journals/ajp/media/testing_recognition/.

  4. Sequential accelerated tests: Improving the correlation of accelerated tests to module performance in the field

    Science.gov (United States)

    Felder, Thomas; Gambogi, William; Stika, Katherine; Yu, Bao-Ling; Bradley, Alex; Hu, Hongjie; Garreau-Iles, Lucie; Trout, T. John

    2016-09-01

    DuPont has been working steadily to develop accelerated backsheet tests that correlate with solar panels observations in the field. This report updates efforts in sequential testing. Single exposure tests are more commonly used and can be completed more quickly, and certain tests provide helpful predictions of certain backsheet failure modes. DuPont recommendations for single exposure tests are based on 25-year exposure levels for UV and humidity/temperature, and form a good basis for sequential test development. We recommend a sequential exposure of damp heat followed by UV then repetitions of thermal cycling and UVA. This sequence preserves 25-year exposure levels for humidity/temperature and UV, and correlates well with a large body of field observations. Measurements can be taken at intervals in the test, although the full test runs 10 months. A second, shorter sequential test based on damp heat and thermal cycling tests mechanical durability and correlates with loss of mechanical properties seen in the field. Ongoing work is directed toward shorter sequential tests that preserve good correlation to field data.

  5. Sequential Probability Ratio Test for Spacecraft Collision Avoidance Maneuver Decisions

    Science.gov (United States)

    Carpenter, J. Russell; Markley, F. Landis

    2013-01-01

    A document discusses sequential probability ratio tests that explicitly allow decision-makers to incorporate false alarm and missed detection risks, and are potentially less sensitive to modeling errors than a procedure that relies solely on a probability of collision threshold. Recent work on constrained Kalman filtering has suggested an approach to formulating such a test for collision avoidance maneuver decisions: a filter bank with two norm-inequality-constrained epoch-state extended Kalman filters. One filter models the null hypotheses that the miss distance is inside the combined hard body radius at the predicted time of closest approach, and one filter models the alternative hypothesis. The epoch-state filter developed for this method explicitly accounts for any process noise present in the system. The method appears to work well using a realistic example based on an upcoming, highly elliptical orbit formation flying mission.

  6. Sequential and simultaneous choices: testing the diet selection and sequential choice models.

    Science.gov (United States)

    Freidin, Esteban; Aw, Justine; Kacelnik, Alex

    2009-03-01

    We investigate simultaneous and sequential choices in starlings, using Charnov's Diet Choice Model (DCM) and Shapiro, Siller and Kacelnik's Sequential Choice Model (SCM) to integrate function and mechanism. During a training phase, starlings encountered one food-related option per trial (A, B or R) in random sequence and with equal probability. A and B delivered food rewards after programmed delays (shorter for A), while R ('rejection') moved directly to the next trial without reward. In this phase we measured latencies to respond. In a later, choice, phase, birds encountered the pairs A-B, A-R and B-R, the first implementing a simultaneous choice and the second and third sequential choices. The DCM predicts when R should be chosen to maximize intake rate, and SCM uses latencies of the training phase to predict choices between any pair of options in the choice phase. The predictions of both models coincided, and both successfully predicted the birds' preferences. The DCM does not deal with partial preferences, while the SCM does, and experimental results were strongly correlated to this model's predictions. We believe that the SCM may expose a very general mechanism of animal choice, and that its wider domain of success reflects the greater ecological significance of sequential over simultaneous choices.

  7. Sensitivity of species to chemicals: dose-response characteristics for various test types (LC(50), LR(50) and LD(50)) and modes of action.

    Science.gov (United States)

    Hendriks, A Jan; Awkerman, Jill A; de Zwart, Dick; Huijbregts, Mark A J

    2013-11-01

    While variable sensitivity of model species to common toxicants has been addressed in previous studies, a systematic analysis of inter-species variability for different test types, modes of action and species is as of yet lacking. Hence, the aim of the present study was to identify similarities and differences in contaminant levels affecting cold-blooded and warm-blooded species administered via different routes. To that end, data on lethal water concentrations LC50, tissue residues LR50 and oral doses LD50 were collected from databases, each representing the largest of its kind. LC50 data were multiplied by a bioconcentration factor (BCF) to convert them to internal concentrations that allow for comparison among species. For each endpoint data set, we calculated the mean and standard deviation of species' lethal level per compound. Next, the means and standard deviations were averaged by mode of action. Both the means and standard deviations calculated depended on the number of species tested, which is at odds with quality standard setting procedures. Means calculated from (BCF) LC50, LR50 and LD50 were largely similar, suggesting that different administration routes roughly yield similar internal levels. Levels for compounds interfering biochemically with elementary life processes were about one order of magnitude below that of narcotics disturbing membranes, and neurotoxic pesticides and dioxins induced death in even lower amounts. Standard deviations for LD50 data were similar across modes of action, while variability of LC50 values was lower for narcotics than for substances with a specific mode of action. The study indicates several directions to go for efficient use of available data in risk assessment and reduction of species testing. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Safety test No. S-6, launch pad abort sequential test Phase II: solid propellant fire

    International Nuclear Information System (INIS)

    Snow, E.C.

    1975-08-01

    In preparation for the Lincoln Laboratory's LES 8/9 space mission, a series of tests was performed to evaluate the nuclear safety capability of the Multi-Hundred Watt (MHW) Radioisotope Thermoelectric Generator (RTG) to be used to supply power for the satellite. One such safety test is Test No. S-6, Launch Pad Abort Sequential Test. The objective of this test was to subject the RTG and its components to the sequential environments characteristic of a catastrophic launch pad accident to evaluate their capability to contain the 238 PuO 2 fuel. This sequence of environments was to have consisted of the blast overpressure and fragments, followed by the fireball, low velocity impact on the launch pad, and solid propellant fire. The blast overpressure and fragments were subsequently eliminated from this sequence. The procedures and results of Phase II of Test S-6, Solid Propellant Fire are presented. In this phase of the test, a simulant Fuel Sphere Assembly (FSA) and a mockup of a damaged Heat Source Assembly (HSA) were subjected to single proximity solid propellant fires of approximately 10-min duration. Steel was introduced into both tests to simulate the effects of launch pad debris and the solid rocket motor (SRM) casing that might be present in the fire zone. (TFD)

  9. Susceptibility testing of sequential isolates of Aspergillus fumigatus recovered from treated patients.

    NARCIS (Netherlands)

    Danaoui, E.; Meletiadis, J.; Tortorano, A.M.; Symoens, F.; Nolard, N.; Viviani, M.A.; Piens, M.A.; Lebeau, B.; Verweij, P.E.; Grillot, R.

    2004-01-01

    Two-hundred sequential Aspergillus fumigatus isolates recovered from 26 immunocompromised patients with invasive aspergillosis or bronchial colonization were tested for their in vitro susceptibility to posaconazole, itraconazole, voriconazole, terbinafine and amphotericin B. Twenty-one patients were

  10. Improving the identification accuracy of senior witnesses: do prelineup questions and sequential testing help?

    Science.gov (United States)

    Memon, Amina; Gabbert, Fiona

    2003-04-01

    Eyewitness research has identified sequential lineup testing as a way of reducing false lineup choices while maintaining accurate identifications. The authors examined the usefulness of this procedure for reducing false choices in older adults. Young and senior witnesses viewed a crime video and were later presented with target present orabsent lineups in a simultaneous or sequential format. In addition, some participants received prelineup questions about their memory for a perpetrator's face and about their confidence in their ability to identify the culprit or to correctly reject the lineup. The sequential lineup reduced false choosing rates among young and older adults in target-absent conditions. In target-present conditions, sequential testing significantly reduced the correct identification rate in both age groups.

  11. Unifying LL and LR parsing

    NARCIS (Netherlands)

    W.H.L.M. Pijls (Wim)

    1993-01-01

    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  12. Fault detection in multiply-redundant measurement systems via sequential testing

    International Nuclear Information System (INIS)

    Ray, A.

    1988-01-01

    The theory and application of a sequential test procedure for fault detection and isolation. The test procedure is suited for development of intelligent instrumentation in strategic processes like aircraft and nuclear plants where redundant measurements are usually available for individual critical variables. The test procedure consists of: (1) a generic redundancy management procedure which is essentially independent of the fault detection strategy and measurement noise statistics, and (2) a modified version of sequential probability ratio test algorithm for fault detection and isolation, which functions within the framework of this redundancy management procedure. The sequential test procedure is suitable for real-time applications using commercially available microcomputers and its efficacy has been verified by online fault detection in an operating nuclear reactor. 15 references

  13. A bayesian procedure in the context of sequential mastery testing

    Directory of Open Access Journals (Sweden)

    Hans J. Vos

    2000-01-01

    Full Text Available Un procedimiento bayesiano en el contexto de los tests secuenciales de clasificación. El propósito de este artículo consiste en obtener reglas óptimas en los tests secuenciales de clasificación. En un test secuencial de clasificación, la decisión a tomar es clasificar a una persona como maestro, no maestro, o continuar el test y administrar el siguiente ítem. Se aplica la teoría de la decisión secuencial bayesiana; es decir, las reglas óptimas resultan de minimizar las pérdidas esperados posteriores asociadas con todas las posibles reglas de decisión en cada momento de test. La principal ventaja de este acercamiento es que los costes de aplicar el test pueden ser tenidos en cuenta de manera explícita. Se asume el modelo binomial para determinar la probabilidad de respuesta correcta dado un cierto nivel de funcionamiento de la persona. Se adopta una pérdida umbral como función de perdida. El artículo termina con un estudio de simulación en el que la estrategia secuencial bayesiana se compara con otros procedimientos disponibles en la literatura para problemas de decisión similares.

  14. Optimal Sequential Diagnostic Strategy Generation Considering Test Placement Cost for Multimode Systems

    Directory of Open Access Journals (Sweden)

    Shigang Zhang

    2015-10-01

    Full Text Available Sequential fault diagnosis is an approach that realizes fault isolation by executing the optimal test step by step. The strategy used, i.e., the sequential diagnostic strategy, has great influence on diagnostic accuracy and cost. Optimal sequential diagnostic strategy generation is an important step in the process of diagnosis system construction, which has been studied extensively in the literature. However, previous algorithms either are designed for single mode systems or do not consider test placement cost. They are not suitable to solve the sequential diagnostic strategy generation problem considering test placement cost for multimode systems. Therefore, this problem is studied in this paper. A formulation is presented. Two algorithms are proposed, one of which is realized by system transformation and the other is newly designed. Extensive simulations are carried out to test the effectiveness of the algorithms. A real-world system is also presented. All the results show that both of them have the ability to solve the diagnostic strategy generation problem, and they have different characteristics.

  15. Optimal Sequential Diagnostic Strategy Generation Considering Test Placement Cost for Multimode Systems

    Science.gov (United States)

    Zhang, Shigang; Song, Lijun; Zhang, Wei; Hu, Zheng; Yang, Yongmin

    2015-01-01

    Sequential fault diagnosis is an approach that realizes fault isolation by executing the optimal test step by step. The strategy used, i.e., the sequential diagnostic strategy, has great influence on diagnostic accuracy and cost. Optimal sequential diagnostic strategy generation is an important step in the process of diagnosis system construction, which has been studied extensively in the literature. However, previous algorithms either are designed for single mode systems or do not consider test placement cost. They are not suitable to solve the sequential diagnostic strategy generation problem considering test placement cost for multimode systems. Therefore, this problem is studied in this paper. A formulation is presented. Two algorithms are proposed, one of which is realized by system transformation and the other is newly designed. Extensive simulations are carried out to test the effectiveness of the algorithms. A real-world system is also presented. All the results show that both of them have the ability to solve the diagnostic strategy generation problem, and they have different characteristics. PMID:26457709

  16. A Bayesian sequential design with adaptive randomization for 2-sided hypothesis test.

    Science.gov (United States)

    Yu, Qingzhao; Zhu, Lin; Zhu, Han

    2017-11-01

    Bayesian sequential and adaptive randomization designs are gaining popularity in clinical trials thanks to their potentials to reduce the number of required participants and save resources. We propose a Bayesian sequential design with adaptive randomization rates so as to more efficiently attribute newly recruited patients to different treatment arms. In this paper, we consider 2-arm clinical trials. Patients are allocated to the 2 arms with a randomization rate to achieve minimum variance for the test statistic. Algorithms are presented to calculate the optimal randomization rate, critical values, and power for the proposed design. Sensitivity analysis is implemented to check the influence on design by changing the prior distributions. Simulation studies are applied to compare the proposed method and traditional methods in terms of power and actual sample sizes. Simulations show that, when total sample size is fixed, the proposed design can obtain greater power and/or cost smaller actual sample size than the traditional Bayesian sequential design. Finally, we apply the proposed method to a real data set and compare the results with the Bayesian sequential design without adaptive randomization in terms of sample sizes. The proposed method can further reduce required sample size. Copyright © 2017 John Wiley & Sons, Ltd.

  17. Double-blind photo lineups using actual eyewitnesses: an experimental test of a sequential versus simultaneous lineup procedure.

    Science.gov (United States)

    Wells, Gary L; Steblay, Nancy K; Dysart, Jennifer E

    2015-02-01

    Eyewitnesses (494) to actual crimes in 4 police jurisdictions were randomly assigned to view simultaneous or sequential photo lineups using laptop computers and double-blind administration. The sequential procedure used in the field experiment mimicked how it is conducted in actual practice (e.g., using a continuation rule, witness does not know how many photos are to be viewed, witnesses resolve any multiple identifications), which is not how most lab experiments have tested the sequential lineup. No significant differences emerged in rates of identifying lineup suspects (25% overall) but the sequential procedure produced a significantly lower rate (11%) of identifying known-innocent lineup fillers than did the simultaneous procedure (18%). The simultaneous/sequential pattern did not significantly interact with estimator variables and no lineup-position effects were observed for either the simultaneous or sequential procedures. Rates of nonidentification were not significantly different for simultaneous and sequential but nonidentifiers from the sequential procedure were more likely to use the "not sure" response option than were nonidentifiers from the simultaneous procedure. Among witnesses who made an identification, 36% (41% of simultaneous and 32% of sequential) identified a known-innocent filler rather than a suspect, indicating that eyewitness performance overall was very poor. The results suggest that the sequential procedure that is used in the field reduces the identification of known-innocent fillers, but the differences are relatively small.

  18. Validation of new prognostic and predictive scores by sequential testing approach

    International Nuclear Information System (INIS)

    Nieder, Carsten; Haukland, Ellinor; Pawinski, Adam; Dalhaug, Astrid

    2010-01-01

    Background and Purpose: For practitioners, the question arises how their own patient population differs from that used in large-scale analyses resulting in new scores and nomograms and whether such tools actually are valid at a local level and thus can be implemented. A recent article proposed an easy-to-use method for the in-clinic validation of new prediction tools with a limited number of patients, a so-called sequential testing approach. The present study evaluates this approach in scores related to radiation oncology. Material and Methods: Three different scores were used, each predicting short overall survival after palliative radiotherapy (bone metastases, brain metastases, metastatic spinal cord compression). For each scenario, a limited number of consecutive patients entered the sequential testing approach. The positive predictive value (PPV) was used for validation of the respective score and it was required that the PPV exceeded 80%. Results: For two scores, validity in the own local patient population could be confirmed after entering 13 and 17 patients, respectively. For the third score, no decision could be reached even after increasing the sample size to 30. Conclusion: In-clinic validation of new predictive tools with sequential testing approach should be preferred over uncritical adoption of tools which provide no significant benefit to local patient populations. Often the necessary number of patients can be reached within reasonable time frames even in small oncology practices. In addition, validation is performed continuously as the data are collected. (orig.)

  19. Validation of new prognostic and predictive scores by sequential testing approach

    Energy Technology Data Exchange (ETDEWEB)

    Nieder, Carsten [Radiation Oncology Unit, Nordland Hospital, Bodo (Norway); Inst. of Clinical Medicine, Univ. of Tromso (Norway); Haukland, Ellinor; Pawinski, Adam; Dalhaug, Astrid [Radiation Oncology Unit, Nordland Hospital, Bodo (Norway)

    2010-03-15

    Background and Purpose: For practitioners, the question arises how their own patient population differs from that used in large-scale analyses resulting in new scores and nomograms and whether such tools actually are valid at a local level and thus can be implemented. A recent article proposed an easy-to-use method for the in-clinic validation of new prediction tools with a limited number of patients, a so-called sequential testing approach. The present study evaluates this approach in scores related to radiation oncology. Material and Methods: Three different scores were used, each predicting short overall survival after palliative radiotherapy (bone metastases, brain metastases, metastatic spinal cord compression). For each scenario, a limited number of consecutive patients entered the sequential testing approach. The positive predictive value (PPV) was used for validation of the respective score and it was required that the PPV exceeded 80%. Results: For two scores, validity in the own local patient population could be confirmed after entering 13 and 17 patients, respectively. For the third score, no decision could be reached even after increasing the sample size to 30. Conclusion: In-clinic validation of new predictive tools with sequential testing approach should be preferred over uncritical adoption of tools which provide no significant benefit to local patient populations. Often the necessary number of patients can be reached within reasonable time frames even in small oncology practices. In addition, validation is performed continuously as the data are collected. (orig.)

  20. Robust real-time pattern matching using bayesian sequential hypothesis testing.

    Science.gov (United States)

    Pele, Ofir; Werman, Michael

    2008-08-01

    This paper describes a method for robust real time pattern matching. We first introduce a family of image distance measures, the "Image Hamming Distance Family". Members of this family are robust to occlusion, small geometrical transforms, light changes and non-rigid deformations. We then present a novel Bayesian framework for sequential hypothesis testing on finite populations. Based on this framework, we design an optimal rejection/acceptance sampling algorithm. This algorithm quickly determines whether two images are similar with respect to a member of the Image Hamming Distance Family. We also present a fast framework that designs a near-optimal sampling algorithm. Extensive experimental results show that the sequential sampling algorithm performance is excellent. Implemented on a Pentium 4 3 GHz processor, detection of a pattern with 2197 pixels, in 640 x 480 pixel frames, where in each frame the pattern rotated and was highly occluded, proceeds at only 0.022 seconds per frame.

  1. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  2. Wald Sequential Probability Ratio Test for Analysis of Orbital Conjunction Data

    Science.gov (United States)

    Carpenter, J. Russell; Markley, F. Landis; Gold, Dara

    2013-01-01

    We propose a Wald Sequential Probability Ratio Test for analysis of commonly available predictions associated with spacecraft conjunctions. Such predictions generally consist of a relative state and relative state error covariance at the time of closest approach, under the assumption that prediction errors are Gaussian. We show that under these circumstances, the likelihood ratio of the Wald test reduces to an especially simple form, involving the current best estimate of collision probability, and a similar estimate of collision probability that is based on prior assumptions about the likelihood of collision.

  3. Sequential Probability Ratio Testing with Power Projective Base Method Improves Decision-Making for BCI

    Science.gov (United States)

    Liu, Rong

    2017-01-01

    Obtaining a fast and reliable decision is an important issue in brain-computer interfaces (BCI), particularly in practical real-time applications such as wheelchair or neuroprosthetic control. In this study, the EEG signals were firstly analyzed with a power projective base method. Then we were applied a decision-making model, the sequential probability ratio testing (SPRT), for single-trial classification of motor imagery movement events. The unique strength of this proposed classification method lies in its accumulative process, which increases the discriminative power as more and more evidence is observed over time. The properties of the method were illustrated on thirteen subjects' recordings from three datasets. Results showed that our proposed power projective method outperformed two benchmark methods for every subject. Moreover, with sequential classifier, the accuracies across subjects were significantly higher than that with nonsequential ones. The average maximum accuracy of the SPRT method was 84.1%, as compared with 82.3% accuracy for the sequential Bayesian (SB) method. The proposed SPRT method provides an explicit relationship between stopping time, thresholds, and error, which is important for balancing the time-accuracy trade-off. These results suggest SPRT would be useful in speeding up decision-making while trading off errors in BCI. PMID:29348781

  4. Impact of controlling the sum of error probability in the sequential probability ratio test

    Directory of Open Access Journals (Sweden)

    Bijoy Kumarr Pradhan

    2013-05-01

    Full Text Available A generalized modified method is proposed to control the sum of error probabilities in sequential probability ratio test to minimize the weighted average of the two average sample numbers under a simple null hypothesis and a simple alternative hypothesis with the restriction that the sum of error probabilities is a pre-assigned constant to find the optimal sample size and finally a comparison is done with the optimal sample size found from fixed sample size procedure. The results are applied to the cases when the random variate follows a normal law as well as Bernoullian law.

  5. The Sequential Probability Ratio Test: An efficient alternative to exact binomial testing for Clean Water Act 303(d) evaluation.

    Science.gov (United States)

    Chen, Connie; Gribble, Matthew O; Bartroff, Jay; Bay, Steven M; Goldstein, Larry

    2017-05-01

    The United States's Clean Water Act stipulates in section 303(d) that states must identify impaired water bodies for which total maximum daily loads (TMDLs) of pollution inputs into water bodies are developed. Decision-making procedures about how to list, or delist, water bodies as impaired, or not, per Clean Water Act 303(d) differ across states. In states such as California, whether or not a particular monitoring sample suggests that water quality is impaired can be regarded as a binary outcome variable, and California's current regulatory framework invokes a version of the exact binomial test to consolidate evidence across samples and assess whether the overall water body complies with the Clean Water Act. Here, we contrast the performance of California's exact binomial test with one potential alternative, the Sequential Probability Ratio Test (SPRT). The SPRT uses a sequential testing framework, testing samples as they become available and evaluating evidence as it emerges, rather than measuring all the samples and calculating a test statistic at the end of the data collection process. Through simulations and theoretical derivations, we demonstrate that the SPRT on average requires fewer samples to be measured to have comparable Type I and Type II error rates as the current fixed-sample binomial test. Policymakers might consider efficient alternatives such as SPRT to current procedure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Science.gov (United States)

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

    2013-11-01

    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

  7. Sequentially optimized reconstruction strategy: A meta-strategy for perimetry testing.

    Directory of Open Access Journals (Sweden)

    Şerife Seda Kucur

    Full Text Available Perimetry testing is an automated method to measure visual function and is heavily used for diagnosing ophthalmic and neurological conditions. Its working principle is to sequentially query a subject about perceived light using different brightness levels at different visual field locations. At a given location, this query-patient-feedback process is expected to converge at a perceived sensitivity, such that a shown stimulus intensity is observed and reported 50% of the time. Given this inherently time-intensive and noisy process, fast testing strategies are necessary in order to measure existing regions more effectively and reliably. In this work, we present a novel meta-strategy which relies on the correlative nature of visual field locations in order to strongly reduce the necessary number of locations that need to be examined. To do this, we sequentially determine locations that most effectively reduce visual field estimation errors in an initial training phase. We then exploit these locations at examination time and show that our approach can easily be combined with existing perceived sensitivity estimation schemes to speed up the examinations. Compared to state-of-the-art strategies, our approach shows marked performance gains with a better accuracy-speed trade-off regime for both mixed and sub-populations.

  8. Sequential detection of influenza epidemics by the Kolmogorov-Smirnov test

    Directory of Open Access Journals (Sweden)

    Closas Pau

    2012-10-01

    Full Text Available Abstract Background Influenza is a well known and common human respiratory infection, causing significant morbidity and mortality every year. Despite Influenza variability, fast and reliable outbreak detection is required for health resource planning. Clinical health records, as published by the Diagnosticat database in Catalonia, host useful data for probabilistic detection of influenza outbreaks. Methods This paper proposes a statistical method to detect influenza epidemic activity. Non-epidemic incidence rates are modeled against the exponential distribution, and the maximum likelihood estimate for the decaying factor λ is calculated. The sequential detection algorithm updates the parameter as new data becomes available. Binary epidemic detection of weekly incidence rates is assessed by Kolmogorov-Smirnov test on the absolute difference between the empirical and the cumulative density function of the estimated exponential distribution with significance level 0 ≤ α ≤ 1. Results The main advantage with respect to other approaches is the adoption of a statistically meaningful test, which provides an indicator of epidemic activity with an associated probability. The detection algorithm was initiated with parameter λ0 = 3.8617 estimated from the training sequence (corresponding to non-epidemic incidence rates of the 2008-2009 influenza season and sequentially updated. Kolmogorov-Smirnov test detected the following weeks as epidemic for each influenza season: 50−10 (2008-2009 season, 38−50 (2009-2010 season, weeks 50−9 (2010-2011 season and weeks 3 to 12 for the current 2011-2012 season. Conclusions Real medical data was used to assess the validity of the approach, as well as to construct a realistic statistical model of weekly influenza incidence rates in non-epidemic periods. For the tested data, the results confirmed the ability of the algorithm to detect the start and the end of epidemic periods. In general, the proposed test could

  9. On-line Flagging of Anomalies and Adaptive Sequential Hypothesis Testing for Fine-feature Characterization of Geosynchronous Satellites

    Science.gov (United States)

    2015-10-18

    model-based evidence. This work resolves cross-tag using three methods (Z-test for dependent data, classical sequential analysis and Brownian motion...Slider Movement The two-facet model is used as the Inversion Model. It represents a three-axis stabilized satellite as two facets, namely a body...the sequential analysis. If is independent and has an approximately normal distribution then Brownian motion drift analysis is used. If is

  10. A novel approach for small sample size family-based association studies: sequential tests.

    Science.gov (United States)

    Ilk, Ozlem; Rajabli, Farid; Dungul, Dilay Ciglidag; Ozdag, Hilal; Ilk, Hakki Gokhan

    2011-08-01

    In this paper, we propose a sequential probability ratio test (SPRT) to overcome the problem of limited samples in studies related to complex genetic diseases. The results of this novel approach are compared with the ones obtained from the traditional transmission disequilibrium test (TDT) on simulated data. Although TDT classifies single-nucleotide polymorphisms (SNPs) to only two groups (SNPs associated with the disease and the others), SPRT has the flexibility of assigning SNPs to a third group, that is, those for which we do not have enough evidence and should keep sampling. It is shown that SPRT results in smaller ratios of false positives and negatives, as well as better accuracy and sensitivity values for classifying SNPs when compared with TDT. By using SPRT, data with small sample size become usable for an accurate association analysis.

  11. Monte Carlo simulation of the sequential probability ratio test for radiation monitoring

    International Nuclear Information System (INIS)

    Coop, K.L.

    1984-01-01

    A computer program simulates the Sequential Probability Ratio Test (SPRT) using Monte Carlo techniques. The program, SEQTEST, performs random-number sampling of either a Poisson or normal distribution to simulate radiation monitoring data. The results are in terms of the detection probabilities and the average time required for a trial. The computed SPRT results can be compared with tabulated single interval test (SIT) values to determine the better statistical test for particular monitoring applications. Use of the SPRT in a hand-and-foot alpha monitor shows that the SPRT provides better detection probabilities while generally requiring less counting time. Calculations are also performed for a monitor where the SPRT is not permitted to the take longer than the single interval test. Although the performance of the SPRT is degraded by this restriction, the detection probabilities are still similar to the SIT values, and average counting times are always less than 75% of the SIT time. Some optimal conditions for use of the SPRT are described. The SPRT should be the test of choice in many radiation monitoring situations. 6 references, 8 figures, 1 table

  12. Sequential Design of Experiments to Maximize Learning from Carbon Capture Pilot Plant Testing

    Energy Technology Data Exchange (ETDEWEB)

    Soepyan, Frits B.; Morgan, Joshua C.; Omell, Benjamin P.; Zamarripa-Perez, Miguel A.; Matuszewski, Michael S.; Miller, David C.

    2018-02-06

    Pilot plant test campaigns can be expensive and time-consuming. Therefore, it is of interest to maximize the amount of learning and the efficiency of the test campaign given the limited number of experiments that can be conducted. This work investigates the use of sequential design of experiments (SDOE) to overcome these challenges by demonstrating its usefulness for a recent solvent-based CO2 capture plant test campaign. Unlike traditional design of experiments methods, SDOE regularly uses information from ongoing experiments to determine the optimum locations in the design space for subsequent runs within the same experiment. However, there are challenges that need to be addressed, including reducing the high computational burden to efficiently update the model, and the need to incorporate the methodology into a computational tool. We address these challenges by applying SDOE in combination with a software tool, the Framework for Optimization, Quantification of Uncertainty and Surrogates (FOQUS) (Miller et al., 2014a, 2016, 2017). The results of applying SDOE on a pilot plant test campaign for CO2 capture suggests that relative to traditional design of experiments methods, SDOE can more effectively reduce the uncertainty of the model, thus decreasing technical risk. Future work includes integrating SDOE into FOQUS and using SDOE to support additional large-scale pilot plant test campaigns.

  13. Testing sequential extraction methods for the analysis of multiple stable isotope systems from a bone sample

    Science.gov (United States)

    Sahlstedt, Elina; Arppe, Laura

    2017-04-01

    Stable isotope composition of bones, analysed either from the mineral phase (hydroxyapatite) or from the organic phase (mainly collagen) carry important climatological and ecological information and are therefore widely used in paleontological and archaeological research. For the analysis of the stable isotope compositions, both of the phases, hydroxyapatite and collagen, have their more or less well established separation and analytical techniques. Recent development in IRMS and wet chemical extraction methods have facilitated the analysis of very small bone fractions (500 μg or less starting material) for PO43-O isotope composition. However, the uniqueness and (pre-) historical value of each archaeological and paleontological finding lead to preciously little material available for stable isotope analyses, encouraging further development of microanalytical methods for the use of stable isotope analyses. Here we present the first results in developing extraction methods for combining collagen C- and N-isotope analyses to PO43-O-isotope analyses from a single bone sample fraction. We tested sequential extraction starting with dilute acid demineralization and collection of both collagen and PO43-fractions, followed by further purification step by H2O2 (PO43-fraction). First results show that bone sample separates as small as 2 mg may be analysed for their δ15N, δ13C and δ18OPO4 values. The method may be incorporated in detailed investigation of sequentially developing skeletal material such as teeth, potentially allowing for the investigation of interannual variability in climatological/environmental signals or investigation of the early life history of an individual.

  14. Some investigations and use of LR-115 track detectors for radon measurements

    CERN Document Server

    Amrani, D

    2001-01-01

    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  15. Solving LR Conflicts Through Context Aware Scanning

    Science.gov (United States)

    Leon, C. Rodriguez; Forte, L. Garcia

    2011-09-01

    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  16. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2011-06-01

    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  17. Sequential Test Selection by Quantifying of the Reduction in Diagnostic Uncertainty for the Diagnosis of Proximal Caries

    Directory of Open Access Journals (Sweden)

    Umut Arslan

    2013-06-01

    Full Text Available Background: In order to determine the presence or absence of a certain disease, multiple diagnostic tests may be necessary. Performance of these tests can be sequentially evaluated. Aims: The aim of the study is to determine the contribution of the test in each step, in reducing diagnostic uncertainty when multiple tests are sequentially used for the diagnosis. Study Design: Diagnostic accuracy study Methods: Radiographs of seventy-three patients of the Department of Dento-Maxillofacial Radiology of Hacettepe University Faculty of Dentistry were assessed. Panoramic (PAN, full mouth intraoral (FM, and bitewing (BW radiographs were used for the diagnosis of proximal caries in the maxillary and mandibular molar regions. Diagnostic performance of radiography was sequentially evaluated by using the reduction in diagnostic uncertainty. Results: FM provided maximum diagnostic information for ruling in potential in the maxillary and mandibular molar regions in the first step. FM provided more diagnostic information than BW radiographs for ruling in the mandibular region in the second step. In the mandibular region, BW radiographs provided more diagnostic information than FM for ruling out in the first step. Conclusion: The presented method in this study provides the clinicians with a solution for the decision of the sequential selection of diagnostic tests for the correct diagnosis of the presence or absence of a certain disease.

  18. About a sequential method for non destructive testing of structures by mechanical vibrations

    International Nuclear Information System (INIS)

    Suarez Antola, R.

    2001-01-01

    The presence and growth of cracks voids or fields of pores under applied forces or environmental actions can produce a meaningful lowering in the proper frequencies of normal modes of mechanical vibration in structures.A quite general expression for the square of modes proper frequency as a functional of displacement field,density field and elastic moduli fields is used as a starting point.The effect of defects on frequency are modeled as equivalent changes in density and elastic moduli fields,introducing the concept of region of influence of each defect.An approximate expression is obtained which relates the relative lowering in the square of modes proper frequency with position,size,shape and orientation of defects in mode displacement field.Some simple examples of structural elements with cracks or fields of pores are considered.the connection with linear elastic fracture mechanics is briefly exemplified.A sequential method is proposed for non-destructive testing of structures using mechanical vibrations combined with properly chosen local nondestructive testing methods

  19. Changes of peritoneal transport parameters with time on dialysis: assessment with sequential peritoneal equilibration test.

    Science.gov (United States)

    Waniewski, Jacek; Antosiewicz, Stefan; Baczynski, Daniel; Poleszczuk, Jan; Pietribiasi, Mauro; Lindholm, Bengt; Wankowicz, Zofia

    2017-10-27

    Sequential peritoneal equilibration test (sPET) is based on the consecutive performance of the peritoneal equilibration test (PET, 4-hour, glucose 2.27%) and the mini-PET (1-hour, glucose 3.86%), and the estimation of peritoneal transport parameters with the 2-pore model. It enables the assessment of the functional transport barrier for fluid and small solutes. The objective of this study was to check whether the estimated model parameters can serve as better and earlier indicators of the changes in the peritoneal transport characteristics than directly measured transport indices that depend on several transport processes. 17 patients were examined using sPET twice with the interval of about 8 months (230 ± 60 days). There was no difference between the observational parameters measured in the 2 examinations. The indices for solute transport, but not net UF, were well correlated between the examinations. Among the estimated parameters, a significant decrease between the 2 examinations was found only for hydraulic permeability LpS, and osmotic conductance for glucose, whereas the other parameters remained unchanged. These fluid transport parameters did not correlate with D/P for creatinine, although the decrease in LpS values between the examinations was observed mostly for patients with low D/P for creatinine. We conclude that changes in fluid transport parameters, hydraulic permeability and osmotic conductance for glucose, as assessed by the pore model, may precede the changes in small solute transport. The systematic assessment of fluid transport status needs specific clinical and mathematical tools beside the standard PET tests.

  20. Variability in creep and rupture test results in a single heat of type 304 stainless steel. R and D report LR:75:4213-01:3

    International Nuclear Information System (INIS)

    Leyda, W.E.; Schultz, C.C.

    1975-09-01

    Results of uniaxial creep and rupture tests, from a single heat of type 304 stainless steel, are examined to determine the reasons for their greater-than-expected variability. The test results were obtained as part of a program to develop and verify high temperature structural design methods for liquid metal fast breeder reactor system components. A single heat of material (heat 9T2796) is being used throughout the program, by all investigators and in several product forms, to minimize the problem of heat-to-heat variations in elevated temperature behavior. The same laboratory reanneal was specified for each product form to reduce differences in behavior among the several being used. The data discussed was obtained from the 5/8-inch diameter, hot-rolled bar product form. The laboratory reanneal was performed after finish machining to minimize specimen-to-specimen differences. In spite of these efforts to reduce data variability, significant scatter was observed in both short-time and long-time deformation response, and also in time-to-rupture results

  1. LRSYS, PASCAL LR(1) Parser Generator System

    International Nuclear Information System (INIS)

    O'Hair, K.

    1991-01-01

    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  2. LR: Compact connectivity representation for triangle meshes

    Energy Technology Data Exchange (ETDEWEB)

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

    2011-01-28

    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  3. Accident dynamics of LR-0 reactor

    International Nuclear Information System (INIS)

    Vorisek, M.; Tinka, I.

    1981-01-01

    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  4. Microcystin-LR Induced Immunotoxicity in Mammals

    Directory of Open Access Journals (Sweden)

    Yaqoob Lone

    2016-01-01

    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  5. The Avalanche Hypothesis and Compression of Morbidity: Testing Assumptions through Cohort-Sequential Analysis.

    Directory of Open Access Journals (Sweden)

    Jordan Silberman

    Full Text Available The compression of morbidity model posits a breakpoint in the adult lifespan that separates an initial period of relative health from a subsequent period of ever increasing morbidity. Researchers often assume that such a breakpoint exists; however, this assumption is hitherto untested.To test the assumption that a breakpoint exists--which we term a morbidity tipping point--separating a period of relative health from a subsequent deterioration in health status. An analogous tipping point for healthcare costs was also investigated.Four years of adults' (N = 55,550 morbidity and costs data were retrospectively analyzed. Data were collected in Pittsburgh, PA between 2006 and 2009; analyses were performed in Rochester, NY and Ann Arbor, MI in 2012 and 2013. Cohort-sequential and hockey stick regression models were used to characterize long-term trajectories and tipping points, respectively, for both morbidity and costs.Morbidity increased exponentially with age (P<.001. A morbidity tipping point was observed at age 45.5 (95% CI, 41.3-49.7. An exponential trajectory was also observed for costs (P<.001, with a costs tipping point occurring at age 39.5 (95% CI, 32.4-46.6. Following their respective tipping points, both morbidity and costs increased substantially (Ps<.001.Findings support the existence of a morbidity tipping point, confirming an important but untested assumption. This tipping point, however, may occur earlier in the lifespan than is widely assumed. An "avalanche of morbidity" occurred after the morbidity tipping point-an ever increasing rate of morbidity progression. For costs, an analogous tipping point and "avalanche" were observed. The time point at which costs began to increase substantially occurred approximately 6 years before health status began to deteriorate.

  6. Comparison of three-stage sequential extraction and toxicity characteristic leaching tests to evaluate metal mobility in mining wastes

    International Nuclear Information System (INIS)

    Margui, E.; Salvado, V.; Queralt, I.; Hidalgo, M.

    2004-01-01

    Abandoned mining sites contain residues from ore processing operations that are characterised by high concentrations of heavy metals. The form in which a metal exists strongly influences its mobility and, thus, the effects on the environment. Operational methods of speciation analysis, such as the use of sequential extraction procedures, are commonly applied. In this work, the modified three-stage sequential extraction procedure proposed by the BCR (now the Standards, Measurements and Testing Programme) was applied for the fractionation of Ni, Zn, Pb and Cd in mining wastes from old Pb-Zn mining areas located in the Val d'Aran (NE Spain) and Cartagena (SE Spain). Analyses of the extracts were performed by inductively coupled plasma atomic emission spectrometry and electrothermal atomic absorption spectrometry. The procedure was evaluated by using a certified reference material, BCR-701. The results of the partitioning study indicate that more easily mobilised forms (acid exchangeable) were predominant for Cd and Zn, particularly in the sample from Cartagena. In contrast, the largest amount of lead was associated with the iron and manganese oxide fractions. On the other hand, the applicability of lixiviation tests commonly used to evaluate the leaching of toxic species from landfill disposal (US-EPA Toxicity Characteristic Leaching Procedure and DIN 38414-S4) to mining wastes was also investigated and the obtained results compared with the information on metal mobility derivable from the application of the three-stage sequential extraction procedure

  7. Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

    Energy Technology Data Exchange (ETDEWEB)

    Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil; Liu, Zunping; Lang, Keenan; Huang, Xianrong; Wieczorek, Michael; Kasman, Elina; Hammonds, John; Macrander, Albert; Assoufid, Lahsen [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States)

    2016-07-27

    We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity and spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.

  8. Adaptive x-ray threat detection using sequential hypotheses testing with fan-beam experimental data (Conference Presentation)

    Science.gov (United States)

    Thamvichai, Ratchaneekorn; Huang, Liang-Chih; Ashok, Amit; Gong, Qian; Coccarelli, David; Greenberg, Joel A.; Gehm, Michael E.; Neifeld, Mark A.

    2017-05-01

    We employ an adaptive measurement system, based on sequential hypotheses testing (SHT) framework, for detecting material-based threats using experimental data acquired on an X-ray experimental testbed system. This testbed employs 45-degree fan-beam geometry and 15 views over a 180-degree span to generate energy sensitive X-ray projection data. Using this testbed system, we acquire multiple view projection data for 200 bags. We consider an adaptive measurement design where the X-ray projection measurements are acquired in a sequential manner and the adaptation occurs through the choice of the optimal "next" source/view system parameter. Our analysis of such an adaptive measurement design using the experimental data demonstrates a 3x-7x reduction in the probability of error relative to a static measurement design. Here the static measurement design refers to the operational system baseline that corresponds to a sequential measurement using all the available sources/views. We also show that by using adaptive measurements it is possible to reduce the number of sources/views by nearly 50% compared a system that relies on static measurements.

  9. Sequential motor task (Luria's Fist-Edge-Palm Test in children with benign focal epilepsy of childhood with centrotemporal spikes

    Directory of Open Access Journals (Sweden)

    Carmen Silvia Molleis Galego Miziara

    2013-06-01

    Full Text Available This study evaluated the sequential motor manual actions in children with benign focal epilepsy of childhood with centrotemporal spikes (BECTS and compares the results with matched control group, through the application of Luria's fist-edge-palm test. The children with BECTS underwent interictal single photon emission computed tomography (SPECT and School Performance Test (SPT. Significant difference occurred between the study and control groups for manual motor action through three equal and three different movements. Children with lower school performance had higher error rate in the imitation of hand gestures. Another factor significantly associated with the failure was the abnormality in SPECT. Children with BECTS showed abnormalities in the test that evaluated manual motor programming/planning. This study may suggest that the functional changes related to epileptiform activity in rolandic region interfere with the executive function in children with BECTS.

  10. Main: 1LR5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  11. L-R asymmetry in gut's

    International Nuclear Information System (INIS)

    Karadayi, H.R.

    1982-01-01

    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  12. Sequential testing scheme for the assessment of the side-effects of plant protection products on the predatory bug Orius laevigatus

    NARCIS (Netherlands)

    Veire, Van de M.; Sterk, G.; Staaij, van der M.; Ramakers, P.M.J.; Tirry, L.

    2002-01-01

    This paper describes a number of test methods, to beused in a sequential scheme, for testing the side-effects ofplant protection products on anthocorid bugs. Orius laevigatuswas used as test species. A `worst case' laboratory method wasdeveloped for evaluating the effect on mortality of the

  13. A minimax sequential procedure in the context of computerized adaptive mastery testing

    NARCIS (Netherlands)

    Vos, Hendrik J.

    1997-01-01

    The purpose of this paper is to derive optimal rules for variable-length mastery tests in case three mastery classification decisions (nonmastery, partial mastery, and mastery) are distinguished. In a variable-length or adaptive mastery test, the decision is to classify a subject as a master, a

  14. Main: 1LR4 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  15. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  16. Ruling out cardiac failure: Cost-benefit analysis of a sequential testing strategy with NT-proBNP before echocardiography

    Science.gov (United States)

    Ferrandis, Maria-José; Ryden, Ingvar; Lindahl, Tomas L.

    2013-01-01

    Objectives To estimate the possible economic benefit of a sequential testing strategy with NT-proBNP to reduce the number of echocardiographies. Methods Retrospective study in a third-party payer perspective. The costs were calculated from three Swedish counties: Blekinge, Östergötland, and Uppland. Two cut-off levels of NT-proBNP were used: 400 and 300 pg/mL. The cost-effectiveness of the testing strategy was estimated through the short-term cost avoidance and reduction in demand for echocardiographies. Results The estimated costs for NT-proBNP tests and echocardiographies per county were reduced by 33%–36% with the 400 pg/mL cut-off and by 28%–29% with the 300 pg/mL cut-off. This corresponded to a yearly cost reduction of approximately €2–5 million per million inhabitants in these counties. Conclusion The use of NT-proBNP as a screening test could substantially reduce the number of echocardiographies in the diagnostic work-up of patients with suspected cardiac failure, as well as the associated costs. PMID:23230860

  17. Construction of computational program of aging in insulating materials for searching reversed sequential test conditions to give damage equivalent to simultaneous exposure of heat and radiation

    International Nuclear Information System (INIS)

    Fuse, Norikazu; Homma, Hiroya; Okamoto, Tatsuki

    2013-01-01

    Two consecutive numerical calculations on degradation of polymeric insulations under thermal and radiation environment are carried out to simulate so-called reversal sequential acceleration test. The aim of the calculation is to search testing conditions which provide material damage equivalent to the case of simultaneous exposure of heat and radiation. At least following four parameters are needed to be considered in the sequential method; dose rate and exposure time in radiation, as well as temperature and aging time in heating. The present paper discusses the handling of these parameters and shows some trial calculation results. (author)

  18. An improved single sensor parity space algorithm for sequential probability ratio test

    Energy Technology Data Exchange (ETDEWEB)

    Racz, A. [Hungarian Academy of Sciences, Budapest (Hungary). Atomic Energy Research Inst.

    1995-12-01

    In our paper we propose a modification of the single sensor parity algorithm in order to make the statistical properties of the generated residual determinable in advance. The algorithm is tested via computer simulated ramp failure at the temperature readings of the pressurizer. (author).

  19. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2010-10-01

    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  20. The influence of simultaneous or sequential test conditions in the properties of industrial polymers, submitted to PWR accident simulations

    International Nuclear Information System (INIS)

    Carlin, F.; Alba, C.; Chenion, J.; Gaussens, G.; Henry, J.Y.

    1986-10-01

    The effect of PWR plant normal and accident operating conditions on polymers forms the basis of nuclear qualification of safety-related containment equipment. This study was carried out on the request of safety organizations. Its purpose was to check whether accident simulations carried out sequentially during equipment qualification tests would lead to the same deterioration as that caused by an accident involving simultaneous irradiation and thermodynamic effects. The IPSN, DAS and the United States NRC have collaborated in preparing this study. The work carried out by ORIS Company as well as the results obtained from measurement of the mechanical properties of 8 industrial polymers are described in this report. The results are given in the conclusion. They tend to show that, overall, the most suitable test cycle for simulating accident operating conditions would be one which included irradiation and consecutive thermodynamic shock. The results of this study and the results obtained in a previous study, which included the same test cycles, except for more severe thermo-ageing, have been compared. This comparison, which was made on three elastomers, shows that ageing after the accident has a different effect on each material [fr

  1. Behavior of X 6 CrNi 18 11 under sequential testing of creep and fatigue

    Energy Technology Data Exchange (ETDEWEB)

    Husslage, W [TNO, Apeldoorn (Netherlands); Breitling, H [INTERATOM, Bergisch Gladbach (Germany)

    1977-07-01

    The behaviour of the austenitic stainless steel X 6 CrNi 18 11 with about 0.05% C, 18% Cr and 11% Ni was investigated under combined creep and cyclic loading at 550 degrees C. Base metal specimens and specimens containing a weld were tested by: prior cyclic loading followed by creep loading to rupture; prior creep loading followed by cyclic loading to rupture; alternating periods of creep and cyclic loading to rupture. The results were evaluated using the linear cumulative fatigue and creep damage rule. The damage factor D determined on basis of the respective behaviour of base material and welds varied between 0.5 and 1.6 if specimens containing a weld defect were not taken into consideration. Weld defects, which had predominantly an influence on fatigue, lowered the damage factor D up to 0.2. Evaluation of the results on welds with the pure creep and fatigue behaviour of base material shows damage factors between 0.4 and 0.9. By the high margins between allowable creep and fatigue life and life measured with specimens, the cumulative damages of base material and welded joints are much better than the allowable values according to CCI 1592 of the ASME Boiler and Pressure Vessel Code. (author)

  2. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

    2016-05-01

    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  3. WWER safety investigations on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2001-01-01

    A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

  4. A Neuro-Fuzzy Inference System Combining Wavelet Denoising, Principal Component Analysis, and Sequential Probability Ratio Test for Sensor Monitoring

    International Nuclear Information System (INIS)

    Na, Man Gyun; Oh, Seungrohk

    2002-01-01

    A neuro-fuzzy inference system combined with the wavelet denoising, principal component analysis (PCA), and sequential probability ratio test (SPRT) methods has been developed to monitor the relevant sensor using the information of other sensors. The parameters of the neuro-fuzzy inference system that estimates the relevant sensor signal are optimized by a genetic algorithm and a least-squares algorithm. The wavelet denoising technique was applied to remove noise components in input signals into the neuro-fuzzy system. By reducing the dimension of an input space into the neuro-fuzzy system without losing a significant amount of information, the PCA was used to reduce the time necessary to train the neuro-fuzzy system, simplify the structure of the neuro-fuzzy inference system, and also, make easy the selection of the input signals into the neuro-fuzzy system. By using the residual signals between the estimated signals and the measured signals, the SPRT is applied to detect whether the sensors are degraded or not. The proposed sensor-monitoring algorithm was verified through applications to the pressurizer water level, the pressurizer pressure, and the hot-leg temperature sensors in pressurized water reactors

  5. The effect of sequential dual-gas testing on laser-induced breakdown spectroscopy-based discrimination: Application to brass samples and bacterial strains

    International Nuclear Information System (INIS)

    Rehse, Steven J.; Mohaidat, Qassem I.

    2009-01-01

    Four Cu-Zn brass alloys with different stoichiometries and compositions have been analyzed by laser-induced breakdown spectroscopy (LIBS) using nanosecond laser pulses. The intensities of 15 emission lines of copper, zinc, lead, carbon, and aluminum (as well as the environmental contaminants sodium and calcium) were normalized and analyzed with a discriminant function analysis (DFA) to rapidly categorize the samples by alloy. The alloys were tested sequentially in two different noble gases (argon and helium) to enhance discrimination between them. When emission intensities from samples tested sequentially in both gases were combined to form a single 30-spectral line 'fingerprint' of the alloy, an overall 100% correct identification was achieved. This was a modest improvement over using emission intensities acquired in argon gas alone. A similar study was performed to demonstrate an enhanced discrimination between two strains of Escherichia coli (a Gram-negative bacterium) and a Gram-positive bacterium. When emission intensities from bacteria sequentially ablated in two different gas environments were combined, the DFA achieved a 100% categorization accuracy. This result showed the benefit of sequentially testing highly similar samples in two different ambient gases to enhance discrimination between the samples.

  6. IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

    Science.gov (United States)

    Woods, Carol M.

    2008-01-01

    Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

  7. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  8. Microcystin-LR equivalent concentrations in fish tissue during a ...

    African Journals Online (AJOL)

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  9. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  10. Assessment of co-seismic landslide susceptibility using LR and ...

    Indian Academy of Sciences (India)

    Suchita Shrestha

    2018-03-28

    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  11. Sequential Banking.

    OpenAIRE

    Bizer, David S; DeMarzo, Peter M

    1992-01-01

    The authors study environments in which agents may borrow sequentially from more than one leader. Although debt is prioritized, additional lending imposes an externality on prior debt because, with moral hazard, the probability of repayment of prior loans decreases. Equilibrium interest rates are higher than they would be if borrowers could commit to borrow from at most one bank. Even though the loan terms are less favorable than they would be under commitment, the indebtedness of borrowers i...

  12. Absolute Transition Rates in {sup 188}lr

    Energy Technology Data Exchange (ETDEWEB)

    Malmskog, S G; Berg, V

    1969-09-15

    Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

  13. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Science.gov (United States)

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

    2013-11-15

    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  14. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    International Nuclear Information System (INIS)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  15. Using a Simple Binomial Model to Assess Improvement in Predictive Capability: Sequential Bayesian Inference, Hypothesis Testing, and Power Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Sigeti, David E. [Los Alamos National Laboratory; Pelak, Robert A. [Los Alamos National Laboratory

    2012-09-11

    We present a Bayesian statistical methodology for identifying improvement in predictive simulations, including an analysis of the number of (presumably expensive) simulations that will need to be made in order to establish with a given level of confidence that an improvement has been observed. Our analysis assumes the ability to predict (or postdict) the same experiments with legacy and new simulation codes and uses a simple binomial model for the probability, {theta}, that, in an experiment chosen at random, the new code will provide a better prediction than the old. This model makes it possible to do statistical analysis with an absolute minimum of assumptions about the statistics of the quantities involved, at the price of discarding some potentially important information in the data. In particular, the analysis depends only on whether or not the new code predicts better than the old in any given experiment, and not on the magnitude of the improvement. We show how the posterior distribution for {theta} may be used, in a kind of Bayesian hypothesis testing, both to decide if an improvement has been observed and to quantify our confidence in that decision. We quantify the predictive probability that should be assigned, prior to taking any data, to the possibility of achieving a given level of confidence, as a function of sample size. We show how this predictive probability depends on the true value of {theta} and, in particular, how there will always be a region around {theta} = 1/2 where it is highly improbable that we will be able to identify an improvement in predictive capability, although the width of this region will shrink to zero as the sample size goes to infinity. We show how the posterior standard deviation may be used, as a kind of 'plan B metric' in the case that the analysis shows that {theta} is close to 1/2 and argue that such a plan B should generally be part of hypothesis testing. All the analysis presented in the paper is done with a

  16. On-line Flagging of Anomalies and Adaptive Sequential Hypothesis Testing for Fine-feature Characterization of Geosynchronous Satellites

    Science.gov (United States)

    Chaudhary, A.; Payne, T.; Kinateder, K.; Dao, P.; Beecher, E.; Boone, D.; Elliott, B.

    The objective of on-line flagging in this paper is to perform interactive assessment of geosynchronous satellites anomalies such as cross-tagging of a satellites in a cluster, solar panel offset change, etc. This assessment will utilize a Bayesian belief propagation procedure and will include automated update of baseline signature data for the satellite, while accounting for the seasonal changes. Its purpose is to enable an ongoing, automated assessment of satellite behavior through its life cycle using the photometry data collected during the synoptic search performed by a ground or space-based sensor as a part of its metrics mission. The change in the satellite features will be reported along with the probabilities of Type I and Type II errors. The objective of adaptive sequential hypothesis testing in this paper is to define future sensor tasking for the purpose of characterization of fine features of the satellite. The tasking will be designed in order to maximize new information with the least number of photometry data points to be collected during the synoptic search by a ground or space-based sensor. Its calculation is based on the utilization of information entropy techniques. The tasking is defined by considering a sequence of hypotheses in regard to the fine features of the satellite. The optimal observation conditions are then ordered in order to maximize new information about a chosen fine feature. The combined objective of on-line flagging and adaptive sequential hypothesis testing is to progressively discover new information about the features of a geosynchronous satellites by leveraging the regular but sparse cadence of data collection during the synoptic search performed by a ground or space-based sensor. Automated Algorithm to Detect Changes in Geostationary Satellite's Configuration and Cross-Tagging Phan Dao, Air Force Research Laboratory/RVB By characterizing geostationary satellites based on photometry and color photometry, analysts can

  17. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

    African Journals Online (AJOL)

    Yomi

    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  18. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Directory of Open Access Journals (Sweden)

    Xiaobin Guo

    2013-01-01

    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  19. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    International Nuclear Information System (INIS)

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

    2013-01-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  20. A meta-analysis of response-time tests of the sequential two-systems model of moral judgment.

    Science.gov (United States)

    Baron, Jonathan; Gürçay, Burcu

    2017-05-01

    The (generalized) sequential two-system ("default interventionist") model of utilitarian moral judgment predicts that utilitarian responses often arise from a system-two correction of system-one deontological intuitions. Response-time (RT) results that seem to support this model are usually explained by the fact that low-probability responses have longer RTs. Following earlier results, we predicted response probability from each subject's tendency to make utilitarian responses (A, "Ability") and each dilemma's tendency to elicit deontological responses (D, "Difficulty"), estimated from a Rasch model. At the point where A = D, the two responses are equally likely, so probability effects cannot account for any RT differences between them. The sequential two-system model still predicts that many of the utilitarian responses made at this point will result from system-two corrections of system-one intuitions, hence should take longer. However, when A = D, RT for the two responses was the same, contradicting the sequential model. Here we report a meta-analysis of 26 data sets, which replicated the earlier results of no RT difference overall at the point where A = D. The data sets used three different kinds of moral judgment items, and the RT equality at the point where A = D held for all three. In addition, we found that RT increased with A-D. This result holds for subjects (characterized by Ability) but not for items (characterized by Difficulty). We explain the main features of this unanticipated effect, and of the main results, with a drift-diffusion model.

  1. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Science.gov (United States)

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

    2018-06-01

    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  2. The hydration enthalpies of Md3+ and Lr3+

    International Nuclear Information System (INIS)

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

    1987-10-01

    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  3. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    Science.gov (United States)

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

    2015-01-01

    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Adaptive decision making in a dynamic environment: a test of a sequential sampling model of relative judgment.

    Science.gov (United States)

    Vuckovic, Anita; Kwantes, Peter J; Neal, Andrew

    2013-09-01

    Research has identified a wide range of factors that influence performance in relative judgment tasks. However, the findings from this research have been inconsistent. Studies have varied with respect to the identification of causal variables and the perceptual and decision-making mechanisms underlying performance. Drawing on the ecological rationality approach, we present a theory of the judgment and decision-making processes involved in a relative judgment task that explains how people judge a stimulus and adapt their decision process to accommodate their own uncertainty associated with those judgments. Undergraduate participants performed a simulated air traffic control conflict detection task. Across two experiments, we systematically manipulated variables known to affect performance. In the first experiment, we manipulated the relative distances of aircraft to a common destination while holding aircraft speeds constant. In a follow-up experiment, we introduced a direct manipulation of relative speed. We then fit a sequential sampling model to the data, and used the best fitting parameters to infer the decision-making processes responsible for performance. Findings were consistent with the theory that people adapt to their own uncertainty by adjusting their criterion and the amount of time they take to collect evidence in order to make a more accurate decision. From a practical perspective, the paper demonstrates that one can use a sequential sampling model to understand performance in a dynamic environment, allowing one to make sense of and interpret complex patterns of empirical findings that would otherwise be difficult to interpret using standard statistical analyses. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  5. Quantum dots as chemiluminescence enhancers tested by sequential injection technique: Comparison of flow and flow-batch conditions

    Energy Technology Data Exchange (ETDEWEB)

    Sklenářová, Hana, E-mail: sklenarova@faf.cuni.cz [Charles University in Prague, Faculty of Pharmacy in Hradec Králové, Department of Analytical Chemistry, Hradec Králové (Czech Republic); Voráčová, Ivona [Institute of Analytical Chemistry of the CAS, v. v. i., Brno (Czech Republic); Chocholouš, Petr; Polášek, Miroslav [Charles University in Prague, Faculty of Pharmacy in Hradec Králové, Department of Analytical Chemistry, Hradec Králové (Czech Republic)

    2017-04-15

    The effect of 0.01–100 µmol L{sup −1} Quantum Dots (QDs) with different emission wavelengths (520–640 nm) and different surface modifications (mercaptopropionic, mercaptoundecanoic, thioglycolic acids and mercaptoethylamine) on permanganate-induced and luminol–hydrogen peroxide chemiluminescence (CL) was studied in detail by a sequential injection technique using a spiral detection flow cell and a flow-batch detection cell operated in flow and stop-flow modes. In permanganate CL system no significant enhancement of the CL signal was observed while for the luminol–hydrogen peroxide CL substantial increase (>100% and >90% with the spiral detection cell in flow and stop-flow modes, respectively) was attained for CdTe QDs. Enhancement exceeding 120% was observed for QDs with emissions at 520, 575 and 603 nm (sizes of 2.8 nm, 3.3 nm and 3.6 nm) using the flow-batch detection cell in the stop-flow mode. Pronounced effect was noted for surface modifications while mercaptoethylamine was the most efficient in CL enhancement compared to mercaptopropionic acid the most commonly applied coating. Significant difference between results obtained in flow and flow-batch conditions based on the entire kinetics of the extremely fast CL reaction was discussed. The increase of the CL signal was always accompanied by reduced lifetime of the CL emission thus application of QDs in flow techniques should be always coupled with the study of the CL lifetime.

  6. Sequential Probability Ratio Test for Collision Avoidance Maneuver Decisions Based on a Bank of Norm-Inequality-Constrained Epoch-State Filters

    Science.gov (United States)

    Carpenter, J. R.; Markley, F. L.; Alfriend, K. T.; Wright, C.; Arcido, J.

    2011-01-01

    Sequential probability ratio tests explicitly allow decision makers to incorporate false alarm and missed detection risks, and are potentially less sensitive to modeling errors than a procedure that relies solely on a probability of collision threshold. Recent work on constrained Kalman filtering has suggested an approach to formulating such a test for collision avoidance maneuver decisions: a filter bank with two norm-inequality-constrained epoch-state extended Kalman filters. One filter models 1he null hypothesis 1ha1 the miss distance is inside the combined hard body radius at the predicted time of closest approach, and one filter models the alternative hypothesis. The epoch-state filter developed for this method explicitly accounts for any process noise present in the system. The method appears to work well using a realistic example based on an upcoming highly-elliptical orbit formation flying mission.

  7. LALR(1) : LL(1) = LR(0) : LL(0)

    NARCIS (Netherlands)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

    1992-01-01

    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  8. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Energy Technology Data Exchange (ETDEWEB)

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  9. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    International Nuclear Information System (INIS)

    Hussein, A.S.

    2007-01-01

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  10. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  11. Bulk etch rate of LR-115 cellulose nitrate film

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

  12. Sequential Neighborhood Effects: The Effect of Long-Term Exposure to Concentrated Disadvantage on Children's Reading and Math Test Scores.

    Science.gov (United States)

    Hicks, Andrew L; Handcock, Mark S; Sastry, Narayan; Pebley, Anne R

    2018-02-01

    Prior research has suggested that children living in a disadvantaged neighborhood have lower achievement test scores, but these studies typically have not estimated causal effects that account for neighborhood choice. Recent studies used propensity score methods to account for the endogeneity of neighborhood exposures, comparing disadvantaged and nondisadvantaged neighborhoods. We develop an alternative propensity function approach in which cumulative neighborhood effects are modeled as a continuous treatment variable. This approach offers several advantages. We use our approach to examine the cumulative effects of neighborhood disadvantage on reading and math test scores in Los Angeles. Our substantive results indicate that recency of exposure to disadvantaged neighborhoods may be more important than average exposure for children's test scores. We conclude that studies of child development should consider both average cumulative neighborhood exposure and the timing of this exposure.

  13. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  14. A Sequential Circuit-Based IP Watermarking Algorithm for Multiple Scan Chains in Design-for-Test

    Directory of Open Access Journals (Sweden)

    C. Wu

    2011-06-01

    Full Text Available In Very Large Scale Integrated Circuits (VLSI design, the existing Design-for-Test(DFT based watermarking techniques usually insert watermark through reordering scan cells, which causes large resource overhead, low security and coverage rate of watermark detection. A novel scheme was proposed to watermark multiple scan chains in DFT for solving the problems. The proposed scheme adopts DFT scan test model of VLSI design, and uses a Linear Feedback Shift Register (LFSR for pseudo random test vector generation. All of the test vectors are shifted in scan input for the construction of multiple scan chains with minimum correlation. Specific registers in multiple scan chains will be changed by the watermark circuit for watermarking the design. The watermark can be effectively detected without interference with normal function of the circuit, even after the chip is packaged. The experimental results on several ISCAS benchmarks show that the proposed scheme has lower resource overhead, probability of coincidence and higher coverage rate of watermark detection by comparing with the existing methods.

  15. Sequential combined test, second trimester maternal serum markers, and circulating fetal cells to select women for invasive prenatal diagnosis.

    Directory of Open Access Journals (Sweden)

    Paolo Guanciali Franchi

    Full Text Available From January 1st 2013 to August 31st 2016, 24408 pregnant women received the first trimester Combined test and contingently offered second trimester maternal serum screening to identify those women who would most benefit from invasive prenatal diagnosis (IPD. The screening was based on first trimester cut-offs of ≥1:30 (IPD indicated, 1:31 to 1:899 (second trimester screening indicated and ≤1:900 (no further action, and a second trimester cut-off of ≥1:250. From January 2014, analysis of fetal cells from peripheral maternal blood was also offered to women with positive screening results. For fetal Down syndrome, the overall detection rate was 96.8% for a false-positive rate of 2.8% resulting in an odds of being affected given a positive result (OAPR of 1:11, equivalent to a positive predictive value (PPV of 8.1%. Additional chromosome abnormalities were also identified resulting in an OAPR for any chromosome abnormality of 1:6.6 (PPV 11.9%. For a sub-set of cases with positive contingent test results, FISH analysis of circulating fetal cells in maternal circulation identified 7 abnormal and 39 as normal cases with 100% specificity and 100% sensitivity. We conclude that contingent screening using conventional Combined and second trimester screening tests is effective but can potentially be considerably enhanced through the addition of fetal cell analysis.

  16. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

    2013-10-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  17. Adaptive local surface refinement based on LR NURBS and its application to contact

    Science.gov (United States)

    Zimmermann, Christopher; Sauer, Roger A.

    2017-12-01

    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  18. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Science.gov (United States)

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

    2015-06-01

    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Sequential Indentation Tests to Investigate the Influence of Confining Stress on Rock Breakage by Tunnel Boring Machine Cutter in a Biaxial State

    Science.gov (United States)

    Liu, Jie; Cao, Ping; Han, Dongya

    2016-04-01

    The influence of confining stress on rock breakage by a tunnel boring machine cutter was investigated by conducting sequential indentation tests in a biaxial state. Combined with morphology measurements of breaking grooves and an analysis of surface and internal crack propagation between nicks, the effects of maximum confining stress and minimum stress on indentation efficiency, crack propagation and chip formation were investigated. Indentation tests and morphology measurements show that increasing a maximum confining stress will result in increased consumed energy in indentations, enlarged groove volumes and promoted indentation efficiency when the corresponding minimum confining stress is fixed. The energy consumed in indentations will increase with increase in minimum confining stress, however, because of the decreased groove volumes as the minimum confining stress increases, the efficiency will decrease. Observations of surface crack propagation show that more intensive fractures will be induced as the maximum confining stress increases, whereas the opposite occurs for an increase of minimum confining stress. An observation of the middle section, cracks and chips shows that as the maximum confining stress increases, chips tend to form in deeper parts when the minimum confining stress is fixed, whereas they tend to formed in shallower parts as the minimum confining stress increases when the maximum confining stress is fixed.

  20. Sequential sentinel SNP Regional Association Plots (SSS-RAP): an approach for testing independence of SNP association signals using meta-analysis data.

    Science.gov (United States)

    Zheng, Jie; Gaunt, Tom R; Day, Ian N M

    2013-01-01

    Genome-Wide Association Studies (GWAS) frequently incorporate meta-analysis within their framework. However, conditional analysis of individual-level data, which is an established approach for fine mapping of causal sites, is often precluded where only group-level summary data are available for analysis. Here, we present a numerical and graphical approach, "sequential sentinel SNP regional association plot" (SSS-RAP), which estimates regression coefficients (beta) with their standard errors using the meta-analysis summary results directly. Under an additive model, typical for genes with small effect, the effect for a sentinel SNP can be transformed to the predicted effect for a possibly dependent SNP through a 2×2 2-SNP haplotypes table. The approach assumes Hardy-Weinberg equilibrium for test SNPs. SSS-RAP is available as a Web-tool (http://apps.biocompute.org.uk/sssrap/sssrap.cgi). To develop and illustrate SSS-RAP we analyzed lipid and ECG traits data from the British Women's Heart and Health Study (BWHHS), evaluated a meta-analysis for ECG trait and presented several simulations. We compared results with existing approaches such as model selection methods and conditional analysis. Generally findings were consistent. SSS-RAP represents a tool for testing independence of SNP association signals using meta-analysis data, and is also a convenient approach based on biological principles for fine mapping in group level summary data. © 2012 Blackwell Publishing Ltd/University College London.

  1. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

    Science.gov (United States)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

  2. Expedient construction of small molecule macroarrays via sequential palladium- and copper-mediated reactions and their ex situ biological testing.

    Science.gov (United States)

    Frei, Reto; Breitbach, Anthony S; Blackwell, Helen E

    2012-05-01

    We report the highly efficient syntheses of a series of focused libraries in the small molecule macroarray format using Suzuki-Miyaura and copper-catalyzed azide-alkyne cycloaddition (or "click") reactions. The libraries were based on stilbene and triazole scaffolds, which are known to have a broad range of biological activities, including quorum-sensing (QS) modulation in bacteria. The library products were generated in parallel on the macroarray in extremely short reaction times (~10-20 min) and isolated in excellent purities. Biological testing of one macroarray library post-cleavage (ex situ) revealed several potent agonists of the QS receptor, LuxR, in Vibrio fischeri. These synthetic agonists, in contrast to others that we have reported, were only active in the presence of the native QS signal in V. fischeri, which is suggestive of a different mode of activity. Notably, the results presented herein showcase the ready compatibility of the macroarray platform with chemical reactions that are commonly utilized in small molecule probe and drug discovery today. As such, this work serves to expand the utility of the small molecule macroarray as a rapid and operationally straightforward approach toward the synthesis and screening of bioactive agents.

  3. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Science.gov (United States)

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  4. LR1: a candidate RNA virus of Leishmania.

    OpenAIRE

    Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

    1988-01-01

    Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

  5. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  6. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    DEFF Research Database (Denmark)

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

    2003-01-01

    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  7. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    International Nuclear Information System (INIS)

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

    2016-01-01

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  8. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

    2016-09-05

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  9. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

    Science.gov (United States)

    2012-01-01

    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  10. Dose-response effects of systemic anandamide administration in mice sequentially submitted to the open field and elevated plus-maze tests.

    Science.gov (United States)

    Ribeiro, A; Ferraz-de-Paula, V; Pinheiro, M L; Palermo-Neto, J

    2009-06-01

    The endocannabinoid system is involved in the control of many physiological functions, including the control of emotional states. In rodents, previous exposure to an open field increases the anxiety-like behavior in the elevated plus-maze. Anxiolytic-like effects of pharmacological compounds that increase endocannabinoid levels have been well documented. However, these effects are more evident in animals with high anxiety levels. Several studies have described characteristic inverted U-shaped dose-response effects of drugs that modulate the endocannabinoid levels. However, there are no studies showing the effects of different doses of exogenous anandamide, an endocannabinoid, in animal models of anxiety. Thus, in the present study, we determined the dose-response effects of exogenous anandamide at doses of 0.01, 0.1, and 1.0 mg/kg in C57BL/6 mice (N = 10/group) sequentially submitted to the open field and elevated plus-maze. Anandamide was diluted in 0.9% saline, ethyl alcohol, Emulphor (18:1:1) and administered ip (0.1 mL/10 g body weight); control animals received the same volume of anandamide vehicle. Anandamide at the dose of 0.1 mg/kg (but not of 0.01 or 1 mg/kg) increased (P open field, as well as the exploration of the open arms of the elevated plus-maze. Thus, exogenous anandamide, like pharmacological compounds that increase endocannabinoid levels, promoted a characteristic inverted U-shaped dose-response effect in animal models of anxiety. Furthermore, anandamide (0.1 mg/kg) induced an anxiolytic-like effect in the elevated plus-maze (P open field test.

  11. Optimal Sequential Rules for Computer-Based Instruction.

    Science.gov (United States)

    Vos, Hans J.

    1998-01-01

    Formulates sequential rules for adapting the appropriate amount of instruction to learning needs in the context of computer-based instruction. Topics include Bayesian decision theory, threshold and linear-utility structure, psychometric model, optimal sequential number of test questions, and an empirical example of sequential instructional…

  12. Perturbation measurements in reactor LR-0 and their evaluation

    International Nuclear Information System (INIS)

    Rypar, W.; Faehrmann, K.H.

    1988-07-01

    To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

  13. Random sequential adsorption of cubes

    Science.gov (United States)

    Cieśla, Michał; Kubala, Piotr

    2018-01-01

    Random packings built of cubes are studied numerically using a random sequential adsorption algorithm. To compare the obtained results with previous reports, three different models of cube orientation sampling were used. Also, three different cube-cube intersection algorithms were tested to find the most efficient one. The study focuses on the mean saturated packing fraction as well as kinetics of packing growth. Microstructural properties of packings were analyzed using density autocorrelation function.

  14. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Directory of Open Access Journals (Sweden)

    Sérgio João de Luca

    2010-03-01

    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  15. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

    2015-08-15

    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  17. Sequential charged particle reaction

    International Nuclear Information System (INIS)

    Hori, Jun-ichi; Ochiai, Kentaro; Sato, Satoshi; Yamauchi, Michinori; Nishitani, Takeo

    2004-01-01

    The effective cross sections for producing the sequential reaction products in F82H, pure vanadium and LiF with respect to the 14.9-MeV neutron were obtained and compared with the estimation ones. Since the sequential reactions depend on the secondary charged particles behavior, the effective cross sections are corresponding to the target nuclei and the material composition. The effective cross sections were also estimated by using the EAF-libraries and compared with the experimental ones. There were large discrepancies between estimated and experimental values. Additionally, we showed the contribution of the sequential reaction on the induced activity and dose rate in the boundary region with water. From the present study, it has been clarified that the sequential reactions are of great importance to evaluate the dose rates around the surface of cooling pipe and the activated corrosion products. (author)

  18. Investigations into the biodegradation of microcystin-LR in wastewaters

    International Nuclear Information System (INIS)

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

    2010-01-01

    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  19. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Science.gov (United States)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-05-15

    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Sequential probability ratio controllers for safeguards radiation monitors

    International Nuclear Information System (INIS)

    Fehlau, P.E.; Coop, K.L.; Nixon, K.V.

    1984-01-01

    Sequential hypothesis tests applied to nuclear safeguards accounting methods make the methods more sensitive to detecting diversion. The sequential tests also improve transient signal detection in safeguards radiation monitors. This paper describes three microprocessor control units with sequential probability-ratio tests for detecting transient increases in radiation intensity. The control units are designed for three specific applications: low-intensity monitoring with Poisson probability ratios, higher intensity gamma-ray monitoring where fixed counting intervals are shortened by sequential testing, and monitoring moving traffic where the sequential technique responds to variable-duration signals. The fixed-interval controller shortens a customary 50-s monitoring time to an average of 18 s, making the monitoring delay less bothersome. The controller for monitoring moving vehicles benefits from the sequential technique by maintaining more than half its sensitivity when the normal passage speed doubles

  1. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-01-01

    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  2. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  3. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

    Science.gov (United States)

    2011-09-30

    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  4. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  5. Sequential stochastic optimization

    CERN Document Server

    Cairoli, Renzo

    1996-01-01

    Sequential Stochastic Optimization provides mathematicians and applied researchers with a well-developed framework in which stochastic optimization problems can be formulated and solved. Offering much material that is either new or has never before appeared in book form, it lucidly presents a unified theory of optimal stopping and optimal sequential control of stochastic processes. This book has been carefully organized so that little prior knowledge of the subject is assumed; its only prerequisites are a standard graduate course in probability theory and some familiarity with discrete-paramet

  6. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    International Nuclear Information System (INIS)

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  7. Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

    Directory of Open Access Journals (Sweden)

    R. Greco

    2013-09-01

    Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

  8. Sequential memory: Binding dynamics

    Science.gov (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  9. Sequential Dependencies in Driving

    Science.gov (United States)

    Doshi, Anup; Tran, Cuong; Wilder, Matthew H.; Mozer, Michael C.; Trivedi, Mohan M.

    2012-01-01

    The effect of recent experience on current behavior has been studied extensively in simple laboratory tasks. We explore the nature of sequential effects in the more naturalistic setting of automobile driving. Driving is a safety-critical task in which delayed response times may have severe consequences. Using a realistic driving simulator, we find…

  10. Mining compressing sequential problems

    NARCIS (Netherlands)

    Hoang, T.L.; Mörchen, F.; Fradkin, D.; Calders, T.G.K.

    2012-01-01

    Compression based pattern mining has been successfully applied to many data mining tasks. We propose an approach based on the minimum description length principle to extract sequential patterns that compress a database of sequences well. We show that mining compressing patterns is NP-Hard and

  11. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    CERN Document Server

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

    1999-01-01

    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  12. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Science.gov (United States)

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

    2017-06-01

    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  13. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2002-01-01

    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  14. Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

    Science.gov (United States)

    Siuly; Li, Yan; Paul Wen, Peng

    2014-03-01

    Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Group-sequential analysis may allow for early trial termination

    DEFF Research Database (Denmark)

    Gerke, Oke; Vilstrup, Mie H; Halekoh, Ulrich

    2017-01-01

    BACKGROUND: Group-sequential testing is widely used in pivotal therapeutic, but rarely in diagnostic research, although it may save studies, time, and costs. The purpose of this paper was to demonstrate a group-sequential analysis strategy in an intra-observer study on quantitative FDG-PET/CT mea......BACKGROUND: Group-sequential testing is widely used in pivotal therapeutic, but rarely in diagnostic research, although it may save studies, time, and costs. The purpose of this paper was to demonstrate a group-sequential analysis strategy in an intra-observer study on quantitative FDG...

  16. Sequential VEGF and BMP-2 releasing PLA-PEG-PLA scaffolds for bone tissue engineering: I. Design and in vitro tests.

    Science.gov (United States)

    Eğri, Sinan; Eczacıoğlu, Numan

    2017-03-01

    Biodegradable PLA-PEG-PLA block copolymers were synthesized with desired backbone structures and molecular weights using PEG20000. Rectangular scaffolds were prepared by freeze drying with or without using NaCl particles. Bone morphogenetic protein (BMP)-2 was loaded to the matrix after the scaffold formation for sustained release while vascular endothelial growth factor (VEGF) was loaded within the pores with gelatin solution. VEGF release was quite fast and almost 60% of it was released in 2 d. However, sequential - sustained released was observed for BMP-2 in the following few months. Corporation of VEGF/BMP-2 couple into the scaffolds increased the cell adhesion and proliferation. Neither significant cytotoxicity nor apoptosis/necrosis were observed.

  17. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Science.gov (United States)

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

    2014-01-01

    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  18. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Liqiang Liu

    2014-08-01

    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  19. Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

    Science.gov (United States)

    Feng, Rulin; Peterson, Kirk A

    2017-08-28

    New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

  20. Forced Sequence Sequential Decoding

    DEFF Research Database (Denmark)

    Jensen, Ole Riis

    In this thesis we describe a new concatenated decoding scheme based on iterations between an inner sequentially decoded convolutional code of rate R=1/4 and memory M=23, and block interleaved outer Reed-Solomon codes with non-uniform profile. With this scheme decoding with good performance...... is possible as low as Eb/No=0.6 dB, which is about 1.7 dB below the signal-to-noise ratio that marks the cut-off rate for the convolutional code. This is possible since the iteration process provides the sequential decoders with side information that allows a smaller average load and minimizes the probability...... of computational overflow. Analytical results for the probability that the first Reed-Solomon word is decoded after C computations are presented. This is supported by simulation results that are also extended to other parameters....

  1. Sequential Power-Dependence Theory

    NARCIS (Netherlands)

    Buskens, Vincent; Rijt, Arnout van de

    2008-01-01

    Existing methods for predicting resource divisions in laboratory exchange networks do not take into account the sequential nature of the experimental setting. We extend network exchange theory by considering sequential exchange. We prove that Sequential Power-Dependence Theory—unlike

  2. Modelling sequentially scored item responses

    NARCIS (Netherlands)

    Akkermans, W.

    2000-01-01

    The sequential model can be used to describe the variable resulting from a sequential scoring process. In this paper two more item response models are investigated with respect to their suitability for sequential scoring: the partial credit model and the graded response model. The investigation is

  3. Forced Sequence Sequential Decoding

    DEFF Research Database (Denmark)

    Jensen, Ole Riis; Paaske, Erik

    1998-01-01

    We describe a new concatenated decoding scheme based on iterations between an inner sequentially decoded convolutional code of rate R=1/4 and memory M=23, and block interleaved outer Reed-Solomon (RS) codes with nonuniform profile. With this scheme decoding with good performance is possible as low...... as Eb/N0=0.6 dB, which is about 1.25 dB below the signal-to-noise ratio (SNR) that marks the cutoff rate for the full system. Accounting for about 0.45 dB due to the outer codes, sequential decoding takes place at about 1.7 dB below the SNR cutoff rate for the convolutional code. This is possible since...... the iteration process provides the sequential decoders with side information that allows a smaller average load and minimizes the probability of computational overflow. Analytical results for the probability that the first RS word is decoded after C computations are presented. These results are supported...

  4. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Science.gov (United States)

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  6. Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

    Directory of Open Access Journals (Sweden)

    Carolina Saori Ishii Mauro

    2016-12-01

    Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

  7. Sequential and Simultaneous Logit: A Nested Model.

    NARCIS (Netherlands)

    van Ophem, J.C.M.; Schram, A.J.H.C.

    1997-01-01

    A nested model is presented which has both the sequential and the multinomial logit model as special cases. This model provides a simple test to investigate the validity of these specifications. Some theoretical properties of the model are discussed. In the analysis a distribution function is

  8. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    Science.gov (United States)

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

    2017-10-01

    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  9. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    International Nuclear Information System (INIS)

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  10. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    International Nuclear Information System (INIS)

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

    2010-01-01

    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  11. Sequential decay of Reggeons

    International Nuclear Information System (INIS)

    Yoshida, Toshihiro

    1981-01-01

    Probabilities of meson production in the sequential decay of Reggeons, which are formed from the projectile and the target in the hadron-hadron to Reggeon-Reggeon processes, are investigated. It is assumed that pair creation of heavy quarks and simultaneous creation of two antiquark-quark pairs are negligible. The leading-order terms with respect to ratio of creation probabilities of anti s s to anti u u (anti d d) are calculated. The production cross sections in the target fragmentation region are given in terms of probabilities in the initial decay of the Reggeons and an effect of manyparticle production. (author)

  12. Synthetic Aperture Sequential Beamforming

    DEFF Research Database (Denmark)

    Kortbek, Jacob; Jensen, Jørgen Arendt; Gammelmark, Kim Løkke

    2008-01-01

    A synthetic aperture focusing (SAF) technique denoted Synthetic Aperture Sequential Beamforming (SASB) suitable for 2D and 3D imaging is presented. The technique differ from prior art of SAF in the sense that SAF is performed on pre-beamformed data contrary to channel data. The objective is to im......A synthetic aperture focusing (SAF) technique denoted Synthetic Aperture Sequential Beamforming (SASB) suitable for 2D and 3D imaging is presented. The technique differ from prior art of SAF in the sense that SAF is performed on pre-beamformed data contrary to channel data. The objective...... is to improve and obtain a more range independent lateral resolution compared to conventional dynamic receive focusing (DRF) without compromising frame rate. SASB is a two-stage procedure using two separate beamformers. First a set of Bmode image lines using a single focal point in both transmit and receive...... is stored. The second stage applies the focused image lines from the first stage as input data. The SASB method has been investigated using simulations in Field II and by off-line processing of data acquired with a commercial scanner. The performance of SASB with a static image object is compared with DRF...

  13. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Directory of Open Access Journals (Sweden)

    Carol P. S. Lam

    2015-01-01

    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  14. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  15. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    International Nuclear Information System (INIS)

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

    2007-01-01

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  16. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    International Nuclear Information System (INIS)

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

    2006-01-01

    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  17. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    International Nuclear Information System (INIS)

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

    2014-01-01

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  18. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

    2018-05-10

    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  19. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Science.gov (United States)

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

    2014-03-01

    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. Methods for identifying the cost effective case definition cut-off for sequential monitoring tests: an extension of Phelps and Mushlin

    Science.gov (United States)

    Longo, Roberta; Baxter, Paul; Hall, Peter; Hewison, Jenny; Afshar, Mehran; Hall, Geoff; McCabe, Christopher

    2015-01-01

    The arrival of personalized medicine in the clinic means that treatment decisions will increasingly rely on test results. The challenge of limited health care resources means that the dissemination of these technologies will be dependent on their value in relation to their cost; i.e. their cost effectiveness. Phelps and Mushlin have described how to optimize tests to meet cost effectiveness target. However, when tests are applied repeatedly the case mix of the patients tested changes with each administration, and this impacts upon the value of each subsequent test administration. In this paper we present a modification of Phelps and Mushlin’s framework for diagnostic tests; to identify the cost effective cut-off for monitoring tests. Using the Ca125 test monitoring for relapse in Ovarian Cancer, we show how the repeated use of the initial cut-off can lead to a substantially increased false negative rate compared to the monitoring cut-off – over 20% higher than in this example – with the associated harms for individual and population health. PMID:24488576

  1. Comparing two Poisson populations sequentially: an application

    International Nuclear Information System (INIS)

    Halteman, E.J.

    1986-01-01

    Rocky Flats Plant in Golden, Colorado monitors each of its employees for radiation exposure. Excess exposure is detected by comparing the means of two Poisson populations. A sequential probability ratio test (SPRT) is proposed as a replacement for the fixed sample normal approximation test. A uniformly most efficient SPRT exists, however logistics suggest using a truncated SPRT. The truncated SPRT is evaluated in detail and shown to possess large potential savings in average time spent by employees in the monitoring process

  2. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Directory of Open Access Journals (Sweden)

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  3. Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

    Science.gov (United States)

    Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

    2005-12-01

    Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

  4. alpha-particle radioactivity from LR 115 by two methods of analysis

    CERN Document Server

    Azkour, K; Adloff, J C; Pape, A

    1999-01-01

    LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

  5. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Science.gov (United States)

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  6. Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

    CERN Document Server

    Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

    1999-01-01

    Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

  7. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    International Nuclear Information System (INIS)

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

    2006-01-01

    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  8. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  9. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  10. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    NARCIS (Netherlands)

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

    2017-01-01

    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  11. Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

    NARCIS (Netherlands)

    Haraksim, Rudolf; Meuwly, Didier

    2013-01-01

    This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

  12. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    Science.gov (United States)

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  13. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Science.gov (United States)

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  14. On Lattice Sequential Decoding for Large MIMO Systems

    KAUST Repository

    Ali, Konpal S.

    2014-04-01

    Due to their ability to provide high data rates, Multiple-Input Multiple-Output (MIMO) wireless communication systems have become increasingly popular. Decoding of these systems with acceptable error performance is computationally very demanding. In the case of large overdetermined MIMO systems, we employ the Sequential Decoder using the Fano Algorithm. A parameter called the bias is varied to attain different performance-complexity trade-offs. Low values of the bias result in excellent performance but at the expense of high complexity and vice versa for higher bias values. We attempt to bound the error by bounding the bias, using the minimum distance of a lattice. Also, a particular trend is observed with increasing SNR: a region of low complexity and high error, followed by a region of high complexity and error falling, and finally a region of low complexity and low error. For lower bias values, the stages of the trend are incurred at lower SNR than for higher bias values. This has the important implication that a low enough bias value, at low to moderate SNR, can result in low error and low complexity even for large MIMO systems. Our work is compared against Lattice Reduction (LR) aided Linear Decoders (LDs). Another impressive observation for low bias values that satisfy the error bound is that the Sequential Decoder\\'s error is seen to fall with increasing system size, while it grows for the LR-aided LDs. For the case of large underdetermined MIMO systems, Sequential Decoding with two preprocessing schemes is proposed – 1) Minimum Mean Square Error Generalized Decision Feedback Equalization (MMSE-GDFE) preprocessing 2) MMSE-GDFE preprocessing, followed by Lattice Reduction and Greedy Ordering. Our work is compared against previous work which employs Sphere Decoding preprocessed using MMSE-GDFE, Lattice Reduction and Greedy Ordering. For the case of large systems, this results in high complexity and difficulty in choosing the sphere radius. Our schemes

  15. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Adaptive sequential controller

    Energy Technology Data Exchange (ETDEWEB)

    El-Sharkawi, Mohamed A. (Renton, WA); Xing, Jian (Seattle, WA); Butler, Nicholas G. (Newberg, OR); Rodriguez, Alonso (Pasadena, CA)

    1994-01-01

    An adaptive sequential controller (50/50') for controlling a circuit breaker (52) or other switching device to substantially eliminate transients on a distribution line caused by closing and opening the circuit breaker. The device adaptively compensates for changes in the response time of the circuit breaker due to aging and environmental effects. A potential transformer (70) provides a reference signal corresponding to the zero crossing of the voltage waveform, and a phase shift comparator circuit (96) compares the reference signal to the time at which any transient was produced when the circuit breaker closed, producing a signal indicative of the adaptive adjustment that should be made. Similarly, in controlling the opening of the circuit breaker, a current transformer (88) provides a reference signal that is compared against the time at which any transient is detected when the circuit breaker last opened. An adaptive adjustment circuit (102) produces a compensation time that is appropriately modified to account for changes in the circuit breaker response, including the effect of ambient conditions and aging. When next opened or closed, the circuit breaker is activated at an appropriately compensated time, so that it closes when the voltage crosses zero and opens when the current crosses zero, minimizing any transients on the distribution line. Phase angle can be used to control the opening of the circuit breaker relative to the reference signal provided by the potential transformer.

  17. Adaptive sequential controller

    Science.gov (United States)

    El-Sharkawi, Mohamed A.; Xing, Jian; Butler, Nicholas G.; Rodriguez, Alonso

    1994-01-01

    An adaptive sequential controller (50/50') for controlling a circuit breaker (52) or other switching device to substantially eliminate transients on a distribution line caused by closing and opening the circuit breaker. The device adaptively compensates for changes in the response time of the circuit breaker due to aging and environmental effects. A potential transformer (70) provides a reference signal corresponding to the zero crossing of the voltage waveform, and a phase shift comparator circuit (96) compares the reference signal to the time at which any transient was produced when the circuit breaker closed, producing a signal indicative of the adaptive adjustment that should be made. Similarly, in controlling the opening of the circuit breaker, a current transformer (88) provides a reference signal that is compared against the time at which any transient is detected when the circuit breaker last opened. An adaptive adjustment circuit (102) produces a compensation time that is appropriately modified to account for changes in the circuit breaker response, including the effect of ambient conditions and aging. When next opened or closed, the circuit breaker is activated at an appropriately compensated time, so that it closes when the voltage crosses zero and opens when the current crosses zero, minimizing any transients on the distribution line. Phase angle can be used to control the opening of the circuit breaker relative to the reference signal provided by the potential transformer.

  18. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Directory of Open Access Journals (Sweden)

    Kai Shen

    2011-07-01

    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  19. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    International Nuclear Information System (INIS)

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  20. On tests of local realism by CP-violation parameters of K0 mesons

    International Nuclear Information System (INIS)

    Genovese, M.

    2005-01-01

    Recently various papers have proposed to test local realism (LR) by considering electroweak CP-violation parameters values in neutral pseudoscalar meson systems. Considering the large interest for a conclusive test of LR and the experimental accessibility to these tests, in this paper we critically consider these results showing how they, albeit that they are very interesting, require anyway additional assumptions and therefore cannot be considered conclusive tests of LR. (orig.)

  1. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    International Nuclear Information System (INIS)

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

    2014-01-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  2. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Science.gov (United States)

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

    2014-06-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  3. Quantum Inequalities and Sequential Measurements

    International Nuclear Information System (INIS)

    Candelpergher, B.; Grandouz, T.; Rubinx, J.L.

    2011-01-01

    In this article, the peculiar context of sequential measurements is chosen in order to analyze the quantum specificity in the two most famous examples of Heisenberg and Bell inequalities: Results are found at some interesting variance with customary textbook materials, where the context of initial state re-initialization is described. A key-point of the analysis is the possibility of defining Joint Probability Distributions for sequential random variables associated to quantum operators. Within the sequential context, it is shown that Joint Probability Distributions can be defined in situations where not all of the quantum operators (corresponding to random variables) do commute two by two. (authors)

  4. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Science.gov (United States)

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

    2018-06-01

    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  5. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    International Nuclear Information System (INIS)

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  6. Framework for sequential approximate optimization

    NARCIS (Netherlands)

    Jacobs, J.H.; Etman, L.F.P.; Keulen, van F.; Rooda, J.E.

    2004-01-01

    An object-oriented framework for Sequential Approximate Optimization (SAO) isproposed. The framework aims to provide an open environment for thespecification and implementation of SAO strategies. The framework is based onthe Python programming language and contains a toolbox of Python

  7. Sequentially pulsed traveling wave accelerator

    Science.gov (United States)

    Caporaso, George J [Livermore, CA; Nelson, Scott D [Patterson, CA; Poole, Brian R [Tracy, CA

    2009-08-18

    A sequentially pulsed traveling wave compact accelerator having two or more pulse forming lines each with a switch for producing a short acceleration pulse along a short length of a beam tube, and a trigger mechanism for sequentially triggering the switches so that a traveling axial electric field is produced along the beam tube in synchronism with an axially traversing pulsed beam of charged particles to serially impart energy to the particle beam.

  8. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Science.gov (United States)

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

    2017-06-01

    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  9. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    International Nuclear Information System (INIS)

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

    2004-01-01

    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  10. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

    2013-02-15

    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  11. Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

    Directory of Open Access Journals (Sweden)

    Ellen Cristine Giese

    2015-06-01

    Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

  12. Direct determination of bulk etching rate for LR-115-II solid state ...

    Indian Academy of Sciences (India)

    The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

  13. Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

    Directory of Open Access Journals (Sweden)

    Jaiok Roh

    2011-01-01

    Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

  14. Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

    CSIR Research Space (South Africa)

    Oberholster, Paul J

    2009-09-01

    Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

  15. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  16. Low-priced, time-saving, reliable and stable LR-115 counting system

    International Nuclear Information System (INIS)

    Tchorz-Trzeciakiewicz, D.E.

    2015-01-01

    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  17. Configural and component processing in simultaneous and sequential lineup procedures

    OpenAIRE

    Flowe, HD; Smith, HMJ; Karoğlu, N; Onwuegbusi, TO; Rai, L

    2015-01-01

    Configural processing supports accurate face recognition, yet it has never been examined within the context of criminal identification lineups. We tested, using the inversion paradigm, the role of configural processing in lineups. Recent research has found that face discrimination accuracy in lineups is better in a simultaneous compared to a sequential lineup procedure. Therefore, we compared configural processing in simultaneous and sequential lineups to examine whether there are differences...

  18. Sequential versus Organized Rehearsal

    Science.gov (United States)

    Weist, Richard M.; Crawford, Charlotte

    1973-01-01

    The purpose of this research was to test the hypothesis that organization in rehearsal is a necessary condition for organization in recall; that is, if recall is organized, then rehearsal must have been organized. (Author)

  19. Group-sequential analysis may allow for early trial termination

    DEFF Research Database (Denmark)

    Gerke, Oke; Vilstrup, Mie H; Halekoh, Ulrich

    2017-01-01

    BACKGROUND: Group-sequential testing is widely used in pivotal therapeutic, but rarely in diagnostic research, although it may save studies, time, and costs. The purpose of this paper was to demonstrate a group-sequential analysis strategy in an intra-observer study on quantitative FDG-PET/CT mea......BACKGROUND: Group-sequential testing is widely used in pivotal therapeutic, but rarely in diagnostic research, although it may save studies, time, and costs. The purpose of this paper was to demonstrate a group-sequential analysis strategy in an intra-observer study on quantitative FDG...... assumed to be normally distributed, and sequential one-sided hypothesis tests on the population standard deviation of the differences against a hypothesised value of 1.5 were performed, employing an alpha spending function. The fixed-sample analysis (N = 45) was compared with the group-sequential analysis...... strategies comprising one (at N = 23), two (at N = 15, 30), or three interim analyses (at N = 11, 23, 34), respectively, which were defined post hoc. RESULTS: When performing interim analyses with one third and two thirds of patients, sufficient agreement could be concluded after the first interim analysis...

  20. Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

    International Nuclear Information System (INIS)

    Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

    2001-01-01

    An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

  1. The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

    Science.gov (United States)

    1956-01-01

    The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

  2. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    International Nuclear Information System (INIS)

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

    1996-01-01

    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  3. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    International Nuclear Information System (INIS)

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

    2016-01-01

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  4. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Energy Technology Data Exchange (ETDEWEB)

    Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

    2016-12-15

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  5. Remarks on sequential designs in risk assessment

    International Nuclear Information System (INIS)

    Seidenfeld, T.

    1982-01-01

    The special merits of sequential designs are reviewed in light of particular challenges that attend risk assessment for human population. The kinds of ''statistical inference'' are distinguished and the problem of design which is pursued is the clash between Neyman-Pearson and Bayesian programs of sequential design. The value of sequential designs is discussed and the Neyman-Pearson vs. Bayesian sequential designs are probed in particular. Finally, warnings with sequential designs are considered, especially in relation to utilitarianism

  6. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Science.gov (United States)

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

    2016-06-01

    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Sequential versus simultaneous market delineation

    DEFF Research Database (Denmark)

    Haldrup, Niels; Møllgaard, Peter; Kastberg Nielsen, Claus

    2005-01-01

    and geographical markets. Using a unique data setfor prices of Norwegian and Scottish salmon, we propose a methodologyfor simultaneous market delineation and we demonstrate that comparedto a sequential approach conclusions will be reversed.JEL: C3, K21, L41, Q22Keywords: Relevant market, econometric delineation......Delineation of the relevant market forms a pivotal part of most antitrustcases. The standard approach is sequential. First the product marketis delineated, then the geographical market is defined. Demand andsupply substitution in both the product dimension and the geographicaldimension...

  8. Sequential logic analysis and synthesis

    CERN Document Server

    Cavanagh, Joseph

    2007-01-01

    Until now, there was no single resource for actual digital system design. Using both basic and advanced concepts, Sequential Logic: Analysis and Synthesis offers a thorough exposition of the analysis and synthesis of both synchronous and asynchronous sequential machines. With 25 years of experience in designing computing equipment, the author stresses the practical design of state machines. He clearly delineates each step of the structured and rigorous design principles that can be applied to practical applications. The book begins by reviewing the analysis of combinatorial logic and Boolean a

  9. Apparently conclusive meta-analyses may be inconclusive--Trial sequential analysis adjustment of random error risk due to repetitive testing of accumulating data in apparently conclusive neonatal meta-analyses

    DEFF Research Database (Denmark)

    Brok, Jesper; Thorlund, Kristian; Wetterslev, Jørn

    2008-01-01

    BACKGROUND: Random error may cause misleading evidence in meta-analyses. The required number of participants in a meta-analysis (i.e. information size) should be at least as large as an adequately powered single trial. Trial sequential analysis (TSA) may reduce risk of random errors due to repeti......BACKGROUND: Random error may cause misleading evidence in meta-analyses. The required number of participants in a meta-analysis (i.e. information size) should be at least as large as an adequately powered single trial. Trial sequential analysis (TSA) may reduce risk of random errors due...

  10. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  11. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  12. Evaluation Using Sequential Trials Methods.

    Science.gov (United States)

    Cohen, Mark E.; Ralls, Stephen A.

    1986-01-01

    Although dental school faculty as well as practitioners are interested in evaluating products and procedures used in clinical practice, research design and statistical analysis can sometimes pose problems. Sequential trials methods provide an analytical structure that is both easy to use and statistically valid. (Author/MLW)

  13. Attack Trees with Sequential Conjunction

    NARCIS (Netherlands)

    Jhawar, Ravi; Kordy, Barbara; Mauw, Sjouke; Radomirović, Sasa; Trujillo-Rasua, Rolando

    2015-01-01

    We provide the first formal foundation of SAND attack trees which are a popular extension of the well-known attack trees. The SAND at- tack tree formalism increases the expressivity of attack trees by intro- ducing the sequential conjunctive operator SAND. This operator enables the modeling of

  14. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    International Nuclear Information System (INIS)

    Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

    2008-01-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  15. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Energy Technology Data Exchange (ETDEWEB)

    Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

    2008-07-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  16. Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

  17. Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

    International Nuclear Information System (INIS)

    De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

    2014-01-01

    An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

  18. Application of the LR-56 at DOE Facilities in the United States

    International Nuclear Information System (INIS)

    Smith, A.C.

    1998-05-01

    The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

  19. Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

    International Nuclear Information System (INIS)

    Hadek, J.; Grundmann, U.

    1989-09-01

    Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

  20. Configural and component processing in simultaneous and sequential lineup procedures.

    Science.gov (United States)

    Flowe, Heather D; Smith, Harriet M J; Karoğlu, Nilda; Onwuegbusi, Tochukwu O; Rai, Lovedeep

    2016-01-01

    Configural processing supports accurate face recognition, yet it has never been examined within the context of criminal identification lineups. We tested, using the inversion paradigm, the role of configural processing in lineups. Recent research has found that face discrimination accuracy in lineups is better in a simultaneous compared to a sequential lineup procedure. Therefore, we compared configural processing in simultaneous and sequential lineups to examine whether there are differences. We had participants view a crime video, and then they attempted to identify the perpetrator from a simultaneous or sequential lineup. The test faces were presented either upright or inverted, as previous research has shown that inverting test faces disrupts configural processing. The size of the inversion effect for faces was the same across lineup procedures, indicating that configural processing underlies face recognition in both procedures. Discrimination accuracy was comparable across lineup procedures in both the upright and inversion condition. Theoretical implications of the results are discussed.

  1. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  2. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Science.gov (United States)

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

    2013-01-01

    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  3. Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

    Science.gov (United States)

    Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

    2017-01-01

    In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

  4. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    International Nuclear Information System (INIS)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

    2003-01-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  5. Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

    International Nuclear Information System (INIS)

    Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

    2010-01-01

    The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

  6. Advances in sequential data assimilation and numerical weather forecasting: An Ensemble Transform Kalman-Bucy Filter, a study on clustering in deterministic ensemble square root filters, and a test of a new time stepping scheme in an atmospheric model

    Science.gov (United States)

    Amezcua, Javier

    This dissertation deals with aspects of sequential data assimilation (in particular ensemble Kalman filtering) and numerical weather forecasting. In the first part, the recently formulated Ensemble Kalman-Bucy (EnKBF) filter is revisited. It is shown that the previously used numerical integration scheme fails when the magnitude of the background error covariance grows beyond that of the observational error covariance in the forecast window. Therefore, we present a suitable integration scheme that handles the stiffening of the differential equations involved and doesn't represent further computational expense. Moreover, a transform-based alternative to the EnKBF is developed: under this scheme, the operations are performed in the ensemble space instead of in the state space. Advantages of this formulation are explained. For the first time, the EnKBF is implemented in an atmospheric model. The second part of this work deals with ensemble clustering, a phenomenon that arises when performing data assimilation using of deterministic ensemble square root filters in highly nonlinear forecast models. Namely, an M-member ensemble detaches into an outlier and a cluster of M-1 members. Previous works may suggest that this issue represents a failure of EnSRFs; this work dispels that notion. It is shown that ensemble clustering can be reverted also due to nonlinear processes, in particular the alternation between nonlinear expansion and compression of the ensemble for different regions of the attractor. Some EnSRFs that use random rotations have been developed to overcome this issue; these formulations are analyzed and their advantages and disadvantages with respect to common EnSRFs are discussed. The third and last part contains the implementation of the Robert-Asselin-Williams (RAW) filter in an atmospheric model. The RAW filter is an improvement to the widely popular Robert-Asselin filter that successfully suppresses spurious computational waves while avoiding any distortion

  7. Robustness of the Sequential Lineup Advantage

    Science.gov (United States)

    Gronlund, Scott D.; Carlson, Curt A.; Dailey, Sarah B.; Goodsell, Charles A.

    2009-01-01

    A growing movement in the United States and around the world involves promoting the advantages of conducting an eyewitness lineup in a sequential manner. We conducted a large study (N = 2,529) that included 24 comparisons of sequential versus simultaneous lineups. A liberal statistical criterion revealed only 2 significant sequential lineup…

  8. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Science.gov (United States)

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

    2018-02-01

    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Science.gov (United States)

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

    2007-12-26

    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  10. Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

    International Nuclear Information System (INIS)

    Clement, G.; Delvecchio, D.J.; Sazawal, V.

    1997-01-01

    The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

  11. Human visual system automatically encodes sequential regularities of discrete events.

    Science.gov (United States)

    Kimura, Motohiro; Schröger, Erich; Czigler, István; Ohira, Hideki

    2010-06-01

    For our adaptive behavior in a dynamically changing environment, an essential task of the brain is to automatically encode sequential regularities inherent in the environment into a memory representation. Recent studies in neuroscience have suggested that sequential regularities embedded in discrete sensory events are automatically encoded into a memory representation at the level of the sensory system. This notion is largely supported by evidence from investigations using auditory mismatch negativity (auditory MMN), an event-related brain potential (ERP) correlate of an automatic memory-mismatch process in the auditory sensory system. However, it is still largely unclear whether or not this notion can be generalized to other sensory modalities. The purpose of the present study was to investigate the contribution of the visual sensory system to the automatic encoding of sequential regularities using visual mismatch negativity (visual MMN), an ERP correlate of an automatic memory-mismatch process in the visual sensory system. To this end, we conducted a sequential analysis of visual MMN in an oddball sequence consisting of infrequent deviant and frequent standard stimuli, and tested whether the underlying memory representation of visual MMN generation contains only a sensory memory trace of standard stimuli (trace-mismatch hypothesis) or whether it also contains sequential regularities extracted from the repetitive standard sequence (regularity-violation hypothesis). The results showed that visual MMN was elicited by first deviant (deviant stimuli following at least one standard stimulus), second deviant (deviant stimuli immediately following first deviant), and first standard (standard stimuli immediately following first deviant), but not by second standard (standard stimuli immediately following first standard). These results are consistent with the regularity-violation hypothesis, suggesting that the visual sensory system automatically encodes sequential

  12. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Science.gov (United States)

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

    2018-04-30

    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  13. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr; Shihada, Basem

    2015-01-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  14. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Science.gov (United States)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

    2017-06-01

    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  15. Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

    International Nuclear Information System (INIS)

    Aharmim, B.; Sabir, A.; Marah, H.

    2002-01-01

    A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

  16. Development of measuring system with self-powered neutron detectors for the LR-0 reactor

    International Nuclear Information System (INIS)

    Erben, O.; Horinek, K.; Szasz, Z.

    1989-01-01

    A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

  17. Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

    International Nuclear Information System (INIS)

    Sawamura, Teruko; Yamazaki, Hatsuo

    1988-01-01

    This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

  18. Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

    International Nuclear Information System (INIS)

    Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

    2006-01-01

    The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

  19. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr

    2015-07-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  20. Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

    International Nuclear Information System (INIS)

    Somogyi, G.; Hunyadi, I.; Varga, Zs.

    1978-01-01

    Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

  1. On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

    International Nuclear Information System (INIS)

    Heydari-Fard, Malihe

    2010-01-01

    The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

  2. Sequential motor task (Luria's Fist-Edge-Palm Test in children with benign focal epilepsy of childhood with centrotemporal spikes Tarefa motora sequencial (Teste de Lúria punho-lado-palma em crianças com epilepsia focal benigna da infância com descarga centrotemporal

    Directory of Open Access Journals (Sweden)

    Carmen Silvia Molleis Galego Miziara

    2013-06-01

    Full Text Available This study evaluated the sequential motor manual actions in children with benign focal epilepsy of childhood with centrotemporal spikes (BECTS and compares the results with matched control group, through the application of Luria's fist-edge-palm test. The children with BECTS underwent interictal single photon emission computed tomography (SPECT and School Performance Test (SPT. Significant difference occurred between the study and control groups for manual motor action through three equal and three different movements. Children with lower school performance had higher error rate in the imitation of hand gestures. Another factor significantly associated with the failure was the abnormality in SPECT. Children with BECTS showed abnormalities in the test that evaluated manual motor programming/planning. This study may suggest that the functional changes related to epileptiform activity in rolandic region interfere with the executive function in children with BECTS.Esse estudo avaliou ações motoras manuais sequenciais em crianças com epilepsia focal benigna da infância com descarga centrotemporal (EBICT e comparou os resultados com o grupo controle pareado, através do teste de Lúria (punho-lado-palma. As crianças com EBICT realizaram single photon emission computed tomography (SPECT interictal e Teste de Desempenho Escolar (TDE. Foram encontradas diferenças significativas entre os dois grupos nas atividades motoras de três movimentos iguais e três movimentos diferentes. As crianças com piores resultados no TDE e com SPECT alterado apresentaram mais erros no teste de imitação manual. Crianças com epilepsia fracassaram nos testes de avaliação motora que envolvem programação/planejamento. Esse estudo sugere que mudanças funcionais relacionadas à atividade epileptiforme na região rolândica interfere com as funções executivas de crianças com EBICT.

  3. Type B liquid package technical issues -- Experience with LR-56 safety analysis

    International Nuclear Information System (INIS)

    Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

    1997-01-01

    In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

  4. Influence of synchronous and sequential stimulation on muscle fatigue

    NARCIS (Netherlands)

    Thomsen, M.; Thomsen, M.; Veltink, Petrus H.

    1997-01-01

    In acute experiments the sciatic nerve of the rat is electrically stimulated to induce fatigue in the medial Gastrocnemius muscle. Fatigue tests are carried out using intermittent stimulation of different compartments (sequential) or a single compartment (synchronous) of the sciatic nerve. The

  5. Lexical decoder for continuous speech recognition: sequential neural network approach

    International Nuclear Information System (INIS)

    Iooss, Christine

    1991-01-01

    The work presented in this dissertation concerns the study of a connectionist architecture to treat sequential inputs. In this context, the model proposed by J.L. Elman, a recurrent multilayers network, is used. Its abilities and its limits are evaluated. Modifications are done in order to treat erroneous or noisy sequential inputs and to classify patterns. The application context of this study concerns the realisation of a lexical decoder for analytical multi-speakers continuous speech recognition. Lexical decoding is completed from lattices of phonemes which are obtained after an acoustic-phonetic decoding stage relying on a K Nearest Neighbors search technique. Test are done on sentences formed from a lexicon of 20 words. The results are obtained show the ability of the proposed connectionist model to take into account the sequentiality at the input level, to memorize the context and to treat noisy or erroneous inputs. (author) [fr

  6. Visual short-term memory for sequential arrays.

    Science.gov (United States)

    Kumar, Arjun; Jiang, Yuhong

    2005-04-01

    The capacity of visual short-term memory (VSTM) for a single visual display has been investigated in past research, but VSTM for multiple sequential arrays has been explored only recently. In this study, we investigate the capacity of VSTM across two sequential arrays separated by a variable stimulus onset asynchrony (SOA). VSTM for spatial locations (Experiment 1), colors (Experiments 2-4), orientations (Experiments 3 and 4), and conjunction of color and orientation (Experiment 4) were tested, with the SOA across the two sequential arrays varying from 100 to 1,500 msec. We find that VSTM for the trailing array is much better than VSTM for the leading array, but when averaged across the two arrays VSTM has a constant capacity independent of the SOA. We suggest that multiple displays compete for retention in VSTM and that separating information into two temporally discrete groups does not enhance the overall capacity of VSTM.

  7. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    International Nuclear Information System (INIS)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

    2016-01-01

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

  8. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Energy Technology Data Exchange (ETDEWEB)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

    2016-01-15

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

  9. Sequential series for nuclear reactions

    International Nuclear Information System (INIS)

    Izumo, Ko

    1975-01-01

    A new time-dependent treatment of nuclear reactions is given, in which the wave function of compound nucleus is expanded by a sequential series of the reaction processes. The wave functions of the sequential series form another complete set of compound nucleus at the limit Δt→0. It is pointed out that the wave function is characterized by the quantities: the number of degrees of freedom of motion n, the period of the motion (Poincare cycle) tsub(n), the delay time t sub(nμ) and the relaxation time tausub(n) to the equilibrium of compound nucleus, instead of the usual quantum number lambda, the energy eigenvalue Esub(lambda) and the total width GAMMAsub(lambda) of resonance levels, respectively. The transition matrix elements and the yields of nuclear reactions also become the functions of time given by the Fourier transform of the usual ones. The Poincare cycles of compound nuclei are compared with the observed correlations among resonance levels, which are about 10 -17 --10 -16 sec for medium and heavy nuclei and about 10 -20 sec for the intermediate resonances. (auth.)

  10. Greater power and computational efficiency for kernel-based association testing of sets of genetic variants.

    Science.gov (United States)

    Lippert, Christoph; Xiang, Jing; Horta, Danilo; Widmer, Christian; Kadie, Carl; Heckerman, David; Listgarten, Jennifer

    2014-11-15

    Set-based variance component tests have been identified as a way to increase power in association studies by aggregating weak individual effects. However, the choice of test statistic has been largely ignored even though it may play an important role in obtaining optimal power. We compared a standard statistical test-a score test-with a recently developed likelihood ratio (LR) test. Further, when correction for hidden structure is needed, or gene-gene interactions are sought, state-of-the art algorithms for both the score and LR tests can be computationally impractical. Thus we develop new computationally efficient methods. After reviewing theoretical differences in performance between the score and LR tests, we find empirically on real data that the LR test generally has more power. In particular, on 15 of 17 real datasets, the LR test yielded at least as many associations as the score test-up to 23 more associations-whereas the score test yielded at most one more association than the LR test in the two remaining datasets. On synthetic data, we find that the LR test yielded up to 12% more associations, consistent with our results on real data, but also observe a regime of extremely small signal where the score test yielded up to 25% more associations than the LR test, consistent with theory. Finally, our computational speedups now enable (i) efficient LR testing when the background kernel is full rank, and (ii) efficient score testing when the background kernel changes with each test, as for gene-gene interaction tests. The latter yielded a factor of 2000 speedup on a cohort of size 13 500. Software available at http://research.microsoft.com/en-us/um/redmond/projects/MSCompBio/Fastlmm/. heckerma@microsoft.com Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  11. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  12. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    CSIR Research Space (South Africa)

    Nchabeleng, T

    2014-12-01

    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  13. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Directory of Open Access Journals (Sweden)

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  14. Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

    DEFF Research Database (Denmark)

    Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

    2015-01-01

    We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

  15. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Science.gov (United States)

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

    2011-10-01

    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  16. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  17. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    International Nuclear Information System (INIS)

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

    2004-01-01

    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  18. Monitoring sequential electron transfer with EPR

    International Nuclear Information System (INIS)

    Thurnauer, M.C.; Feezel, L.L.; Snyder, S.W.; Tang, J.; Norris, J.R.; Morris, A.L.; Rustandi, R.R.

    1989-01-01

    A completely general model which treats electron spin polarization (ESP) found in a system in which radical pairs with different magnetic interactions are formed sequentially has been described. This treatment has been applied specifically to the ESP found in the bacterial reaction center. Test cases show clearly how parameters such as structure, lifetime, and magnetic interactions within the successive radical pairs affect the ESP, and demonstrate that previous treatments of this problem have been incomplete. The photosynthetic bacterial reaction center protein is an ideal system for testing the general model of ESP. The radical pair which exhibits ESP, P 870 + Q - (P 870 + is the oxidized, primary electron donor, a bacteriochlorophyll special pair and Q - is the reduced, primary quinone acceptor) is formed via sequential electron transport through the intermediary radical pair P 870 + I - (I - is the reduced, intermediary electron acceptor, a bacteriopheophytin). In addition, it is possible to experimentally vary most of the important parameters, such as the lifetime of the intermediary radical pair and the magnetic interactions in each pair. It has been shown how selective isotopic substitution ( 1 H or 2 H) on P 870 , I and Q affects the ESP of the EPR spectrum of P 870 + Q - , observed at two different microwave frequencies, in Fe 2+ -depleted bacterial reaction centers of Rhodobacter sphaeroides R26. Thus, the relative magnitudes of the magnetic properties (nuclear hyperfine and g-factor differences) which influence ESP development were varied. The results support the general model of ESP in that they suggest that the P 870 + Q - radical pair interactions are the dominant source of ESP production in 2 H bacterial reaction centers

  19. Exploring the sequential lineup advantage using WITNESS.

    Science.gov (United States)

    Goodsell, Charles A; Gronlund, Scott D; Carlson, Curt A

    2010-12-01

    Advocates claim that the sequential lineup is an improvement over simultaneous lineup procedures, but no formal (quantitatively specified) explanation exists for why it is better. The computational model WITNESS (Clark, Appl Cogn Psychol 17:629-654, 2003) was used to develop theoretical explanations for the sequential lineup advantage. In its current form, WITNESS produced a sequential advantage only by pairing conservative sequential choosing with liberal simultaneous choosing. However, this combination failed to approximate four extant experiments that exhibited large sequential advantages. Two of these experiments became the focus of our efforts because the data were uncontaminated by likely suspect position effects. Decision-based and memory-based modifications to WITNESS approximated the data and produced a sequential advantage. The next step is to evaluate the proposed explanations and modify public policy recommendations accordingly.

  20. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Science.gov (United States)

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

    2017-11-01

    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Sequential lineup presentation: Patterns and policy

    OpenAIRE

    Lindsay, R C L; Mansour, Jamal K; Beaudry, J L; Leach, A-M; Bertrand, M I

    2009-01-01

    Sequential lineups were offered as an alternative to the traditional simultaneous lineup. Sequential lineups reduce incorrect lineup selections; however, the accompanying loss of correct identifications has resulted in controversy regarding adoption of the technique. We discuss the procedure and research relevant to (1) the pattern of results found using sequential versus simultaneous lineups; (2) reasons (theory) for differences in witness responses; (3) two methodological issues; and (4) im...

  2. The Bacterial Sequential Markov Coalescent.

    Science.gov (United States)

    De Maio, Nicola; Wilson, Daniel J

    2017-05-01

    Bacteria can exchange and acquire new genetic material from other organisms directly and via the environment. This process, known as bacterial recombination, has a strong impact on the evolution of bacteria, for example, leading to the spread of antibiotic resistance across clades and species, and to the avoidance of clonal interference. Recombination hinders phylogenetic and transmission inference because it creates patterns of substitutions (homoplasies) inconsistent with the hypothesis of a single evolutionary tree. Bacterial recombination is typically modeled as statistically akin to gene conversion in eukaryotes, i.e. , using the coalescent with gene conversion (CGC). However, this model can be very computationally demanding as it needs to account for the correlations of evolutionary histories of even distant loci. So, with the increasing popularity of whole genome sequencing, the need has emerged for a faster approach to model and simulate bacterial genome evolution. We present a new model that approximates the coalescent with gene conversion: the bacterial sequential Markov coalescent (BSMC). Our approach is based on a similar idea to the sequential Markov coalescent (SMC)-an approximation of the coalescent with crossover recombination. However, bacterial recombination poses hurdles to a sequential Markov approximation, as it leads to strong correlations and linkage disequilibrium across very distant sites in the genome. Our BSMC overcomes these difficulties, and shows a considerable reduction in computational demand compared to the exact CGC, and very similar patterns in simulated data. We implemented our BSMC model within new simulation software FastSimBac. In addition to the decreased computational demand compared to previous bacterial genome evolution simulators, FastSimBac provides more general options for evolutionary scenarios, allowing population structure with migration, speciation, population size changes, and recombination hotspots. FastSimBac is

  3. Biased lineups: sequential presentation reduces the problem.

    Science.gov (United States)

    Lindsay, R C; Lea, J A; Nosworthy, G J; Fulford, J A; Hector, J; LeVan, V; Seabrook, C

    1991-12-01

    Biased lineups have been shown to increase significantly false, but not correct, identification rates (Lindsay, Wallbridge, & Drennan, 1987; Lindsay & Wells, 1980; Malpass & Devine, 1981). Lindsay and Wells (1985) found that sequential lineup presentation reduced false identification rates, presumably by reducing reliance on relative judgment processes. Five staged-crime experiments were conducted to examine the effect of lineup biases and sequential presentation on eyewitness recognition accuracy. Sequential lineup presentation significantly reduced false identification rates from fair lineups as well as from lineups biased with regard to foil similarity, instructions, or witness attire, and from lineups biased in all of these ways. The results support recommendations that police present lineups sequentially.

  4. Immediate Sequential Bilateral Cataract Surgery

    DEFF Research Database (Denmark)

    Kessel, Line; Andresen, Jens; Erngaard, Ditte

    2015-01-01

    The aim of the present systematic review was to examine the benefits and harms associated with immediate sequential bilateral cataract surgery (ISBCS) with specific emphasis on the rate of complications, postoperative anisometropia, and subjective visual function in order to formulate evidence......-based national Danish guidelines for cataract surgery. A systematic literature review in PubMed, Embase, and Cochrane central databases identified three randomized controlled trials that compared outcome in patients randomized to ISBCS or bilateral cataract surgery on two different dates. Meta-analyses were...... performed using the Cochrane Review Manager software. The quality of the evidence was assessed using the GRADE method (Grading of Recommendation, Assessment, Development, and Evaluation). We did not find any difference in the risk of complications or visual outcome in patients randomized to ISBCS or surgery...

  5. Random and cooperative sequential adsorption

    Science.gov (United States)

    Evans, J. W.

    1993-10-01

    Irreversible random sequential adsorption (RSA) on lattices, and continuum "car parking" analogues, have long received attention as models for reactions on polymer chains, chemisorption on single-crystal surfaces, adsorption in colloidal systems, and solid state transformations. Cooperative generalizations of these models (CSA) are sometimes more appropriate, and can exhibit richer kinetics and spatial structure, e.g., autocatalysis and clustering. The distribution of filled or transformed sites in RSA and CSA is not described by an equilibrium Gibbs measure. This is the case even for the saturation "jammed" state of models where the lattice or space cannot fill completely. However exact analysis is often possible in one dimension, and a variety of powerful analytic methods have been developed for higher dimensional models. Here we review the detailed understanding of asymptotic kinetics, spatial correlations, percolative structure, etc., which is emerging for these far-from-equilibrium processes.

  6. DIF Testing with an Empirical-Histogram Approximation of the Latent Density for Each Group

    Science.gov (United States)

    Woods, Carol M.

    2011-01-01

    This research introduces, illustrates, and tests a variation of IRT-LR-DIF, called EH-DIF-2, in which the latent density for each group is estimated simultaneously with the item parameters as an empirical histogram (EH). IRT-LR-DIF is used to evaluate the degree to which items have different measurement properties for one group of people versus…

  7. Comparative study of six sequential spectrophotometric methods for quantification and separation of ribavirin, sofosbuvir and daclatasvir: An application on Laboratory prepared mixture, pharmaceutical preparations, spiked human urine, spiked human plasma, and dissolution test.

    Science.gov (United States)

    Hassan, Wafaa S; Elmasry, Manal S; Elsayed, Heba M; Zidan, Dalia W

    2018-05-18

    In accordance with International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) guidelines, six novel, simple and precise sequential spectrophotometric methods were developed and validated for the simultaneous analysis of Ribavirin (RIB), Sofosbuvir (SOF), and Daclatasvir (DAC) in their mixture without prior separation steps. These drugs are described as co-administered for treatment of Hepatitis C virus (HCV). HCV is the cause of hepatitis C and some cancers such as liver cancer (hepatocellular carcinoma) and lymphomas in humans. These techniques consisted of several sequential steps using zero, ratio and/or derivative spectra. DAC was first determined through direct spectrophotometry at 313.7 nm without any interference of the other two drugs while RIB and SOF can be determined after ratio subtraction through five methods; Ratio difference spectrophotometric method, successive derivative ratio method, constant center, isoabsorptive method at 238.8 nm, and mean centering of the ratio spectra (MCR) at 224 nm and 258 nm for RIB and SOF, respectively. The calibration curve is linear over the concentration ranges of (6-42), (10-70) and (4-16) μg/mL for RIB, SOF, and DAC, respectively. This method was successfully applied to commercial pharmaceutical preparation of the drugs, spiked human urine, and spiked human plasma. The above methods are very simple methods that were developed for the simultaneous determination of binary and ternary mixtures and so enhance signal-to-noise ratio. The method has been successfully applied to the simultaneous analysis of RIB, SOF, and DAC in laboratory prepared mixtures. The obtained results are statistically compared with those obtained by the official or reported methods, showing no significant difference with respect to accuracy and precision at p = 0.05. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Likelihood ratio sequential sampling models of recognition memory.

    Science.gov (United States)

    Osth, Adam F; Dennis, Simon; Heathcote, Andrew

    2017-02-01

    The mirror effect - a phenomenon whereby a manipulation produces opposite effects on hit and false alarm rates - is benchmark regularity of recognition memory. A likelihood ratio decision process, basing recognition on the relative likelihood that a stimulus is a target or a lure, naturally predicts the mirror effect, and so has been widely adopted in quantitative models of recognition memory. Glanzer, Hilford, and Maloney (2009) demonstrated that likelihood ratio models, assuming Gaussian memory strength, are also capable of explaining regularities observed in receiver-operating characteristics (ROCs), such as greater target than lure variance. Despite its central place in theorising about recognition memory, however, this class of models has not been tested using response time (RT) distributions. In this article, we develop a linear approximation to the likelihood ratio transformation, which we show predicts the same regularities as the exact transformation. This development enabled us to develop a tractable model of recognition-memory RT based on the diffusion decision model (DDM), with inputs (drift rates) provided by an approximate likelihood ratio transformation. We compared this "LR-DDM" to a standard DDM where all targets and lures receive their own drift rate parameters. Both were implemented as hierarchical Bayesian models and applied to four datasets. Model selection taking into account parsimony favored the LR-DDM, which requires fewer parameters than the standard DDM but still fits the data well. These results support log-likelihood based models as providing an elegant explanation of the regularities of recognition memory, not only in terms of choices made but also in terms of the times it takes to make them. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Science.gov (United States)

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  10. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Directory of Open Access Journals (Sweden)

    Gábor Vasas

    2013-09-01

    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  11. Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

    International Nuclear Information System (INIS)

    Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

    2007-01-01

    Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

  12. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    International Nuclear Information System (INIS)

    Josek, R.; Hudec, F.; Rypar, V.

    2006-01-01

    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  13. Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

    2016-01-01

    Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

  14. Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

    Directory of Open Access Journals (Sweden)

    Košál Michal

    2017-01-01

    Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

  15. Trial Sequential Methods for Meta-Analysis

    Science.gov (United States)

    Kulinskaya, Elena; Wood, John

    2014-01-01

    Statistical methods for sequential meta-analysis have applications also for the design of new trials. Existing methods are based on group sequential methods developed for single trials and start with the calculation of a required information size. This works satisfactorily within the framework of fixed effects meta-analysis, but conceptual…

  16. Sequential lineup laps and eyewitness accuracy.

    Science.gov (United States)

    Steblay, Nancy K; Dietrich, Hannah L; Ryan, Shannon L; Raczynski, Jeanette L; James, Kali A

    2011-08-01

    Police practice of double-blind sequential lineups prompts a question about the efficacy of repeated viewings (laps) of the sequential lineup. Two laboratory experiments confirmed the presence of a sequential lap effect: an increase in witness lineup picks from first to second lap, when the culprit was a stranger. The second lap produced more errors than correct identifications. In Experiment 2, lineup diagnosticity was significantly higher for sequential lineup procedures that employed a single versus double laps. Witnesses who elected to view a second lap made significantly more errors than witnesses who chose to stop after one lap or those who were required to view two laps. Witnesses with prior exposure to the culprit did not exhibit a sequential lap effect.

  17. Sequential Product of Quantum Effects: An Overview

    Science.gov (United States)

    Gudder, Stan

    2010-12-01

    This article presents an overview for the theory of sequential products of quantum effects. We first summarize some of the highlights of this relatively recent field of investigation and then provide some new results. We begin by discussing sequential effect algebras which are effect algebras endowed with a sequential product satisfying certain basic conditions. We then consider sequential products of (discrete) quantum measurements. We next treat transition effect matrices (TEMs) and their associated sequential product. A TEM is a matrix whose entries are effects and whose rows form quantum measurements. We show that TEMs can be employed for the study of quantum Markov chains. Finally, we prove some new results concerning TEMs and vector densities.

  18. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Directory of Open Access Journals (Sweden)

    Mawethu P. Bilibana

    2016-11-01

    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  19. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-01-01

    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  20. An automatic system for acidity determination based on sequential injection titration and the monosegmented flow approach.

    Science.gov (United States)

    Kozak, Joanna; Wójtowicz, Marzena; Gawenda, Nadzieja; Kościelniak, Paweł

    2011-06-15

    An automatic sequential injection system, combining monosegmented flow analysis, sequential injection analysis and sequential injection titration is proposed for acidity determination. The system enables controllable sample dilution and generation of standards of required concentration in a monosegmented sequential injection manner, sequential injection titration of the prepared solutions, data collecting, and handling. It has been tested on spectrophotometric determination of acetic, citric and phosphoric acids with sodium hydroxide used as a titrant and phenolphthalein or thymolphthalein (in the case of phosphoric acid determination) as indicators. Accuracy better than |4.4|% (RE) and repeatability better than 2.9% (RSD) have been obtained. It has been applied to the determination of total acidity in vinegars and various soft drinks. The system provides low sample (less than 0.3 mL) consumption. On average, analysis of a sample takes several minutes. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    International Nuclear Information System (INIS)

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

    2017-01-01

    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  2. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Science.gov (United States)

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

    2016-12-01

    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Sequential boundaries approach in clinical trials with unequal allocation ratios

    Directory of Open Access Journals (Sweden)

    Ayatollahi Seyyed

    2006-01-01

    Full Text Available Abstract Background In clinical trials, both unequal randomization design and sequential analyses have ethical and economic advantages. In the single-stage-design (SSD, however, if the sample size is not adjusted based on unequal randomization, the power of the trial will decrease, whereas with sequential analysis the power will always remain constant. Our aim was to compare sequential boundaries approach with the SSD when the allocation ratio (R was not equal. Methods We evaluated the influence of R, the ratio of the patients in experimental group to the standard group, on the statistical properties of two-sided tests, including the two-sided single triangular test (TT, double triangular test (DTT and SSD by multiple simulations. The average sample size numbers (ASNs and power (1-β were evaluated for all tests. Results Our simulation study showed that choosing R = 2 instead of R = 1 increases the sample size of SSD by 12% and the ASN of the TT and DTT by the same proportion. Moreover, when R = 2, compared to the adjusted SSD, using the TT or DTT allows to retrieve the well known reductions of ASN observed when R = 1, compared to SSD. In addition, when R = 2, compared to SSD, using the TT and DTT allows to obtain smaller reductions of ASN than when R = 1, but maintains the power of the test to its planned value. Conclusion This study indicates that when the allocation ratio is not equal among the treatment groups, sequential analysis could indeed serve as a compromise between ethicists, economists and statisticians.

  4. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Science.gov (United States)

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

    2011-01-01

    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  5. Multilevel sequential Monte Carlo samplers

    KAUST Repository

    Beskos, Alexandros; Jasra, Ajay; Law, Kody; Tempone, Raul; Zhou, Yan

    2016-01-01

    In this article we consider the approximation of expectations w.r.t. probability distributions associated to the solution of partial differential equations (PDEs); this scenario appears routinely in Bayesian inverse problems. In practice, one often has to solve the associated PDE numerically, using, for instance finite element methods which depend on the step-size level . hL. In addition, the expectation cannot be computed analytically and one often resorts to Monte Carlo methods. In the context of this problem, it is known that the introduction of the multilevel Monte Carlo (MLMC) method can reduce the amount of computational effort to estimate expectations, for a given level of error. This is achieved via a telescoping identity associated to a Monte Carlo approximation of a sequence of probability distributions with discretization levels . ∞>h0>h1⋯>hL. In many practical problems of interest, one cannot achieve an i.i.d. sampling of the associated sequence and a sequential Monte Carlo (SMC) version of the MLMC method is introduced to deal with this problem. It is shown that under appropriate assumptions, the attractive property of a reduction of the amount of computational effort to estimate expectations, for a given level of error, can be maintained within the SMC context. That is, relative to exact sampling and Monte Carlo for the distribution at the finest level . hL. The approach is numerically illustrated on a Bayesian inverse problem. © 2016 Elsevier B.V.

  6. Multilevel sequential Monte Carlo samplers

    KAUST Repository

    Beskos, Alexandros

    2016-08-29

    In this article we consider the approximation of expectations w.r.t. probability distributions associated to the solution of partial differential equations (PDEs); this scenario appears routinely in Bayesian inverse problems. In practice, one often has to solve the associated PDE numerically, using, for instance finite element methods which depend on the step-size level . hL. In addition, the expectation cannot be computed analytically and one often resorts to Monte Carlo methods. In the context of this problem, it is known that the introduction of the multilevel Monte Carlo (MLMC) method can reduce the amount of computational effort to estimate expectations, for a given level of error. This is achieved via a telescoping identity associated to a Monte Carlo approximation of a sequence of probability distributions with discretization levels . ∞>h0>h1⋯>hL. In many practical problems of interest, one cannot achieve an i.i.d. sampling of the associated sequence and a sequential Monte Carlo (SMC) version of the MLMC method is introduced to deal with this problem. It is shown that under appropriate assumptions, the attractive property of a reduction of the amount of computational effort to estimate expectations, for a given level of error, can be maintained within the SMC context. That is, relative to exact sampling and Monte Carlo for the distribution at the finest level . hL. The approach is numerically illustrated on a Bayesian inverse problem. © 2016 Elsevier B.V.

  7. Sequential Scintigraphy in Renal Transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Winkel, K. zum; Harbst, H.; Schenck, P.; Franz, H. E.; Ritz, E.; Roehl, L.; Ziegler, M.; Ammann, W.; Maier-Borst, W. [Institut Fuer Nuklearmedizin, Deutsches Krebsforschungszentrum, Heidelberg, Federal Republic of Germany (Germany)

    1969-05-15

    Based on experience gained from more than 1600 patients with proved or suspected kidney diseases and on results on extended studies with dogs, sequential scintigraphy was performed after renal transplantation in dogs. After intravenous injection of 500 {mu}Ci. {sup 131}I-Hippuran scintiphotos were taken during the first minute with an exposure time of 15 sec each and thereafter with an exposure of 2 min up to at least 16 min.. Several examinations were evaluated digitally. 26 examinations were performed on 11 dogs with homotransplanted kidneys. Immediately after transplantation the renal function was almost normal arid the bladder was filled in due time. At the beginning of rejection the initial uptake of radioactive Hippuran was reduced. The intrarenal transport became delayed; probably the renal extraction rate decreased. Corresponding to the development of an oedema in the transplant the uptake area increased in size. In cases of thrombosis of the main artery there was no evidence of any uptake of radioactivity in the transplant. Similar results were obtained in 41 examinations on 15 persons. Patients with postoperative anuria due to acute tubular necrosis showed still some uptake of radioactivity contrary to those with thrombosis of the renal artery, where no uptake was found. In cases of rejection the most frequent signs were a reduced initial uptake and a delayed intrarenal transport of radioactive Hippuran. Infarction could be detected by a reduced uptake in distinct areas of the transplant. (author)

  8. Sequential provisional implant prosthodontics therapy.

    Science.gov (United States)

    Zinner, Ira D; Markovits, Stanley; Jansen, Curtis E; Reid, Patrick E; Schnader, Yale E; Shapiro, Herbert J

    2012-01-01

    The fabrication and long-term use of first- and second-stage provisional implant prostheses is critical to create a favorable prognosis for function and esthetics of a fixed-implant supported prosthesis. The fixed metal and acrylic resin cemented first-stage prosthesis, as reviewed in Part I, is needed for prevention of adjacent and opposing tooth movement, pressure on the implant site as well as protection to avoid micromovement of the freshly placed implant body. The second-stage prosthesis, reviewed in Part II, should be used following implant uncovering and abutment installation. The patient wears this provisional prosthesis until maturation of the bone and healing of soft tissues. The second-stage provisional prosthesis is also a fail-safe mechanism for possible early implant failures and also can be used with late failures and/or for the necessity to repair the definitive prosthesis. In addition, the screw-retained provisional prosthesis is used if and when an implant requires removal or other implants are to be placed as in a sequential approach. The creation and use of both first- and second-stage provisional prostheses involve a restorative dentist, dental technician, surgeon, and patient to work as a team. If the dentist alone cannot do diagnosis and treatment planning, surgery, and laboratory techniques, he or she needs help by employing the expertise of a surgeon and a laboratory technician. This team approach is essential for optimum results.

  9. Simple and flexible SAS and SPSS programs for analyzing lag-sequential categorical data.

    Science.gov (United States)

    O'Connor, B P

    1999-11-01

    This paper describes simple and flexible programs for analyzing lag-sequential categorical data, using SAS and SPSS. The programs read a stream of codes and produce a variety of lag-sequential statistics, including transitional frequencies, expected transitional frequencies, transitional probabilities, adjusted residuals, z values, Yule's Q values, likelihood ratio tests of stationarity across time and homogeneity across groups or segments, transformed kappas for unidirectional dependence, bidirectional dependence, parallel and nonparallel dominance, and significance levels based on both parametric and randomization tests.

  10. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    OpenAIRE

    Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

    2016-01-01

    International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

  11. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Science.gov (United States)

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

    2016-03-01

    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  12. Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

    Directory of Open Access Journals (Sweden)

    Fernanda da Conceição Moreira

    2017-06-01

    Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

  13. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    International Nuclear Information System (INIS)

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

    1991-01-01

    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  14. Tradable permit allocations and sequential choice

    Energy Technology Data Exchange (ETDEWEB)

    MacKenzie, Ian A. [Centre for Economic Research, ETH Zuerich, Zurichbergstrasse 18, 8092 Zuerich (Switzerland)

    2011-01-15

    This paper investigates initial allocation choices in an international tradable pollution permit market. For two sovereign governments, we compare allocation choices that are either simultaneously or sequentially announced. We show sequential allocation announcements result in higher (lower) aggregate emissions when announcements are strategic substitutes (complements). Whether allocation announcements are strategic substitutes or complements depends on the relationship between the follower's damage function and governments' abatement costs. When the marginal damage function is relatively steep (flat), allocation announcements are strategic substitutes (complements). For quadratic abatement costs and damages, sequential announcements provide a higher level of aggregate emissions. (author)

  15. Sequential Generalized Transforms on Function Space

    Directory of Open Access Journals (Sweden)

    Jae Gil Choi

    2013-01-01

    Full Text Available We define two sequential transforms on a function space Ca,b[0,T] induced by generalized Brownian motion process. We then establish the existence of the sequential transforms for functionals in a Banach algebra of functionals on Ca,b[0,T]. We also establish that any one of these transforms acts like an inverse transform of the other transform. Finally, we give some remarks about certain relations between our sequential transforms and other well-known transforms on Ca,b[0,T].

  16. Efficacy of premixed versus sequential administration of ...

    African Journals Online (AJOL)

    sequential administration in separate syringes on block characteristics, haemodynamic parameters, side effect profile and postoperative analgesic requirement. Trial design: This was a prospective, randomised clinical study. Method: Sixty orthopaedic patients scheduled for elective lower limb surgery under spinal ...

  17. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    International Nuclear Information System (INIS)

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

    2012-01-01

    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  18. Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

    Science.gov (United States)

    Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

    2018-06-01

    The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

  19. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Science.gov (United States)

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

    2017-07-01

    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

    OpenAIRE

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

  1. Structural Consistency, Consistency, and Sequential Rationality.

    OpenAIRE

    Kreps, David M; Ramey, Garey

    1987-01-01

    Sequential equilibria comprise consistent beliefs and a sequentially ra tional strategy profile. Consistent beliefs are limits of Bayes ratio nal beliefs for sequences of strategies that approach the equilibrium strategy. Beliefs are structurally consistent if they are rationaliz ed by some single conjecture concerning opponents' strategies. Consis tent beliefs are not necessarily structurally consistent, notwithstan ding a claim by Kreps and Robert Wilson (1982). Moreover, the spirit of stru...

  2. Effects of neostriatal 6-OHDA lesion on performance in a rat sequential reaction time task.

    Science.gov (United States)

    Domenger, D; Schwarting, R K W

    2008-10-31

    Work in humans and monkeys has provided evidence that the basal ganglia, and the neurotransmitter dopamine therein, play an important role for sequential learning and performance. Compared to primates, experimental work in rodents is rather sparse, largely due to the fact that tasks comparable to the human ones, especially serial reaction time tasks (SRTT), had been lacking until recently. We have developed a rat model of the SRTT, which allows to study neural correlates of sequential performance and motor sequence execution. Here, we report the effects of dopaminergic neostriatal lesions, performed using bilateral 6-hydroxydopamine injections, on performance of well-trained rats tested in our SRTT. Sequential behavior was measured in two ways: for one, the effects of small violations of otherwise well trained sequences were examined as a measure of attention and automation. Secondly, sequential versus random performance was compared as a measure of sequential learning. Neurochemically, the lesions led to sub-total dopamine depletions in the neostriatum, which ranged around 60% in the lateral, and around 40% in the medial neostriatum. These lesions led to a general instrumental impairment in terms of reduced speed (response latencies) and response rate, and these deficits were correlated with the degree of striatal dopamine loss. Furthermore, the violation test indicated that the lesion group conducted less automated responses. The comparison of random versus sequential responding showed that the lesion group did not retain its superior sequential performance in terms of speed, whereas they did in terms of accuracy. Also, rats with lesions did not improve further in overall performance as compared to pre-lesion values, whereas controls did. These results support previous results that neostriatal dopamine is involved in instrumental behaviour in general. Also, these lesions are not sufficient to completely abolish sequential performance, at least when acquired

  3. Accurately controlled sequential self-folding structures by polystyrene film

    Science.gov (United States)

    Deng, Dongping; Yang, Yang; Chen, Yong; Lan, Xing; Tice, Jesse

    2017-08-01

    Four-dimensional (4D) printing overcomes the traditional fabrication limitations by designing heterogeneous materials to enable the printed structures evolve over time (the fourth dimension) under external stimuli. Here, we present a simple 4D printing of self-folding structures that can be sequentially and accurately folded. When heated above their glass transition temperature pre-strained polystyrene films shrink along the XY plane. In our process silver ink traces printed on the film are used to provide heat stimuli by conducting current to trigger the self-folding behavior. The parameters affecting the folding process are studied and discussed. Sequential folding and accurately controlled folding angles are achieved by using printed ink traces and angle lock design. Theoretical analyses are done to guide the design of the folding processes. Programmable structures such as a lock and a three-dimensional antenna are achieved to test the feasibility and potential applications of this method. These self-folding structures change their shapes after fabrication under controlled stimuli (electric current) and have potential applications in the fields of electronics, consumer devices, and robotics. Our design and fabrication method provides an easy way by using silver ink printed on polystyrene films to 4D print self-folding structures for electrically induced sequential folding with angular control.

  4. Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

    2003-07-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  5. A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

    Science.gov (United States)

    Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

    2017-06-05

    A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

    Science.gov (United States)

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

  7. Efficient sequential and parallel algorithms for record linkage.

    Science.gov (United States)

    Mamun, Abdullah-Al; Mi, Tian; Aseltine, Robert; Rajasekaran, Sanguthevar

    2014-01-01

    Integrating data from multiple sources is a crucial and challenging problem. Even though there exist numerous algorithms for record linkage or deduplication, they suffer from either large time needs or restrictions on the number of datasets that they can integrate. In this paper we report efficient sequential and parallel algorithms for record linkage which handle any number of datasets and outperform previous algorithms. Our algorithms employ hierarchical clustering algorithms as the basis. A key idea that we use is radix sorting on certain attributes to eliminate identical records before any further processing. Another novel idea is to form a graph that links similar records and find the connected components. Our sequential and parallel algorithms have been tested on a real dataset of 1,083,878 records and synthetic datasets ranging in size from 50,000 to 9,000,000 records. Our sequential algorithm runs at least two times faster, for any dataset, than the previous best-known algorithm, the two-phase algorithm using faster computation of the edit distance (TPA (FCED)). The speedups obtained by our parallel algorithm are almost linear. For example, we get a speedup of 7.5 with 8 cores (residing in a single node), 14.1 with 16 cores (residing in two nodes), and 26.4 with 32 cores (residing in four nodes). We have compared the performance of our sequential algorithm with TPA (FCED) and found that our algorithm outperforms the previous one. The accuracy is the same as that of this previous best-known algorithm.

  8. Imitation of the sequential structure of actions by chimpanzees (Pan troglodytes).

    Science.gov (United States)

    Whiten, A

    1998-09-01

    Imitation was studied experimentally by allowing chimpanzees (Pan troglodytes) to observe alternative patterns of actions for opening a specially designed "artificial fruit." Like problematic foods primates deal with naturally, with the test fruit several defenses had to be removed to gain access to an edible core, but the sequential order and method of defense removal could be systematically varied. Each subject repeatedly observed 1 of 2 alternative techniques for removing each defense and 1 of 2 alternative sequential patterns of defense removal. Imitation of sequential organization emerged after repeated cycles of demonstration and attempts at opening the fruit. Imitation in chimpanzees may thus have some power to produce cultural convergence, counter to the supposition that individual learning processes corrupt copied actions. Imitation of sequential organization was accompanied by imitation of some aspects of the techniques that made up the sequence.

  9. Sequential lineup presentation promotes less-biased criterion setting but does not improve discriminability.

    Science.gov (United States)

    Palmer, Matthew A; Brewer, Neil

    2012-06-01

    When compared with simultaneous lineup presentation, sequential presentation has been shown to reduce false identifications to a greater extent than it reduces correct identifications. However, there has been much debate about whether this difference in identification performance represents improved discriminability or more conservative responding. In this research, data from 22 experiments that compared sequential and simultaneous lineups were analyzed using a compound signal-detection model, which is specifically designed to describe decision-making performance on tasks such as eyewitness identification tests. Sequential (cf. simultaneous) presentation did not influence discriminability, but produced a conservative shift in response bias that resulted in less-biased choosing for sequential than simultaneous lineups. These results inform understanding of the effects of lineup presentation mode on eyewitness identification decisions.

  10. Large-scale sequential quadratic programming algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Eldersveld, S.K.

    1992-09-01

    The problem addressed is the general nonlinear programming problem: finding a local minimizer for a nonlinear function subject to a mixture of nonlinear equality and inequality constraints. The methods studied are in the class of sequential quadratic programming (SQP) algorithms, which have previously proved successful for problems of moderate size. Our goal is to devise an SQP algorithm that is applicable to large-scale optimization problems, using sparse data structures and storing less curvature information but maintaining the property of superlinear convergence. The main features are: 1. The use of a quasi-Newton approximation to the reduced Hessian of the Lagrangian function. Only an estimate of the reduced Hessian matrix is required by our algorithm. The impact of not having available the full Hessian approximation is studied and alternative estimates are constructed. 2. The use of a transformation matrix Q. This allows the QP gradient to be computed easily when only the reduced Hessian approximation is maintained. 3. The use of a reduced-gradient form of the basis for the null space of the working set. This choice of basis is more practical than an orthogonal null-space basis for large-scale problems. The continuity condition for this choice is proven. 4. The use of incomplete solutions of quadratic programming subproblems. Certain iterates generated by an active-set method for the QP subproblem are used in place of the QP minimizer to define the search direction for the nonlinear problem. An implementation of the new algorithm has been obtained by modifying the code MINOS. Results and comparisons with MINOS and NPSOL are given for the new algorithm on a set of 92 test problems.

  11. Sequential dependencies in magnitude scaling of loudness

    DEFF Research Database (Denmark)

    Joshi, Suyash Narendra; Jesteadt, Walt

    2013-01-01

    Ten normally hearing listeners used a programmable sone-potentiometer knob to adjust the level of a 1000-Hz sinusoid to match the loudness of numbers presented to them in a magnitude production task. Three different power-law exponents (0.15, 0.30, and 0.60) and a log-law with equal steps in d......B were used to program the sone-potentiometer. The knob settings systematically influenced the form of the loudness function. Time series analysis was used to assess the sequential dependencies in the data, which increased with increasing exponent and were greatest for the log-law. It would be possible......, therefore, to choose knob properties that minimized these dependencies. When the sequential dependencies were removed from the data, the slope of the loudness functions did not change, but the variability decreased. Sequential dependencies were only present when the level of the tone on the previous trial...

  12. Dihydroazulene photoswitch operating in sequential tunneling regime

    DEFF Research Database (Denmark)

    Broman, Søren Lindbæk; Lara-Avila, Samuel; Thisted, Christine Lindbjerg

    2012-01-01

    to electrodes so that the electron transport goes by sequential tunneling. To assure weak coupling, the DHA switching kernel is modified by incorporating p-MeSC6H4 end-groups. Molecules are prepared by Suzuki cross-couplings on suitable halogenated derivatives of DHA. The synthesis presents an expansion of our......, incorporating a p-MeSC6H4 anchoring group in one end, has been placed in a silver nanogap. Conductance measurements justify that transport through both DHA (high resistivity) and VHF (low resistivity) forms goes by sequential tunneling. The switching is fairly reversible and reenterable; after more than 20 ON...

  13. Asynchronous Operators of Sequential Logic Venjunction & Sequention

    CERN Document Server

    Vasyukevich, Vadim

    2011-01-01

    This book is dedicated to new mathematical instruments assigned for logical modeling of the memory of digital devices. The case in point is logic-dynamical operation named venjunction and venjunctive function as well as sequention and sequentional function. Venjunction and sequention operate within the framework of sequential logic. In a form of the corresponding equations, they organically fit analytical expressions of Boolean algebra. Thus, a sort of symbiosis is formed using elements of asynchronous sequential logic on the one hand and combinational logic on the other hand. So, asynchronous

  14. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    International Nuclear Information System (INIS)

    Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

    2016-01-01

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  15. Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

    Directory of Open Access Journals (Sweden)

    Vitor Vasconcelos

    2011-12-01

    Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

  16. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

    2016-08-31

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  17. The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

    Science.gov (United States)

    Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

    2012-10-01

    • The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  18. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    International Nuclear Information System (INIS)

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

    2014-01-01

    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  19. MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

    Science.gov (United States)

    Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

    2016-01-01

    The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

  20. Eyewitness confidence in simultaneous and sequential lineups: a criterion shift account for sequential mistaken identification overconfidence.

    Science.gov (United States)

    Dobolyi, David G; Dodson, Chad S

    2013-12-01

    Confidence judgments for eyewitness identifications play an integral role in determining guilt during legal proceedings. Past research has shown that confidence in positive identifications is strongly associated with accuracy. Using a standard lineup recognition paradigm, we investigated accuracy using signal detection and ROC analyses, along with the tendency to choose a face with both simultaneous and sequential lineups. We replicated past findings of reduced rates of choosing with sequential as compared to simultaneous lineups, but notably found an accuracy advantage in favor of simultaneous lineups. Moreover, our analysis of the confidence-accuracy relationship revealed two key findings. First, we observed a sequential mistaken identification overconfidence effect: despite an overall reduction in false alarms, confidence for false alarms that did occur was higher with sequential lineups than with simultaneous lineups, with no differences in confidence for correct identifications. This sequential mistaken identification overconfidence effect is an expected byproduct of the use of a more conservative identification criterion with sequential than with simultaneous lineups. Second, we found a steady drop in confidence for mistaken identifications (i.e., foil identifications and false alarms) from the first to the last face in sequential lineups, whereas confidence in and accuracy of correct identifications remained relatively stable. Overall, we observed that sequential lineups are both less accurate and produce higher confidence false identifications than do simultaneous lineups. Given the increasing prominence of sequential lineups in our legal system, our data argue for increased scrutiny and possibly a wholesale reevaluation of this lineup format. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  1. Interpretability degrees of finitely axiomatized sequential theories

    NARCIS (Netherlands)

    Visser, Albert

    In this paper we show that the degrees of interpretability of finitely axiomatized extensions-in-the-same-language of a finitely axiomatized sequential theory-like Elementary Arithmetic EA, IΣ1, or the Gödel-Bernays theory of sets and classes GB-have suprema. This partially answers a question posed

  2. Interpretability Degrees of Finitely Axiomatized Sequential Theories

    NARCIS (Netherlands)

    Visser, Albert

    2012-01-01

    In this paper we show that the degrees of interpretability of finitely axiomatized extensions-in-the-same-language of a finitely axiomatized sequential theory —like Elementary Arithmetic EA, IΣ1, or the Gödel-Bernays theory of sets and classes GB— have suprema. This partially answers a question

  3. S.M.P. SEQUENTIAL MATHEMATICS PROGRAM.

    Science.gov (United States)

    CICIARELLI, V; LEONARD, JOSEPH

    A SEQUENTIAL MATHEMATICS PROGRAM BEGINNING WITH THE BASIC FUNDAMENTALS ON THE FOURTH GRADE LEVEL IS PRESENTED. INCLUDED ARE AN UNDERSTANDING OF OUR NUMBER SYSTEM, AND THE BASIC OPERATIONS OF WORKING WITH WHOLE NUMBERS--ADDITION, SUBTRACTION, MULTIPLICATION, AND DIVISION. COMMON FRACTIONS ARE TAUGHT IN THE FIFTH, SIXTH, AND SEVENTH GRADES. A…

  4. Sensitivity Analysis in Sequential Decision Models.

    Science.gov (United States)

    Chen, Qiushi; Ayer, Turgay; Chhatwal, Jagpreet

    2017-02-01

    Sequential decision problems are frequently encountered in medical decision making, which are commonly solved using Markov decision processes (MDPs). Modeling guidelines recommend conducting sensitivity analyses in decision-analytic models to assess the robustness of the model results against the uncertainty in model parameters. However, standard methods of conducting sensitivity analyses cannot be directly applied to sequential decision problems because this would require evaluating all possible decision sequences, typically in the order of trillions, which is not practically feasible. As a result, most MDP-based modeling studies do not examine confidence in their recommended policies. In this study, we provide an approach to estimate uncertainty and confidence in the results of sequential decision models. First, we provide a probabilistic univariate method to identify the most sensitive parameters in MDPs. Second, we present a probabilistic multivariate approach to estimate the overall confidence in the recommended optimal policy considering joint uncertainty in the model parameters. We provide a graphical representation, which we call a policy acceptability curve, to summarize the confidence in the optimal policy by incorporating stakeholders' willingness to accept the base case policy. For a cost-effectiveness analysis, we provide an approach to construct a cost-effectiveness acceptability frontier, which shows the most cost-effective policy as well as the confidence in that for a given willingness to pay threshold. We demonstrate our approach using a simple MDP case study. We developed a method to conduct sensitivity analysis in sequential decision models, which could increase the credibility of these models among stakeholders.

  5. Sequential models for coarsening and missingness

    NARCIS (Netherlands)

    Gill, R.D.; Robins, J.M.

    1997-01-01

    In a companion paper we described what intuitively would seem to be the most general possible way to generate Coarsening at Random mechanisms a sequential procedure called randomized monotone coarsening Counterexamples showed that CAR mechanisms exist which cannot be represented in this way Here we

  6. Sequential motor skill: cognition, perception and action

    NARCIS (Netherlands)

    Ruitenberg, M.F.L.

    2013-01-01

    Discrete movement sequences are assumed to be the building blocks of more complex sequential actions that are present in our everyday behavior. The studies presented in this dissertation address the (neuro)cognitive underpinnings of such movement sequences, in particular in relationship to the role

  7. Sequential decoders for large MIMO systems

    KAUST Repository

    Ali, Konpal S.; Abediseid, Walid; Alouini, Mohamed-Slim

    2014-01-01

    the Sequential Decoder using the Fano Algorithm for large MIMO systems. A parameter called the bias is varied to attain different performance-complexity trade-offs. Low values of the bias result in excellent performance but at the expense of high complexity

  8. A framework for sequential multiblock component methods

    NARCIS (Netherlands)

    Smilde, A.K.; Westerhuis, J.A.; Jong, S.de

    2003-01-01

    Multiblock or multiset methods are starting to be used in chemistry and biology to study complex data sets. In chemometrics, sequential multiblock methods are popular; that is, methods that calculate one component at a time and use deflation for finding the next component. In this paper a framework

  9. Classical and sequential limit analysis revisited

    Science.gov (United States)

    Leblond, Jean-Baptiste; Kondo, Djimédo; Morin, Léo; Remmal, Almahdi

    2018-04-01

    Classical limit analysis applies to ideal plastic materials, and within a linearized geometrical framework implying small displacements and strains. Sequential limit analysis was proposed as a heuristic extension to materials exhibiting strain hardening, and within a fully general geometrical framework involving large displacements and strains. The purpose of this paper is to study and clearly state the precise conditions permitting such an extension. This is done by comparing the evolution equations of the full elastic-plastic problem, the equations of classical limit analysis, and those of sequential limit analysis. The main conclusion is that, whereas classical limit analysis applies to materials exhibiting elasticity - in the absence of hardening and within a linearized geometrical framework -, sequential limit analysis, to be applicable, strictly prohibits the presence of elasticity - although it tolerates strain hardening and large displacements and strains. For a given mechanical situation, the relevance of sequential limit analysis therefore essentially depends upon the importance of the elastic-plastic coupling in the specific case considered.

  10. Sequential spatial processes for image analysis

    NARCIS (Netherlands)

    M.N.M. van Lieshout (Marie-Colette); V. Capasso

    2009-01-01

    htmlabstractWe give a brief introduction to sequential spatial processes. We discuss their definition, formulate a Markov property, and indicate why such processes are natural tools in tackling high level vision problems. We focus on the problem of tracking a variable number of moving objects

  11. Sequential spatial processes for image analysis

    NARCIS (Netherlands)

    Lieshout, van M.N.M.; Capasso, V.

    2009-01-01

    We give a brief introduction to sequential spatial processes. We discuss their definition, formulate a Markov property, and indicate why such processes are natural tools in tackling high level vision problems. We focus on the problem of tracking a variable number of moving objects through a video

  12. STABILIZED SEQUENTIAL QUADRATIC PROGRAMMING: A SURVEY

    Directory of Open Access Journals (Sweden)

    Damián Fernández

    2014-12-01

    Full Text Available We review the motivation for, the current state-of-the-art in convergence results, and some open questions concerning the stabilized version of the sequential quadratic programming algorithm for constrained optimization. We also discuss the tools required for its local convergence analysis, globalization challenges, and extentions of the method to the more general variational problems.

  13. Truly costly sequential search and oligopolistic pricing

    NARCIS (Netherlands)

    Janssen, Maarten C W; Moraga-González, José Luis; Wildenbeest, Matthijs R.

    We modify the paper of Stahl (1989) [Stahl, D.O., 1989. Oligopolistic pricing with sequential consumer search. American Economic Review 79, 700-12] by relaxing the assumption that consumers obtain the first price quotation for free. When all price quotations are costly to obtain, the unique

  14. Zips : mining compressing sequential patterns in streams

    NARCIS (Netherlands)

    Hoang, T.L.; Calders, T.G.K.; Yang, J.; Mörchen, F.; Fradkin, D.; Chau, D.H.; Vreeken, J.; Leeuwen, van M.; Faloutsos, C.

    2013-01-01

    We propose a streaming algorithm, based on the minimal description length (MDL) principle, for extracting non-redundant sequential patterns. For static databases, the MDL-based approach that selects patterns based on their capacity to compress data rather than their frequency, was shown to be

  15. How to Read the Tractatus Sequentially

    Directory of Open Access Journals (Sweden)

    Tim Kraft

    2016-11-01

    Full Text Available One of the unconventional features of Wittgenstein’s Tractatus Logico-Philosophicus is its use of an elaborated and detailed numbering system. Recently, Bazzocchi, Hacker und Kuusela have argued that the numbering system means that the Tractatus must be read and interpreted not as a sequentially ordered book, but as a text with a two-dimensional, tree-like structure. Apart from being able to explain how the Tractatus was composed, the tree reading allegedly solves exegetical issues both on the local (e. g. how 4.02 fits into the series of remarks surrounding it and the global level (e. g. relation between ontology and picture theory, solipsism and the eye analogy, resolute and irresolute readings. This paper defends the sequential reading against the tree reading. After presenting the challenges generated by the numbering system and the two accounts as attempts to solve them, it is argued that Wittgenstein’s own explanation of the numbering system, anaphoric references within the Tractatus and the exegetical issues mentioned above do not favour the tree reading, but a version of the sequential reading. This reading maintains that the remarks of the Tractatus form a sequential chain: The role of the numbers is to indicate how remarks on different levels are interconnected to form a concise, surveyable and unified whole.

  16. Adult Word Recognition and Visual Sequential Memory

    Science.gov (United States)

    Holmes, V. M.

    2012-01-01

    Two experiments were conducted investigating the role of visual sequential memory skill in the word recognition efficiency of undergraduate university students. Word recognition was assessed in a lexical decision task using regularly and strangely spelt words, and nonwords that were either standard orthographically legal strings or items made from…

  17. Terminating Sequential Delphi Survey Data Collection

    Science.gov (United States)

    Kalaian, Sema A.; Kasim, Rafa M.

    2012-01-01

    The Delphi survey technique is an iterative mail or electronic (e-mail or web-based) survey method used to obtain agreement or consensus among a group of experts in a specific field on a particular issue through a well-designed and systematic multiple sequential rounds of survey administrations. Each of the multiple rounds of the Delphi survey…

  18. 太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

    Institute of Scientific and Technical Information of China (English)

    王文琴; 张永臣; 贾红玲

    2013-01-01

    目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

  19. Sequential vs simultaneous encoding of spatial information: a comparison between the blind and the sighted.

    Science.gov (United States)

    Ruotolo, Francesco; Ruggiero, Gennaro; Vinciguerra, Michela; Iachini, Tina

    2012-02-01

    The aim of this research is to assess whether the crucial factor in determining the characteristics of blind people's spatial mental images is concerned with the visual impairment per se or the processing style that the dominant perceptual modalities used to acquire spatial information impose, i.e. simultaneous (vision) vs sequential (kinaesthesis). Participants were asked to learn six positions in a large parking area via movement alone (congenitally blind, adventitiously blind, blindfolded sighted) or with vision plus movement (simultaneous sighted, sequential sighted), and then to mentally scan between positions in the path. The crucial manipulation concerned the sequential sighted group. Their visual exploration was made sequential by putting visual obstacles within the pathway in such a way that they could not see simultaneously the positions along the pathway. The results revealed a significant time/distance linear relation in all tested groups. However, the linear component was lower in sequential sighted and blind participants, especially congenital. Sequential sighted and congenitally blind participants showed an almost overlapping performance. Differences between groups became evident when mentally scanning farther distances (more than 5m). This threshold effect could be revealing of processing limitations due to the need of integrating and updating spatial information. Overall, the results suggest that the characteristics of the processing style rather than the visual impairment per se affect blind people's spatial mental images. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. The subtyping of primary aldosteronism by adrenal vein sampling: sequential blood sampling causes factitious lateralization.

    Science.gov (United States)

    Rossitto, Giacomo; Battistel, Michele; Barbiero, Giulio; Bisogni, Valeria; Maiolino, Giuseppe; Diego, Miotto; Seccia, Teresa M; Rossi, Gian Paolo

    2018-02-01

    The pulsatile secretion of adrenocortical hormones and a stress reaction occurring when starting adrenal vein sampling (AVS) can affect the selectivity and also the assessment of lateralization when sequential blood sampling is used. We therefore tested the hypothesis that a simulated sequential blood sampling could decrease the diagnostic accuracy of lateralization index for identification of aldosterone-producing adenoma (APA), as compared with bilaterally simultaneous AVS. In 138 consecutive patients who underwent subtyping of primary aldosteronism, we compared the results obtained simultaneously bilaterally when starting AVS (t-15) and 15 min after (t0), with those gained with a simulated sequential right-to-left AVS technique (R ⇒ L) created by combining hormonal values obtained at t-15 and at t0. The concordance between simultaneously obtained values at t-15 and t0, and between simultaneously obtained values and values gained with a sequential R ⇒ L technique, was also assessed. We found a marked interindividual variability of lateralization index values in the patients with bilaterally selective AVS at both time point. However, overall the lateralization index simultaneously determined at t0 provided a more accurate identification of APA than the simulated sequential lateralization indexR ⇒ L (P = 0.001). Moreover, regardless of which side was sampled first, the sequential AVS technique induced a sequence-dependent overestimation of lateralization index. While in APA patients the concordance between simultaneous AVS at t0 and t-15 and between simultaneous t0 and sequential technique was moderate-to-good (K = 0.55 and 0.66, respectively), in non-APA patients, it was poor (K = 0.12 and 0.13, respectively). Sequential AVS generates factitious between-sides gradients, which lower its diagnostic accuracy, likely because of the stress reaction arising upon starting AVS.

  1. Effects of sequential and discrete rapid naming on reading in Japanese children with reading difficulty.

    Science.gov (United States)

    Wakamiya, Eiji; Okumura, Tomohito; Nakanishi, Makoto; Takeshita, Takashi; Mizuta, Mekumi; Kurimoto, Naoko; Tamai, Hiroshi

    2011-06-01

    To clarify whether rapid naming ability itself is a main underpinning factor of rapid automatized naming tests (RAN) and how deep an influence the discrete decoding process has on reading, we performed discrete naming tasks and discrete hiragana reading tasks as well as sequential naming tasks and sequential hiragana reading tasks with 38 Japanese schoolchildren with reading difficulty. There were high correlations between both discrete and sequential hiragana reading and sentence reading, suggesting that some mechanism which automatizes hiragana reading makes sentence reading fluent. In object and color tasks, there were moderate correlations between sentence reading and sequential naming, and between sequential naming and discrete naming. But no correlation was found between reading tasks and discrete naming tasks. The influence of rapid naming ability of objects and colors upon reading seemed relatively small, and multi-item processing may work in relation to these. In contrast, in the digit naming task there was moderate correlation between sentence reading and discrete naming, while no correlation was seen between sequential naming and discrete naming. There was moderate correlation between reading tasks and sequential digit naming tasks. Digit rapid naming ability has more direct effect on reading while its effect on RAN is relatively limited. The ratio of how rapid naming ability influences RAN and reading seems to vary according to kind of the stimuli used. An assumption about components in RAN which influence reading is discussed in the context of both sequential processing and discrete naming speed. Copyright © 2010 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  2. Alternatives to the sequential lineup: the importance of controlling the pictures.

    Science.gov (United States)

    Lindsay, R C; Bellinger, K

    1999-06-01

    Because sequential lineups reduce false-positive choices, their use has been recommended (R. C. L. Lindsay, 1999; R. C. L. Lindsay & G. L. Wells, 1985). Blind testing is included in the recommended procedures. Police, concerned about blind testing, devised alternative procedures, including self-administered sequential lineups, to reduce use of relative judgments (G. L. Wells, 1984) while permitting the investigating officer to conduct the procedure. Identification data from undergraduates exposed to a staged crime (N = 165) demonstrated that 4 alternative identification procedures tested were less effective than the original sequential lineup. Allowing witnesses to control the photographs resulted in higher rates of false-positive identification. Self-reports of using relative judgments were shown to be postdictive of decision accuracy.

  3. Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

    Science.gov (United States)

    Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

    2017-10-01

    The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

    International Nuclear Information System (INIS)

    Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

    2007-01-01

    Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

  5. Simple tests for CP or P violation by sequential decays: V1V2 modes with decays into l-bar/sub A/l/sub B/ and/or q-bar/sub A/q/sub B/

    International Nuclear Information System (INIS)

    Dell'Aquila, J.R.; Nelson, C.A.

    1986-01-01

    In a phiJ, JJ, or JUPSILON decay channel sin 2phi and/or sin phi terms in the azimuthal distribution would imply that P and CP separately are violated. Similarly in a phiZ 0 , JZ 0 , Z 0 Z 0 , or W + W - decay channel sin 2phi terms would imply that CP is violated. For these latter modes there are several distinct α and γ signatures for CP violation. Analogous signatures for expected P violation occur in a charged phiW +- , JW +- , or Z 0 W +- decay channel. Stronger tests for violations occur when the two vector bosons are identical and the X has odd spin because for J = 1 (>1) there are only two (three) independent amplitudes. For X of spin 0 many signatures and consistency checks are tabulated for (i) the violation of both P invariance and CP invariance in a phirho 0 , phiphi, K/sup asterisk+/K/sup asterisk-/, phiJ, JJ, or JUPSILON decay channel, for (ii) the violation of CP invariance in a phiZ 0 , JZ 0 , Z 0 Z 0 , or W + W - decay channel, and for (iii) the expected violation of P invariance in a charged phiW +- , JW +- , or Z 0 W +- decay channel

  6. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    International Nuclear Information System (INIS)

    Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

    2017-01-01

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  7. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  8. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Energy Technology Data Exchange (ETDEWEB)

    Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

    2017-02-15

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  9. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Directory of Open Access Journals (Sweden)

    Hanna Mazur

    2001-09-01

    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  10. On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

    International Nuclear Information System (INIS)

    Cerrada, Lucia; San Martin, Jesus

    2011-01-01

    In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

  11. Bootstrap Sequential Determination of the Co-integration Rank in VAR Models

    DEFF Research Database (Denmark)

    Guiseppe, Cavaliere; Rahbæk, Anders; Taylor, A.M. Robert

    with empirical rejection frequencies often very much in excess of the nominal level. As a consequence, bootstrap versions of these tests have been developed. To be useful, however, sequential procedures for determining the co-integrating rank based on these bootstrap tests need to be consistent, in the sense...... in the literature by proposing a bootstrap sequential algorithm which we demonstrate delivers consistent cointegration rank estimation for general I(1) processes. Finite sample Monte Carlo simulations show the proposed procedure performs well in practice....

  12. Sequential analysis of materials balances. Application to a prospective reprocessing facility

    International Nuclear Information System (INIS)

    Picard, R.

    1986-01-01

    This paper discusses near-real-time accounting in the context of the prospective DWK reprocessing plant. Sensitivity of a standard sequential testing procedure, applied to unfalsified operator data only, is examined with respect to a variety of loss scenarios. It is seen that large inventories preclude high-probability detection of certain protracted losses of material. In Sec. 2, a rough error propagation for the MBA of interest is outlined. Mathematical development for the analysis is given in Sec. 3, and generic aspects of sequential testing are reviewed in Sec. 4. In Sec. 5, results from a simulation to quantify performance of the accounting system are presented

  13. Impact of Diagrams on Recalling Sequential Elements in Expository Texts.

    Science.gov (United States)

    Guri-Rozenblit, Sarah

    1988-01-01

    Examines the instructional effectiveness of abstract diagrams on recall of sequential relations in social science textbooks. Concludes that diagrams assist significantly the recall of sequential relations in a text and decrease significantly the rate of order mistakes. (RS)

  14. Documentscape: Intertextuality, Sequentiality & Autonomy at Work

    DEFF Research Database (Denmark)

    Christensen, Lars Rune; Bjørn, Pernille

    2014-01-01

    On the basis of an ethnographic field study, this article introduces the concept of documentscape to the analysis of document-centric work practices. The concept of documentscape refers to the entire ensemble of documents in their mutual intertextual interlocking. Providing empirical data from...... a global software development case, we show how hierarchical structures and sequentiality across the interlocked documents are critical to how actors make sense of the work of others and what to do next in a geographically distributed setting. Furthermore, we found that while each document is created...... as part of a quasi-sequential order, this characteristic does not make the document, as a single entity, into a stable object. Instead, we found that the documents were malleable and dynamic while suspended in intertextual structures. Our concept of documentscape points to how the hierarchical structure...

  15. Sequential learning in individuals with agrammatic aphasia: evidence from artificial grammar learning.

    Science.gov (United States)

    Schuchard, Julia; Thompson, Cynthia K

    2017-01-01

    We examined sequential learning in individuals with agrammatic aphasia ( n = 12) and healthy age-matched participants ( n = 12) using an artificial grammar. Artificial grammar acquisition, 24-hour retention, and the potential benefits of additional training were examined by administering an artificial grammar judgment test (1) immediately following auditory exposure-based training, (2) one day after training, and (3) after a second training session on the second day. An untrained control group ( n = 12 healthy age-matched participants) completed the tests on the same time schedule. The trained healthy and aphasic groups showed greater sensitivity to the detection of grammatical items than the control group. No significant correlations between sequential learning and language abilities were observed among the aphasic participants. The results suggest that individuals with agrammatic aphasia show sequential learning, but the underlying processes involved in this learning may be different than for healthy adults.

  16. Sequential pattern recognition by maximum conditional informativity

    Czech Academy of Sciences Publication Activity Database

    Grim, Jiří

    2014-01-01

    Roč. 45, č. 1 (2014), s. 39-45 ISSN 0167-8655 R&D Projects: GA ČR(CZ) GA14-02652S; GA ČR(CZ) GA14-10911S Keywords : Multivariate statistics * Statistical pattern recognition * Sequential decision making * Product mixtures * EM algorithm * Shannon information Subject RIV: IN - Informatics, Computer Sci ence Impact factor: 1.551, year: 2014 http://library.utia.cas.cz/separaty/2014/RO/grim-0428565.pdf

  17. Heat accumulation during sequential cortical bone drilling.

    Science.gov (United States)

    Palmisano, Andrew C; Tai, Bruce L; Belmont, Barry; Irwin, Todd A; Shih, Albert; Holmes, James R

    2016-03-01

    Significant research exists regarding heat production during single-hole bone drilling. No published data exist regarding repetitive sequential drilling. This study elucidates the phenomenon of heat accumulation for sequential drilling with both Kirschner wires (K wires) and standard two-flute twist drills. It was hypothesized that cumulative heat would result in a higher temperature with each subsequent drill pass. Nine holes in a 3 × 3 array were drilled sequentially on moistened cadaveric tibia bone kept at body temperature (about 37 °C). Four thermocouples were placed at the center of four adjacent holes and 2 mm below the surface. A battery-driven hand drill guided by a servo-controlled motion system was used. Six samples were drilled with each tool (2.0 mm K wire and 2.0 and 2.5 mm standard drills). K wire drilling increased temperature from 5 °C at the first hole to 20 °C at holes 6 through 9. A similar trend was found in standard drills with less significant increments. The maximum temperatures of both tools increased from drill sizes was found to be insignificant (P > 0.05). In conclusion, heat accumulated during sequential drilling, with size difference being insignificant. K wire produced more heat than its twist-drill counterparts. This study has demonstrated the heat accumulation phenomenon and its significant effect on temperature. Maximizing the drilling field and reducing the number of drill passes may decrease bone injury. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  18. Sequential Monte Carlo with Highly Informative Observations

    OpenAIRE

    Del Moral, Pierre; Murray, Lawrence M.

    2014-01-01

    We propose sequential Monte Carlo (SMC) methods for sampling the posterior distribution of state-space models under highly informative observation regimes, a situation in which standard SMC methods can perform poorly. A special case is simulating bridges between given initial and final values. The basic idea is to introduce a schedule of intermediate weighting and resampling times between observation times, which guide particles towards the final state. This can always be done for continuous-...

  19. Sequential neural models with stochastic layers

    DEFF Research Database (Denmark)

    Fraccaro, Marco; Sønderby, Søren Kaae; Paquet, Ulrich

    2016-01-01

    How can we efficiently propagate uncertainty in a latent state representation with recurrent neural networks? This paper introduces stochastic recurrent neural networks which glue a deterministic recurrent neural network and a state space model together to form a stochastic and sequential neural...... generative model. The clear separation of deterministic and stochastic layers allows a structured variational inference network to track the factorization of the model's posterior distribution. By retaining both the nonlinear recursive structure of a recurrent neural network and averaging over...

  20. MUSCLE OR MOTIVATION? A STOP SIGNAL STUDY ON THE EFFECTS OF SEQUENTIAL COGNITIVE CONTROL

    Directory of Open Access Journals (Sweden)

    Hilde M. Huizenga

    2012-05-01

    Full Text Available Performance in cognitive control tasks deteriorates when these tasks are performed together with other tasks that also require cognitive control, that is, if simultaneous cognitive control is required. Surprisingly, this decrease in performance is also observed if tasks are preceded by other cognitive control tasks, that is, if sequential cognitive control is required. The common explanation for the latter finding is that previous acts of cognitive control deplete a common resource, just like a muscle becomes fatigued after repeated use. An alternative explanation however has also been put forward, namely that repeated acts of cognitive control reduce the motivation to match allocated resources to required resources. In this paper we formalize these two accounts, the muscle and the motivation account, and show that they yield differential predictions on the interaction between simultaneous and sequential cognitive control. Such an interaction is not predicted by the muscle account, whereas it is predicted by the motivation account.These predictions were tested in a paradigm where participants had to perform a series of stop-signal tasks, these tasks varied both in their demands on simultaneous control and in their demands on sequential control. This paradigm, combined with a multilevel analysis, offered the possibility to test the differential predictions directly. Results of two studies indicate that an interaction between simultaneous and sequential cognitive control is present. Therefore it is concluded that effects of sequential cognitive control are best explained by the motivation account.

  1. TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

    Science.gov (United States)

    Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

    2018-03-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

  2. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Science.gov (United States)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  3. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Science.gov (United States)

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

    2013-04-01

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  4. Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

    Science.gov (United States)

    The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

  5. Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

    Science.gov (United States)

    Sellbom, Martin; Bagby, R. Michael

    2008-01-01

    In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

  6. System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

    International Nuclear Information System (INIS)

    Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

    1998-01-01

    In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

  7. Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

    2014-04-18

    Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

  8. Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

    NARCIS (Netherlands)

    K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

    2016-01-01

    markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

  9. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    International Nuclear Information System (INIS)

    Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-01-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  10. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

    2010-03-15

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  11. Robust Sequential Tests for Memoryless Discrimination From Dependent Observations

    National Research Council Canada - National Science Library

    Geraniotis, Evaggelos

    1991-01-01

    ... over i = 1 is the observation sequence, the coefficients A(bar) and B(bar) are selected so that the normalized drifts of S sub n are antipodal under the two hypotheses, and the nonlinearity g solves a linear integral...

  12. In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

    Science.gov (United States)

    Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

    2013-05-01

    Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

  13. Sequential sampling: a novel method in farm animal welfare assessment.

    Science.gov (United States)

    Heath, C A E; Main, D C J; Mullan, S; Haskell, M J; Browne, W J

    2016-02-01

    Lameness in dairy cows is an important welfare issue. As part of a welfare assessment, herd level lameness prevalence can be estimated from scoring a sample of animals, where higher levels of accuracy are associated with larger sample sizes. As the financial cost is related to the number of cows sampled, smaller samples are preferred. Sequential sampling schemes have been used for informing decision making in clinical trials. Sequential sampling involves taking samples in stages, where sampling can stop early depending on the estimated lameness prevalence. When welfare assessment is used for a pass/fail decision, a similar approach could be applied to reduce the overall sample size. The sampling schemes proposed here apply the principles of sequential sampling within a diagnostic testing framework. This study develops three sequential sampling schemes of increasing complexity to classify 80 fully assessed UK dairy farms, each with known lameness prevalence. Using the Welfare Quality herd-size-based sampling scheme, the first 'basic' scheme involves two sampling events. At the first sampling event half the Welfare Quality sample size is drawn, and then depending on the outcome, sampling either stops or is continued and the same number of animals is sampled again. In the second 'cautious' scheme, an adaptation is made to ensure that correctly classifying a farm as 'bad' is done with greater certainty. The third scheme is the only scheme to go beyond lameness as a binary measure and investigates the potential for increasing accuracy by incorporating the number of severely lame cows into the decision. The three schemes are evaluated with respect to accuracy and average sample size by running 100 000 simulations for each scheme, and a comparison is made with the fixed size Welfare Quality herd-size-based sampling scheme. All three schemes performed almost as well as the fixed size scheme but with much smaller average sample sizes. For the third scheme, an overall

  14. Evidence Based Medicine; Positive and Negative Likelihood Ratios of Diagnostic Tests

    Directory of Open Access Journals (Sweden)

    Alireza Baratloo

    2015-10-01

    Full Text Available In the previous two parts of educational manuscript series in Emergency, we explained some screening characteristics of diagnostic tests including accuracy, sensitivity, specificity, and positive and negative predictive values. In the 3rd  part we aimed to explain positive and negative likelihood ratio (LR as one of the most reliable performance measures of a diagnostic test. To better understand this characteristic of a test, it is first necessary to fully understand the concept of sensitivity and specificity. So we strongly advise you to review the 1st part of this series again. In short, the likelihood ratios are about the percentage of people with and without a disease but having the same test result. The prevalence of a disease can directly influence screening characteristics of a diagnostic test, especially its sensitivity and specificity. Trying to eliminate this effect, LR was developed. Pre-test probability of a disease multiplied by positive or negative LR can estimate post-test probability. Therefore, LR is the most important characteristic of a test to rule out or rule in a diagnosis. A positive likelihood ratio > 1 means higher probability of the disease to be present in a patient with a positive test. The further from 1, either higher or lower, the stronger the evidence to rule in or rule out the disease, respectively. It is obvious that tests with LR close to one are less practical. On the other hand, LR further from one will have more value for application in medicine. Usually tests with 0.1 < LR > 10 are considered suitable for implication in routine practice.

  15. Computerized Classification Testing with the Rasch Model

    Science.gov (United States)

    Eggen, Theo J. H. M.

    2011-01-01

    If classification in a limited number of categories is the purpose of testing, computerized adaptive tests (CATs) with algorithms based on sequential statistical testing perform better than estimation-based CATs (e.g., Eggen & Straetmans, 2000). In these computerized classification tests (CCTs), the Sequential Probability Ratio Test (SPRT) (Wald,…

  16. [Optimization and Prognosis of Cell Radiosensitivity Enhancement in vitro and in vivo after Sequential Thermoradiactive Action].

    Science.gov (United States)

    Belkina, S V; Petin, V G

    2016-01-01

    Previously developed mathematical model of simultaneous action of two inactivating agents has been adapted and tested to describe the results of sequential action. The possibility of applying the mathematical model to the interpretation and prognosis of the increase in radio-sensitivity of tumor cells as well as mammalian cells after sequential action of two high temperatures or hyperthermia and ionizing radiation is analyzed. The model predicts the value of the thermal enhancement ratio depending on the duration of thermal exposure, its greatest value, and the condition under which it is achieved.

  17. Examining Age-Related Movement Representations for Sequential (Fine-Motor) Finger Movements

    Science.gov (United States)

    Gabbard, Carl; Cacola, Priscila; Bobbio, Tatiana

    2011-01-01

    Theory suggests that imagined and executed movement planning relies on internal models for action. Using a chronometry paradigm to compare the movement duration of imagined and executed movements, we tested children aged 7-11 years and adults on their ability to perform sequential finger movements. Underscoring this tactic was our desire to gain a…

  18. Beyond Grand Rounds: A Comprehensive and Sequential Intervention to Improve Identification of Delirium

    Science.gov (United States)

    Ramaswamy, Ravishankar; Dix, Edward F.; Drew, Janet E.; Diamond, James J.; Inouye, Sharon K.; Roehl, Barbara J. O.

    2011-01-01

    Purpose of the Study: Delirium is a widespread concern for hospitalized seniors, yet is often unrecognized. A comprehensive and sequential intervention (CSI) aiming to effect change in clinician behavior by improving knowledge about delirium was tested. Design and Methods: A 2-day CSI program that consisted of progressive 4-part didactic series,…

  19. Tree-Based Global Model Tests for Polytomous Rasch Models

    Science.gov (United States)

    Komboz, Basil; Strobl, Carolin; Zeileis, Achim

    2018-01-01

    Psychometric measurement models are only valid if measurement invariance holds between test takers of different groups. Global model tests, such as the well-established likelihood ratio (LR) test, are sensitive to violations of measurement invariance, such as differential item functioning and differential step functioning. However, these…

  20. Adjuvant chemotherapy with sequential or concurrent anthracycline and docetaxel: Breast International Group 02-98 randomized trial

    DEFF Research Database (Denmark)

    Francis, P.; Crown, J.; Di, Leo A.

    2008-01-01

    BACKGROUND: Docetaxel is more effective than doxorubicin for patients with advanced breast cancer. The Breast International Group 02-98 randomized trial tested the effect of incorporating docetaxel into anthracycline-based adjuvant chemotherapy and compared sequential vs concurrent administration....... However, important differences may be related to doxorubicin and docetaxel scheduling, with sequential but not concurrent administration, appearing to produce better DFS than anthracycline-based chemotherapy Udgivelsesdato: 2008/1/16...

  1. Sequential decoding of intramuscular EMG signals via estimation of a Markov model.

    Science.gov (United States)

    Monsifrot, Jonathan; Le Carpentier, Eric; Aoustin, Yannick; Farina, Dario

    2014-09-01

    This paper addresses the sequential decoding of intramuscular single-channel electromyographic (EMG) signals to extract the activity of individual motor neurons. A hidden Markov model is derived from the physiological generation of the EMG signal. The EMG signal is described as a sum of several action potentials (wavelet) trains, embedded in noise. For each train, the time interval between wavelets is modeled by a process that parameters are linked to the muscular activity. The parameters of this process are estimated sequentially by a Bayes filter, along with the firing instants. The method was tested on some simulated signals and an experimental one, from which the rates of detection and classification of action potentials were above 95% with respect to the reference decomposition. The method works sequentially in time, and is the first to address the problem of intramuscular EMG decomposition online. It has potential applications for man-machine interfacing based on motor neuron activities.

  2. A sequential adaptation technique and its application to the Mark 12 IFF system

    Science.gov (United States)

    Bailey, John S.; Mallett, John D.; Sheppard, Duane J.; Warner, F. Neal; Adams, Robert

    1986-07-01

    Sequential adaptation uses only two sets of receivers, correlators, and A/D converters which are time multiplexed to effect spatial adaptation in a system with (N) adaptive degrees of freedom. This technique can substantially reduce the hardware cost over what is realizable in a parallel architecture. A three channel L-band version of the sequential adapter was built and tested for use with the MARK XII IFF (identify friend or foe) system. In this system the sequentially determined adaptive weights were obtained digitally but implemented at RF. As a result, many of the post RF hardware induced sources of error that normally limit cancellation, such as receiver mismatch, are removed by the feedback property. The result is a system that can yield high levels of cancellation and be readily retrofitted to currently fielded equipment.

  3. Reliability assessment of restructured power systems using reliability network equivalent and pseudo-sequential simulation techniques

    International Nuclear Information System (INIS)

    Ding, Yi; Wang, Peng; Goel, Lalit; Billinton, Roy; Karki, Rajesh

    2007-01-01

    This paper presents a technique to evaluate reliability of a restructured power system with a bilateral market. The proposed technique is based on the combination of the reliability network equivalent and pseudo-sequential simulation approaches. The reliability network equivalent techniques have been implemented in the Monte Carlo simulation procedure to reduce the computational burden of the analysis. Pseudo-sequential simulation has been used to increase the computational efficiency of the non-sequential simulation method and to model the chronological aspects of market trading and system operation. Multi-state Markov models for generation and transmission systems are proposed and implemented in the simulation. A new load shedding scheme is proposed during generation inadequacy and network congestion to minimize the load curtailment. The IEEE reliability test system (RTS) is used to illustrate the technique. (author)

  4. Physics-based, Bayesian sequential detection method and system for radioactive contraband

    Science.gov (United States)

    Candy, James V; Axelrod, Michael C; Breitfeller, Eric F; Chambers, David H; Guidry, Brian L; Manatt, Douglas R; Meyer, Alan W; Sale, Kenneth E

    2014-03-18

    A distributed sequential method and system for detecting and identifying radioactive contraband from highly uncertain (noisy) low-count, radionuclide measurements, i.e. an event mode sequence (EMS), using a statistical approach based on Bayesian inference and physics-model-based signal processing based on the representation of a radionuclide as a monoenergetic decomposition of monoenergetic sources. For a given photon event of the EMS, the appropriate monoenergy processing channel is determined using a confidence interval condition-based discriminator for the energy amplitude and interarrival time and parameter estimates are used to update a measured probability density function estimate for a target radionuclide. A sequential likelihood ratio test is then used to determine one of two threshold conditions signifying that the EMS is either identified as the target radionuclide or not, and if not, then repeating the process for the next sequential photon event of the EMS until one of the two threshold conditions is satisfied.

  5. Decoding restricted participation in sequential electricity markets

    Energy Technology Data Exchange (ETDEWEB)

    Knaut, Andreas; Paschmann, Martin

    2017-06-15

    Restricted participation in sequential markets may cause high price volatility and welfare losses. In this paper we therefore analyze the drivers of restricted participation in the German intraday auction which is a short-term electricity market with quarter-hourly products. Applying a fundamental electricity market model with 15-minute temporal resolution, we identify the lack of sub-hourly market coupling being the most relevant driver of restricted participation. We derive a proxy for price volatility and find that full market coupling may trigger quarter-hourly price volatility to decrease by a factor close to four.

  6. THE DEVELOPMENT OF SPECIAL SEQUENTIALLY-TIMED

    Directory of Open Access Journals (Sweden)

    Stanislav LICHOROBIEC

    2016-06-01

    Full Text Available This article documents the development of the noninvasive use of explosives during the destruction of ice mass in river flows. The system of special sequentially-timed charges utilizes the increase in efficiency of cutting charges by covering them with bags filled with water, while simultaneously increasing the effect of the entire system of timed charges. Timing, spatial combinations during placement, and the linking of these charges results in the loosening of ice barriers on a frozen waterway, while at the same time regulating the size of the ice fragments. The developed charges will increase the operability and safety of IRS units.

  7. Pass-transistor asynchronous sequential circuits

    Science.gov (United States)

    Whitaker, Sterling R.; Maki, Gary K.

    1989-01-01

    Design methods for asynchronous sequential pass-transistor circuits, which result in circuits that are hazard- and critical-race-free and which have added degrees of freedom for the input signals, are discussed. The design procedures are straightforward and easy to implement. Two single-transition-time state assignment methods are presented, and hardware bounds for each are established. A surprising result is that the hardware realizations for each next state variable and output variable is identical for a given flow table. Thus, a state machine with N states and M outputs can be constructed using a single layout replicated N + M times.

  8. Estimation After a Group Sequential Trial.

    Science.gov (United States)

    Milanzi, Elasma; Molenberghs, Geert; Alonso, Ariel; Kenward, Michael G; Tsiatis, Anastasios A; Davidian, Marie; Verbeke, Geert

    2015-10-01

    Group sequential trials are one important instance of studies for which the sample size is not fixed a priori but rather takes one of a finite set of pre-specified values, dependent on the observed data. Much work has been devoted to the inferential consequences of this design feature. Molenberghs et al (2012) and Milanzi et al (2012) reviewed and extended the existing literature, focusing on a collection of seemingly disparate, but related, settings, namely completely random sample sizes, group sequential studies with deterministic and random stopping rules, incomplete data, and random cluster sizes. They showed that the ordinary sample average is a viable option for estimation following a group sequential trial, for a wide class of stopping rules and for random outcomes with a distribution in the exponential family. Their results are somewhat surprising in the sense that the sample average is not optimal, and further, there does not exist an optimal, or even, unbiased linear estimator. However, the sample average is asymptotically unbiased, both conditionally upon the observed sample size as well as marginalized over it. By exploiting ignorability they showed that the sample average is the conventional maximum likelihood estimator. They also showed that a conditional maximum likelihood estimator is finite sample unbiased, but is less efficient than the sample average and has the larger mean squared error. Asymptotically, the sample average and the conditional maximum likelihood estimator are equivalent. This previous work is restricted, however, to the situation in which the the random sample size can take only two values, N = n or N = 2 n . In this paper, we consider the more practically useful setting of sample sizes in a the finite set { n 1 , n 2 , …, n L }. It is shown that the sample average is then a justifiable estimator , in the sense that it follows from joint likelihood estimation, and it is consistent and asymptotically unbiased. We also show why

  9. A sequential/parallel track selector

    CERN Document Server

    Bertolino, F; Bressani, Tullio; Chiavassa, E; Costa, S; Dellacasa, G; Gallio, M; Musso, A

    1980-01-01

    A medium speed ( approximately 1 mu s) hardware pre-analyzer for the selection of events detected in four planes of drift chambers in the magnetic field of the Omicron Spectrometer at the CERN SC is described. Specific geometrical criteria determine patterns of hits in the four planes of vertical wires that have to be recognized and that are stored as patterns of '1's in random access memories. Pairs of good hits are found sequentially, then the RAMs are used as look-up tables. (6 refs).

  10. Boundary conditions in random sequential adsorption

    Science.gov (United States)

    Cieśla, Michał; Ziff, Robert M.

    2018-04-01

    The influence of different boundary conditions on the density of random packings of disks is studied. Packings are generated using the random sequential adsorption algorithm with three different types of boundary conditions: periodic, open, and wall. It is found that the finite size effects are smallest for periodic boundary conditions, as expected. On the other hand, in the case of open and wall boundaries it is possible to introduce an effective packing size and a constant correction term to significantly improve the packing densities.

  11. Automatic synthesis of sequential control schemes

    International Nuclear Information System (INIS)

    Klein, I.

    1993-01-01

    Of all hard- and software developed for industrial control purposes, the majority is devoted to sequential, or binary valued, control and only a minor part to classical linear control. Typically, the sequential parts of the controller are invoked during startup and shut-down to bring the system into its normal operating region and into some safe standby region, respectively. Despite its importance, fairly little theoretical research has been devoted to this area, and sequential control programs are therefore still created manually without much theoretical support to obtain a systematic approach. We propose a method to create sequential control programs automatically. The main ideas is to spend some effort off-line modelling the plant, and from this model generate the control strategy, that is the plan. The plant is modelled using action structures, thereby concentrating on the actions instead of the states of the plant. In general the planning problem shows exponential complexity in the number of state variables. However, by focusing on the actions, we can identify problem classes as well as algorithms such that the planning complexity is reduced to polynomial complexity. We prove that these algorithms are sound, i.e., the generated solution will solve the stated problem, and complete, i.e., if the algorithms fail, then no solution exists. The algorithms generate a plan as a set of actions and a partial order on this set specifying the execution order. The generated plant is proven to be minimal and maximally parallel. For a larger class of problems we propose a method to split the original problem into a number of simple problems that can each be solved using one of the presented algorithms. It is also shown how a plan can be translated into a GRAFCET chart, and to illustrate these ideas we have implemented a planing tool, i.e., a system that is able to automatically create control schemes. Such a tool can of course also be used on-line if it is fast enough. This

  12. From sequential to parallel programming with patterns

    CERN Document Server

    CERN. Geneva

    2018-01-01

    To increase in both performance and efficiency, our programming models need to adapt to better exploit modern processors. The classic idioms and patterns for programming such as loops, branches or recursion are the pillars of almost every code and are well known among all programmers. These patterns all have in common that they are sequential in nature. Embracing parallel programming patterns, which allow us to program for multi- and many-core hardware in a natural way, greatly simplifies the task of designing a program that scales and performs on modern hardware, independently of the used programming language, and in a generic way.

  13. Sequential extraction of uranium metal contamination

    International Nuclear Information System (INIS)

    Murry, M.M.; Spitz, H.B.; Connick, W.B.

    2016-01-01

    Samples of uranium contaminated dirt collected from the dirt floor of an abandoned metal rolling mill were analyzed for uranium using a sequential extraction protocol involving a series of five increasingly aggressive solvents. The quantity of uranium extracted from the contaminated dirt by each reagent can aid in predicting the fate and transport of the uranium contamination in the environment. Uranium was separated from each fraction using anion exchange, electrodeposition and analyzed by alpha spectroscopy analysis. Results demonstrate that approximately 77 % of the uranium was extracted using NH 4 Ac in 25 % acetic acid. (author)

  14. Simultaneous optimization of sequential IMRT plans

    International Nuclear Information System (INIS)

    Popple, Richard A.; Prellop, Perri B.; Spencer, Sharon A.; Santos, Jennifer F. de los; Duan, Jun; Fiveash, John B.; Brezovich, Ivan A.

    2005-01-01

    Radiotherapy often comprises two phases, in which irradiation of a volume at risk for microscopic disease is followed by a sequential dose escalation to a smaller volume either at a higher risk for microscopic disease or containing only gross disease. This technique is difficult to implement with intensity modulated radiotherapy, as the tolerance doses of critical structures must be respected over the sum of the two plans. Techniques that include an integrated boost have been proposed to address this problem. However, clinical experience with such techniques is limited, and many clinicians are uncomfortable prescribing nonconventional fractionation schemes. To solve this problem, we developed an optimization technique that simultaneously generates sequential initial and boost IMRT plans. We have developed an optimization tool that uses a commercial treatment planning system (TPS) and a high level programming language for technical computing. The tool uses the TPS to calculate the dose deposition coefficients (DDCs) for optimization. The DDCs were imported into external software and the treatment ports duplicated to create the boost plan. The initial, boost, and tolerance doses were specified and used to construct cost functions. The initial and boost plans were optimized simultaneously using a gradient search technique. Following optimization, the fluence maps were exported to the TPS for dose calculation. Seven patients treated using sequential techniques were selected from our clinical database. The initial and boost plans used to treat these patients were developed independently of each other by dividing the tolerance doses proportionally between the initial and boost plans and then iteratively optimizing the plans until a summation that met the treatment goals was obtained. We used the simultaneous optimization technique to generate plans that met the original planning goals. The coverage of the initial and boost target volumes in the simultaneously optimized

  15. Relationship of physical examination test of shoulder instability to arthroscopic findings in dogs.

    Science.gov (United States)

    Devitt, Chad M; Neely, Marlon R; Vanvechten, Brian J

    2007-10-01

    To determine the diagnostic validity of commonly used physical examination maneuvers for shoulder instability. Retrospective study. Dogs (n=24) referred for shoulder arthroscopy. Results of physical maneuvers and arthroscopic findings were recorded and sensitivity, specificity, positive likelihood ratios (LR+), and negative likelihood ratios (LR-) were calculated for each of 4 physical examination test findings for arthroscopic changes in the medial, lateral, cranial, or caudal compartments of the shoulder joint viewed in dorsal recumbency by lateral and craniomedial portals. Distribution of compartment changes was: medial (17 dogs), caudal (15), cranial (12), and lateral (5). The biceps test had a moderate effect (LR+=9) on post-test probability of cranial compartment changes and a small effect on post-test probability of lateral and caudal compartment changes (LR+=3 and 2.4, respectively). Hyperabduction had a minimal effect and mediolateral instability test had a small effect (LR+=1.64 and 2.68, respectively) on post-test probability of medial compartment changes. Craniocaudal instability test had little to no effect on post-test probability of changes in any compartment. Physical examination tests evaluated were limited in their ability to predict the type of arthroscopic pathology in this study population. Clinicians should understand that a diagnostic test performs inconsistently based on prevalence of a condition in a given patient population. The use of likelihood ratios can assist clinicians in determining the probability of intraarticular changes from a group with a differing prevalence than the patient population presented.

  16. Modeling sequential context effects in diagnostic interpretation of screening mammograms.

    Science.gov (United States)

    Alamudun, Folami; Paulus, Paige; Yoon, Hong-Jun; Tourassi, Georgia

    2018-07-01

    Prior research has shown that physicians' medical decisions can be influenced by sequential context, particularly in cases where successive stimuli exhibit similar characteristics when analyzing medical images. This type of systematic error is known to psychophysicists as sequential context effect as it indicates that judgments are influenced by features of and decisions about the preceding case in the sequence of examined cases, rather than being based solely on the peculiarities unique to the present case. We determine if radiologists experience some form of context bias, using screening mammography as the use case. To this end, we explore correlations between previous perceptual behavior and diagnostic decisions and current decisions. We hypothesize that a radiologist's visual search pattern and diagnostic decisions in previous cases are predictive of the radiologist's current diagnostic decisions. To test our hypothesis, we tasked 10 radiologists of varied experience to conduct blind reviews of 100 four-view screening mammograms. Eye-tracking data and diagnostic decisions were collected from each radiologist under conditions mimicking clinical practice. Perceptual behavior was quantified using the fractal dimension of gaze scanpath, which was computed using the Minkowski-Bouligand box-counting method. To test the effect of previous behavior and decisions, we conducted a multifactor fixed-effects ANOVA. Further, to examine the predictive value of previous perceptual behavior and decisions, we trained and evaluated a predictive model for radiologists' current diagnostic decisions. ANOVA tests showed that previous visual behavior, characterized by fractal analysis, previous diagnostic decisions, and image characteristics of previous cases are significant predictors of current diagnostic decisions. Additionally, predictive modeling of diagnostic decisions showed an overall improvement in prediction error when the model is trained on additional information about

  17. Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

    Science.gov (United States)

    Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

    2015-02-01

    The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

  18. Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

    Science.gov (United States)

    Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

    2017-12-01

    The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

  19. Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

    Directory of Open Access Journals (Sweden)

    Maya Safira Dewi

    2011-05-01

    Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

  20. Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

    International Nuclear Information System (INIS)

    Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

    2016-01-01

    Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

  1. Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

    International Nuclear Information System (INIS)

    Agba, Dabo Salif Ignace

    2011-02-01

    Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

  2. Comparison of Sequential and Variational Data Assimilation

    Science.gov (United States)

    Alvarado Montero, Rodolfo; Schwanenberg, Dirk; Weerts, Albrecht

    2017-04-01

    Data assimilation is a valuable tool to improve model state estimates by combining measured observations with model simulations. It has recently gained significant attention due to its potential in using remote sensing products to improve operational hydrological forecasts and for reanalysis purposes. This has been supported by the application of sequential techniques such as the Ensemble Kalman Filter which require no additional features within the modeling process, i.e. it can use arbitrary black-box models. Alternatively, variational techniques rely on optimization algorithms to minimize a pre-defined objective function. This function describes the trade-off between the amount of noise introduced into the system and the mismatch between simulated and observed variables. While sequential techniques have been commonly applied to hydrological processes, variational techniques are seldom used. In our believe, this is mainly attributed to the required computation of first order sensitivities by algorithmic differentiation techniques and related model enhancements, but also to lack of comparison between both techniques. We contribute to filling this gap and present the results from the assimilation of streamflow data in two basins located in Germany and Canada. The assimilation introduces noise to precipitation and temperature to produce better initial estimates of an HBV model. The results are computed for a hindcast period and assessed using lead time performance metrics. The study concludes with a discussion of the main features of each technique and their advantages/disadvantages in hydrological applications.

  3. Time scale of random sequential adsorption.

    Science.gov (United States)

    Erban, Radek; Chapman, S Jonathan

    2007-04-01

    A simple multiscale approach to the diffusion-driven adsorption from a solution to a solid surface is presented. The model combines two important features of the adsorption process: (i) The kinetics of the chemical reaction between adsorbing molecules and the surface and (ii) geometrical constraints on the surface made by molecules which are already adsorbed. The process (i) is modeled in a diffusion-driven context, i.e., the conditional probability of adsorbing a molecule provided that the molecule hits the surface is related to the macroscopic surface reaction rate. The geometrical constraint (ii) is modeled using random sequential adsorption (RSA), which is the sequential addition of molecules at random positions on a surface; one attempt to attach a molecule is made per one RSA simulation time step. By coupling RSA with the diffusion of molecules in the solution above the surface the RSA simulation time step is related to the real physical time. The method is illustrated on a model of chemisorption of reactive polymers to a virus surface.

  4. Critical Role of Endoplasmic Reticulum Stress in Cognitive Impairment Induced by Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Fei Cai

    2015-11-01

    Full Text Available Recent studies showed that cyanobacteria-derived microcystin-leucine-arginine (MCLR can cause hippocampal pathological damage and trigger cognitive impairment; but the underlying mechanisms have not been well understood. The objective of the present study was to investigate the mechanism of MCLR-induced cognitive deficit; with a focus on endoplasmic reticulum (ER stress. The Morris water maze test and electrophysiological study demonstrated that MCLR caused spatial memory injury in male Wistar rats; which could be inhibited by ER stress blocker; tauroursodeoxycholic acid (TUDCA. Meanwhile; real-time polymerase chain reaction (real-time PCR and immunohistochemistry demonstrated that the expression level of the 78-kDa glucose-regulated protein (GRP78; C/EBP homologous protein (CHOP and caspase 12 were significantly up-regulated. These effects were rescued by co-administration of TUDCA. In agreement with this; we also observed that treatment of rats with TUDCA blocked the alterations in ER ultrastructure and apoptotic cell death in CA1 neurons from rats exposed to MCLR. Taken together; the present results suggested that ER stress plays an important role in potential memory impairments in rats treated with MCLR; and amelioration of ER stress may serve as a novel strategy to alleviate damaged cognitive function triggered by MCLR.

  5. Sequential Service Restoration for Unbalanced Distribution Systems and Microgrids

    International Nuclear Information System (INIS)

    Chen, Bo; Chen, Chen; Wang, Jianhui; Butler-Purry, Karen L.

    2017-01-01

    The resilience and reliability of modern power systems are threatened by increasingly severe weather events and cyber-physical security events. An effective restoration methodology is desired to optimally integrate emerging smart grid technologies and pave the way for developing self-healing smart grids. In this paper, a sequential service restoration (SSR) framework is proposed to generate restoration solutions for distribution systems and microgrids in the event of large-scale power outages. The restoration solution contains a sequence of control actions that properly coordinate switches, distributed generators, and switchable loads to form multiple isolated microgrids. The SSR can be applied for three-phase unbalanced distribution systems and microgrids and can adapt to various operation conditions. Mathematical models are introduced for three-phase unbalanced power flow, voltage regulators, transformers, and loads. Furthermore, the SSR problem is formulated as a mixed-integer linear programming model, and its effectiveness is evaluated via the modified IEEE 123 node test feeder.

  6. Test

    DEFF Research Database (Denmark)

    Bendixen, Carsten

    2014-01-01

    Bidrag med en kortfattet, introducerende, perspektiverende og begrebsafklarende fremstilling af begrebet test i det pædagogiske univers.......Bidrag med en kortfattet, introducerende, perspektiverende og begrebsafklarende fremstilling af begrebet test i det pædagogiske univers....

  7. Anatomy of a defective barrier: sequential glove leak detection in a surgical and dental environment.

    Science.gov (United States)

    Albin, M S; Bunegin, L; Duke, E S; Ritter, R R; Page, C P

    1992-02-01

    a) To determine the frequency of perforations in latex surgical gloves before, during, and after surgical and dental procedures; b) to evaluate the topographical distribution of perforations in latex surgical gloves after surgical and dental procedures; and c) to validate methods of testing for latex surgical glove patency. Multitrial tests under in vitro conditions and a prospective sequential patient study using consecutive testing. An outpatient dental clinic at a university dental school, the operating suite in a medical school affiliated with the Veteran's Hospital, and a biomechanics laboratory. Surgeons, scrub nurses, and dental technicians participating in 50 surgical and 50 dental procedures. We collected 679 latex surgical gloves after surgical procedures and tested them for patency by using a water pressure test. We also employed an electronic glove leak detector before donning, after sequential time intervals, and upon termination of 47 surgical (sequential surgical), 50 dental (sequential dental), and in three orthopedic cases where double gloving was used. The electronic glove leak detector was validated by using electronic point-by-point surface probing, fluorescein dye diffusion, as well as detecting glove punctures made with a 27-gauge needle. The random study indicated a leak rate of 33.0% (224 out of 679) in latex surgical gloves; the sequential surgical study demonstrated patency in 203 out of 347 gloves (58.5%); the sequential dental study showed 34 leaks in the 106 gloves used (32.1%); and with double gloving, the leak rate decreased to 25.0% (13 of 52 gloves tested). While the allowable FDA defect rate for unused latex surgical gloves is 1.5%, we noted defect rates in unused gloves of 5.5% in the sequential surgical, 1.9% in the sequential dental, and 4.0% in our electronic glove leak detector validating study. In the sequential surgical study, 52% of the leaks had occurred by 75 mins, and in the sequential dental study, 75% of the leaks

  8. Equivalence between quantum simultaneous games and quantum sequential games

    OpenAIRE

    Kobayashi, Naoki

    2007-01-01

    A framework for discussing relationships between different types of games is proposed. Within the framework, quantum simultaneous games, finite quantum simultaneous games, quantum sequential games, and finite quantum sequential games are defined. In addition, a notion of equivalence between two games is defined. Finally, the following three theorems are shown: (1) For any quantum simultaneous game G, there exists a quantum sequential game equivalent to G. (2) For any finite quantum simultaneo...

  9. Discrimination between sequential and simultaneous virtual channels with electrical hearing

    OpenAIRE

    Landsberger, David; Galvin, John J.

    2011-01-01

    In cochlear implants (CIs), simultaneous or sequential stimulation of adjacent electrodes can produce intermediate pitch percepts between those of the component electrodes. However, it is unclear whether simultaneous and sequential virtual channels (VCs) can be discriminated. In this study, CI users were asked to discriminate simultaneous and sequential VCs; discrimination was measured for monopolar (MP) and bipolar + 1 stimulation (BP + 1), i.e., relatively broad and focused stimulation mode...

  10. C-quence: a tool for analyzing qualitative sequential data.

    Science.gov (United States)

    Duncan, Starkey; Collier, Nicholson T

    2002-02-01

    C-quence is a software application that matches sequential patterns of qualitative data specified by the user and calculates the rate of occurrence of these patterns in a data set. Although it was designed to facilitate analyses of face-to-face interaction, it is applicable to any data set involving categorical data and sequential information. C-quence queries are constructed using a graphical user interface. The program does not limit the complexity of the sequential patterns specified by the user.

  11. Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

    Directory of Open Access Journals (Sweden)

    Vanessa de Farias

    2009-06-01

    Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

  12. Discrimination between sequential and simultaneous virtual channels with electrical hearing.

    Science.gov (United States)

    Landsberger, David; Galvin, John J

    2011-09-01

    In cochlear implants (CIs), simultaneous or sequential stimulation of adjacent electrodes can produce intermediate pitch percepts between those of the component electrodes. However, it is unclear whether simultaneous and sequential virtual channels (VCs) can be discriminated. In this study, CI users were asked to discriminate simultaneous and sequential VCs; discrimination was measured for monopolar (MP) and bipolar + 1 stimulation (BP + 1), i.e., relatively broad and focused stimulation modes. For sequential VCs, the interpulse interval (IPI) varied between 0.0 and 1.8 ms. All stimuli were presented at comfortably loud, loudness-balanced levels at a 250 pulse per second per electrode (ppse) stimulation rate. On average, CI subjects were able to reliably discriminate between sequential and simultaneous VCs. While there was no significant effect of IPI or stimulation mode on VC discrimination, some subjects exhibited better VC discrimination with BP + 1 stimulation. Subjects' discrimination between sequential and simultaneous VCs was correlated with electrode discrimination, suggesting that spatial selectivity may influence perception of sequential VCs. To maintain equal loudness, sequential VC amplitudes were nearly double those of simultaneous VCs, presumably resulting in a broader spread of excitation. These results suggest that perceptual differences between simultaneous and sequential VCs might be explained by differences in the spread of excitation. © 2011 Acoustical Society of America

  13. Lineup composition, suspect position, and the sequential lineup advantage.

    Science.gov (United States)

    Carlson, Curt A; Gronlund, Scott D; Clark, Steven E

    2008-06-01

    N. M. Steblay, J. Dysart, S. Fulero, and R. C. L. Lindsay (2001) argued that sequential lineups reduce the likelihood of mistaken eyewitness identification. Experiment 1 replicated the design of R. C. L. Lindsay and G. L. Wells (1985), the first study to show the sequential lineup advantage. However, the innocent suspect was chosen at a lower rate in the simultaneous lineup, and no sequential lineup advantage was found. This led the authors to hypothesize that protection from a sequential lineup might emerge only when an innocent suspect stands out from the other lineup members. In Experiment 2, participants viewed a simultaneous or sequential lineup with either the guilty suspect or 1 of 3 innocent suspects. Lineup fairness was varied to influence the degree to which a suspect stood out. A sequential lineup advantage was found only for the unfair lineups. Additional analyses of suspect position in the sequential lineups showed an increase in the diagnosticity of suspect identifications as the suspect was placed later in the sequential lineup. These results suggest that the sequential lineup advantage is dependent on lineup composition and suspect position. (c) 2008 APA, all rights reserved

  14. Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

    International Nuclear Information System (INIS)

    Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

    1987-01-01

    The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

  15. Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

    International Nuclear Information System (INIS)

    Vallejo Delgado, L.R.

    1989-01-01

    This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

  16. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Directory of Open Access Journals (Sweden)

    Košťál Michal

    2016-01-01

    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  17. Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Julin Yuan

    2015-10-01

    Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

  18. Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

    OpenAIRE

    Jacobs, Loraine Cristina do Valle

    2011-01-01

    Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

  19. siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

    Science.gov (United States)

    Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

    2018-07-01

    The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

  20. Sequential infiltration synthesis for advanced lithography

    Energy Technology Data Exchange (ETDEWEB)

    Darling, Seth B.; Elam, Jeffrey W.; Tseng, Yu-Chih; Peng, Qing

    2017-10-10

    A plasma etch resist material modified by an inorganic protective component via sequential infiltration synthesis (SIS) and methods of preparing the modified resist material. The modified resist material is characterized by an improved resistance to a plasma etching or related process relative to the unmodified resist material, thereby allowing formation of patterned features into a substrate material, which may be high-aspect ratio features. The SIS process forms the protective component within the bulk resist material through a plurality of alternating exposures to gas phase precursors which infiltrate the resist material. The plasma etch resist material may be initially patterned using photolithography, electron-beam lithography or a block copolymer self-assembly process.

  1. Clinical evaluation of synthetic aperture sequential beamforming

    DEFF Research Database (Denmark)

    Hansen, Peter Møller; Hemmsen, Martin Christian; Lange, Theis

    2012-01-01

    In this study clinically relevant ultrasound images generated with synthetic aperture sequential beamforming (SASB) is compared to images generated with a conventional technique. The advantage of SASB is the ability to produce high resolution ultrasound images with a high frame rate and at the same...... time massively reduce the amount of generated data. SASB was implemented in a system consisting of a conventional ultrasound scanner connected to a PC via a research interface. This setup enables simultaneous recording with both SASB and conventional technique. Eighteen volunteers were ultrasound...... scanned abdominally, and 84 sequence pairs were recorded. Each sequence pair consists of two simultaneous recordings of the same anatomical location with SASB and conventional B-mode imaging. The images were evaluated in terms of spatial resolution, contrast, unwanted artifacts, and penetration depth...

  2. Sequential cooling insert for turbine stator vane

    Science.gov (United States)

    Jones, Russel B

    2017-04-04

    A sequential flow cooling insert for a turbine stator vane of a small gas turbine engine, where the impingement cooling insert is formed as a single piece from a metal additive manufacturing process such as 3D metal printing, and where the insert includes a plurality of rows of radial extending impingement cooling air holes alternating with rows of radial extending return air holes on a pressure side wall, and where the insert includes a plurality of rows of chordwise extending second impingement cooling air holes on a suction side wall. The insert includes alternating rows of radial extending cooling air supply channels and return air channels that form a series of impingement cooling on the pressure side followed by the suction side of the insert.

  3. Gleason-Busch theorem for sequential measurements

    Science.gov (United States)

    Flatt, Kieran; Barnett, Stephen M.; Croke, Sarah

    2017-12-01

    Gleason's theorem is a statement that, given some reasonable assumptions, the Born rule used to calculate probabilities in quantum mechanics is essentially unique [A. M. Gleason, Indiana Univ. Math. J. 6, 885 (1957), 10.1512/iumj.1957.6.56050]. We show that Gleason's theorem contains within it also the structure of sequential measurements, and along with this the state update rule. We give a small set of axioms, which are physically motivated and analogous to those in Busch's proof of Gleason's theorem [P. Busch, Phys. Rev. Lett. 91, 120403 (2003), 10.1103/PhysRevLett.91.120403], from which the familiar Kraus operator form follows. An axiomatic approach has practical relevance as well as fundamental interest, in making clear those assumptions which underlie the security of quantum communication protocols. Interestingly, the two-time formalism is seen to arise naturally in this approach.

  4. Multilevel sequential Monte-Carlo samplers

    KAUST Repository

    Jasra, Ajay

    2016-01-01

    Multilevel Monte-Carlo methods provide a powerful computational technique for reducing the computational cost of estimating expectations for a given computational effort. They are particularly relevant for computational problems when approximate distributions are determined via a resolution parameter h, with h=0 giving the theoretical exact distribution (e.g. SDEs or inverse problems with PDEs). The method provides a benefit by coupling samples from successive resolutions, and estimating differences of successive expectations. We develop a methodology that brings Sequential Monte-Carlo (SMC) algorithms within the framework of the Multilevel idea, as SMC provides a natural set-up for coupling samples over different resolutions. We prove that the new algorithm indeed preserves the benefits of the multilevel principle, even if samples at all resolutions are now correlated.

  5. Sequential Stereotype Priming: A Meta-Analysis.

    Science.gov (United States)

    Kidder, Ciara K; White, Katherine R; Hinojos, Michelle R; Sandoval, Mayra; Crites, Stephen L

    2017-08-01

    Psychological interest in stereotype measurement has spanned nearly a century, with researchers adopting implicit measures in the 1980s to complement explicit measures. One of the most frequently used implicit measures of stereotypes is the sequential priming paradigm. The current meta-analysis examines stereotype priming, focusing specifically on this paradigm. To contribute to ongoing discussions regarding methodological rigor in social psychology, one primary goal was to identify methodological moderators of the stereotype priming effect-whether priming is due to a relation between the prime and target stimuli, the prime and target response, participant task, stereotype dimension, stimulus onset asynchrony (SOA), and stimuli type. Data from 39 studies yielded 87 individual effect sizes from 5,497 participants. Analyses revealed that stereotype priming is significantly moderated by the presence of prime-response relations, participant task, stereotype dimension, target stimulus type, SOA, and prime repetition. These results carry both practical and theoretical implications for future research on stereotype priming.

  6. Sequential Acral Lentiginous Melanomas of the Foot

    Directory of Open Access Journals (Sweden)

    Jiro Uehara

    2010-12-01

    Full Text Available A 64-year-old Japanese woman had a lightly brown-blackish pigmented macule (1.2 cm in diameter on the left sole of her foot. She received surgical excision following a diagnosis of acral lentiginous melanoma (ALM, which was confirmed histopathologically. One month after the operation, a second melanoma lesion was noticed adjacent to the grafted site. Histopathologically, the two lesions had no continuity, but HMB-45 and cyclin D1 double-positive cells were detected not only on aggregates of atypical melanocytes but also on single cells near the cutting edge of the first lesion. The unique occurrence of a sequential lesion of a primary melanoma might be caused by stimulated subclinical field cells during the wound healing process following the initial operation. This case warrants further investigation to establish the appropriate surgical margin of ALM lesions.

  7. Dancing Twins: Stellar Hierarchies That Formed Sequentially?

    Science.gov (United States)

    Tokovinin, Andrei

    2018-04-01

    This paper draws attention to the class of resolved triple stars with moderate ratios of inner and outer periods (possibly in a mean motion resonance) and nearly circular, mutually aligned orbits. Moreover, stars in the inner pair are twins with almost identical masses, while the mass sum of the inner pair is comparable to the mass of the outer component. Such systems could be formed either sequentially (inside-out) by disk fragmentation with subsequent accretion and migration, or by a cascade hierarchical fragmentation of a rotating cloud. Orbits of the outer and inner subsystems are computed or updated in four such hierarchies: LHS 1070 (GJ 2005, periods 77.6 and 17.25 years), HIP 9497 (80 and 14.4 years), HIP 25240 (1200 and 47.0 years), and HIP 78842 (131 and 10.5 years).

  8. Multilevel sequential Monte-Carlo samplers

    KAUST Repository

    Jasra, Ajay

    2016-01-05

    Multilevel Monte-Carlo methods provide a powerful computational technique for reducing the computational cost of estimating expectations for a given computational effort. They are particularly relevant for computational problems when approximate distributions are determined via a resolution parameter h, with h=0 giving the theoretical exact distribution (e.g. SDEs or inverse problems with PDEs). The method provides a benefit by coupling samples from successive resolutions, and estimating differences of successive expectations. We develop a methodology that brings Sequential Monte-Carlo (SMC) algorithms within the framework of the Multilevel idea, as SMC provides a natural set-up for coupling samples over different resolutions. We prove that the new algorithm indeed preserves the benefits of the multilevel principle, even if samples at all resolutions are now correlated.

  9. Sequential Therapy in Metastatic Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Bradford R Hirsch

    2016-04-01

    Full Text Available The treatment of metastatic renal cell carcinoma (mRCC has changed dramatically in the past decade. As the number of available agents, and related volume of research, has grown, it is increasingly complex to know how to optimally treat patients. The authors are practicing medical oncologists at the US Oncology Network, the largest community-based network of oncology providers in the country, and represent the leadership of the Network's Genitourinary Research Committee. We outline our thought process in approaching sequential therapy of mRCC and the use of real-world data to inform our approach. We also highlight the evolving literature that will impact practicing oncologists in the near future.

  10. Microstructure history effect during sequential thermomechanical processing

    International Nuclear Information System (INIS)

    Yassar, Reza S.; Murphy, John; Burton, Christina; Horstemeyer, Mark F.; El kadiri, Haitham; Shokuhfar, Tolou

    2008-01-01

    The key to modeling the material processing behavior is the linking of the microstructure evolution to its processing history. This paper quantifies various microstructural features of an aluminum automotive alloy that undergoes sequential thermomechanical processing which is comprised hot rolling of a 150-mm billet to a 75-mm billet, rolling to 3 mm, annealing, and then cold rolling to a 0.8-mm thickness sheet. The microstructural content was characterized by means of electron backscatter diffraction, scanning electron microscopy, and transmission electron microscopy. The results clearly demonstrate the evolution of precipitate morphologies, dislocation structures, and grain orientation distributions. These data can be used to improve material models that claim to capture the history effects of the processing materials

  11. Prosody and alignment: a sequential perspective

    Science.gov (United States)

    Szczepek Reed, Beatrice

    2010-12-01

    In their analysis of a corpus of classroom interactions in an inner city high school, Roth and Tobin describe how teachers and students accomplish interactional alignment by prosodically matching each other's turns. Prosodic matching, and specific prosodic patterns are interpreted as signs of, and contributions to successful interactional outcomes and positive emotions. Lack of prosodic matching, and other specific prosodic patterns are interpreted as features of unsuccessful interactions, and negative emotions. This forum focuses on the article's analysis of the relation between interpersonal alignment, emotion and prosody. It argues that prosodic matching, and other prosodic linking practices, play a primarily sequential role, i.e. one that displays the way in which participants place and design their turns in relation to other participants' turns. Prosodic matching, rather than being a conversational action in itself, is argued to be an interactional practice (Schegloff 1997), which is not always employed for the accomplishment of `positive', or aligning actions.

  12. Tailored sequential drug release from bilayered calcium sulfate composites

    International Nuclear Information System (INIS)

    Orellana, Bryan R.; Puleo, David A.

    2014-01-01

    The current standard for treating infected bony defects, such as those caused by periodontal disease, requires multiple time-consuming steps and often multiple procedures to fight the infection and recover lost tissue. Releasing an antibiotic followed by an osteogenic agent from a synthetic bone graft substitute could allow for a streamlined treatment, reducing the need for multiple surgeries and thereby shortening recovery time. Tailorable bilayered calcium sulfate (CS) bone graft substitutes were developed with the ability to sequentially release multiple therapeutic agents. Bilayered composite samples having a shell and core geometry were fabricated with varying amounts (1 or 10 wt.%) of metronidazole-loaded poly(lactic-co-glycolic acid) (PLGA) particles embedded in the shell and simvastatin directly loaded into either the shell, core, or both. Microcomputed tomography showed the overall layered geometry as well as the uniform distribution of PLGA within the shells. Dissolution studies demonstrated that the amount of PLGA particles (i.e., 1 vs. 10 wt.%) had a small but significant effect on the erosion rate (3% vs. 3.4%/d). Mechanical testing determined that introducing a layered geometry had a significant effect on the compressive strength, with an average reduction of 35%, but properties were comparable to those of mandibular trabecular bone. Sustained release of simvastatin directly loaded into CS demonstrated that changing the shell to core volume ratio dictates the duration of drug release from each layer. When loaded together in the shell or in separate layers, sequential release of metronidazole and simvastatin was achieved. By introducing a tunable, layered geometry capable of releasing multiple drugs, CS-based bone graft substitutes could be tailored in order to help streamline the multiple steps needed to regenerate tissue in infected defects. - Highlights: • Bilayered CS composites were fabricated as potential bone graft substitutes. • The shell

  13. Tailored sequential drug release from bilayered calcium sulfate composites

    Energy Technology Data Exchange (ETDEWEB)

    Orellana, Bryan R.; Puleo, David A., E-mail: puleo@uky.edu

    2014-10-01

    The current standard for treating infected bony defects, such as those caused by periodontal disease, requires multiple time-consuming steps and often multiple procedures to fight the infection and recover lost tissue. Releasing an antibiotic followed by an osteogenic agent from a synthetic bone graft substitute could allow for a streamlined treatment, reducing the need for multiple surgeries and thereby shortening recovery time. Tailorable bilayered calcium sulfate (CS) bone graft substitutes were developed with the ability to sequentially release multiple therapeutic agents. Bilayered composite samples having a shell and core geometry were fabricated with varying amounts (1 or 10 wt.%) of metronidazole-loaded poly(lactic-co-glycolic acid) (PLGA) particles embedded in the shell and simvastatin directly loaded into either the shell, core, or both. Microcomputed tomography showed the overall layered geometry as well as the uniform distribution of PLGA within the shells. Dissolution studies demonstrated that the amount of PLGA particles (i.e., 1 vs. 10 wt.%) had a small but significant effect on the erosion rate (3% vs. 3.4%/d). Mechanical testing determined that introducing a layered geometry had a significant effect on the compressive strength, with an average reduction of 35%, but properties were comparable to those of mandibular trabecular bone. Sustained release of simvastatin directly loaded into CS demonstrated that changing the shell to core volume ratio dictates the duration of drug release from each layer. When loaded together in the shell or in separate layers, sequential release of metronidazole and simvastatin was achieved. By introducing a tunable, layered geometry capable of releasing multiple drugs, CS-based bone graft substitutes could be tailored in order to help streamline the multiple steps needed to regenerate tissue in infected defects. - Highlights: • Bilayered CS composites were fabricated as potential bone graft substitutes. • The shell

  14. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

    Science.gov (United States)

    Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-03-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  15. Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)

    2014-07-01

    Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

  16. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Science.gov (United States)

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

    2018-03-29

    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Microcystin-LR detection in water by the Fabry-Pérot interferometer using an optical fibre coated with a sol-gel imprinted sensing membrane.

    Science.gov (United States)

    Queirós, Raquel B; Silva, S O; Noronha, J P; Frazão, O; Jorge, P; Aguilar, G; Marques, P V S; Sales, M G F

    2011-05-15

    Cyanobacteria deteriorate the water quality and are responsible for emerging outbreaks and epidemics causing harmful diseases in Humans and animals because of their toxins. Microcystin-LR (MCT) is one of the most relevant cyanotoxin, being the most widely studied hepatotoxin. For safety purposes, the World Health Organization recommends a maximum value of 1 μg L(-1) of MCT in drinking water. Therefore, there is a great demand for remote and real-time sensing techniques to detect and quantify MCT. In this work a Fabry-Pérot sensing probe based on an optical fibre tip coated with a MCT selective thin film is presented. The membranes were developed by imprinting MCT in a sol-gel matrix that was applied over the tip of the fibre by dip coating. The imprinting effect was obtained by curing the sol-gel membrane, prepared with (3-aminopropyl) trimethoxysilane (APTMS), diphenyl-dimethoxysilane (DPDMS), tetraethoxysilane (TEOS), in the presence of MCT. The imprinting effect was tested by preparing a similar membrane without template. In general, the fibre Fabry-Pérot with a Molecular Imprinted Polymer (MIP) sensor showed low thermal effect, thus avoiding the need of temperature control in field applications. It presented a linear response to MCT concentration within 0.3-1.4 μg L(-1) with a sensitivity of -12.4±0.7 nm L μg(-1). The corresponding Non-Imprinted Polymer (NIP) displayed linear behaviour for the same MCT concentration range, but with much less sensitivity, of -5.9±0.2 nm L μg(-1). The method shows excellent selectivity for MCT against other species co-existing with the analyte in environmental waters. It was successfully applied to the determination of MCT in contaminated samples. The main advantages of the proposed optical sensor include high sensitivity and specificity, low-cost, robustness, easy preparation and preservation. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Campbell and moment measures for finite sequential spatial processes

    NARCIS (Netherlands)

    M.N.M. van Lieshout (Marie-Colette)

    2006-01-01

    textabstractWe define moment and Campbell measures for sequential spatial processes, prove a Campbell-Mecke theorem, and relate the results to their counterparts in the theory of point processes. In particular, we show that any finite sequential spatial process model can be derived as the vector

  19. Simultaneous versus sequential penetrating keratoplasty and cataract surgery.

    Science.gov (United States)

    Hayashi, Ken; Hayashi, Hideyuki

    2006-10-01

    To compare the surgical outcomes of simultaneous penetrating keratoplasty and cataract surgery with those of sequential surgery. Thirty-nine eyes of 39 patients scheduled for simultaneous keratoplasty and cataract surgery and 23 eyes of 23 patients scheduled for sequential keratoplasty and secondary phacoemulsification surgery were recruited. Refractive error, regular and irregular corneal astigmatism determined by Fourier analysis, and endothelial cell loss were studied at 1 week and 3, 6, and 12 months after combined surgery in the simultaneous surgery group or after subsequent phacoemulsification surgery in the sequential surgery group. At 3 and more months after surgery, mean refractive error was significantly greater in the simultaneous surgery group than in the sequential surgery group, although no difference was seen at 1 week. The refractive error at 12 months was within 2 D of that targeted in 15 eyes (39%) in the simultaneous surgery group and within 2 D in 16 eyes (70%) in the sequential surgery group; the incidence was significantly greater in the sequential group (P = 0.0344). The regular and irregular astigmatism was not significantly different between the groups at 3 and more months after surgery. No significant difference was also found in the percentage of endothelial cell loss between the groups. Although corneal astigmatism and endothelial cell loss were not different, refractive error from target refraction was greater after simultaneous keratoplasty and cataract surgery than after sequential surgery, indicating a better outcome after sequential surgery than after simultaneous surgery.

  20. Reading Remediation Based on Sequential and Simultaneous Processing.

    Science.gov (United States)

    Gunnison, Judy; And Others

    1982-01-01

    The theory postulating a dichotomy between sequential and simultaneous processing is reviewed and its implications for remediating reading problems are reviewed. Research is cited on sequential-simultaneous processing for early and advanced reading. A list of remedial strategies based on the processing dichotomy addresses decoding and lexical…

  1. Induction of simultaneous and sequential malolactic fermentation in durian wine.

    Science.gov (United States)

    Taniasuri, Fransisca; Lee, Pin-Rou; Liu, Shao-Quan

    2016-08-02

    This study represented for the first time the impact of malolactic fermentation (MLF) induced by Oenococcus oeni and its inoculation strategies (simultaneous vs. sequential) on the fermentation performance as well as aroma compound profile of durian wine. There was no negative impact of simultaneous inoculation of O. oeni and Saccharomyces cerevisiae on the growth and fermentation kinetics of S. cerevisiae as compared to sequential fermentation. Simultaneous MLF did not lead to an excessive increase in volatile acidity as compared to sequential MLF. The kinetic changes of organic acids (i.e. malic, lactic, succinic, acetic and α-ketoglutaric acids) varied with simultaneous and sequential MLF relative to yeast alone. MLF, regardless of inoculation mode, resulted in higher production of fermentation-derived volatiles as compared to control (alcoholic fermentation only), including esters, volatile fatty acids, and terpenes, except for higher alcohols. Most indigenous volatile sulphur compounds in durian were decreased to trace levels with little differences among the control, simultaneous and sequential MLF. Among the different wines, the wine with simultaneous MLF had higher concentrations of terpenes and acetate esters while sequential MLF had increased concentrations of medium- and long-chain ethyl esters. Relative to alcoholic fermentation only, both simultaneous and sequential MLF reduced acetaldehyde substantially with sequential MLF being more effective. These findings illustrate that MLF is an effective and novel way of modulating the volatile and aroma compound profile of durian wine. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. A Survey of Multi-Objective Sequential Decision-Making

    NARCIS (Netherlands)

    Roijers, D.M.; Vamplew, P.; Whiteson, S.; Dazeley, R.

    2013-01-01

    Sequential decision-making problems with multiple objectives arise naturally in practice and pose unique challenges for research in decision-theoretic planning and learning, which has largely focused on single-objective settings. This article surveys algorithms designed for sequential

  3. Dynamics-based sequential memory: Winnerless competition of patterns

    International Nuclear Information System (INIS)

    Seliger, Philip; Tsimring, Lev S.; Rabinovich, Mikhail I.

    2003-01-01

    We introduce a biologically motivated dynamical principle of sequential memory which is based on winnerless competition (WLC) of event images. This mechanism is implemented in a two-layer neural model of sequential spatial memory. We present the learning dynamics which leads to the formation of a WLC network. After learning, the system is capable of associative retrieval of prerecorded sequences of patterns

  4. Sequential, progressive, equal-power, reflective beam-splitter arrays

    Science.gov (United States)

    Manhart, Paul K.

    2017-11-01

    The equations to calculate equal-power reflectivity of a sequential series of beam splitters is presented. Non-sequential optical design examples are offered for uniform illumination using diode lasers. Objects created using Boolean operators and Swept Surfaces can create objects capable of reflecting light into predefined elevation and azimuth angles. Analysis of the illumination patterns for the array are also presented.

  5. The sequential price of anarchy for atomic congestion games

    NARCIS (Netherlands)

    de Jong, Jasper; Uetz, Marc Jochen; Liu, Tie-Yan; Qi, Qi; Ye, Yinyu

    2014-01-01

    In situations without central coordination, the price of anarchy relates the quality of any Nash equilibrium to the quality of a global optimum. Instead of assuming that all players choose their actions simultaneously, we consider games where players choose their actions sequentially. The sequential

  6. Quantum Probability Zero-One Law for Sequential Terminal Events

    Science.gov (United States)

    Rehder, Wulf

    1980-07-01

    On the basis of the Jauch-Piron quantum probability calculus a zero-one law for sequential terminal events is proven, and the significance of certain crucial axioms in the quantum probability calculus is discussed. The result shows that the Jauch-Piron set of axioms is appropriate for the non-Boolean algebra of sequential events.

  7. Lineup Composition, Suspect Position, and the Sequential Lineup Advantage

    Science.gov (United States)

    Carlson, Curt A.; Gronlund, Scott D.; Clark, Steven E.

    2008-01-01

    N. M. Steblay, J. Dysart, S. Fulero, and R. C. L. Lindsay (2001) argued that sequential lineups reduce the likelihood of mistaken eyewitness identification. Experiment 1 replicated the design of R. C. L. Lindsay and G. L. Wells (1985), the first study to show the sequential lineup advantage. However, the innocent suspect was chosen at a lower rate…

  8. Accounting for Heterogeneous Returns in Sequential Schooling Decisions

    NARCIS (Netherlands)

    Zamarro, G.

    2006-01-01

    This paper presents a method for estimating returns to schooling that takes into account that returns may be heterogeneous among agents and that educational decisions are made sequentially.A sequential decision model is interesting because it explicitly considers that the level of education of each

  9. Simultaneous sequential monitoring of efficacy and safety led to masking of effects.

    Science.gov (United States)

    van Eekelen, Rik; de Hoop, Esther; van der Tweel, Ingeborg

    2016-08-01

    Usually, sequential designs for clinical trials are applied on the primary (=efficacy) outcome. In practice, other outcomes (e.g., safety) will also be monitored and influence the decision whether to stop a trial early. Implications of simultaneous monitoring on trial decision making are yet unclear. This study examines what happens to the type I error, power, and required sample sizes when one efficacy outcome and one correlated safety outcome are monitored simultaneously using sequential designs. We conducted a simulation study in the framework of a two-arm parallel clinical trial. Interim analyses on two outcomes were performed independently and simultaneously on the same data sets using four sequential monitoring designs, including O'Brien-Fleming and Triangular Test boundaries. Simulations differed in values for correlations and true effect sizes. When an effect was present in both outcomes, competition was introduced, which decreased power (e.g., from 80% to 60%). Futility boundaries for the efficacy outcome reduced overall type I errors as well as power for the safety outcome. Monitoring two correlated outcomes, given that both are essential for early trial termination, leads to masking of true effects. Careful consideration of scenarios must be taken into account when designing sequential trials. Simulation results can help guide trial design. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Bursts and heavy tails in temporal and sequential dynamics of foraging decisions.

    Directory of Open Access Journals (Sweden)

    Kanghoon Jung

    2014-08-01

    Full Text Available A fundamental understanding of behavior requires predicting when and what an individual will choose. However, the actual temporal and sequential dynamics of successive choices made among multiple alternatives remain unclear. In the current study, we tested the hypothesis that there is a general bursting property in both the timing and sequential patterns of foraging decisions. We conducted a foraging experiment in which rats chose among four different foods over a continuous two-week time period. Regarding when choices were made, we found bursts of rapidly occurring actions, separated by time-varying inactive periods, partially based on a circadian rhythm. Regarding what was chosen, we found sequential dynamics in affective choices characterized by two key features: (a a highly biased choice distribution; and (b preferential attachment, in which the animals were more likely to choose what they had previously chosen. To capture the temporal dynamics, we propose a dual-state model consisting of active and inactive states. We also introduce a satiation-attainment process for bursty activity, and a non-homogeneous Poisson process for longer inactivity between bursts. For the sequential dynamics, we propose a dual-control model consisting of goal-directed and habit systems, based on outcome valuation and choice history, respectively. This study provides insights into how the bursty nature of behavior emerges from the interaction of different underlying systems, leading to heavy tails in the distribution of behavior over time and choices.

  11. Multi-Stage Recognition of Speech Emotion Using Sequential Forward Feature Selection

    Directory of Open Access Journals (Sweden)

    Liogienė Tatjana

    2016-07-01

    Full Text Available The intensive research of speech emotion recognition introduced a huge collection of speech emotion features. Large feature sets complicate the speech emotion recognition task. Among various feature selection and transformation techniques for one-stage classification, multiple classifier systems were proposed. The main idea of multiple classifiers is to arrange the emotion classification process in stages. Besides parallel and serial cases, the hierarchical arrangement of multi-stage classification is most widely used for speech emotion recognition. In this paper, we present a sequential-forward-feature-selection-based multi-stage classification scheme. The Sequential Forward Selection (SFS and Sequential Floating Forward Selection (SFFS techniques were employed for every stage of the multi-stage classification scheme. Experimental testing of the proposed scheme was performed using the German and Lithuanian emotional speech datasets. Sequential-feature-selection-based multi-stage classification outperformed the single-stage scheme by 12–42 % for different emotion sets. The multi-stage scheme has shown higher robustness to the growth of emotion set. The decrease in recognition rate with the increase in emotion set for multi-stage scheme was lower by 10–20 % in comparison with the single-stage case. Differences in SFS and SFFS employment for feature selection were negligible.

  12. Bursts and Heavy Tails in Temporal and Sequential Dynamics of Foraging Decisions

    Science.gov (United States)

    Jung, Kanghoon; Jang, Hyeran; Kralik, Jerald D.; Jeong, Jaeseung

    2014-01-01

    A fundamental understanding of behavior requires predicting when and what an individual will choose. However, the actual temporal and sequential dynamics of successive choices made among multiple alternatives remain unclear. In the current study, we tested the hypothesis that there is a general bursting property in both the timing and sequential patterns of foraging decisions. We conducted a foraging experiment in which rats chose among four different foods over a continuous two-week time period. Regarding when choices were made, we found bursts of rapidly occurring actions, separated by time-varying inactive periods, partially based on a circadian rhythm. Regarding what was chosen, we found sequential dynamics in affective choices characterized by two key features: (a) a highly biased choice distribution; and (b) preferential attachment, in which the animals were more likely to choose what they had previously chosen. To capture the temporal dynamics, we propose a dual-state model consisting of active and inactive states. We also introduce a satiation-attainment process for bursty activity, and a non-homogeneous Poisson process for longer inactivity between bursts. For the sequential dynamics, we propose a dual-control model consisting of goal-directed and habit systems, based on outcome valuation and choice history, respectively. This study provides insights into how the bursty nature of behavior emerges from the interaction of different underlying systems, leading to heavy tails in the distribution of behavior over time and choices. PMID:25122498

  13. The reliability and validity of using the urine dipstick test by patient self-assessment for urinary tract infection screening in spinal cord injury patients.

    Science.gov (United States)

    Duanngai, Krit; Sirasaporn, Patpiya; Ngaosinchai, Siriwan Surapaitoon

    2017-01-01

    The aim of this is to evaluate the reliability of the urine dipstick test by patients' self-assessment for urinary tract infection (UTI) screening and to determine the validity of urine dipstick test. Rehabilitation Department, Srinagarind Hospital, Thailand. A diagnostic study. This study compared the urine dipstick test (index test) with the National Institute on Disability and Rehabilitation Research (NIDRR) criteria (gold standard test) in spinal cord injury (SCI) patients. The urine dipstick test informed positive and negative results. Besides the NIDRR criteria classified as UTI and no UTI. The interrater reliability was measured in the sense of Kappa whereas the validity of urine dipstick test was reported in terms of sensitivity, specificity, positive likelihood ratio (LR) (+LR), negative LR (-LR), positive predictive value (PPV), and negative predictive value (NPV). Out of the 56 participants, the kappa of urine dipstick test for leukocyte esterase, nitrite, and combined leukocyte esterase and nitrite were 0.09, 0.21, and 0.52, respectively. The nitrite urine dipstick test showed the highest sensitivity (90%). The combined leukocyte esterase and nitrite urine dipstick test gave the highest specificity (87%), PPV (60%), NPV (93%), and +LR (5.63). The interrater reliability of combined leukocyte esterase and nitrite urine dipstick test was moderate agreement. The combined leukocyte esterase and nitrite urine dipstick test showed high level of both sensitivity and specificity. The combined leukocyte esterase and nitrite urine dipstick test should be promoted for patients' self-assessment for UTI screening in SCI patients.

  14. Constrained treatment planning using sequential beam selection

    International Nuclear Information System (INIS)

    Woudstra, E.; Storchi, P.R.M.

    2000-01-01

    In this paper an algorithm is described for automated treatment plan generation. The algorithm aims at delivery of the prescribed dose to the target volume without violation of constraints for target, organs at risk and the surrounding normal tissue. Pre-calculated dose distributions for all candidate orientations are used as input. Treatment beams are selected in a sequential way. A score function designed for beam selection is used for the simultaneous selection of beam orientations and weights. In order to determine the optimum choice for the orientation and the corresponding weight of each new beam, the score function is first redefined to account for the dose distribution of the previously selected beams. Addition of more beams to the plan is stopped when the target dose is reached or when no additional dose can be delivered without violating a constraint. In the latter case the score function is modified by importance factor changes to enforce better sparing of the organ with the limiting constraint and the algorithm is run again. (author)

  15. Phenomenology of the next sequential lepton

    International Nuclear Information System (INIS)

    Rizzo, T.G.

    1980-01-01

    We consider the phenomenology of a sequential, charged lepton in the mass range 6 --13 GeV. We find the semileptonic branching ratio of such a lepton to be approx. 13%; the dominant two-body modes are found to include the decay L → ν/sub L/F* with a branching ratio approx. 6%. In this analysis we assume that the mass of the lepton under consideration is lighter than the t quark such that decays such as L → ν/sub L/t-barq, where q= (d, s, or b) are kinematically forbidden. We also find that decays such as L → ν/sub L/B* (c-barb) can also be as large as approx. 6% depending on the mixing angles; the lifetime of such a lepton is found to be approx. 2.6 x 10 -12 M/sub L/ -5 sec, where M/sub L/ is in GeV

  16. The Origin of Sequential Chromospheric Brightenings

    Science.gov (United States)

    Kirk, M. S.; Balasubramaniam, K. S.; Jackiewicz, J.; Gilbert, H. R.

    2017-06-01

    Sequential chromospheric brightenings (SCBs) are often observed in the immediate vicinity of erupting flares and are associated with coronal mass ejections. Since their initial discovery in 2005, there have been several subsequent investigations of SCBs. These studies have used differing detection and analysis techniques, making it difficult to compare results between studies. This work employs the automated detection algorithm of Kirk et al. (Solar Phys. 283, 97, 2013) to extract the physical characteristics of SCBs in 11 flares of varying size and intensity. We demonstrate that the magnetic substructure within the SCB appears to have a significantly smaller area than the corresponding Hα emission. We conclude that SCBs originate in the lower corona around 0.1 R_{⊙} above the photosphere, propagate away from the flare center at speeds of 35 - 85 km s^{-1}, and have peak photosphere magnetic intensities of 148±2.9 G. In light of these measurements, we infer SCBs to be distinctive chromospheric signatures of erupting coronal mass ejections.

  17. Sequential decoders for large MIMO systems

    KAUST Repository

    Ali, Konpal S.

    2014-05-01

    Due to their ability to provide high data rates, multiple-input multiple-output (MIMO) systems have become increasingly popular. Decoding of these systems with acceptable error performance is computationally very demanding. In this paper, we employ the Sequential Decoder using the Fano Algorithm for large MIMO systems. A parameter called the bias is varied to attain different performance-complexity trade-offs. Low values of the bias result in excellent performance but at the expense of high complexity and vice versa for higher bias values. Numerical results are done that show moderate bias values result in a decent performance-complexity trade-off. We also attempt to bound the error by bounding the bias, using the minimum distance of a lattice. The variations in complexity with SNR have an interesting trend that shows room for considerable improvement. Our work is compared against linear decoders (LDs) aided with Element-based Lattice Reduction (ELR) and Complex Lenstra-Lenstra-Lovasz (CLLL) reduction. © 2014 IFIP.

  18. Social Influences in Sequential Decision Making.

    Directory of Open Access Journals (Sweden)

    Markus Schöbel

    Full Text Available People often make decisions in a social environment. The present work examines social influence on people's decisions in a sequential decision-making situation. In the first experimental study, we implemented an information cascade paradigm, illustrating that people infer information from decisions of others and use this information to make their own decisions. We followed a cognitive modeling approach to elicit the weight people give to social as compared to private individual information. The proposed social influence model shows that participants overweight their own private information relative to social information, contrary to the normative Bayesian account. In our second study, we embedded the abstract decision problem of Study 1 in a medical decision-making problem. We examined whether in a medical situation people also take others' authority into account in addition to the information that their decisions convey. The social influence model illustrates that people weight social information differentially according to the authority of other decision makers. The influence of authority was strongest when an authority's decision contrasted with private information. Both studies illustrate how the social environment provides sources of information that people integrate differently for their decisions.

  19. Social Influences in Sequential Decision Making

    Science.gov (United States)

    Schöbel, Markus; Rieskamp, Jörg; Huber, Rafael

    2016-01-01

    People often make decisions in a social environment. The present work examines social influence on people’s decisions in a sequential decision-making situation. In the first experimental study, we implemented an information cascade paradigm, illustrating that people infer information from decisions of others and use this information to make their own decisions. We followed a cognitive modeling approach to elicit the weight people give to social as compared to private individual information. The proposed social influence model shows that participants overweight their own private information relative to social information, contrary to the normative Bayesian account. In our second study, we embedded the abstract decision problem of Study 1 in a medical decision-making problem. We examined whether in a medical situation people also take others’ authority into account in addition to the information that their decisions convey. The social influence model illustrates that people weight social information differentially according to the authority of other decision makers. The influence of authority was strongest when an authority's decision contrasted with private information. Both studies illustrate how the social environment provides sources of information that people integrate differently for their decisions. PMID:26784448

  20. Sequential acquisition of mutations in myelodysplastic syndromes.

    Science.gov (United States)

    Makishima, Hideki

    2017-01-01

    Recent progress in next-generation sequencing technologies allows us to discover frequent mutations throughout the coding regions of myelodysplastic syndromes (MDS), potentially providing us with virtually a complete spectrum of driver mutations in this disease. As shown by many study groups these days, such driver mutations are acquired in a gene-specific fashion. For instance, DDX41 mutations are observed in germline cells long before MDS presentation. In blood samples from healthy elderly individuals, somatic DNMT3A and TET2 mutations are detected as age-related clonal hematopoiesis and are believed to be a risk factor for hematological neoplasms. In MDS, mutations of genes such as NRAS and FLT3, designated as Type-1 genes, may be significantly associated with leukemic evolution. Another type (Type-2) of genes, including RUNX1 and GATA2, are related to progression from low-risk to high-risk MDS. Overall, various driver mutations are sequentially acquired in MDS, at a specific time, in either germline cells, normal hematopoietic cells, or clonal MDS cells.

  1. Building a Lego wall: Sequential action selection.

    Science.gov (United States)

    Arnold, Amy; Wing, Alan M; Rotshtein, Pia

    2017-05-01

    The present study draws together two distinct lines of enquiry into the selection and control of sequential action: motor sequence production and action selection in everyday tasks. Participants were asked to build 2 different Lego walls. The walls were designed to have hierarchical structures with shared and dissociated colors and spatial components. Participants built 1 wall at a time, under low and high load cognitive states. Selection times for correctly completed trials were measured using 3-dimensional motion tracking. The paradigm enabled precise measurement of the timing of actions, while using real objects to create an end product. The experiment demonstrated that action selection was slowed at decision boundary points, relative to boundaries where no between-wall decision was required. Decision points also affected selection time prior to the actual selection window. Dual-task conditions increased selection errors. Errors mostly occurred at boundaries between chunks and especially when these required decisions. The data support hierarchical control of sequenced behavior. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  2. Sequential experimental design based generalised ANOVA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Souvik, E-mail: csouvik41@gmail.com; Chowdhury, Rajib, E-mail: rajibfce@iitr.ac.in

    2016-07-15

    Over the last decade, surrogate modelling technique has gained wide popularity in the field of uncertainty quantification, optimization, model exploration and sensitivity analysis. This approach relies on experimental design to generate training points and regression/interpolation for generating the surrogate. In this work, it is argued that conventional experimental design may render a surrogate model inefficient. In order to address this issue, this paper presents a novel distribution adaptive sequential experimental design (DA-SED). The proposed DA-SED has been coupled with a variant of generalised analysis of variance (G-ANOVA), developed by representing the component function using the generalised polynomial chaos expansion. Moreover, generalised analytical expressions for calculating the first two statistical moments of the response, which are utilized in predicting the probability of failure, have also been developed. The proposed approach has been utilized in predicting probability of failure of three structural mechanics problems. It is observed that the proposed approach yields accurate and computationally efficient estimate of the failure probability.

  3. Social Influences in Sequential Decision Making.

    Science.gov (United States)

    Schöbel, Markus; Rieskamp, Jörg; Huber, Rafael

    2016-01-01

    People often make decisions in a social environment. The present work examines social influence on people's decisions in a sequential decision-making situation. In the first experimental study, we implemented an information cascade paradigm, illustrating that people infer information from decisions of others and use this information to make their own decisions. We followed a cognitive modeling approach to elicit the weight people give to social as compared to private individual information. The proposed social influence model shows that participants overweight their own private information relative to social information, contrary to the normative Bayesian account. In our second study, we embedded the abstract decision problem of Study 1 in a medical decision-making problem. We examined whether in a medical situation people also take others' authority into account in addition to the information that their decisions convey. The social influence model illustrates that people weight social information differentially according to the authority of other decision makers. The influence of authority was strongest when an authority's decision contrasted with private information. Both studies illustrate how the social environment provides sources of information that people integrate differently for their decisions.

  4. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Science.gov (United States)

    Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna

    2016-08-01

    Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

  5. Study of sequential disinfection for the inactivation of protozoa and indicator microorganisms in wastewater

    Directory of Open Access Journals (Sweden)

    Raphael Corrêa Medeiros

    2015-05-01

    Full Text Available Sewage disinfection has the primary objective of inactivating pathogenic organisms to prevent the dissemination of waterborne diseases. This study analyzed individual disinfection, with chlorine and ultraviolet radiation, and sequential disinfection (chlorine-UV radiation. The tests were conducted with anaerobic effluent in batch, in laboratory scale, with two dosages of chlorine (10 and 20 mg L-1 and UV (2.5 and 6.1 Wh m-3. In addition, to guarantee the presence of cysts in the tests, 104 cysts per liter of Giardia spp. were inoculated. The resistance order was as follows: E. coli = Total Coliforms < Clostridium perfringens < Giardia spp.. Furthermore, synergistic effects reached 0.06 to 1.42 log of inactivation in sequential disinfection for both the most resistant microorganisms.

  6. Test sample handling apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    A test sample handling apparatus using automatic scintillation counting for gamma detection, for use in such fields as radioimmunoassay, is described. The apparatus automatically and continuously counts large numbers of samples rapidly and efficiently by the simultaneous counting of two samples. By means of sequential ordering of non-sequential counting data, it is possible to obtain precisely ordered data while utilizing sample carrier holders having a minimum length. (U.K.)

  7. Comparison of ablation centration after bilateral sequential versus simultaneous LASIK.

    Science.gov (United States)

    Lin, Jane-Ming; Tsai, Yi-Yu

    2005-01-01

    To compare ablation centration after bilateral sequential and simultaneous myopic LASIK. A retrospective randomized case series was performed of 670 eyes of 335 consecutive patients who had undergone either bilateral sequential (group 1) or simultaneous (group 2) myopic LASIK between July 2000 and July 2001 at the China Medical University Hospital, Taichung, Taiwan. The ablation centrations of the first and second eyes in the two groups were compared 3 months postoperatively. Of 670 eyes, 274 eyes (137 patients) comprised the sequential group and 396 eyes (198 patients) comprised the simultaneous group. Three months post-operatively, 220 eyes of 110 patients (80%) in the sequential group and 236 eyes of 118 patients (60%) in the simultaneous group provided topographic data for centration analysis. For the first eyes, mean decentration was 0.39 +/- 0.26 mm in the sequential group and 0.41 +/- 0.19 mm in the simultaneous group (P = .30). For the second eyes, mean decentration was 0.28 +/- 0.23 mm in the sequential group and 0.30 +/- 0.21 mm in the simultaneous group (P = .36). Decentration in the second eyes significantly improved in both groups (group 1, P = .02; group 2, P sequential group and 0.32 +/- 0.18 mm in the simultaneous group (P = .33). The difference of ablation center angles between the first and second eyes was 43.2 sequential group and 45.1 +/- 50.8 degrees in the simultaneous group (P = .42). Simultaneous bilateral LASIK is comparable to sequential surgery in ablation centration.

  8. The sequential trauma score - a new instrument for the sequential mortality prediction in major trauma*

    Directory of Open Access Journals (Sweden)

    Huber-Wagner S

    2010-05-01

    Full Text Available Abstract Background There are several well established scores for the assessment of the prognosis of major trauma patients that all have in common that they can be calculated at the earliest during intensive care unit stay. We intended to develop a sequential trauma score (STS that allows prognosis at several early stages based on the information that is available at a particular time. Study design In a retrospective, multicenter study using data derived from the Trauma Registry of the German Trauma Society (2002-2006, we identified the most relevant prognostic factors from the patients basic data (P, prehospital phase (A, early (B1, and late (B2 trauma room phase. Univariate and logistic regression models as well as score quality criteria and the explanatory power have been calculated. Results A total of 2,354 patients with complete data were identified. From the patients basic data (P, logistic regression showed that age was a significant predictor of survival (AUCmodel p, area under the curve = 0.63. Logistic regression of the prehospital data (A showed that blood pressure, pulse rate, Glasgow coma scale (GCS, and anisocoria were significant predictors (AUCmodel A = 0.76; AUCmodel P + A = 0.82. Logistic regression of the early trauma room phase (B1 showed that peripheral oxygen saturation, GCS, anisocoria, base excess, and thromboplastin time to be significant predictors of survival (AUCmodel B1 = 0.78; AUCmodel P +A + B1 = 0.85. Multivariate analysis of the late trauma room phase (B2 detected cardiac massage, abbreviated injury score (AIS of the head ≥ 3, the maximum AIS, the need for transfusion or massive blood transfusion, to be the most important predictors (AUCmodel B2 = 0.84; AUCfinal model P + A + B1 + B2 = 0.90. The explanatory power - a tool for the assessment of the relative impact of each segment to mortality - is 25% for P, 7% for A, 17% for B1 and 51% for B2. A spreadsheet for the easy calculation of the sequential trauma

  9. The Maximum Cross-Correlation approach to detecting translational motions from sequential remote-sensing images

    Science.gov (United States)

    Gao, J.; Lythe, M. B.

    1996-06-01

    This paper presents the principle of the Maximum Cross-Correlation (MCC) approach in detecting translational motions within dynamic fields from time-sequential remotely sensed images. A C program implementing the approach is presented and illustrated in a flowchart. The program is tested with a pair of sea-surface temperature images derived from Advanced Very High Resolution Radiometer (AVHRR) images near East Cape, New Zealand. Results show that the mean currents in the region have been detected satisfactorily with the approach.

  10. Moving Synergistically Acting Drug Combinations to the Clinic by Comparing Sequential versus Simultaneous Drug Administrations.

    Science.gov (United States)

    Dinavahi, Saketh S; Noory, Mohammad A; Gowda, Raghavendra; Drabick, Joseph J; Berg, Arthur; Neves, Rogerio I; Robertson, Gavin P

    2018-03-01

    Drug combinations acting synergistically to kill cancer cells have become increasingly important in melanoma as an approach to manage the recurrent resistant disease. Protein kinase B (AKT) is a major target in this disease but its inhibitors are not effective clinically, which is a major concern. Targeting AKT in combination with WEE1 (mitotic inhibitor kinase) seems to have potential to make AKT-based therapeutics effective clinically. Since agents targeting AKT and WEE1 have been tested individually in the clinic, the quickest way to move the drug combination to patients would be to combine these agents sequentially, enabling the use of existing phase I clinical trial toxicity data. Therefore, a rapid preclinical approach is needed to evaluate whether simultaneous or sequential drug treatment has maximal therapeutic efficacy, which is based on a mechanistic rationale. To develop this approach, melanoma cell lines were treated with AKT inhibitor AZD5363 [4-amino- N -[(1 S )-1-(4-chlorophenyl)-3-hydroxypropyl]-1-(7 H -pyrrolo[2,3- d ]pyrimidin-4-yl)piperidine-4-carboxamide] and WEE1 inhibitor AZD1775 [2-allyl-1-(6-(2-hydroxypropan-2-yl)pyridin-2-yl)-6-((4-(4-methylpiperazin-1-yl)phenyl)amino)-1 H -pyrazolo[3,4- d ]pyrimidin-3(2 H )-one] using simultaneous and sequential dosing schedules. Simultaneous treatment synergistically reduced melanoma cell survival and tumor growth. In contrast, sequential treatment was antagonistic and had a minimal tumor inhibitory effect compared with individual agents. Mechanistically, simultaneous targeting of AKT and WEE1 enhanced deregulation of the cell cycle and DNA damage repair pathways by modulating transcription factors p53 and forkhead box M1, which was not observed with sequential treatment. Thus, this study identifies a rapid approach to assess the drug combinations with a mechanistic basis for selection, which suggests that combining AKT and WEE1 inhibitors is needed for maximal efficacy. Copyright © 2018 by The American

  11. Comparison of Sequential Regimen and Standard Therapy for Helicobacter pylori Eradication in Patients with Dyspepsia

    Directory of Open Access Journals (Sweden)

    Gh. Roshanaei

    2013-10-01

    Full Text Available Introduction & Objective: Some studies have reported successful eradication rates using se-quential therapy but more recent studies performed in Asia did not find a similar benefit. Due to inconsistencies in the comparison of standard triple drugs therapy and sequential regimen, in the previous researches we decided to compare these treatments in Persian patients. Materials & Methods: This study is a randomized clinical trial, performed in one hundred and forty patients suffering from dyspepsia with indication for H. pylori eradication between No-vember 2010 and March 2012.Patients were randomized in two equal groups. The patients in the first group (standard were treated by omeprazole capsule 20 mg BID, amoxicillin cap-sule 1 gr BID, clarithromycin tablet 500mg BID for 14 days; while the patients in the second group (sequential were treated by omeprazole capsule 20 mg for 10 days, amoxicillin cap-sule 1 gr BID for 5 days, then clarithromycin tablet 500 mg and tinidazole tablet 500 mg BID for other 5 days. 4-6 weeks after the treatment, we compared the eradication of H.pylori be-tween the two groups by urease breathe test with C14. Results: H. pylori infection was successfully cured in 57/70 (81.43% with a 10-day sequen-tial therapy, in 60/70 (85.75% with the standard fourteen-day triple therapy, respectively. Conclusion: We detected no significant differences between the 10-day sequential eradication therapy for H. pylori and 14-day standard triple treatment among the patients. (Sci J Hamadan Univ Med Sci 2013; 20 (3:184-193

  12. Fast sequential Monte Carlo methods for counting and optimization

    CERN Document Server

    Rubinstein, Reuven Y; Vaisman, Radislav

    2013-01-01

    A comprehensive account of the theory and application of Monte Carlo methods Based on years of research in efficient Monte Carlo methods for estimation of rare-event probabilities, counting problems, and combinatorial optimization, Fast Sequential Monte Carlo Methods for Counting and Optimization is a complete illustration of fast sequential Monte Carlo techniques. The book provides an accessible overview of current work in the field of Monte Carlo methods, specifically sequential Monte Carlo techniques, for solving abstract counting and optimization problems. Written by authorities in the

  13. Sequential formation of subgroups in OB associations

    International Nuclear Information System (INIS)

    Elmegreen, B.G.; Lada, C.J.

    1977-01-01

    We reconsider the structure and formation of OB association in view of recent radio and infrared observations of the adjacent molecular clouds. As a result of this reexamination, we propose that OB subgroups are formed in a step-by-step process which involves the propagation of ionization (I) and shock (S) fronts through a molecular cloud complex. OB stars formed at the edge of a molecular cloud drive these I-S fronts into the cloud. A layer of dense neutral material accumulates between the I and S fronts and eventually becomes gravitationally unstable. This process is analyzed in detail. Several arguments concerning the temperature and mass of this layer suggest that a new OB subgroup will form. After approximately one-half million years, these stars will emerge from and disrupt the star-forming layer. A new shock will be driven into the remaining molecular cloud and will initiate another cycle of star formation.Several observed properties of OB associations are shown to follow from a sequential star-forming mechanism. These include the spatial separation and systematic differences in age of OB subgroups in a given association, the regularity of subgroup masses, the alignment of subgroups along the galactic plane, and their physical expansion. Detailed observations of ionization fronts, masers, IR sources, and molecular clouds are also in agreement with this model. Finally, this mechanism provides a means of dissipating a molecular cloud and exposing less massive stars (e.g., T Tauri stars) which may have formed ahead of the shock as part of the original cloud collapsed and fragmented

  14. District heating in sequential energy supply

    International Nuclear Information System (INIS)

    Persson, Urban; Werner, Sven

    2012-01-01

    Highlights: ► European excess heat recovery and utilisation by district heat distribution. ► Heat recovery in district heating systems – a structural energy efficiency measure. ► Introduction of new theoretical concepts to express excess heat recovery. ► Fourfold potential for excess heat utilisation in EU27 compared to current levels. ► Large scale excess heat recovery – a collaborative challenge for future Europe. -- Abstract: Increased recovery of excess heat from thermal power generation and industrial processes has great potential to reduce primary energy demands in EU27. In this study, current excess heat utilisation levels by means of district heat distribution are assessed and expressed by concepts such as recovery efficiency, heat recovery rate, and heat utilisation rate. For two chosen excess heat activities, current average EU27 heat recovery levels are compared to currently best Member State practices, whereby future potentials of European excess heat recovery and utilisation are estimated. The principle of sequential energy supply is elaborated to capture the conceptual idea of excess heat recovery in district heating systems as a structural and organisational energy efficiency measure. The general conditions discussed concerning expansion of heat recovery into district heating systems include infrastructure investments in district heating networks, collaboration agreements, maintained value chains, policy support, world market energy prices, allocation of synergy benefits, and local initiatives. The main conclusion from this study is that a future fourfold increase of current EU27 excess heat utilisation by means of district heat distribution to residential and service sectors is conceived as plausible if applying best Member State practice. This estimation is higher than the threefold increase with respect to direct feasible distribution costs estimated by the same authors in a previous study. Hence, no direct barriers appear with

  15. DYNAMIC ANALYSIS OF THE BULK TRITIUM SHIPPING PACKAGE SUBJECTED TO CLOSURE TORQUES AND SEQUENTIAL IMPACTS

    International Nuclear Information System (INIS)

    Wu, T; Paul Blanton, P; Kurt Eberl, K

    2007-01-01

    This paper presents a finite-element technique to simulate the structural responses and to evaluate the cumulative damage of a radioactive material packaging requiring bolt closure-tightening torque and subjected to the scenarios of the Hypothetical Accident Conditions (HAC) defined in the Code of Federal Regulations Title 10 part 71 (10CFR71). Existing finite-element methods for modeling closure stresses from bolt pre-load are not readily adaptable to dynamic analyses. The HAC events are required to occur sequentially per 10CFR71 and thus the evaluation of the cumulative damage is desirable. Generally, each HAC event is analyzed separately and the cumulative damage is partially addressed by superposition. This results in relying on additional physical testing to comply with 10CFR71 requirements for assessment of cumulative damage. The proposed technique utilizes the combination of kinematic constraints, rigid-body motions and structural deformations to overcome some of the difficulties encountered in modeling the effect of cumulative damage. This methodology provides improved numerical solutions in compliance with the 10CFR71 requirements for sequential HAC tests. Analyses were performed for the Bulk Tritium Shipping Package (BTSP) designed by Savannah River National Laboratory to demonstrate the applications of the technique. The methodology proposed simulates the closure bolt torque preload followed by the sequential HAC events, the 30-foot drop and the 30-foot dynamic crush. The analytical results will be compared to the package test data

  16. An Efficient System Based On Closed Sequential Patterns for Web Recommendations

    OpenAIRE

    Utpala Niranjan; R.B.V. Subramanyam; V-Khana

    2010-01-01

    Sequential pattern mining, since its introduction has received considerable attention among the researchers with broad applications. The sequential pattern algorithms generally face problems when mining long sequential patterns or while using very low support threshold. One possible solution of such problems is by mining the closed sequential patterns, which is a condensed representation of sequential patterns. Recently, several researchers have utilized the sequential pattern discovery for d...

  17. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Directory of Open Access Journals (Sweden)

    Augusto Etchegaray

    2010-01-01

    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  18. Sequential ensemble-based optimal design for parameter estimation: SEQUENTIAL ENSEMBLE-BASED OPTIMAL DESIGN

    Energy Technology Data Exchange (ETDEWEB)

    Man, Jun [Zhejiang Provincial Key Laboratory of Agricultural Resources and Environment, Institute of Soil and Water Resources and Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou China; Zhang, Jiangjiang [Zhejiang Provincial Key Laboratory of Agricultural Resources and Environment, Institute of Soil and Water Resources and Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou China; Li, Weixuan [Pacific Northwest National Laboratory, Richland Washington USA; Zeng, Lingzao [Zhejiang Provincial Key Laboratory of Agricultural Resources and Environment, Institute of Soil and Water Resources and Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou China; Wu, Laosheng [Department of Environmental Sciences, University of California, Riverside California USA

    2016-10-01

    The ensemble Kalman filter (EnKF) has been widely used in parameter estimation for hydrological models. The focus of most previous studies was to develop more efficient analysis (estimation) algorithms. On the other hand, it is intuitively understandable that a well-designed sampling (data-collection) strategy should provide more informative measurements and subsequently improve the parameter estimation. In this work, a Sequential Ensemble-based Optimal Design (SEOD) method, coupled with EnKF, information theory and sequential optimal design, is proposed to improve the performance of parameter estimation. Based on the first-order and second-order statistics, different information metrics including the Shannon entropy difference (SD), degrees of freedom for signal (DFS) and relative entropy (RE) are used to design the optimal sampling strategy, respectively. The effectiveness of the proposed method is illustrated by synthetic one-dimensional and two-dimensional unsaturated flow case studies. It is shown that the designed sampling strategies can provide more accurate parameter estimation and state prediction compared with conventional sampling strategies. Optimal sampling designs based on various information metrics perform similarly in our cases. The effect of ensemble size on the optimal design is also investigated. Overall, larger ensemble size improves the parameter estimation and convergence of optimal sampling strategy. Although the proposed method is applied to unsaturated flow problems in this study, it can be equally applied in any other hydrological problems.

  19. Sequential lineups: shift in criterion or decision strategy?

    Science.gov (United States)

    Gronlund, Scott D

    2004-04-01

    R. C. L. Lindsay and G. L. Wells (1985) argued that a sequential lineup enhanced discriminability because it elicited use of an absolute decision strategy. E. B. Ebbesen and H. D. Flowe (2002) argued that a sequential lineup led witnesses to adopt a more conservative response criterion, thereby affecting bias, not discriminability. Height was encoded as absolute (e.g., 6 ft [1.83 m] tall) or relative (e.g., taller than). If a sequential lineup elicited an absolute decision strategy, the principle of transfer-appropriate processing predicted that performance should be best when height was encoded absolutely. Conversely, if a simultaneous lineup elicited a relative decision strategy, performance should be best when height was encoded relatively. The predicted interaction was observed, providing direct evidence for the decision strategies explanation of what happens when witnesses view a sequential lineup.

  20. Relations between the simultaneous and sequential transfer of two nucleons

    International Nuclear Information System (INIS)

    Satchler, G.R.

    1982-01-01

    The author discusses the perturbative treatment of simultaneous and sequential two-nucleon transfer reactions with special regards to the DWBA. As examples the (t,p), (p,t), and (α,d) reactions are considered. (HSI)