Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke
The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.
Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria
2013-08-08
Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of
Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes
Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.
Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.
Sorting cancer karyotypes using double-cut-and-joins, duplications and deletions.
Zeira, Ron; Shamir, Ron
2018-05-03
Problems of genome rearrangement are central in both evolution and cancer research. Most genome rearrangement models assume that the genome contains a single copy of each gene and the only changes in the genome are structural, i.e., reordering of segments. In contrast, tumor genomes also undergo numerical changes such as deletions and duplications, and thus the number of copies of genes varies. Dealing with unequal gene content is a very challenging task, addressed by few algorithms to date. More realistic models are needed to help trace genome evolution during tumorigenesis. Here we present a model for the evolution of genomes with multiple gene copies using the operation types double-cut-and-joins, duplications and deletions. The events supported by the model are reversals, translocations, tandem duplications, segmental deletions, and chromosomal amplifications and deletions, covering most types of structural and numerical changes observed in tumor samples. Our goal is to find a series of operations of minimum length that transform one karyotype into the other. We show that the problem is NP-hard and give an integer linear programming formulation that solves the problem exactly under some mild assumptions. We test our method on simulated genomes and on ovarian cancer genomes. Our study advances the state of the art in two ways: It allows a broader set of operations than extant models, thus being more realistic, and it is the first study attempting to reconstruct the full sequence of structural and numerical events during cancer evolution. Code and data are available in https://github.com/Shamir-Lab/Sorting-Cancer-Karyotypes. ronzeira@post.tau.ac.il, rshamir@tau.ac.il. Supplementary data are available at Bioinformatics online.
The detection of large deletions or duplications in genomic DNA.
Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R
2002-11-01
While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua
2013-09-01
There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.
Risk of Psychiatric Disorders Among Individuals With the 22q11.2 Deletion or Duplication
DEFF Research Database (Denmark)
Hoeffding, Louise K; Trabjerg, Betina B; Olsen, Line
2017-01-01
) age at diagnosis of any psychiatric disorder was 12.5 (8.3) years for individuals with deletions and 6.1 (0.9) years for duplication carriers. A parental diagnosis of schizophrenia-but not of other psychiatric diagnoses-was associated with a 22q11.2 deletion, and parental psychiatric diagnoses other.......2 deletion or duplicationwas performed. A total of 3 768 943 individuals born in Denmark from 1955 to 2012 were followed up during the study period (total follow-up, 57.1 million person-years). Indicators of 22q11.2 deletion or duplication and cumulative incidenceswere estimated using a nested case...
Goettel, Wolfgang; Ramirez, Martha; Upchurch, Robert G; An, Yong-Qiang Charles
2016-08-01
Identification and characterization of a 254-kb genomic deletion on a duplicated chromosome segment that resulted in a low level of palmitic acid in soybean seeds using transcriptome sequencing. A large number of soybean genotypes varying in seed oil composition and content have been identified. Understanding the molecular mechanisms underlying these variations is important for breeders to effectively utilize them as a genetic resource. Through design and application of a bioinformatics approach, we identified nine co-regulated gene clusters by comparing seed transcriptomes of nine soybean genotypes varying in oil composition and content. We demonstrated that four gene clusters in the genotypes M23, Jack and N0304-303-3 coincided with large-scale genome rearrangements. The co-regulated gene clusters in M23 and Jack mapped to a previously described 164-kb deletion and a copy number amplification of the Rhg1 locus, respectively. The coordinately down-regulated gene clusters in N0304-303-3 were caused by a 254-kb deletion containing 19 genes including a fatty acyl-ACP thioesterase B gene (FATB1a). This deletion was associated with reduced palmitic acid content in seeds and was the molecular cause of a previously reported nonfunctional FATB1a allele, fap nc . The M23 and N0304-304-3 deletions were located in duplicated genome segments retained from the Glycine-specific whole genome duplication that occurred 13 million years ago. The homoeologous genes in these duplicated regions shared a strong similarity in both their encoded protein sequences and transcript accumulation levels, suggesting that they may have conserved and important functions in seeds. The functional conservation of homoeologous genes may result in genetic redundancy and gene dosage effects for their associated seed traits, explaining why the large deletion did not cause lethal effects or completely eliminate palmitic acid in N0304-303-3.
Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.
Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F
2009-01-01
Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Di Bartolo Daniel L
2012-07-01
Full Text Available Abstract Partial duplication and partial deletion of the short arm of chromosome 9 have each been reported in the literature as clinically recognizable syndromes. We present clinical, cytogenetic, and molecular findings on a five-week-old female infant with concomitant duplication and terminal deletion of the short arm of chromosome 9. To our knowledge ten such cases have previously been reported. Conventional cytogenetic analysis identified additional material on chromosome 9 at band p23. FISH analysis aided in determining the additional material consisted of an inverted duplication with a terminal deletion of the short arm. Microarray analysis confirmed this interpretation and further characterized the abnormality as a duplication of about 32.7 Mb, from 9p23 to 9p11.2, and a terminal deletion of about 11.5 Mb, from 9p24.3 to 9p23. The infant displayed characteristic features of Duplication 9p Syndrome (hypotonia, bulbous nose, single transverse palmar crease, cranial anomalies, as well as features associated with Deletion 9p Syndrome (flat nasal bridge, long philtrum, cardiac anomalies despite the deletion being distal to the reported critical region for this syndrome. This case suggests that there are genes or regulatory elements that lie outside of the reported critical region responsible for certain phenotypic features associated with Deletion 9p Syndrome. It also underscores the importance of utilizing array technology to precisely define abnormalities involving the short arm of 9p in order to further refine genotype/phenotype associations and to identify additional cases of duplication/deletion.
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2007-05-01
Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.
11p15 duplication and 13q34 deletion with Beckwith-Wiedemann syndrome and factor VII deficiency.
Jurkiewicz, Dorota; Kugaudo, Monika; Tańska, Anna; Wawrzkiewicz-Witkowska, Angelika; Tomaszewska, Agnieszka; Kucharczyk, Marzena; Cieślikowska, Agata; Ciara, Elżbieta; Krajewska-Walasek, Małgorzata
2015-06-01
Here we report a patient with 11p15.4p15.5 duplication and 13q34 deletion presenting with Beckwith-Wiedemann syndrome (BWS) and moderate deficiency of factor VII (FVII). The duplication was initially diagnosed on methylation-sensitive multiplex ligation-dependent probe amplification. Array comparative genome hybridization confirmed its presence and indicated a 13q34 distal deletion. The patient's clinical symptoms, including developmental delay and facial dysmorphism, were typical of BWS with paternal 11p15 trisomy. Partial 13q monosomy in this patient is associated with moderate deficiency of FVII and may also overlap with a few symptoms of paternal 11p15 trisomy such as developmental delay and some facial features. To our knowledge this is the first report of 11p15.4p15.5 duplication associated with deletion of 13q34 and FVII deficiency. Moreover, this report emphasizes the importance of detailed clinical as well as molecular examinations in patients with BWS features and developmental delay. © 2015 Japan Pediatric Society.
Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.
Directory of Open Access Journals (Sweden)
Qingyu Chen
Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.
Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.
Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin
2016-01-01
First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.
Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba
2016-02-01
Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Meiotic UV-sensitive mutant that causes deletion of duplications in neurospora
International Nuclear Information System (INIS)
Newmeyer, D.; Galeazzi, D.R.
1978-01-01
The meiotic-3 (mei-3) mutant of Neurospora crassa has several effects: (1) when homozygous, it almost completely blocks meiosis and ascospore formation, (2) it is sensitive to uv, (3) its growth is inhibited by histidine, and (4) it increases the instability of nontandem duplications. This was shown for duplications produced by five different rearrangements and was demonstrated by two different criteria. The effects on meiosis and duplication instability are expressed strongly at 25 0 ; the effects on sensitivity to uv and to histidine are expressed strongly at 38.5 0 but only slightly at 25 0 . Nevertheless, all four effects were shown to be due to a single gene. Mei-3 is not allelic with previously reported uv-sensitive mutants. Two other results were obtained that are not necessarily due to mei-3: (1) a cross involving mei-3 produced a new unlinked meiotic mutant, mei-4, which is not sensitive to uv or histidine, and (2) a burst of several new mutants occurred in a different mei-3 stock, including a partial revertant to mei-3. Mei-3 has previously been shown to cause frequent complete loss of a terminal duplicate segment, beginning exactly at the original rearrangement breakpoint. Possible mechanisms are discussed by which a uv-sensitive mutant could cause such precise deletions
Partial USH2A deletions contribute to Usher syndrome in Denmark.
Dad, Shzeena; Rendtorff, Nanna D; Kann, Erik; Albrechtsen, Anders; Mehrjouy, Mana M; Bak, Mads; Tommerup, Niels; Tranebjærg, Lisbeth; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth B
2015-12-01
Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment, progressive visual loss owing to retinitis pigmentosa and in some cases vestibular dysfunction. Usher syndrome is divided into three subtypes, USH1, USH2 and USH3. Twelve loci and eleven genes have so far been identified. Duplications and deletions in PCDH15 and USH2A that lead to USH1 and USH2, respectively, have previously been identified in patients from United Kingdom, Spain and Italy. In this study, we investigate the proportion of exon deletions and duplications in PCDH15 and USH2A in 20 USH1 and 30 USH2 patients from Denmark using multiplex ligation-dependent probe amplification (MLPA). Two heterozygous deletions were identified in USH2A, but no deletions or duplications were identified in PCDH15. Next-generation mate-pair sequencing was used to identify the exact breakpoints of the two deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.
Deletions, Inversions, Duplications: Engineering of Structural Variants using CRISPR/Cas in Mice
Directory of Open Access Journals (Sweden)
Katerina Kraft
2015-02-01
Full Text Available Structural variations (SVs contribute to the variability of our genome and are often associated with disease. Their study in model systems was hampered until now by labor-intensive genetic targeting procedures and multiple mouse crossing steps. Here we present the use of CRISPR/Cas for the fast (10 weeks and efficient generation of SVs in mice. We specifically produced deletions, inversions, and also duplications at six different genomic loci ranging from 1.1 kb to 1.6 Mb with efficiencies up to 42%. After PCR-based selection, clones were successfully used to create mice via aggregation. To test the practicability of the method, we reproduced a human 500 kb disease-associated deletion and were able to recapitulate the human phenotype in mice. Furthermore, we evaluated the regulatory potential of a large genomic interval by deleting a 1.5 Mb fragment. The method presented permits rapid in vivo modeling of genomic rearrangements.
Reciprocal deletion and duplication at 2q23.1 indicates a role for MBD5 in autism spectrum disorder.
Mullegama, Sureni V; Rosenfeld, Jill A; Orellana, Carmen; van Bon, Bregje W M; Halbach, Sara; Repnikova, Elena A; Brick, Lauren; Li, Chumei; Dupuis, Lucie; Rosello, Monica; Aradhya, Swaroop; Stavropoulos, D James; Manickam, Kandamurugu; Mitchell, Elyse; Hodge, Jennelle C; Talkowski, Michael E; Gusella, James F; Keller, Kory; Zonana, Jonathan; Schwartz, Stuart; Pyatt, Robert E; Waggoner, Darrel J; Shaffer, Lisa G; Lin, Angela E; de Vries, Bert B A; Mendoza-Londono, Roberto; Elsea, Sarah H
2014-01-01
Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.
Zevering, C E; Moritz, C; Heideman, A; Sturm, R A
1991-11-01
Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.
Mulle, Jennifer Gladys; Pulver, Ann E; McGrath, John A; Wolyniec, Paula S; Dodd, Anne F; Cutler, David J; Sebat, Jonathan; Malhotra, Dheeraj; Nestadt, Gerald; Conrad, Donald F; Hurles, Matthew; Barnes, Chris P; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F; Gejman, Pablo V; Sanders, Alan R; Duan, Jubao; Mitchell, Adele A; Peter, Inga; Sklar, Pamela; O'Dushlaine, Colm T; Grozeva, Detelina; O'Donovan, Michael C; Owen, Michael J; Hultman, Christina M; Kähler, Anna K; Sullivan, Patrick F; Kirov, George; Warren, Stephen T
2014-03-01
Several copy number variants (CNVs) have been implicated as susceptibility factors for schizophrenia (SZ). Some of these same CNVs also increase risk for autism spectrum disorders, suggesting an etiologic overlap between these conditions. Recently, de novo duplications of a region on chromosome 7q11.23 were associated with autism spectrum disorders. The reciprocal deletion of this region causes Williams-Beuren syndrome. We assayed an Ashkenazi Jewish cohort of 554 SZ cases and 1014 controls for genome-wide CNV. An excess of large rare and de novo CNVs were observed, including a 1.4 Mb duplication on chromosome 7q11.23 identified in two unrelated patients. To test whether this 7q11.23 duplication is also associated with SZ, we obtained data for 14,387 SZ cases and 28,139 controls from seven additional studies with high-resolution genome-wide CNV detection. We performed a meta-analysis, correcting for study population of origin, to assess whether the duplication is associated with SZ. We found duplications at 7q11.23 in 11 of 14,387 SZ cases with only 1 in 28,139 control subjects (unadjusted odds ratio 21.52, 95% confidence interval: 3.13-922.6, p value 5.5 × 10(-5); adjusted odds ratio 10.8, 95% confidence interval: 1.46-79.62, p value .007). Of three SZ duplication carriers with detailed retrospective data, all showed social anxiety and language delay premorbid to SZ onset, consistent with both human studies and animal models of the 7q11.23 duplication. We have identified a new CNV associated with SZ. Reciprocal duplication of the Williams-Beuren syndrome deletion at chromosome 7q11.23 confers an approximately tenfold increase in risk for SZ. Copyright © 2014 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion
Directory of Open Access Journals (Sweden)
Shao Mingfu
2012-12-01
Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.
Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert
2009-07-01
Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.
Fast detection of deletion breakpoints using quantitative PCR
Directory of Open Access Journals (Sweden)
Gulshara Abildinova
2016-01-01
Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.
Devillard, Françoise; Guinchat, Vincent; Moreno-De-Luca, Daniel; Tabet, Anne-Claude; Gruchy, Nicolas; Guillem, Pascale; Nguyen Morel, Marie-Ange; Leporrier, Nathalie; Leboyer, Marion; Jouk, Pierre-Simon; Lespinasse, James; Betancur, Catalina
2010-09-01
We describe a patient with autism and a paracentric inversion of chromosome 2q14.2q37.3, with a concurrent duplication of the proximal breakpoint at 2q14.1q14.2 and a deletion of the distal breakpoint at 2q37.3. The abnormality was derived from his mother with a balanced paracentric inversion. The inversion in the child appeared to be cytogenetically balanced but subtelomere FISH revealed a cryptic deletion at the 2q37.3 breakpoint. High-resolution single nucleotide polymorphism array confirmed the presence of a 3.5 Mb deletion that extended to the telomere, and showed a 4.2 Mb duplication at 2q14.1q14.2. FISH studies using a 2q14.2 probe showed that the duplicated segment was located at the telomeric end of chromosome 2q. This recombinant probably resulted from breakage of a dicentric chromosome. The child had autism, mental retardation, speech and language delay, hyperactivity, growth retardation with growth hormone deficiency, insulin-dependent diabetes, and mild facial dysmorphism. Most of these features have been previously described in individuals with simple terminal deletion of 2q37. Pure duplications of the proximal chromosome 2q are rare and no specific syndrome has been defined yet, so the contribution of the 2q14.1q14.2 duplication to the phenotype of the patient is unknown. These findings underscore the need to explore apparently balanced chromosomal rearrangements inherited from a phenotypically normal parent in subjects with autism and/or developmental delay. In addition, they provide further evidence indicating that chromosome 2q terminal deletions are among the most frequently reported cytogenetic abnormalities in individuals with autism.
Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J
1998-08-01
Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.
Crespi, Bernard J; Procyshyn, Tanya L
2017-08-01
We describe and evaluate an integrative hypothesis for helping to explain the major neurocognitive features of individuals with Williams syndrome region deletions and duplications. First, we demonstrate how the cognitive differences between Williams syndrome individuals, individuals with duplications of this region, and healthy individuals parallel the differences between individuals subject to effects of increased or decreased oxytocin. Second, we synthesize evidence showing that variation in expression of the gene GTF2I (General Transcription Factor II-I) underlies the primary social phenotypes of Williams syndrome and that common genetic variation in GTF2I mediates oxytocin reactivity, and its correlates, in healthy populations. Third, we describe findings relevant to the hypothesis that the GTF2I gene is subject to parent of origin effects whose behavioral expression fits with predictions from the kinship theory of genomic imprinting. Fourth, we describe how Williams syndrome can be considered, in part, as an autistic syndrome of Lorna Wing's 'active-but-odd' autism subtype, in contrast to associations of duplications with both schizophrenia and autism. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Praveen Baskaran
Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.
Armour, Christine M; McGowan-Jordan, Jean; Lawrence, Sarah E; Bouchard, Amélie; Basik, Mark; Allanson, Judith E
2008-01-01
We report on a girl with partial deletion of Xp and partial duplication of 22q. Family studies demonstrate that both the patient's mother and her nonidentical twin sister carry the corresponding balanced translocation; 46,X,t(X;22)(p11.4;q11.2). This girl has developmental delay, microcephaly, mild dysmorphisms and hearing loss but otherwise shows few of the features described in individuals with duplications of the long arm of chromosome 22. She does manifest characteristics, such as short stature and biochemical evidence of ovarian failure, which are seen in partial or complete Xp deletions and Turner's syndrome.
Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR
Energy Technology Data Exchange (ETDEWEB)
Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)
1994-09-01
Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.
Stevens, Servi J C; Blom, Eveline W; Siegelaer, Ingrid T J; Smeets, Eric E J G L
2015-04-01
We identified an identical and recurrent 9.4-Mbp deletion at chromosome bands 2p11.2-2p12, which occurred de novo in two unrelated patients. It is flanked at the distal and proximal breakpoints by two homologous segmental duplications consisting of low copy repeat (LCR) blocks in direct orientation, which have >99% sequence identity. Despite the fact that the deletion was almost 10 Mbp in size, the patients showed a relatively mild clinical phenotype, that is, mild-to-moderate intellectual disability, a happy disposition, speech delay and delayed motor development. Their phenotype matches with that of previously described patients. The 2p11.2-2p12 deletion includes the REEP1 gene that is associated with spastic paraplegia and phenotypic features related to this are apparent in most 2p11.2-2p12 deletion patients, but not in all. Other hemizygous genes that may contribute to the clinical phenotype include LRRTM1 and CTNNA2. We propose a recurrent but rare 2p11.2-2p12 deletion syndrome based on (1) the identical, non-random localisation of the de novo deletion breakpoints in two unrelated patients and a patient from literature, (2) the patients' phenotypic similarity and their phenotypic overlap with other 2p deletions and (3) the presence of highly identical LCR blocks flanking both breakpoints, consistent with a non-allelic homologous recombination (NAHR)-mediated rearrangement.
Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut
2015-09-15
Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.
Directory of Open Access Journals (Sweden)
Michael H. Kohn
2008-01-01
Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.
Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.
Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C
2010-12-20
Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.
Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures
Directory of Open Access Journals (Sweden)
Kesterson Robert A
2003-04-01
Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.
Ha, Kyungsoo; Shen, Yiping; Graves, Tyler; Kim, Cheol-Hee; Kim, Hyung-Goo
2016-01-01
1q21 microdeletion syndrome is a rare contiguous gene deletion disorder with de novo or autosomal dominant inheritance patterns and its phenotypic features include intellectual disability, distinctive facial dysmorphism, microcephaly, cardiac abnormalities, and cataracts. MECP2 duplication syndrome is an X-linked recessive neurodevelopmental disorder characterized by intellectual disability, global developmental delay, and other neurological complications including late-onset seizures. Previously, these two different genetic syndromes have not been reported segregating independently in a same family. Here we describe two siblings carrying either a chromosome 1q21 microdeletion or a chromosome Xq28 duplication. Using a comparative genomic hybridization (CGH) array, we identified a 1.24 Mb heterozygous deletion at 1q21 resulting in the loss of 9 genes in a girl with learning disability, hypothyroidism, short stature, sensory integration disorder, and soft dysmorphic features including cupped ears and a unilateral ear pit. We also characterized a 508 kb Xq28 duplication encompassing MECP2 in her younger brother with hypotonia, poor speech, cognitive and motor impairment. The parental CGH and quantitative PCR (qPCR) analyses revealed that the 1q21 deletion in the elder sister is de novo , but the Xq28 duplication in the younger brother was originally inherited from the maternal grandmother through the mother, both of whom are asymptomatic carriers. RT-qPCR assays revealed that the affected brother has almost double the amount of MECP2 mRNA expression compared to other family members of both genders including maternal grandmother and mother who have the same Xq28 duplication with no phenotype. This suggests the X chromosome with an Xq28 duplication in the carrier females is preferentially silenced. From our understanding, this would be the first report showing the independent segregation of two genetically unrelated syndromes, 1q21 microdeletion and Xq28 duplication
DEFF Research Database (Denmark)
Rasmussen, Maria; Vestergaard, Else Marie; Graakjaer, Jesper
2016-01-01
deletions and 26 phenotyped patients with 17q12 duplications. The total cohort includes 19 index patients and 19 family members. We also reviewed the literature in order to further improve the basis for the counseling. We emphasize that renal disease, learning disability, behavioral abnormalities, epilepsy...... a variable degree of learning disabilities, delayed language development, delayed motor milestones, and a broad range of psychiatric and neurological features. This patient group also included adults achieving an academic degree. Assessing index patients and non-index patients separately, our observations...... illustrate that an overall milder disease burden is seen, in particular in patients with 17q12 duplications who are ascertained on the duplication rather than the phenotype. This evidence may be useful in prenatal counseling...
Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.
Directory of Open Access Journals (Sweden)
Mohammed Uddin
Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.
Directory of Open Access Journals (Sweden)
Bergthorsson Ulfar
2011-09-01
Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.
Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee
2011-11-01
Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.
Directory of Open Access Journals (Sweden)
Lall Meena
2011-09-01
Full Text Available Abstract Background Partial Trisomy 11q syndrome (or Duplication 11q has defined clinical features and is documented as a rare syndrome by National Organization of Rare Disorders (NORD. Deletion 1q44 (or Monosomy 1q44 is a well-defined syndrome, but there is controversy about the genes lying in 1q44 region, responsible for agenesis of the corpus callosum. We report a female child with the rare Partial Trisomy 11q syndrome and Deletion 1q44 syndrome. The genomic imbalance in the proband was used for molecular characterization of the critical genes in 1q44 region for agenesis of corpus callosum. Some genes in 11q14q25 may be responsible for laryngomalacia. Results We report a female child with dysmorphic features, microcephaly, growth retardation, seizures, acyanotic heart disease, and hand and foot deformities. She had agenesis of corpus callosum, laryngomalacia, anterior ectopic anus, esophageal reflux and respiratory distress. Chromosome analysis revealed a derivative chromosome 1. Her karyotype was 46,XX,der(1t(1;11(q44;q14pat. The mother had a normal karyotype and the karyotype of the father was 46,XY,t(1;11(q44;q14. SNP array analysis showed that the proband had a 54 Mb duplication of 11q14q25 and a 0.9 Mb deletion of the submicroscopic subtelomeric 1q44 region. Fluorescence Insitu Hybridisation confirmed the duplication of 11qter and deletion of 1qter. Conclusion Laryngomalacia or obstruction of the upper airway is the outcome of increased dosage of some genes due to Partial Trisomy 11q Syndrome. In association with other phenotypic features, agenesis of corpus callosum appears to be a landmark phenotype for Deletion 1q44 syndrome, the critical genes lying proximal to SMYD3 in 1q44 region.
Analysis Of Segmental Duplications In The Pig Genome Based On Next-Generation Sequencing
DEFF Research Database (Denmark)
Fadista, João; Bendixen, Christian
Segmental duplications are >1kb segments of duplicated DNA present in a genome with high sequence identity (>90%). They are associated with genomic rearrangements and provide a significant source of gene and genome evolution within mammalian genomes. Although segmental duplications have been...... extensively studied in other organisms, its analysis in pig has been hampered by the lack of a complete pig genome assembly. By measuring the depth of coverage of Illumina whole-genome shotgun sequencing reads of the Tabasco animal aligned to the latest pig genome assembly (Sus scrofa 10 – based also...... and their associated copy number alterations, focusing on the global organization of these segments and their possible functional significance in porcine phenotypes. This work provides insights into mammalian genome evolution and generates a valuable resource for porcine genomics research...
Directory of Open Access Journals (Sweden)
Martin M Johansson
Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in
Noh, Hyun Ji; Ponting, Chris P; Boulding, Hannah C; Meader, Stephen; Betancur, Catalina; Buxbaum, Joseph D; Pinto, Dalila; Marshall, Christian R; Lionel, Anath C; Scherer, Stephen W; Webber, Caleb
2013-06-01
Autism Spectrum Disorders (ASD) are highly heritable and characterised by impairments in social interaction and communication, and restricted and repetitive behaviours. Considering four sets of de novo copy number variants (CNVs) identified in 181 individuals with autism and exploiting mouse functional genomics and known protein-protein interactions, we identified a large and significantly interconnected interaction network. This network contains 187 genes affected by CNVs drawn from 45% of the patients we considered and 22 genes previously implicated in ASD, of which 192 form a single interconnected cluster. On average, those patients with copy number changed genes from this network possess changes in 3 network genes, suggesting that epistasis mediated through the network is extensive. Correspondingly, genes that are highly connected within the network, and thus whose copy number change is predicted by the network to be more phenotypically consequential, are significantly enriched among patients that possess only a single ASD-associated network copy number changed gene (p = 0.002). Strikingly, deleted or disrupted genes from the network are significantly enriched in GO-annotated positive regulators (2.3-fold enrichment, corrected p = 2×10(-5)), whereas duplicated genes are significantly enriched in GO-annotated negative regulators (2.2-fold enrichment, corrected p = 0.005). The direction of copy change is highly informative in the context of the network, providing the means through which perturbations arising from distinct deletions or duplications can yield a common outcome. These findings reveal an extensive ASD-associated molecular network, whose topology indicates ASD-relevant mutational deleteriousness and that mechanistically details how convergent aetiologies can result extensively from CNVs affecting pathways causally implicated in ASD.
The Sequence and Analysis of Duplication Rich Human Chromosome 16
Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.
2004-01-01
We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.
The sequence and analysis of duplication rich human chromosome 16
Energy Technology Data Exchange (ETDEWEB)
Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.
2004-08-01
We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.
Quelin, Chloe; Spaggiari, Emmanuel; Khung-Savatovsky, Suonavy; Dupont, Celine; Pasquier, Laurent; Loeuillet, Laurence; Jaillard, Sylvie; Lucas, Josette; Marcorelles, Pascale; Journel, Hubert; Pluquailec-Bilavarn, Khantaby; Bazin, Anne; Verloes, Alain; Delezoide, Anne-Lise; Aboura, Azzedine; Guimiot, Fabien
2014-10-01
Inversion duplication and terminal deletion of the long arm of chromosome 13 (inv dup del 13q) is a rare chromosomal rearrangement: only five patients have been reported, mostly involving a ring chromosome 13. We report on additional three fetuses with pure inv dup del 13q: Patient 1 had macrosomia, enlarged kidneys, hypersegmented lungs, unilateral moderate ventriculomegaly, and a mild form of hand and feet preaxial polydactyly; Patient 2 had intrauterine growth retardation, widely spaced eyes, left microphthalmia, right anophthalmia, short nose, bilateral absent thumbs, cutaneous syndactyly of toes 4 and 5, bifid third metacarpal, a small left kidney, hyposegmented lungs, and partial agenesis of the corpus callosum; Patient 3 had widely spaced eyes, long and smooth philtrum, low-set ears, median notch in the upper alveolar ridge, bifid tongue, cutaneous syndactyly of toes 2 and 3, enlarged kidneys and pancreas, arhinencephaly, and partial agenesis of the corpus callosum. We compared the phenotypes of these patients to those previously reported for ring chromosome 13, pure 13q deletions and duplications. We narrowed some critical regions previously reported for lung, kidney and fetal growth, and for thumb, cerebral, and eye anomalies. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Chih-Ping Chen
2015-06-01
Conclusion: Simultaneous occurrence of 7q deletion and 3p duplication can be associated with alobar holoprosencephaly. For the couple with a parental translocation involving 7q and 3p, prenatal ultrasound should include a detailed investigation of central nervous system anomalies.
Utilization of deletion bins to anchor and order sequences along the wheat 7B chromosome.
Belova, Tatiana; Grønvold, Lars; Kumar, Ajay; Kianian, Shahryar; He, Xinyao; Lillemo, Morten; Springer, Nathan M; Lien, Sigbjørn; Olsen, Odd-Arne; Sandve, Simen R
2014-09-01
A total of 3,671 sequence contigs and scaffolds were mapped to deletion bins on wheat chromosome 7B providing a foundation for developing high-resolution integrated physical map for this chromosome. Bread wheat (Triticum aestivum L.) has a large, complex and highly repetitive genome which is challenging to assemble into high quality pseudo-chromosomes. As part of the international effort to sequence the hexaploid bread wheat genome by the international wheat genome sequencing consortium (IWGSC) we are focused on assembling a reference sequence for chromosome 7B. The successful completion of the reference chromosome sequence is highly dependent on the integration of genetic and physical maps. To aid the integration of these two types of maps, we have constructed a high-density deletion bin map of chromosome 7B. Using the 270 K Nimblegen comparative genomic hybridization (CGH) array on a set of cv. Chinese spring deletion lines, a total of 3,671 sequence contigs and scaffolds (~7.8 % of chromosome 7B physical length) were mapped into nine deletion bins. Our method of genotyping deletions on chromosome 7B relied on a model-based clustering algorithm (Mclust) to accurately predict the presence or absence of a given genomic sequence in a deletion line. The bin mapping results were validated using three different approaches, viz. (a) PCR-based amplification of randomly selected bin mapped sequences (b) comparison with previously mapped ESTs and (c) comparison with a 7B genetic map developed in the present study. Validation of the bin mapping results suggested a high accuracy of the assignment of 7B sequence contigs and scaffolds to the 7B deletion bins.
Recurrent deletion of ZNF630 at Xp11.23 is not associated with mental retardation
DEFF Research Database (Denmark)
Lugtenberg, Dorien; Zangrande-Vieira, Luiz; Kirchhoff, Maria
2010-01-01
12 ZNF630 deletions in a total of 1,562 male patients with mental retardation from Brazil, USA, Australia, and Europe. The breakpoints were analyzed in 10 families, and in all cases they were located within two segmental duplications that share more than 99% sequence identity, indicating...
Mun, Se Jin; Cho, Eun Hae; Chey, Myoung-Jae; Shim, Gyu-Hong; Shin, Bo-Moon; Lee, Rae-Kyung; Ko, Ji-Kyung; Yoo, Soo Jin
2010-02-01
Pericentric inversion of chromosome 4 can give rise to 2 alternate recombinant (rec) chromosomesby duplication or deletion of 4p. The deletion of distal 4p manifests as Wolf-Hirschhorn syndrome (WHS). Here, we report the molecular cytogenetic findings and clinical manifestations observed in an infant with 46,XX,rec(4)dup(4q)inv(4)(p16q31.3)pat. The infant was delivered by Cesarean section at the 33rd week of gestation because pleural effusion and polyhydramnios were detected on ultrasonography. At birth, the infant showed no malformation or dysfunction, except for a preauricular skin tag. Array comparative genomic hybridization analysis of neonatal peripheral blood samples showed a gain of 38 Mb on 4q31.3-qter and a loss of 3 Mb on 4p16.3, and these results were consistent with WHS. At the last follow-up at 8 months of age (corrected age, 6 months), the infant had not achieved complete head control.
Defining the Effect of the 16p11.2 Duplication on Cognition, Behavior, and Medical Comorbidities
D’Angelo, Debra; Lebon, Sébastien; Chen, Qixuan; Martin-Brevet, Sandra; Snyder, LeeAnne Green; Hippolyte, Loyse; Hanson, Ellen; Maillard, Anne M.; Faucett, W. Andrew; Macé, Aurélien; Pain, Aurélie; Bernier, Raphael; Chawner, Samuel J. R. A.; David, Albert; Andrieux, Joris; Aylward, Elizabeth; Baujat, Genevieve; Caldeira, Ines; Conus, Philippe; Ferrari, Carrina; Forzano, Francesca; Gérard, Marion; Goin-Kochel, Robin P.; Grant, Ellen; Hunter, Jill V.; Isidor, Bertrand; Jacquette, Aurélia; Jønch, Aia E.; Keren, Boris; Lacombe, Didier; Caignec, Cédric Le; Martin, Christa Lese; Männik, Katrin; Metspalu, Andres; Mignot, Cyril; Mukherjee, Pratik; Owen, Michael J.; Passeggeri, Marzia; Rooryck-Thambo, Caroline; Rosenfeld, Jill A.; Spence, Sarah J.; Steinman, Kyle J.; Tjernagel, Jennifer; Van Haelst, Mieke; Shen, Yiping; Draganski, Bogdan; Sherr, Elliott H.; Ledbetter, David H.; van den Bree, Marianne B. M.; Beckmann, Jacques S.; Spiro, John E.; Reymond, Alexandre; Jacquemont, Sébastien; Chung, Wendy K.
2018-01-01
IMPORTANCE The 16p11.2 BP4-BP5 duplication is the copy number variant most frequently associated with autism spectrum disorder (ASD), schizophrenia, and comorbidities such as decreased body mass index (BMI). OBJECTIVES To characterize the effects of the 16p11.2 duplication on cognitive, behavioral, medical, and anthropometric traits and to understand the specificity of these effects by systematically comparing results in duplication carriers and reciprocal deletion carriers, who are also at risk for ASD. DESIGN, SETTING, AND PARTICIPANTS This international cohort study of 1006 study participants compared 270 duplication carriers with their 102 intrafamilial control individuals, 390 reciprocal deletion carriers, and 244 deletion controls from European and North American cohorts. Data were collected from August 1, 2010, to May 31, 2015 and analyzed from January 1 to August 14, 2015. Linear mixed models were used to estimate the effect of the duplication and deletion on clinical traits by comparison with noncarrier relatives. MAIN OUTCOMES AND MEASURES Findings on the Full-Scale IQ (FSIQ), Nonverbal IQ, and Verbal IQ; the presence of ASD or other DSM-IV diagnoses; BMI; head circumference; and medical data. RESULTS Among the 1006 study participants, the duplication was associated with a mean FSIQ score that was lower by 26.3 points between proband carriers and noncarrier relatives and a lower mean FSIQ score (16.2-11.4 points) in nonproband carriers. The mean overall effect of the deletion was similar (−22.1 points; P 100) compared with the deletion group (P < .001). Parental FSIQ predicted part of this variation (approximately 36.0% in hereditary probands). Although the frequency of ASD was similar in deletion and duplication proband carriers (16.0% and 20.0%, respectively), the FSIQ was significantly lower (by 26.3 points) in the duplication probands with ASD. There also were lower head circumference and BMI measurements among duplication carriers, which is
Piccione, Maria; Salzano, Emanuela; Vecchio, Davide; Ferrara, Dante; Malacarne, Michela; Pierluigi, Mauro; Ferrara, Ines; Corsello, Giovanni
2015-07-01
Microscopically chromosome rearrangements of the short arm of chromosome 4 include the two known clinical entities: partial trisomy 4p and deletions of the Wolf-Hirschhorn critical regions 1 and 2 (WHSCR-1 and WHSCR-2, respectively), which cause cranio-facial anomalies, congenital malformations and developmental delay/intellectual disability. We report on clinical findings detected in a Chinese patient with a de novo 4p16.1-p15.32 duplication in association with a subtle 4p terminal deletion of 6 Mb in size. This unusual chromosome imbalance resulted in WHS classical phenotype, while clinical manifestations of 4p trisomy were practically absent. This observation suggests the hypothesis that haploinsufficiency of sensitive dosage genes with regulatory function placed in WHS critical region, is more pathogenic than concomitant 4p duplicated segment. Additionally clinical findings in our patient confirm a variable penetrance of major malformations and neurological features in Chinese children despite of WHS critical region's deletion. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
Insights into three whole-genome duplications gleaned from the Paramecium caudatum genome sequence.
McGrath, Casey L; Gout, Jean-Francois; Doak, Thomas G; Yanagi, Akira; Lynch, Michael
2014-08-01
Paramecium has long been a model eukaryote. The sequence of the Paramecium tetraurelia genome reveals a history of three successive whole-genome duplications (WGDs), and the sequences of P. biaurelia and P. sexaurelia suggest that these WGDs are shared by all members of the aurelia species complex. Here, we present the genome sequence of P. caudatum, a species closely related to the P. aurelia species group. P. caudatum shares only the most ancient of the three WGDs with the aurelia complex. We found that P. caudatum maintains twice as many paralogs from this early event as the P. aurelia species, suggesting that post-WGD gene retention is influenced by subsequent WGDs and supporting the importance of selection for dosage in gene retention. The availability of P. caudatum as an outgroup allows an expanded analysis of the aurelia intermediate and recent WGD events. Both the Guanine+Cytosine (GC) content and the expression level of preduplication genes are significant predictors of duplicate retention. We find widespread asymmetrical evolution among aurelia paralogs, which is likely caused by gradual pseudogenization rather than by neofunctionalization. Finally, cases of divergent resolution of intermediate WGD duplicates between aurelia species implicate this process acts as an ongoing reinforcement mechanism of reproductive isolation long after a WGD event. Copyright © 2014 by the Genetics Society of America.
Exploration of methods to localize DNA sequences missing from c-locus deletions
International Nuclear Information System (INIS)
Albritton, L.M.; Russell, L.B.; Montgomery, C.S.
1987-01-01
The authors have earlier characterized a large number of radiation-induced mutations at the c locus (on Chromosome 7) through genetic analysis, including extensive complementation tests. Based on this work, they have postulated that many of these mutations are deletions of various lengths, overlapping at c (the marker used in the mutation-rate experiments that generated the mutants). It was possible to apportion these deletions among 13 complementation groups and to fit them to a linear map of 8 functional units. Collectively, the deletions extend from a point between tp and c to one between sh-1 and Hbb, i.e., a genetic distance of from 6 to 10 cM, corresponding to at least 10 4 Kb of DNA. This year, the authors completed a pilot study designed to explore methods for finding DNA sequences that map to the region covered by the various c-deletions. The general plan was to probe DNA with clones derived from Chromosome-7-enriched libraries or with sequences known (or suspected) to reside in Chromosome 7. Three methods were explored for deriving the c-region-deficient DNA: (a) from mouse-hamster somatic-cell hydrids retaining a deleted mouse Chromosome 7, but no homologue; (b) from F 1 hybrids of M. musculus domesticus (carrying a c-locus deletion) by M. spretus; and (c) from F 1 hybrids of M. domesticus stocks carrying complementing deletions
Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.
Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya
2014-08-01
We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.
A molecularly defined duplication set for the X chromosome of Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.
2010-07-22
We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.
The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.
Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J
2013-01-01
Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.
Characterization of the past and current duplication activities in the human 22q11.2 region
Directory of Open Access Journals (Sweden)
Morrow Bernice
2011-01-01
Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.
DEFF Research Database (Denmark)
Limborg, Morten; Seeb, Lisa W.; Seeb, J. E.
2016-01-01
Many plants and animals of polyploid origin are currently enjoying a genomics explosion enabled by modern sequencing and genotyping technologies. However, routine filtering of duplicated loci in most studies using genotyping by sequencing introduces an unacceptable, but often overlooked, bias when...... particularly stress the sometimes overlooked fact that basing genomic studies on dense maps provides value added in the form of locating and annotating outlier loci or colocating outliers into islands of divergenc...
Directory of Open Access Journals (Sweden)
Matthew A Carrigan
Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates
Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J
2002-01-01
The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel
A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.
Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C
2010-12-01
We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.
Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J
2010-10-15
Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.
Kuroda, Yukiko; Ohashi, Ikuko; Naruto, Takuya; Ida, Kazumi; Enomoto, Yumi; Saito, Toshiyuki; Nagai, Jun-Ichi; Kurosawa, Kenji
2018-03-09
Ehlers-Danlos syndrome classical type is a connective tissue disorder characterized by skin hyperextensibility, atrophic scarring, and joint hypermobility. The condition typically results from mutations in COL5A1 or COL5A2 leading to the functional haploinsufficiency. Here, we report of a 24-year-old male with mild intellectual disability, dysmorphic features, and a phenotype consistent with Ehlers-Danlos syndrome classical type. A copy number variant-calling algorithm from panel sequencing data identified the deletions exons 2-11 and duplications of exons 12-67 within COL5A1. Array comparative genomic hybridization confirmed a 94 kb deletion at 9q34.3 involving exons 2-11 of COL5A1, and a 3.4 Mb duplication at 9q34.3 involving exons 12-67 of COL5A1. © 2018 Japanese Teratology Society.
Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene
Directory of Open Access Journals (Sweden)
Kane L Greer
2014-01-01
Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.
Sagar, Angela; Pinto, Dalila; Najjar, Fedra; Guter, Stephen J; Macmillan, Carol; Cook, Edwin H
2017-06-01
Chromosomal abnormalities, such as unbalanced translocations and copy number variants (CNVs), are found in autism spectrum disorders (ASDs) [Sanders et al. (2011) Neuron 70: 863-885]. Many chromosomal abnormalities, including sub microscopic genomic deletions and duplications, are missed by G-banded karyotyping or Fragile X screening alone and are picked up by chromosomal microarrays [Shen et al. (2010) Pediatrics 125: e727-735]. Translocations involving chromosomes 4 and 8 are possibly the second most frequent translocation in humans and are often undetected in routine cytogenetics [Giglio et al. (2002) Circulation 102: 432-437]. Deletions of 4p16 have been associated with Wolf-Hirschhorn syndrome while 4p16 duplications have been associated with an overgrowth syndrome and mild to moderate mental retardation [Partington et al. (1997) Journal of Medical Genetics 34: 719-728]. The 8p23.3 region contains the autism candidate gene DLGAP2, which can contribute to autism when disrupted [Marshall et al. (2008) The American Journal of Human Genetics 82: 477-488] . There has been a case report of a family with autism spectrum disorder (ASD), prominent obsessional behavior, and overgrowth in patients with der (8) t (4;8) p (16;23) [Partington et al. (1997)]. This is an independent report of a male patient with autism, obsessive compulsive disorder (OCD), attention-deficit hyperactivity disorder (ADHD), and an overgrowth syndrome, whose de novo unbalanced translocation der (8) t (4;8) p (16.1→ter; 23.1→ter) was initially missed by routine cytogenetics but detected with SNP microarray, allowing higher resolution of translocation breakpoints. © 2017 Wiley Periodicals, Inc.
Targeted Genome Sequencing Reveals Varicella-Zoster Virus Open Reading Frame 12 Deletion.
Cohrs, Randall J; Lee, Katherine S; Beach, Addilynn; Sanford, Bridget; Baird, Nicholas L; Como, Christina; Graybill, Chiharu; Jones, Dallas; Tekeste, Eden; Ballard, Mitchell; Chen, Xiaomi; Yalacki, David; Frietze, Seth; Jones, Kenneth; Lenac Rovis, Tihana; Jonjić, Stipan; Haas, Jürgen; Gilden, Don
2017-10-15
The neurotropic herpesvirus varicella-zoster virus (VZV) establishes a lifelong latent infection in humans following primary infection. The low abundance of VZV nucleic acids in human neurons has hindered an understanding of the mechanisms that regulate viral gene transcription during latency. To overcome this critical barrier, we optimized a targeted capture protocol to enrich VZV DNA and cDNA prior to whole-genome/transcriptome sequence analysis. Since the VZV genome is remarkably stable, it was surprising to detect that VZV32, a VZV laboratory strain with no discernible growth defect in tissue culture, contained a 2,158-bp deletion in open reading frame (ORF) 12. Consequently, ORF 12 and 13 protein expression was abolished and Akt phosphorylation was inhibited. The discovery of the ORF 12 deletion, revealed through targeted genome sequencing analysis, points to the need to authenticate the VZV genome when the virus is propagated in tissue culture. IMPORTANCE Viruses isolated from clinical samples often undergo genetic modifications when cultured in the laboratory. Historically, VZV is among the most genetically stable herpesviruses, a notion supported by more than 60 complete genome sequences from multiple isolates and following multiple in vitro passages. However, application of enrichment protocols to targeted genome sequencing revealed the unexpected deletion of a significant portion of VZV ORF 12 following propagation in cultured human fibroblast cells. While the enrichment protocol did not introduce bias in either the virus genome or transcriptome, the findings indicate the need for authentication of VZV by sequencing when the virus is propagated in tissue culture. Copyright © 2017 American Society for Microbiology.
Recurrent duplications of 17q12 associated with variable phenotypes
DEFF Research Database (Denmark)
Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne
2015-01-01
The ability to identify the clinical nature of the recurrent duplication of chromosome 17q12 has been limited by its rarity and the diverse range of phenotypes associated with this genomic change. In order to further define the clinical features of affected patients, detailed clinical information......, potentially contributory copy number changes in a subset of patients, including one patient each with 16p11.2 deletion and 15q13.3 deletion. Our data further define and expand the clinical spectrum associated with duplications of 17q12 and provide support for the role of genomic modifiers contributing...... to phenotypic variability....
Allam, Amin
2015-07-14
Motivation: Next-generation sequencing generates large amounts of data affected by errors in the form of substitutions, insertions or deletions of bases. Error correction based on the high-coverage information, typically improves de novo assembly. Most existing tools can correct substitution errors only; some support insertions and deletions, but accuracy in many cases is low. Results: We present Karect, a novel error correction technique based on multiple alignment. Our approach supports substitution, insertion and deletion errors. It can handle non-uniform coverage as well as moderately covered areas of the sequenced genome. Experiments with data from Illumina, 454 FLX and Ion Torrent sequencing machines demonstrate that Karect is more accurate than previous methods, both in terms of correcting individual-bases errors (up to 10% increase in accuracy gain) and post de novo assembly quality (up to 10% increase in NGA50). We also introduce an improved framework for evaluating the quality of error correction.
The duplication 17p13.3 phenotype
DEFF Research Database (Denmark)
Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica
2013-01-01
. Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....
Directory of Open Access Journals (Sweden)
Marion Ouedraogo
Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.
A conserved segmental duplication within ELA.
Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C
2010-12-01
The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.
Directory of Open Access Journals (Sweden)
Thomas Arbogast
2016-02-01
Full Text Available The 16p11.2 600 kb BP4-BP5 deletion and duplication syndromes have been associated with developmental delay; autism spectrum disorders; and reciprocal effects on the body mass index, head circumference and brain volumes. Here, we explored these relationships using novel engineered mouse models carrying a deletion (Del/+ or a duplication (Dup/+ of the Sult1a1-Spn region homologous to the human 16p11.2 BP4-BP5 locus. On a C57BL/6N inbred genetic background, Del/+ mice exhibited reduced weight and impaired adipogenesis, hyperactivity, repetitive behaviors, and recognition memory deficits. In contrast, Dup/+ mice showed largely opposite phenotypes. On a F1 C57BL/6N × C3B hybrid genetic background, we also observed alterations in social interaction in the Del/+ and the Dup/+ animals, with other robust phenotypes affecting recognition memory and weight. To explore the dosage effect of the 16p11.2 genes on metabolism, Del/+ and Dup/+ models were challenged with high fat and high sugar diet, which revealed opposite energy imbalance. Transcriptomic analysis revealed that the majority of the genes located in the Sult1a1-Spn region were sensitive to dosage with a major effect on several pathways associated with neurocognitive and metabolic phenotypes. Whereas the behavioral consequence of the 16p11 region genetic dosage was similar in mice and humans with activity and memory alterations, the metabolic defects were opposite: adult Del/+ mice are lean in comparison to the human obese phenotype and the Dup/+ mice are overweight in comparison to the human underweight phenotype. Together, these data indicate that the dosage imbalance at the 16p11.2 locus perturbs the expression of modifiers outside the CNV that can modulate the penetrance, expressivity and direction of effects in both humans and mice.
DEFF Research Database (Denmark)
Mesbah-Uddin, Md; Guldbrandtsen, Bernt; Lund, Mogens Sandø
2018-01-01
We presented a deletion genotyping (copy-number estimation) method that leverages population-scale whole genome sequence variants data from 1K bull genomes project (1KBGP) to build reference panel for imputation. To estimate deletion-genotype likelihood, we extracted read-depth (RD) data of all...
Lopez, Genghis H; Turner, Robyn M; McGowan, Eunike C; Schoeman, Elizna M; Scott, Stacy A; O'Brien, Helen; Millard, Glenda M; Roulis, Eileen V; Allen, Amanda J; Liew, Yew-Wah; Flower, Robert L; Hyland, Catherine A
2018-03-01
The RhD blood group antigen is extremely polymorphic and the DEL phenotype represents one such class of polymorphisms. The DEL phenotype prevalent in East Asian populations arises from a synonymous substitution defined as RHD*1227A. However, initially, based on genomic and cDNA studies, the genetic basis for a DEL phenotype in Taiwan was attributed to a deletion of RHD Exon 9 that was never verified at the genomic level by any other independent group. Here we investigate the genetic basis for a Caucasian donor with a DEL partial D phenotype and compare the genomic findings to those initial molecular studies. The 3'-region of the RHD gene was amplified by long-range polymerase chain reaction (PCR) for massively parallel sequencing. Primers were designed to encompass a deletion, flanking Exon 9, by standard PCR for Sanger sequencing. Targeted sequencing of exons and flanking introns was also performed. Genomic DNA exhibited a 1012-bp deletion spanning from Intron 8, across Exon 9 into Intron 9. The deletion breakpoints occurred between two 25-bp repeat motifs flanking Exon 9 such that one repeat sequence remained. Deletion mutations bordered by repeat sequences are a hallmark of slipped-strand mispairing (SSM) event. We propose this genetic mechanism generated the germline deletion in the Caucasian donor. Extensive studies show that the RHD*1227A is the most prevalent DEL allele in East Asian populations and may have confounded the initial molecular studies. Review of the literature revealed that the SSM model explains some of the extreme polymorphisms observed in the clinically significant RhD blood group antigen. © 2017 AABB.
Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy
Directory of Open Access Journals (Sweden)
van Ommen Gert-Jan B
2007-07-01
Full Text Available Abstract Background Antisense-mediated exon skipping is currently one of the most promising therapeutic approaches for Duchenne muscular dystrophy (DMD. Using antisense oligonucleotides (AONs targeting specific exons the DMD reading frame is restored and partially functional dystrophins are produced. Following proof of concept in cultured muscle cells from patients with various deletions and point mutations, we now focus on single and multiple exon duplications. These mutations are in principle ideal targets for this approach since the specific skipping of duplicated exons would generate original, full-length transcripts. Methods Cultured muscle cells from DMD patients carrying duplications were transfected with AONs targeting the duplicated exons, and the dystrophin RNA and protein were analyzed. Results For two brothers with an exon 44 duplication, skipping was, even at suboptimal transfection conditions, so efficient that both exons 44 were skipped, thus generating, once more, an out-of-frame transcript. In such cases, one may resort to multi-exon skipping to restore the reading frame, as is shown here by inducing skipping of exon 43 and both exons 44. By contrast, in cells from a patient with an exon 45 duplication we were able to induce single exon 45 skipping, which allowed restoration of wild type dystrophin. The correction of a larger duplication (involving exons 52 to 62, by combinations of AONs targeting the outer exons, appeared problematic due to inefficient skipping and mistargeting of original instead of duplicated exons. Conclusion The correction of DMD duplications by exon skipping depends on the specific exons targeted. Its options vary from the ideal one, restoring for the first time the true, wild type dystrophin, to requiring more 'classical' skipping strategies, while the correction of multi-exon deletions may need the design of tailored approaches.
Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E
2006-09-01
Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.
Directory of Open Access Journals (Sweden)
Yan Koon-Kiu
2007-11-01
Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga
Recurrent deletion of ZNF630 at Xp11.23 is not associated with mental retardation
DEFF Research Database (Denmark)
Lugtenberg, Dorien; Zangrande-Vieira, Luiz; Kirchhoff, Maria
2010-01-01
that the deletions resulted from non-allelic homologous recombination. In 2,121 healthy male controls, 10 ZNF630 deletions were identified. In total, there was a 1.6-fold higher frequency of this deletion in males with mental retardation as compared to controls, but this increase was not statistically significant (P......ZNF630 is a member of the primate-specific Xp11 zinc finger gene cluster that consists of six closely related genes, of which ZNF41, ZNF81, and ZNF674 have been shown to be involved in mental retardation. This suggests that mutations of ZNF630 might influence cognitive function. Here, we detected...... 12 ZNF630 deletions in a total of 1,562 male patients with mental retardation from Brazil, USA, Australia, and Europe. The breakpoints were analyzed in 10 families, and in all cases they were located within two segmental duplications that share more than 99% sequence identity, indicating...
International Nuclear Information System (INIS)
Nussbaum, R.L.; Lesko, J.G.; Lewis, R.A.; Ledbetter, S.A.; Ledbetter, D.H.
1987-01-01
Choroideremia, an X-chromosome linked retinal dystrophy of unknown pathogenesis, causes progressive nightblindness and eventual central blindness in affected males by the third to fourth decade of life. Choroideremia has been mapped to Xq13-21 by tight linkage to restriction fragment length polymorphism loci. The authors have recently identified two families in which choroideremia is inherited with mental retardation and deafness. In family XL-62, an interstitial deletion Xq21 is visible by cytogenetic analysis and two linked anonymous DNA markers, DXYS1 and DXS72, are deleted. In the second family, XL-45, an interstitial deletion was suspected on phenotypic grounds but could not be confirmed by high-resolution cytogenetic analysis. They used phenol-enhanced reassociation of 48,XXXX DNA in competition with excess XL-45 DNA to generate a library of cloned DNA enriched for sequences that might be deleted in XL-45. Two of the first 83 sequences characterized from the library were found to be deleted in probands from family XL-45 as well as from family XL-62. Isolation of these sequences proves that XL-45 does contain a submicroscopic deletion and provides a starting point for identifying overlapping genomic sequences that span the XL-45 deletion. Each overlapping sequence will be studied to identify exons from the choroideremia locus
Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang
2012-06-15
Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication
Deletion mutations of bacteriophage
International Nuclear Information System (INIS)
Ryo, Yeikou
1975-01-01
Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)
Autism Spectrum Disorder, Developmental and Psychiatric Features in 16p11.2 Duplication.
Green Snyder, LeeAnne; D'Angelo, Debra; Chen, Qixuan; Bernier, Raphael; Goin-Kochel, Robin P; Wallace, Arianne Stevens; Gerdts, Jennifer; Kanne, Stephen; Berry, Leandra; Blaskey, Lisa; Kuschner, Emily; Roberts, Timothy; Sherr, Elliot; Martin, Christa L; Ledbetter, David H; Spiro, John E; Chung, Wendy K; Hanson, Ellen
2016-08-01
The 16p11.2 duplication (BP4-BP5) is associated with Autism Spectrum Disorder (ASD), although significant heterogeneity exists. Quantitative ASD, behavioral and neuropsychological measures and DSM-IV diagnoses in child and adult carriers were compared with familial non-carrier controls, and to published results from deletion carriers. The 16p11.2 duplication phenotype ranges widely from asymptomatic presentation to significant disability. The most common diagnoses were intellectual disability, motor delays and Attention Deficit Hyperactivity Disorder in children, and anxiety in adults. ASD occurred in nearly 20 % of child cases, but a majority of carriers did not show the unique social features of ASD. The 16p11.2 duplication phenotype is characterized by wider variability than the reciprocal deletion, likely reflecting contributions from additional risk factors.
The complete sequence of human chromosome 5
Energy Technology Data Exchange (ETDEWEB)
Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, State; Gordon, Laurie A.; Scott, Duncan; Xie, Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan, Yee Man; Denys, Mirian; Detter, Chris; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstenin, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimbal, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou, Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar, Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang, Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, Susan M.; Myers, Richard M.; Rubin, Edward M.
2004-04-15
Chromosome 5 is one of the largest human chromosomes yet has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding and syntenic conservation with non-mammalian vertebrates, suggesting they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-encoding genes including the protocadherin and interleukin gene families and the first complete versions of each of the large chromosome 5 specific internal duplications. These duplications are very recent evolutionary events and play a likely mechanistic role, since deletions of these regions are the cause of debilitating disorders including spinal muscular atrophy (SMA).
Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc
2017-11-01
The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Partial USH2A deletions contribute to Usher syndrome in Denmark
DEFF Research Database (Denmark)
Dad, Shzeena; Rendtorff, Nanna Dahl; Kann, Erik
2015-01-01
deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.European Journal of Human Genetics advance online publication, 25 March 2015; doi:10.1038...
Kouprina, Natalay; Noskov, Vladimir N.; Waterfall, Joshua J.; Walker, Robert L.; Meltzer, Paul S.; Topol, Eric J.; Larionov, Vladimir
2018-01-01
Tandem segmental duplications (SDs) greater than 10 kb are widespread in complex genomes. They provide material for gene divergence and evolutionary adaptation, while formation of specific de novo SDs is a hallmark of cancer and some human diseases. Most SDs map to distinct genomic regions termed ‘duplication blocks’. SDs organization within these blocks is often poorly characterized as they are mosaics of ancestral duplicons juxtaposed with younger duplicons arising from more recent duplication events. Structural and functional analysis of SDs is further hampered as long repetitive DNA structures are underrepresented in existing BAC and YAC libraries. We applied Transformation-Associated Recombination (TAR) cloning, a versatile technique for large DNA manipulation, to selectively isolate the coronary artery disease (CAD) interval sequence within the 9p21.3 chromosome locus from a patient with coronary artery disease and normal individuals. Four tandem head-to-tail duplicons, each ∼50 kb long, were recovered in the patient but not in normal individuals. Sequence analysis revealed that the repeats varied by 10-15 SNPs between each other and by 82 SNPs between the human genome sequence (version hg19). SNPs polymorphism within the junctions between repeats allowed two junction types to be distinguished, Type 1 and Type 2, which were found at a 2:1 ratio. The junction sequences contained an Alu element, a sequence previously shown to play a role in duplication. Knowledge of structural variation in the CAD interval from more patients could help link this locus to cardiovascular diseases susceptibility, and maybe relevant to other cases of regional amplification, including cancer. PMID:29632643
Williams Syndrome and 15q Duplication: Coincidence versus Association.
Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila
2017-01-01
Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.
Coexistence of 9p Deletion Syndrome and Autism Spectrum Disorder
Günes, Serkan; Ekinci, Özalp; Ekinci, Nuran; Toros, Fevziye
2017-01-01
Deletion or duplication of the short arm of chromosome 9 may lead to a variety of clinical conditions including craniofacial and limb abnormalities, skeletal malformations, mental retardation, and autism spectrum disorder. Here, we present a case report of 5-year-old boy with 9p deletion syndrome and autism spectrum disorder.
The DrosDel Deletion Collection: A Drosophila Genomewide Chromosomal Deficiency Resource
Ryder, Edward; Ashburner, Michael; Bautista-Llacer, Rosa; Drummond, Jenny; Webster, Jane; Johnson, Glynnis; Morley, Terri; Chan, Yuk Sang; Blows, Fiona; Coulson, Darin; Reuter, Gunter; Baisch, Heiko; Apelt, Christian; Kauk, Andreas; Rudolph, Thomas
2007-01-01
We describe a second-generation deficiency kit for Drosophila melanogaster composed of molecularly mapped deletions on an isogenic background, covering ∼77% of the Release 5.1 genome. Using a previously reported collection of FRT-bearing P-element insertions, we have generated 655 new deletions and verified a set of 209 deletion-bearing fly stocks. In addition to deletions, we demonstrate how the P elements may also be used to generate a set of custom inversions and duplications, particularly...
Sasías, Sebastián; Martínez-Sanguiné, Adriana; Betancor, Laura; Martínez, Arací; D'Alessandro, Bruno; Iriarte, Andrés; Chabalgoity, José A; Yim, Lucía
2018-01-01
Salmonella enterica serovar Dublin is adapted to cattle but is able to infect humans with high invasiveness. An acute inflammatory response at the intestine helps to prevent Salmonella dissemination to systemic sites. Flagella contribute to this response by providing motility and FliC-mediated signaling through pattern recognition receptors. In a previous work, we reported a high frequency (11 out of 25) of S Dublin isolates lacking flagella in a collection obtained from humans and cattle. The aflagellate strains were impaired in their proinflammatory properties in vitro and in vivo The aim of this work was to elucidate the underlying cause of the absence of flagella in S Dublin isolates. We report here that class 3 flagellar genes are repressed in the human aflagellate isolates, due to impaired secretion of FliA anti-sigma factor FlgM. This phenotype is due to an in-frame 42-nucleotide deletion in the fliE gene, which codes for a protein located in the flagellar basal body. The deletion is predicted to produce a protein lacking amino acids 18 to 31. The aflagellate phenotype was highly stable; revertants were obtained only when fliA was artificially overexpressed combined with several successive passages in motility agar. DNA sequence analysis revealed that motile revertants resulted from duplications of DNA sequences in fliE adjacent to the deleted region. These duplications produced a FliE protein of similar length to the wild type and demonstrate that amino acids 18 to 31 of FliE are not essential. The same deletion was detected in S Dublin isolates obtained from cattle, indicating that this mutation circulates in nature. Copyright © 2017 American Society for Microbiology.
Liang, Liyang; Xie, Yingjun; Shen, Yiping; Yin, Qibin; Yuan, Haiming
2016-01-01
Proximal 4p deletion syndrome is a relatively rare genetic condition characterized by dysmorphic facial features, limb anomalies, minor congenital heart defects, hypogonadism, cafe-au-lait spots, developmental delay, tall and thin habitus, and intellectual disability. At present, over 20 cases of this syndrome have been published. However, duplication of the same region in proximal 4p has never been reported. Here, we describe a 2-year-5-month-old boy with severe congenital heart defects, limb anomalies, hypogonadism, distinctive facial features, pre- and postnatal developmental delay, and mild cognitive impairments. A de novo 4.5-Mb interstitial duplication at 4p15.2p15.1 was detected by chromosomal microarray analysis. Next-generation sequencing was employed and confirmed the duplication, but revealed no additional pathogenic variants. Several candidate genes in this interval responsible for the complex clinical phenotype were identified, such as RBPJ, STIM2, CCKAR, and LGI2. The results suggest a novel contiguous gene duplication syndrome. © 2016 S. Karger AG, Basel.
Effect of Duplicate Genes on Mouse Genetic Robustness: An Update
Directory of Open Access Journals (Sweden)
Zhixi Su
2014-01-01
Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.
Directory of Open Access Journals (Sweden)
Jamie A. O'Rourke
2013-06-01
Full Text Available A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants with striking visual phenotypes. Analysis of these genomes identified three classes of structural variation; between cultivar variation, natural variation within the fast neutron mutant population, and fast neutron induced mutagenesis. Our analyses focused on the latter two classes. We identified 23 large deletions (>40 bp common to multiple individuals, illustrating residual heterogeneity and regions of structural variation within the common bean cv. Red Hawk. An additional 18 large deletions were identified in individual mutant plants. These deletions, ranging in size from 40 bp to 43,000 bp, are potentially the result of fast neutron mutagenesis. Six of the 18 deletions lie near or within gene coding regions, identifying potential candidate genes causing the mutant phenotype.
Sorting by Cuts, Joins, and Whole Chromosome Duplications.
Zeira, Ron; Shamir, Ron
2017-02-01
Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.
Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat
2016-11-01
Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Origin of the duplicated regions in the yeast genomes
DEFF Research Database (Denmark)
Piskur, Jure
2001-01-01
The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...
Energy Technology Data Exchange (ETDEWEB)
Takeshima, Y.; Matuso, M.; Sakamoto, H.; Nishio, H. [Kobe Univ. School of Medicine and Science (Japan)
1994-09-01
Molecular analysis of dystrophin Kobe showed that exon 19 of the dystrophin gene bearing a 52 bp deletion was skipped during splicing, although the known consensus sequences at the 5{prime} and 3{prime} splice site of exon 19 were maintained. These data suggest that the deleted sequence of exon 19 may function as a cis-acting factor for exact splicing for the upstream intron. To investigate this potential role, an in vitro splicing system using dystrophin precursors was established. A two-exon precursor containing exon 18, truncated intron 18, and exon 19 was accurately spliced. However, splicing of intron 18 was dramatically inhibited when wild exon 19 was replaced with mutated exon 19. Even though the length of exon 19 was restored to normal by replacing the deleted sequence with other sequence, splicing of intron 18 was not fully reactivated. Characteristically, splicing of intron 18 was inactivated more markedly when the replaced sequence contained less polypurine stretches. These data suggested that modification of the exon sequence would result in a splicing abnormality. Antisense 31 mer 2`-O-methyl ribonucleotide was targeted against 5{prime} end of deleted region of exon 19 to modulate splicing of the mRNA precursor. Splicing of intron 18 was inhibited in a dose- and time-dependent manner. This is the first in vitro evidence to show splicing of dystrophin pre-mRNA can be managed by antisense oligonucleotides. These experiments represent an approach in which antisense oligonucleotides are used to restore the function of a defective dystrophin gene in Duchenne muscular dystrophy by inducing skipping of certain exons during splicing.
Saveliev, S V; Cox, M M
1994-01-01
Thousands of DNA deletion events occur during macronuclear development in the ciliate Tetrahymena thermophila. In two deleted genomic regions, designated M and R, the eliminated sequences form circles that can be detected by PCR. However, the circles are not normal products of the reaction pathway. The circular forms occur at very low levels in conjugating cells, but are stable. Sequencing analysis showed that many of the circles (as many as 50% of those examined) reflected a precise deletion in the M and R regions. The remaining circles were either smaller or larger and contained varying lengths of sequences derived from the chromosomal DNA surrounding the eliminated region. The chromosomal junctions left behind after deletion were more precise, although deletions in either the M or R regions can generate any of several alternative junctions (1). Some new chromosomal junctions were detected in the present study. The results suggest that the deleted segment is released as a linear DNA species that is degraded rapidly. The species is only rarely converted to the stable circles we detect. The deletion mechanism is different from those proposed for deletion events in hypotrichous ciliates (2-4), and does not reflect a conservative site-specific recombination process such as that promoted by the bacteriophage lambda integrase (5). Images PMID:7838724
Directory of Open Access Journals (Sweden)
Xiao-Long Wang
2015-01-01
Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.
"Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Zhang Guofan
2009-02-01
Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.
Identification of Heterozygous Single- and Multi-exon Deletions in IL7R by Whole Exome Sequencing.
Engelhardt, Karin R; Xu, Yaobo; Grainger, Angela; Germani Batacchi, Mila G C; Swan, David J; Willet, Joseph D P; Abd Hamid, Intan J; Agyeman, Philipp; Barge, Dawn; Bibi, Shahnaz; Jenkins, Lucy; Flood, Terence J; Abinun, Mario; Slatter, Mary A; Gennery, Andrew R
2017-01-01
Purpose We aimed to achieve a retrospective molecular diagnosis by applying state-of-the-art genomic sequencing methods to past patients with T-B+NK+ severe combined immunodeficiency (SCID). We included identification of copy number variations (CNVs) by whole exome sequencing (WES) using the CNV calling method ExomeDepth to detect gene alterations for which routine Sanger sequencing analysis is not suitable, such as large heterozygous deletions. Methods Of a total of 12 undiagnosed patients w...
Cheng, Ji-Hong; Liu, Wen-Chun; Chang, Ting-Tsung; Hsieh, Sun-Yuan; Tseng, Vincent S
2017-10-01
Many studies have suggested that deletions of Hepatitis B Viral (HBV) are associated with the development of progressive liver diseases, even ultimately resulting in hepatocellular carcinoma (HCC). Among the methods for detecting deletions from next-generation sequencing (NGS) data, few methods considered the characteristics of virus, such as high evolution rates and high divergence among the different HBV genomes. Sequencing high divergence HBV genome sequences using the NGS technology outputs millions of reads. Thus, detecting exact breakpoints of deletions from these big and complex data incurs very high computational cost. We proposed a novel analytical method named VirDelect (Virus Deletion Detect), which uses split read alignment base to detect exact breakpoint and diversity variable to consider high divergence in single-end reads data, such that the computational cost can be reduced without losing accuracy. We use four simulated reads datasets and two real pair-end reads datasets of HBV genome sequence to verify VirDelect accuracy by score functions. The experimental results show that VirDelect outperforms the state-of-the-art method Pindel in terms of accuracy score for all simulated datasets and VirDelect had only two base errors even in real datasets. VirDelect is also shown to deliver high accuracy in analyzing the single-end read data as well as pair-end data. VirDelect can serve as an effective and efficient bioinformatics tool for physiologists with high accuracy and efficient performance and applicable to further analysis with characteristics similar to HBV on genome length and high divergence. The software program of VirDelect can be downloaded at https://sourceforge.net/projects/virdelect/. Copyright © 2017. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Yue-zhong Li
2017-04-01
Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.
Mapping copy number variation by population-scale genome sequencing
DEFF Research Database (Denmark)
Mills, Ryan E.; Walter, Klaudia; Stewart, Chip
2011-01-01
Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is......, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications...
Detection and correction of false segmental duplications caused by genome mis-assembly
2010-01-01
Diploid genomes with divergent chromosomes present special problems for assembly software as two copies of especially polymorphic regions may be mistakenly constructed, creating the appearance of a recent segmental duplication. We developed a method for identifying such false duplications and applied it to four vertebrate genomes. For each genome, we corrected mis-assemblies, improved estimates of the amount of duplicated sequence, and recovered polymorphisms between the sequenced chromosomes. PMID:20219098
2012-01-01
Background Hepatitis B virus (HBV), because of its error-prone viral polymerase, has a high mutation rate leading to widespread substitutions, deletions, and insertions in the HBV genome. Deletions may significantly change viral biological features complicating the progression of liver diseases. However, the clinical conditions correlating to the accumulation of deleted mutants remain unclear. In this study, we explored HBV deletion patterns and their association with disease status and antiviral treatment by performing whole genome sequencing on samples from 51 hepatitis B patients and by monitoring changes in deletion variants during treatment. Clone sequencing was used to analyze preS regions in another cohort of 52 patients. Results Among the core, preS, and basic core promoter (BCP) deletion hotspots, we identified preS to have the highest frequency and the most complex deletion pattern using whole genome sequencing. Further clone sequencing analysis on preS identified 70 deletions which were classified into 4 types, the most common being preS2. Also, in contrast to the core and BCP regions, most preS deletions were in-frame. Most deletions interrupted viral surface epitopes, and are possibly involved in evading immuno-surveillance. Among various clinical factors examined, logistic regression showed that antiviral medication affected the accumulation of deletion mutants (OR = 6.81, 95% CI = 1.296 ~ 35.817, P = 0.023). In chronic carriers of the virus, and individuals with chronic hepatitis, the deletion rate was significantly higher in the antiviral treatment group (Fisher exact test, P = 0.007). Particularly, preS2 deletions were associated with the usage of nucleos(t)ide analog therapy (Fisher exact test, P = 0.023). Dynamic increases in preS1 or preS2 deletions were also observed in quasispecies from samples taken from patients before and after three months of ADV therapy. In vitro experiments demonstrated that preS2 deletions alone
Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S
1996-03-01
In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.
Directory of Open Access Journals (Sweden)
Chih-Ping Chen
2014-03-01
Conclusion: An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22–p11.21 microdeletion and 22q11.2 microduplication.
Tassano, E; Alpigiani, M G; Salvati, P; Gimelli, S; Lorini, R; Gimelli, G
2012-12-15
Inverted duplications associated with terminal deletions are complex anomalies described in an increasing of chromosome ends. We report on the cytogenetic characterization of the first de novo inv dup del(4) with partial 4p duplication and 4q deletion in a girl with clinical signs consistent with "recombinant 4 syndrome". This abnormality was suspected by banding, but high-resolution molecular cytogenetic investigations allowed us to define the breakpoints of the rearrangement. The terminal duplicated region extending from 4p15.1 to the telomere was estimated to be 29.27 Mb, while the size of the terminal deletion was 3.114 Mb in the 4q35.1 region. Until now, 10 patients with duplicated 4p14-p15 and deleted 4q35 chromosome 4 have been described. In all cases the abnormal chromosome 4 was derived from a pericentric inversion inherited from one of the parents. In conclusion, we have identified the first case of inv dup del(4) with normal parents suggesting that, often, terminal duplications or terminal deletions mask complex rearrangements. Copyright © 2012 Elsevier B.V. All rights reserved.
Signals of historical interlocus gene conversion in human segmental duplications.
Directory of Open Access Journals (Sweden)
Beth L Dumont
Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Neurodevelopmental and neurobehavioral characteristics in males and females with CDKL5 duplications.
Szafranski, Przemyslaw; Golla, Sailaja; Jin, Weihong; Fang, Ping; Hixson, Patricia; Matalon, Reuben; Kinney, Daniel; Bock, Hans-Georg; Craigen, William; Smith, Janice L; Bi, Weimin; Patel, Ankita; Wai Cheung, Sau; Bacino, Carlos A; Stankiewicz, Paweł
2015-07-01
Point mutations and genomic deletions of the CDKL5 (STK9) gene on chromosome Xp22 have been reported in patients with severe neurodevelopmental abnormalities, including Rett-like disorders. To date, only larger-sized (8-21 Mb) duplications harboring CDKL5 have been described. We report seven females and four males from seven unrelated families with CDKL5 duplications 540-935 kb in size. Three families of different ethnicities had identical 667kb duplications containing only the shorter CDKL5 isoform. Four affected boys, 8-14 years of age, and three affected girls, 6-8 years of age, manifested autistic behavior, developmental delay, language impairment, and hyperactivity. Of note, two boys and one girl had macrocephaly. Two carrier mothers of the affected boys reported a history of problems with learning and mathematics while at school. None of the patients had epilepsy. Similarly to CDKL5 mutations and deletions, the X-inactivation pattern in all six studied females was random. We hypothesize that the increased dosage of CDKL5 might have affected interactions of this kinase with its substrates, leading to perturbation of synaptic plasticity and learning, and resulting in autistic behavior, developmental and speech delay, hyperactivity, and macrocephaly.
Jimenez, Nelson Lopez; Flannick, Jason; Yahyavi, Mani; Li, Jiang; Bardakjian, Tanya; Tonkin, Leath; Schneider, Adele; Sherr, Elliott H; Slavotinek, Anne M
2011-12-28
Anophthalmia/microphthalmia (A/M) is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP) calling software. We verified predicted sequence alterations using Sanger sequencing. We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15) that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp) deletion and one 3 bp duplication in SOX2. Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M.
Constitutional Tandem Duplication of 9q34 that Truncates EHMT1 in a Child with Ganglioglioma
Cheung, Hannah C.; Yatsenko, Svetlana A.; Kadapakkam, Meena; Legay, Hélène; Su, Jack; Lupski, James R.; Plon, Sharon E.
2011-01-01
Point mutations of EHMT1 or deletions and duplications of chromosome 9q34.3 are found in patients with variable neurologic and developmental disorders. Here, we present a child with congenital cataract, developmental and speech delay who developed a metastatic ganglioglioma with progression to anaplastic astrocytoma. Molecular analysis identified a novel constitutional tandem duplication in 9q34.3 with breakpoints in intron 1 of TRAF2 and intron 16 of EHMT1 generating a fusion transcript predicted to encode a truncated form of EHMT1. The ganglioglioma showed complex chromosomal aberrations with further duplication of the dup9q34. Thus, this unique tandem 9q34.3 duplication may impact brain tumor formation. PMID:21681934
High quality maize centromere 10 sequence reveals evidence of frequent recombination events
Directory of Open Access Journals (Sweden)
Thomas Kai Wolfgruber
2016-03-01
Full Text Available The ancestral centromeres of maize contain long stretches of the tandemly arranged CentC repeat. The abundance of tandem DNA repeats and centromeric retrotransposons (CR have presented a significant challenge to completely assembling centromeres using traditional sequencing methods. Here we report a nearly complete assembly of the 1.85 Mb maize centromere 10 from inbred B73 using PacBio technology and BACs from the reference genome project. The error rates estimated from overlapping BAC sequences are 7 x 10-6 and 5 x 10-5 for mismatches and indels, respectively. The number of gaps in the region covered by the reassembly was reduced from 140 in the reference genome to three. Three expressed genes are located between 92 and 477 kb of the inferred ancestral CentC cluster, which lies within the region of highest centromeric repeat density. The improved assembly increased the count of full-length centromeric retrotransposons from 5 to 55 and revealed a 22.7 kb segmental duplication that occurred approximately 121,000 years ago. Our analysis provides evidence of frequent recombination events in the form of partial retrotransposons, deletions within retrotransposons, chimeric retrotransposons, segmental duplications including higher order CentC repeats, a deleted CentC monomer, centromere-proximal inversions, and insertion of mitochondrial sequences. Double-strand DNA break (DSB repair is the most plausible mechanism for these events and may be the major driver of centromere repeat evolution and diversity. This repair appears to be mediated by microhomology, suggesting that tandem repeats may have evolved to facilitate the repair of frequent DSBs in centromeres.
Enhanced Maternal Origin of the 22q11.2 Deletion in Velocardiofacial and DiGeorge Syndromes
DEFF Research Database (Denmark)
Delio, Maria; Guo, Tingwei; McDonald-McGinn, Donna M
2013-01-01
Velocardiofacial and DiGeorge syndromes, also known as 22q11.2 deletion syndrome (22q11DS), are congenital-anomaly disorders caused by a de novo hemizygous 22q11.2 deletion mediated by meiotic nonallelic homologous recombination events between low-copy repeats, also known as segmental duplication...
Directory of Open Access Journals (Sweden)
Capra Valeria
2012-10-01
Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.
Energy Technology Data Exchange (ETDEWEB)
Nickel, R.E.; Pillers, D.M.; Merkens, M.; Magenis, R.E.; Zonana, J. [Oregon Health Sciences Univ., Portland, OR (United States); Driscoll, D.A.; Emanuel, B.S. [Univ. of Pennsylvania Medical Center, Philadelphia, PA (United States)
1994-10-01
Approximately 5% of children with neural tube defects (NTDs) have a congenital heart defect and/or cleft lip and palate. The cause of isolated meningomyelocele, congenital heart defects, or cleft lip and palate has been largely thought to be multifactorial. However, chromosomal, teratogenic, and single gene causes of combinations of NTDs with congenital heart defects and/or cleft lip and palate have been reported. We report on 3 patients with meningomyelocele, congenital heart defects, and 22q11 deletions. Two of the children had the clinical diagnosis of velo-cardio-facial syndrome (VCFS); both have bifid uvula. The third child had DiGeorge sequence (DGS). The association of NTDs with 22q11 deletion has not been reported previously. An accurate diagnosis of the 22q11 deletion is critical as this micro-deletion and its associated clinical problems is transmitted as an autosomal dominant trait due to the inheritance of the deletion-bearing chromosome. We recommend that all children with NTDs and congenital heart defects, with or without cleft palate, have cytogenetic and molecular studies performed to detect 22q11 deletions. 31 refs., 3 figs.
Characterization of an Equine α-S2-Casein Variant Due to a 1.3 kb Deletion Spanning Two Coding Exons
Brinkmann, Julia; Koudelka, Tomas; Keppler, Julia K.; Tholey, Andreas; Schwarz, Karin; Thaller, Georg; Tetens, Jens
2015-01-01
The production and consumption of mare’s milk in Europe has gained importance, mainly based on positive health effects and a lower allergenic potential as compared to cows’ milk. The allergenicity of milk is to a certain extent affected by different genetic variants. In classical dairy species, much research has been conducted into the genetic variability of milk proteins, but the knowledge in horses is scarce. Here, we characterize two major forms of equine αS2-casein arising from genomic 1.3 kb in-frame deletion involving two coding exons, one of which represents an equid specific duplication. Findings at the DNA-level have been verified by cDNA sequencing from horse milk of mares with different genotypes. At the protein-level, we were able to show by SDS-page and in-gel digestion with subsequent LC-MS analysis that both proteins are actually expressed. The comparison with published sequences of other equids revealed that the deletion has probably occurred before the ancestor of present-day asses and zebras diverged from the horse lineage. PMID:26444874
Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo
2010-04-01
Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.
Deletion Mutations in an Australian Series of HNPCC Patients
Directory of Open Access Journals (Sweden)
McPhillips Mary
2005-11-01
Full Text Available Abstract Hereditary non polyposis colorectal cancer (HNPCC is characterized by the presence of early onset colorectal cancer and other epithelial malignancies. The genetic basis of HNPCC is a deficiency in DNA mismatch repair, which manifests itself as DNA microsatellite instability in tumours. There are four genes involved in DNA mismatch repair that have been linked to HNPCC; these include hMSH2, hMLH1, hMSH6 and hPMS2. Of these four genes hMLH1 and hMSH2 account for the majority of families diagnosed with the disease. Notwithstanding, up to 40 percent of families do not appear to harbour a change in either hMSH2 or hMLH1 that can be detected using standard screening procedures such as direct DNA sequencing or a variety of methods all based on a heteroduplex analysis. In this report we have screened a series of 118 probands that all have the clinical diagnosis of HNPCC for medium to large deletions by the Multiplex Ligation-Dependent Probe Amplification assay (MLPA to determine the frequency of this type of mutation. The results indicate that a significant proportion of Australian HNPCC patients harbour deletion or duplication mutations primarily in hMSH2 but also in hMLH1.
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
International Nuclear Information System (INIS)
Gangnonngiw, Warachin; Anantasomboon, Gun; Sang-oum, Wiwat; Sriurairatana, Siriporn; Sritunyalucksana, Kallaya; Flegel, Timothy W.
2009-01-01
RT-PCR using a commercial kit for yellow head virus (YHV) detection in growth-retarded shrimp yielded an unusual 777 bp amplicon instead of expected amplicons of 277 bp for YHV type-1 (YHV-1) or 406 bp for YHV type-2 (YHV-2). Cloning and sequencing (GenBank (EU170438)) revealed approximately 80% identity to non-structural (NS) ORF1b sequences of both YHV-1 (GenBank (AA083987)) and YHV-2 (GenBank (AF227196)), indicating an atypical YHV type (A-YHV) phylogenetically equidistant from both types. An RT-PCR test specifically designed for A-YHV revealed that it was uncommon and that its occurrence in shrimp culture ponds did not correlate with growth retardation or mortality. By immunohistochemistry with YHV-specific monoclonal antibodies, the A-YHV gave positive reactions for envelope protein gp64 and capsid protein p20, but not for envelope protein gp116, even though gp116 and gp64 originate from a polyprotein of ORF3. Lack of gp116 immunoreactivity correlated with a large ORF3 deletion (GenBank (EU123854)) in the region of the protein targeted by an MAb against gp116. Transmission electron microscopy of A-YHV-infected shrimp revealed only unenveloped pre-virions. During manuscript revision, information received revealed that typing of YHV isolates based on sequences of ORF1b and ORF3 had yielded several geographical types, including one virulent type (YHV-1b) with an ORF3 deletion sequence that matched the sequence of A-YHV. Using these sequences and an additional A-YHV sequence ( (EU853170)) from the ORF1b typing region, A-YHV potentially represents a recombinant between type 1b and type 5. SDS-PAGE and Western blot analysis revealed that type 1b produced a gp116 deletion protein that did not bind with the MAb or polyclonal Ab to normal gp116. Overall, the information suggested that lack of A-YHV virulence was associated with the NS gene sequence linked to ORF1b rather than the deletion in ORF3
Li, Haonan; Jin, Peng; Hao, Qian; Zhu, Wei; Chen, Xia; Wang, Ping
2017-11-01
Waardenburg syndrome (WS) is a rare autosomal dominant disorder associated with pigmentation abnormalities and sensorineural hearing loss. In this study, we investigated the genetic cause of WSII in a patient and evaluated the reliability of the targeted next-generation exome sequencing method for the genetic diagnosis of WS. Clinical evaluations were conducted on the patient and targeted next-generation sequencing (NGS) was used to identify the candidate genes responsible for WSII. Multiplex ligation-dependent probe amplification (MLPA) and real-time quantitative polymerase chain reaction (qPCR) were performed to confirm the targeted NGS results. Targeted NGS detected the entire deletion of the coding sequence (CDS) of the SOX10 gene in the WSII patient. MLPA results indicated that all exons of the SOX10 heterozygous deletion were detected; no aberrant copy number in the PAX3 and microphthalmia-associated transcription factor (MITF) genes was found. Real-time qPCR results identified the mutation as a de novo heterozygous deletion. This is the first report of using a targeted NGS method for WS candidate gene sequencing; its accuracy was verified by using the MLPA and qPCR methods. Our research provides a valuable method for the genetic diagnosis of WS.
So, Joyce; Müller, Ines; Kunath, Melanie; Herrmann, Susanne; Ullmann, Reinhard; Schweiger, Susann
2008-01-01
Opitz G/BBB syndrome (OS) is a congenital midline malformation syndrome characterized by hypertelorism, hypospadias, cleft lip/palate, laryngotracheoesophageal abnormalities, imperforate anus, developmental delay and cardiac defects. The X-linked form is caused by mutations in the MID1 gene, while no gene has yet been identified for the autosomal dominant form. Here, we report on a 15-year-old boy who was referred for MID1 mutation analysis with findings typical of OS, including apparent hypertelorism, hypospadias, a history of feeding difficulties, dysphagia secondary to esophageal arteria lusoria, growth retardation and developmental delay. No MID1 mutation was found, but subsequent sub-megabase resolution array CGH unexpectedly documented a 2.34 Mb terminal 4p deletion, suggesting a diagnosis of WHS, and a duplication in Xp22.31. Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving terminal chromosome 4p deletions, in particular 4p16.3. WHS is characterized by typical facial appearance ("Greek helmet facies"), mental retardation, congenital hypotonia, and growth retardation. While the severity of developmental delay in this patient supports the diagnosis of WHS rather than OS, this case illustrates the striking similarities of clinical findings in seemingly unrelated syndromes, suggesting common or interacting pathways at the molecular and pathogenetic level. This is the first report of arteria lusoria (esophageal vascular ring) in a patient with WHS. (c) 2007 Wiley-Liss, Inc.
Evolution dynamics of a model for gene duplication under adaptive conflict
Ancliff, Mark; Park, Jeong-Man
2014-06-01
We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.
International Nuclear Information System (INIS)
Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.
1989-01-01
The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region
Directory of Open Access Journals (Sweden)
Lopez Jimenez Nelson
2011-12-01
Full Text Available Abstract Background Anophthalmia/microphthalmia (A/M is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. Methods We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP calling software. We verified predicted sequence alterations using Sanger sequencing. Results We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15 that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp deletion and one 3 bp duplication in SOX2. Conclusions Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M.
A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae.
Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K
2013-11-06
Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.
Defining the Effect of the 16p11.2 Duplication on Cognition, Behavior, and Medical Comorbidities
DEFF Research Database (Denmark)
D'Angelo, Debra; Lebon, Sébastien; Chen, Qixuan
2016-01-01
Importance: The 16p11.2 BP4-BP5 duplication is the copy number variant most frequently associated with autism spectrum disorder (ASD), schizophrenia, and comorbidities such as decreased body mass index (BMI). Objectives: To characterize the effects of the 16p11.2 duplication on cognitive...... subgroups not observed with the deletion. These results suggest that additional genetic and familial factors contribute to this variability. Additional studies will be necessary to characterize the predictors of cognitive deficits....
Analysis of high-identity segmental duplications in the grapevine genome
Directory of Open Access Journals (Sweden)
Carelli Francesco N
2011-08-01
Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.
Branciamore, Sergio; Di Giulio, Massimo
2012-04-01
The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.
Reversion in variants from a duplication strain of Aspergillus nidulans
International Nuclear Information System (INIS)
Menezes, E.M.; Azevedo, J.L.
1978-01-01
Strains of Aspergillus nidulans with a chromosome segment in duplicate, one in normal position and one translocated to another chromosome, are unstable at mitosis. In addition to variants which result from deletions in either of the duplicate segments, which usually have improved morphology, they produce variants with deteriorated morphology. Three deteriorated variants reverted frequently to parental type morphology, both spontaneously and after ultra-violet treatment. Of six reversions analysed genetically, five were due to suppressors and one was probably due to back mutation. The suppressors segregated as single genes and were not linked to the mutation which they suppress. The instability of these so-called 'deteriorated' variants is discussed in relation to mitotic instability phenomena in A. nidulans. (orig.) [de
Directory of Open Access Journals (Sweden)
Barbaro Michela
2013-01-01
Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
DEFF Research Database (Denmark)
Erdogan, F; Belloso, J M; Gabau, E
2008-01-01
deletions or duplications elsewhere in the genome. The main clinical features of the patient are microcephaly and congenital heart disease, which are likely to be caused by dosage effect of one or several genes in the duplicated region. Similar phenotypes have been found in other patients with 10q11-q22...
DEFF Research Database (Denmark)
Krausz, C; Giachini, C; Xue, Y
2008-01-01
of duplications and the Y-chromosomal haplogroup were characterised. Although the study had good power to detect factors that accounted for >or=5.5% of the variation in sperm concentration, no such factor was found. A negative effect of gr/gr deletions followed by b2/b4 duplication was found within...
Amino-acid composition after loop deletion drives domain swapping.
Nandwani, Neha; Surana, Parag; Udgaonkar, Jayant B; Das, Ranabir; Gosavi, Shachi
2017-10-01
Rational engineering of a protein to enable domain swapping requires an understanding of the sequence, structural and energetic factors that favor the domain-swapped oligomer over the monomer. While it is known that the deletion of loops between β-strands can promote domain swapping, the spliced sequence at the position of the loop deletion is thought to have a minimal role to play in such domain swapping. Here, two loop-deletion mutants of the non-domain-swapping protein monellin, frame-shifted by a single residue, were designed. Although the spliced sequence in the two mutants differed by only one residue at the site of the deletion, only one of them (YEIKG) promoted domain swapping. The mutant containing the spliced sequence YENKG was entirely monomeric. This new understanding that the domain swapping propensity after loop deletion may depend critically on the chemical composition of the shortened loop will facilitate the rational design of domain swapping. © 2017 The Protein Society.
Analysis of spontaneous deletions and gene amplification in the lac region of Escherichia coli
International Nuclear Information System (INIS)
Albertini, A.M.; Hofer, M.; Calos, M.P.; Tlsty, T.D.; Miller, J.H.
1983-01-01
Spontaneous rearrangements, such as large deletions and duplications, have important implications for the structure of the genome. It is therefore of great interest to analyze these events at the molecular level. We have constructed derivatives of a lacI-Z fusion strain, which allow us to study deletions in a more systematic manner than was previously possible. These derivatives have been used to investigate how frequently larger deletions (> 700 bp) occur between short homologies on both recA and recA - strains and to determine the effect of the lengths of the short homologies and of the distance between homologies on the frequency of deletion formation. 38 references, 11 figures
Energy Technology Data Exchange (ETDEWEB)
Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))
1992-02-01
DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.
International Nuclear Information System (INIS)
Shull, B.C.; Chen, K.C.; Lederman, M.; Stout, E.R.; Bates, R.C.
1988-01-01
Genomic clones of the autonomous parvovirus bovine parvovirus (BPV) were constructed by blunt-end ligation of reannealed virion plus and minus DNA strands into the plasmid pUC8. These clones were stable during propagation in Escherichia coli JM107. All clones tested were found to be infectious by the criteria of plaque titer and progressive cytophathic effect after transfection into bovine fetal lung cells. Sequencing of the recombinant plasmids demonstrated that all of the BPV inserts had left-end (3')-terminal deletions of up to 34 bases. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. Full-length genomic clones with 3' flip and 3' flop conformations were constructed and were found to have equal infectivity. Expression of capsid proteins from tranfected genomes was demonstrated by hemagglutination, indirect immunofluorescence, and immunoprecipitation of [ 35 S]methionine-labeled cell lysates. Use of appropriate antiserum for immunoprecipitation showed the synthesis of BPV capsid and noncapsid proteins after transfection. Independently, a series of genomic clones with increasingly larger 3'-terminal deletions was prepared from separately subcloned 3'-terminal fragments. Transfection of these clones into bovine fetal lung cells revealed that deletions of up to 34 bases at the 3' end lowered but did not abolish infectivity, while deletions of greater than 52 bases were lethal. End-label analysis showed that the 34-base deletion was repaired to wild-type length in the progeny virus
Drosophila duplication hotspots are associated with late-replicating regions of the genome.
Directory of Open Access Journals (Sweden)
Margarida Cardoso-Moreira
2011-11-01
Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is
Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.
2012-01-01
Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055
Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei
2014-04-01
α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.
Directory of Open Access Journals (Sweden)
Francesca Duraturo
2013-01-01
Full Text Available Lynch syndrome is associated with germ-line mutations in the DNA mismatch repair (MMR genes, mainly MLH1 and MSH2. Most of the mutations reported in these genes to date are point mutations, small deletions, and insertions. Large genomic rearrangements in the MMR genes predisposing to Lynch syndrome also occur, but the frequency varies depending on the population studied on average from 5 to 20%. The aim of this study was to examine the contribution of large rearrangements in the MLH1 and MSH2 genes in a well-characterised series of 63 unrelated Southern Italian Lynch syndrome patients who were negative for pathogenic point mutations in the MLH1, MSH2, and MSH6 genes. We identified a large novel deletion in the MSH2 gene, including exon 6 in one of the patients analysed (1.6% frequency. This deletion was confirmed and localised by long-range PCR. The breakpoints of this rearrangement were characterised by sequencing. Further analysis of the breakpoints revealed that this rearrangement was a product of Alu-mediated recombination. Our findings identified a novel Alu-mediated rearrangement within MSH2 gene and showed that large deletions or duplications in MLH1 and MSH2 genes are low-frequency mutational events in Southern Italian patients with an inherited predisposition to colon cancer.
Barbi, G; Kennerknecht, I; Wöhr, G; Avramopoulos, D; Karadima, G; Petersen, M B
2000-03-13
We report on a mentally retarded child with multiple minor anomalies and an unusually rearranged chromosome 21. This der(21) chromosome has a deletion of 21p and of proximal 21q, whereas the main portion of 21q is duplicated leading to a mirror-symmetric appearance with the mirror axis at the breakpoint. The centromere is only characterized by a secondary constriction (with a centromeric index of a G chromosome) at an unexpected distal position, but fluorescence in situ hybridization (FISH) with either chromosome specific or with all human centromeres alpha satellite DNA shows no cross hybridization. Thus, the marker chromosome represents a further example of an "analphoid marker with neocentromere." Molecular analysis using polymorphic markers on chromosome 21 verified a very small monosomic segment of the proximal long arm of chromosome 21, and additionally trisomy of the remaining distal segment. Although trisomic for almost the entire 21q arm, our patient shows no classical Down syndrome phenotype, but only a few minor anomalies found in trisomy 21 and in monosomy of proximal 21q, respectively. Copyright 2000 Wiley-Liss, Inc.
Enhancement of RNA synthesis by promoter duplication in tombusviruses
International Nuclear Information System (INIS)
Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.
2003-01-01
Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses
Energy Technology Data Exchange (ETDEWEB)
Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others
1994-09-15
In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.
Energy Technology Data Exchange (ETDEWEB)
Pangalos, C.; Prieur, M.; Rethore, M.O.; Lejeune, J. (Institut de Progenese, Paris (France)); Theophile, D.; Sinet, P.M.; Chettouh, Z.; Delabar, J.M. (Hopital Necker Enfants Malades, Paris (France)); Marks, A. (Univ. of Toronto, Ontario (Canada)); Stamboulieh-Abazis, D. (Diagnostic Genetic Center, Athens (Greece)); Verellen, C. (Centre de Genetique Humaine, Brussels (Belgium))
1992-12-01
Three Down syndrome patients for whom karyotypic analysis showed a mirror' (reverse tandem) duplication of chromosome 21 were studied by phenotypic, cytogenetic, and molecular methods. On high-resolution R-banding analysis performed in two cases, the size of the fusion 21q22.3 band was apparently less than twice the size of the normal 21q22.3, suggesting a partial deletion of distal 21q. The evaluation of eight chromosome 21 single-copy sequences of the 21q22 region - namely, SOD1, D21S15, D21S42, CRYA1, PFKL, CD18, COL6A1, and S100B - by a slot blot method showed in all three cases a partial deletion of 21q22.3 and partial monosomy. The translocation breakpoints were different in each patient, and in two cases the rearranged chromosome was found to be asymmetrical. The molecular definition of the monosomy 21 in each patient was, respectively, COL6A1-S100B, CD18-S100B, and PFKL-S100B. DNA polymorphism analysis indicated in all cases a homozygosity of the duplicated material. The duplicated region was maternal in two patients and paternal in one patient. These data suggest that the reverse tandem chromosomes did not result from a telomeric fusion between chromosomes 21 but from a translocation between sister chromatids. The phenotypes of these patients did not differ significantly from that of individuals with full trisomy 21, except in one case with large ears with an unfolded helix. The fact that monosomy of distal 21q22.3 in these patients resulted in a phenotype very similar to Down syndrome suggests that the duplication of the genes located in this part of chromosome 21 is not necessary for the pathogenesis of the Down syndrome features observed in these patients, including most of the facial and hand features, muscular hypotonia, cardiopathy of the Fallot tetralogy type, and part of the mental retardation. 54 refs., 5 figs., 3 tabs.
Comparative inference of duplicated genes produced by polyploidization in soybean genome.
Yang, Yanmei; Wang, Jinpeng; Di, Jianyong
2013-01-01
Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.
Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N
2003-09-01
Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.
Clinical validation of targeted next-generation sequencing for inherited disorders.
Yohe, Sophia; Hauge, Adam; Bunjer, Kari; Kemmer, Teresa; Bower, Matthew; Schomaker, Matthew; Onsongo, Getiria; Wilson, Jon; Erdmann, Jesse; Zhou, Yi; Deshpande, Archana; Spears, Michael D; Beckman, Kenneth; Silverstein, Kevin A T; Thyagarajan, Bharat
2015-02-01
Although next-generation sequencing (NGS) can revolutionize molecular diagnostics, several hurdles remain in the implementation of this technology in clinical laboratories. To validate and implement an NGS panel for genetic diagnosis of more than 100 inherited diseases, such as neurologic conditions, congenital hearing loss and eye disorders, developmental disorders, nonmalignant diseases treated by hematopoietic cell transplantation, familial cancers, connective tissue disorders, metabolic disorders, disorders of sexual development, and cardiac disorders. The diagnostic gene panels ranged from 1 to 54 genes with most of panels containing 10 genes or fewer. We used a liquid hybridization-based, target-enrichment strategy to enrich 10 067 exons in 568 genes, followed by NGS with a HiSeq 2000 sequencing system (Illumina, San Diego, California). We successfully sequenced 97.6% (9825 of 10 067) of the targeted exons to obtain a minimum coverage of 20× at all bases. We demonstrated 100% concordance in detecting 19 pathogenic single-nucleotide variations and 11 pathogenic insertion-deletion mutations ranging in size from 1 to 18 base pairs across 18 samples that were previously characterized by Sanger sequencing. Using 4 pairs of blinded, duplicate samples, we demonstrated a high degree of concordance (>99%) among the blinded, duplicate pairs. We have successfully demonstrated the feasibility of using the NGS platform to multiplex genetic tests for several rare diseases and the use of cloud computing for bioinformatics analysis as a relatively low-cost solution for implementing NGS in clinical laboratories.
Directory of Open Access Journals (Sweden)
Green Eric D
2004-05-01
Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.
Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.
Directory of Open Access Journals (Sweden)
Nemanja Vukašinović
Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.
Koga, Tomoyuki; Li, Bin; Figueroa, Javier M; Ren, Bing; Chen, Clark C; Carter, Bob S; Furnari, Frank B
2018-04-12
Epidermal growth factor receptor (EGFR) variant III (vIII) is the most common oncogenic rearrangement in glioblastoma (GBM) generated by deletion of exons two to seven of EGFR. The proximal breakpoints occur in variable positions within the 123-kb intron one, presenting significant challenges in terms of PCR-based mapping. Molecular mechanisms underlying these deletions remain unclear. We determined the presence of EGFRvIII and its breakpoints for 29 GBM samples using quantitative polymerase chain reaction (qPCR), arrayed PCR mapping, Sanger sequencing, and whole genome sequencing (WGS). Patient-specific breakpoint PCR was performed on tumors, plasma and cerebrospinal fluid (CSF) samples. The breakpoint sequences and single nucleotide polymorphisms (SNPs) were analyzed to elucidate the underlying biogenic mechanism. PCR mapping and WGS independently unveiled eight EGFRvIII breakpoints in six tumors. Patient-specific primers yielded EGFRvIII PCR amplicons in matched tumors, and in cell-free DNA (cfDNA) from a CSF sample, but not in cfDNA or extracellular-vesicle DNA from plasma. The breakpoint analysis revealed nucleotide insertions in four, an insertion of a region outside of EGFR locus in one, microhomologies in three, as well as a duplication or an inversion accompanied by microhomologies in two, suggestive of distinct DNA repair mechanisms. In the GBM samples that harbored distinct breakpoints, the SNP compositions of EGFRvIII and amplified non-vIII EGFR were identical, suggesting that these rearrangements arose from amplified non-vIII EGFR. Our approach efficiently "fingerprints" each sample's EGFRvIII breakpoints. Breakpoint sequence analyses suggest that independent breakpoints arose from precursor amplified non-vIII EGFR through different DNA repair mechanisms.
Translocations used to generate chromosome segment duplications ...
Indian Academy of Sciences (India)
a duplication (Dp) of the translocated segment and four inviable (white, W) ascospores with .... of this work, namely, the definition of breakpoint junction sequences of 12 ..... then our results would place supercontig 10.9 in distal. LG VIR. A third ...
Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S
2012-08-19
Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.
Bragagnolo, Silvia; Colovati, Mileny E S; Guilherme, Roberta S; Dantas, Anelisa G; de Souza, Malú Zamariolli; de Soares, Maria F; Melaragno, Maria I; Perez, Ana B
2016-01-01
Wolf-Hirschhorn syndrome (WHS) is a contiguous gene and multiple malformation syndrome that results from a deletion in the 4p16.3 region. We describe here a 6-month-old girl that presented with WHS features but also displayed unusual findings, such as epibulbar dermoid in the left eye, ear tags, and left microtia. Although on G-banding her karyotype appeared to be normal, chromosomal microarray analysis revealed an ∼13-Mb 4p16.3p15.33 deletion and an ∼9-Mb Xp22.33p22.31 duplication, resulting from a balanced maternal t(X;4)(p22.31;p15.33) translocation. The patient presented with functional Xp disomy due to an unbalanced X-autosome translocation, a rare cytogenetic finding in females with unbalanced rearrangements. Sequencing of both chromosome breakpoints detected no gene disruption. To the best of our knowledge, this is the first patient described in the literature with WHS and epibulbar dermoid, a typical characteristic of the oculoauriculovertebral spectrum (OAVS). Our data suggest that possible candidate genes for OAVS may have been deleted along with the WHS critical region. © 2016 S. Karger AG, Basel.
Functional requirements driving the gene duplication in 12 Drosophila species.
Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui
2013-08-15
Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.
Enteric and rectal duplications and duplication cysts in the adult.
Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin
2005-03-01
Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.
Sequence analysis of 17 NRXN1 deletions
DEFF Research Database (Denmark)
Hoeffding, Louise Kristine Enggaard; Hansen, Thomas; Ingason, Andrés
2014-01-01
into the molecular mechanisms governing such genomic rearrangements may increase our understanding of disease pathology and evolutionary processes. Here we analyse 17 carriers of non-recurrent deletions in the NRXN1 gene, which have been associated with neurodevelopmental disorders, e.g. schizophrenia, autism...
A large duplication involving the IHH locus mimics acrocallosal syndrome.
Yuksel-Apak, Memnune; Bögershausen, Nina; Pawlik, Barbara; Li, Yun; Apak, Selcuk; Uyguner, Oya; Milz, Esther; Nürnberg, Gudrun; Karaman, Birsen; Gülgören, Ayan; Grzeschik, Karl-Heinz; Nürnberg, Peter; Kayserili, Hülya; Wollnik, Bernd
2012-06-01
Indian hedgehog (Ihh) signaling is a major determinant of various processes during embryonic development and has a pivotal role in embryonic skeletal development. A specific spatial and temporal expression of Ihh within the developing limb buds is essential for accurate digit outgrowth and correct digit number. Although missense mutations in IHH cause brachydactyly type A1, small tandem duplications involving the IHH locus have recently been described in patients with mild syndactyly and craniosynostosis. In contrast, a ∼600-kb deletion 5' of IHH in the doublefoot mouse mutant (Dbf) leads to severe polydactyly without craniosynostosis, but with craniofacial dysmorphism. We now present a patient resembling acrocallosal syndrome (ACS) with extensive polysyndactyly of the hands and feet, craniofacial abnormalities including macrocephaly, agenesis of the corpus callosum, dysplastic and low-set ears, severe hypertelorism and profound psychomotor delay. Single-nucleotide polymorphism (SNP) array copy number analysis identified a ∼900-kb duplication of the IHH locus, which was confirmed by an independent quantitative method. A fetus from a second pregnancy of the mother by a different spouse showed similar craniofacial and limb malformations and the same duplication of the IHH-locus. We defined the exact breakpoints and showed that the duplications are identical tandem duplications in both sibs. No copy number changes were observed in the healthy mother. To our knowledge, this is the first report of a human phenotype similar to the Dbf mutant and strikingly overlapping with ACS that is caused by a copy number variation involving the IHH locus on chromosome 2q35.
Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.
Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L
2015-12-01
Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.
Detection of mitochondrial DNA deletions in human cells induced by ionizing radiation
International Nuclear Information System (INIS)
Liu, Qing-Jie; Feng, Jiang-Bin; Lu, Xue; Li, Yu-Wen; Chen, De-Qing
2008-01-01
Full text: Purpose: To screen the novel mitochondrial DNA (mt DNA) deletions induced by ionizing radiation, and analyze the several kinds of mt DNA deletions, known as 3895 bp, 889 bp, 7436 bp or 4934 bp deletions. Methods: Long-range PCR with two pairs of primers, which could amplify the whole human mitochondrial genome, was used to analyze the lymphoblastoid cell line before and after exposed to 10 Gy 60 Co γ-rays. The limited condition PCR was used to certify the possible mt DNA deletion showed by long-range PCR. The PCR products were purified, cloned, sequenced and the sequence result were BLASTed. Regular PCR or nest-PCR were used to analyze the 3895 bp, 889 bp, 7436 bp or 4934 bp deletions before and after radiation exposure. The final PCR products were purified, sequenced and BALSTed on standard human mitochondrial genome sequence database. Results: (1) The predicted bands of mt DNA were observed on the control cell lines, and the possible mt DNA deletions were also detected on the irradiated cell lines. The deletions were certified by the limited condition PCR. The sequence BLAST results of the cloned PCR products showed that two kinds of deletions, 7455 bp deletion (nt 475-7929 in heavy strand) and 9225 bp deletion (nt 7714-369 in heavy strand), which were between two 8 bp direct repeats. Further bioinformatics analysis showed that the two deletions were novel deletions. (2) The 889 bp and 3895 bp deletion were not detected for the cell line samples not exposed to 60 Co γ-rays. The 889 bp and 3895 bp deletions were detected on samples exposed to 10 Gy 60 Co γ-rays. The BALST results showed that the 889 bp and 3895 deletions flanked nt 11688 bp-12576, nt 548 bp-4443, respectively. The 7436 bp deletion levels were not changed much before and after irradiation. (3) The 4934 bp deletions had the same pattern as 7436 bp deletion, but it could induced by radiation. Conclusions: Ionizing radiation could induce the human lymphoblastoid two novel mt DNA
Sorting genomes by reciprocal translocations, insertions, and deletions.
Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying
2010-01-01
The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.
External cystic rectal duplication: an unusual presentation of rectal duplication cyst.
Karaman, I; Karaman, A; Arda, N; Cakmak, O
2007-11-01
Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.
Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion
Directory of Open Access Journals (Sweden)
Jeffrey A. Fawcett
2011-02-01
Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.
Ben-Salem, Salma; Al-Shamsi, Aisha M; John, Anne; Ali, Bassam R; Al-Gazali, Lihadh
2015-05-01
Recent studies have implicated the WW domain-containing oxidoreductase encoding gene (WWOX) in a severe form of autosomal recessive neurological disorder. This condition showed an overlapping spectrum of clinical features including spinocerebellar ataxia associated with generalized seizures and delayed psychomotor development to growth retardation, spasticity, and microcephaly. We evaluated a child from a consanguineous Emirati family that presented at birth with growth retardation, microcephaly, epileptic seizures, and later developed spasticity and delayed psychomotor development. Screening for deletions and duplications using whole-chromosomal microarray analysis identified a novel homozygous microdeletion encompassing exon 5 of the WWOX gene. Analysis of parental DNA indicated that this deletion was inherited from both parents and lies within a large region of homozygosity. Sanger sequencing of the cDNA showed that the deletion resulted in exon 5 skipping leading to a frame-shift and creating a premature stop codon at amino acid position 212. Quantification of mRNA revealed striking low level of WWOX expression in the child and moderate level of expression in the mother compared to a healthy control. To the best of our knowledge, this is the first homozygous germline structural variation in WWOX gene resulting in truncated transcripts that were presumably subject to NMD pathway. Our findings extend the clinical and genetic spectrum of WWOX mutations and support a crucial role of this gene in neurological development.
Beaujard, M-P; Jouannic, J-M; Bessières, B; Borie, C; Martin-Luis, I; Fallet-Bianco, C; Portnoï, M-F
2005-06-01
To present the prenatal diagnosis of a de novo terminal inversion duplication of the short arm of chromosome 4 and a review of the literature. An amniocentesis for chromosome analysis was performed at 33 weeks' gestation because ultrasound examination showed a female fetus with multiple abnormalities consisting of severe intrauterine growth retardation, microcephaly, a cleft lip and renal hypoplasia. Cytogenetic analysis and FISH studies of the cultured amniocytes revealed a de novo terminal inversion duplication of the short arm of chromosome 4 characterized by a duplication of 4p14-p16.1 chromosome region concomitant with a terminal deletion 4p16.1-pter. The karyotype was thus: 46,XX, inv dup del (4)(:p14-->p16.1::p16.1-->qter). The parents opted to terminate the pregnancy. Fetopathological examination showed dysmorphic features and abnormalities consistent with a Wolf-Hirschhorn syndrome (WHS) diagnosis, clinical manifestations of partial 4p trisomy being mild. Although relatively rare, inverted duplications have been reported repeatedly in an increasing number of chromosomes. Only two previous cases with de novo inv dup del (4p) and one with tandem dup 4p have been reported, all of them associated with a 4pter deletion. We report the first case diagnosed prenatally. Breakpoints are variable, resulting in different abnormal phenotype. In our case, clinical manifestations resulted in a WHS phenotype.
Fukushige, Tetsunari; Goszczynski, Barbara; Tian, Helen; McGhee, James D
2003-10-01
WGATAR sequences); ELT-4 protein neither enhanced nor inhibited the strong sequence-specific binding of the ELT-2 protein. Whereas ELT-2 protein is a strong transcriptional activator in yeast, ELT-4 protein has no such activity under similar conditions, nor does it influence the transcriptional activity of coexpressed ELT-2 protein. Although an elt-2 homolog was easily identified in the genomic sequence of the related nematode C. briggsae, no elt-4 homolog could be identified. Analysis of the changes in silent third codon positions within the DNA-binding domains indicates that elt-4 arose as a duplication of elt-2, some 25-55 MYA. Thus, elt-4 has survived far longer than the average duplicated gene in C. elegans, even though no obvious biological function could be detected. elt-4 provides an interesting example of a tandemly duplicated gene that may originally have been the same size as elt-2 but has gradually been whittled down to its present size of little more than a zinc finger. Although elt-4 must confer (or must have conferred) some selective advantage to C. elegans, we suggest that its ultimate evolutionary fate will be disappearance from the C. elegans genome.
Jeziorczak, Paul M; Warner, Brad W
2018-03-01
Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.
The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.
Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P
2017-07-31
The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.
Chandrasekharappa, Settara C; Lach, Francis P; Kimble, Danielle C; Kamat, Aparna; Teer, Jamie K; Donovan, Frank X; Flynn, Elizabeth; Sen, Shurjo K; Thongthip, Supawat; Sanborn, Erica; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A
2013-05-30
Current methods for detecting mutations in Fanconi anemia (FA)-suspected patients are inefficient and often miss mutations. We have applied recent advances in DNA sequencing and genomic capture to the diagnosis of FA. Specifically, we used custom molecular inversion probes or TruSeq-enrichment oligos to capture and sequence FA and related genes, including introns, from 27 samples from the International Fanconi Anemia Registry at The Rockefeller University. DNA sequencing was complemented with custom array comparative genomic hybridization (aCGH) and RNA sequencing (RNA-seq) analysis. aCGH identified deletions/duplications in 4 different FA genes. RNA-seq analysis revealed lack of allele specific expression associated with a deletion and splicing defects caused by missense, synonymous, and deep-in-intron variants. The combination of TruSeq-targeted capture, aCGH, and RNA-seq enabled us to identify the complementation group and biallelic germline mutations in all 27 families: FANCA (7), FANCB (3), FANCC (3), FANCD1 (1), FANCD2 (3), FANCF (2), FANCG (2), FANCI (1), FANCJ (2), and FANCL (3). FANCC mutations are often the cause of FA in patients of Ashkenazi Jewish (AJ) ancestry, and we identified 2 novel FANCC mutations in 2 patients of AJ ancestry. We describe here a strategy for efficient molecular diagnosis of FA.
Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R
2007-01-01
The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat
10p Duplication characterized by fluorescence in situ hybridization
Energy Technology Data Exchange (ETDEWEB)
Wiktor, A.; Feldman, G.L.; Van Dyke, D.L.; Kratkoczki, P.; Ditmars, D.M. Jr. [Henry Ford Hospital, Detroit, MI (United States)
1994-09-01
We describe a patient with severe failure to thrive, mild-moderate developmental delay, cleft lip and palate, and other anomalies. Routine cytogenetic analysis documented a de novo chromosome rearrangement involving chromosome 4, but the origin of the derived material was unknown. Using chromosome specific painting probes, the karyotype was defined as 46,XY,der(4)t(4;10)(q35;p11.23). Characterization of the dup(10p) by fluorescence in situ hybridization (FISH) analysis provides another example of the usefulness of this technology in identifying small deletions, duplications, or supernumerary marker chromosomes. 19 refs., 4 figs.
Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.
Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A
2018-06-04
Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.
2014-01-01
Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669
Haghshenas, Maryam; Akbari, Mohammad Taghi; Karizi, Shohreh Zare; Deilamani, Faravareh Khordadpoor; Nafissi, Shahriar; Salehi, Zivar
2016-06-01
Duchenne and Becker muscular dystrophies (DMD and BMD) are X-linked neuromuscular diseases characterized by progressive muscular weakness and degeneration of skeletal muscles. Approximately two-thirds of the patients have large deletions or duplications in the dystrophin gene and the remaining one-third have point mutations. This study was performed to evaluate point mutations in Iranian DMD/BMD male patients. A total of 29 DNA samples from patients who did not show any large deletion/duplication mutations following multiplex polymerase chain reaction (PCR) and multiplex ligation-dependent probe amplification (MLPA) screening were sequenced for detection of point mutations in exons 50-79. Also exon 44 was sequenced in one sample in which a false positive deletion was detected by MLPA method. Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants.
Directory of Open Access Journals (Sweden)
Jessica B Hostetler
2016-10-01
Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.
The evolution of the tape measure protein: units, duplications and losses
Directory of Open Access Journals (Sweden)
Poisson Guylaine
2011-10-01
Full Text Available Abstract Background A large family of viruses that infect bacteria, called phages, is characterized by long tails used to inject DNA into their victims' cells. The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species. A natural question is whether there exist units for these tape measures, and if different tape measures have different units and lengths. Such units would allow us to retrace the evolution of tape measure proteins using their duplication/loss history. The vast number of sequenced phages genomes allows us to attack this problem with a comparative genomics approach. Results Here we describe a subset of phages whose tape measure proteins contain variable numbers of an 11 amino acids sequence repeat, aligned with sequence similarity, structural properties, and simple arithmetics. This subset provides a unique opportunity for the combinatorial study of phage evolution, without the added uncertainties of multiple alignments, which are trivial in this case, or of protein functions, that are well established. We give a heuristic that reconstructs the duplication history of these sequences, using divergent strains to discriminate between mutations that occurred before and after speciation, or lineage divergence. The heuristic is based on an efficient algorithm that gives an exhaustive enumeration of all possible parsimonious reconstructions of the duplication/speciation history of a single nucleotide. Finally, we present a method that allows, when possible, to discriminate between duplication and loss events. Conclusions Establishing the evolutionary history of viruses is difficult, in part due to extensive recombinations and gene transfers, and high mutation rates that often erase detectable similarity between homologous genes. In this paper, we introduce new tools to address this
Radiological findings of male urethral duplication associated with bladder duplication: case report
International Nuclear Information System (INIS)
Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae
2004-01-01
Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication
Energy Technology Data Exchange (ETDEWEB)
Kenwrick, S J; Smith, T J; England, S; Collins, F; Davies, K E
1988-02-25
The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.
Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C
2008-02-12
The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.
Directory of Open Access Journals (Sweden)
Chen Chen
Full Text Available Duchenne muscular dystrophy (DMD is a common X-linked recessive disease of muscle degeneration and death. In order to provide accurate and reliable genetic counseling and prenatal diagnosis, we screened DMD mutations in a cohort of 119 Chinese patients using multiplex ligation-dependent probe amplification (MLPA and denaturing high performance liquid chromatography (DHPLC followed by Sanger sequencing. In these unrelated DMD patients, we identified 11 patients with DMD small mutations (9.2% and 81 patients with DMD deletions/duplications (del/dup (68.1%, of which 64 (79.0% were deletions, 16 (19.8% were duplications, and one (1.2% was both deletion and duplication. Furthermore, we analyzed the frequency of DMD breakpoint in the 64 deletion cases by calculating exon-deletion events of certain exon interval that revealed a novel mutation hotspot boundary. To explore why DMD rearrangement breakpoints were predisposed to specific regions (hotspot, we precisely characterized junction sequences of breakpoints at the nucleotide level in 21 patients with exon deleted/duplicated in DMD with a high-resolution SNP microarray assay. There were no exactly recurrent breakpoints and there was also no significant difference between single-exon del/dup and multiple-exon del/dup cases. The data from the current study provided a comprehensive strategy to detect DMD mutations for clinical practice, and identified two deletion hotspots at exon 43-55 and exon 10-23 by calculating exon-deletion events of certain exon interval. Furthermore, this is the first study to characterize DMD breakpoint at the nucleotide level in a Chinese population. Our observations provide better understanding of the mechanism for DMD gene rearrangements.
MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement
Directory of Open Access Journals (Sweden)
Zhang Liqing
2010-01-01
Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments
A case of de novo duplication of 15q24-q26.3
Directory of Open Access Journals (Sweden)
Hye Ran Kim
2011-06-01
Full Text Available Distal duplication, or trisomy 15q, is an extremely rare chromosomal disorder characterized by prenatal and postnatal overgrowth, mental retardation, and craniofacial malformations. Additional abnormalities typically include an unusually short neck, malformations of the fingers and toes, scoliosis and skeletal malformations, genital abnormalities, particularly in affected males, and, in some cases, cardiac defects. The range and severity of symptoms and physical findings may vary from case to case, depending upon the length and location of the duplicated portion of chromosome 15q. Most reported cases of duplication of the long arm of chromosome 15 frequently have more than one segmental imbalance resulting from unbalanced translocations involving chromosome 15 and deletions in another chromosome, as well as other structural chromosomal abnormalities. We report a female newborn with a de novo duplication, 15q24- q26.3, showing intrauterine overgrowth, a narrow asymmetric face with down-slanting palpebral fissures, a large, prominent nose, and micrognathia, arachnodactyly, camptodactyly, congenital heart disease, hydronephrosis, and hydroureter. Chromosomal analysis showed a 46,XX,inv(9(p12q13,dup(15(q24q26.3. Array comparative genomic hybridization analysis revealed a gain of 42 clones on 15q24-q26.3. This case represents the only reported patient with a de novo 15q24-q26.3 duplication that did not result from an unbalanced translocation and did not have a concomitant monosomic component in Korea.
Cuscó, Ivon; del Campo, Miguel; Vilardell, Mireia; González, Eva; Gener, Blanca; Galán, Enrique; Toledo, Laura; Pérez-Jurado, Luis A
2008-04-11
Kabuki syndrome (KS) is a multiple congenital anomaly syndrome characterized by specific facial features, mild to moderate mental retardation, postnatal growth delay, skeletal abnormalities, and unusual dermatoglyphic patterns with prominent fingertip pads. A 3.5 Mb duplication at 8p23.1-p22 was once reported as a specific alteration in KS but has not been confirmed in other patients. The molecular basis of KS remains unknown. We have studied 16 Spanish patients with a clinical diagnosis of KS or KS-like to search for genomic imbalances using genome-wide array technologies. All putative rearrangements were confirmed by FISH, microsatellite markers and/or MLPA assays, which also determined whether the imbalance was de novo or inherited. No duplication at 8p23.1-p22 was observed in our patients. We detected complex rearrangements involving 2q in two patients with Kabuki-like features: 1) a de novo inverted duplication of 11 Mb with a 4.5 Mb terminal deletion, and 2) a de novo 7.2 Mb-terminal deletion in a patient with an additional de novo 0.5 Mb interstitial deletion in 16p. Additional copy number variations (CNV), either inherited or reported in normal controls, were identified and interpreted as polymorphic variants. No specific CNV was significantly increased in the KS group. Our results further confirmed that genomic duplications of 8p23 region are not a common cause of KS and failed to detect other recurrent rearrangement causing this disorder. The detection of two patients with 2q37 deletions suggests that there is a phenotypic overlap between the two conditions, and screening this region in the Kabuki-like patients should be considered.
Annelid Distal-less/Dlx duplications reveal varied post-duplication fates
Directory of Open Access Journals (Sweden)
Korchagina Natalia
2011-08-01
Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.
Comprehensive analysis of pathogenic deletion variants in Fanconi anemia genes.
Flynn, Elizabeth K; Kamat, Aparna; Lach, Francis P; Donovan, Frank X; Kimble, Danielle C; Narisu, Narisu; Sanborn, Erica; Boulad, Farid; Davies, Stella M; Gillio, Alfred P; Harris, Richard E; MacMillan, Margaret L; Wagner, John E; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A; Chandrasekharappa, Settara C
2014-11-01
Fanconi anemia (FA) is a rare recessive disease resulting from mutations in one of at least 16 different genes. Mutation types and phenotypic manifestations of FA are highly heterogeneous and influence the clinical management of the disease. We analyzed 202 FA families for large deletions, using high-resolution comparative genome hybridization arrays, single-nucleotide polymorphism arrays, and DNA sequencing. We found pathogenic deletions in 88 FANCA, seven FANCC, two FANCD2, and one FANCB families. We find 35% of FA families carry large deletions, accounting for 18% of all FA pathogenic variants. Cloning and sequencing across the deletion breakpoints revealed that 52 FANCA deletion ends, and one FANCC deletion end extended beyond the gene boundaries, potentially affecting neighboring genes with phenotypic consequences. Seventy-five percent of the FANCA deletions are Alu-Alu mediated, predominantly by AluY elements, and appear to be caused by nonallelic homologous recombination. Individual Alu hotspots were identified. Defining the haplotypes of four FANCA deletions shared by multiple families revealed that three share a common ancestry. Knowing the exact molecular changes that lead to the disease may be critical for a better understanding of the FA phenotype, and to gain insight into the mechanisms driving these pathogenic deletion variants. © 2014 WILEY PERIODICALS, INC.
Gillet-Markowska, Alexandre; Richard, Hugues; Fischer, Gilles; Lafontaine, Ingrid
2015-03-15
The detection of structural variations (SVs) in short-range Paired-End (PE) libraries remains challenging because SV breakpoints can involve large dispersed repeated sequences, or carry inherent complexity, hardly resolvable with classical PE sequencing data. In contrast, large insert-size sequencing libraries (Mate-Pair libraries) provide higher physical coverage of the genome and give access to repeat-containing regions. They can thus theoretically overcome previous limitations as they are becoming routinely accessible. Nevertheless, broad insert size distributions and high rates of chimerical sequences are usually associated to this type of libraries, which makes the accurate annotation of SV challenging. Here, we present Ulysses, a tool that achieves drastically higher detection accuracy than existing tools, both on simulated and real mate-pair sequencing datasets from the 1000 Human Genome project. Ulysses achieves high specificity over the complete spectrum of variants by assessing, in a principled manner, the statistical significance of each possible variant (duplications, deletions, translocations, insertions and inversions) against an explicit model for the generation of experimental noise. This statistical model proves particularly useful for the detection of low frequency variants. SV detection performed on a large insert Mate-Pair library from a breast cancer sample revealed a high level of somatic duplications in the tumor and, to a lesser extent, in the blood sample as well. Altogether, these results show that Ulysses is a valuable tool for the characterization of somatic mosaicism in human tissues and in cancer genomes. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
M Febin Farook
Full Text Available Childhood neurodevelopmental disorders like Angelman syndrome and autism may be the result of underlying defects in neuronal plasticity and ongoing problems with synaptic signaling. Some of these defects may be due to abnormal monoamine levels in different regions of the brain. Ube3a, a gene that causes Angelman syndrome (AS when maternally deleted and is associated with autism when maternally duplicated has recently been shown to regulate monoamine synthesis in the Drosophila brain. Therefore, we examined monoamine levels in striatum, ventral midbrain, frontal cerebral cortex, cerebellar cortex and hippocampus in Ube3a deficient and Ube3a duplication animals. We found that serotonin (5HT, a monoamine affected in autism, was elevated in the striatum and cortex of AS mice. Dopamine levels were almost uniformly elevated compared to control littermates in the striatum, midbrain and frontal cortex regardless of genotype in Ube3a deficient and Ube3a duplication animals. In the duplication 15q autism mouse model, paternal but not maternal duplication animals showed a decrease in 5HT levels when compared to their wild type littermates, in accordance with previously published data. However, maternal duplication animals show no significant changes in 5HT levels throughout the brain. These abnormal monoamine levels could be responsible for many of the behavioral abnormalities observed in both AS and autism, but further investigation is required to determine if any of these changes are purely dependent on Ube3a levels in the brain.
Directory of Open Access Journals (Sweden)
Chenfei Zheng
Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P
Rare Genome-Wide Copy Number Variation and Expression of Schizophrenia in 22q11.2 Deletion Syndrome.
Bassett, Anne S; Lowther, Chelsea; Merico, Daniele; Costain, Gregory; Chow, Eva W C; van Amelsvoort, Therese; McDonald-McGinn, Donna; Gur, Raquel E; Swillen, Ann; Van den Bree, Marianne; Murphy, Kieran; Gothelf, Doron; Bearden, Carrie E; Eliez, Stephan; Kates, Wendy; Philip, Nicole; Sashi, Vandana; Campbell, Linda; Vorstman, Jacob; Cubells, Joseph; Repetto, Gabriela M; Simon, Tony; Boot, Erik; Heung, Tracy; Evers, Rens; Vingerhoets, Claudia; van Duin, Esther; Zackai, Elaine; Vergaelen, Elfi; Devriendt, Koen; Vermeesch, Joris R; Owen, Michael; Murphy, Clodagh; Michaelovosky, Elena; Kushan, Leila; Schneider, Maude; Fremont, Wanda; Busa, Tiffany; Hooper, Stephen; McCabe, Kathryn; Duijff, Sasja; Isaev, Karin; Pellecchia, Giovanna; Wei, John; Gazzellone, Matthew J; Scherer, Stephen W; Emanuel, Beverly S; Guo, Tingwei; Morrow, Bernice E; Marshall, Christian R
2017-11-01
Chromosome 22q11.2 deletion syndrome (22q11.2DS) is associated with a more than 20-fold increased risk for developing schizophrenia. The aim of this study was to identify additional genetic factors (i.e., "second hits") that may contribute to schizophrenia expression. Through an international consortium, the authors obtained DNA samples from 329 psychiatrically phenotyped subjects with 22q11.2DS. Using a high-resolution microarray platform and established methods to assess copy number variation (CNV), the authors compared the genome-wide burden of rare autosomal CNV, outside of the 22q11.2 deletion region, between two groups: a schizophrenia group and those with no psychotic disorder at age ≥25 years. The authors assessed whether genes overlapped by rare CNVs were overrepresented in functional pathways relevant to schizophrenia. Rare CNVs overlapping one or more protein-coding genes revealed significant between-group differences. For rare exonic duplications, six of 19 gene sets tested were enriched in the schizophrenia group; genes associated with abnormal nervous system phenotypes remained significant in a stepwise logistic regression model and showed significant interactions with 22q11.2 deletion region genes in a connectivity analysis. For rare exonic deletions, the schizophrenia group had, on average, more genes overlapped. The additional rare CNVs implicated known (e.g., GRM7, 15q13.3, 16p12.2) and novel schizophrenia risk genes and loci. The results suggest that additional rare CNVs overlapping genes outside of the 22q11.2 deletion region contribute to schizophrenia risk in 22q11.2DS, supporting a multigenic hypothesis for schizophrenia. The findings have implications for understanding expression of psychotic illness and herald the importance of whole-genome sequencing to appreciate the overall genomic architecture of schizophrenia.
Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris
2018-01-22
Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kenwrick, S.J.; Smith, T.J.; England, S.; Collins, F.; Davies, K.E.
1988-02-25
The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.
LaDuca, Holly; Stuenkel, A J; Dolinsky, Jill S.; Keiles, Steven; Tandy, Stephany; Pesaran, Tina; Chen, Elaine; Gau, Chia-Ling; Palmaer, Erika; Shoaepour, Kamelia; Shah, Divya; Speare, Virginia; Gandomi, Stephanie; Chao, Elizabeth
2014-01-01
Purpose: The aim of this study was to determine the clinical and molecular characteristics of 2,079 patients who underwent hereditary cancer multigene panel testing. Methods: Panels included comprehensive analysis of 14–22 cancer susceptibility genes (BRCA1 and BRCA2 not included), depending on the panel ordered (BreastNext, OvaNext, ColoNext, or CancerNext). Next-generation sequencing and deletion/duplication analyses were performed for all genes except EPCAM (deletion/duplication analysis o...
Frahry, Matthew Blake; Sun, Cheng; Chong, Rebecca A; Mueller, Rachel Lockridge
2015-02-01
Across the tree of life, species vary dramatically in nuclear genome size. Mutations that add or remove sequences from genomes-insertions or deletions, or indels-are the ultimate source of this variation. Differences in the tempo and mode of insertion and deletion across taxa have been proposed to contribute to evolutionary diversity in genome size. Among vertebrates, most of the largest genomes are found within the salamanders, an amphibian clade with genome sizes ranging from ~14 to ~120 Gb. Salamander genomes have been shown to experience slower rates of DNA loss through small (i.e., genomes. However, no studies have addressed DNA loss from salamander genomes resulting from larger deletions. Here, we focus on one type of large deletion-ectopic-recombination-mediated removal of LTR retrotransposon sequences. In ectopic recombination, double-strand breaks are repaired using a "wrong" (i.e., ectopic, or non-allelic) template sequence-typically another locus of similar sequence. When breaks occur within the LTR portions of LTR retrotransposons, ectopic-recombination-mediated repair can produce deletions that remove the internal transposon sequence and the equivalent of one of the two LTR sequences. These deletions leave a signature in the genome-a solo LTR sequence. We compared levels of solo LTRs in the genomes of four salamander species with levels present in five vertebrates with smaller genomes. Our results demonstrate that salamanders have low levels of solo LTRs, suggesting that ectopic-recombination-mediated deletion of LTR retrotransposons occurs more slowly than in other vertebrates with smaller genomes.
França, M M; Funari, M F A; Nishi, M Y; Narcizo, A M; Domenice, S; Costa, E M F; Lerario, A M; Mendonca, B B
2018-02-01
Targeted massively parallel sequencing (TMPS) has been used in genetic diagnosis for Mendelian disorders. In the past few years, the TMPS has identified new and already described genes associated with primary ovarian insufficiency (POI) phenotype. Here, we performed a targeted gene sequencing to find a genetic diagnosis in idiopathic cases of Brazilian POI cohort. A custom SureSelect XT DNA target enrichment panel was designed and the sequencing was performed on Illumina NextSeq sequencer. We identified 1 homozygous 1-bp deletion variant (c.783delC) in the GDF9 gene in 1 patient with POI. The variant was confirmed and segregated using Sanger sequencing. The c.783delC GDF9 variant changed an amino acid creating a premature termination codon (p.Ser262Hisfs*2). This variant was not present in all public databases (ExAC/gnomAD, NHLBI/EVS and 1000Genomes). Moreover, it was absent in 400 alleles from fertile Brazilian women screened by Sanger sequencing. The patient's mother and her unaffected sister carried the c.783delC variant in a heterozygous state, as expected for an autosomal recessive inheritance. Here, the TMPS identified the first homozygous 1-bp deletion variant in GDF9. This finding reveals a novel inheritance pattern of pathogenic variant in GDF9 associated with POI, thus improving the genetic diagnosis of this disorder. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Molecular studies of deletions at the human steroid sulfatase locus
International Nuclear Information System (INIS)
Shapiro, L.J.; Yen, P.; Pomerantz, D.; Martin, E.; Rolewic, L.; Mohandas, T.
1989-01-01
The human steroid sulfatase gene (STS) is located on the distal X chromosome short arm close to the pseudoautosomal region but in a segment of DNA that is unique to the X chromosome. In contrast to most X chromosome-encoded genes, STS expression is not extinguished during the process of X chromosome inactivation. Deficiency of STS activity produced the syndrome of X chromosome-linked ichthyosis, which is one of the most common inborn errors of metabolism in man. Approximately 90% of STS - individuals have large deletions at the STS locus. The authors and others have found that the end points of such deletions are heterogeneous in their location. One recently ascertained subject was observed to have a 40-kilobase deletion that is entirely intragenic, permitting the cloning and sequencing of the deletion junction. Studies of this patient and of other X chromosome sequences in other subjects permit some insight into the mechanism(s) responsible for generating frequent deletions on the short arm of the X chromosome
Energy Technology Data Exchange (ETDEWEB)
Hoop, R.C.; Schwartz, L.S.; Hoffman, E.P. [Univ. of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Russo, L.S. [Univ. of Florida, Jacksonville, FL (United States); Riconda, D.L. [Orlando Regional Medical Center, Orlando, FL (United States)
1994-02-01
Two male cousins with Duchenne muscular dystrophy were found to have different maternal dystrophin gene haplotypes and different deletion mutations. One propositus showed two noncontiguous deletions-one in the 5{prime}, proximal deletional hotspot region, and the other in the 3{prime}, more distal deletional hotspot region. The second propositus showed only the 5{prime} deletion. Using multiple fluorescent exon dosage and fluorescent multiplex CA repeat linkage analyses, the authors show that the mother of each propositus carries both deletions on the same grandmaternal X chromosome. This paradox is explained by a single recombinational event between the 2 deleted regions of one of the carrier`s dystrophin genes, giving rise to a son with a partially {open_quotes}repaired{close_quotes} gene retaining only the 5{prime} deletion. 20 refs., 4 figs.
2012-01-01
Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280
Yavaş, Gökhan; Koyutürk, Mehmet; Gould, Meetha P; McMahon, Sarah; LaFramboise, Thomas
2014-03-05
With the advent of paired-end high throughput sequencing, it is now possible to identify various types of structural variation on a genome-wide scale. Although many methods have been proposed for structural variation detection, most do not provide precise boundaries for identified variants. In this paper, we propose a new method, Distribution Based detection of Duplication Boundaries (DB2), for accurate detection of tandem duplication breakpoints, an important class of structural variation, with high precision and recall. Our computational experiments on simulated data show that DB2 outperforms state-of-the-art methods in terms of finding breakpoints of tandem duplications, with a higher positive predictive value (precision) in calling the duplications' presence. In particular, DB2's prediction of tandem duplications is correct 99% of the time even for very noisy data, while narrowing down the space of possible breakpoints within a margin of 15 to 20 bps on the average. Most of the existing methods provide boundaries in ranges that extend to hundreds of bases with lower precision values. Our method is also highly robust to varying properties of the sequencing library and to the sizes of the tandem duplications, as shown by its stable precision, recall and mean boundary mismatch performance. We demonstrate our method's efficacy using both simulated paired-end reads, and those generated from a melanoma sample and two ovarian cancer samples. Newly discovered tandem duplications are validated using PCR and Sanger sequencing. Our method, DB2, uses discordantly aligned reads, taking into account the distribution of fragment length to predict tandem duplications along with their breakpoints on a donor genome. The proposed method fine tunes the breakpoint calls by applying a novel probabilistic framework that incorporates the empirical fragment length distribution to score each feasible breakpoint. DB2 is implemented in Java programming language and is freely available
Directory of Open Access Journals (Sweden)
Wayne Aubrey
Full Text Available Many advances in synthetic biology require the removal of a large number of genomic elements from a genome. Most existing deletion methods leave behind markers, and as there are a limited number of markers, such methods can only be applied a fixed number of times. Deletion methods that recycle markers generally are either imprecise (remove untargeted sequences, or leave scar sequences which can cause genome instability and rearrangements. No existing marker recycling method is automation-friendly. We have developed a novel openly available deletion tool that consists of: 1 a method for deleting genomic elements that can be repeatedly used without limit, is precise, scar-free, and suitable for automation; and 2 software to design the method's primers. Our tool is sequence agnostic and could be used to delete large numbers of coding sequences, promoter regions, transcription factor binding sites, terminators, etc in a single genome. We have validated our tool on the deletion of non-essential open reading frames (ORFs from S. cerevisiae. The tool is applicable to arbitrary genomes, and we provide primer sequences for the deletion of: 90% of the ORFs from the S. cerevisiae genome, 88% of the ORFs from S. pombe genome, and 85% of the ORFs from the L. lactis genome.
Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes
Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.
2011-01-01
vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289
Hirschfeldova, Katerina; Solc, Roman
2017-09-05
The effect of heterozygous duplications of SHOX and associated elements on Lėri-Weill dyschondrosteosis (LWD) and idiopathic short stature (ISS) development is less distinct when compared to reciprocal deletions. The aim of our study was to compare frequency and distribution of duplications within SHOX and associated elements between population sample and LWD (ISS) patients. A preliminary analysis conducted on Czech population sample of 250 individuals compared to our previously reported sample of 352 ISS/LWD Czech patients indicated that rather than the difference in frequency of duplications it is the difference in their distribution. Particularly, there was an increased frequency of duplications residing to the CNE-9 enhancer in our LWD/ISS sample. To see whether the obtained data are consistent across published studies we made a literature survey to get published cases with SHOX or associated elements duplication and formed the merged LWD, the merged ISS, and the merged population samples. Relative frequency of particular region duplication in each of those merged samples were calculated. There was a significant difference in the relative frequency of CNE-9 enhancer duplications (11 vs. 3) and complete SHOX (exon1-6b) duplications (4 vs. 24) (p-value 0.0139 and p-value 0.000014, respectively) between the merged LWD sample and the merged population sample. We thus propose that partial SHOX duplications and small duplications encompassing CNE-9 enhancer could be highly penetrant alleles associated with ISS and LWD development. Copyright © 2017 Elsevier B.V. All rights reserved.
Hominoid chromosomal rearrangements on 17q map to complex regions of segmental duplication.
Cardone, Maria Francesca; Jiang, Zhaoshi; D'Addabbo, Pietro; Archidiacono, Nicoletta; Rocchi, Mariano; Eichler, Evan E; Ventura, Mario
2008-01-01
Chromosomal rearrangements, such as translocations and inversions, are recurrent phenomena during evolution, and both of them are involved in reproductive isolation and speciation. To better understand the molecular basis of chromosome rearrangements and their part in karyotype evolution, we have investigated the history of human chromosome 17 by comparative fluorescence in situ hybridization (FISH) and sequence analysis. Human bacterial artificial chromosome/p1 artificial chromosome probes spanning the length of chromosome 17 were used in FISH experiments on great apes, Old World monkeys and New World monkeys to study the evolutionary history of this chromosome. We observed that the macaque marker order represents the ancestral organization. Human, chimpanzee and gorilla homologous chromosomes differ by a paracentric inversion that occurred specifically in the Homo sapiens/Pan troglodytes/Gorilla gorilla ancestor. Detailed analyses of the paracentric inversion revealed that the breakpoints mapped to two regions syntenic to human 17q12/21 and 17q23, both rich in segmental duplications. Sequence analyses of the human and macaque organization suggest that the duplication events occurred in the catarrhine ancestor with the duplication blocks continuing to duplicate or undergo gene conversion during evolution of the hominoid lineage. We propose that the presence of these duplicons has mediated the inversion in the H. sapiens/P. troglodytes/G. gorilla ancestor. Recently, the same duplication blocks have been shown to be polymorphic in the human population and to be involved in triggering microdeletion and duplication in human. These results further support a model where genomic architecture has a direct role in both rearrangement involved in karyotype evolution and genomic instability in human.
Loupe, Jacob; Sampath, Srirangan; Lacassie, Yves
2014-10-01
We report an African-American family that was identified after the proposita was referred for diagnostic evaluation at 4½ months with a history of Hirschsprung and dysmorphic features typical of Waardenburg syndrome (WS). Family evaluation revealed that the father had heterochromidia irides and hypertelorism supporting the clinical diagnosis of WS; however, examination of the mother revealed characteristic facial and digital features of Coffin-Lowry syndrome (CLS). Molecular testing of the mother identified a novel 2 bp deletion (c.865_866delCA) in codon 289 of RPS6KA3 leading to a frame-shift and premature termination of translation 5 codons downstream (NM_004586.2:p.Gln289ValfsX5). This deletion also was identified in the proposita and her three sisters with a clinical suspicion of CLS, all of whom as carriers for this X-linked disorder had very subtle manifestations. The molecular confirmation of WS type 4 (Shah-Waardenburg; WS4) was not as straightforward. To evaluate WS types 1-4, multiple sequential molecular tests were requested, including Sanger sequencing of all exons, and deletion/duplication analysis using MLPA for PAX3, MITF, SOX10, EDN3 and EDNRB. Although sequencing did not identify any disease causing variants, MLPA identified a heterozygous deletion of the entire EDNRB in the father. This deletion was also found in the proposita and the oldest child. Since the heterozygous deletion was the only change identified in EDNRB, this family represents one of the few cases of an autosomal dominant inheritance of WS4 involving the endothelin pathway. Altogether, clinical evaluation of the family revealed one child to be positive for WS4 and two positive for CLS, while two children were positive for both diseases simultaneously (including the proposita) while another pair test negative for either disease. This kinship is an example of the coincidence of two conditions co-segregating in one family, with variable phenotypes requiring molecular testing to
Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence
International Nuclear Information System (INIS)
Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.
2015-01-01
The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)
Directory of Open Access Journals (Sweden)
Stephen C Collins
2010-03-01
Full Text Available Fragile X syndrome (FXS is caused by loss of function mutations in the FMR1 gene. Trinucleotide CGG-repeat expansions, resulting in FMR1 gene silencing, are the most common mutations observed at this locus. Even though the repeat expansion mutation is a functional null mutation, few conventional mutations have been identified at this locus, largely due to the clinical laboratory focus on the repeat tract.To more thoroughly evaluate the frequency of conventional mutations in FXS-like patients, we used an array-based method to sequence FMR1 in 51 unrelated males exhibiting several features characteristic of FXS but with normal CGG-repeat tracts of FMR1. One patient was identified with a deletion in FMR1, but none of the patients were found to have other conventional mutations.These data suggest that missense mutations in FMR1 are not a common cause of the FXS phenotype in patients who have normal-length CGG-repeat tracts. However, screening for small deletions of FMR1 may be of clinically utility.
Genomic rearrangements by LINE-1 insertion-mediated deletion in the human and chimpanzee lineages.
Han, Kyudong; Sen, Shurjo K; Wang, Jianxin; Callinan, Pauline A; Lee, Jungnam; Cordaux, Richard; Liang, Ping; Batzer, Mark A
2005-01-01
Long INterspersed Elements (LINE-1s or L1s) are abundant non-LTR retrotransposons in mammalian genomes that are capable of insertional mutagenesis. They have been associated with target site deletions upon insertion in cell culture studies of retrotransposition. Here, we report 50 deletion events in the human and chimpanzee genomes directly linked to the insertion of L1 elements, resulting in the loss of approximately 18 kb of sequence from the human genome and approximately 15 kb from the chimpanzee genome. Our data suggest that during the primate radiation, L1 insertions may have deleted up to 7.5 Mb of target genomic sequences. While the results of our in vivo analysis differ from those of previous cell culture assays of L1 insertion-mediated deletions in terms of the size and rate of sequence deletion, evolutionary factors can reconcile the differences. We report a pattern of genomic deletion sizes similar to those created during the retrotransposition of Alu elements. Our study provides support for the existence of different mechanisms for small and large L1-mediated deletions, and we present a model for the correlation of L1 element size and the corresponding deletion size. In addition, we show that internal rearrangements can modify L1 structure during retrotransposition events associated with large deletions.
Directory of Open Access Journals (Sweden)
Gadagkar Sudhindra R
2010-04-01
with microtubule-associated proteins. CTT residues overwhelming comprise the co-evolving residues between Drosophila alpha 2 and beta 3 tubulin proteins, indicating CTT specializations can be mediated at the level of the tubulin dimer. Gene duplications post-dating separation of the insect orders are unevenly distributed, most often appearing in major alpha 1 and minor beta 2 clades. More than 40 introns are found in tubulins. Their distribution among tubulins reveals that insertion and deletion events are common, surprising given their potential for disrupting tubulin coding sequence. Compensatory evolution is found in Drosophila beta 2 tubulin cis-regulation, and reveals selective pressures acting to maintain testis expression without the use of previously identified testis cis-regulatory elements. Conclusion Tubulins have stringent structure/function relationships, indicated by strong purifying selection, the loss of many gene duplication products, alpha-beta co-evolution in the tubulin dimer, and compensatory evolution in beta 2 tubulin cis-regulation. They evolve through gene duplication, subfunctionalization in expression domain and divergence of duplication products, largely in CTT residues that mediate interactions with other proteins. This has resulted in the tissue-specific minor insect isoforms, and in particular the highly diverse α3, α4, and β2 reproductive tissue-specific tubulin isoforms, illustrating that even a highly conserved protein family can participate in the adaptive process and respond to sexual selection.
Directory of Open Access Journals (Sweden)
Etchells J Peter
2009-10-01
Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.
Detection of three-base deletion by exciplex formation with perylene derivatives.
Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki
2011-06-14
Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011
A survey of innovation through duplication in the reduced genomes of twelve parasites.
Directory of Open Access Journals (Sweden)
Jeremy D DeBarry
Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that
Naveilhan, P; Baudet, C; Jabbour, W; Wion, D
1994-09-01
A model that may explain the limited division potential of certain cells such as human fibroblasts in culture is presented. The central postulate of this theory is that there exists, prior to certain key exons that code for materials needed for cell division, a unique sequence of specific repeating segments of DNA. One copy of such repeating segments is deleted during each cell cycle in cells that are not protected from such deletion through methylation of their cytosine residues. According to this theory, the means through which such repeated sequences are removed, one per cycle, is through the sequential action of enzymes that act much as bacterial restriction enzymes do--namely to produce scissions in both strands of DNA in areas that correspond to the DNA base sequence recognition specificities of such enzymes. After the first scission early in a replicative cycle, that enzyme becomes inhibited, but the cleavage of the first site exposes the closest site in the repetitive element to the action of a second restriction enzyme after which that enzyme also becomes inhibited. Then repair occurs, regenerating the original first site. Through this sequential activation and inhibition of two different restriction enzymes, only one copy of the repeating sequence is deleted during each cell cycle. In effect, the repeating sequence operates as a precise counter of the numbers of cell doubling that have occurred since the cells involved differentiated during development.
North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.
Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P
2016-01-01
To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC
Benito-Sanz, S; Barroso, E; Heine-Suñer, D; Hisado-Oliva, A; Romanelli, V; Rosell, J; Aragones, A; Caimari, M; Argente, J; Ross, J L; Zinn, A R; Gracia, R; Lapunzina, P; Campos-Barros, A; Heath, K E
2011-02-01
Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and the Madelung deformity of the forearm. SHOX mutations and pseudoautosomal region 1 deletions encompassing SHOX or its enhancers have been identified in approximately 60% of LWD and approximately 15% of idiopathic short stature (ISS) individuals. Recently SHOX duplications have been described in LWD/ISS but also in individuals with other clinical manifestations, thus questioning their pathogenicity. The objective of the study was to investigate the pathogenicity of SHOX duplications in LWD and ISS. Multiplex ligation-dependent probe amplification is routinely used in our unit to analyze for SHOX/pseudoautosomal region 1 copy number changes in LWD/ISS referrals. Quantitative PCR, microsatellite marker, and fluorescence in situ hybridization analysis were undertaken to confirm all identified duplications. During the routine analysis of 122 LWD and 613 ISS referrals, a total of four complete and 10 partial SHOX duplications or multiple copy number (n > 3) as well as one duplication of the SHOX 5' flanking region were identified in nine LWD and six ISS cases. Partial SHOX duplications appeared to have a more deleterious effect on skeletal dysplasia and height gain than complete SHOX duplications. Importantly, no increase in SHOX copy number was identified in 340 individuals with normal stature or 104 overgrowth referrals. MLPA analysis of SHOX/PAR1 led to the identification of partial and complete SHOX duplications or multiple copies associated with LWD or ISS, suggesting that they may represent an additional class of mutations implicated in the molecular etiology of these clinical entities.
Quantum deletion: Beyond the no-deletion principle
International Nuclear Information System (INIS)
Adhikari, Satyabrata
2005-01-01
Suppose we are given two identical copies of an unknown quantum state and we wish to delete one copy from among the given two copies. The quantum no-deletion principle restricts us from perfectly deleting a copy but it does not prohibit us from deleting a copy approximately. Here we construct two types of a 'universal quantum deletion machine' which approximately deletes a copy such that the fidelity of deletion does not depend on the input state. The two types of universal quantum deletion machines are (1) a conventional deletion machine described by one unitary operator and (2) a modified deletion machine described by two unitary operators. Here it is shown that the modified deletion machine deletes a qubit with fidelity 3/4, which is the maximum limit for deleting an unknown quantum state. In addition to this we also show that the modified deletion machine retains the qubit in the first mode with average fidelity 0.77 (approx.) which is slightly greater than the fidelity of measurement for two given identical states, showing how precisely one can determine its state [S. Massar and S. Popescu, Phys. Rev. Lett. 74, 1259 (1995)]. We also show that the deletion machine itself is input state independent, i.e., the information is not hidden in the deleting machine, and hence we can delete the information completely from the deletion machine
Directory of Open Access Journals (Sweden)
Ariel M Pani
2010-08-01
Full Text Available Intellectual disability (ID affects 2-3% of the population and may occur with or without multiple congenital anomalies (MCA or other medical conditions. Established genetic syndromes and visible chromosome abnormalities account for a substantial percentage of ID diagnoses, although for approximately 50% the molecular etiology is unknown. Individuals with features suggestive of various syndromes but lacking their associated genetic anomalies pose a formidable clinical challenge. With the advent of microarray techniques, submicroscopic genome alterations not associated with known syndromes are emerging as a significant cause of ID and MCA.High-density SNP microarrays were used to determine genome wide copy number in 42 individuals: 7 with confirmed alterations in the WS region but atypical clinical phenotypes, 31 with ID and/or MCA, and 4 controls. One individual from the first group had the most telomeric gene in the WS critical region deleted along with 2 Mb of flanking sequence. A second person had the classic WS deletion and a rearrangement on chromosome 5p within the Cri du Chat syndrome (OMIM:123450 region. Six individuals from the ID/MCA group had large rearrangements (3 deletions, 3 duplications, one of whom had a large inversion associated with a deletion that was not detected by the SNP arrays.Combining SNP microarray analyses and qPCR allowed us to clone and sequence 21 deletion breakpoints in individuals with atypical deletions in the WS region and/or ID or MCA. Comparison of these breakpoints to databases of genomic variation revealed that 52% occurred in regions harboring structural variants in the general population. For two probands the genomic alterations were flanked by segmental duplications, which frequently mediate recurrent genome rearrangements; these may represent new genomic disorders. While SNP arrays and related technologies can identify potentially pathogenic deletions and duplications, obtaining sequence information
Three duplication events and variable molecular evolution ...
Indian Academy of Sciences (India)
Some large insertion fragments of NbeGGPS1 and NbeGGPS3 were deleted for more visibility. Three conserved motifs were located in the middle region of proteins and were conservative in all 25 sequences. Four positive selection sites were detected in N-terminal region of proteins that are labelled as red arrows.
Duplicate editorial on duplicate publication.
Corson, Stephen L; Decherney, Alan H
2005-04-01
The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.
ABCA7 frameshift deletion associated with Alzheimer disease in African Americans
Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.
2016-01-01
Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719
A salmonid EST genomic study: genes, duplications, phylogeny and microarrays
Directory of Open Access Journals (Sweden)
Brahmbhatt Sonal
2008-11-01
Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is
Spectrum of small mutations in the dystrophin coding region
Energy Technology Data Exchange (ETDEWEB)
Prior, T.W.; Bartolo, C.; Pearl, D.K. [Ohio State Univ., Columbus, OH (United States)] [and others
1995-07-01
Duchenne and Becker muscular dystrophies (DMD and BMD) are caused by defects in the dystrophin gene. About two-thirds of the affected patients have large deletions or duplications, which occur in the 5` and central portion of the gene. The nondeletion/duplication cases are most likely the result of smaller mutations that cannot be identified by current diagnostic screening strategies. We screened {approximately} 80% of the dystrophin coding sequence for small mutations in 158 patients without deletions or duplications and identified 29 mutations. The study indicates that many of the DMD and the majority of the BMD small mutations lie in noncoding regions of the gene. All of the mutations identified were unique to single patients, and most of the mutations resulted in protein truncation. We did not find a clustering of small mutations similar to the deletion distribution but found > 40% of the small mutations 3` of exon 55. The extent of protein truncation caused by the 3` mutations did not determine the phenotype, since even the exon 76 nonsense mutation resulted in the severe DMD phenotype. Our study confirms that the dystrophin gene is subject to a high rate of mutation in CpG sequences. As a consequence of not finding any hotspots or prevalent small mutations, we conclude that it is presently not possible to perform direct carrier and prenatal diagnostics for many families without deletions or duplications. 71 refs., 2 figs., 2 tabs.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
De Rocker, Nina; Vergult, Sarah; Koolen, David; Jacobs, Eva; Hoischen, Alexander; Zeesman, Susan; Bang, Birgitte; Béna, Frédérique; Bockaert, Nele; Bongers, Ernie M; de Ravel, Thomy; Devriendt, Koenraad; Giglio, Sabrina; Faivre, Laurence; Joss, Shelagh; Maas, Saskia; Marle, Nathalie; Novara, Francesca; Nowaczyk, Malgorzata J M; Peeters, Hilde; Polstra, Abeltje; Roelens, Filip; Rosenberg, Carla; Thevenon, Julien; Tümer, Zeynep; Vanhauwaert, Suzanne; Varvagiannis, Konstantinos; Willaert, Andy; Willemsen, Marjolein; Willems, Marjolaine; Zuffardi, Orsetta; Coucke, Paul; Speleman, Frank; Eichler, Evan E; Kleefstra, Tjitske; Menten, Björn
2015-06-01
Submicroscopic deletions of chromosome band 2p25.3 are associated with intellectual disability and/or central obesity. Although MYT1L is believed to be a critical gene responsible for intellectual disability, so far no unequivocal data have confirmed this hypothesis. In this study we evaluated a cohort of 22 patients (15 sporadic patients and two families) with a 2p25.3 aberration to further refine the clinical phenotype and to delineate the role of MYT1L in intellectual disability and obesity. In addition, myt1l spatiotemporal expression in zebrafish embryos was analyzed by quantitative polymerase chain reaction and whole-mount in situ hybridization. Complete MYT1L deletion, intragenic deletion, or duplication was observed in all sporadic patients, in addition to two patients with a de novo point mutation in MYT1L. The familial cases comprise a 6-Mb deletion in a father and his three children and a 5' MYT1L overlapping duplication in a father and his two children. Expression analysis in zebrafish embryos shows specific myt1l expression in the developing brain. Our data strongly strengthen the hypothesis that MYT1L is the causal gene for the observed syndromal intellectual disability. Moreover, because 17 patients present with obesity/overweight, haploinsufficiency of MYT1L might predispose to weight problems with childhood onset.Genet Med 17 6, 460-466.
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi
2009-07-01
The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.
Directory of Open Access Journals (Sweden)
Tsutomu Ogata
Full Text Available BACKGROUND: Although TBX1 mutations have been identified in patients with 22q11.2 deletion syndrome (22q11.2DS-like phenotypes including characteristic craniofacial features, cardiovascular anomalies, hypoparathyroidism, and thymic hypoplasia, the frequency of TBX1 mutations remains rare in deletion-negative patients. Thus, it would be reasonable to perform a comprehensive genetic analysis in deletion-negative patients with 22q11.2DS-like phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: We studied three subjects with craniofacial features and hypocalcemia (group 1, two subjects with craniofacial features alone (group 2, and three subjects with normal phenotype within a single Japanese family. Fluorescence in situ hybridization analysis excluded chromosome 22q11.2 deletion, and genomewide array comparative genomic hybridization analysis revealed no copy number change specific to group 1 or groups 1+2. However, exome sequencing identified a heterozygous TBX1 frameshift mutation (c.1253delA, p.Y418fsX459 specific to groups 1+2, as well as six missense variants and two in-frame microdeletions specific to groups 1+2 and two missense variants specific to group 1. The TBX1 mutation resided at exon 9C and was predicted to produce a non-functional truncated protein missing the nuclear localization signal and most of the transactivation domain. CONCLUSIONS/SIGNIFICANCE: Clinical features in groups 1+2 are well explained by the TBX1 mutation, while the clinical effects of the remaining variants are largely unknown. Thus, the results exemplify the usefulness of exome sequencing in the identification of disease-causing mutations in familial disorders. Furthermore, the results, in conjunction with the previous data, imply that TBX1 isoform C is the biologically essential variant and that TBX1 mutations are associated with a wide phenotypic spectrum, including most of 22q11.2DS phenotypes.
Analysis of human HPRT- deletion mutants by the microarray-CGH (comparative genomic hybridization)
International Nuclear Information System (INIS)
Kodaira, M.; Sasaki, K.; Tagawa, H.; Omine, H.; Kushiro, J.; Takahashi, N.; Katayama, H.
2003-01-01
We are trying to evaluate genetic effects of radiation on human using mutation frequency as an indicator. For the efficient detection of mutations, it is important to understand the mechanism and the characteristics of radiation-induced mutations. We have started the analysis of hypoxanthine-guanine phosphoribosyl transferase (HPRT) mutants induced by X-ray in order to clarify the deletion size and the mutation-distribution. We analyzed 39 human X-ray induced HPRT-deletion mutants by using the microarray-CGH. The array for this analysis contains 57 BAC clones covering as much as possible of the 4Mb of the 5' side and 10Mb of the 3' side of the HPRT gene based on the NCBI genome database. DNA from parent strain and each HPRT-mutant strain are labeled with Cy5 and Cy3 respectively, and were mixed and hybridized on the array. Fluorescent intensity ratio of the obtained spots was analyzed using software we developed to identify clones corresponding to the deletion region. The deletion in these strains ranged up to 3.5 Mb on the 5' side and 6 Mb on the 3' side of the HPRT gene. Deletions in 13 strains ended around BAC clones located at about 3 Mb on the 5' side. On the 3' side, deletions extended up to the specific clones located at 1.5 Mb in 11 strains. The mutations seem to be complex on the 3' end of deletion; some accompanied duplications with deletions and others could not be explained by one mutation event. We need to confirm these results, taking into account the experimental reproducibility and the accuracy of the published genetic map. The results of the research using the microarray-CGH help us to search the regions where deletions are easily induced and to identify the factors affecting the range of deletions
Characterization of five partial deletions of the factor VIII gene
International Nuclear Information System (INIS)
Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.
1987-01-01
Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes
Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A
2011-11-01
HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.
De novo duplication of 17p13.1-p13.2 in a patient with intellectual disability and obesity.
Kuroda, Yukiko; Ohashi, Ikuko; Tominaga, Makiko; Saito, Toshiyuki; Nagai, Jun-Ichi; Ida, Kazumi; Naruto, Takuya; Masuno, Mitsuo; Kurosawa, Kenji
2014-06-01
17p13.1 Deletion encompassing TP53 has been described as a syndrome characterized by intellectual disability and dysmorphic features. Only one case with a 17p13.1 duplication encompassing TP53 has been reported in a patient with intellectual disability, seizures, obesity, and diabetes mellitus. Here, we present a patient with a 17p13.1 duplication who exhibited obesity and intellectual disability, similar to the previous report. The 9-year-old proposita was referred for the evaluation of intellectual disability and obesity. She also exhibited insulin resistance and liver dysfunction. She had wide palpebral fissures, upturned nostrils, a long mandible, short and slender fingers, and skin hyperpigmentation. Array comparative genomic hybridization (array CGH) detected a 3.2 Mb duplication of 17p13.1-p13.2 encompassing TP53, FXR2, NLGN2, and SLC2A4, which encodes the insulin-responsive glucose transporter 4 (GLUT4) associated with insulin-stimulated glucose uptake in adipocytes and muscle. We suggest that 17p13.1 duplication may represent a clinically recognizable condition characterized partially by a characteristic facial phenotype, developmental delay, and obesity. © 2014 Wiley Periodicals, Inc.
Duplicability of self-interacting human genes.
LENUS (Irish Health Repository)
Pérez-Bercoff, Asa
2010-01-01
BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.
Dürig, N; Jude, R; Holl, H; Brooks, S A; Lafayette, C; Jagannathan, V; Leeb, T
2017-08-01
White spotting phenotypes in horses can range in severity from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for such phenotypes in horses. For the present study, we re-investigated a large horse family segregating a variable white spotting phenotype, for which conventional Sanger sequencing of the candidate genes' individual exons had failed to reveal the causative variant. We obtained whole genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~1.9-kb deletion spanning exons 10-13 of the KIT gene (chr3:77,740,239_77,742,136del1898insTATAT). In continuity with previously named equine KIT variants we propose to designate the newly identified deletion variant W22. We had access to 21 horses carrying the W22 allele. Four of them were compound heterozygous W20/W22 and had a completely white phenotype. Our data suggest that W22 represents a true null allele of the KIT gene, whereas the previously identified W20 leads to a partial loss of function. These findings will enable more precise genetic testing for depigmentation phenotypes in horses. © 2017 Stichting International Foundation for Animal Genetics.
Facial duplication: case, review, and embryogenesis.
Barr, M
1982-04-01
The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Effect of gamma rays at the dihydrofolate reductase locus: deletions and inversions
International Nuclear Information System (INIS)
Urlaub, G.; Mitchell, P.J.; Kas, E.; Chasin, L.A.; Funanage, V.L.; Myoda, T.T.; Hamlin, J.
1986-01-01
A series 11 gamma-ray-induced mutants at the dihydrofolate reductase (dhfr) locus in Chinese hamster ovary cells has been examined for the types of DNA sequence change brought about by this form of ionizing radiation. All 11 mutants were found to have suffered major structural changes affecting the dhfr gene. In eight of the mutants, all or part of the dhfr gene has been deleted. The extent of these deletions was examined in seven of these mutants and, for comparison, in two deletion mutants that were induced by UV irradiation. For this purpose, probes from an overlapping set of cosmids that span 210 kb of DNA in this region were used. Three of seven gamma-ray-induced mutants and one UV-induced mutant were shown to have deleted the entire 210-kb region. In the remaining mutants, endpoints ranging from within the dhfr gene to 100 kb downstream were observed. No upstream endpoints were detected, so that an upper limit on the size of these large deletions could not be assigned. Three of the 11 gamma-ray-induced mutants contained an interruption in the dhfr gene without any detectable loss of sequence. Restriction analysis of these interrupted mutants showed that at least 8-14 kb of foreign DNA sequence became joined to the gene at the point of disruption. Cytogenetic analysis of these mutants showed that in two cases an inversion of the banding pattern on chromosome Z-2 had taken place. The inverted dhfr mutants contain very low amounts of dhfr RNA sequences, and the 5' end of an inversion mutant gene exhibits the same pattern of DNA methylation and DNase I-hypersensitivity as the wild-type gene. Our results suggest that ionizing radiation causes primarily, if not exclusively, large deletions and inversions in mammalian cells
Hong, Jungeui; Gresham, David
2017-11-01
Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.
A novel 5-bp deletion in Clarin 1 in a family with Usher syndrome.
Akoury, Elie; El Zir, Elie; Mansour, Ahmad; Mégarbané, André; Majewski, Jacek; Slim, Rima
2011-11-01
To identify the genetic defect in a Lebanese family with two sibs diagnosed with Usher Syndrome. Exome capture and sequencing were performed on DNA from one affected member using Agilent in solution bead capture, followed by Illumina sequencing. This analysis revealed the presence of a novel homozygous 5-bp deletion, in Clarin 1 (CLRN1), a known gene responsible for Usher syndrome type III. The deletion is inherited from both parents and segregates with the disease phenotype in the family. The 5-bp deletion, c.301_305delGTCAT, p.Val101SerfsX27, is predicted to result in a frameshift and protein truncation after 27 amino acids. Sequencing all the coding regions of the CLRN1 gene in the proband did not reveal any other mutation or variant. Here we describe a novel deletion in CLRN1. Our data support previously reported intra familial variability in the clinical features of Usher syndrome type I and III.
Directory of Open Access Journals (Sweden)
Chang-Hyun Lee
2016-10-01
Full Text Available Cell competition, the conditional loss of viable genotypes only when surrounded by other cells, is a phenomenon observed in certain genetic mosaic conditions. We conducted a chemical mutagenesis and screen to recover new mutations that affect cell competition between wild-type and RpS3 heterozygous cells. Mutations were identified by whole-genome sequencing, making use of software tools that greatly facilitate the distinction between newly induced mutations and other sources of apparent sequence polymorphism, thereby reducing false-positive and false-negative identification rates. In addition, we utilized iPLEX MassARRAY for genotyping recombinant chromosomes. These approaches permitted the mapping of a new mutation affecting cell competition when only a single allele existed, with a phenotype assessed only in genetic mosaics, without the benefit of complementation with existing mutations, deletions, or duplications. These techniques expand the utility of chemical mutagenesis and whole-genome sequencing for mutant identification. We discuss mutations in the Atm and Xrp1 genes identified in this screen.
The rates and patterns of deletions in the human factor IX gene
Energy Technology Data Exchange (ETDEWEB)
Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))
1994-02-01
Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.
Rectal duplication with sciatic hernia.
Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł
2015-07-01
Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.
Craniofacial duplication: a case report.
Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya
2013-09-01
A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.
Evaluation of contrast in duplicated radiographs
International Nuclear Information System (INIS)
Thunthy, K.H.; Weinberg, R.
1982-01-01
This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original
Deletion of ultraconserved elements yields viable mice
Energy Technology Data Exchange (ETDEWEB)
Ahituv, Nadav; Zhu, Yiwen; Visel, Axel; Holt, Amy; Afzal, Veena; Pennacchio, Len A.; Rubin, Edward M.
2007-07-15
Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lacking these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.
Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.
Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W
2014-04-01
Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.
Identifying structural variants using linked-read sequencing data.
Elyanow, Rebecca; Wu, Hsin-Ta; Raphael, Benjamin J
2017-11-03
Structural variation, including large deletions, duplications, inversions, translocations, and other rearrangements, is common in human and cancer genomes. A number of methods have been developed to identify structural variants from Illumina short-read sequencing data. However, reliable identification of structural variants remains challenging because many variants have breakpoints in repetitive regions of the genome and thus are difficult to identify with short reads. The recently developed linked-read sequencing technology from 10X Genomics combines a novel barcoding strategy with Illumina sequencing. This technology labels all reads that originate from a small number (~5-10) DNA molecules ~50Kbp in length with the same molecular barcode. These barcoded reads contain long-range sequence information that is advantageous for identification of structural variants. We present Novel Adjacency Identification with Barcoded Reads (NAIBR), an algorithm to identify structural variants in linked-read sequencing data. NAIBR predicts novel adjacencies in a individual genome resulting from structural variants using a probabilistic model that combines multiple signals in barcoded reads. We show that NAIBR outperforms several existing methods for structural variant identification - including two recent methods that also analyze linked-reads - on simulated sequencing data and 10X whole-genome sequencing data from the NA12878 human genome and the HCC1954 breast cancer cell line. Several of the novel somatic structural variants identified in HCC1954 overlap known cancer genes. Software is available at compbio.cs.brown.edu/software. braphael@princeton.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Asur, Rajalakshmi S; Kimble, Danielle C; Lach, Francis P; Jung, Moonjung; Donovan, Frank X; Kamat, Aparna; Noonan, Raymond J; Thomas, James W; Park, Morgan; Chines, Peter; Vlachos, Adrianna; Auerbach, Arleen D; Smogorzewska, Agata; Chandrasekharappa, Settara C
2018-01-01
Fanconi anemia (FA) is a rare disorder characterized by congenital malformations, progressive bone marrow failure, and predisposition to cancer. Patients harboring X-linked FANCB pathogenic variants usually present with severe congenital malformations resembling VACTERL syndrome with hydrocephalus. We employed the diepoxybutane (DEB) test for FA diagnosis, arrayCGH for detection of duplication, targeted capture and next-gen sequencing for defining the duplication breakpoint, PacBio sequencing of full-length FANCB aberrant transcript, FANCD2 ubiquitination and foci formation assays for the evaluation of FANCB protein function by viral transduction of FANCB-null cells with lentiviral FANCB WT and mutant expression constructs, and droplet digital PCR for quantitation of the duplication in the genomic DNA and cDNA. We describe here an FA-B patient with a mild phenotype. The DEB diagnostic test for FA revealed somatic mosaicism. We identified a 9154 bp intragenic duplication in FANCB, covering the first coding exon 3 and the flanking regions. A four bp homology (GTAG) present at both ends of the breakpoint is consistent with microhomology-mediated duplication mechanism. The duplicated allele gives rise to an aberrant transcript containing exon 3 duplication, predicted to introduce a stop codon in FANCB protein (p.A319*). Duplication levels in the peripheral blood DNA declined from 93% to 7.9% in the span of eleven years. Moreover, the patient fibroblasts have shown 8% of wild-type (WT) allele and his carrier mother showed higher than expected levels of WT allele (79% vs. 50%) in peripheral blood, suggesting that the duplication was highly unstable. Unlike sequence point variants, intragenic duplications are difficult to precisely define, accurately quantify, and may be very unstable, challenging the proper diagnosis. The reversion of genomic duplication to the WT allele results in somatic mosaicism and may explain the relatively milder phenotype displayed by the FA
Cho, Anna; Seong, Moon-Woo; Lim, Byung Chan; Lee, Hwa Jeen; Byeon, Jung Hye; Kim, Seung Soo; Kim, Soo Yeon; Choi, Sun Ah; Wong, Ai-Lynn; Lee, Jeongho; Kim, Jon Soo; Ryu, Hye Won; Lee, Jin Sook; Kim, Hunmin; Hwang, Hee; Choi, Ji Eun; Kim, Ki Joong; Hwang, Young Seung; Hong, Ki Ho; Park, Seungman; Cho, Sung Im; Lee, Seung Jun; Park, Hyunwoong; Seo, Soo Hyun; Park, Sung Sup; Chae, Jong Hee
2017-05-01
Duchenne and Becker muscular dystrophies (DMD and BMD) are allelic X-linked recessive muscle diseases caused by mutations in the large and complex dystrophin gene. We analyzed the dystrophin gene in 507 Korean DMD/BMD patients by multiple ligation-dependent probe amplification and direct sequencing. Overall, 117 different deletions, 48 duplications, and 90 pathogenic sequence variations, including 30 novel variations, were identified. Deletions and duplications accounted for 65.4% and 13.3% of Korean dystrophinopathy, respectively, suggesting that the incidence of large rearrangements in dystrophin is similar among different ethnic groups. We also detected sequence variations in >100 probands. The small variations were dispersed across the whole gene, and 12.3% were nonsense mutations. Precise genetic characterization in patients with DMD/BMD is timely and important for implementing nationwide registration systems and future molecular therapeutic trials in Korea and globally. Muscle Nerve 55: 727-734, 2017. © 2016 Wiley Periodicals, Inc.
Complete colonic duplication in children.
Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh
2012-01-01
Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.
Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.
Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun
α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.
Genome-Wide Analysis of Syntenic Gene Deletion in the Grasses
Schnable, James C.; Freeling, Michael; Lyons, Eric
2012-01-01
The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community. PMID:22275519
Deletion Mutagenesis and Identification of Causative Mutations in Maize.
Jia, Shangang; Li, Aixia; Zhang, Chi; Holding, David
2018-01-01
We describe a method for gamma-irradiation of mature maize seeds to generate mutants with opaque endosperm and reduced kernel fill phenotypes. We also describe methods for mapping mutants and identifying causal gene mutations. Using this method, a population of 1788M2 families and 47 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes was developed. For molecular characterization of the mutants, we utilized a novel functional genomics platform that combines separate Bulked Segregant RNA and exome sequencing data sets (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. We also describe the use of exome capture sequencing of F2 mutant and normal pools to perform mapping and candidate gene identification without the need for separate RNA-seq (BSEx-seq). To exemplify the utility of the deletion mutants for functional genomics and provide proof-of-concept for the bioinformatics platform, we summarize the identification of the causative deletion in two mutants. Mutant 937, which was characterized by BSREx-seq, harbors a 6203-bp in-frame deletion covering six exons within the Opaque-1 gene on chromosome 4. Preliminary investigation of opaque mutant 1486 with BSEx-seq shows a tight mapping interval and associated deletion on chromosome 10.
A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.
Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques
2016-01-01
We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.
Kathuria, Preetleen; Sharma, Purshotam; Manderville, Richard A; Wetmore, Stacey D
2017-08-21
Exposure to ochratoxin A (OTA), a possible human carcinogen, leads to many different DNA mutations. As a first step toward understanding the structural basis of OTA-induced mutagenicity, the present work uses a robust computational approach and a slipped mutagenic intermediate model previously studied for C 8 -dG aromatic amine adducts to analyze the conformational features of postreplication two-base deletion DNA duplexes containing OT-dG, the major OTA lesion at the C 8 position of guanine. Specifically, a total of 960 ns of molecular dynamics simulations (excluding trial simulations) were carried out on four OT-dG ionization states in three sequence contexts within oligomers containing the NarI recognition sequence, a known hotspot for deletion mutations induced by related adducts formed from known carcinogens. Our results indicate that the structural properties and relative stability of the competing "major groove" and "stacked" conformations of OTA adducted two-base deletion duplexes depend on both the OTA ionization state and the sequence context, mainly due to conformation-dependent deviations in discrete local (hydrogen-bonding and stacking) interactions at the lesion site, as well as DNA bending. When the structural characteristics of the OT-dG adducted two-base deletion duplexes are compared to those associated with previously studied C 8 -dG adducts, a greater understanding of the effects of the nucleobase-carcinogen linkage, and size of the carcinogenic moiety on the conformational preferences of damaged DNA is obtained. Most importantly, our work predicts key structural features for OT-dG-adducted deletion DNA duplexes, which in turn allow us to develop hypotheses regarding OT-dG replication outcomes. Thus, our computational results are valuable for the design and interpretation of future biochemical studies on the potentially carcinogenic OT-dG lesion.
Directory of Open Access Journals (Sweden)
Corti Stefania
2011-03-01
Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects
Myeloablation-associated deletion of ORF4 in a human coronavirus 229E infection.
Greninger, Alexander L; Pepper, Gregory; Shean, Ryan C; Cent, Anne; Palileo, Isabel; Kuypers, Jane M; Schiffer, Joshua T; Jerome, Keith R
2017-01-01
We describe metagenomic next-generation sequencing (mNGS) of a human coronavirus 229E from a patient with AML and persistent upper respiratory symptoms, who underwent hematopoietic cell transplantation (HCT). mNGS revealed a 548-nucleotide deletion, which comprised the near entirety of the ORF4 gene, and no minor allele variants were detected to suggest a mixed infection. As part of her pre-HCT conditioning regimen, the patient received myeloablative treatment with cyclophosphamide and 12 Gy total body irradiation. Iterative sequencing and RT-PCR confirmation of four respiratory samples over the 4-week peritransplant period revealed that the pre-conditioning strain contained an intact ORF4 gene, while the deletion strain appeared just after conditioning and persisted over a 2.5-week period. This sequence represents one of the largest genomic deletions detected in a human RNA virus and describes large-scale viral mutation associated with myeloablation for HCT.
Chen, Liang; Zhu, Feng; Xiong, Chenglong; Zhang, Zhijie; Jiang, Lufang; Chen, Yue; Zhao, Genming; Jiang, Qingwu
2015-01-20
Objective. A novel avian influenza A virus (AIV) H7N9 subtype which emerged in China in 2013 caused worldwide concern. Deletion of amino-acids 69 to 73 in the neuraminidase stalk was its most notable characteristic. This study is aimed to discuss the tropism and virulence effects of this deletion. Neuraminidase gene sequences of N9 subtype were collected from NCBI and GISAID. MEGA6.0, Stata12.0, and UCSF Chimera were employed for sequence aligning, significance testing, and protein tertiary structure homology modeling. A total of 736 sequences were obtained; there were 81 human isolates of the novel AIV H7N9, of which 79 had the deletion. Among all the 654 avian origin sequences, only 43 had the deletion (p deletion obviously changed the spatial direction of neuraminidase. The deletion in neuraminidase stalk could have strengthened human tropism of the novel AIV H7N9, as well as its virulence.
DEFF Research Database (Denmark)
Feldt-Rasmussen, Ulla; Dobrovolny, Robert; Nazarenko, Irina
2011-01-01
Fabry disease, an X-linked lysosomal storage disorder, results from the deficient activity of a-galactosidase A (a-Gal A). In affected males, the clinical diagnosis is confirmed by the markedly decreased a-Gal A activity. However, in female heterozygotes, the a-Gal A activity can range from low t...... on enzyme replacement therapy. Thus, gene dosage analyses can detect large deletions (>50bp) in suspect heterozygotes for X-linked and autosomal dominant diseases that are "sequencing cryptic," resolving molecular diagnostic dilemmas....
One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1
Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.
2014-01-01
Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158
Large Genomic Deletions in CACNA1A Cause Episodic Ataxia Type 2
Directory of Open Access Journals (Sweden)
Jijun eWan
2011-09-01
Full Text Available Episodic ataxia (EA syndromes are heritable diseases characterized by dramatic episodes of imbalance and incoordination. Episodic ataxia type 2 (EA2, the most common and the best characterized subtype, is caused by mostly nonsense, splice site, small indel and sometimes missense mutations in CACNA1A. Direct sequencing of CACNA1A fails to identify mutations in some patients with EA2-like features, possibly due to incomplete interrogation of CACNA1A or defects in other EA genes not yet defined. Previous reports described genomic deletions between 4-40kb in EA2. In 47 subjects with EA (26 with EA2-like features who tested negative for mutations in the known EA genes, we used Multiplex Ligation-dependent Probe Amplification (MLPA to analyze CACNA1A for exonic copy number variations. Breakpoints were further defined by long-range PCR. We identified distinct multi-exonic deletions in three probands with classic EA2-like features: episodes of prolonged vertigo and ataxia triggered by stress and fatigue, interictal nystagmus, with onset during infancy or early childhood. The breakpoints in all three probands are located in Alu sequences, indicating errors in homologous recombination of Alu sequences as the underlying mechanism. The smallest deletion spanned exons 39 and 40, while the largest deletion spanned 200kb, missing all but the first three exons. One deletion involving exons 39 through 47 arose spontaneously. The search for mutations in CACNA1A appears most fruitful in EA patients with interictal nystagmus and onset early in life. The finding of large heterozygous deletions suggests haploinsufficiency as a possible pathomechanism of EA2.
The Yeast Deletion Collection: A Decade of Functional Genomics
Giaever, Guri; Nislow, Corey
2014-01-01
The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991
Deletion at the GCNT2 Locus Causes Autosomal Recessive Congenital Cataracts.
Irum, Bushra; Khan, Shahid Y; Ali, Muhammad; Daud, Muhammad; Kabir, Firoz; Rauf, Bushra; Fatima, Fareeha; Iqbal, Hira; Khan, Arif O; Al Obaisi, Saif; Naeem, Muhammad Asif; Nasir, Idrees A; Khan, Shaheen N; Husnain, Tayyab; Riazuddin, Sheikh; Akram, Javed; Eghrari, Allen O; Riazuddin, S Amer
2016-01-01
The aim of this study is to identify the molecular basis of autosomal recessive congenital cataracts (arCC) in a large consanguineous pedigree. All participating individuals underwent a detailed ophthalmic examination. Each patient's medical history, particularly of cataracts and other ocular abnormalities, was compiled from available medical records and interviews with family elders. Blood samples were donated by all participating family members and used to extract genomic DNA. Genetic analysis was performed to rule out linkage to known arCC loci and genes. Whole-exome sequencing libraries were prepared and paired-end sequenced. A large deletion was found that segregated with arCC in the family, and chromosome walking was conducted to estimate the proximal and distal boundaries of the deletion mutation. Exclusion and linkage analysis suggested linkage to a region of chromosome 6p24 harboring GCNT2 (glucosaminyl (N-acetyl) transferase 2) with a two-point logarithm of odds score of 5.78. PCR amplifications of the coding exons of GCNT2 failed in individuals with arCC, and whole-exome data analysis revealed a large deletion on chromosome 6p in the region harboring GCNT2. Chromosomal walking using multiple primer pairs delineated the extent of the deletion to approximately 190 kb. Interestingly, a failure to amplify a junctional fragment of the deletion break strongly suggests an insertion in addition to the large deletion. Here, we report a novel insertion/deletion mutation at the GCNT2 locus that is responsible for congenital cataracts in a large consanguineous family.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V
2016-01-01
Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Directory of Open Access Journals (Sweden)
Olga V Popova
Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even
Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis.
D'Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; Lee, Ji-Yun; He, Hong; Li, Shibo; Smaoui, Nizar; Hejtmancik, James F; Sieving, Paul A; Wang, Xinjing
2013-01-01
X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4-5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5' region of the RS1 gene (including the promoter) through intron 1 (c.(-35)-1723_c.51+2664del4472). The exon 4-5 deletion spans introns 3 to intron 5 (c.185-1020_c.522+1844del5764). Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes.
Li, Minghui; Sun, Yunlv; Zhao, Jiue; Shi, Hongjuan; Zeng, Sheng; Ye, Kai; Jiang, Dongneng; Zhou, Linyan; Sun, Lina; Tao, Wenjing; Nagahama, Yoshitaka; Kocher, Thomas D.; Wang, Deshou
2015-01-01
Variation in the TGF-β signaling pathway is emerging as an important mechanism by which gonadal sex determination is controlled in teleosts. Here we show that amhy, a Y-specific duplicate of the anti-Müllerian hormone (amh) gene, induces male sex determination in Nile tilapia. amhy is a tandem duplicate located immediately downstream of amhΔ-y on the Y chromosome. The coding sequence of amhy was identical to the X-linked amh (amh) except a missense SNP (C/T) which changes an amino acid (Ser/Leu92) in the N-terminal region. amhy lacks 5608 bp of promoter sequence that is found in the X-linked amh homolog. The amhΔ-y contains several insertions and deletions in the promoter region, and even a 5 bp insertion in exonVI that results in a premature stop codon and thus a truncated protein product lacking the TGF-β binding domain. Both amhy and amhΔ-y expression is restricted to XY gonads from 5 days after hatching (dah) onwards. CRISPR/Cas9 knockout of amhy in XY fish resulted in male to female sex reversal, while mutation of amhΔ-y alone could not. In contrast, overexpression of Amhy in XX fish, using a fosmid transgene that carries the amhy/amhΔ-y haplotype or a vector containing amhy ORF under the control of CMV promoter, resulted in female to male sex reversal, while overexpression of AmhΔ-y alone in XX fish could not. Knockout of the anti-Müllerian hormone receptor type II (amhrII) in XY fish also resulted in 100% complete male to female sex reversal. Taken together, these results strongly suggest that the duplicated amhy with a missense SNP is the candidate sex determining gene and amhy/amhrII signal is essential for male sex determination in Nile tilapia. These findings highlight the conserved roles of TGF-β signaling pathway in fish sex determination. PMID:26588702
Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi
2013-01-01
The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833
Decoding Synteny Blocks and Large-Scale Duplications in Mammalian and Plant Genomes
Peng, Qian; Alekseyev, Max A.; Tesler, Glenn; Pevzner, Pavel A.
The existing synteny block reconstruction algorithms use anchors (e.g., orthologous genes) shared over all genomes to construct the synteny blocks for multiple genomes. This approach, while efficient for a few genomes, cannot be scaled to address the need to construct synteny blocks in many mammalian genomes that are currently being sequenced. The problem is that the number of anchors shared among all genomes quickly decreases with the increase in the number of genomes. Another problem is that many genomes (plant genomes in particular) had extensive duplications, which makes decoding of genomic architecture and rearrangement analysis in plants difficult. The existing synteny block generation algorithms in plants do not address the issue of generating non-overlapping synteny blocks suitable for analyzing rearrangements and evolution history of duplications. We present a new algorithm based on the A-Bruijn graph framework that overcomes these difficulties and provides a unified approach to synteny block reconstruction for multiple genomes, and for genomes with large duplications.
Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.
Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M
1997-10-01
We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.
Directory of Open Access Journals (Sweden)
Sanggu Kim
Full Text Available Xenotropic murine leukemia virus (MLV-related virus (XMRV is a new human retrovirus associated with prostate cancer and chronic fatigue syndrome. The causal relationship of XMRV infection to human disease and the mechanism of pathogenicity have not been established. During retrovirus replication, integration of the cDNA copy of the viral RNA genome into the host cell chromosome is an essential step and involves coordinated joining of the two ends of the linear viral DNA into staggered sites on target DNA. Correct integration produces proviruses that are flanked by a short direct repeat, which varies from 4 to 6 bp among the retroviruses but is invariant for each particular retrovirus. Uncoordinated joining of the two viral DNA ends into target DNA can cause insertions, deletions, or other genomic alterations at the integration site. To determine the fidelity of XMRV integration, cells infected with XMRV were clonally expanded and DNA sequences at the viral-host DNA junctions were determined and analyzed. We found that a majority of the provirus ends were correctly processed and flanked by a 4-bp direct repeat of host DNA. A weak consensus sequence was also detected at the XMRV integration sites. We conclude that integration of XMRV DNA involves a coordinated joining of two viral DNA ends that are spaced 4 bp apart on the target DNA and proceeds with high fidelity.
Clinical features of SMARCA2 duplication overlap with Coffin-Siris syndrome.
Miyake, Noriko; Abdel-Salam, Ghada; Yamagata, Takanori; Eid, Maha M; Osaka, Hitoshi; Okamoto, Nobuhiko; Mohamed, Amal M; Ikeda, Takahiro; Afifi, Hanan H; Piard, Juliette; van Maldergem, Lionel; Mizuguchi, Takeshi; Miyatake, Satoko; Tsurusaki, Yoshinori; Matsumoto, Naomichi
2016-10-01
Coffin-Siris syndrome is a rare congenital malformation and intellectual disability syndrome. Mutations in at least seven genes have been identified. Here, we performed copy number analysis in 37 patients with features of CSS in whom no causative mutations were identified by exome sequencing. We identified a patient with a 9p24.3-p22.2 duplication and another patient with the chromosome der(6)t(6;9)(p25;p21)mat. Both patients share a duplicated 15.8-Mb region containing 46 protein coding genes, including SMARCA2. Dominant negative effects of SMARCA2 mutations may contribute to Nicolaides-Baraitser syndrome. We conclude that their features better resemble Coffin-Siris syndrome, rather than Nicolaides-Baraitser syndrome and that these features likely arise from SMARCA2 over-dosage. Pure 9p duplications (not caused by unbalanced translocations) are rare. Copy number analysis in patients with features that overlap with Coffin-Siris syndrome is recommended to further determine their genetic aspects. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Rectal duplication: a case report.
Didden, K; Masereel, B; Geyskens, P
2013-01-01
Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.
Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua
2015-04-18
Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to
International Nuclear Information System (INIS)
Latt, S.A.; Lalande, M.; Donlon, T.
1986-01-01
This paper describes a few of the many possible examples in which application of a molecular cytogenetic approach can ultimately lead to a new, important understanding about the statics and dynamics of human chromosome structure. In the case of retinoblastoma, cytological observations of deletions and linkage analysis have positioned the retinoblastoma locus to bank 13q14. This locus is grossly deleted in some spontaneous tumors. It is still necessary to locate more precisely and characterize the nature of the retinoblastoma locus, as well as the basis for the heterogeneity in deletions removing one copy of this locus. One is left with the possibility that those deletions that may be observed cytologically reflect but the tip of the iceberg of deletions; detection of others may require molecular probes. A related question is the nature of the DNA sequences at the deletion boundaries and the role they play in promoting these deletions
Biedrzycka, Aleksandra; O'Connor, Emily; Sebastian, Alvaro; Migalska, Magdalena; Radwan, Jacek; Zając, Tadeusz; Bielański, Wojciech; Solarz, Wojciech; Ćmiel, Adam; Westerdahl, Helena
2017-07-05
Recent work suggests that gene duplications may play an important role in the evolution of immunity genes. Passerine birds, and in particular Sylvioidea warblers, have highly duplicated major histocompatibility complex (MHC) genes, which are key in immunity, compared to other vertebrates. However, reasons for this high MHC gene copy number are yet unclear. High-throughput sequencing (HTS) allows MHC genotyping even in individuals with extremely duplicated genes. This HTS data can reveal evidence of selection, which may help to unravel the putative functions of different gene copies, i.e. neofunctionalization. We performed exhaustive genotyping of MHC class I in a Sylvioidea warbler, the sedge warbler, Acrocephalus schoenobaenus, using the Illumina MiSeq technique on individuals from a wild study population. The MHC diversity in 863 genotyped individuals by far exceeds that of any other bird species described to date. A single individual could carry up to 65 different alleles, a large proportion of which are expressed (transcribed). The MHC alleles were of three different lengths differing in evidence of selection, diversity and divergence within our study population. Alleles without any deletions and alleles containing a 6 bp deletion showed characteristics of classical MHC genes, with evidence of multiple sites subject to positive selection and high sequence divergence. In contrast, alleles containing a 3 bp deletion had no sites subject to positive selection and had low divergence. Our results suggest that sedge warbler MHC alleles that either have no deletion, or contain a 6 bp deletion, encode classical antigen presenting MHC molecules. In contrast, MHC alleles containing a 3 bp deletion may encode molecules with a different function. This study demonstrates that highly duplicated MHC genes can be characterised with HTS and that selection patterns can be useful for revealing neofunctionalization. Importantly, our results highlight the need to consider the
Directory of Open Access Journals (Sweden)
Kulkarni B
1995-04-01
Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.
Directory of Open Access Journals (Sweden)
Pagni Marco
2005-08-01
Full Text Available Abstract Background Whole-genome sequencing projects are rapidly producing an enormous number of new sequences. Consequently almost every family of proteins now contains hundreds of members. It has thus become necessary to develop tools, which classify protein sequences automatically and also quickly and reliably. The difficulty of this task is intimately linked to the mechanism by which protein sequences diverge, i.e. by simultaneous residue substitutions, insertions and/or deletions and whole domain reorganisations (duplications/swapping/fusion. Results Here we present a novel approach, which is based on random sampling of sub-sequences (probes out of a set of input sequences. The probes are compared to the input sequences, after a normalisation step; the results are used to partition the input sequences into homogeneous groups of proteins. In addition, this method provides information on diagnostic parts of the proteins. The performance of this method is challenged by two data sets. The first one contains the sequences of prokaryotic lyases that could be arranged as a multiple sequence alignment. The second one contains all proteins from Swiss-Prot Release 36 with at least one Src homology 2 (SH2 domain – a classical example for proteins with modular architecture. Conclusion The outcome of our method is robust, highly reproducible as shown using bootstrap and resampling validation procedures. The results are essentially coherent with the biology. This method depends solely on well-established publicly available software and algorithms.
R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)
Energy Technology Data Exchange (ETDEWEB)
Cervenakova, L.; Brown, P.; Nagle, J. [and others
1994-09-01
There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.
Energy Technology Data Exchange (ETDEWEB)
Lingg, G; Nebel, G
1981-08-01
The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.
Evolution of the DAZ gene and the AZFc region on primate Y chromosomes
Directory of Open Access Journals (Sweden)
Yu Jane-Fang
2008-03-01
Full Text Available Abstract Background The Azoospermia Factor c (AZFc region of the human Y chromosome is a unique product of segmental duplication. It consists almost entirely of very long amplicons, represented by different colors, and is frequently deleted in subfertile men. Most of the AZFc amplicons have high sequence similarity with autosomal segments, indicating recent duplication and transposition to the Y chromosome. The Deleted in Azoospermia (DAZ gene within the red-amplicon arose from an ancestral autosomal DAZ-like (DAZL gene. It varies significantly between different men regarding to its copy number and the numbers of RNA recognition motif and DAZ repeat it encodes. We used Southern analyses to study the evolution of DAZ and AZFc amplicons on the Y chromosomes of primates. Results The Old World monkey rhesus macaque has only one DAZ gene. In contrast, the great apes have multiple copies of DAZ, ranging from 2 copies in bonobos and gorillas to at least 6 copies in orangutans, and these DAZ genes have polymorphic structures similar to those of their human counterparts. Sequences homologous to the various AZFc amplicons are present on the Y chromosomes of some but not all primates, indicating that they arrived on the Y chromosome at different times during primate evolution. Conclusion The duplication and transposition of AZFc amplicons to the human Y chromosome occurred in three waves, i.e., after the branching of the New World monkey, the gorilla, and the chimpanzee/bonobo lineages, respectively. The red-amplicon, one of the first to arrive on the Y chromosome, amplified by inverted duplication followed by direct duplication after the separation of the Old World monkey and the great ape lineages. Subsequent duplication/deletion in the various lineages gave rise to a spectrum of DAZ gene structure and copy number found in today's great apes.
Duplication of the dystroglycan gene in most branches of teleost fish
Directory of Open Access Journals (Sweden)
Giardina Bruno
2007-05-01
Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details
Directory of Open Access Journals (Sweden)
Eichler Evan E
2008-08-01
Full Text Available Abstract Background It has been suggested that chromosomal rearrangements harbor the molecular footprint of the biological phenomena which they induce, in the form, for instance, of changes in the sequence divergence rates of linked genes. So far, all the studies of these potential associations have focused on the relationship between structural changes and the rates of evolution of single-copy DNA and have tried to exclude segmental duplications (SDs. This is paradoxical, since SDs are one of the primary forces driving the evolution of structure and function in our genomes and have been linked not only with novel genes acquiring new functions, but also with overall higher DNA sequence divergence and major chromosomal rearrangements. Results Here we take the opposite view and focus on SDs. We analyze several of the features of SDs, including the rates of intraspecific divergence between paralogous copies of human SDs and of interspecific divergence between human SDs and chimpanzee DNA. We study how divergence measures relate to chromosomal rearrangements, while considering other factors that affect evolutionary rates in single copy DNA. Conclusion We find that interspecific SD divergence behaves similarly to divergence of single-copy DNA. In contrast, old and recent paralogous copies of SDs do present different patterns of intraspecific divergence. Also, we show that some relatively recent SDs accumulate in regions that carry inversions in sister lineages.
International Nuclear Information System (INIS)
Lingg, G.; Nebel, G.
1981-01-01
The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de
Heads or tails: L1 insertion-associated 5' homopolymeric sequences
Directory of Open Access Journals (Sweden)
Meyer Thomas J
2010-02-01
Full Text Available Abstract Background L1s are one of the most successful autonomous mobile elements in primate genomes. These elements comprise as much as 17% of primate genomes with the majority of insertions occurring via target primed reverse transcription (TPRT. Twin priming, a variant of TPRT, can result in unusual DNA sequence architecture. These insertions appear to be inverted, truncated L1s flanked by target site duplications. Results We report on loci with sequence architecture consistent with variants of the twin priming mechanism and introduce dual priming, a mechanism that could generate similar sequence characteristics. These insertions take the form of truncated L1s with hallmarks of classical TPRT insertions but having a poly(T simple repeat at the 5' end of the insertion. We identified loci using computational analyses of the human, chimpanzee, orangutan, rhesus macaque and marmoset genomes. Insertion site characteristics for all putative loci were experimentally verified. Conclusions The 39 loci that passed our computational and experimental screens probably represent inversion-deletion events which resulted in a 5' inverted poly(A tail. Based on our observations of these loci and their local sequence properties, we conclude that they most probably represent twin priming events with unusually short non-inverted portions. We postulate that dual priming could, theoretically, produce the same patterns. The resulting homopolymeric stretches associated with these insertion events may promote genomic instability and create potential target sites for future retrotransposition events.
Anterior colorectal duplication presenting as rectal prolapse.
Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo
2007-09-01
Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.
Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo
2012-01-01
Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714
2015-12-01
AWARD NUMBER: W81XWH-14-1-0251 TITLE: Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase... Tyrosine Kinase Inhibitors 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-14-1-0251 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Kiran Mahajan 5d...ABSTRACT Central to all cycling cells-including prostate cancer stem cells- is the expression of WEE1 tyrosine kinase. WEE1 monitors duplication of
Lee, Chang-Hyun; Rimesso, Gerard; Reynolds, David M; Cai, Jinlu; Baker, Nicholas E
2016-10-13
Cell competition, the conditional loss of viable genotypes only when surrounded by other cells, is a phenomenon observed in certain genetic mosaic conditions. We conducted a chemical mutagenesis and screen to recover new mutations that affect cell competition between wild-type and RpS3 heterozygous cells. Mutations were identified by whole-genome sequencing, making use of software tools that greatly facilitate the distinction between newly induced mutations and other sources of apparent sequence polymorphism, thereby reducing false-positive and false-negative identification rates. In addition, we utilized iPLEX MassARRAY for genotyping recombinant chromosomes. These approaches permitted the mapping of a new mutation affecting cell competition when only a single allele existed, with a phenotype assessed only in genetic mosaics, without the benefit of complementation with existing mutations, deletions, or duplications. These techniques expand the utility of chemical mutagenesis and whole-genome sequencing for mutant identification. We discuss mutations in the Atm and Xrp1 genes identified in this screen. Copyright © 2016 Lee et al.
Genome Sequence of the Palaeopolyploid soybean
Energy Technology Data Exchange (ETDEWEB)
Schmutz, Jeremy; Cannon, Steven B.; Schlueter, Jessica; Ma, Jianxin; Mitros, Therese; Nelson, William; Hyten, David L.; Song, Qijian; Thelen, Jay J.; Cheng, Jianlin; Xu, Dong; Hellsten, Uffe; May, Gregory D.; Yu, Yeisoo; Sakura, Tetsuya; Umezawa, Taishi; Bhattacharyya, Madan K.; Sandhu, Devinder; Valliyodan, Babu; Lindquist, Erika; Peto, Myron; Grant, David; Shu, Shengqiang; Goodstein, David; Barry, Kerrie; Futrell-Griggs, Montona; Abernathy, Brian; Du, Jianchang; Tian, Zhixi; Zhu, Liucun; Gill, Navdeep; Joshi, Trupti; Libault, Marc; Sethuraman, Anand; Zhang, Xue-Cheng; Shinozaki, Kazuo; Nguyen, Henry T.; Wing, Rod A.; Cregan, Perry; Specht, James; Grimwood, Jane; Rokhsar, Dan; Stacey, Gary; Shoemaker, Randy C.; Jackson, Scott A.
2009-08-03
Soybean (Glycine max) is one of the most important crop plants for seed protein and oil content, and for its capacity to fix atmospheric nitrogen through symbioses with soil-borne microorganisms. We sequenced the 1.1-gigabase genome by a whole-genome shotgun approach and integrated it with physical and high-density genetic maps to create a chromosome-scale draft sequence assembly. We predict 46,430 protein-coding genes, 70percent more than Arabidopsis and similar to the poplar genome which, like soybean, is an ancient polyploid (palaeopolyploid). About 78percent of the predicted genes occur in chromosome ends, which comprise less than one-half of the genome but account for nearly all of the genetic recombination. Genome duplications occurred at approximately 59 and 13 million years ago, resulting in a highly duplicated genome with nearly 75percent of the genes present in multiple copies. The two duplication events were followed by gene diversification and loss, and numerous chromosome rearrangements. An accurate soybean genome sequence will facilitate the identification of the genetic basis of many soybean traits, and accelerate the creation of improved soybean varieties.
Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang
2012-08-21
Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 - 153,589,577) from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.
Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R
2010-12-01
Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.
Pudupakam, R S; Huang, Y W; Opriessnig, T; Halbur, P G; Pierson, F W; Meng, X J
2009-01-01
Hepatitis E virus (HEV) is an important human pathogen, although little is known about its biology and replication. Comparative sequence analysis revealed a hypervariable region (HVR) with extensive sequence variations in open reading frame 1 of HEV. To elucidate the role of the HVR in HEV replication, we first constructed two HVR deletion mutants, hHVRd1 and hHVRd2, with in-frame deletion of amino acids (aa) 711 to 777 and 747 to 761 in the HVR of a genotype 1 human HEV replicon. Evidence of HEV replication was detected in Huh7 cells transfected with RNA transcripts from mutant hHVRd2, as evidenced by expression of enhanced green fluorescent protein. To confirm the in vitro results, we constructed three avian HEV mutants with various HVR deletions: mutants aHVRd1, with deletion of aa 557 to 585 (Delta557-585); aHVRd2 (Delta612-641); and aHVRd3 (Delta557-641). Chickens intrahepatically inoculated with capped RNA transcripts from mutants aHVRd1 and aHVRd2 developed active viral infection, as evidenced by seroconversion, viremia, and fecal virus shedding, although mutant aHVRd3, with complete HVR deletion, was apparently attenuated in chickens. To further verify the results, we constructed four additional HVR deletion mutants using the genotype 3 swine HEV as the backbone. Mutants sHVRd2 (Delta722-781), sHVRd3 (Delta735-765), and sHVRd4 (Delta712-765) were shown to tolerate deletions and were infectious in pigs intrahepatically inoculated with capped RNA transcripts from the mutants, whereas mutant sHVRd1 (Delta712-790), with a nearly complete HVR deletion, exhibited an attenuation phenotype in infected pigs. The data from these studies indicate that deletions in HVR do not abolish HEV infectivity in vitro or in vivo, although evidence for attenuation was observed for HEV mutants with a larger or nearly complete HVR deletion.
Klaassens, Merel; Morrogh, Deborah; Rosser, Elisabeth M; Jaffer, Fatima; Vreeburg, Maaike; Bok, Levinus A; Segboer, Tim; van Belzen, Martine; Quinlivan, Ros M; Kumar, Ajith; Hurst, Jane A; Scott, Richard H
2015-05-01
De novo monoallelic variants in NFIX cause two distinct syndromes. Whole gene deletions, nonsense variants and missense variants affecting the DNA-binding domain have been seen in association with a Sotos-like phenotype that we propose is referred to as Malan syndrome. Frameshift and splice-site variants thought to avoid nonsense-mediated RNA decay have been seen in Marshall-Smith syndrome. We report six additional patients with Malan syndrome and de novo NFIX deletions or sequence variants and review the 20 patients now reported. The phenotype is characterised by moderate postnatal overgrowth and macrocephaly. Median height and head circumference in childhood are 2.0 and 2.3 standard deviations (SD) above the mean, respectively. There is overlap of the facial phenotype with NSD1-positive Sotos syndrome in some cases including a prominent forehead, high anterior hairline, downslanting palpebral fissures and prominent chin. Neonatal feeding difficulties and/or hypotonia have been reported in 30% of patients. Developmental delay/learning disability have been reported in all cases and are typically moderate. Ocular phenotypes are common, including strabismus (65%), nystagmus (25% ) and optic disc pallor/hypoplasia (25%). Other recurrent features include pectus excavatum (40%) and scoliosis (25%). Eight reported patients have a deletion also encompassing CACNA1A, haploinsufficiency of which causes episodic ataxia type 2 or familial hemiplegic migraine. One previous case had episodic ataxia and one case we report has had cyclical vomiting responsive to pizotifen. In individuals with this contiguous gene deletion syndrome, awareness of possible later neurological manifestations is important, although their penetrance is not yet clear.
Directory of Open Access Journals (Sweden)
Herring Christopher D
2007-08-01
Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.
Raffan, Eleanor; Dennis, Rowena?J.; O?Donovan, Conor?J.; Becker, Julia?M.; Scott, Robert?A.; Smith, Stephen?P.; Withers, David?J.; Wood, Claire?J.; Conci, Elena; Clements, Dylan?N.; Summers, Kim?M.; German, Alexander?J.; Mellersh, Cathryn?S.; Arendt, Maja?L.; Iyemere, Valentine?P.
2016-01-01
Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food mot...
A novel large deletion of the ICR1 region including H19 and putative enhancer elements.
Fryssira, Helen; Amenta, Stella; Kanber, Deniz; Sofocleous, Christalena; Lykopoulou, Evangelia; Kanaka-Gantenbein, Christina; Cerrato, Flavia; Lüdecke, Hermann-Josef; Bens, Susanne; Riccio, Andrea; Buiting, Karin
2015-05-06
Beckwith-Wiedemann syndrome (BWS) is a rare pediatric overgrowth disorder with a variable clinical phenotype caused by deregulation affecting imprinted genes in the chromosomal region 11p15. Alterations of the imprinting control region 1 (ICR1) at the IGF2/H19 locus resulting in biallelic expression of IGF2 and biallelic silencing of H19 account for approximately 10% of patients with BWS. The majority of these patients have epimutations of the ICR1 without detectable DNA sequence changes. Only a few patients were found to have deletions. Most of these deletions are small affecting different parts of the ICR1 differentially methylated region (ICR1-DMR) removing target sequences for CTCF. Only a very few deletions reported so far include the H19 gene in addition to the CTCF binding sites. None of these deletions include IGF2. A male patient was born with hypotonia, facial dysmorphisms and hypoglycemia suggestive of Beckwith-Wiedemann syndrome. Using methylation-specific (MS)-MLPA (Multiplex ligation-dependent probe amplification) we have identified a maternally inherited large deletion of the ICR1 region in a patient and his mother. The deletion results in a variable clinical expression with a classical BWS in the mother and a more severe presentation of BWS in her son. By genome-wide SNP array analysis the deletion was found to span ~100 kb genomic DNA including the ICR1DMR, H19, two adjacent non-imprinted genes and two of three predicted enhancer elements downstream to H19. Methylation analysis by deep bisulfite next generation sequencing revealed hypermethylation of the maternal allele at the IGF2 locus in both, mother and child, although IGF2 is not affected by the deletion. We here report on a novel large familial deletion of the ICR1 region in a BWS family. Due to the deletion of the ICR1-DMR CTCF binding cannot take place and the residual enhancer elements have access to the IGF2 promoters. The aberrant methylation (hypermethylation) of the maternal IGF2
International Nuclear Information System (INIS)
Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander
2005-01-01
The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer
Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander
2005-04-29
The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.
Directory of Open Access Journals (Sweden)
Campbell Ian G
2005-04-01
Full Text Available Abstract The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. Methods We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. Results The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. Conclusion The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.
Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun
2015-12-29
In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C
Directory of Open Access Journals (Sweden)
V.L. Quadros
2006-07-01
Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.
International Nuclear Information System (INIS)
Chen Xiaosui; Zhou Lijun; Wang Yuxiao; Qu Jia; Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie
2006-01-01
Objective: To construct a stable plasmid that spanning deleted human mitochondrial DNA (mtDNA) 4977 bp induced by ionizing radiation and another one for control DNA fragment, in order to use in the human mitochondrial genome study in the future. Methods: The peripheral blood, which had no mtDNA 4977 bp deletion found in previous study, was exposed to 10 Gy 60 Co γ-rays in vitro. The total cell DNA was extracted and PCR was carried out: a nest-PCR of three-round PCR was used for the mtDNA 4977 bp deletion and one- round regular PCR was used for the control ND1 gene. The PCR products were used for transfection by electroporation and the positive clones were obtained after screening. The plasmid DNA was isolated and sequenced after enzymatic digestion and purification. The sequence result was BLASTed with the human mitochondrial genome. Results: The sizes of PCR products for the flanked 4977 bp deletion and the ND1 gene were similar with those predicted according to GeneBank. The sequences for the positive clones were above 99 per cent homologous with the human mitochondrial genome after BLASTed. Conclusion: The plasmids for deleted human mtDNA 4977 bp and control DNA fragment have been constructed successfully, and they could be used in the quality and quantity studies on human mtDNA 4977 bp deletion. (authors)
Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism
Directory of Open Access Journals (Sweden)
Guerra-Júnior Gil
2010-06-01
Full Text Available Abstract Background Congenital adrenal hyperplasia due to 21-hydroxylase deficiency is caused by deletions, large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes for putative serine/threonine Kinase RP, complement C4, steroid 21-hydroxylase CYP21 tenascin TNX, normally, in a duplicated cluster known as RCCX module. The CYP21 extra copy is a pseudogene (CYP21A1P. In Brazil, 30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles. Such alleles are considered to result from unequal crossovers within the bimodular C4/CYP21 locus. Depending on the localization of recombination breakpoint, different alleles can be generated conferring the locus high degree of allelic variability. The purpose of the study was to investigate the variability of deleted alleles in patients with 21-hydroxylase deficiency. Methods We used different techniques to investigate the variability of 30-kb deletion alleles in patients with 21-hydroxylase deficiency. Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR and MLPA analyses followed by sequencing to refine the location of recombination breakpoints. Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. Results An allele carrying a CYP21A1P/A2 chimeric gene was found unusually associated to a C4B/C4A Taq I 6.4-kb fragment, generally associated to C4B and CYP21A1P deletions. A novel haplotype bearing both p.P34L and p.H62L, novel and rare mutations, respectively, was identified in exon 1, however p.P30L, the most frequent pseudogene-derived mutation in this exon, was absent. Four unrelated patients showed this haplotype. Absence of p.P34L in CYP21A1P of normal controls indicated that it is not derived from pseudogene. In addition, the combination of different
Directory of Open Access Journals (Sweden)
Miri eMichaeli
2012-12-01
Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.
Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales
Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy
2013-01-01
Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes
Li, Guotian; Jain, Rashmi; Chern, Mawsheng; Pham, Nikki T; Martin, Joel A; Wei, Tong; Schackwitz, Wendy S; Lipzen, Anna M; Duong, Phat Q; Jones, Kyle C; Jiang, Liangrong; Ruan, Deling; Bauer, Diane; Peng, Yi; Barry, Kerrie W; Schmutz, Jeremy; Ronald, Pamela C
2017-06-01
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake ( Oryza sativa ssp japonica ), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. © 2017 American Society of Plant Biologists. All rights reserved.
Directory of Open Access Journals (Sweden)
N. H. Birkebæk
2011-01-01
Full Text Available We report on a boy with diabetes mellitus and a phenotype indicating glucokinase (GCK insufficiency, but a normal GCK gene examination applying direct gene sequencing. The boy was referred for diabetes mellitus at 7.5 years old. His father, grandfather and great grandfather suffered type 2 DM. Several blood glucose profiles showed (BG of 6.5–10 mmol/L L. After three years on neutral insulin Hagedorn (NPH in a dose of 0.3 IU/kg/day haemoglobin A1c (HbA1c was 6.8%. Treatment was changed to sulphonylurea 750 mg a day, and after 4 years HbA1c was 7%. At that time a multiplex ligation-dependent amplification gene dosage assay (MLPA was done, revealing a whole GCK gene deletion. Medical treatment was ceased, and after one year HbA1c was 6.8%. This case underscores the importance of a MLPA examination if the phenotype of a patient is strongly indicative of GCK insufficiency and no mutation is identified using direct sequencing.
Directory of Open Access Journals (Sweden)
Xu Xiu
2012-08-01
Full Text Available Abstract Background Autistic spectrum disorders (ASDs are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 – 153,589,577 from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. Conclusions To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.
Biliary tract duplication cyst with gastric heterotopia
Energy Technology Data Exchange (ETDEWEB)
Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.
1988-05-01
Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.
Biliary tract duplication cyst with gastric heterotopia
International Nuclear Information System (INIS)
Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.
1988-01-01
Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)
The centriole duplication cycle
Fırat-Karalar, Elif Nur; Stearns, Tim
2014-01-01
Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614
Current incidence of duplicate publication in otolaryngology.
Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K
2014-03-01
Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.
Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.
Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A
2014-10-01
Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Essouissi, Imen
2006-01-01
Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)
The diploid genome sequence of an individual human.
Directory of Open Access Journals (Sweden)
Samuel Levy
2007-09-01
Full Text Available Presented here is a genome sequence of an individual human. It was produced from approximately 32 million random DNA fragments, sequenced by Sanger dideoxy technology and assembled into 4,528 scaffolds, comprising 2,810 million bases (Mb of contiguous sequence with approximately 7.5-fold coverage for any given region. We developed a modified version of the Celera assembler to facilitate the identification and comparison of alternate alleles within this individual diploid genome. Comparison of this genome and the National Center for Biotechnology Information human reference assembly revealed more than 4.1 million DNA variants, encompassing 12.3 Mb. These variants (of which 1,288,319 were novel included 3,213,401 single nucleotide polymorphisms (SNPs, 53,823 block substitutions (2-206 bp, 292,102 heterozygous insertion/deletion events (indels(1-571 bp, 559,473 homozygous indels (1-82,711 bp, 90 inversions, as well as numerous segmental duplications and copy number variation regions. Non-SNP DNA variation accounts for 22% of all events identified in the donor, however they involve 74% of all variant bases. This suggests an important role for non-SNP genetic alterations in defining the diploid genome structure. Moreover, 44% of genes were heterozygous for one or more variants. Using a novel haplotype assembly strategy, we were able to span 1.5 Gb of genome sequence in segments >200 kb, providing further precision to the diploid nature of the genome. These data depict a definitive molecular portrait of a diploid human genome that provides a starting point for future genome comparisons and enables an era of individualized genomic information.
Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A
2015-08-29
The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Establishment of screening technique for mutant cell and analysis of base sequence in the mutation
International Nuclear Information System (INIS)
Sofuni, Toshio; Nomi, Takehiko; Yamada, Masami; Masumura, Kenichi
2000-01-01
This research project aimed to establish an easy and quick detection method for radiation-induced mutation using molecular-biological techniques and an effective analyzing method for the molecular changes in base sequence. In this year, Spi mutants derived from γ-radiation exposed mouse were analyzed by PCR method and DNA sequence method. Male transgenic mice were exposed to γ-ray at 5,10, 50 Gy and the transgene was taken out from the genome DNA from the spleen in vivo packaging method. Spi mutant plaques were obtained by infecting the recovered phage to E. coli. Sequence analysis for the mutants was made using ALFred DNA sequencer and SequiTherm TM Long-Red Cycle sequencing kit. Sequence analysis was carried out for 41 of 50 independent Spi mutants obtained. The deletions were classified into 4 groups; Group 1 included 15 mutants that were characterized with a large deletion (43 bp-10 kb) with a short homologous sequence. Group 2 included 11 mutants of a large deletion having no homologous sequence at the connecting region. Group 3 included 11 mutants having a short deletion of less than 20 bp, which occurred in the non-repetitive sequence of gam gene and possibly caused by oxidative breakage of DNA or recombination of DNA fragment produced by the breakage. Group 4 included 4 mutants having deletions as short as 20 bp or less in the repetitive sequence of gam gene, resulting in an alteration of the reading frame. Thus, the synthesis of Gam protein was terminated by the appearance of TGA between code 13 and 14 of redB gene, leading to inactivation of gam gene and redBA gene. These results indicated that most of Spi mutants had a deletion in red/gam region and the deletions in more than half mutants occurred in homologous sequences as short as 8 bp. (M.N.)
Comparative analysis and relationships of six important crop ...
African Journals Online (AJOL)
Administrator
tools using complete chloroplast genomes. Results obtained depict cases of major genome rearrangements, translocation, duplication, inversion and deletion of genes. Members of the poaceae family indicate a close relationship in the nature of conserved sequences while Oryza sativa and. Chlorella vulgaris, which are not ...
Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.
2014-01-01
We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,
Deletion of a coordinate regulator of type 2 cytokine expression in mice
Energy Technology Data Exchange (ETDEWEB)
Mohrs, Markus; Blankespoor, Catherine M.; Wang, Zhi-En; Loots, Gaby G.; Hadeiba, Husein; Shinkai, Kanade; Rubin, Edward M.; Locksley, Richard M.
2001-07-30
Mechanisms underlying the differentiation of stable T helper subsets will be important in understanding how discrete types of immunity develop in response to different pathogens. An evolutionarily conserved {approx}400 base pair non-coding sequence in the IL-4/IL-13 intergenic region, designated CNS-1, was deleted in mice. The capacity to develop Th2 cells was compromised in vitro and in vivo in the absence of CNS-1. Despite the profound effect in T cells, mast cells from CNS-1-deleted mice maintained their capacity to produce IL-4. A T cell-specific element critical for optimal expression of type 2 cytokines may represent evolution of a regulatory sequence exploited by adaptive immunity.
International Nuclear Information System (INIS)
Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.
1988-01-01
The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Directory of Open Access Journals (Sweden)
Xinyi WU
2017-01-01
Full Text Available Bottle gourd is an important cucurbit crop worldwide. To provide more available molecular markers for this crop, a bioinformatic approach was employed to develop insertion–deletions (InDels markers in bottle gourd based on restriction site-associated DNA sequencing (RAD-Seq data. A total of 892 Indels were predicted, with the length varying from 1 bp to 167 bp. Single-nucleotide InDels were the predominant types of InDels. To validate these InDels, PCR primers were designed from 162 loci where InDels longer than 2 bp were predicated. A total of 112 InDels were found to be polymorphic among 9 bottle gourd accessions under investigation. The rate of prediction accuracy was thus at a high level of 72.7%. DNA fingerprinting for 4 cultivars were performed using 8 selected Indels markers, demonstrating the usefulness of these markers.
Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K
2007-11-01
Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.
A macaque's-eye view of human insertions and deletions: differences in mechanisms.
Directory of Open Access Journals (Sweden)
Erika M Kvikstad
2007-09-01
Full Text Available Insertions and deletions (indels cause numerous genetic diseases and lead to pronounced evolutionary differences among genomes. The macaque sequences provide an opportunity to gain insights into the mechanisms generating these mutations on a genome-wide scale by establishing the polarity of indels occurring in the human lineage since its divergence from the chimpanzee. Here we apply novel regression techniques and multiscale analyses to demonstrate an extensive regional indel rate variation stemming from local fluctuations in divergence, GC content, male and female recombination rates, proximity to telomeres, and other genomic factors. We find that both replication and, surprisingly, recombination are significantly associated with the occurrence of small indels. Intriguingly, the relative inputs of replication versus recombination differ between insertions and deletions, thus the two types of mutations are likely guided in part by distinct mechanisms. Namely, insertions are more strongly associated with factors linked to recombination, while deletions are mostly associated with replication-related features. Indel as a term misleadingly groups the two types of mutations together by their effect on a sequence alignment. However, here we establish that the correct identification of a small gap as an insertion or a deletion (by use of an outgroup is crucial to determining its mechanism of origin. In addition to providing novel insights into insertion and deletion mutagenesis, these results will assist in gap penalty modeling and eventually lead to more reliable genomic alignments.
Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.
Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J
2011-09-01
Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.
DEFF Research Database (Denmark)
Kirchhoff, Maria; Bisgaard, Anne-Marie; Bryndorf, Thue
2007-01-01
MLPA analysis for a panel of syndromes with mental retardation (MRS-MLPA) was used for investigation of 258 mentally retarded and dysmorphic patients with normal conventional karyotypes (P064 probe set, MRC-Holland, for detection of (micro)deletions associated with 1p36-deletion, Sotos, Williams...... referred with a clinical suspicion of a specific syndrome, which was confirmed in 17 patients (21.3%). The remaining 90 patients were referred because of mental retardation and dysmorphism but without suspicion of a specific syndrome. Seven imbalances, including four duplications, were detected in these 90...
The odds of duplicate gene persistence after polyploidization
Directory of Open Access Journals (Sweden)
Chain Frédéric JJ
2011-12-01
Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.
Colonic duplication in an adult
International Nuclear Information System (INIS)
Baro, P.; Dario Casas, J.; Sanchez, D.
1988-01-01
A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)
Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...
African Journals Online (AJOL)
Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...
Richardson, Dale N.; Wiehe, Thomas
Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.
Noncommunicating Isolated Enteric Duplication Cyst in the ...
African Journals Online (AJOL)
Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...
Contribution of insertions and deletions to the variability of hepatitis C virus populations.
Torres-Puente, Manuela; Cuevas, José M; Jiménez-Hernández, Nuria; Bracho, María A; García-Robles, Inmaculada; Carnicer, Fernando; del Olmo, Juan; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando
2007-08-01
Little is known about the potential effects of insertions and deletions (indels) on the evolutionary dynamics of hepatitis C virus (HCV). In fact, the consequences of indels on antiviral treatment response are a field of investigation completely unexplored. Here, an extensive sequencing project was undertaken by cloning and sequencing serum samples from 25 patients infected with HCV subtype 1a and 48 patients with subtype 1b. For 23 patients, samples obtained after treatment with alpha interferon plus ribavirin were also available. Two genome fragments containing the hypervariable regions in the envelope 2 glycoprotein and the PKR-BD domain in NS5A were sequenced, yielding almost 16 000 sequences. Our results show that insertions are quite rare, but they are often present in biologically relevant domains of the HCV genome. Moreover, their frequency distributions between different time samples reflect the quasispecies dynamics of HCV populations. Deletions seem to be subject to negative selection.
Laparoscopic excision of a newborn rectal duplication cyst.
Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L
2008-08-01
Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.
Our experience with unusual gastrointestinal tract duplications in infants
Directory of Open Access Journals (Sweden)
Bilal Mirza
2014-01-01
Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.
Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher
2014-05-01
Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.
Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila.
Saveliev, S V; Cox, M M
2001-06-15
DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15-16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form.
Vengalil, Seena; Preethish-Kumar, Veeramani; Polavarapu, Kiran; Mahadevappa, Manjunath; Sekar, Deepha; Purushottam, Meera; Thomas, Priya Treesa; Nashi, Saraswathi; Nalini, Atchayaram
2017-01-01
Studies of cases of Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) confirmed by multiplex ligation-dependent probe amplification (MLPA) have determined the clinical characteristics, genotype, and relations between the reading frame and phenotype for different countries. This is the first such study from India. A retrospective genotype-phenotype analysis of 317 MLPA-confirmed patients with DMD or BMD who visited the neuromuscular clinic of a quaternary referral center in southern India. The 317 patients comprised 279 cases of DMD (88%), 32 of BMD (10.1%), and 6 of intermediate phenotype (1.9%). Deletions accounted for 91.8% of cases, with duplications causing the remaining 8.2%. There were 254 cases of DMD (91%) with deletions and 25 (9%) due to duplications, and 31 cases (96.8%) of BMD with deletions and 1 (3.2%) due to duplication. All six cases of intermediate type were due to deletions. The most-common mutation was a single-exon deletion. Deletions of six or fewer exons constituted 68.8% of cases. The deletion of exon 50 was the most common. The reading-frame rule held in 90% of DMD and 94% of BMD cases. A tendency toward a lower IQ and earlier wheelchair dependence was observed with distal exon deletions, though a significant correlation was not found. The reading-frame rule held in 90% to 94% of children, which is consistent with reports from other parts of the world. However, testing by MLPA is a limitation, and advanced sequencing methods including analysis of the structure of mutant dystrophin is needed for more-accurate assessments of the genotype-phenotype correlation.
Lybæk, Helle; de Bruijn, Diederik; den Engelsman-van Dijk, Anke H A; Vanichkina, Darya; Nepal, Chirag; Brendehaug, Atle; Houge, Gunnar
2014-03-01
It was recently shown that duplications of the RevSex element, located 0.5 Mb upstream of SOX9, cause XX-disorder of sex development (DSD), and that deletions cause XY-DSD. To explore how a 148 kb RevSex duplication could have turned on gonadal SOX9 expression in the absence of SRY in an XX-male, we examined the chromatin landscape in primary skin fibroblast cultures from the index, his RevSex duplication-carrier father and six controls. The ENCODE project supports the notion that chromatin state maps show overlap between different cell types, i.e., that our study of fibroblasts could be of biological relevance. We examined the SOX9 regulatory region by high-resolution ChIP-on-chip experiments (a kind of "chromatin-CGH") and DNA methylation investigations. The RevSex duplication was associated with chromatin changes predicting better accessibility of the SRY-responsive TESCO enhancer region 14-15 kb upstream of SOX9. Four kb downstream of the TESCO evolutionary conserved region, a peak of the enhancer/promoter-associated H3K4me3 mark was found together with a major dip of the repressive H3K9me3 chromatin mark. Similar differences were also found when three control males were compared with three control females. A marked male/female difference was a more open chromatin signature in males starting ~400 kb upstream of SOX9 and increasing toward the SOX9 promoter. In the RevSex duplication-carrier father, two positions of DNA hypomethylation were also found, one corresponding to the H3K4me3 peak mentioned above. Our results suggest that the RevSex duplication could operate by inducing long-range epigenetic changes. Furthermore, the differences in chromatin state maps between males and females suggest that the Y chromosome or X chromosome dosage may affect chromatin conformation, i.e., that sex-dependent gene regulation may take place by chromatin modification.
Evolutionary diversification of plant shikimate kinase gene duplicates.
Directory of Open Access Journals (Sweden)
Geoffrey Fucile
2008-12-01
Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.
Bai, Ying; Chen, Yibing; Kong, Xiangdong
2018-02-02
It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.
MYO7A and USH2A gene sequence variants in Italian patients with Usher syndrome.
Sodi, Andrea; Mariottini, Alessandro; Passerini, Ilaria; Murro, Vittoria; Tachyla, Iryna; Bianchi, Benedetta; Menchini, Ugo; Torricelli, Francesca
2014-01-01
To analyze the spectrum of sequence variants in the MYO7A and USH2A genes in a group of Italian patients affected by Usher syndrome (USH). Thirty-six Italian patients with a diagnosis of USH were recruited. They received a standard ophthalmologic examination, visual field testing, optical coherence tomography (OCT) scan, and electrophysiological tests. Fluorescein angiography and fundus autofluorescence imaging were performed in selected cases. All the patients underwent an audiologic examination for the 0.25-8,000 Hz frequencies. Vestibular function was evaluated with specific tests. DNA samples were analyzed for sequence variants of the MYO7A gene (for USH1) and the USH2A gene (for USH2) with direct sequencing techniques. A few patients were analyzed for both genes. In the MYO7A gene, ten missense variants were found; three patients were compound heterozygous, and two were homozygous. Thirty-four USH2A gene variants were detected, including eight missense variants, nine nonsense variants, six splicing variants, and 11 duplications/deletions; 19 patients were compound heterozygous, and three were homozygous. Four MYO7A and 17 USH2A variants have already been described in the literature. Among the novel mutations there are four USH2A large deletions, detected with multiplex ligation dependent probe amplification (MLPA) technology. Two potentially pathogenic variants were found in 27 patients (75%). Affected patients showed variable clinical pictures without a clear genotype-phenotype correlation. Ten variants in the MYO7A gene and 34 variants in the USH2A gene were detected in Italian patients with USH at a high detection rate. A selective analysis of these genes may be valuable for molecular analysis, combining diagnostic efficiency with little time wastage and less resource consumption.
DNA sequence analysis of X-ray induced Adh null mutations in Drosophila melanogaster
International Nuclear Information System (INIS)
Mahmoud, J.; Fossett, N.G.; Arbour-Reily, P.; McDaniel, M.; Tucker, A.; Chang, S.H.; Lee, W.R.
1991-01-01
The mutational spectrum for 28 X-ray induced mutations and 2 spontaneous mutations, previously determined by genetic and cytogenetic methods, consisted of 20 multilocus deficiencies (19 induced and 1 spontaneous) and 10 intragenic mutations (9 induced and 1 spontaneous). One of the X-ray induced intragenic mutations was lost, and another was determined to be a recombinant with the allele used in the recovery scheme. The DNA sequence of two X-ray induced intragenic mutations has been published. This paper reports the results of DNA sequence analysis of the remaining intragenic mutations and a summary of the X-ray induced mutational spectrum. The combination of DNA sequence analysis with genetic complementation analysis shows a continuous distribution in size of deletions rather than two different types of mutations consisting of deletions and 'point mutations'. Sequencing is shown to be essential for detecting intragenic deletions. Of particular importance for future studies is the observation that all of the intragenic deletions consist of a direct repeat adjacent to the breakpoint with one of the repeats deleted
Perforated ileal duplication cyst with haemorrhagic pseudocyst formation
International Nuclear Information System (INIS)
Hwang, Im Kyung; Kim, Bong Soo; Kim, Heung Chul; Lee, In Sun; Hwang, Woo Chul; Namkung, Sook
2003-01-01
Duplication cysts of the gastrointestinal tract are rare congenital abnormalities. Ectopic gastric mucosa, which can be found in duplications, may cause peptic ulceration, gastrointestinal bleeding or perforation. We report a 1-year-old boy with a perforated ileal duplication cyst with haemorrhagic pseudocyst formation caused by peptic ulceration of the duplication cyst. It presented a snowman-like appearance consisting of a small, thick-walled, true enteric cyst and a large, thin-walled haemorrhagic pseudocyst on US and CT. It is an unusual manifestation of a duplication cyst, which has not been reported in the English language literature. (orig.)
Detection of 1p36 deletion by clinical exome-first diagnostic approach.
Watanabe, Miki; Hayabuchi, Yasunobu; Ono, Akemi; Naruto, Takuya; Horikawa, Hideaki; Kohmoto, Tomohiro; Masuda, Kiyoshi; Nakagawa, Ryuji; Ito, Hiromichi; Kagami, Shoji; Imoto, Issei
2016-01-01
Although chromosome 1p36 deletion syndrome is considered clinically recognizable based on characteristic features, the clinical manifestations of patients during infancy are often not consistent with those observed later in life. We report a 4-month-old girl who showed multiple congenital anomalies and developmental delay, but no clinical signs of syndromic disease caused by a terminal deletion in 1p36.32-p36.33 that was first identified by targeted-exome sequencing for molecular diagnosis.
Directory of Open Access Journals (Sweden)
Yagan Pillay
2015-01-01
Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.
Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y
2018-01-15
Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.
Presentation and Surgical Management of Duodenal Duplication in Adults
Directory of Open Access Journals (Sweden)
Caroline C. Jadlowiec
2015-01-01
Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.
Genomic Deletion at 10q23 in Prostate Cancer: More Than PTEN Loss?
Directory of Open Access Journals (Sweden)
Raghavendra Tejo Karthik Poluri
2018-06-01
Full Text Available The PTEN gene encodes for the phosphatase and tensin homolog; it is a tumor suppressor gene that is among the most frequently inactivated genes throughout the human cancer spectrum. The most recent sequencing approaches have allowed the identification of PTEN genomic alterations, including deletion, mutation, or rearrangement in about 50% of prostate cancer (PCa cases. It appears that mechanisms leading to PTEN inactivation are cancer-specific, comprising gene mutations, small insertions/deletions, copy number alterations (CNAs, promoter hypermethylation, and RNA interference. The examination of publicly available results from deep-sequencing studies of various cancers showed that PCa appears to be the only cancer in which PTEN is lost mostly through CNA. Instead of inactivating mutations, which are seen in other cancers, deletion of the 10q23 locus is the most common form of PTEN inactivation in PCa. By investigating the minimal deleted region at 10q23, several other genes appear to be lost simultaneously with PTEN. Expression data indicate that, like PTEN, these genes are also downregulated upon loss of 10q23. These analyses raise the possibility that 10q23 is lost upon selective pressure not only to inactivate PTEN but also to impair the expression of surrounding genes. As such, several genes from this deleted region, which represents about 500 kb, may also act as tumor suppressors in PCa, requiring further studies on their respective functions in that context.
Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M
2015-03-15
Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.
Kumazawa, Yoshinori; Endo, Hideki
2004-04-30
The mitochondrial genome of the Komodo dragon (Varanus komodoensis) was nearly completely sequenced, except for two highly repetitive noncoding regions. An efficient sequencing method for squamate mitochondrial genomes was established by combining the long polymerase chain reaction (PCR) technology and a set of reptile-oriented primers designed for nested PCR amplifications. It was found that the mitochondrial genome had novel gene arrangements in which genes from NADH dehydrogenase subunit 6 to proline tRNA were extensively shuffled with duplicate control regions. These control regions had 99% sequence similarity over 700 bp. Although snake mitochondrial genomes are also known to possess duplicate control regions with nearly identical sequences, the location of the second control region suggested independent occurrence of the duplication on lineages leading to snakes and the Komodo dragon. Another feature of the mitochondrial genome of the Komodo dragon was the considerable number of tandem repeats, including sequences with a strong secondary structure, as a possible site for the slipped-strand mispairing in replication. These observations are consistent with hypotheses that tandem duplications via the slipped-strand mispairing may induce mitochondrial gene rearrangements and may serve to maintain similar copies of the control region.
Abe, Hideaki; Aoya, Daiki; Takeuchi, Hiro-Aki; Inoue-Murayama, Miho
2017-07-21
Neuregulin 3 (NRG3) plays a key role in central nervous system development and is a strong candidate for human mental disorders. Thus, genetic variation in NRG3 may have some impact on a variety of phenotypes in non-mammalian vertebrates. Recently, genome-wide screening for short insertions and deletions in chicken (Gallus gallus) genomes has provided useful information about structural variation in functionally important genes. NRG3 is one such gene that has a putative frameshift deletion in exon 2, resulting in premature termination of translation. Our aims were to characterize the structure of chicken NRG3 and to compare expression patterns between NRG3 isoforms. Depending on the presence or absence of the 2-bp deletion in chicken NRG3, 3 breeds (red junglefowl [RJF], Boris Brown [BB], and Hinai-jidori [HJ]) were genotyped using flanking primers. In the commercial breeds (BB and HJ), approximately 45% of individuals had at least one exon 2 allele with the 2-bp deletion, whereas there was no deletion allele in RJF. The lack of a homozygous mutant indicated the existence of duplicated NRG3 segments in the chicken genome. Indeed, highly conserved elements consisting of exon 1, intron 1, exon 2, and part of intron 2 were found in the reference RJF genome, and quantitative PCR detected copy number variation (CNV) between breeds as well as between individuals. The copy number of conserved elements was significantly higher in chicks harboring the 2-bp deletion in exon 2. We identified 7 novel transcript variants using total mRNA isolated from the amygdala. Novel isoforms were found to lack the exon 2 cassette, which probably harbored the premature termination codon. The relative transcription levels of the newly identified isoforms were almost the same between chick groups with and without the 2-bp deletion, while chicks with the deletion showed significant suppression of the expression of previously reported isoforms. A putative frameshift deletion and CNV in chicken
Directory of Open Access Journals (Sweden)
Brenner Sydney
2008-06-01
Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate
Institute of Scientific and Technical Information of China (English)
张道荣; 牟弦琴; 李振东; 李恭才; 王修忠; 代蕊霜
1983-01-01
@@ 我们两院近10年来共收治先天性直肠重复畸形17例(其中河北医学院11例,西安医学院6例).均经手术及病理证实.现总结如下:临床资料本组男性6例,女性11例,最小年龄4天,最大年龄14岁.%This paper reports 17 cases of rectal duplication. There were 6 males and 11rectal duplications were divided into three bordered by a common wall.9 patients in this series were found to have this condition.a rectovestitubular fistula.B.Pararectal duplication.The duplicated bowel lies near elliptical in shape and filled with fluid.In Complicated rectal duplication.The dupticated bowel is located at the perineum near the abnormal anus and is usually associated with hypospadia.Two cases were of this type.between the duplicated bowel and normal rectum must be partially resected at the distal end.The rectovestitubular fistula should be repaired at the same time.Pararectal duplication can be completely resected.resect the duplicated bowel from perineum but leave the genital anomaly for later treatment.
Rectal duplication cyst in a cat.
Kook, Peter H; Hagen, Regine; Willi, Barbara; Ruetten, Maja; Venzin, Claudio
2010-12-01
Enteric duplication is a rare developmental malformation in people, dogs and cats. The purpose of the present report is to describe the first case of a rectal duplication cyst in a 7-year-old domestic shorthair cat presenting for acute constipation and tenesmus. On rectal palpation a spherical mass compressing the lumen of the rectum could be felt in the dorsal wall of the rectum. A computed tomography (CT) scan confirmed the presence of a well demarcated cystic lesion in the pelvic canal, dorsal to the rectum. The cyst was surgically removed via a perineal approach. No communication with the rectal lumen could be demonstrated. Histopathological examination was consistent with a rectal duplication cyst. Clinical signs resolved completely after excision of this conjoined non-communicating cystic rectal duplicate. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.
Vicente, Carmen; Schwab, Claire; Broux, Michaël; Geerdens, Ellen; Degryse, Sandrine; Demeyer, Sofie; Lahortiga, Idoya; Elliott, Alannah; Chilton, Lucy; La Starza, Roberta; Mecucci, Cristina; Vandenberghe, Peter; Goulden, Nicholas; Vora, Ajay; Moorman, Anthony V.; Soulier, Jean; Harrison, Christine J.; Clappier, Emmanuelle; Cools, Jan
2015-01-01
T-cell acute lymphoblastic leukemia is caused by the accumulation of multiple oncogenic lesions, including chromosomal rearrangements and mutations. To determine the frequency and co-occurrence of mutations in T-cell acute lymphoblastic leukemia, we performed targeted re-sequencing of 115 genes across 155 diagnostic samples (44 adult and 111 childhood cases). NOTCH1 and CDKN2A/B were mutated/deleted in more than half of the cases, while an additional 37 genes were mutated/deleted in 4% to 20% of cases. We found that IL7R-JAK pathway genes were mutated in 27.7% of cases, with JAK3 mutations being the most frequent event in this group. Copy number variations were also detected, including deletions of CREBBP or CTCF and duplication of MYB. FLT3 mutations were rare, but a novel extracellular mutation in FLT3 was detected and confirmed to be transforming. Furthermore, we identified complex patterns of pairwise associations, including a significant association between mutations in IL7R-JAK genes and epigenetic regulators (WT1, PRC2, PHF6). Our analyses showed that IL7R-JAK genetic lesions did not confer adverse prognosis in T-cell acute lymphoblastic leukemia cases enrolled in the UK ALL2003 trial. Overall, these results identify interconnections between the T-cell acute lymphoblastic leukemia genome and disease biology, and suggest a potential clinical application for JAK inhibitors in a significant proportion of patients with T-cell acute lymphoblastic leukemia. PMID:26206799
Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom
Directory of Open Access Journals (Sweden)
Heitman Joseph
2010-09-01
Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural
Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen
2016-05-10
Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Choi, Rihwa; Park, Hyung-Doo; Kang, Ben; Choi, So Yoon; Ki, Chang-Seok; Lee, Soo-Youn; Kim, Jong-Won; Song, Junghan; Choe, Yon Ho
2016-04-21
Molecular diagnosis of glycogen storage diseases (GSDs) is important to enable accurate diagnoses and make appropriate therapeutic plans. The aim of this study was to evaluate the PHKA2 mutation spectrum in Korean patients with GSD type IX. Thirteen Korean patients were tested for PHKA2 mutations using direct sequencing and a multiplex polymerase chain reaction method. A comprehensive review of the literature on previously reported PHKA2 mutations in other ethnic populations was conducted for comparison. Among 13 patients tested, six unrelated male patients with GSD IX aged 2 to 6 years at the first diagnostic work-up for hepatomegaly with elevated aspartate transaminase (AST) and alanine transaminase (ALT) were found to have PHKA2 mutations. These patients had different PHKA2 mutations: five were known mutations (c.537 + 5G > A, c.884G > A [p.Arg295His], c.3210_3212delGAG [p.Arg1072del], exon 8 deletion, and exons 27-33 deletion) and one was a novel mutation (exons 18-33 deletion). Notably, the most common type of mutation was gross deletion, in contrast to other ethnic populations in which the most common mutation type was sequence variant. This study expands our knowledge of the PHKA2 mutation spectrum of GSD IX. Considering the PHKA2 mutation spectrum in Korean patients with GSD IX, molecular diagnostic methods for deletions should be conducted in conjunction with direct sequence analysis to enable accurate molecular diagnosis of this disease in the Korean population.
Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu
1998-01-01
The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.
Wu, Dandan; Chen, Yang; Xu, Chen; Wang, Ke; Wang, Huijun; Zheng, Fengyun; Ma, Duan; Wang, Guomin
2013-01-01
Velocardiofacial syndrome (VCFS) is a disease in human with an expansive phenotypic spectrum and diverse genetic mechanisms mainly associated with copy number variations (CNVs) on 22q11.2 or other chromosomes. However, the correlations between CNVs and phenotypes remain ambiguous. This study aims to analyze the types and sizes of CNVs in VCFS patients, to define whether correlations exist between CNVs and clinical manifestations in Chinese VCFS patients. In total, 55 clinically suspected Chinese VCFS patients and 100 normal controls were detected by multiplex ligation-dependent probe amplification (MLPA). The data from MLPA and all the detailed clinical features of the objects were documented and analyzed. A total of 44 patients (80.0%) were diagnosed with CNVs on 22q11.2. Among them, 43 (78.2%) presented with 22q11.2 heterozygous deletions, of whom 40 (93.0%) had typical 3-Mb deletion, and 3 (7.0%) exhibited proximal 1.5-Mb deletion; no patient was found with atypical deletion on 22q11.2. One patient (1.8%) presented with a 3-Mb duplication mapping to the typical 3-Mb region on 22q11.2, while none of the chromosomal abnormalities in the MLPA kit were found in the other 11 patients and 100 normal controls. All the 43 patients with 22q11.2 deletions displayed characteristic face and palatal anomalies; 37 of them (86.0%) had cognitive or behavioral disorders, and 23 (53.5%) suffered from immune deficiencies; 10 patients (23.3%) manifested congenital heart diseases. Interestingly, all patients with the characteristic face had 22q11.2 heterozygous deletions, but no difference in phenotypic spectrum was observed between 3-Mb and 1.5-Mb deletions. Our data suggest that the characteristic face can be used as a key indicator for direct diagnosis of 22q11.2 deletions in Chinese VCFS patients.
Exon duplications in the ATP7A gene
DEFF Research Database (Denmark)
Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko
2011-01-01
the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...
A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3
Directory of Open Access Journals (Sweden)
Stefanie Lehner
2018-02-01
Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.
The -(α)(5.2) Deletion Detected in a Uruguayan Family: First Case Report in the Americas.
Soler, Ana María; Schelotto, Magdalena; de Oliveira Mota, Natalia; Dorta Ferreira, Roberta; Sonati, Maria de Fatima; da Luz, Julio Abayubá
2016-08-01
In Uruguay, α-thalassemia (α-thal) mutations were introduced predominantly by Mediterranean European immigrant populations and by slave trade of African populations. A patient with anemia with hypochromia and microcytosis, refractory to iron treatment and with normal hemoglobin (Hb) electrophoresis was analyzed for α-thal mutations by multiplex gap-polymerase chain reaction (gap-PCR), automated sequencing and multiplex ligation-dependent probe amplification (MLPA) analyses. Agarose gel electrophoresis of the multiplex gap-PCR showed a band of unexpected size (approximately 700 bp) in the samples from the proband and mother. Automated sequencing of the amplified fragment showed the presence of the -(α)(5.2) deletion (NG_000006.1: g.32867_38062del5196) [an α-thal-1 deletion of 5196 nucleotides (nts)]. The MLPA analysis of the proband's sample also showed the presence of the -(α)(5.2) deletion in heterozygous state. We report here the presence of the -(α)(5.2) deletion, for the first time in the Americas, in a Uruguayan family with Italian ancestry, detected with a previously described multiplex gap-PCR.
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J
2004-01-01
Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel
Long segment ileal duplication with extensive gastric heterotopia
Directory of Open Access Journals (Sweden)
Jacob Sunitha
2009-07-01
Full Text Available Duplications of the alimentary tract are rare congenital anomalies which can be found at all levels of the alimentary tract. Majority of the duplications present as spherical cysts and usually range from a few millimeters to less than ten centimeters in size. Duplications produce complications such as intestinal obstruction or hemorrhage. A two-month-old infant presented with recurrent episodes of bleeding per rectum. Laparotomy revealed a giant ileal duplicated bowel segment which exhibited extensive gastric heterotopia with focal ulceration.
Bi, Weimin; Cheung, Sau-Wai; Breman, Amy M; Bacino, Carlos A
2016-10-01
Deletions in the 4p16.3 region cause Wolf-Hirschhorn syndrome, a well known contiguous microdeletion syndrome with the critical region for common phenotype mapped in WHSCR2. Recently, duplications in 4p16.3 were reported in three patients with developmental delay and dysmorphic features. Through chromosomal microarray analysis, we identified 156 patients with a deletion (n = 109) or duplication (n = 47) in 4p16.3 out of approximately 60,000 patients analyzed by Baylor Miraca Genetics Laboratories. Seventy-five of the postnatally detected deletions encompassed the entire critical region, 32 (43%) of which were associated with other chromosome rearrangements, including six patients (8%) that had a duplication adjacent to the terminal deletion. Our data indicate that Wolf-Hirschhorn syndrome deletions with an adjacent duplication occur at a higher frequency than previously appreciated. Pure deletions (n = 14) or duplications (n = 15) without other copy number changes distal to or inside the WHSCR2 were identified for mapping of critical regions. Our data suggest that deletion of the segment from 0.6 to 0.9 Mb from the terminus of 4p causes a seizure phenotype and duplications of a region distal to the previously defined smallest region of overlap for 4p16.3 microduplication syndrome are associated with neurodevelopmental problems. We detected seven Wolf-Hirschhorn syndrome deletions and one 4p16.3 duplication prenatally; all of the seven are either >8 Mb in size and/or associated with large duplications. In conclusion, our study provides deeper insight into the molecular mechanisms, the critical regions and effective prenatal diagnosis for 4p16.3 deletions/ duplications. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Finding all sorting tandem duplication random loss operations
DEFF Research Database (Denmark)
Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang
2011-01-01
A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...
Flipsen-ten Berg, Klara; van Hasselt, Peter M; Eleveld, Marc J; van der Wijst, Suzanne E; Hol, Frans A; de Vroede, Monique A M; Beemer, Frits A; Hochstenbach, P F Ron; Poot, Martin
2007-11-01
The Wolf-Hirschhorn syndrome (WHS (MIM 194190)), which is characterized by growth delay, mental retardation, epilepsy, facial dysmorphisms, and midline fusion defects, shows extensive phenotypic variability. Several of the proposed mutational and epigenetic mechanisms in this and other chromosomal deletion syndromes fail to explain the observed phenotypic variability. To explain the complex phenotype of a patient with WHS and features reminiscent of Wolfram syndrome (WFS (MIM 222300)), we performed extensive clinical evaluation and classical and molecular cytogenetic (GTG banding, FISH and array-CGH) and WFS1 gene mutation analyses. We detected an 8.3 Mb terminal deletion and an adjacent 2.6 Mb inverted duplication in the short arm of chromosome 4, which encompasses a gene associated with WFS (WFS1). In addition, a nonsense mutation in exon 8 of the WFS1 gene was found on the structurally normal chromosome 4. The combination of the 4p deletion with the WFS1 point mutation explains the complex phenotype presented by our patient. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletions represents an additional explanation for the phenotypic variability observed in chromosomal deletion disorders.
Generating Bona Fide Mammalian Prions with Internal Deletions.
Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel
2016-08-01
Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative
Directory of Open Access Journals (Sweden)
Dmitri J Gritsun
Full Text Available RNA secondary structures in the 3'untranslated regions (3'UTR of the viruses of the family Flaviviridae, previously identified as essential (promoters or beneficial (enhancers for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3'UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3'UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV. RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3'UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3'UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3'UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs.
Directory of Open Access Journals (Sweden)
Brian B Tuch
Full Text Available Due to growing throughput and shrinking cost, massively parallel sequencing is rapidly becoming an attractive alternative to microarrays for the genome-wide study of gene expression and copy number alterations in primary tumors. The sequencing of transcripts (RNA-Seq should offer several advantages over microarray-based methods, including the ability to detect somatic mutations and accurately measure allele-specific expression. To investigate these advantages we have applied a novel, strand-specific RNA-Seq method to tumors and matched normal tissue from three patients with oral squamous cell carcinomas. Additionally, to better understand the genomic determinants of the gene expression changes observed, we have sequenced the tumor and normal genomes of one of these patients. We demonstrate here that our RNA-Seq method accurately measures allelic imbalance and that measurement on the genome-wide scale yields novel insights into cancer etiology. As expected, the set of genes differentially expressed in the tumors is enriched for cell adhesion and differentiation functions, but, unexpectedly, the set of allelically imbalanced genes is also enriched for these same cancer-related functions. By comparing the transcriptomic perturbations observed in one patient to his underlying normal and tumor genomes, we find that allelic imbalance in the tumor is associated with copy number mutations and that copy number mutations are, in turn, strongly associated with changes in transcript abundance. These results support a model in which allele-specific deletions and duplications drive allele-specific changes in gene expression in the developing tumor.
Cridland, Julie M; Thornton, Kevin R
2010-01-13
Several recent studies have focused on the evolution of recently duplicated genes in Drosophila. Currently, however, little is known about the evolutionary forces acting upon duplications that are segregating in natural populations. We used a high-throughput, paired-end sequencing platform (Illumina) to identify structural variants in a population sample of African D. melanogaster. Polymerase chain reaction and sequencing confirmation of duplications detected by multiple, independent paired-ends showed that paired-end sequencing reliably uncovered the break points of structural rearrangements and allowed us to identify a number of tandem duplications segregating within a natural population. Our confirmation experiments show that rates of confirmation are very high, even at modest coverage. Our results also compare well with previous studies using microarrays (Emerson J, Cardoso-Moreira M, Borevitz JO, Long M. 2008. Natural selection shapes genome wide patterns of copy-number polymorphism in Drosophila melanogaster. Science. 320:1629-1631. and Dopman EB, Hartl DL. 2007. A portrait of copy-number polymorphism in Drosophila melanogaster. Proc Natl Acad Sci U S A. 104:19920-19925.), which both gives us confidence in the results of this study as well as confirms previous microarray results.We were also able to identify whole-gene duplications, such as a novel duplication of Or22a, an olfactory receptor, and identify copy-number differences in genes previously known to be under positive selection, like Cyp6g1, which confers resistance to dichlorodiphenyltrichloroethane. Several "hot spots" of duplications were detected in this study, which indicate that particular regions of the genome may be more prone to generating duplications. Finally, population frequency analysis of confirmed events also showed an excess of rare variants in our population, which indicates that duplications segregating in the population may be deleterious and ultimately destined to be lost from the
Zmienko, Agnieszka; Samelak-Czajka, Anna; Kozlowski, Piotr; Szymanska, Maja; Figlerowicz, Marek
2016-11-08
Intraspecies copy number variations (CNVs), defined as unbalanced structural variations of specific genomic loci, ≥1 kb in size, are present in the genomes of animals and plants. A growing number of examples indicate that CNVs may have functional significance and contribute to phenotypic diversity. In the model plant Arabidopsis thaliana at least several hundred protein-coding genes might display CNV; however, locus-specific genotyping studies in this plant have not been conducted. We analyzed the natural CNVs in the region overlapping MSH2 gene that encodes the DNA mismatch repair protein, and AT3G18530 and AT3G18535 genes that encode poorly characterized proteins. By applying multiplex ligation-dependent probe amplification and droplet digital PCR we genotyped those genes in 189 A. thaliana accessions. We found that AT3G18530 and AT3G18535 were duplicated (2-14 times) in 20 and deleted in 101 accessions. MSH2 was duplicated in 12 accessions (up to 12-14 copies) but never deleted. In all but one case, the MSH2 duplications were associated with those of AT3G18530 and AT3G18535. Considering the structure of the CNVs, we distinguished 5 genotypes for this region, determined their frequency and geographical distribution. We defined the CNV breakpoints in 35 accessions with AT3G18530 and AT3G18535 deletions and tandem duplications and showed that they were reciprocal events, resulting from non-allelic homologous recombination between 99 %-identical sequences flanking these genes. The widespread geographical distribution of the deletions supported by the SNP and linkage disequilibrium analyses of the genomic sequence confirmed the recurrent nature of this CNV. We characterized in detail for the first time the complex multiallelic CNV in Arabidopsis genome. The region encoding MSH2, AT3G18530 and AT3G18535 genes shows enormous variation of copy numbers among natural ecotypes, being a remarkable example of high Arabidopsis genome plasticity. We provided the molecular
Directory of Open Access Journals (Sweden)
Taro Tsujimura
2010-12-01
Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.
Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva
2013-01-01
Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.
Directory of Open Access Journals (Sweden)
Fernando Martínez-Alberola
Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.
Demura, Masashi; Takeda, Yoshiyu; Yoneda, Takashi; Furukawa, Kenji; Usukura, Mikiya; Itoh, Yuji; Mabuchi, Hiroshi
2002-01-01
Study of two families containing individuals with nephrogenic diabetes insipidus (NDI) indicated different types of 21.3 kb and 26.3 kb deletions involving the AVPR2 and ARHGAP4 (RhoGAP C1) genes. In the case of the 21.3 kb deletion, the deletion consensus motif (5'-TGAAGG-3') and polypurine runs, known as the arrest site of polymerase alpha, were detected in the vicinity of the deletion junction. Inverted repeats (7/8 matches), believed to potentiate DNA loop formation, flank the deletion breakpoint. We propose this deletion to be the result of slipped mispairing during DNA replication. In the case of the 26.3 kb deletion, the 12,945 bp inverted region with the 10,003 bp internal deletion was accompanied with the 2,509 bp deletion in the 5'-side and the 13,785 bp deletion in the 3'-side. We defined three deletion junctions in this rearrangement (DJ1, DJ2, and DJ3) from the 5'-side. The surrounding sequence of DJ1 (5'-CCC-3') closely resembled that of DJ3 (5'-AGGG-3') (DJ1; 5'-cCCCgaggg-3', DJ3; 5'-ccccAGGG-3'), and DJ1 was located in the 5'-side of DJ3 without any overlapping in sequence. The immunoglobulin class switch (ICS) motif (5'-TGGGG-3') was found around the complementary sequence of DJ3. There was a 10-base palindrome (5'-aGACAtgtct-3') in the alignment of the DJ2 (5'-GACA-3') region. From these findings, we propose a novel mutation process with the rearrangement probably resulting from stem-loop induced non-homologous recombination in an ICS-like fashion. Both patients, despite lacking ARHGAP4, had no morphological, clinical, or laboratory abnormalities except for those usually found in patients with NDI. Copyright 2001 Wiley-Liss, Inc.
An intronic deletion in the PROM1 gene leads to autosomal recessive cone-rod dystrophy.
Eidinger, Osnat; Leibu, Rina; Newman, Hadas; Rizel, Leah; Perlman, Ido; Ben-Yosef, Tamar
2015-01-01
To investigate the genetic basis for autosomal recessive cone-rod dystrophy (CRD) in a consanguineous Israeli Jewish family. Patients underwent a detailed ophthalmic evaluation, including eye examination, visual field testing, optical coherence tomography (OCT), and electrophysiological tests, electroretinography (ERG) and visual evoked potential (VEP). Genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array was performed to identify homozygous regions shared among two of the affected individuals. Mutation screening of the underlying gene was performed with direct sequencing. In silico and in vitro analyses were used to predict the effect of the identified mutation on splicing. The affected family members are three siblings who have various degrees of progressive visual deterioration, glare, color vision abnormalities, and night vision difficulties. Visual field tests revealed central scotomas of different extension. Cone and rod ERG responses were reduced, with cones more severely affected. Homozygosity mapping revealed several homozygous intervals shared among two of the affected individuals. One included the PROM1 gene. Sequence analysis of the 26 coding exons of PROM1 in one affected individual revealed no mutations in the coding sequence or in intronic splice sites. However, in intron 21, proximate to the intron-exon junction, we observed a homozygous 10 bp deletion between positions -26 and -17 (c.2281-26_-17del). The deletion was linked to a known SNP, c.2281-6C>G. The deletion cosegregated with the disease in the family, and was not detected in public databases or in 101 ethnically-matched control individuals. In silico analysis predicted that this deletion would lead to altered intron 21 splicing. Bioinformatic analysis predicted that a recognition site for the SRSF2 splicing factor is located within the deleted sequence. The in vitro splicing assay demonstrated that c.2281-26_-17del leads to complete exon 22 skipping. A novel
Embryonic duplications in sheep.
Dennis, S M
1975-02-01
Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.
Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene
Directory of Open Access Journals (Sweden)
Shomron Noam
2007-11-01
Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.
Prevalence of lower extremity venous duplication
Directory of Open Access Journals (Sweden)
Simpson William
2010-01-01
Full Text Available Purpose: This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center. Materials and Methods: The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded. Results: A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664 had at least one venous segment duplicated and 5.4% of patients (143/2664 had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664 had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353 had the same venous segment(s seen on one examination but not another. Conclusion: Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis.
Patients Carrying 9q31.1-q32 Deletion Share Common Features with Cornelia de Lange Syndrome
Directory of Open Access Journals (Sweden)
Ruixue Cao
2015-01-01
Full Text Available Background: Cornelia de Lange Syndrome (CdLS is a rare but severe clinically heterogeneous developmental disorder characterized by facial dysmorphia, growth and cognitive retardation, and abnormalities of limb development. Objectives: To determine the pathogenesis of a patient with CdLS. Methods: We studied a patient with CdLS by whole exome sequencing, karyotyping and Agilent CGH Array. The results were confirmed by quantitative real-time PCR analysis of the patient and her parents. Further comparison of our patient and cases with partially overlapping deletions retrieved from the literature and databases was undertaken. Results: Whole exome sequencing had excluded the mutation of cohesion genes such as NIPBL,SMC1A and SMC3. The result of karyotyping showed a deletion of chromosome 9q31.1-q32 and the result of Agilent CGH Array further displayed a 12.01-Mb region of deletion at chromosome bands 9q31.1-q32. Reported cases with the deletion of 9q31.1-q32 share similar features with our CdLS patient. One of the genes in the deleted region, SMC2, belongs to the Structural Maintenance of Chromosomes (SMC family and regulates gene expression and DNA repair. Conclusions: Patients carrying the deletion of 9q31.1-q32 showed similar phenotypes with CdLS.
International Nuclear Information System (INIS)
Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.
1987-01-01
Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase)], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions
Complete cloacal duplication imaged before and during pregnancy.
Ragab, Omar; Landay, Melanie; Shriki, Jabi
2009-01-01
The authors describe a 31 year-old female who presented emergently with abdominal pain and was found at CT to have complete genitourinary duplication including separate urinary bladders, uteri, cervices, and vaginas, and also duplication of the rectum. No etiology for abdominal pain was identified. The patient was referred to urology for further evaluation, and an intravenous urographic study was obtained, which confirmed complete lower urinary tract duplication. The patient presented emergently 9 months later during a subsequent pregnancy for further evaluation of abdominal pain. A second CT scan was ordered to rule out appendicitis. Findings consistent with cloacal duplication were again noted. There was also dilatation of the urinary collecting systems, more prominently on the right side. A Cesarean section was performed and confirmed total genitourinary and rectal duplication.
Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.
2016-01-01
The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025
A recombinant E1-deleted porcine adenovirus-3 as an expression vector
International Nuclear Information System (INIS)
Zakhartchouk, Alexander; Zhou Yan; Tikoo, Suresh Kumar
2003-01-01
Replication-defective E1-deleted porcine adenoviruses (PAVs) are attractive vectors for vaccination. As a prerequisite for generating PAV-3 vectors containing complete deletion of E1, we transfected VIDO R1 cells (fetal porcine retina cells transformed with E1 region of human adenovirus 5) with a construct containing PAV-3 E1B large coding sequences under the control of HCMV promoter. A cell line named VR1BL could be isolated that expressed E1B large of PAV-3 and also complemented PAV214 (E1A+E1B small deleted). The VR1BL cells could be efficiently transfected with DNA and allowed the rescue and propagation of recombinant PAV507 containing a triple stop codon inserted in the E1B large coding sequence. In addition, recombinant PAV227 containing complete deletion of E1 (E1A+E1B small + E1B large ) could be successfully rescued using VR1BL cell line. Recombinant PAV227 replicated as efficiently as wild-type in VR1BL cells but not in VIDO R1 cells, suggesting that E1B large was essential for replication of PAV-3. Next, we constructed recombinant PAV219 by inserting green fluorescent (GFP) protein gene flanked by a promoter and a poly(A) in the E1 region of the PAV227 genome. We demonstrated that PAV219 was able to transduce and direct expression of GFP in some human cell lines
An unusual presentation of a rectal duplication cyst.
Jackson, Katharine L; Peche, William J; Rollins, Michael D
2012-01-01
Intestinal duplications are rare developmental anomalies that can occur anywhere along the gastrointestinal tract. Rectal duplication cysts account for approximately 4% of all duplication cysts. They usually present in childhood with symptoms of mass effect, local infection or more rarely with rectal bleeding from ectopic gastric mucosa. A 26year old male presented with a history of bright red blood per rectum. On examination a mucosal defect with an associated cavity adjacent to the rectum was identified. This was confirmed with rigid proctoscopy and CT scan imaging. A complete transanal excision was performed. Rectal duplication cysts are more common in pediatric patients. They more frequently present with symptoms of mass effect or local infection than with rectal bleeding. In adult patients they are a rare cause of rectal bleeding. Definitive treatment is with surgical excision. A transanal, transcoccygeal, posterior sagittal or a combined abdominoperineal approach may be used depending on anatomic characteristics of the duplication cyst. We present a rare case of a rectal duplication cyst presenting in adulthood with rectal bleeding, managed with transanal excision. Published by Elsevier Ltd.
[Rectal duplication cyst--case report].
Turyna, R; Horák, L; Kucera, E; Hejda, V; Krofta, L; Feyereisl, J
2009-06-01
The authors demonstrate a rare case of duplication anomaly of the rectum. Case report. Institute for the Care of Mother and Child, Prague. We present a rare case of cystic rectal duplication in adult, completely removed and histologically confirmed. A literature review was summarized. The case was complicated by delay in diagnosis, multiple operations, and by the association with endometriosis, as well. Mentioned anomaly is published in the Czech literature for the very first time.
Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi
2016-05-24
Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.
22q11.2 deletion carriers and schizophrenia-associated novel variants.
Balan, S; Iwayama, Y; Toyota, T; Toyoshima, M; Maekawa, M; Yoshikawa, T
2014-01-01
The penetrance of schizophrenia risk in carriers of the 22q11.2 deletion is high but incomplete, suggesting the possibility of additional genetic defects. We performed whole exome sequencing on two individuals with 22q11.2 deletion, one with schizophrenia and the other who was psychosis-free. The results revealed novel genetic variants related to neuronal function exclusively in the person with schizophrenia (frameshift: KAT8, APOH and SNX31; nonsense: EFCAB11 and CLVS2). This study paves the way towards a more complete understanding of variant dose and genetic architecture in schizophrenia.
Duplicate Record Elimination in Large Data Files.
1981-08-01
UNCLASSIFIJED CSTR -445 NL LmEE~hhE - I1.0 . 111112----5 1.~4 __112 ___IL25_ 1.4 111111.6 EI24 COMPUTER SCIENCES DEPARTMENT oUniversity of Wisconsin...we propose a combinatorial model for the use in the analysis of algorithms for duplicate elimination. We contend that this model can serve as a...duplicates in a multiset of records, knowing the size of the multiset and the number of distinct records in it. 3. Algorithms for Duplicate Elimination
Epilepsy and outcome in FOXG1-related disorders
Seltzer, Laurie E.; Ma, Mandy; Ahmed, Sohnee; Bertrand, Mary; Dobyns, William B.; Wheless, James; Paciorkowski, Alex R.
2014-01-01
Summary Objective FOXG1-related disorders are associated with severe intellectual disability, absent speech with autistic features, and epilepsy. Children with deletions or intragenic mutations of FOXG1 also have postnatal microcephaly, morphologic abnormalities of the corpus callosum, and choreiform movements. Duplications of 14q12 often present with infantile spasms, and have subsequent intellectual disability with autistic features. Long term epilepsy outcome and response to treatment has not been studied systematically in a well-described cohort of subjects with FOXG1-related disorders. We report on the epilepsy features and developmental outcome of 23 new subjects with deletions or intragenic mutations of FOXG1, and 7 subjects with duplications. Methods Subjects had either chromosomal microarray or FOXG1 gene sequencing performed as part of routine clinical care. Development and epilepsy follow-up data were collected from medical records from treating neurologists and through telephone parental interviews using standardized questionnaires. Results Epilepsy was diagnosed in 87% of the subjects with FOXG1-related disorders. The mean age of epilepsy diagnosis in FOXG1 duplications was significantly younger than those with deletions/intragenic mutations (p=0.0002). All of the duplication FOXG1 children with infantile spasms responded to hormonal therapy and only one required long-term anti-epileptic therapy. In contrast, more children with deletions/intragenic mutations required anti-epileptic drugs on follow-up (p<0.0005). All subjects with FOXG1-related disorders had neurodevelopmental disabilities after 3 years of age, regardless of the epilepsy type or intractability of seizures. All had impaired verbal language and social contact, and three duplication subjects were formally diagnosed with autism. Subjects with deletion/intragenic mutations however had significantly worse ambulation (p=0.04) and functional hand use (p<0.0005). Significance Epilepsy and
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Aguiar, Derek; Halldórsson, Bjarni V.; Morrow, Eric M.; Istrail, Sorin
2012-01-01
Motivation: The understanding of the genetic determinants of complex disease is undergoing a paradigm shift. Genetic heterogeneity of rare mutations with deleterious effects is more commonly being viewed as a major component of disease. Autism is an excellent example where research is active in identifying matches between the phenotypic and genomic heterogeneities. A considerable portion of autism appears to be correlated with copy number variation, which is not directly probed by single nucleotide polymorphism (SNP) array or sequencing technologies. Identifying the genetic heterogeneity of small deletions remains a major unresolved computational problem partly due to the inability of algorithms to detect them. Results: In this article, we present an algorithmic framework, which we term DELISHUS, that implements three exact algorithms for inferring regions of hemizygosity containing genomic deletions of all sizes and frequencies in SNP genotype data. We implement an efficient backtracking algorithm—that processes a 1 billion entry genome-wide association study SNP matrix in a few minutes—to compute all inherited deletions in a dataset. We further extend our model to give an efficient algorithm for detecting de novo deletions. Finally, given a set of called deletions, we also give a polynomial time algorithm for computing the critical regions of recurrent deletions. DELISHUS achieves significantly lower false-positive rates and higher power than previously published algorithms partly because it considers all individuals in the sample simultaneously. DELISHUS may be applied to SNP array or sequencing data to identify the deletion spectrum for family-based association studies. Availability: DELISHUS is available at http://www.brown.edu/Research/Istrail_Lab/. Contact: Eric_Morrow@brown.edu and Sorin_Istrail@brown.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22689755
Files synchronization from a large number of insertions and deletions
Ellappan, Vijayan; Kumari, Savera
2017-11-01
Synchronization between different versions of files is becoming a major issue that most of the applications are facing. To make the applications more efficient a economical algorithm is developed from the previously used algorithm of “File Loading Algorithm”. I am extending this algorithm in three ways: First, dealing with non-binary files, Second backup is generated for uploaded files and lastly each files are synchronized with insertions and deletions. User can reconstruct file from the former file with minimizing the error and also provides interactive communication by eliminating the frequency without any disturbance. The drawback of previous system is overcome by using synchronization, in which multiple copies of each file/record is created and stored in backup database and is efficiently restored in case of any unwanted deletion or loss of data. That is, to introduce a protocol that user B may use to reconstruct file X from file Y with suitably low probability of error. Synchronization algorithms find numerous areas of use, including data storage, file sharing, source code control systems, and cloud applications. For example, cloud storage services such as Drop box synchronize between local copies and cloud backups each time users make changes to local versions. Similarly, synchronization tools are necessary in mobile devices. Specialized synchronization algorithms are used for video and sound editing. Synchronization tools are also capable of performing data duplication.
A case report of Ileal duplication
Energy Technology Data Exchange (ETDEWEB)
Oh, K K; Suh, J H; Choi, B S [Yonsei University College of Medicine, Seoul (Korea, Republic of)
1971-10-15
Since Frankel reported the congenital anomalous intestinal duplication incidentally during autopsy in 1883, about 228 cases has been reported on the literatures. In our severance hospital, one case of ileal duplication was found, and was confirmed by pathology and surgery. This patient of duplication usually reveals the symptoms of abnormal distension, pain and palpable abdominal mass, and sometimes the symptoms of intestinal obstruction. On x-ray flate abdomen, huge occupying mass displaces intestinal gas pattern to left side. Barium enema study reveals elongation and displacement of ileum by large extrinsic mass. And cecum is also displaced upward. On the IVP, this extrinsic mass is not related to kidneys. Also, the literature was reviewed.
Omar, Aimi Farehah; Ismail, Ismanizan
2016-11-01
Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.
Saski, Christopher; Lee, Seung-Bum; Fjellheim, Siri; Guda, Chittibabu; Jansen, Robert K.; Luo, Hong; Tomkins, Jeffrey; Rognli, Odd Arne; Clarke, Jihong Liu
2009-01-01
Comparisons of complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera to six published grass chloroplast genomes reveal that gene content and order are similar but two microstructural changes have occurred. First, the expansion of the IR at the SSC/IRa boundary that duplicates a portion of the 5′ end of ndhH is restricted to the three genera of the subfamily Pooideae (Agrostis, Hordeum and Triticum). Second, a 6 bp deletion in ndhK is shared by Agrostis, Hordeum, Oryza and Triticum, and this event supports the sister relationship between the subfamilies Erhartoideae and Pooideae. Repeat analysis identified 19–37 direct and inverted repeats 30 bp or longer with a sequence identity of at least 90%. Seventeen of the 26 shared repeats are found in all the grass chloroplast genomes examined and are located in the same genes or intergenic spacer (IGS) regions. Examination of simple sequence repeats (SSRs) identified 16–21 potential polymorphic SSRs. Five IGS regions have 100% sequence identity among Zea mays, Saccharum officinarum and Sorghum bicolor, whereas no spacer regions were identical among Oryza sativa, Triticum aestivum, H. vulgare and A. stolonifera despite their close phylogenetic relationship. Alignment of EST sequences and DNA coding sequences identified six C–U conversions in both Sorghum bicolor and H. vulgare but only one in A. stolonifera. Phylogenetic trees based on DNA sequences of 61 protein-coding genes of 38 taxa using both maximum parsimony and likelihood methods provide moderate support for a sister relationship between the subfamilies Erhartoideae and Pooideae. PMID:17534593
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
Zhang, Z; Cavalier-Smith, T; Green, B R
2001-08-01
Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.
Suárez-Merino, B; Bye, J; McDowall, J; Ross, M; Craig, I W
2001-06-01
Mutations at the Norrie disease gene locus, NDP, manifest in a broad range of defects. These range from a relatively mild, late-onset, exudative vitreoretinopathy to congenital blindness and sensorineural deafness combined, in some cases, with mental retardation. In addition, extensive deletions involving the NDP locus, located at Xp11.3, the adjacent monoamine oxidadase genes MAOA and MAOB, and additional material, result in a more severe pattern of symptoms. The phenotypes include all or some of the following; mental retardation, involuntary movements, hypertensive crises and hypogonadism. We extended an existing YAC contig to embrace the boundaries of three of the largest deletions and converted this into four PAC contigs. Computer analysis and experimental data have resulted in the identification of several putative loci, including a phosphatase inhibitor 2-like gene (dJ154.1) and a 250-bp sequence which resembles a homeobox domain (dA113.3), 1.2 Mb and 400 kb respectively from the MAO/NDP cluster. The pattern of expression of dJ154.1 suggests that it may represent an important factor contributing to the complex phenotypes of these deletion patients. Hum Mutat 17:523, 2001. Copyright 2001 Wiley-Liss, Inc.
Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.
Möller, M; Hellberg, Å; Olsson, M L
2018-02-01
ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.
Duplication of Key Frames of Video Streams in Wireless Networks
Sagatov, Evgeny S.; Sukhov, Andrei M.
2011-01-01
In this paper technological solutions for improving the quality of video transfer along wireless networks are investigated. Tools have been developed to allow packets to be duplicated with key frames data. In the paper we tested video streams with duplication of all frames, with duplication of key frames, and without duplication. The experiments showed that the best results are obtained by duplication of packages which contain key frames. The paper also provides an overview of the coefficient...
Lorenzon, S; Wesonga, H; Ygesu, Laikemariam; Tekleghiorgis, Tesfaalem; Maikano, Y; Angaya, M; Hendrikx, P; Thiaucourt, F
2002-03-01
Contagious caprine pleuropneumonia (CCPP) is a major threat to goat farming in developing countries. Its exact distribution is not well known, despite the fact that new diagnostic tools such as PCR and competitive ELISA are now available. The authors developed a study of the molecular epidemiology of the disease, based on the amplification of a 2400 bp long fragment containing two duplicated gene coding for a putative membrane protein. The sequence of this fragment, obtained on 19 Mycoplasma capricolum subsp. capripneumoniae (Mccp) strains from various geographical locations, gave 11 polymorphic positions. The three mutations found on gene H2prim were silent and did not appear to induce any amino acid modifications in the putative translated protein. The second gene may be a pseudogene not translated in vivo, as it bore a deletion of the ATG codon found in the other members of the "Mycoplasma mycoides cluster" and as the six mutations evidenced in the Mccp strains would induce modifications in the translated amino acids. In addition, an Mccp strain isolated in the United Arab Emirates showed a deletion of the whole pseudogene, a further indication that this gene is not compulsory for mycoplasma growth. Four lineages were defined, based on the nucleotide sequence. These correlated relatively well with the geographical origin of the strains: North, Central or East Africa. The strain of Turkish origin had a sequence similar to that found in North African strains, while strains isolated in Oman had sequences similar to those of North or East African strains. The latter is possibly due to the regular import of goats of various origins. Similar molecular epidemiology tools have been developed by sequencing the two operons of the 16S rRNA gene or by AFLP. All these various techniques give complementary results. One (16S rRNA) offers the likelihood of a finer identification of strains circulating in a region, another (H2) of determining the geographical origin of the
Genomic deletion of a long-range bone enhancer misregulatessclerostin in Van Buchem disease
Energy Technology Data Exchange (ETDEWEB)
Loots, Gabriela G.; Kneissel, Michaela; Keller, Hansjoerg; Baptist, Myma; Chang, Jessie; Collette, Nicole M.; Ovcharenko, Dmitriy; Plajzer-Frick, Ingrid; Rubin, Edward M.
2005-04-15
Mutations in distant regulatory elements can negatively impact human development and health, yet due to the difficulty of detecting these critical sequences we predominantly focus on coding sequences for diagnostic purposes. We have undertaken a comparative sequence-based approach to characterize a large noncoding region deleted in patients affected by Van Buchem disease (VB), a severe sclerosing bone dysplasia. Using BAC recombination and transgenesis we characterized the expression of human sclerostin (sost) from normal (hSOSTwt) or Van Buchem(hSOSTvb D) alleles. Only the hSOSTwt allele faithfully expressed high levels of human sost in the adult bone and impacted bone metabolism, consistent with the model that the VB noncoding deletion removes a sost specific regulatory element. By exploiting cross-species sequence comparisons with in vitro and in vivo enhancer assays we were able to identify a candidate enhancer element that drives human sost expression in osteoblast-like cell lines in vitro and in the skeletal anlage of the E14.5 mouse embryo, and discovered a novel function for sclerostin during limb development. Our approach represents a framework for characterizing distant regulatory elements associated with abnormal human phenotypes.
Partial craniofacial duplication: a review of the literature and case report.
Costa, Melinda A; Borzabadi-Farahani, Ali; Lara-Sanchez, Pedro A; Schweitzer, Daniela; Jacobson, Lia; Clarke, Noreen; Hammoudeh, Jeffery; Urata, Mark M; Magee, William P
2014-06-01
Diprosopus (Greek; di-, "two" + prosopon, "face"), or craniofacial duplication, is a rare craniofacial anomaly referring to the complete duplication of facial structures. Partial craniofacial duplication describes a broad spectrum of congenital anomalies, including duplications of the oral cavity. This paper describes a 15 month-old female with a duplicated oral cavity, mandible, and maxilla. A Tessier type 7 cleft, midline meningocele, and duplicated hypophysis were also present. The preoperative evaluation, surgical approach, postoperative results, and a review of the literature are presented. The surgical approach was designed to preserve facial nerve innervation to the reconstructed cheek and mouth. The duplicated mandible and maxilla were excised and the remaining left maxilla was bone grafted. Soft tissue repair included closure of the Tessier type VII cleft. Craniofacial duplication remains a rare entity that is more common in females. The pathophysiology remains incompletely characterized, but is postulated to be due to duplication of the notochord, as well as duplication of mandibular growth centres. While diprosopus is a severe deformity often associated with anencephaly, patients with partial duplication typically benefit from surgical treatment. Managing craniofacial duplication requires a detailed preoperative evaluation as well as a comprehensive, staged treatment plan. Long-term follow up is needed appropriately to address ongoing craniofacial deformity. Published by Elsevier Ltd.
Rectal duplication cyst presenting as rectal prolapse in an infant
Directory of Open Access Journals (Sweden)
Maher Zaiem
2018-05-01
Full Text Available Rectal duplication is a rare variety of gastrointestinal duplication. It accounts 4% of the total gastrointestinal duplications.In this paper, we are reporting a case of an 8 months old male who presented with rectal prolapse. Digital rectal examination revealed a soft mass bulging through the posterior wall of rectum. Computed tomography (CT scan showed a cystic mass compressing the posterior wall of the rectum. The mass was excised using a Muscle Complex Saving Posterior Sagittal approach (MCS-PSA. The pathology report confirmed the diagnosis of the rectal duplication cyst. The postoperative recovery was uneventful. Keywords: Intestinal duplication, Cystic rectal duplication, Rectal prolapse
Gritsun, Dmitri J.; Jones, Ian M.; Gould, Ernest A.; Gritsun, Tamara S.
2014-01-01
RNA secondary structures in the 3′untranslated regions (3′UTR) of the viruses of the family Flaviviridae, previously identified as essential (promoters) or beneficial (enhancers) for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3′UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3′UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV). RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3′UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3′UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3′UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs. PMID:24647143
Rath, M; Najm, J; Sirb, H; Kentouche, K; Dufke, A; Pauli, S; Hackmann, K; Liehr, T; Hübner, C A; Felbor, U
2015-01-01
Congenital factor VII (FVII) and factor X (FX) deficiencies belong to the group of rare bleeding disorders which may occur in separate or combined forms since both the F7 and F10 genes are located in close proximity on the distal long arm of chromosome 13 (13q34). We here present data of 192 consecutive index cases with FVII and/or FX deficiency. 10 novel and 53 recurrent sequence alterations were identified in the F7 gene and 5 novel as well as 11 recurrent in the F10 gene including one homozygous 4.35 kb deletion within F7 (c.64+430_131-6delinsTCGTAA) and three large heterozygous deletions involving both the F7 and F10 genes. One of the latter proved to be cytogenetically visible as a chromosome 13q34 deletion and associated with agenesis of the corpus callosum and psychomotor retardation. Large deletions play a minor but essential role in the mutational spectrum of the F7 and F10 genes. Copy number analyses (e. g. MLPA) should be considered if sequencing cannot clarify the underlying reason of an observed coagulopathy. Of note, in cases of combined FVII/FX deficiency, a deletion of the two contiguous genes might be part of a larger chromosomal rearrangement.
Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.
Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A
1996-11-01
Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and
Choi, Hwan-Won; Nam, Eeuri; Lee, Yoo Jin; Noh, Yun-Hee; Lee, Seung-Chul; Yoon, In-Joong; Kim, Hyun-Soo; Kang, Shien-Young; Choi, Young-Ki; Lee, Changhee
2014-06-04
Porcine reproductive and respiratory syndrome virus (PRRSV) is a globally ubiquitous swine virus that exhibits genetic and pathogenic heterogeneity among isolates. The present study was conducted to determine the complete genome sequence and pathogenicity of two Korean type 2 PRRSV nonstructural protein 2 (nsp2) deletion mutants, CA-2 and KNU-12-KJ4. The full-length genomes of CA-2 and KNU-12-KJ4 were determined to be 15,018 and 15,019 nucleotides in length, excluding the poly(A) tail, respectively, which were 393- or 392-nucleotide shorter than that of the type 2 NA prototype strain VR-2332 due to the presence of notable large deletions within the nsp2 gene. The genomes of CA-2 and KNU-12-KJ4 consisted of a 189- or 190-nucleotide 5' untranslated region (UTR), a 14,677-nucleotide protein-coding region, and a 151-nucleotide 3' UTR. Whole genome evaluation revealed that the nucleotide sequences of CA-2 and KNU-12-KJ4 are most similar to each other (10.7% sequence divergence), and then to the Korean strain CA-1 (11.3% sequence divergence) and the US strain MN184C (13.1% sequence divergence), respectively. To evaluate the in vitro immunity of nsp2 deletion variants, we sought to explore alteration of inflammatory cytokine and chemokine expression in PAM-pCD163 cells infected with each virus strain using quantitative real-time RT-PCR. Cytokine genes including IL-8, IL-10, and TNF-α, and chemokines such as MCP-1 and RANTES were found to be significantly elevated in nsp2 deletion virus-infected PAM cells. In contrast, expression of interferons (IFN-β, γ, and λ) and antiviral genes including ISG-15, -54, and -56 were unchanged or down-regulated in PAM cells infected with the nsp2 deletion mutants. Animal studies to assess the pathogenicity of nsp2 deletion PRRSVs demonstrated that both CA-2 and KNU-12-KJ4 strains notably produce weight loss in infected pigs. Furthermore, the nsp2 deletion mutants replicated well in pigs with significantly increased and prolonged
Zimowski, Janusz G; Massalska, Diana; Holding, Mariola; Jadczak, Sylwia; Fidziańska, Elżbieta; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Kamińska, Anna; Zaremba, Jacek
2014-01-01
Duchenne/Becker muscular dystrophy (DMD/BMD) is a recessive, X-linked disorder caused by a mutation in the dystrophin gene. Deletions account for approximately 60-65% of mutations, duplications for 5-10%. The remaining cases are mainly point mutations. According to Monaco theory clinical form of the disease depends on maintaining or disrupting the reading frame. The purpose of the study was to determine frequency and location of deletions and duplications in the dystrophin gene, to determine the compliance between maintaining/disrupting the reading frame and clinical form of the disease and to check the effectiveness of MLPA (multiplex ligation-dependent probe amplification) in the detection of these mutations in hemizygous patients and heterozygous female carriers. The material is composed of combined results of molecular diagnosis carried out in years 2009-2012 in 180 unrelated patients referred with the diagnosis of DMD/BMD tested by use of MLPA. We identified 110 deletions, 22 duplication (in one patient two different duplications were detected) and 2 point mutations. Deletions involved mainly exons 45-54 and 3-21, whereas most duplications involved exons 3-18. The compliance with Monaco theory was 95% for deletions and 76% for duplications. Most of mutations in the dystrophin gene were localized in the hot spots - different for deletions and duplications. MLPA enabled their quick identification, exact localization and determination whether or not they maintained or disrupted the reading frame. MLPA was also effective in detection of deletions and duplications in female carriers. Copyright © 2014 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
van der Kuyl, A. C.; Neeleman, L.; Bol, J. F.
1991-01-01
DNA copies of alfalfa mosaic virus (AIMV) RNA 3 were transcribed in vitro into RNA molecules with deletions in coding and noncoding sequences. The replication of these transcripts was studied in protoplasts from transgenic tobacco plants expressing DNA copies of AIMV RNAs 1 and 2. Deletions in the
Deletion of Indian hedgehog gene causes dominant semi-lethal Creeper trait in chicken
Jin, Sihua; Zhu, Feng; Wang, Yanyun; Yi, Guoqiang; Li, Junying; Lian, Ling; Zheng, Jiangxia; Xu, Guiyun; Jiao, Rengang; Gong, Yu; Hou, Zhuocheng; Yang, Ning
2016-01-01
The Creeper trait, a classical monogenic phenotype of chicken, is controlled by a dominant semi-lethal gene. This trait has been widely cited in the genetics and molecular biology textbooks for illustrating autosomal dominant semi-lethal inheritance over decades. However, the genetic basis of the Creeper trait remains unknown. Here we have utilized ultra-deep sequencing and extensive analysis for targeting causative mutation controlling the Creeper trait. Our results indicated that the deletion of Indian hedgehog (IHH) gene was only found in the whole-genome sequencing data of lethal embryos and Creeper chickens. Large scale segregation analysis demonstrated that the deletion of IHH was fully linked with early embryonic death and the Creeper trait. Expression analysis showed a much lower expression of IHH in Creeper than wild-type chickens. We therefore suggest the deletion of IHH to be the causative mutation for the Creeper trait in chicken. Our findings unravel the genetic basis of the longstanding Creeper phenotype mystery in chicken as the same gene also underlies bone dysplasia in human and mouse, and thus highlight the significance of IHH in animal development and human haploinsufficiency disorders. PMID:27439785
Thudi, Mahendar; Khan, Aamir W; Kumar, Vinay; Gaur, Pooran M; Katta, Krishnamohan; Garg, Vanika; Roorkiwal, Manish; Samineni, Srinivasan; Varshney, Rajeev K
2016-01-27
Chickpea (Cicer arietinum L.) is the second most important grain legume cultivated by resource poor farmers in South Asia and Sub-Saharan Africa. In order to harness the untapped genetic potential available for chickpea improvement, we re-sequenced 35 chickpea genotypes representing parental lines of 16 mapping populations segregating for abiotic (drought, heat, salinity), biotic stresses (Fusarium wilt, Ascochyta blight, Botrytis grey mould, Helicoverpa armigera) and nutritionally important (protein content) traits using whole genome re-sequencing approach. A total of 192.19 Gb data, generated on 35 genotypes of chickpea, comprising 973.13 million reads, with an average sequencing depth of ~10 X for each line. On an average 92.18 % reads from each genotype were aligned to the chickpea reference genome with 82.17 % coverage. A total of 2,058,566 unique single nucleotide polymorphisms (SNPs) and 292,588 Indels were detected while comparing with the reference chickpea genome. Highest number of SNPs were identified on the Ca4 pseudomolecule. In addition, copy number variations (CNVs) such as gene deletions and duplications were identified across the chickpea parental genotypes, which were minimum in PI 489777 (1 gene deletion) and maximum in JG 74 (1,497). A total of 164,856 line specific variations (144,888 SNPs and 19,968 Indels) with the highest percentage were identified in coding regions in ICC 1496 (21 %) followed by ICCV 97105 (12 %). Of 539 miscellaneous variations, 339, 138 and 62 were inter-chromosomal variations (CTX), intra-chromosomal variations (ITX) and inversions (INV) respectively. Genome-wide SNPs, Indels, CNVs, PAVs, and miscellaneous variations identified in different mapping populations are a valuable resource in genetic research and helpful in locating genes/genomic segments responsible for economically important traits. Further, the genome-wide variations identified in the present study can be used for developing high density SNP arrays for
International Nuclear Information System (INIS)
Sinnott, P.; Collier, S.; Dyer, P.A.; Harris, R.; Strachan, T.; Costigan, C.
1990-01-01
The HLA-linked human steroid 21-hydroxylase gene CYP21B and its closely homologous pseudogene CYP21A are each normally located centromeric to a fourth component of complement (C4) gene, C4B and C4A, respectively, in an organization suggesting tandem duplication of a ca. 30-kilobase DNA unit containing a CYP21 gene and a C4 gene. Such an organization has been considered to facilitate gene deletion and addition events by unequal crossover between the tandem repeats. The authors have identified a steroid 21-hydroxylase deficiency patient who has a maternally inherited disease haplotype that carries a de novo deletion of a ca. 30-kilobase repeat unit including the CYP21B gene and associated C4B gene. This disease haplotype appears to have been generated as a result of meiotic unequal crossover between maternal homologous chromosomes. One of the maternal haplotypes is the frequently occurring HLA-DR3,B8,A1 haplotype that normally carries a deletion of a ca. 30-kilobase unit including the CYP21A gene and C4A gene. Haplotypes of this type may possible act as premutations, increasing the susceptibility of developing a 21-hydroxylase deficiency mutation by facilitating unequal chromosome pairing
International Nuclear Information System (INIS)
Le Beau, M.M.; Epstein, N.D.; O'Brien, S.J.; Nienhuis, A.W.; Yang, Y.C.; Clark, S.C.; Rowley, J.D.
1987-01-01
The gene IL-3 encodes interleukin 3, a hematopoietic colony-stimulating factor (CSF) that is capable of supporting the proliferation of a broad range of hematopoietic cell types. By using somatic cell hybrids and in situ chromosomal hybridization, the authors localized this gene to human chromosome 5 at bands q23-31, a chromosomal region that is frequently deleted [del(5q)] in patients with myeloid disorders. By in situ hybridization, IL-3 was found to be deleted in the 5q-chromosome of one patient with refractory anemia who had a del(5)(q15q33.3), of three patients with refractory anemia (two patients) or acute nonlymphocytic leukemia (ANLL) de novo who had a similar distal breakpoint [del(5)(q13q33.3)], and of a fifth patient, with therapy-related ANLL, who had a similar distal breakpoint in band q33[del(5)(q14q33.3)]. Southern blot analysis of somatic cell hybrids retaining the normal or the deleted chromosome 5 from two patients with the refractory anemia 5q- syndrome indicated that IL-3 sequences were absent from the hybrids retaining the deleted chromosome 5 but not from hybrids that had a cytologically normal chromosome 5. Thus, a small segment of chromosome 5 contains IL-3, GM-CSF, CSF-1, and FMS. The findings and earlier results indicating that GM-CSF, CSF-1, and FMS were deleted in the 5q- chromosome, suggest that loss of IL-3 or of other CSF genes may play an important role in the pathogenesis of hematologic disorders associated with a del(5q)
Auger, Julie; Baptiste, Amandine; Benabbad, Imane; Thierry, Gaëlle; Costa, Jean-Marc; Amouyal, Mélanie; Kottler, Marie-Laure; Leheup, Bruno; Touraine, Renaud; Schmitt, Sébastien; Lebrun, Marine; Cormier Daire, Valérie; Bonnefont, Jean-Paul; de Roux, Nicolas; Elie, Caroline; Rosilio, Myriam
2016-01-01
The aim of our study was to describe a large population with anomalies involving the SHOX region, responsible for idiopathic short stature and Léri-Weill dyschondrosteosis (LWD), and to identify a possible genotype/phenotype correlation. We performed a retrospective multicenter study on French subjects with a SHOX region anomaly diagnosed by multiplex ligation-dependent probe amplification or Sanger sequencing. Phenotypes were collected in each of the 7 genetic laboratories practicing this technique for SHOX analysis. Among 205 index cases and 100 related cases, 91.3% had LWD. For index cases, median age at evaluation was 11.7 (9.0; 15.9) years and mean height standard deviation score was -2.3 ± 1.1. A deletion of either SHOX or PAR1 or both was found in 74% of patients. Duplications and point mutations/indels affected 8 and 18% of the population, respectively. Genotype-phenotype correlation showed that deletions were more frequently associated with Madelung deformity and mesomelic shortening in girls, as well as with presence of radiologic anomalies, than duplications. Our results highlight genotype-phenotype relationships in the French population with a SHOX defect and provide new information showing that clinical expression is milder in cases of duplication compared to deletions. © 2016 S. Karger AG, Basel.
Two novel deletions (array CGH findings) in pigment dispersion syndrome.
Mikelsaar, Ruth; Molder, Harras; Bartsch, Oliver; Punab, Margus
2007-12-01
We report the first male with pigment dispersion syndrome and a balanced translocation t(10;15)(p11.1;q11.1). Cytogenetic analyses using Giemsa banding and FISH methods, and array CGH were performed. Array CGH analyses did not show altered DNA sequences in the breakpoints of the translocation, but revealed two novel deletions in 2q22.1 and 18q22.1. We suppose that the coexistence of t(10;15) and pigment dispersion syndrome in our patient is a coincidence. The deletion in 2q22.1, where the gene LRP1B has been located, may play a major role in the dysembryogenesis of the eye and cause the disorder.
Spontaneous and mutagen-induced deletions: mechanistic studies in Salmonella tester strain TA102
International Nuclear Information System (INIS)
Levin, D.E.; Marnett, L.J.; Ames, B.N.
1984-01-01
Salmonella tester strain TA102 carries the hisG428 ochre mutation on the multicopy plasmid pAQ1. DNA sequence analysis of 45 spontaneous revertants of hisG428 on the chromosome in the presence of pKM101 (strain TA103) indicates that hisG428 revertants fall into three major categories: (i) small, in-frame deletions (3 or 6 base pairs) that remove part or all of the ochre triplet; (ii) base substitution mutations at the ochre site; (iii) extragenic ochre suppressors. Deletion revertants are identified in a simple phenotypic screen by their resistance to the inhibitory histidine analog thiazolealanine, which feedback inhibits the wild-type hisG enzyme but not the enzyme resulting from the deletions. The effect of various genetic backgrounds on the generation of spontaneous deletion revertants was examined. The presence of a uvrB mutation or a recA mutation suppressed the generation of spontaneous deletion revertants to approximately 1/2.5. When hisG428 was in multiple copies on pAQ1, the frequency of spontaneous deletion revertants increased by 40-fold, which is the approximate copy number of pAQ1. Mutagenic agents that induce single-strand breaks in DNA (e.g., x-rays, bleomycin, and nalidixic acid) induced deletion revertants in TA102. These agents induced deletion revertants only in hisG428 on pAQ1 and only in the presence of pKM101. Deletion revertants were not induced by frameshift mutagens (i.e., ICR-191 and 9aminoacridine). These results indicate that different pathways exist for the generation of spontaneous and mutagen-induced deletion revertants of hisG428. 41 references, 2 figures, 3 tables
DEFF Research Database (Denmark)
Piskur, Jure; Langkjær, Rikke Breinhold
2004-01-01
For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...
[Intestinal volvulus due to yeyunal duplication].
Rodríguez Iglesias, P; Carazo Palacios, M E; Lluna González, J; Ibáñez Pradas, V; Rodríguez Caraballo, L
2014-10-01
Duplications of the alimentary tract are congenital malformations. The ileum is the most commonly affected organ. A lot of duplications are incidentally diagnosed but most of patients present a combination of pain or complications such as obstructive symptoms, intestinal intussusception, perforation or volvulus. We report the case of a 6-years-old girl, with intermittent abdominal pain and vomits for two months long. Laboratory work was completely normal and in the radiology analysis (abdominal sonography and magnetic resonance) a cystic image with intestinal volvulus was observed. The patient underwent laparotomy, Ladd's procedure was done and the cyst was resected. In conclusion, if a patient is admitted with abdominal pain and obstructive symptoms, it is important to consider duplication of the alimentary tract as a possible diagnosis.
Surgical management of complete penile duplication accompanied by multiple anomalies.
Karaca, Irfan; Turk, Erdal; Ucan, A Basak; Yayla, Derya; Itirli, Gulcin; Ercal, Derya
2014-09-01
Diphallus (penile duplication) is very rare and seen once every 5.5 million births. It can be isolated, but is usually accompanied by other congenital anomalies. Previous studies have reported many concurrent anomalies, such as bladder extrophy, cloacal extrophy, duplicated bladder, scrotal abnormalities, hypospadias, separated symphysis pubis, intestinal anomalies and imperforate anus; no penile duplication case accompanied by omphalocele has been reported. We present the surgical management of a patient with multiple anomalies, including complete penile duplication, hypo-gastric omphalocele and extrophic rectal duplication.
Directory of Open Access Journals (Sweden)
Volfovsky Natalia
2009-01-01
Full Text Available Abstract Background Understanding structure and function of human genome requires knowledge of genomes of our closest living relatives, the primates. Nucleotide insertions and deletions (indels play a significant role in differentiation that underlies phenotypic differences between humans and chimpanzees. In this study, we evaluated distribution, evolutionary history, and function of indels found by comparing syntenic regions of the human and chimpanzee genomes. Results Specifically, we identified 6,279 indels of 10 bp or greater in a ~33 Mb alignment between human and chimpanzee chromosome 22. After the exclusion of those in repetitive DNA, 1,429 or 23% of indels still remained. This group was characterized according to the local or genome-wide repetitive nature, size, location relative to genes, and other genomic features. We defined three major classes of these indels, using local structure analysis: (i those indels found uniquely without additional copies of indel sequence in the surrounding (10 Kb region, (ii those with at least one exact copy found nearby, and (iii those with similar but not identical copies found locally. Among these classes, we encountered a high number of exactly repeated indel sequences, most likely due to recent duplications. Many of these indels (683 of 1,429 were in proximity of known human genes. Coding sequences and splice sites contained significantly fewer of these indels than expected from random expectations, suggesting that selection is a factor in limiting their persistence. A subset of indels from coding regions was experimentally validated and their impacts were predicted based on direct sequencing in several human populations as well as chimpanzees, bonobos, gorillas, and two subspecies of orangutans. Conclusion Our analysis demonstrates that while indels are distributed essentially randomly in intergenic and intronic genomic regions, they are significantly under-represented in coding sequences. There are
Kelsen, Judith R; Dawany, Noor; Martinez, Alejandro; Martinez, Alejuandro; Grochowski, Christopher M; Maurer, Kelly; Rappaport, Eric; Piccoli, David A; Baldassano, Robert N; Mamula, Petar; Sullivan, Kathleen E; Devoto, Marcella
2015-11-18
Children with very early-onset inflammatory bowel disease (VEO-IBD), those diagnosed at less than 5 years of age, are a unique population. A subset of these patients present with a distinct phenotype and more severe disease than older children and adults. Host genetics is thought to play a more prominent role in this young population, and monogenic defects in genes related to primary immunodeficiencies are responsible for the disease in a small subset of patients with VEO-IBD. We report a child who presented at 3 weeks of life with very early-onset inflammatory bowel disease (VEO-IBD). He had a complicated disease course and remained unresponsive to medical and surgical therapy. The refractory nature of his disease, together with his young age of presentation, prompted utilization of whole exome sequencing (WES) to detect an underlying monogenic primary immunodeficiency and potentially target therapy to the identified defect. Copy number variation analysis (CNV) was performed using the eXome-Hidden Markov Model. Whole exome sequencing revealed 1,380 nonsense and missense variants in the patient. Plausible candidate variants were not detected following analysis of filtered variants, therefore, we performed CNV analysis of the WES data, which led us to identify a de novo whole gene deletion in XIAP. This is the first reported whole gene deletion in XIAP, the causal gene responsible for XLP2 (X-linked lymphoproliferative Disease 2). XLP2 is a syndrome resulting in VEO-IBD and can increase susceptibility to hemophagocytic lymphohistocytosis (HLH). This identification allowed the patient to be referred for bone marrow transplantation, potentially curative for his disease and critical to prevent the catastrophic sequela of HLH. This illustrates the unique etiology of VEO-IBD, and the subsequent effects on therapeutic options. This cohort requires careful and thorough evaluation for monogenic defects and primary immunodeficiencies.
Endoscopic ultrasonography and rectal duplication cyst in an adult.
Castro-Poças, Fernando M; Araújo, Tarcísio P; Silva, Jorge D; Gonçalves, Vicente S
2017-01-01
Rectal duplication cysts account for 4% of all duplications of the alimentary tract. Presentation in adulthood is rare. An asymptomatic 54-year-old man was referred for endoscopic colorectal cancer screening. A bulging mass covered by normal mucosa was identified in the rectum. Endoscopic ultrasonography (EUS) with fine needle aspiration (FNA) was made for a diagnosis of rectal duplication cyst. The patient was operated and the diagnosis was confirmed. The diagnosis of the rectal duplication cyst is a challenge. EUS may have a singular role when identifying a muscular layer, because this is the only absolutely necessary criterion for the diagnosis. FNA by EUS may eventually identify colorectal and/or heterotypic epithelium that are the other diagnostic criteria of the duplication cyst.
Saveliev, S V; Cox, M M
1996-01-01
We provide a molecular description of key intermediates in the deletion of two internal eliminated sequences (IES elements), the M and R regions, during macronuclear development in Tetrahymena thermophila. Using a variety of PCR-based methods in vivo, double-strand breaks are detected that are generated by hydrolytic cleavage and correspond closely to the observed chromosomal junctions left behind in the macronuclei. The breaks exhibit a temporal and structural relationship to the deletion reaction that provides strong evidence that they are intermediates in the deletion pathway. Breaks in the individual strands are staggered by 4 bp, producing a four nucleotide 5' extension. Evidence is presented that breaks do not occur simultaneously at both ends. The results are most consistent with a deletion mechanism featuring initiation by double-strand cleavage at one end of the deleted element, followed by transesterification to generate the macronuclear junction on one DNA strand. An adenosine residue is found at all the nucleophilic 3' ends used in the postulated transesterification step. Evidence for the transesterification step is provided by detection of a 3' hydroxyl that would be liberated by such a step at a deletion boundary where no other DNA strand ends are detected. Images PMID:8654384
Finnerty, John R; Mazza, Maureen E; Jezewski, Peter A
2009-01-20
Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx) in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal), were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.
Directory of Open Access Journals (Sweden)
Finnerty John R
2009-01-01
Full Text Available Abstract Background Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Results Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal, were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Conclusion Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.
Traverse, Charles C; Ochman, Howard
2017-08-29
Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions
Energy Technology Data Exchange (ETDEWEB)
Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL
2009-01-01
Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.
Duplications created by transformation in Sordaria macrospora are not inactivated during meiosis.
Le Chevanton, L; Leblon, G; Lebilcot, S
1989-09-01
We present here the first report of a transformation system developed for the filamentous fungus Sordaria macrospora. Protoplasts from a ura-5 strain were transformed using the cloned Sordaria gene at a frequency of 2 x 10(-5) transformants per viable protoplast (10 per microgram of DNA). Transformation occurred by integration of the donor sequences in the chromosomes of the recipient strain. In 71 cases out of 74, integration occurred outside the ura5 locus; frequently several (two to four) copies were found at a unique integration site. Using the advantage of the spore colour phenotype of the ura5-1 marker, we have shown that the transformed phenotype is stable through mitosis and meiosis in all transformants analysed. No methylation of the duplicated sequences could be observed during meiotic divisions in the transformants.
Human Chromosome 7: DNA Sequence and Biology
Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.
2003-01-01
DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...
Immunohistochemical findings in rectal duplication mimicking rectal prolapse.
Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F
2008-08-01
Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.
Bilateral duplication of the internal auditory canal
International Nuclear Information System (INIS)
Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won
2007-01-01
Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)
[Colonic duplication revealed by intestinal obstruction due to fecal impaction].
Azahouani, A; Hida, M; Benhaddou, H
2015-12-01
Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.
Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet
2016-02-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.
Craniofacial duplication (diprosopus).
Turpin, I M; Furnas, D W; Amlie, R N
1981-02-01
No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.
Hoffmann, Robert D; Palmgren, Michael
2016-06-13
Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.
Do mtDNA Deletions Play a Role in the Development of Nasal Polyposis?
Directory of Open Access Journals (Sweden)
Arzu Tatar
2014-04-01
Full Text Available Objective:Nasal polyposis (NP is an inflammatory disease of the nasal mucosa and paranasal sinuses. Mitochondria are the cellular organelles which produce cellular energy by Oxidative Phosphorylation (OXPHOS, and they have own inheritance material, mtDNA. mtDNA is affected by reactive oxygen samples (ROS which are produced by both OXPHOS and the inflammatory process. The aim of this study was to investigate the 4977 bp and 7400 bp deletions of mtDNA in nasal polyposis tissue, and to indicate the possible association of mtDNA deletions with NP. Methods:Thirty-three patients, aged 15 to 65 years, with nasal polyposis were selected to be assessed for mitochondrial DNA deletions. The patients with possible mtDNA mutations due to mitochondrial disease, being treated with radiotherapy, of advanced age, with a familiar history, aspirin hypersensitivity, or a history of asthma, were excluded. Polyp excision surgery was applied to the treatment of the NP, and after histopathological diagnosis 1x1 cm of polyp tissue samples were used to isolate mtDNA. The 4977 bp and 7400 bp deletion regions, and two control regions of mtDNA were assessed by using four pairs of primers. DNA extractions from the NP tissues and peripheral blood samples of the patients were made, and then Polymerase Chain Reactions (PCR were made. PCR products were separated in 2% agarose gel.Results:No patient had either the 4977 bp deletion or the 7400 bp deletion in their NP tissue, and neither were these deletions evident in their peripheral blood. Two control sequences, one of them from a non-deleted region, and the other from a possible deletion region, were detected in the NP tissues and peripheral blood of all the patients.Conclusions:We had anticipated that some mtDNA deletion might have occurred in NP tissue due to the increased ROS levels caused by chronic inflammation, but we did not detect any deletion. Probably, the duration of inflammation in NP is insufficient to form mt
Duplication of the Portal Vein: A Case Report
Energy Technology Data Exchange (ETDEWEB)
Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)
2009-12-15
The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally
Castori, Marco; Bottillo, Irene; Morlino, Silvia; Barone, Chiara; Cascone, Piero; Grammatico, Paola; Laino, Luigi
2016-01-01
Campomelic dysplasia and acampomelic campomelic dysplasia (ACD) are allelic disorders due to heterozygous mutations in or around SOX9. Translocations and deletions involving the SOX9 5' regulatory region are rare causes of these disorders, as well as Pierre Robin sequence (PRS) and 46,XY gonadal dysgenesis. Genotype-phenotype correlations are not straightforward due to the complex epigenetic regulation of SOX9 expression during development. We report a three-generation pedigree with a novel ∼1 Mb deletion upstream of SOX9 and including KCNJ2 and KCNJ16, and ascertained for dominant transmission of PRS. Further characterization of the family identified subtle appendicular anomalies and a variable constellation of axial skeletal features evocative of ACD in several members. Affected males showed learning disability. The identified deletion was smaller than all other chromosome rearrangements associated with ACD. Comparison with other reported translocations and deletions involving this region allowed further refining of genotype-phenotype correlations and an update of the smallest regions of overlap associated with the different phenotypes. Intrafamilial variability in this pedigree suggests a phenotypic continuity between ACD and PRS in patients carrying mutations in the SOX9 5' regulatory region. © 2015 Wiley Periodicals, Inc.
Identification of a novel 15.5 kb SHOX deletion associated with ...
Indian Academy of Sciences (India)
ANGELOS ALEXANDROU
deletion, encompassing exons 3–6, was initially detected by array-CGH, followed by MLPA analysis. Sequencing of ... The proband, a female, second child of four children was born to ... at the age of 43 years, she had an occipitofrontal circumfer- ence (ofc) of ..... obox gene cause growth failure in idiopathic short stature and.
Impaired spermatogenesis and gr/gr deletions related to Y chromosome haplogroups in Korean men.
Directory of Open Access Journals (Sweden)
Jin Choi
Full Text Available Microdeletion of the Azoospermia Factor (AZF regions in Y chromosome is a well-known genetic cause of male infertility resulting from spermatogenetic impairment. However, the partial deletions of AZFc region related to spermatogenetic impairment are controversial. In this study, we characterized partial deletion of AZFc region in Korean patients with spermatogenetic impairment and assessed whether the DAZ and CDY1 contributes to the phenotype in patients with gr/gr deletions. Total of 377 patients with azoo-/oligozoospermia and 217 controls were analyzed using multiplex polymerase chain reaction (PCR, analysis of DAZ-CDY1 sequence family variants (SFVs, and quantitative fluorescent (QF-PCR. Of the 377 men with impaired spermatogenesis, 59 cases (15.6% had partial AZFc deletions, including 32 gr/gr (8.5%, 22 b2/b3 (5.8%, four b1/b3 (1.1% and one b3/b4 (0.3% deletion. In comparison, 14 of 217 normozoospermic controls (6.5% had partial AZFc deletions, including five gr/gr (2.3% and nine b2/b3 (4.1% deletions. The frequency of gr/gr deletions was significantly higher in the azoo-/oligozoospermic group than in the normozoospermic control group (p = 0.003; OR = 3.933; 95% CI = 1.509-10.250. Concerning Y haplogroup, we observed no significant differences in the frequency of gr/gr deletions between the case and the control groups in the YAP+ lineages, while gr/gr deletion were significantly higher in azoo-/oligozoospermia than normozoospermia in the YAP- lineage (p = 0.004; OR = 6.341; 95% CI = 1.472-27.312. Our data suggested that gr/gr deletion is associated with impaired spermatogenesis in Koreans with YAP- lineage, regardless of the gr/gr subtypes.
A platform-independent method for detecting errors in metagenomic sequencing data: DRISEE.
Directory of Open Access Journals (Sweden)
Kevin P Keegan
Full Text Available We provide a novel method, DRISEE (duplicate read inferred sequencing error estimation, to assess sequencing quality (alternatively referred to as "noise" or "error" within and/or between sequencing samples. DRISEE provides positional error estimates that can be used to inform read trimming within a sample. It also provides global (whole sample error estimates that can be used to identify samples with high or varying levels of sequencing error that may confound downstream analyses, particularly in the case of studies that utilize data from multiple sequencing samples. For shotgun metagenomic data, we believe that DRISEE provides estimates of sequencing error that are more accurate and less constrained by technical limitations than existing methods that rely on reference genomes or the use of scores (e.g. Phred. Here, DRISEE is applied to (non amplicon data sets from both the 454 and Illumina platforms. The DRISEE error estimate is obtained by analyzing sets of artifactual duplicate reads (ADRs, a known by-product of both sequencing platforms. We present DRISEE as an open-source, platform-independent method to assess sequencing error in shotgun metagenomic data, and utilize it to discover previously uncharacterized error in de novo sequence data from the 454 and Illumina sequencing platforms.
Typewriting: Toward Duplicating Success
Orsborn, Karen J.
1977-01-01
A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)
Identification of approximately duplicate material records in ERP systems
Zong, Wei; Wu, Feng; Chu, Lap-Keung; Sculli, Domenic
2017-03-01
The quality of master data is crucial for the accurate functioning of the various modules of an enterprise resource planning (ERP) system. This study addresses specific data problems arising from the generation of approximately duplicate material records in ERP databases. Such problems are mainly due to the firm's lack of unique and global identifiers for the material records, and to the arbitrary assignment of alternative names for the same material by various users. Traditional duplicate detection methods are ineffective in identifying such approximately duplicate material records because these methods typically rely on string comparisons of each field. To address this problem, a machine learning-based framework is developed to recognise semantic similarity between strings and to further identify and reunify approximately duplicate material records - a process referred to as de-duplication in this article. First, the keywords of the material records are extracted to form vectors of discriminating words. Second, a machine learning method using a probabilistic neural network is applied to determine the semantic similarity between these material records. The approach was evaluated using data from a real case study. The test results indicate that the proposed method outperforms traditional algorithms in identifying approximately duplicate material records.
Copy Number Deletion Has Little Impact on Gene Expression Levels in Racehorses
Directory of Open Access Journals (Sweden)
Kyung-Do Park
2014-09-01
Full Text Available Copy number variations (CNVs, important genetic factors for study of human diseases, may have as large of an effect on phenotype as do single nucleotide polymorphisms. Indeed, it is widely accepted that CNVs are associated with differential disease susceptibility. However, the relationships between CNVs and gene expression have not been characterized in the horse. In this study, we investigated the effects of copy number deletion in the blood and muscle transcriptomes of Thoroughbred racing horses. We identified a total of 1,246 CNVs of deletion polymorphisms using DNA re-sequencing data from 18 Thoroughbred racing horses. To discover the tendencies between CNV status and gene expression levels, we extracted CNVs of four Thoroughbred racing horses of which RNA sequencing was available. We found that 252 pairs of CNVs and genes were associated in the four horse samples. We did not observe a clear and consistent relationship between the deletion status of CNVs and gene expression levels before and after exercise in blood and muscle. However, we found some pairs of CNVs and associated genes that indicated relationships with gene expression levels: a positive relationship with genes responsible for membrane structure or cytoskeleton and a negative relationship with genes involved in disease. This study will lead to conceptual advances in understanding the relationship between CNVs and global gene expression in the horse.
High incidence of large deletions in the PMS2 gene in Spanish Lynch syndrome families.
Brea-Fernández, A J; Cameselle-Teijeiro, J M; Alenda, C; Fernández-Rozadilla, C; Cubiella, J; Clofent, J; Reñé, J M; Anido, U; Milá, M; Balaguer, F; Castells, A; Castellvi-Bel, S; Jover, R; Carracedo, A; Ruiz-Ponte, C
2014-06-01
Lynch syndrome (LS) is caused by germline mutations in one of the four mismatch repair (MMR) genes. Defects in this pathway lead to microsatellite instability (MSI) in DNA tumors, which constitutes the molecular hallmark of this disease. Selection of patients for genetic testing in LS is usually based on fulfillment of diagnostic clinical criteria (i.e. Amsterdam criteria or the revised Bethesda guidelines). However, following these criteria PMS2 mutations have probably been underestimated as their penetrances appear to be lower than those of the other MMR genes. The use of universal MMR study-based strategies, using MSI testing and immunohistochemical (IHC) staining, is being one proposed alternative. Besides, germline mutation detection in PMS2 is complicated by the presence of highly homologous pseudogenes. Nevertheless, specific amplification of PMS2 by long-range polymerase chain reaction (PCR) and the improvement of the analysis of large deletions/duplications by multiplex ligation-dependent probe amplification (MLPA) overcome this difficulty. By using both approaches, we analyzed 19 PMS2-suspected carriers who have been selected by clinical or universal strategies and found five large deletions and one frameshift mutation in PMS2 in six patients (31%). Owing to the high incidence of large deletions found in our cohort, we recommend MLPA analysis as the first-line method for searching germline mutations in PMS2. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Multi-exon deletions of the FBN1 gene in Marfan syndrome
Directory of Open Access Journals (Sweden)
Schrijver Iris
2001-10-01
Full Text Available Abstract Background Mutations in the fibrillin -1 gene (FBN1 cause Marfan syndrome (MFS, an autosomal dominant multi-system connective tissue disorder. The 200 different mutations reported in the 235 kb, 65 exon-containing gene include only one family with a genomic multi-exon deletion. Methods We used long-range RT-PCR for mutation detection and long-range genomic PCR and DNA sequencing for identification of deletion breakpoints, allele-specific transcript analyses to determine stability of the mutant RNA, and pulse-chase studies to quantitate fibrillin synthesis and extracellular matrix deposition in cultured fibroblasts. Southern blots of genomic DNA were probed with three overlapping fragments covering the FBN1 coding exons Results Two novel multi-exon FBN1 deletions were discovered. Identical nucleotide pentamers were found at or near the intronic breakpoints. In a Case with classic MFS, an in-frame deletion of exons 42 and 43 removed the C-terminal 24 amino acids of the 5th LTBP (8-cysteine domain and the adjacent 25th calcium-binding EGF-like (6-cysteine domain. The mutant mRNA was stable, but fibrillin synthesis and matrix deposition were significantly reduced. A Case with severe childhood-onset MFS has a de novo deletion of exons 44–46 that removed three EGF-like domains. Fibrillin protein synthesis was normal, but matrix deposition was strikingly reduced. No genomic rearrangements were detected by Southern analysis of 18 unrelated MFS samples negative for FBN1 mutation screening. Conclusions Two novel deletion cases expand knowledge of mutational mechanisms and genotype/phenotype correlations of fibrillinopathies. Deletions or mutations affecting an LTBP domain may result in unstable mutant protein cleavage products that interfere with microfibril assembly.
Chromosomal duplication strains of Aspergillus nidulans and their instability
International Nuclear Information System (INIS)
Azevedo, J.L. de; Almeida Okino, L.M. de
1981-01-01
Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt
Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain
International Nuclear Information System (INIS)
Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu
2004-01-01
In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis
Gene duplication and fragmentation in the zebra finch major histocompatibility complex.
Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V
2010-04-01
Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the
Gene duplication and fragmentation in the zebra finch major histocompatibility complex
Directory of Open Access Journals (Sweden)
Burt David W
2010-04-01
Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving
Slipins: ancient origin, duplication and diversification of the stomatin protein family
Directory of Open Access Journals (Sweden)
Young J Peter W
2008-02-01
Full Text Available Abstract Background Stomatin is a membrane protein that was first isolated from human red blood cells. Since then, a number of stomatin-like proteins have been identified in all three domains of life. The conservation among these proteins is remarkable, with bacterial and human homologs sharing 50 % identity. Despite being associated with a variety of diseases such as cancer, kidney failure and anaemia, precise functions of these proteins remain unclear. Results We have constructed a comprehensive phylogeny of all 'stomatin-like' sequences that share a 150 amino acid domain. We show these proteins comprise an ancient family that arose early in prokaryotic evolution, and we propose a new nomenclature that reflects their phylogeny, based on the name "slipin" (stomatin-like protein. Within prokaryotes there are two distinct subfamilies that account for the two different origins of the eight eukaryotic stomatin subfamilies, one of which gave rise to eukaryotic SLP-2, renamed here "paraslipin". This was apparently acquired through the mitochondrial endosymbiosis and is widely distributed amongst the major kingdoms. The other prokaryotic subfamily gave rise to the ancestor of the remaining seven eukaryotic subfamilies. The highly diverged "alloslipin" subfamily is represented only by fungal, viral and ciliate sequences. The remaining six subfamilies, collectively termed "slipins", are confined to metazoa. Protostome stomatin, as well as a newly reported arthropod subfamily slipin-4, are restricted to invertebrate groups, whilst slipin-1 (previously SLP-1 is present in nematodes and higher metazoa. In vertebrates, the stomatin family expanded considerably, with at least two duplication events giving rise to podocin and slipin-3 subfamilies (previously SLP-3, with the retained ancestral sequence giving rise to vertebrate stomatin. Conclusion Stomatin-like proteins have their origin in an ancient duplication event that occurred early on in the evolution
Partial duplication of head--a rare congenital anomaly.
Hemachandran, Manikkapurath; Radotra, Bishan Dass
2004-10-01
Duplication of notochord results in rare congenital anomalies like double headed monsters, with or without trunk/limb duplication, depending upon the extent of notochordal abnormality. Here we describe the morphological abnormalities in a case of partial duplication of cranial structures with fusion of the two. Autopsy findings suggest that the bifurcation of the neural tube took place around 4th to 6th week of gestation. There are only few reports in English literature describing the autopsy findings of such an anomaly, which is termed as Diprosopus triophthalmus in the modern literature.
Duplication of the Left Vertebral Artery Origin: A Case Report
Energy Technology Data Exchange (ETDEWEB)
Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun [Dept. of Radiology, College of Medicine, Hanyang University, Hanyang University Guri Hospital, Guri (Korea, Republic of)
2013-01-15
Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.
Duplication of the Left Vertebral Artery Origin: A Case Report
International Nuclear Information System (INIS)
Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun
2013-01-01
Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.
Rare deletions at 16p13.11 predispose to a diverse spectrum of sporadic epilepsy syndromes.
Heinzen, Erin L; Radtke, Rodney A; Urban, Thomas J; Cavalleri, Gianpiero L; Depondt, Chantal; Need, Anna C; Walley, Nicole M; Nicoletti, Paola; Ge, Dongliang; Catarino, Claudia B; Duncan, John S; Kasperaviciūte, Dalia; Tate, Sarah K; Caboclo, Luis O; Sander, Josemir W; Clayton, Lisa; Linney, Kristen N; Shianna, Kevin V; Gumbs, Curtis E; Smith, Jason; Cronin, Kenneth D; Maia, Jessica M; Doherty, Colin P; Pandolfo, Massimo; Leppert, David; Middleton, Lefkos T; Gibson, Rachel A; Johnson, Michael R; Matthews, Paul M; Hosford, David; Kälviäinen, Reetta; Eriksson, Kai; Kantanen, Anne-Mari; Dorn, Thomas; Hansen, Jörg; Krämer, Günter; Steinhoff, Bernhard J; Wieser, Heinz-Gregor; Zumsteg, Dominik; Ortega, Marcos; Wood, Nicholas W; Huxley-Jones, Julie; Mikati, Mohamad; Gallentine, William B; Husain, Aatif M; Buckley, Patrick G; Stallings, Ray L; Podgoreanu, Mihai V; Delanty, Norman; Sisodiya, Sanjay M; Goldstein, David B
2010-05-14
Deletions at 16p13.11 are associated with schizophrenia, mental retardation, and most recently idiopathic generalized epilepsy. To evaluate the role of 16p13.11 deletions, as well as other structural variation, in epilepsy disorders, we used genome-wide screens to identify copy number variation in 3812 patients with a diverse spectrum of epilepsy syndromes and in 1299 neurologically-normal controls. Large deletions (> 100 kb) at 16p13.11 were observed in 23 patients, whereas no control had a deletion greater than 16 kb. Patients, even those with identically sized 16p13.11 deletions, presented with highly variable epilepsy phenotypes. For a subset of patients with a 16p13.11 deletion, we show a consistent reduction of expression for included genes, suggesting that haploinsufficiency might contribute to pathogenicity. We also investigated another possible mechanism of pathogenicity by using hybridization-based capture and next-generation sequencing of the homologous chromosome for ten 16p13.11-deletion patients to look for unmasked recessive mutations. Follow-up genotyping of suggestive polymorphisms failed to identify any convincing recessive-acting mutations in the homologous interval corresponding to the deletion. The observation that two of the 16p13.11 deletions were larger than 2 Mb in size led us to screen for other large deletions. We found 12 additional genomic regions harboring deletions > 2 Mb in epilepsy patients, and none in controls. Additional evaluation is needed to characterize the role of these exceedingly large, non-locus-specific deletions in epilepsy. Collectively, these data implicate 16p13.11 and possibly other large deletions as risk factors for a wide range of epilepsy disorders, and they appear to point toward haploinsufficiency as a contributor to the pathogenicity of deletions. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Adenovirus sequences required for replication in vivo.
Wang, K; Pearson, G D
1985-01-01
We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occup...
Gene duplication and the evolution of hemoglobin isoform differentiation in birds.
Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F
2012-11-02
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.
Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*
Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.
2012-01-01
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007
Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.
Bondurand, Nadége; Fouquet, Virginie; Baral, Viviane; Lecerf, Laure; Loundon, Natalie; Goossens, Michel; Duriez, Benedicte; Labrune, Philippe; Pingault, Veronique
2012-09-01
Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders.
Rectal duplication cyst in adults treated with transanal endoscopic microsurgery.
Ben-Ishay, O; Person, B; Eran, B; Hershkovitz, D; Duek, D Simon
2011-12-01
Rectal duplication cyst is a rare entity that accounts for approximately 4% of all alimentary tract duplications. To the best of our knowledge, the presented cases are the first reports in the English literature of rectal duplication cyst resection by transanal endoscopic microsurgery. We present two patients; both are 41-year-old women with a palpable rectal mass. Workup revealed a submucosal posterior mass that was then resected by transanal endoscopic microsurgery. The pathology report described cystic lesions with squamous and columnar epithelium and segments of smooth muscle. These findings were compatible with rectal duplication cyst. Our limited experience showed good results with minimal morbidity and mortality for resection of rectal duplication cysts of limited size with no evidence of malignancy.
Lv, Yuanda; Zhao, Liang; Xu, Xiaoyang; Wang, Lei; Wang, Cheng; Zhang, Tianzhen; Guo, Wangzhen
2013-03-13
Cotton is the leading fiber crop worldwide. Gossypium barbadense is an important species of cotton because of its extra-long staple fibers with superior luster and silkiness. However, a systematic analysis and utilization of cDNA sequences from G. barbadense fiber development remains understudied. A total of 21,079 high quality sequences were generated from two non-normalized cDNA libraries prepared by using a mixture of G. barbadense Hai7124 fibers and ovules. After assembly processing, a set of 8,653 unigenes were obtained. Of those, 7,786 were matched to known proteins and 7,316 were assigned to functional categories. The molecular functions of these unigenes were mostly related to binding and catalytic activity, and carbohydrate, amino acid, and energy metabolisms were major contributors among the subsets of metabolism. Sequences comparison between G. barbadense and G. hirsutum revealed that 8,245 unigenes from G. barbadense were detected the similarity with those released publicly in G. hirsutum, however, the remaining 408 sequences had no hits against G. hirsutum unigenes database. Furthermore, 13,275 putative ESTs InDels loci involved in the orthologous and/or homoeologous differences between/within G. barbadense and G. hirsutum were discovered by in silico analyses, and 2,160 InDel markers were developed by ESTs with more than five insertions or deletions. By gel electrophoresis combined with sequencing verification, 71.11% candidate InDel loci were reconfirmed orthologous and/or homoeologous loci polymorphisms using G. hirsutum acc TM-1 and G. barbadense cv Hai7124. Blastx result showed among 2,160 InDel loci, 81 with significant function similarity with known genes associated with secondary wall synthesis process, indicating the important roles in fiber quality in tetraploid cultivated cotton species. Sequence comparisons and InDel markers development will lay the groundwork for promoting the identification of genes related to superior agronomic traits
Stress-induced rearrangement of Fusarium retrotransposon sequences.
Anaya, N; Roncero, M I
1996-11-27
Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.
Double-blind ureteral duplication: report of two cases
International Nuclear Information System (INIS)
Choi, Ja-Young; Kim, Seung Hyup; Kim, Sun Ho
2002-01-01
Blind ending of ureteral duplication is one of the most rare anomalies of the upper urinary tract. We report two cases of ureteral duplication with a blind ending both superiorly and inferiorly, and with no definite communication with the urinary tract. (orig.)
Gennip, van H.G.P.; Widjojoatmodjo, M.N.; Smit, de A.J.; Moormann, R.J.M.
1999-01-01
A pig pestivirus isolate, strain H, was characterized by using reverse transcription-PCR (RT-PCR) and direct sequencing of the amplicons. A duplication of 74 nucleotides was found at the 5' terminus of the 5' noncoding (NC) region, which was also found in RNA isolates from tonsils from two other
Endoscopic Decompression and Marsupialization of A Duodenal Duplication Cyst
Directory of Open Access Journals (Sweden)
Eliza I-Lin Sin
2018-06-01
Full Text Available Introduction: Duodenal duplication cysts are rare congenital foregut anomalies, accounting for 2%–12% of all gastrointestinal tract duplications. Surgical excision entails risk of injury to the pancreaticobiliary structures due to proximity or communication with the cyst. We present a case of duodenal duplication cyst in a 3 year-old boy who successfully underwent endoscopic decompression. Case report: AT is a young boy who first presented at 15 months of age with abdominal pain. There was one subsequent episode of pancreatitis. Ultrasonography showed the typical double wall sign of a duplication cyst and magnetic resonance cholangio-pancreatography showed a large 5 cm cyst postero-medial to the second part of the duodenum, communicating with the pancreaticobiliary system and causing dilatation of the proximal duodenum. He subsequently underwent successful endoscopic ultrasound guided decompression at 3 years of age under general anesthesia, and had an uneventful postoperative recovery. Conclusion: Endoscopic ultrasound guided assessment and treatment of gastrointestinal duplication cysts is increasingly reported in adults. To the best of our knowledge, only one case of endoscopic treatment of duodenal duplication cyst, in an older child, has been reported thus far in the paediatric literature. In this paper, we review the current literature and discuss the therapeutic options of this rare condition.
Liu, Qingqing; Cornejo, Kristine M; Cheng, Liang; Hutchinson, Lloyd; Wang, Mingsheng; Zhang, Shaobo; Tomaszewicz, Keith; Cosar, Ediz F; Woda, Bruce A; Jiang, Zhong
2018-04-01
Overlapping morphologic, immunohistochemical, and ultrastructural features make it difficult to diagnose chromophobe renal cell carcinoma (ChRCC) and renal oncocytoma (RO). Because ChRCC is a malignant tumor, whereas RO is a tumor with benign behavior, it is important to distinguish these two entities. We aimed to identify genetic markers that distinguish ChRCC from RO by using next-generation sequencing (NGS). NGS for hotspot mutations or gene copy number changes was performed on 12 renal neoplasms, including seven ChRCC and five RO cases. Matched normal tissues from the same patients were used to exclude germline variants. Rare hotspot mutations were found in cancer-critical genes (TP53 and PIK3CA) in ChRCC but not RO. The NGS gene copy number analysis revealed multiple abnormalities. The two most common deletions were tumor-suppressor genes RB1 and ERBB4 in ChRCC but not RO. Fluorescence in situ hybridization was performed on 65 cases (ChRCC, n = 33; RO, n = 32) to verify hemizygous deletion of RB1 (17/33, 52%) or ERBB4 (11/33, 33%) in ChRCC, but not in RO (0/32, 0%). In total, ChRCCs (23/33, 70%) carry either a hemizygous deletion of RB1 or ERBB4. The combined use of RB1 and ERBB4 fluorescence in situ hybridization to detect deletion of these genes may offer a highly sensitive and specific assay to distinguish ChRCC from RO. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Enteric Duplication Cysts in Children: A Clinicopathological Dilemma.
Sharma, Sonam; Yadav, Amit K; Mandal, Ashish K; Zaheer, Sufian; Yadav, Devendra K; Samie, Amat
2015-08-01
Enteric duplication cysts are rare and uncommon congenital malformations formed during the embryonic period of the development of human digestive system and are mainly encountered during infancy or early childhood, but seldom in adults. The clinical presentation is extremely variable depending upon its size, location and type. We present six cases of enteric duplication cysts with diverse clinico-pathological features. This study was carried out in the Department of Pathology and Department of Paediatric Surgery, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India for a period of 2 years (January 2013 - December 2014). We retrospectively analyzed six patients of enteric duplication cysts based on data obtained, which consisted of patient's age, sex, clinical presentation, radiological features, operative findings and histopathology report. The data collected was analyzed by descriptive statistics. Six children between age range of 3 days to 10 years had enteric duplication cysts. Two had ileal and one each were of pyloroduodenal, colonic and rectal duplication cyst. In one patient a presumptive diagnosis of enteric duplication cyst was made. Radiology played an important contributory role in diagnosis of these cysts in all the patients but histopathology proved to be gold standard for its confirmation. All these patients were managed by surgical excision. The postoperative and follow up period in all the cases was uneventful. It is important to be aware and make a definitive diagnosis of this rare congenital anomaly as they can present in various clinical forms and can cause significant morbidity and even mortality if left untreated by causing life threatening complications.
Penile Duplication and Two Anal Openings; Report of a Very Rare Case
Bakheet, Mohamed Abdel Al M.; Refaei, Mohammad
2012-01-01
Background Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. Case Presentation A 21 days old Egyptian neonate is reported with complete penile duplication and t...
Toyota, S; Hirosawa, S; Aoki, N
1994-02-01
Alpha 2-plasmin inhibitor (alpha 2PI) deficiency Okinawa results from defective secretion of the inhibitor from the liver and appears to be a direct consequence of the deletion of Glu137 in the amino acid sequence of alpha 2PI. To examine the effects of replacing the amino acid occupying position 137 or deleting its neighboring amino acid on alpha 2PI secretion, we used oligonucleotide-directed mutagenesis of alpha 2PI cDNA to change the codon specifying Glu137 or delete a codon specifying its neighboring amino acid. The effects were determined by pulse-chase experiments and by enzyme-linked immunosorbent assay of media from transiently transfected COS-7 cells. Replacement of Glu137 with an amino acid other than Cys had little effect on alpha 2PI secretion. In contrast, deletion of an amino acid in a region spanning a sequence of less than 30 amino acids including positions 127 and 137 severely impaired the secretion. The results suggest that structural integrity of the region, rather than its component amino acids, is important for the intracellular transport and secretion of alpha 2PI.
40 CFR 25.13 - Coordination and non-duplication.
2010-07-01
... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...
Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.
Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu
2016-09-01
Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.
Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.
Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M
2017-08-01
Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.
Recombination facilitates neofunctionalization of duplicate genes via originalization
Directory of Open Access Journals (Sweden)
Huang Ren
2010-06-01
Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.
Schizophrenia and chromosomal deletions
Energy Technology Data Exchange (ETDEWEB)
Lindsay, E.A.; Baldini, A. [Baylor College of Medicine, Houston, TX (United States); Morris, M. A. [Univ. of Geneva School of Medicine, NY (United States)] [and others
1995-06-01
Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized. These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.
International Nuclear Information System (INIS)
Pylkäs, Katri; Erkko, Hannele; Nikkilä, Jenni; Sólyom, Szilvia; Winqvist, Robert
2008-01-01
BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA) method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13) in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility
Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry
2011-10-15
The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Nelson, S.L.; Grosovsky, A.J.; Jones, I.M.; Burkhart-Schultz, K.; Fuscoe, J.C.
1995-01-01
We have examined the extent of of HPRT - total gene deletions in three mutant collections: spontaneous and X-ray-induced deletions in TK6 human B lymphoblasts, and HPRT - deletions arising in vivo in T cells. A set of 13 Xq26 STS markers surrounding hprt and spanning approximately 3.3 Mb was used. Each marker used was observed to be missing in at least one of the hprt deletion mutants analyzed. The largest deletion observed encompassed at least 3 Mb. Nine deletions extended outside of the mapped region in the centromeric direction (>1.7 Mb). In contrast, only two telomeric deletions extended to marker 342R (1.26 Mb), and both exhibited slowed or limited cell growth. These data suggest the existence of a gene, within the vicinity of 342R, which establishes the telomeric limit of recoverable deletions. Most (25/41) X-ray-induced total gene deletion mutants exhibited marker loss, but only 1/8 of the spontaneous deletions encompassed any Xq26 markers (P = 0.0187). Furthermore, nearly half (3/8) of the spontaneous 3' total deletion breakpoints were within 14 kb of the hprt coding sequence. In contrast, 40/41 X-ray-induced HPRT - total deletions extended beyond this point (P = 0.011). Although the overall representation of total gene deletions in the in vivo spectrum is low, 4/5 encompass Xq26 markers flanking hprt. This pattern differs significantly from spontaneous HPRT - large deletions occurring in vitro (P = 0.032) but resembles the spectrum of X-ray-induced deletions. 24 refs., 6 figs., 1 tab
Directory of Open Access Journals (Sweden)
Ulusal SD
2017-06-01
Full Text Available Neurofibromatosis Type I (NF1 is a multi systemic autosomal dominant neurocutaneous disorder predisposing patients to have benign and/or malignant lesions predominantly of the skin, nervous system and bone. Loss of function mutations or deletions of the NF1 gene is responsible for NF1 disease. Involvement of various pathogenic variants, the size of the gene and presence of pseudogenes makes it difficult to analyze. We aimed to report the results of 2 years of multiplex ligation-dependent probe amplification (MLPA and next generation sequencing (NGS for genetic diagnosis of NF1 applied at our genetic diagnosis center. The MLPA, semiconductor sequencing and Sanger sequencing were performed in genomic DNA samples from 24 unrelated patients and their affected family members referred to our center suspected of having NF1. In total, three novel and 12 known pathogenic variants and a whole gene deletion were determined. We suggest that next generation sequencing is a practical tool for genetic analysis of NF1. Deletion/duplication analysis with MLPA may also be helpful for patients clinically diagnosed to carry NF1 but do not have a detectable mutation in NGS.
Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M
2016-12-13
Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Female Urethral Duplication: Rare Anomaly with Unusual Presentation
African Journals Online (AJOL)
UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...
Directory of Open Access Journals (Sweden)
Ge Song
2010-04-01
Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN
Li, Zhen; Van de Peer, Yves; De Smet, Riet
2016-01-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215
Duplicate retention in signalling proteins and constraints from network dynamics.
Soyer, O S; Creevey, C J
2010-11-01
Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.
Xie, Qian; Cao, Yujuan; Su, Juan; Wu, Jie; Wu, Xianbo; Wan, Chengsong; He, Mingliang; Ke, Changwen; Zhang, Bao; Zhao, Wei
2017-08-01
Significant sequence variation of Middle East respiratory syndrome coronavirus (MERS CoV) has never been detected since it was first reported in 2012. A MERS patient came from Korea to China in late May 2015. The patient was 44 years old and had symptoms including high fever, dry cough with a little phlegm, and shortness of breath, which are roughly consistent with those associated with MERS, and had had close contact with individuals with confirmed cases of MERS.After one month of therapy with antiviral, anti-infection, and immune-enhancing agents, the patient recovered in the hospital and was discharged. A nasopharyngeal swab sample was collected for direct sequencing, which revealed two deletion variants of MERS CoV. Deletions of 414 and 419 nt occurred between ORF5 and the E protein, resulting in a partial protein fusion or truncation of ORF5 and the E protein. Functional analysis by bioinformatics and comparison to previous studies implied that the two variants might be defective in their ability to package MERS CoV. However, the mechanism of how these deletions occurred and what effects they have need to be further investigated.
Qin, Shengfang; Wang, Xueyan; Li, Yunxing; Wei, Ping; Chen, Chun; Zeng, Lan
2016-02-01
To explore the genetics mechanism for the phenotypic variability in a patient carrying a rare ring chromosome 9. The karyotype of the patient was analyzed with cytogenetics method. Presence of sex chromosome was confirmed with fluorescence in situ hybridization. The SRY gene was subjected to PCR amplification and direct sequencing. Potential deletion and duplication were detected with array-based comparative genomic hybridization (array-CGH). The karyotype of the patient has comprised 6 types of cell lines containing a ring chromosome 9. The SRY gene sequence was normal. By array-CGH, the patient has carried a hemizygous deletion at 9p24.3-p23 (174 201-9 721 761) encompassing 30 genes from Online Mendelian Inheritance in Man. The phenotypic variability of the 9p deletion syndrome in conjunct with ring chromosome 9 may be attributable to multiple factors including loss of chromosomal material, insufficient dosage of genes, instability of ring chromosome, and pattern of inheritance.
Use of diagnostic imaging in the evaluation of gastrointestinal tract duplications.
Laskowska, Katarzyna; Gałązka, Przemysław; Daniluk-Matraś, Irena; Leszczyński, Waldemar; Serafin, Zbigniew
2014-01-01
Gastrointestinal tract duplication is a rare malformation associated with the presence of additional segment of the fetal gut. The aim of this study was to retrospectively review clinical features and imaging findings in intraoperatively confirmed cases of gastrointestinal tract duplication in children. The analysis included own material from the years 2002-2012. The analyzed group included 14 children, among them 8 boys and 6 girls. The youngest patient was diagnosed at the age of three weeks, and the oldest at 12 years of age. The duplication cysts were identified in the esophagus (n=2), stomach (n=5), duodenum (n=1), terminal ileum (n=5), and rectum (n=1). In four cases, the duplication coexisted with other anomalies, such as patent urachus, Meckel's diverticulum, mesenteric cyst, and accessory pancreas. Clinical manifestation of gastrointestinal duplication cysts was variable, and some of them were detected accidently. Thin- or thick-walled cystic structures adjacent to the wall of neighboring gastrointestinal segment were documented on diagnostic imaging. Ultrasound and computed tomography are the methods of choice in the evaluation of gastrointestinal duplication cysts. Apart from the diagnosis of the duplication cyst, an important issue is the detection of concomitant developmental pathologies, including pancreatic heterotopy.
Directory of Open Access Journals (Sweden)
Alicia Blaker-Lee
2012-11-01
Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs, intellectual disability disorder (IDD and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV. The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed ‘dosage sensors’, which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development – impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa and kinesin family member 22 (kif22 genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.