WorldWideScience

Sample records for sense primer derived

  1. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  2. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  3. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  4. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  5. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  6. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  7. Deriving harmonised forest information in Europe using remote sensing methods

    DEFF Research Database (Denmark)

    Seebach, Lucia Maria

    the need for harmonised forest information can be satisfied using remote sensing methods. In conclusion, the study showed that it is possible to derive harmonised forest information of high spatial detail in Europe with remote sensing. The study also highlighted the imperative provision of accuracy...

  8. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A Remote Sensing-Derived Corn Yield Assessment Model

    Science.gov (United States)

    Shrestha, Ranjay Man

    Agricultural studies and food security have become critical research topics due to continuous growth in human population and simultaneous shrinkage in agricultural land. In spite of modern technological advancements to improve agricultural productivity, more studies on crop yield assessments and food productivities are still necessary to fulfill the constantly increasing food demands. Besides human activities, natural disasters such as flood and drought, along with rapid climate changes, also inflect an adverse effect on food productivities. Understanding the impact of these disasters on crop yield and making early impact estimations could help planning for any national or international food crisis. Similarly, the United States Department of Agriculture (USDA) Risk Management Agency (RMA) insurance management utilizes appropriately estimated crop yield and damage assessment information to sustain farmers' practice through timely and proper compensations. Through County Agricultural Production Survey (CAPS), the USDA National Agricultural Statistical Service (NASS) uses traditional methods of field interviews and farmer-reported survey data to perform annual crop condition monitoring and production estimations at the regional and state levels. As these manual approaches of yield estimations are highly inefficient and produce very limited samples to represent the entire area, NASS requires supplemental spatial data that provides continuous and timely information on crop production and annual yield. Compared to traditional methods, remote sensing data and products offer wider spatial extent, more accurate location information, higher temporal resolution and data distribution, and lower data cost--thus providing a complementary option for estimation of crop yield information. Remote sensing derived vegetation indices such as Normalized Difference Vegetation Index (NDVI) provide measurable statistics of potential crop growth based on the spectral reflectance and could

  10. Remote Sensing-Derived Bathymetry of Lake Poopó

    Directory of Open Access Journals (Sweden)

    Adalbert Arsen

    2013-12-01

    Full Text Available Located within the Altiplano at 3,686 m above sea level, Lake Poopó is remarkably shallow and very sensitive to hydrologic recharge. Progressive drying has been observed in the entire Titicaca-Poopó-Desaguadero-Salar de Coipasa (TPDS system during the last decade, causing dramatic changes to Lake Poopó’s surface and its regional water supplies. Our research aims to improve understanding of Lake Poopó water storage capacity. Thus, we propose a new method based on freely available remote sensing data to reproduce Lake Poopó bathymetry. Laser ranging altimeter ICESat (Ice, Cloud, and land Elevation Satellite is used during the lake’s lowest stages to measure vertical heights with high precision over dry land. These heights are used to estimate elevations of water contours obtained with Landsat imagery. Contour points with assigned elevation are filtered and grouped in a points cloud. Mesh gridding and interpolation function are then applied to construct 3D bathymetry. Complementary analysis of Moderate Resolution Imaging Spectroradiometer (MODIS surfaces from 2000 to 2012 combined with bathymetry gives water levels and storage evolution every 8 days.

  11. A thiourea derivative as potential ionophore for copper sensing

    Science.gov (United States)

    Ying, Kook Shih; Heng, Lee Yook; Hassan, Nurul Izzaty; Hasbullah, Siti Aishah

    2018-04-01

    A new thiourea derivative, N1,N3-bis[[3,5-bis(trifluoromethyl)phenyl]carbamothioyl]isophthalamide (TPC), as a potential copper ionophore was investigated. TPC was immobilized via drop casting method into poly(n-butyl acrylate) pBA membrane and the sensor was characterized by potentiometric method. The sensor fabricated based on TPC showed a Nernstian response towards copper ion with the slope of 27.07±2.84 mV/decade in the range of 1.0×10-6 - 1.0-10-4 M and limit of detection of 6.24 × 10-7 M. In addition, based on the separate solution method (SSM), the logarithm selectivity coefficients were less than -3.00 for monovalent, divalent and trivalent cations that are present in the environmental water samples such as K+, Ca2+, Mg2+ and Fe3+. This confirmed that the sensor fabricated with TPC exhibited good sensitivity and selectivity towards copper ion.

  12. Evaluation of AMSR-E derived soil moisture over Australia, /Remote Sensing of Environment

    NARCIS (Netherlands)

    Draper, C.S.; Walker, J.P.; Steinle, P.J.; De Jeu, R.A.M.; Holmes, T.R.H.

    2009-01-01

    This paper assesses remotely sensed near-surface soil moisture over Australia, derived from the passive microwave Advanced Microwave Scanning Radiometer - Earth Observing System (AMSR-E) instrument. Soil moisture fields generated by the AMSR-E soil moisture retrieval algorithm developed at the Vrije

  13. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  14. HABSEED: a Simple Spatially Explicit Meta-Populations Model Using Remote Sensing Derived Habitat Quality Data

    Science.gov (United States)

    Heumann, B. W.; Guichard, F.; Seaquist, J. W.

    2005-05-01

    The HABSEED model uses remote sensing derived NPP as a surrogate for habitat quality as the driving mechanism for population growth and local seed dispersal. The model has been applied to the Sahel region of Africa. Results show that the functional response of plants to habitat quality alters population distribution. Plants more tolerant of medium quality habitat have greater distributions to the North while plants requiring only the best habitat are limited to the South. For all functional response types, increased seed production results in diminishing returns. Functional response types have been related to life history tradeoffs and r-K strategies based on the results. Results are compared to remote sensing derived vegetation land cover.

  15. Pyridoxal derived chemosensor for chromogenic sensing of Cu2+ and fluorogenic sensing of Fe3+ in semi-aqueous medium

    International Nuclear Information System (INIS)

    Sahoo, Suban K.; Sharma, Darshna; Moirangthem, Anuradha; Kuba, Aman; Thomas, Rini; Kumar, Rajender; Kuwar, Anil; Choi, Heung-Jin; Basu, Anupam

    2016-01-01

    An easy-to-prepare chemosensor L was developed by condensation of pyridoxal with 1,8-diaminonaphthalene. In DMSO:H 2 O (1:1, v/v), sensor L displayed a highly selective and sensitive response towards Cu 2+ via perceptible color and UV–vis absorbance changes among the other tested metal ions. However, the fluorescence of L is selectively quenched in the presence of both Fe 3+ and Cu 2+ . With a micromolar detection limit and non-interference from other co-existing metal ions, this sensor can be applied over a wide pH range for the detection of Fe 3+ and Cu 2+ . In addition, the cytotoxicity and fluorescence changes of L within live HeLa cells were examined in the absence and presence of Cu 2+ . - Highlights: • A new noncytotoxic chemosensor derived from vitamin B 6 cofactor was introduced. • Sensor showed colorimetric sensing ability towards Cu 2+ . • Sensor showed fluorescent turn-off sensing ability towards Fe 3+ and Cu 2+ . • Detection limit was better than the prescribed permissible limit.

  16. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  17. Remote sensing reflectance and inherent optical properties of oceanic waters derived from above-water measurements

    Science.gov (United States)

    Lee, Zhongping; Carder, Kendall L.; Steward, Robert G.; Peacock, Thomas G.; Davis, Curtiss O.; Mueller, James L.

    1997-02-01

    Remote-sensing reflectance and inherent optical properties of oceanic properties of oceanic waters are important parameters for ocean optics. Due to surface reflectance, Rrs or water-leaving radiance is difficult to measure from above the surface. It usually is derived by correcting for the reflected skylight in the measured above-water upwelling radiance using a theoretical Fresnel reflectance value. As it is difficult to determine the reflected skylight, there are errors in the Q and E derived Rrs, and the errors may get bigger for high chl_a coastal waters. For better correction of the reflected skylight,w e propose the following derivation procedure: partition the skylight into Rayleigh and aerosol contributions, remove the Rayleigh contribution using the Fresnel reflectance, and correct the aerosol contribution using an optimization algorithm. During the process, Rrs and in-water inherent optical properties are derived at the same time. For measurements of 45 sites made in the Gulf of Mexico and Arabian Sea with chl_a concentrations ranging from 0.07 to 49 mg/m3, the derived Rrs and inherent optical property values were compared with those from in-water measurements. These results indicate that for the waters studied, the proposed algorithm performs quite well in deriving Rrs and in- water inherent optical properties from above-surface measurements for clear and turbid waters.

  18. The influence of land surface parameters on energy flux densities derived from remote sensing data

    Energy Technology Data Exchange (ETDEWEB)

    Tittebrand, A.; Schwiebus, A. [Inst. for Hydrology und Meteorology, TU Dresden (Germany); Berger, F.H. [Observatory Lindenberg, German Weather Service, Lindenberg (Germany)

    2005-04-01

    Knowledge of the vegetation properties surface reflectance, normalised difference vegetation index (NDVI) and leaf area index (LAI) are essential for the determination of the heat and water fluxes between terrestrial ecosystems and the atmosphere. Remote sensing data can be used to derive spatial estimates of the required surface properties. The determination of land surface parameters and their influence on radiant and energy flux densities is investigated with data of different remote sensing systems. Sensitivity studies show the importance of correctly derived land surface properties to estimate the key quantity of the hydrological cycle, the evapotranspiration (L.E), most exactly. In addition to variable parameters like LAI or NDVI there are also parameters which are can not be inferred from satellite data but needed for the Penman-Monteith approach. Fixed values are assumed for these variables because they have little influence on L.E. Data of Landsat-7 ETM+ and NOAA-16 AVHRR are used to show results in different spatial resolution. The satellite derived results are compared with ground truth data provided by the Observatory Lindenberg of the German Weather Service. (orig.)

  19. A spatial-spectral approach for deriving high signal quality eigenvectors for remote sensing image transformations

    DEFF Research Database (Denmark)

    Rogge, Derek; Bachmann, Martin; Rivard, Benoit

    2014-01-01

    Spectral decorrelation (transformations) methods have long been used in remote sensing. Transformation of the image data onto eigenvectors that comprise physically meaningful spectral properties (signal) can be used to reduce the dimensionality of hyperspectral images as the number of spectrally...... distinct signal sources composing a given hyperspectral scene is generally much less than the number of spectral bands. Determining eigenvectors dominated by signal variance as opposed to noise is a difficult task. Problems also arise in using these transformations on large images, multiple flight...... and spectral subsampling to the data, which is accomplished by deriving a limited set of eigenvectors for spatially contiguous subsets. These subset eigenvectors are compiled together to form a new noise reduced data set, which is subsequently used to derive a set of global orthogonal eigenvectors. Data from...

  20. Space-Derived Imagery and a Commercial Remote Sensing Industry: Impossible Dream or Inevitable Reality?

    Science.gov (United States)

    Murray, Felsher

    Landsat-1 was launched in 1972 as a research satellite. Many of us viewed this satellite as a precursor to remote sensing "commercialization." Indeed since that time, the birth, growth and maturation of a remote sensing "industry" has been an ongoing objective for much of the U.S. private sector engaged in space and ground-segment activities related to the acquisition, analysis, and dissemination of imagery. In September 1999 a U.S. commercial entity, Space Imaging, Inc. launched its 1-meter pan/4-meter multispectral IKONOS sensor. DigitalGlobe, Inc. (nee EarthWatch, Inc.) matched this feat in October 2001. Thus, a full 30 years later, we are finally on the brink of building a true remote sensing information industry based on the global availability of competitively-priced space- derived imagery of the Earth. The upcoming availability of similar imagery from non-U.S. sources as ImageSat and U.S. sources as ORBIMAGE will only strengthen that reality. However, a remote sensing industry can only grow by allowing these entities (in times of peace) unencumbered access to a world market. And that market continues to expand -- up 11% in 2001, with gross revenues of U.S. commercial remote sensing firms alone reaching 2.44 billion, according to a joint NASA/ASPRS industry survey. However, the 30-year gap between the research-labeled Landsat-1 and our current commercial successes was not technology-driven. That lacuna was purely political -- driven by valid concerns related to national security. Although the world's governments have cooperated thoroughly and completely in areas related to satellite telecommunications, cooperation in space-derived image information is still today done cautiously and on a case-by-case basis -- and then only for science- based undertakings. It is still a fact that, except for the United States, all other Earth-imaging satellites/sensors flying today are owned, operated, and their products disseminated, by national governments -- and not private

  1. Remote sensing estimation of terrestrially derived colored dissolved organic matterinput to the Arctic Ocean

    Science.gov (United States)

    Li, J.; Yu, Q.; Tian, Y. Q.

    2017-12-01

    The DOC flux from land to the Arctic Ocean has remarkable implication on the carbon cycle, biogeochemical & ecological processes in the Arctic. This lateral carbon flux is required to be monitored with high spatial & temporal resolution. However, the current studies in the Arctic regions were obstructed by the factors of the low spatial coverages. The remote sensing could provide an alternative bio-optical approach to field sampling for DOC dynamics monitoring through the observation of the colored dissolved organic matter (CDOM). The DOC and CDOM were found highly correlated based on the analysis of the field sampling data from the Arctic-GRO. These provide the solid foundation of the remote sensing observation. In this study, six major Arctic Rivers (Yukon, Kolyma, Lena, Mackenzie, Ob', Yenisey) were selected to derive the CDOM dynamics along four years. Our newly developed SBOP algorithm was applied to the large Landsat-8 OLI image data (nearly 100 images) for getting the high spatial resolution results. The SBOP algorithm is the first approach developing for the Shallow Water Bio-optical properties estimation. The CDOM absorption derived from the satellite images were verified with the field sampling results with high accuracy (R2 = 0.87). The distinct CDOM dynamics were found in different Rivers. The CDOM absorptions were found highly related to the hydrological activities and the terrestrially environmental dynamics. Our study helps to build the reliable system for studying the carbon cycle at Arctic regions.

  2. Investigating the relationship between tree heights derived from SIBBORK forest model and remote sensing measurements

    Science.gov (United States)

    Osmanoglu, B.; Feliciano, E. A.; Armstrong, A. H.; Sun, G.; Montesano, P.; Ranson, K.

    2017-12-01

    Tree heights are one of the most commonly used remote sensing parameters to measure biomass of a forest. In this project, we investigate the relationship between remotely sensed tree heights (e.g. G-LiHT lidar and commercially available high resolution satellite imagery, HRSI) and the SIBBORK modeled tree heights. G-LiHT is a portable, airborne imaging system that simultaneously maps the composition, structure, and function of terrestrial ecosystems using lidar, imaging spectroscopy and thermal mapping. Ground elevation and canopy height models were generated using the lidar data acquired in 2012. A digital surface model was also generated using the HRSI technique from the commercially available WorldView data in 2016. The HRSI derived height and biomass products are available at the plot (10x10m) level. For this study, we parameterized the SIBBORK individual-based gap model for Howland forest, Maine. The parameterization was calibrated using field data for the study site and results show that the simulated forest reproduces the structural complexity of Howland old growth forest, based on comparisons of key variables including, aboveground biomass, forest height and basal area. Furthermore carbon cycle and ecosystem observational capabilities will be enhanced over the next 6 years via the launch of two LiDAR (NASA's GEDI and ICESAT 2) and two SAR (NASA's ISRO NiSAR and ESA's Biomass) systems. Our aim is to present the comparison of canopy height models obtained with SIBBORK forest model and remote sensing techniques, highlighting the synergy between individual-based forest modeling and high-resolution remote sensing.

  3. Surface plasmon resonance spectroscopic study of UV-addressable phenylalanine sensing based on a self-assembled spirooxazine derivative monolayer

    International Nuclear Information System (INIS)

    Suk, Shinae; Suh, Hee-Jung; Gun An, Won; Kim, Jae-Ho; Jin, Sung-Ho; Kim, Sung-Hoon; Gal, Yeong-Soon; Koh, Kwangnak

    2004-01-01

    Light-addressable compounds are very interesting due to the possibilities of their practical use such as optical switches and memories or variable transmission materials. For example, transportation of phenylalanine across liposomal bilayers mediated by a photoresponsive carrier like spirooxazine through electrostatic interaction between phenylalanine and spirooxazine derivative. Thus, the spirooxazine is expected to form a UV-addressable phenylalanine sensing interface. In this study, we prepared phenylalanine sensing interface of a spirooxazine derivative by self-assembly technique and evaluated interaction between a spirooxazine moiety and phenylalanine with a surface plasmon resonance (SPR). The refractive index change of monolayer caused by interaction between a spirooxazine derivative and phenylalanine led to the SPR angle shifts upon UV irradiation. The SPR angle shift increased with increasing the concentration of phenylalanine solution. These results indicated that the spirooxazine derivative self-assembled monolayer (SAM) has an application potential for UV-addressable phenylalanine sensing

  4. Relationship between different approaches to derive weighting functions related to atmospheric remote sensing problems

    International Nuclear Information System (INIS)

    Rozanov, Vladimir V.; Rozanov, Alexei V.

    2007-01-01

    The paper is devoted to the investigation of the relationship between different methods used to derive weighting functions required to solve numerous inverse problems related to the remote sensing of the Earth's atmosphere by means of scattered solar light observations. The first method commonly referred to as the forward-adjoint approach is based on a joint solution of the forward and adjoint radiative transfer equations and the second one requires the linearized forward radiative transfer equation to be solved. In the framework of the forward-adjoint method we consider two approaches commonly used to derive the weighting functions. These approaches are referenced as the 'response function' and the 'formal solution' techniques, respectively. We demonstrate here that the weighting functions derived employing the formal solution technique can also be obtained substituting the analytical representations for the direct forward and direct adjoint intensities into corresponding expressions obtained in the framework of the response function technique. The advantages and disadvantages of different techniques are discussed

  5. Formation and Characterization of Self-Assembled Phenylboronic Acid Derivative Monolayers toward Developing Monosaccaride Sensing-Interface

    Directory of Open Access Journals (Sweden)

    Kwangnak Koh

    2007-08-01

    Full Text Available We designed and synthesized phenylboronic acid as a molecular recognitionmodel system for saccharide detection. The phenylboronic acid derivatives that haveboronic acid moiety are well known to interact with saccharides in aqueous solution; thus,they can be applied to a functional interface of saccharide sensing through the formation ofself-assembled monolayer (SAM. In this study, self-assembled phenylboronic acidderivative monolayers were formed on Au surface and carefully characterized by atomicforce microscopy (AFM, Fourier transform infrared reflection absorption spectroscopy(FTIR-RAS, surface enhanced Raman spectroscopy (SERS, and surface electrochemicalmeasurements. The saccharide sensing application was investigated using surface plasmonresonance (SPR spectroscopy. The phenylboronic acid monolayers showed goodsensitivity of monosaccharide sensing even at the low concentration range (1.0 × 10-12 M.The SPR angle shift derived from interaction between phenylboronic acid andmonosaccharide was increased with increasing the alkyl spacer length of synthesizedphenylboronic acid derivatives.

  6. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  7. Comparing land surface phenology derived from satellite and GPS network microwave remote sensing.

    Science.gov (United States)

    Jones, Matthew O; Kimball, John S; Small, Eric E; Larson, Kristine M

    2014-08-01

    The land surface phenology (LSP) start of season (SOS) metric signals the seasonal onset of vegetation activity, including canopy growth and associated increases in land-atmosphere water, energy and carbon (CO2) exchanges influencing weather and climate variability. The vegetation optical depth (VOD) parameter determined from satellite passive microwave remote sensing provides for global LSP monitoring that is sensitive to changes in vegetation canopy water content and biomass, and insensitive to atmosphere and solar illumination constraints. Direct field measures of canopy water content and biomass changes desired for LSP validation are generally lacking due to the prohibitive costs of maintaining regional monitoring networks. Alternatively, a normalized microwave reflectance index (NMRI) derived from GPS base station measurements is sensitive to daily vegetation water content changes and may provide for effective microwave LSP validation. We compared multiyear (2007-2011) NMRI and satellite VOD records at over 300 GPS sites in North America, and their derived SOS metrics for a subset of 24 homogenous land cover sites to investigate VOD and NMRI correspondence, and potential NMRI utility for LSP validation. Significant correlations (P<0.05) were found at 276 of 305 sites (90.5 %), with generally favorable correspondence in the resulting SOS metrics (r (2)=0.73, P<0.001, RMSE=36.8 days). This study is the first attempt to compare satellite microwave LSP metrics to a GPS network derived reflectance index and highlights both the utility and limitations of the NMRI data for LSP validation, including spatial scale discrepancies between local NMRI measurements and relatively coarse satellite VOD retrievals.

  8. Changing Requirements for Archiving Climate Data Records Derived From Remotely Sensed Data

    Science.gov (United States)

    Fleig, A. J.; Tilmes, C.

    2007-05-01

    With the arrival of long term sets of measurements of remotely sensed data it becomes important to improve the standard practices associated with archival of information needed to allow creation of climate data records, CDRs, from individual sets of measurements. Several aspects of the production of CDRs suggest that there should be changes in standard best practices for archival. A fundamental requirement for understanding long- term trends in climate data is that changes with time shown by the data reflect changes in actual geophysical parameters rather than changes in the measurement system. Even well developed and validated data sets from remotely sensed measurements contain artifacts. If the nature of the measurement and the algorithm is consistent over time, these artifacts may have little impact on trends derived from the data. However data sets derived with different algorithms created with different assumptions are likely to introduce non-physical changes in trend data. Yet technology for making measurements and analyzing data improves with time and this must be accounted for. To do this for an ongoing long term data set based on multiple instruments it is important to understand exactly how the preceding data was produced. But we are reaching the point where the scientists and engineers that developed the initial measurements and algorithms are no longer available to explain and assist in adapting today's systems for use with future measurement systems. In an era where tens to hundreds of man years are involved in calibrating an instrument and producing and validating a set of geophysical measurements from the calibrated data we have long passed the time when it was reasonable to say "just give me the basic measurement and a bright graduate student and I can produce anything I need in a year." Examples of problems encountered and alternative solutions will be provided based on developing and reprocessing data sets from long term measurements of

  9. Twenty-four year record of Northern Hemisphere snow cover derived from passive microwave remote sensing

    Science.gov (United States)

    Armstrong, Richard L.; Brodzik, Mary Jo

    2003-04-01

    Snow cover is an important variable for climate and hydrologic models due to its effects on energy and moisture budgets. Seasonal snow can cover more than 50% of the Northern Hemisphere land surface during the winter resulting in snow cover being the land surface characteristic responsible for the largest annual and interannual differences in albedo. Passive microwave satellite remote sensing can augment measurements based on visible satellite data alone because of the ability to acquire data through most clouds or during darkness as well as to provide a measure of snow depth or water equivalent. It is now possible to monitor the global fluctuation of snow cover over a 24 year period using passive microwave data (Scanning Multichannel Microwave Radiometer (SMMR) 1978-1987 and Special Sensor Microwave/Imager (SSM/I), 1987-present). Evaluation of snow extent derived from passive microwave algorithms is presented through comparison with the NOAA Northern Hemisphere snow extent data. For the period 1978 to 2002, both passive microwave and visible data sets show a smiliar pattern of inter-annual variability, although the maximum snow extents derived from the microwave data are consistently less than those provided by the visible statellite data and the visible data typically show higher monthly variability. During shallow snow conditions of the early winter season microwave data consistently indicate less snow-covered area than the visible data. This underestimate of snow extent results from the fact that shallow snow cover (less than about 5.0 cm) does not provide a scattering signal of sufficient strength to be detected by the algorithms. As the snow cover continues to build during the months of January through March, as well as on into the melt season, agreement between the two data types continually improves. This occurs because as the snow becomes deeper and the layered structure more complex, the negative spectral gradient driving the passive microwave algorithm

  10. Hg(II) sensing platforms with improved photostability: The combination of rhodamine derived chemosensors and up-conversion nanocrystals.

    Science.gov (United States)

    Song, Kai; Mo, Jingang; Lu, Chengwen

    2017-05-15

    This paper reported two nanocomposite sensing platforms for Hg(II) detection with improved photostability, using two rhodamine derivatives as chemosensors and up-conversion nanocrystals as excitation host, respectively. There existed a secondary energy transfer from this excitation host to these chemosensors, which was confirmed by spectral analysis, energy transfer radius calculation and emission decay lifetime comparison. In this case, chemosensor photostability was greatly improved. Further analysis suggested that these chemosensors recognized Hg(II) following a simple binding stoichiometry of 1:1. Hg(II) sensing performance of these sensing platforms was analyzed through their emission spectra upon various Hg(II) concentrations. Emission spectral response, Stern-Volmer equation, emission stability and sensing selectivity were discussed in detail. It was finally concluded that these chemosensors showed emission turn on effect towards Hg(II), with high photostability, good selectivity and linear response. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Urban thermal environment and its biophysical parameters derived from satellite remote sensing imagery

    Science.gov (United States)

    Zoran, Maria A.; Savastru, Roxana S.; Savastru, Dan M.; Tautan, Marina N.; Baschir, Laurentiu V.

    2013-10-01

    In frame of global warming, the field of urbanization and urban thermal environment are important issues among scientists all over the world. This paper investigated the influences of urbanization on urban thermal environment as well as the relationships of thermal characteristics to other biophysical variables in Bucharest metropolitan area of Romania based on satellite remote sensing imagery Landsat TM/ETM+, time series MODIS Terra/Aqua data and IKONOS acquired during 1990 - 2012 period. Vegetation abundances and percent impervious surfaces were derived by means of linear spectral mixture model, and a method for effectively enhancing impervious surface has been developed to accurately examine the urban growth. The land surface temperature (Ts), a key parameter for urban thermal characteristics analysis, was also retrieved from thermal infrared band of Landsat TM/ETM+, from MODIS Terra/Aqua datasets. Based on these parameters, the urban growth, urban heat island effect (UHI) and the relationships of Ts to other biophysical parameters have been analyzed. Results indicated that the metropolitan area ratio of impervious surface in Bucharest increased significantly during two decades investigated period, the intensity of urban heat island and heat wave events being most significant. The correlation analyses revealed that, at the pixel-scale, Ts possessed a strong positive correlation with percent impervious surfaces and negative correlation with vegetation abundances at the regional scale, respectively. This analysis provided an integrated research scheme and the findings can be very useful for urban ecosystem modeling.

  12. REMOTE SENSING AND SURFACE ENERGY FLUX MODELS TO DERIVE EVAPOTRANSPIRATION AND CROP COEFFICIENT

    Directory of Open Access Journals (Sweden)

    Salvatore Barbagallo

    2008-06-01

    Full Text Available Remote sensing techniques using high resolution satellite images provide opportunities to evaluate daily crop water use and its spatial and temporal distribution on a field by field basis. Mapping this indicator with pixels of few meters of size on extend areas allows to characterize different processes and parameters. Satellite data on vegetation reflectance, integrated with in field measurements of canopy coverage features and the monitoring of energy fluxes through the soil-plant-atmosphere system, allow to estimate conventional irrigation components (ET, Kc thus improving irrigation strategies. In the study, satellite potential evapotranspiration (ETp and crop coefficient (Kc maps of orange orchards are derived using semi-empirical approaches between reflectance data from IKONOS imagery and ground measurements of vegetation features. The monitoring of energy fluxes through the orchard allows to estimate actual crop evapotranspiration (ETa using energy balance and the Surface Renewal theory. The approach indicates substantial promise as an efficient, accurate and relatively inexpensive procedure to predict actual ET fluxes and Kc from irrigated lands.

  13. Ca{sup 2+} ion sensing by a piperidin-4-one derivative and the effect of β-cyclodextrin complexation on the sensing

    Energy Technology Data Exchange (ETDEWEB)

    Sumithra, M.; Sivaraj, R.; Selvan, G. Tamil; Selvakumar, P. Mosae; Enoch, Israel V.M.V., E-mail: drisraelenoch@gmail.com

    2017-05-15

    In this paper, we report the turn-on fluorescence based Ca{sup 2+} ion sensing by an anthracene piperidin-4-one derivative. The compound is obtained using a simple two step synthesis. The compound is characterized using NMR and mass spectral methods. The host-guest complex formation of the compound with β-cyclodextrin is prepared and characterized using fluorescence and 2D ROESY spectroscopy. The compound forms the inclusion complex with a 1:1 stoichiometry. The structure of the host-guest complex is proposed. The Ca{sup 2+} ion selectivity of the compound in its free form and cyclodextrin-bound forms are studied. In both the forms, the piperidin-4-one derivative senses Ca{sup 2+} and in the case of the cyclodextrin encapsulated form it shows a better competitive binding of Ca{sup 2+} in the presence of other metal ions. - Highlights: •An anthracene iminoderivative of 3-methyl-2,6-diphenylpiperidin-4-one is synthesized. •The anthracene moiety of the compound is encapsulated by β-Cyclodextrin. •The compound senses Ca{sup 2+} ion both in water and β-CD media. •β-CD molecule does not interrupt the Ca{sup 2+} ion binding.

  14. Landscape effects of wildfire on permafrost distribution in interior Alaska derived from remote sensing

    Science.gov (United States)

    Brown, Dana R. N.; Jorgenson, M. Torre; Kielland, Knut; Verbyla, David L.; Prakash, Anupma; Koch, Joshua C.

    2016-01-01

    Climate change coupled with an intensifying wildfire regime is becoming an important driver of permafrost loss and ecosystem change in the northern boreal forest. There is a growing need to understand the effects of fire on the spatial distribution of permafrost and its associated ecological consequences. We focus on the effects of fire a decade after disturbance in a rocky upland landscape in the interior Alaskan boreal forest. Our main objectives were to (1) map near-surface permafrost distribution and drainage classes and (2) analyze the controls over landscape-scale patterns of post-fire permafrost degradation. Relationships among remote sensing variables and field-based data on soil properties (temperature, moisture, organic layer thickness) and vegetation (plant community composition) were analyzed using correlation, regression, and ordination analyses. The remote sensing data we considered included spectral indices from optical datasets (Landsat 7 Enhanced Thematic Mapper Plus (ETM+) and Landsat 8 Operational Land Imager (OLI)), the principal components of a time series of radar backscatter (Advanced Land Observing Satellite—Phased Array type L-band Synthetic Aperture Radar (ALOS-PALSAR)), and topographic variables from a Light Detection and Ranging (LiDAR)-derived digital elevation model (DEM). We found strong empirical relationships between the normalized difference infrared index (NDII) and post-fire vegetation, soil moisture, and soil temperature, enabling us to indirectly map permafrost status and drainage class using regression-based models. The thickness of the insulating surface organic layer after fire, a measure of burn severity, was an important control over the extent of permafrost degradation. According to our classifications, 90% of the area considered to have experienced high severity burn (using the difference normalized burn ratio (dNBR)) lacked permafrost after fire. Permafrost thaw, in turn, likely increased drainage and resulted in

  15. Landscape Effects of Wildfire on Permafrost Distribution in Interior Alaska Derived from Remote Sensing

    Directory of Open Access Journals (Sweden)

    Dana R.N. Brown

    2016-08-01

    Full Text Available Climate change coupled with an intensifying wildfire regime is becoming an important driver of permafrost loss and ecosystem change in the northern boreal forest. There is a growing need to understand the effects of fire on the spatial distribution of permafrost and its associated ecological consequences. We focus on the effects of fire a decade after disturbance in a rocky upland landscape in the interior Alaskan boreal forest. Our main objectives were to (1 map near-surface permafrost distribution and drainage classes and (2 analyze the controls over landscape-scale patterns of post-fire permafrost degradation. Relationships among remote sensing variables and field-based data on soil properties (temperature, moisture, organic layer thickness and vegetation (plant community composition were analyzed using correlation, regression, and ordination analyses. The remote sensing data we considered included spectral indices from optical datasets (Landsat 7 Enhanced Thematic Mapper Plus (ETM+ and Landsat 8 Operational Land Imager (OLI, the principal components of a time series of radar backscatter (Advanced Land Observing Satellite—Phased Array type L-band Synthetic Aperture Radar (ALOS-PALSAR, and topographic variables from a Light Detection and Ranging (LiDAR-derived digital elevation model (DEM. We found strong empirical relationships between the normalized difference infrared index (NDII and post-fire vegetation, soil moisture, and soil temperature, enabling us to indirectly map permafrost status and drainage class using regression-based models. The thickness of the insulating surface organic layer after fire, a measure of burn severity, was an important control over the extent of permafrost degradation. According to our classifications, 90% of the area considered to have experienced high severity burn (using the difference normalized burn ratio (dNBR lacked permafrost after fire. Permafrost thaw, in turn, likely increased drainage and resulted

  16. Plant-Derived Natural Products as Sources of Anti-Quorum Sensing Compounds

    OpenAIRE

    Koh, Chong-Lek; Sam, Choon-Kook; Yin, Wai-Fong; Tan, Li Ying; Krishnan, Thiba; Chong, Yee Meng; Chan, Kok-Gan

    2013-01-01

    Quorum sensing is a system of stimuli and responses in relation to bacterial cell population density that regulates gene expression, including virulence determinants. Consequently, quorum sensing has been an attractive target for the development of novel anti-infective measures that do not rely on the use of antibiotics. Anti-quorum sensing has been a promising strategy to combat bacterial infections as it is unlikely to develop multidrug resistant pathogens since it does not impose any selec...

  17. "Using Satellite Remote Sensing to Derive Numeric Criteria in Coastal and Inland Waters of the United States"

    Science.gov (United States)

    Crawford, T. N.; Schaeffer, B. A.

    2016-12-01

    Anthropogenic nutrient pollution is a major stressor of aquatic ecosystems around the world. In the United States, states and tribes can adopt numeric water quality values (i.e. criteria) into their water quality management standards to protect aquatic life from eutrophication impacts. However, budget and resource constraints have limited the ability of many states and tribes to collect the water quality monitoring data needed to derive numeric criteria. Over the last few decades, satellite technology has provided water quality measurements on a global scale over long time periods. Water quality managers are finding the data provided by satellite technology useful in managing eutrophication impacts in coastal waters, estuaries, lakes, and reservoirs. In recent years EPA has worked with states and tribes to derive remotely sensed numeric Chl-a criteria for coastal waters with limited field-based data. This approach is now being expanded and used to derive Chl-a criteria in freshwater systems across the United States. This presentation will cover EPA's approach to derive numeric Chl-a criteria using satellite remote sensing, recommendations to improve satellite sensors to expand applications, potential areas of interest, and the challenges of using remote sensing to establish water quality management goals, as well as provide a case in which this approach has been applied.

  18. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  19. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  20. A highly selective fluorescence sensing platform for nanomolar Hg(II) detection based on cytosine derived quantum dot

    Science.gov (United States)

    Luo, Liang; Song, Ting; Wang, Haoqiang; Yuan, Qunhui; Zhou, Shenghai

    2018-03-01

    Inspired by low toxicity and good biocompatibility of biomass derived quantum dot (QD), we herein developed a cytosine derived quantum dot, namely cyt-dot, via a one-step hydrothermal synthesis. The as-prepared cyt-dot emits blue fluorescence (FL) containing abundant oxygen (20.6 at.%) and nitrogen (24.1 at.%) contents. The cyt-dot based sensing platform shows exclusive selectivity for Hg(II) while being insensitive towards Fe(III) and Ag(I), which are important interference that usually cannot be ruled out. The detection limit for Hg(II) is of 11 nM, which is very close to the guideline value of 10 nM allowed by the U.S. Environmental Protection Agency in drinking water. In real water sample analyses, the present sensing platform can fulfil satisfied recoveries ranging from 100% to 108%. Besides, the acidity of solution has almost no effect on the sensing performance of the cyt-dot in a pH range of 5-8, suggesting its potential applications in sensing and bio-imaging.

  1. Polymer-derived microporous ceramics for membranes and sensors for high temperature hydrogen purification and sensing

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, Ravi Mohan

    2012-06-11

    The growing interest in the use of hydrogen as main fuel has increased the need for pure hydrogen (H{sub 2}) production and purification. There are several by-products (CO, H{sub 2}O, CO{sub 2}) associated with the production of hydrogen which might damage the production rate. Therefore, separation of hydrogen from other gases is an important step in the hydrogen production process. If H{sub 2} can be selectively removed from the product side during hydrogen production in membrane reactors, then it would be possible to achieve complete CO conversion in a single-step under high temperature conditions. The main goal of the present work is the high temperature H{sub 2} purification and sensing by applying polymer-derived ceramics. To prove the concept, the microporous SiBCN, Si{sub 3}N{sub 4} and SiCN ceramic membranes have been synthesized by the polymer-pyrolysis route and their performance for the hydrogen separation have been evaluated in tubular membranes as well as in planar chemiresistors. The synthesis of amorphous SiBCN ceramics has been realized through pyrolysis of poly(organoborosilazanes) in argon. Multilayered amorphous SiBCN/{gamma}-Al{sub 2}O{sub 3}/{alpha}-Al{sub 2}O{sub 3} membranes with gradient porosity have been realized and assessed with respect to the thermal stability, pore-size distribution and H{sub 2}/CO permeance. N{sub 2}-adsorption measurement indicates micropores in the range of 0.68-0.73 nm for three-fold SiBCN/{gamma}-Al{sub 2}O{sub 3}/{alpha}-Al{sub 2}O{sub 3} membrane. SEM characterization of three-fold SiBCN/{gamma}-Al{sub 2}O{sub 3}/{alpha}-Al{sub 2}O{sub 3} membrane shows the thickness of SiBCN membrane layer is 2.8 {mu}m; gas permeance measurements of the membrane shows H{sub 2}/CO selectivity of about 10.5 and the H{sub 2} permeance of about 1.05 x 10{sup -8} mol m{sup -2}s{sup -1}Pa{sup -1}. The observed gas permeation properties point out that the transportation of gas molecules through the membrane is governed by both

  2. A macroecological analysis of SERA derived forest heights and implications for forest volume remote sensing.

    Science.gov (United States)

    Brolly, Matthew; Woodhouse, Iain H; Niklas, Karl J; Hammond, Sean T

    2012-01-01

    Individual trees have been shown to exhibit strong relationships between DBH, height and volume. Often such studies are cited as justification for forest volume or standing biomass estimation through remote sensing. With resolution of common satellite remote sensing systems generally too low to resolve individuals, and a need for larger coverage, these systems rely on descriptive heights, which account for tree collections in forests. For remote sensing and allometric applications, this height is not entirely understood in terms of its location. Here, a forest growth model (SERA) analyzes forest canopy height relationships with forest wood volume. Maximum height, mean, H₁₀₀, and Lorey's height are examined for variability under plant number density, resource and species. Our findings, shown to be allometrically consistent with empirical measurements for forested communities world-wide, are analyzed for implications to forest remote sensing techniques such as LiDAR and RADAR. Traditional forestry measures of maximum height, and to a lesser extent H₁₀₀ and Lorey's, exhibit little consistent correlation with forest volume across modeled conditions. The implication is that using forest height to infer volume or biomass from remote sensing requires species and community behavioral information to infer accurate estimates using height alone. SERA predicts mean height to provide the most consistent relationship with volume of the height classifications studied and overall across forest variations. This prediction agrees with empirical data collected from conifer and angiosperm forests with plant densities ranging between 10²-10⁶ plants/hectare and heights 6-49 m. Height classifications investigated are potentially linked to radar scattering centers with implications for allometry. These findings may be used to advance forest biomass estimation accuracy through remote sensing. Furthermore, Lorey's height with its specific relationship to remote sensing

  3. Plant-Derived Natural Products as Sources of Anti-Quorum Sensing Compounds

    Directory of Open Access Journals (Sweden)

    Kok-Gan Chan

    2013-05-01

    Full Text Available Quorum sensing is a system of stimuli and responses in relation to bacterial cell population density that regulates gene expression, including virulence determinants. Consequently, quorum sensing has been an attractive target for the development of novel anti-infective measures that do not rely on the use of antibiotics. Anti-quorum sensing has been a promising strategy to combat bacterial infections as it is unlikely to develop multidrug resistant pathogens since it does not impose any selection pressure. A number of anti-quorum sensing approaches have been documented and plant-based natural products have been extensively studied in this context. Plant matter is one of the major sources of chemicals in use today in various industries, ranging from the pharmaceutical, cosmetic, and food biotechnology to the textile industries. Just like animals and humans, plants are constantly exposed to bacterial infections, it is therefore logical to expect that plants have developed sophisticated of chemical mechanisms to combat pathogens. In this review, we have surveyed the various types of plant-based natural products that exhibit anti-quorum sensing properties and their anti-quorum sensing mechanisms.

  4. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  5. Cloud-to-Ground Lightning Estimates Derived from SSMI Microwave Remote Sensing and NLDN

    Science.gov (United States)

    Winesett, Thomas; Magi, Brian; Cecil, Daniel

    2015-01-01

    Lightning observations are collected using ground-based and satellite-based sensors. The National Lightning Detection Network (NLDN) in the United States uses multiple ground sensors to triangulate the electromagnetic signals created when lightning strikes the Earth's surface. Satellite-based lightning observations have been made from 1998 to present using the Lightning Imaging Sensor (LIS) on the NASA Tropical Rainfall Measuring Mission (TRMM) satellite, and from 1995 to 2000 using the Optical Transient Detector (OTD) on the Microlab-1 satellite. Both LIS and OTD are staring imagers that detect lightning as momentary changes in an optical scene. Passive microwave remote sensing (85 and 37 GHz brightness temperatures) from the TRMM Microwave Imager (TMI) has also been used to quantify characteristics of thunderstorms related to lightning. Each lightning detection system has fundamental limitations. TRMM satellite coverage is limited to the tropics and subtropics between 38 deg N and 38 deg S, so lightning at the higher latitudes of the northern and southern hemispheres is not observed. The detection efficiency of NLDN sensors exceeds 95%, but the sensors are only located in the USA. Even if data from other ground-based lightning sensors (World Wide Lightning Location Network, the European Cooperation for Lightning Detection, and Canadian Lightning Detection Network) were combined with TRMM and NLDN, there would be enormous spatial gaps in present-day coverage of lightning. In addition, a globally-complete time history of observed lightning activity is currently not available either, with network coverage and detection efficiencies varying through the years. Previous research using the TRMM LIS and Microwave Imager (TMI) showed that there is a statistically significant correlation between lightning flash rates and passive microwave brightness temperatures. The physical basis for this correlation emerges because lightning in a thunderstorm occurs where ice is first

  6. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  7. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  8. Solución de modelos matemáticos, utilizando el software derive en aplicaciones de ecuaciones diferenciales de primer orden

    Directory of Open Access Journals (Sweden)

    Jhon Franklin Espinosa-Castro

    2013-01-01

    Full Text Available With the continuous advance of the exact sciences, through technology in different real contexts, we have used mathematical models represented by differential equations that describe the phenomenon to be analyzed, and the solution has allowed to give satisfactory answers in the study and manipulation Of variables. For this reason, the following article was developed, in which different applications of the first order differential equations in biology, chemistry, physics and economics are explained by the mathematical software Derive, using two types of methodology: application and explanatory. Among the topics discussed are two groups; In the first one are: temperature of an object when leaving a furnace, growth of a bacterial colony, load and current of an RC circuit, concentration of salt in a tank with brine and balance of a bank account with continuous interest, Which are determined with respect to the passage of time; And in the second they are valproic acid in the body, contamination of lake Michigan and dating of a fossil with carbon 14, in which a time was found according to the data supplied; Due to the above, only the exercises in the first group have graphs, and are exponential. Finally, it was determined that all the exercises performed had in common the intervention of time. In addition, a dimensionless constant was used depending on the application.

  9. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  10. Enhanced Electromagnetic and Chemical/Biological Sensing. Properties of Atomic Cluster-Derived Materials

    National Research Council Canada - National Science Library

    Schatz, George

    2003-01-01

    The Center for Atomic Clusters-derived Materials performed a broad range of research concerned with synthesizing, characterizing and utilizing atomic and molecular clusters, nanoparticles and nanomaterial...

  11. Pyridoxal derived chemosensor for chromogenic sensing of Cu{sup 2+} and fluorogenic sensing of Fe{sup 3+} in semi-aqueous medium

    Energy Technology Data Exchange (ETDEWEB)

    Sahoo, Suban K., E-mail: suban_sahoo@rediffmail.com [Department of Applied Chemistry, SV National Institute Technology, Surat, Gujrat (India); Department of Applied Chemistry, Kyungpook National University, Daegu 701702 (Korea, Republic of); Sharma, Darshna [Department of Applied Chemistry, SV National Institute Technology, Surat, Gujrat (India); Moirangthem, Anuradha [Molecular Biology and Human Genetics Laboratory, Department of Zoology, The University of Burdwan, Burdwan, West Bengal (India); Kuba, Aman; Thomas, Rini; Kumar, Rajender [Department of Applied Chemistry, SV National Institute Technology, Surat, Gujrat (India); Kuwar, Anil [School of Chemical Sciences, North Maharashtra University, Jalgaon, Maharashtra 425001 (India); Choi, Heung-Jin [Department of Applied Chemistry, Kyungpook National University, Daegu 701702 (Korea, Republic of); Basu, Anupam, E-mail: abasu@zoo.buruniv.ac.in [Molecular Biology and Human Genetics Laboratory, Department of Zoology, The University of Burdwan, Burdwan, West Bengal (India)

    2016-04-15

    An easy-to-prepare chemosensor L was developed by condensation of pyridoxal with 1,8-diaminonaphthalene. In DMSO:H{sub 2}O (1:1, v/v), sensor L displayed a highly selective and sensitive response towards Cu{sup 2+}via perceptible color and UV–vis absorbance changes among the other tested metal ions. However, the fluorescence of L is selectively quenched in the presence of both Fe{sup 3+} and Cu{sup 2+}. With a micromolar detection limit and non-interference from other co-existing metal ions, this sensor can be applied over a wide pH range for the detection of Fe{sup 3+} and Cu{sup 2+}. In addition, the cytotoxicity and fluorescence changes of L within live HeLa cells were examined in the absence and presence of Cu{sup 2+}. - Highlights: • A new noncytotoxic chemosensor derived from vitamin B{sub 6} cofactor was introduced. • Sensor showed colorimetric sensing ability towards Cu{sup 2+}. • Sensor showed fluorescent turn-off sensing ability towards Fe{sup 3+} and Cu{sup 2+}. • Detection limit was better than the prescribed permissible limit.

  12. Universal Dimensions of Meaning Derived from Semantic Relations among Words and Senses: Mereological Completeness vs. Ontological Generality

    Directory of Open Access Journals (Sweden)

    Alexei V. Samsonovich

    2014-07-01

    Full Text Available A key to semantic analysis is a precise and practically useful definition of meaning that is general for all domains of knowledge. We previously introduced the notion of weak semantic map: a metric space allocating concepts along their most general (universal semantic characteristics while at the same time ignoring other, domain-specific aspects of their meanings. Here we address questions of the number, quality, and mutual independence of the weak semantic dimensions. Specifically, we employ semantic relationships not previously used for weak semantic mapping, such as holonymy/meronymy (“is-part/member-of”, and we compare maps constructed from word senses to those constructed from words. We show that the “completeness” dimension derived from the holonym/meronym relation is independent of, and practically orthogonal to, the “abstractness” dimension derived from the hypernym-hyponym (“is-a” relation, while both dimensions are orthogonal to the maps derived from synonymy and antonymy. Interestingly, the choice of using relations among words vs. senses implies a non-trivial trade-off between rich and unambiguous information due to homonymy and polysemy. The practical utility of the new and prior dimensions is illustrated by the automated evaluation of different kinds of documents. Residual analysis of available linguistic resources, such as WordNet, suggests that the number of universal semantic dimensions representable in natural language may be finite. Their complete characterization, as well as the extension of results to non-linguistic materials, remains an open challenge.

  13. Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

    Science.gov (United States)

    Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

    2015-09-01

    Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  14. Remotely sensed rice yield prediction using multi-temporal NDVI data derived from NOAA's-AVHRR.

    Science.gov (United States)

    Huang, Jingfeng; Wang, Xiuzhen; Li, Xinxing; Tian, Hanqin; Pan, Zhuokun

    2013-01-01

    Grain-yield prediction using remotely sensed data have been intensively studied in wheat and maize, but such information is limited in rice, barley, oats and soybeans. The present study proposes a new framework for rice-yield prediction, which eliminates the influence of the technology development, fertilizer application, and management improvement and can be used for the development and implementation of provincial rice-yield predictions. The technique requires the collection of remotely sensed data over an adequate time frame and a corresponding record of the region's crop yields. Longer normalized-difference-vegetation-index (NDVI) time series are preferable to shorter ones for the purposes of rice-yield prediction because the well-contrasted seasons in a longer time series provide the opportunity to build regression models with a wide application range. A regression analysis of the yield versus the year indicated an annual gain in the rice yield of 50 to 128 kg ha(-1). Stepwise regression models for the remotely sensed rice-yield predictions have been developed for five typical rice-growing provinces in China. The prediction models for the remotely sensed rice yield indicated that the influences of the NDVIs on the rice yield were always positive. The association between the predicted and observed rice yields was highly significant without obvious outliers from 1982 to 2004. Independent validation found that the overall relative error is approximately 5.82%, and a majority of the relative errors were less than 5% in 2005 and 2006, depending on the study area. The proposed models can be used in an operational context to predict rice yields at the provincial level in China. The methodologies described in the present paper can be applied to any crop for which a sufficient time series of NDVI data and the corresponding historical yield information are available, as long as the historical yield increases significantly.

  15. Multifunctional PHPMA-Derived Polymer for Ratiometric pH Sensing, Fluorescence Imaging, and Magnetic Resonance Imaging.

    Science.gov (United States)

    Su, Fengyu; Agarwal, Shubhangi; Pan, Tingting; Qiao, Yuan; Zhang, Liqiang; Shi, Zhengwei; Kong, Xiangxing; Day, Kevin; Chen, Meiwan; Meldrum, Deirdre; Kodibagkar, Vikram D; Tian, Yanqing

    2018-01-17

    In this paper, we report synthesis and characterization of a novel multimodality (MRI/fluorescence) probe for pH sensing and imaging. A multifunctional polymer was derived from poly(N-(2-hydroxypropyl)methacrylamide) (PHPMA) and integrated with a naphthalimide-based-ratiometric fluorescence probe and a gadolinium-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid complex (Gd-DOTA complex). The polymer was characterized using UV-vis absorption spectrophotometry, fluorescence spectrofluorophotometry, magnetic resonance imaging (MRI), and confocal microscopy for optical and MRI-based pH sensing and cellular imaging. In vitro labeling of macrophage J774 and esophageal CP-A cell lines shows the polymer's ability to be internalized in the cells. The transverse relaxation time (T 2 ) of the polymer was observed to be pH-dependent, whereas the spin-lattice relaxation time (T 1 ) was not. The pH probe in the polymer shows a strong fluorescence-based ratiometric pH response with emission window changes, exhibiting blue emission under acidic conditions and green emission under basic conditions, respectively. This study provides new materials with multimodalities for pH sensing and imaging.

  16. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells.

    Directory of Open Access Journals (Sweden)

    Jennifer Paijo

    2016-04-01

    Full Text Available Human cytomegalovirus (HCMV infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING and thus induces antiviral type I interferon (IFN-I responses. We found that plasmacytoid dendritic cells (pDC as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages.

  17. Deriving temporally continuous soil moisture estimations at fine resolution by downscaling remotely sensed product

    Science.gov (United States)

    Jin, Yan; Ge, Yong; Wang, Jianghao; Heuvelink, Gerard B. M.

    2018-06-01

    Land surface soil moisture (SSM) has important roles in the energy balance of the land surface and in the water cycle. Downscaling of coarse-resolution SSM remote sensing products is an efficient way for producing fine-resolution data. However, the downscaling methods used most widely require full-coverage visible/infrared satellite data as ancillary information. These methods are restricted to cloud-free days, making them unsuitable for continuous monitoring. The purpose of this study is to overcome this limitation to obtain temporally continuous fine-resolution SSM estimations. The local spatial heterogeneities of SSM and multiscale ancillary variables were considered in the downscaling process both to solve the problem of the strong variability of SSM and to benefit from the fusion of ancillary information. The generation of continuous downscaled remote sensing data was achieved via two principal steps. For cloud-free days, a stepwise hybrid geostatistical downscaling approach, based on geographically weighted area-to-area regression kriging (GWATARK), was employed by combining multiscale ancillary variables with passive microwave remote sensing data. Then, the GWATARK-estimated SSM and China Soil Moisture Dataset from Microwave Data Assimilation SSM data were combined to estimate fine-resolution data for cloudy days. The developed methodology was validated by application to the 25-km resolution daily AMSR-E SSM product to produce continuous SSM estimations at 1-km resolution over the Tibetan Plateau. In comparison with ground-based observations, the downscaled estimations showed correlation (R ≥ 0.7) for both ascending and descending overpasses. The analysis indicated the high potential of the proposed approach for producing a temporally continuous SSM product at fine spatial resolution.

  18. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  19. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  20. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  1. Analysis of spatiotemporal variability of C-factor derived from remote sensing data

    Czech Academy of Sciences Publication Activity Database

    Pechanec, V.; Mráz, A.; Benc, A.; Cudlín, Pavel

    2018-01-01

    Roč. 12, č. 1 (2018), č. článku 016022. ISSN 1931-3195 R&D Projects: GA MŠk(CZ) LO1415 Grant - others:EHP,MF ČR(CZ) EHP-CZ02-OV-1-014-2014 Program:CZ02 Institutional support: RVO:86652079 Keywords : leaf-area index * soil-erosion * water erosion * ecosystem * model * vegetation * europe * fluxes * scale * ndvi * C-factor * soil erosion * erosion models * remote sensing * vegetation Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7) Impact factor: 1.107, year: 2016

  2. Screening of Natural Product Derivatives Identifies Two Structurally Related Flavonoids as Potent Quorum Sensing Inhibitors against Gram-Negative Bacteria

    Directory of Open Access Journals (Sweden)

    Suvi Manner

    2018-05-01

    Full Text Available Owing to the failure of conventional antibiotics in biofilm control, alternative approaches are urgently needed. Inhibition of quorum sensing (QS represents an attractive target since it is involved in several processes essential for biofilm formation. In this study, a compound library of natural product derivatives (n = 3040 was screened for anti-quorum sensing activity using Chromobacterium violaceum as reporter bacteria. Screening assays, based on QS-mediated violacein production and viability, were performed in parallel to identify non-bactericidal QS inhibitors (QSIs. Nine highly active QSIs were identified, while 328 compounds were classified as moderately actives and 2062 compounds as inactives. Re-testing of the highly actives at a lower concentration against C. violaceum, complemented by a literature search, led to the identification of two flavonoid derivatives as the most potent QSIs, and their impact on biofilm maturation in Escherichia coli and Pseudomonas aeruginosa was further investigated. Finally, effects of these leads on swimming and swarming motility of P. aeruginosa were quantified. The identified flavonoids affected all the studied QS-related functions at micromolar concentrations. These compounds can serve as starting points for further optimization and development of more potent QSIs as adjunctive agents used with antibiotics in the treatment of biofilms.

  3. Analysis of spatiotemporal variability of C-factor derived from remote sensing data

    Science.gov (United States)

    Pechanec, Vilém; Mráz, Alexander; Benc, Antonín; Cudlín, Pavel

    2018-01-01

    Soil erosion is an important phenomenon that contributes to the degradation of agricultural land. Even though it is a natural process, human activities can significantly increase its impact on land degradation and present serious limitation on sustainable agricultural land use. Nowadays, the risk of soil erosion is assessed either qualitatively by expert assessment or quantitatively using model-based approach. One of the primary factors affecting the soil erosion assessment is a cover-management factor, C-factor. In the Czech Republic, several models are used to assess the C-factor on a long-term basis based on data collected using traditional tabular methods. This paper presents work to investigate the estimation of both long-term and short-term cover-management factors using remote sensing data. The results demonstrate a successful development of C-factor maps for each month of 2014, growing season average, and annual average for the Czech Republic. C-factor values calculated from remote sensing data confirmed expected trend in their temporal variability for selected crops. The results presented in this paper can be used for enhancing existing methods for estimating C-factor, planning future agricultural activities, and designing technical remediations and improvement activities of land use in the Czech Republic, which are also financially supported by the European Union funds.

  4. Electrochemical sensing platforms based on the different carbon derivative incorporated interface.

    Science.gov (United States)

    Dervisevic, Muamer; Çevik, Emre; Durmuş, Zehra; Şenel, Mehmet

    2016-01-01

    their effects on the properties of these biosensors. Biosensors were prepared by Horseradish peroxidase (HRP) immobilization on the composite electrodes composed of carbon black, carbon nanofiber (CNF), extended graphite, multiwalled carbon nanotube (MWCNT), reduced graphene oxide (REGO) and poly(glycidyl methacrylateco-vinylferrocene) (P(GMA-co-VFc)) as mediator, covalent linker, and host matrix for carbon derivatives. The modified pencil graphite electrode (PGE) was used for the detection of hydrogen peroxide and to follow electrochemical behavior of different carbon derivatives which were recorded. The electrochemical characterization was investigated by cyclic voltammetry and electrochemical impedance spectroscopy methods. Amperometric measurements showed that the REGO and MWCNT modified electrodes have excellent performance in comparison with other carbon derivatives studied.

  5. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  6. Surface Biophysical Parameters Derived From Remote Sensing Data For Urban Changes Assessment

    International Nuclear Information System (INIS)

    Zoran, M.; Pavelescu, G.; Nicolae, D.N.; Talianu, C.

    2007-01-01

    Remote sensing is a key application in global-change science, being very useful for urban climatology and land use-Landcover dynamics analysis.Multi-spectral and multi-temporal satellite imagery (LANDSAT TM, ETM ;SAR ) over 1984 - 2004 period for Bucharest urban area provide the most reliable technique of monitoring of different urban structures regarding the net radiation and heat fluxes associated with urbanization at the regional scale. This study attempts to provide environmental awareness to urban planners in future urban development. The land cover information, properly classified, can provide a spatially and temporally explicit view of societal and environmental attributes and can be an important complement to in-situ measurements

  7. Land Cover Classification Using Integrated Spectral, Temporal, and Spatial Features Derived from Remotely Sensed Images

    Directory of Open Access Journals (Sweden)

    Yongguang Zhai

    2018-03-01

    Full Text Available Obtaining accurate and timely land cover information is an important topic in many remote sensing applications. Using satellite image time series data should achieve high-accuracy land cover classification. However, most satellite image time-series classification methods do not fully exploit the available data for mining the effective features to identify different land cover types. Therefore, a classification method that can take full advantage of the rich information provided by time-series data to improve the accuracy of land cover classification is needed. In this paper, a novel method for time-series land cover classification using spectral, temporal, and spatial information at an annual scale was introduced. Based on all the available data from time-series remote sensing images, a refined nonlinear dimensionality reduction method was used to extract the spectral and temporal features, and a modified graph segmentation method was used to extract the spatial features. The proposed classification method was applied in three study areas with land cover complexity, including Illinois, South Dakota, and Texas. All the Landsat time series data in 2014 were used, and different study areas have different amounts of invalid data. A series of comparative experiments were conducted on the annual time-series images using training data generated from Cropland Data Layer. The results demonstrated higher overall and per-class classification accuracies and kappa index values using the proposed spectral-temporal-spatial method compared to spectral-temporal classification methods. We also discuss the implications of this study and possibilities for future applications and developments of the method.

  8. Spatiotemporal shoreline dynamics of Namibian coastal lagoons derived by a dense remote sensing time series approach

    Science.gov (United States)

    Behling, Robert; Milewski, Robert; Chabrillat, Sabine

    2018-06-01

    This paper proposes the remote sensing time series approach WLMO (Water-Land MOnitor) to monitor spatiotemporal shoreline changes. The approach uses a hierarchical classification system based on temporal MNDWI-trajectories with the goal to accommodate typical uncertainties in remote sensing shoreline extraction techniques such as existence of clouds and geometric mismatches between images. Applied to a dense Landsat time series between 1984 and 2014 for the two Namibian coastal lagoons at Walvis Bay and Sandwich Harbour the WLMO was able to identify detailed accretion and erosion progressions at the sand spits forming these lagoons. For both lagoons a northward expansion of the sand spits of up to 1000 m was identified, which corresponds well with the prevailing northwards directed ocean current and wind processes that are responsible for the material transport along the shore. At Walvis Bay we could also show that in the 30 years of analysis the sand spit's width has decreased by more than a half from 750 m in 1984-360 m in 2014. This ongoing cross-shore erosion process is a severe risk for future sand spit breaching, which would expose parts of the lagoon and the city to the open ocean. One of the major advantages of WLMO is the opportunity to analyze detailed spatiotemporal shoreline changes. Thus, it could be shown that the observed long-term accretion and erosion processes underwent great variations over time and cannot a priori be assumed as linear processes. Such detailed spatiotemporal process patterns are a prerequisite to improve the understanding of the processes forming the Namibian shorelines. Moreover, the approach has also the potential to be used in other coastal areas, because the focus on MNDWI-trajectories allows the transfer to many multispectral satellite sensors (e.g. Sentinel-2, ASTER) available worldwide.

  9. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  10. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  11. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  12. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  13. A new BODIPY-derived ratiometric senor with internal charge transfer (ICT) effect: colorimetric/fluorometric sensing of Ag.

    Science.gov (United States)

    Zhang, Changli; Han, Zhong; Wang, Mengjia; Yang, Zhenghao; Ran, Xueqin; He, Weijiang

    2018-02-13

    With a 4-aminostyryl group introduced at its 3-position, a BODIPY BDP-ODTAC was derived as a new ratiometric sensor for Ag + by modifying 4-amino group as a Ag + chelator, 1-oxa-4,10-dithia-7-azacyclododecane (ODTAC). In addition to the specific Ag + -induced hypsochromic absorption shift from 606 to 562 nm, this sensor demonstrated an excitation shift from 600 to 560 nm due to the internal charge transfer (ICT) effect endowed by the introduced α-4-aminostyryl group. The Ag + -induced recovery and enhancement of the intrinsic local emission band was also observed. The different sensing behavior of ODTAC-BDP with chelator ODTAC substituting on the meso-phenyl group infers that the ratiometric sensing behavior of BDP-ODTAC is correlated to the amino group in ODTAC acting as the electron donor for the ICT effect. With high Ag + selectivity over interfering cations such as Hg 2+ and Pb 2+ , BDP-ODTAC displays a fluorometric limit of detection (LOD) of ∼17 nM (∼0.002 ppm), which is distinctly lower than EPA and WHO standards for drinking water (500 nM, ∼0.055 ppm). Moreover, the BDP-ODTAC-doped PVC film shows the Ag + sensitivity of 1 ppm with a color switch from blue to purple, providing this sensor the ability to determine Ag + in totally aqueous solution sensitively via naked-eye detection.

  14. Vertical profiles of aerosol mass concentration derived by unmanned airborne in situ and remote sensing instruments during dust events

    Science.gov (United States)

    Mamali, Dimitra; Marinou, Eleni; Sciare, Jean; Pikridas, Michael; Kokkalis, Panagiotis; Kottas, Michael; Binietoglou, Ioannis; Tsekeri, Alexandra; Keleshis, Christos; Engelmann, Ronny; Baars, Holger; Ansmann, Albert; Amiridis, Vassilis; Russchenberg, Herman; Biskos, George

    2018-05-01

    In situ measurements using unmanned aerial vehicles (UAVs) and remote sensing observations can independently provide dense vertically resolved measurements of atmospheric aerosols, information which is strongly required in climate models. In both cases, inverting the recorded signals to useful information requires assumptions and constraints, and this can make the comparison of the results difficult. Here we compare, for the first time, vertical profiles of the aerosol mass concentration derived from light detection and ranging (lidar) observations and in situ measurements using an optical particle counter on board a UAV during moderate and weak Saharan dust episodes. Agreement between the two measurement methods was within experimental uncertainty for the coarse mode (i.e. particles having radii > 0.5 µm), where the properties of dust particles can be assumed with good accuracy. This result proves that the two techniques can be used interchangeably for determining the vertical profiles of aerosol concentrations, bringing them a step closer towards their systematic exploitation in climate models.

  15. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  16. Comparison of global inventories of CO emissions from biomass burning derived from remotely sensed data

    Directory of Open Access Journals (Sweden)

    D. Stroppiana

    2010-12-01

    Full Text Available We compare five global inventories of monthly CO emissions named VGT, ATSR, MODIS, GFED3 and MOPITT based on remotely sensed active fires and/or burned area products for the year 2003. The objective is to highlight similarities and differences by focusing on the geographical and temporal distribution and on the emissions for three broad land cover classes (forest, savanna/grassland and agriculture. Globally, CO emissions for the year 2003 range between 365 Tg CO (GFED3 and 1422 Tg CO (VGT. Despite the large uncertainty in the total amounts, some common spatial patterns typical of biomass burning can be identified in the boreal forests of Siberia, in agricultural areas of Eastern Europe and Russia and in savanna ecosystems of South America, Africa and Australia. Regionally, the largest difference in terms of total amounts (CV > 100% and seasonality is observed at the northernmost latitudes, especially in North America and Siberia where VGT appears to overestimate the area affected by fires. On the contrary, Africa shows the best agreement both in terms of total annual amounts (CV = 31% and of seasonality despite some overestimation of emissions from forest and agriculture observed in the MODIS inventory. In Africa VGT provides the most reliable seasonality. Looking at the broad land cover types, the range of contribution to the global emissions of CO is 64–74%, 23–32% and 3–4% for forest, savanna/grassland and agriculture, respectively. These results suggest that there is still large uncertainty in global estimates of emissions and it increases if the comparison is carried by out taking into account the temporal (month and spatial (0.5° × 0.5° cell dimensions. Besides the area affected by fires, also vegetation characteristics and conditions at the time of burning should also be accurately parameterized since they can greatly influence the global estimates of CO emissions.

  17. Issues involved in using sol-gel-derived glasses as platforms for chemical sensing

    Science.gov (United States)

    Doody, Meagan A.; Baker, Gary A.; Pandey, Siddharth; Bonzagni, Neil J.; Bright, Frank V.

    1999-11-01

    Over the past several years our group has been ex;poring the potential of sol-gel-derived glasses as platforms for advanced sensors and biosensors. In this paper we will outline the challenges that are associated with using these xerogels. Toward this end, we discuss recent results from our laboratories on the performance of polyclonal anti- dansyl antibodies sequestered within a series of xerogels. We assess antibody performance by determining the hapten/antibody association constant, the static excitation and emission for the dansyl hapten bound to the antibody combing site, and the excited-state fluorescence anisotropy and intensity decay kinetics for the dansyl/anti-dansyl system within a series of xerogels.

  18. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  19. Analysis of spatio-temporal variability of C-factor derived from remote sensing data

    Science.gov (United States)

    Pechanec, Vilem; Benc, Antonin; Purkyt, Jan; Cudlin, Pavel

    2016-04-01

    procedure and remote sensing, ii) variability assessment of values in different months for selected crops - time variability, growth dynamics and vegetation cover have been taken into account; iii) evaluation of space variability of C-factor values for selected crops - variability of natural conditions, markedly influencing vegetation fitness, has been taken into account. Described methods can be used for the planning of agricultural activities and for the proposing of full-scale land replotting. Presently these activities have been financially supported by the European Structural and Investment Funds.

  20. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  1. The MIL-88A-Derived Fe3O4-Carbon Hierarchical Nanocomposites for Electrochemical Sensing

    Science.gov (United States)

    Wang, Li; Zhang, Yayun; Li, Xia; Xie, Yingzhen; He, Juan; Yu, Jie; Song, Yonghai

    2015-01-01

    Metal or metal oxides/carbon nanocomposites with hierarchical superstructures have become one of the most promising functional materials in sensor, catalysis, energy conversion, etc. In this work, novel hierarchical Fe3O4/carbon superstructures have been fabricated based on metal-organic frameworks (MOFs)-derived method. Three kinds of Fe-MOFs (MIL-88A) with different morphologies were prepared beforehand as templates, and then pyrolyzed to fabricate the corresponding novel hierarchical Fe3O4/carbon superstructures. The systematic studies on the thermal decomposition process of the three kinds of MIL-88A and the effect of template morphology on the products were carried out in detail. Scanning electron microscopy, transmission electron microscopy, X-ray powder diffraction, X-ray photoelectron spectroscopy and thermal analysis were employed to investigate the hierarchical Fe3O4/carbon superstructures. Based on these resulted hierarchical Fe3O4/carbon superstructures, a novel and sensitive nonenzymatic N-acetyl cysteine sensor was developed. The porous and hierarchical superstructures and large surface area of the as-formed Fe3O4/carbon superstructures eventually contributed to the good electrocatalytic activity of the prepared sensor towards the oxidation of N-acetyl cysteine. The proposed preparation method of the hierarchical Fe3O4/carbon superstructures is simple, efficient, cheap and easy to mass production. It might open up a new way for hierarchical superstructures preparation. PMID:26387535

  2. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  3. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  4. Comparison of elevation and remote sensing derived products as auxiliary data for climate surface interpolation

    Science.gov (United States)

    Alvarez, Otto; Guo, Qinghua; Klinger, Robert C.; Li, Wenkai; Doherty, Paul

    2013-01-01

    Climate models may be limited in their inferential use if they cannot be locally validated or do not account for spatial uncertainty. Much of the focus has gone into determining which interpolation method is best suited for creating gridded climate surfaces, which often a covariate such as elevation (Digital Elevation Model, DEM) is used to improve the interpolation accuracy. One key area where little research has addressed is in determining which covariate best improves the accuracy in the interpolation. In this study, a comprehensive evaluation was carried out in determining which covariates were most suitable for interpolating climatic variables (e.g. precipitation, mean temperature, minimum temperature, and maximum temperature). We compiled data for each climate variable from 1950 to 1999 from approximately 500 weather stations across the Western United States (32° to 49° latitude and −124.7° to −112.9° longitude). In addition, we examined the uncertainty of the interpolated climate surface. Specifically, Thin Plate Spline (TPS) was used as the interpolation method since it is one of the most popular interpolation techniques to generate climate surfaces. We considered several covariates, including DEM, slope, distance to coast (Euclidean distance), aspect, solar potential, radar, and two Normalized Difference Vegetation Index (NDVI) products derived from Advanced Very High Resolution Radiometer (AVHRR) and Moderate Resolution Imaging Spectroradiometer (MODIS). A tenfold cross-validation was applied to determine the uncertainty of the interpolation based on each covariate. In general, the leading covariate for precipitation was radar, while DEM was the leading covariate for maximum, mean, and minimum temperatures. A comparison to other products such as PRISM and WorldClim showed strong agreement across large geographic areas but climate surfaces generated in this study (ClimSurf) had greater variability at high elevation regions, such as in the Sierra

  5. Global irrigated area map (GIAM), derived from remote sensing, for the end of the last millennium

    Science.gov (United States)

    Thenkabail, P.S.; Biradar, C.M.; Noojipady, P.; Dheeravath, V.; Li, Y.; Velpuri, M.; Gumma, M.; Gangalakunta, O.R.P.; Turral, H.; Cai, X.; Vithanage, J.; Schull, M.A.; Dutta, R.

    2009-01-01

    A Global Irrigated Area Map (GIAM) has been produced for the end of the last millennium using multiple satellite sensor, secondary, Google Earth and groundtruth data. The data included: (a) Advanced Very High Resolution Radiometer (AVHRR) 3-band and Normalized Difference Vegetation Index (NDVI) 10 km monthly time-series for 1997-1999, (b) Syste me pour l'Observation de la Terre Vegetation (SPOT VGT) NDVI 1 km monthly time series for 1999, (c) East Anglia University Climate Research Unit (CRU) rainfall 50km monthly time series for 1961-2000, (d) Global 30 Arc-Second Elevation Data Set (GTOPO30) 1 km digital elevation data of the World, (e) Japanese Earth Resources Satellite-1 Synthetic Aperture Radar (JERS-1 SAR) data for the rain forests during two seasons in 1996 and (f) University of Maryland Global Tree Cover 1 km data for 1992-1993. A single mega-file data-cube (MFDC) of the World with 159 layers, akin to hyperspectral data, was composed by re-sampling different data types into a common 1 km resolution. The MFDC was segmented based on elevation, temperature and precipitation zones. Classification was performed on the segments. Quantitative spectral matching techniques (SMTs) used in hyperspectral data analysis were adopted to group class spectra derived from unsupervised classification and match them with ideal or target spectra. A rigorous class identification and labelling process involved the use of: (a) space-time spiral curve (ST-SC) plots, (b) brightness-greenness-wetness (BGW) plots, (c) time series NDVI plots, (d) Google Earth very-high-resolution imagery (VHRI) 'zoom-in views' in over 11 000 locations, (e) groundtruth data broadly sourced from the degree confluence project (3 864 sample locations) and from the GIAM project (1 790 sample locations), (f) high-resolution Landsat-ETM+ Geocover 150m mosaic of the World and (g) secondary data (e.g. national and global land use and land cover data). Mixed classes were resolved based on decision tree

  6. Evaluation of snow cover and snow depth on the Qinghai–Tibetan Plateau derived from passive microwave remote sensing

    Directory of Open Access Journals (Sweden)

    L. Dai

    2017-08-01

    Full Text Available Snow cover on the Qinghai–Tibetan Plateau (QTP plays a significant role in the global climate system and is an important water resource for rivers in the high-elevation region of Asia. At present, passive microwave (PMW remote sensing data are the only efficient way to monitor temporal and spatial variations in snow depth at large scale. However, existing snow depth products show the largest uncertainties across the QTP. In this study, MODIS fractional snow cover product, point, line and intense sampling data are synthesized to evaluate the accuracy of snow cover and snow depth derived from PMW remote sensing data and to analyze the possible causes of uncertainties. The results show that the accuracy of snow cover extents varies spatially and depends on the fraction of snow cover. Based on the assumption that grids with MODIS snow cover fraction > 10 % are regarded as snow cover, the overall accuracy in snow cover is 66.7 %, overestimation error is 56.1 %, underestimation error is 21.1 %, commission error is 27.6 % and omission error is 47.4 %. The commission and overestimation errors of snow cover primarily occur in the northwest and southeast areas with low ground temperature. Omission error primarily occurs in cold desert areas with shallow snow, and underestimation error mainly occurs in glacier and lake areas. With the increase of snow cover fraction, the overestimation error decreases and the omission error increases. A comparison between snow depths measured in field experiments, measured at meteorological stations and estimated across the QTP shows that agreement between observation and retrieval improves with an increasing number of observation points in a PMW grid. The misclassification and errors between observed and retrieved snow depth are associated with the relatively coarse resolution of PMW remote sensing, ground temperature, snow characteristics and topography. To accurately understand the variation in snow

  7. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  8. Investigation of cobalt porphyrin doped polymer membrane films for the optical sensing of imidazole and its derivatives

    Directory of Open Access Journals (Sweden)

    Yueyang Tan

    2015-03-01

    Full Text Available A cobalt(II porphyrin was successfully incorporated into polymer membranes for the optical sensing of imidazole and its derivatives. This research has led to a better understanding of the behavior of Co(II porphyrin in solution and in polymeric membranes. In aprotic dichloromethane (DCM, the Co(II tetraphenylporphyrin (CoTPP and Co(II octaethylporphyrin (CoOEP show a sensitive response to imidazole due to the strong ligation of the N-3 on the imidazole ring to the Co(II center, which induces an absorbance change to the Soret band. However, when doped in polymeric films, only the CoTPP exhibits moderate sensitivity towards aqueous imidazole, histamine and histidine. This weakened coordination ability of CoTPP towards imidazole in the polymer films may be due to the coordination of the plasticizer, the impurities from the THF and polymer matrix at the Co(II center. The selectivity of the polymer films towards imidazole over common anions is high. Lifetime of the cobalt(II porphyrin incorporated polymer film was relatively short.

  9. T Follicular Helper Cells Promote a Beneficial Gut Ecosystem for Host Metabolic Homeostasis by Sensing Microbiota-Derived Extracellular ATP.

    Science.gov (United States)

    Perruzza, Lisa; Gargari, Giorgio; Proietti, Michele; Fosso, Bruno; D'Erchia, Anna Maria; Faliti, Caterina Elisa; Rezzonico-Jost, Tanja; Scribano, Daniela; Mauri, Laura; Colombo, Diego; Pellegrini, Giovanni; Moregola, Annalisa; Mooser, Catherine; Pesole, Graziano; Nicoletti, Mauro; Norata, Giuseppe Danilo; Geuking, Markus B; McCoy, Kathy D; Guglielmetti, Simone; Grassi, Fabio

    2017-03-14

    The ATP-gated ionotropic P2X7 receptor regulates T follicular helper (Tfh) cell abundance in the Peyer's patches (PPs) of the small intestine; deletion of P2rx7, encoding for P2X7, in Tfh cells results in enhanced IgA secretion and binding to commensal bacteria. Here, we show that Tfh cell activity is important for generating a diverse bacterial community in the gut and that sensing of microbiota-derived extracellular ATP via P2X7 promotes the generation of a proficient gut ecosystem for metabolic homeostasis. The results of this study indicate that Tfh cells play a role in host-microbiota mutualism beyond protecting the intestinal mucosa by induction of affinity-matured IgA and suggest that extracellular ATP constitutes an inter-kingdom signaling molecule important for selecting a beneficial microbial community for the host via P2X7-mediated regulation of B cell help. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. T Follicular Helper Cells Promote a Beneficial Gut Ecosystem for Host Metabolic Homeostasis by Sensing Microbiota-Derived Extracellular ATP

    Directory of Open Access Journals (Sweden)

    Lisa Perruzza

    2017-03-01

    Full Text Available The ATP-gated ionotropic P2X7 receptor regulates T follicular helper (Tfh cell abundance in the Peyer’s patches (PPs of the small intestine; deletion of P2rx7, encoding for P2X7, in Tfh cells results in enhanced IgA secretion and binding to commensal bacteria. Here, we show that Tfh cell activity is important for generating a diverse bacterial community in the gut and that sensing of microbiota-derived extracellular ATP via P2X7 promotes the generation of a proficient gut ecosystem for metabolic homeostasis. The results of this study indicate that Tfh cells play a role in host-microbiota mutualism beyond protecting the intestinal mucosa by induction of affinity-matured IgA and suggest that extracellular ATP constitutes an inter-kingdom signaling molecule important for selecting a beneficial microbial community for the host via P2X7-mediated regulation of B cell help.

  11. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  12. Construction of a zinc porphyrin-fullerene-derivative based nonenzymatic electrochemical sensor for sensitive sensing of hydrogen peroxide and nitrite.

    Science.gov (United States)

    Wu, Hai; Fan, Suhua; Jin, Xiaoyan; Zhang, Hong; Chen, Hong; Dai, Zong; Zou, Xiaoyong

    2014-07-01

    Enzymatic sensors possess high selectivity but suffer from some limitations such as instability, complicated modified procedure, and critical environmental factors, which stimulate the development of more sensitive and stable nonenzymatic electrochemical sensors. Herein, a novel nonenzymatic electrochemical sensor is proposed based on a new zinc porphyrin-fullerene (C60) derivative (ZnP-C60), which was designed and synthesized according to the conformational calculations and the electronic structures of two typical ZnP-C60 derivatives of para-ZnP-C60 (ZnP(p)-C60) and ortho-ZnP-C60 (ZnP(o)-C60). The two derivatives were first investigated by density functional theory (DFT) and ZnP(p)-C60 with a bent conformation was verified to possess a smaller energy gap and better electron-transport ability. Then ZnP(p)-C60 was entrapped in tetraoctylammonium bromide (TOAB) film and modified on glassy carbon electrode (TOAB/ZnP(p)-C60/GCE). The TOAB/ZnP(p)-C60/GCE showed four well-defined quasi-reversible redox couples with extremely fast direct electron transfer and excellent nonenzymatic sensing ability. The electrocatalytic reduction of H2O2 showed a wide linear range from 0.035 to 3.40 mM, with a high sensitivity of 215.6 μA mM(-1) and a limit of detection (LOD) as low as 0.81 μM. The electrocatalytic oxidation of nitrite showed a linear range from 2.0 μM to 0.164 mM, with a sensitivity of 249.9 μA mM(-1) and a LOD down to 1.44 μM. Moreover, the TOAB/ZnP(p)-C60/GCE showed excellent stability and reproducibility, and good testing recoveries for analysis of the nitrite levels of river water and rainwater. The ZnP(p)-C60 can be used as a novel material for the fabrication of nonenzymatic electrochemical sensors.

  13. Amino-Functionalized Luminescent Metal-Organic Framework Test Paper for Rapid and Selective Sensing of SO2 Gas and Its Derivatives by Luminescence Turn-On Effect.

    Science.gov (United States)

    Wang, Meng; Guo, Lin; Cao, Dapeng

    2018-03-06

    Rapid and selective sensing of sulfur dioxide (SO 2 ) gas has attracted more and more attention because SO 2 not only causes environmental pollution but also severely affects the health of human beings. Here we report an amino-functionalized luminescent metal-organic framework (MOF) material (i.e., MOF-5-NH 2 ) and further investigate its sensing property for SO 2 gas and its derivatives as a luminescent probe. The results indicate that the MOF-5-NH 2 probe can selectively and sensitively sense SO 2 derivatives (i.e., SO 3 2- ) in real time by a luminescence turn-on effect with a lower detection limit of 0.168 ppm and a response time of less than 15 s. Importantly, the luminescence turn-on phenomenon can be observed by the naked eye. We also assembled MOF-5-NH 2 into a test paper to achieve the aim of portable detection, and the lower-limit concentration of the test paper for sensing SO 2 in real time was found to be about 0.05 ppm. Moreover, MOF-5-NH 2 also shows good anti-interference ability, strong luminescence stability, and reusability, which means that this material is an excellent sensing candidate. The amino functionalization may also provide a modification strategy to design luminescent sensors for other atmospheric pollutants.

  14. A Method for Deriving All-Sky Evapotranspiration From the Synergistic Use of Remotely Sensed Images and Meteorological Data

    Science.gov (United States)

    Leng, Pei; Li, Zhao-Liang; Duan, Si-Bo; Tang, Ronglin; Gao, Mao-Fang

    2017-12-01

    Evapotranspiration (ET) is an important component of the water and energy cycle. The present study develops a practical approach for generating all-sky ET with the synergistic use of satellite images and meteorological data. In this approach, the ET over clear-sky pixels is estimated from a two-stage land surface temperature (LST)/fractional vegetation cover feature space method where the dry/wet edges are determined from theoretical calculations. For cloudy pixels, the Penman-Monteith equation is used to calculate the ET where no valid remotely sensed LST is available. An evaluation of the method with ET collected at ground-based large aperture scintillometer measurements at the Yucheng Comprehensive Experimental Station (YCES) in China is performed over a growth period from April to October 2010. The results show that the root-mean-square error (RMSE) and bias over clear-sky pixels are 57.3 W/m2 and 18.2 W/m2, respectively, whereas an RMSE of 69.3 W/m2 with a bias of 12.3 W/m2 can be found over cloudy pixels. Moreover, a reasonable overall RMSE of 65.3 W/m2 with a bias of 14.4 W/m2 at the YCES can be obtained under all-sky conditions, indicating a promising prospect for the derivation of all-sky ET using currently available satellite and meteorological data at a regional or global scale in future developments.

  15. Estimation of global soil respiration by accounting for land-use changes derived from remote sensing data.

    Science.gov (United States)

    Adachi, Minaco; Ito, Akihiko; Yonemura, Seiichiro; Takeuchi, Wataru

    2017-09-15

    Soil respiration is one of the largest carbon fluxes from terrestrial ecosystems. Estimating global soil respiration is difficult because of its high spatiotemporal variability and sensitivity to land-use change. Satellite monitoring provides useful data for estimating the global carbon budget, but few studies have estimated global soil respiration using satellite data. We provide preliminary insights into the estimation of global soil respiration in 2001 and 2009 using empirically derived soil temperature equations for 17 ecosystems obtained by field studies, as well as MODIS climate data and land-use maps at a 4-km resolution. The daytime surface temperature from winter to early summer based on the MODIS data tended to be higher than the field-observed soil temperatures in subarctic and temperate ecosystems. The estimated global soil respiration was 94.8 and 93.8 Pg C yr -1 in 2001 and 2009, respectively. However, the MODIS land-use maps had insufficient spatial resolution to evaluate the effect of land-use change on soil respiration. The spatial variation of soil respiration (Q 10 ) values was higher but its spatial variation was lower in high-latitude areas than in other areas. However, Q 10 in tropical areas was more variable and was not accurately estimated (the values were >7.5 or soil respiration in tropical ecosystems. To solve these problems, it will be necessary to validate our results using a combination of remote sensing data at higher spatial resolution and field observations for many different ecosystems, and it will be necessary to account for the effects of more soil factors in the predictive equations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Rational design and synthesis of new quorum-sensing inhibitors derived from acylated homoserine lactones and natural products from garlic

    DEFF Research Database (Denmark)

    Persson, T.; Rasmussen, Thomas Bovbjerg; Skindersoe, M.

    2005-01-01

    within the binding-site and structural motifs in molecular components isolated from garlic, 7 and 8, shown to be quorum-sensing inhibitors but not antibiotics. A potent quorum-sensing inhibitor N-(heptylsulfanylacetyl)-L-homoserine lactone (10c) was identified. Together with data collected for the other...

  17. Sugar sensing by ChREBP/Mondo-Mlx-new insight into downstream regulatory networks and integration of nutrient-derived signals.

    Science.gov (United States)

    Havula, Essi; Hietakangas, Ville

    2018-04-01

    Animals regulate their physiology with respect to nutrient status, which requires nutrient sensing pathways. Simple carbohydrates, sugars, are sensed by the basic-helix-loop-helix leucine zipper transcription factors ChREBP/Mondo, together with their heterodimerization partner Mlx, which are well-established activators of sugar-induced lipogenesis. Loss of ChREBP/Mondo-Mlx in mouse and Drosophila leads to sugar intolerance, that is, inability to survive on sugar containing diet. Recent evidence has revealed that ChREBP/Mondo-Mlx responds to sugar and fatty acid-derived metabolites through several mechanisms and cross-connects with other nutrient sensing pathways. ChREBP/Mondo-Mlx controls several downstream transcription factors and hormones, which mediate not only readjustment of metabolic pathways, but also control feeding behavior, intestinal digestion, and circadian rhythm. Copyright © 2017. Published by Elsevier Ltd.

  18. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  19. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  20. The calculus primer

    CERN Document Server

    Schaaf, William L

    2011-01-01

    Comprehensive but concise, this introduction to differential and integral calculus covers all the topics usually included in a first course. The straightforward development places less emphasis on mathematical rigor, and the informal manner of presentation sets students at ease. Many carefully worked-out examples illuminate the text, in addition to numerous diagrams, problems, and answers.Bearing the needs of beginners constantly in mind, the treatment covers all the basic concepts of calculus: functions, derivatives, differentiation of algebraic and transcendental functions, partial different

  1. Optical Fiber Chemical Sensor with Sol-Gel Derived Refractive Material as Transducer for High Temperature Gas Sensing in Clean Coal Technology

    Energy Technology Data Exchange (ETDEWEB)

    Shiquan Tao

    2006-12-31

    The chemistry of sol-gel derived silica and refractive metal oxide has been systematically studied. Sol-gel processes have been developed for preparing porous silica and semiconductor metal oxide materials. Micelle/reversed micelle techniques have been developed for preparing nanometer sized semiconductor metal oxides and noble metal particles. Techniques for doping metal ions, metal oxides and nanosized metal particles into porous sol-gel material have also been developed. Optical properties of sol-gel derived materials in ambient and high temperature gases have been studied by using fiber optic spectroscopic techniques, such as fiber optic ultraviolet/visible absorption spectrometry, fiber optic near infrared absorption spectrometry and fiber optic fluorescence spectrometry. Fiber optic spectrometric techniques have been developed for investigating the optical properties of these sol-gel derived materials prepared as porous optical fibers or as coatings on the surface of silica optical fibers. Optical and electron microscopic techniques have been used to observe the microstructure, such as pore size, pore shape, sensing agent distribution, of sol-gel derived material, as well as the size and morphology of nanometer metal particle doped in sol-gel derived porous silica, the nature of coating of sol-gel derived materials on silica optical fiber surface. In addition, the chemical reactions of metal ion, nanostructured semiconductor metal oxides and nanometer sized metal particles with gas components at room temperature and high temperatures have also been investigated with fiber optic spectrometric methods. Three classes of fiber optic sensors have been developed based on the thorough investigation of sol-gel chemistry and sol-gel derived materials. The first group of fiber optic sensors uses porous silica optical fibers doped with metal ions or metal oxide as transducers for sensing trace NH{sub 3} and H{sub 2}S in high temperature gas samples. The second group of

  2. Radiology Architecture Project Primer.

    Science.gov (United States)

    Sze, Raymond W; Hogan, Laurie; Teshima, Satoshi; Davidson, Scott

    2017-12-19

    The rapid pace of technologic advancement and increasing expectations for patient- and family-friendly environments make it common for radiology leaders to be involved in imaging remodel and construction projects. Most radiologists and business directors lack formal training in architectural and construction processes but are expected to play significant and often leading roles in all phases of an imaging construction project. Avoidable mistakes can result in significant increased costs and scheduling delays; knowledgeable participation and communication can result in a final product that enhances staff workflow and morale and improves patient care and experience. This article presents practical guidelines for preparing for and leading a new imaging architectural and construction project. We share principles derived from the radiology and nonradiology literature and our own experience over the past decade completely remodeling a large pediatric radiology department and building a full-service outpatient imaging center. Copyright © 2017 American College of Radiology. Published by Elsevier Inc. All rights reserved.

  3. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  4. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  5. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  6. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  7. Synthesis, selective pH-sensing activity and logic behavior of highly water-soluble 1,8-naphthalimide and dihydroimidazonaphthalimide derivatives

    International Nuclear Information System (INIS)

    Georgiev, Nikolai I.; Dimov, Stefan M.; Asiri, Abdullah M.; Alamry, Khalid A.; Obaid, Abdullah Y.; Bojinov, Vladimir B.

    2014-01-01

    This paper reports on the design, synthesis and fluorescence pH-sensing activity of a novel highly water-soluble 1,8-naphthalimide and its 9,10-dihydro-7H-imidazo[1,2-b]benz[d,e]isoqionolin-7-one derivative. The changes in the photophysical properties of the compounds as a function of pH were investigated in 100% aqueous medium. The 1,8-naphthalimide dye manifests “off–on” pH sensing properties based on photoinduced electron transfer, while its condensed heterocyclic derivative revealed ratiometric “off–on–off” fluorescence pH probe activity. Due to the two different “off”-states the dihydroimidazonaphthalimide derivative is able to execute the logical functions INH and XNOR and as such, to act as a magnitude digital comparator. The synthesized compounds show excellent selectivity toward protons over the representative transition metal ions (Co 2+ , Cu 2+ , Fe 3+ , Ni 2+ , Cd 2+ , Pb 2+ , Zn 2+ , Hg 2+ and Ag + ) is commonly used buffer solutions. The high water solubility and excellent pH selectivity of both probes as well as the ratiometric pH sensitivity of dihydroimidazonaphthalimide derivative may be beneficially for monitoring pH variations in complex samples. - Highlights: • Two novel highly water-soluble fluorescent dihydroimidazonaphthalimide and 1,8-naphthalimide derivatives are synthesized. • Compounds are designed as fluorescent “off–on” and “off–on–off” molecular pH probes based on PET and ICT. • Probes manifest selective response to protons over representative transition metal ions in 100% aqueous medium. • Logic functions INH and XNOR are achieved for dihydroimidazonaphthalimide derivative. • A combinatorial logic circuit (magnitude digital comparator) is demonstrated

  8. Synthesis, selective pH-sensing activity and logic behavior of highly water-soluble 1,8-naphthalimide and dihydroimidazonaphthalimide derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Georgiev, Nikolai I.; Dimov, Stefan M. [Department of Organic Synthesis, University of Chemical Technology and Metallurgy, 8 Kliment Ohridsky Street, 1756 Sofia (Bulgaria); Asiri, Abdullah M. [Chemistry Department, Faculty of Sciences, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Center of Excellence for Advanced Materials Research (CEAMR), King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Alamry, Khalid A.; Obaid, Abdullah Y. [Chemistry Department, Faculty of Sciences, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Bojinov, Vladimir B., E-mail: vlbojin@uctm.edu [Department of Organic Synthesis, University of Chemical Technology and Metallurgy, 8 Kliment Ohridsky Street, 1756 Sofia (Bulgaria); Chemistry Department, Faculty of Sciences, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia)

    2014-05-01

    This paper reports on the design, synthesis and fluorescence pH-sensing activity of a novel highly water-soluble 1,8-naphthalimide and its 9,10-dihydro-7H-imidazo[1,2-b]benz[d,e]isoqionolin-7-one derivative. The changes in the photophysical properties of the compounds as a function of pH were investigated in 100% aqueous medium. The 1,8-naphthalimide dye manifests “off–on” pH sensing properties based on photoinduced electron transfer, while its condensed heterocyclic derivative revealed ratiometric “off–on–off” fluorescence pH probe activity. Due to the two different “off”-states the dihydroimidazonaphthalimide derivative is able to execute the logical functions INH and XNOR and as such, to act as a magnitude digital comparator. The synthesized compounds show excellent selectivity toward protons over the representative transition metal ions (Co{sup 2+}, Cu{sup 2+}, Fe{sup 3+}, Ni{sup 2+}, Cd{sup 2+}, Pb{sup 2+}, Zn{sup 2+}, Hg{sup 2+} and Ag{sup +}) is commonly used buffer solutions. The high water solubility and excellent pH selectivity of both probes as well as the ratiometric pH sensitivity of dihydroimidazonaphthalimide derivative may be beneficially for monitoring pH variations in complex samples. - Highlights: • Two novel highly water-soluble fluorescent dihydroimidazonaphthalimide and 1,8-naphthalimide derivatives are synthesized. • Compounds are designed as fluorescent “off–on” and “off–on–off” molecular pH probes based on PET and ICT. • Probes manifest selective response to protons over representative transition metal ions in 100% aqueous medium. • Logic functions INH and XNOR are achieved for dihydroimidazonaphthalimide derivative. • A combinatorial logic circuit (magnitude digital comparator) is demonstrated.

  9. Effect of carbon derivatives in sulfonated poly(etherimide)-liquid crystal polymer composite for methanol vapor sensing

    Science.gov (United States)

    Bag, Souvik; Rathi, Keerti; Pal, Kaushik

    2017-05-01

    A class of highly sensitive chemiresistive sensors is developed for methanol (MeOH) vapor detection in ambient atmosphere by introducing conductive nanofillers like carbon black, multi-wall carbon nanotubes, and reduced graphene oxide into sulfonated poly(etherimide) (PEI)/liquid crystal polymer (LCP) composite (sPEI-LCP). Polar composites are prepared by a sulfonation process for instantaneous enhancement in adsorption capability of the sensing films to the target analyte (MeOH). Sensing properties exhibit that polymer composite-based fabricated sensors are efficient for the detection of different concentration of methanol vapor from 300-1200 parts-per-million (ppm) at room temperature. The incorporation of nanofiller induces the dramatic change in sensing behavior of base composite film (sPEI-LCP). Thus, less mass fraction of nanofillers (i.e. 2 wt%) influences the nonlinear sensing behavior for the entire range of methanol vapor. The simple method and low fabrication cost of the prepared sensor are compelling reasons that methanol vapor sensor is suitable for environmental monitoring.

  10. Comparison of Uncalibrated Rgbvi with Spectrometer-Based Ndvi Derived from Uav Sensing Systems on Field Scale

    Science.gov (United States)

    Bareth, G.; Bolten, A.; Gnyp, M. L.; Reusch, S.; Jasper, J.

    2016-06-01

    The development of UAV-based sensing systems for agronomic applications serves the improvement of crop management. The latter is in the focus of precision agriculture which intends to optimize yield, fertilizer input, and crop protection. Besides, in some cropping systems vehicle-based sensing devices are less suitable because fields cannot be entered from certain growing stages onwards. This is true for rice, maize, sorghum, and many more crops. Consequently, UAV-based sensing approaches fill a niche of very high resolution data acquisition on the field scale in space and time. While mounting RGB digital compact cameras to low-weight UAVs (modified version of the Yara N-Sensor. The latter is a well-established tractor-based hyperspectral sensor for crop management and is available on the market since a decade. It was modified for this study to fit the requirements of UAV-based data acquisition. Consequently, we focus on three objectives in this contribution: (1) to evaluate the potential of the uncalibrated RGBVI for monitoring nitrogen status in winter wheat, (2) investigate the UAV-based performance of the modified Yara N-Sensor, and (3) compare the results of the two different UAV-based sensing approaches for winter wheat.

  11. Forensic electrochemistry: the electroanalytical sensing of synthetic cathinone-derivatives and their accompanying adulterants in "legal high" products.

    Science.gov (United States)

    Smith, Jamie P; Metters, Jonathan P; Irving, Craig; Sutcliffe, Oliver B; Banks, Craig E

    2014-01-21

    The production and abuse of new psychoactive substances, known as "legal highs" which mimic traditional drugs of abuse is becoming a global epidemic. Traditional analytical methodologies exist which can provide confirmatory analysis but there is a requirement for an on-the-spot analytical screening tool that could be used to determine whether a substance, or sample matrix contains such legal, or formally "legal highs". In this paper the electrochemical sensing of (±)-methcathinone and related compounds at a range of commercially available electrode substrates is explored. We demonstrate for the first time that this class of "legal highs" are electrochemically active providing a novel sensing protocol based upon their electrochemical oxidation. Screen-printed graphite sensing platforms are favoured due to their proven ability to be mass-produced providing large numbers of reliable and reproducible electrode sensing platforms that preclude the requirement of surface pre-treatment such as mechanical polishing as is the case in the use of solid/re-usable electrode substrates. Additionally they hold potential to be used on-site potentially being the basis of an on-site legal high screening device. Consequently the electroanalytical sensing of (±)-methcathinone (3a), (±)-4′-methylmethcathinone [3b, 4-MMC, (±)-mephedrone] and (±)-4′-methyl-N-ethylcathinone (3c, 4-MEC) is explored using screen-printed sensing platforms with the effect of pH explored upon the analytical response with their analytical efficiency evaluated towards the target legal highs. Interesting at pH values below 6 the voltammetric response quantitatively changes from that of an electrochemically irreversible response to that of a quasi-reversible signature which can be used analytically. It is demonstrated for the first time that the electroanalytical sensing of (±)-methcathinone (3a), (±)-mephedrone (3b) and 4-MEC (3c) are possible with accessible linear ranges found to correspond to 16

  12. COMPARISON OF UNCALIBRATED RGBVI WITH SPECTROMETER-BASED NDVI DERIVED FROM UAV SENSING SYSTEMS ON FIELD SCALE

    Directory of Open Access Journals (Sweden)

    G. Bareth

    2016-06-01

    Full Text Available The development of UAV-based sensing systems for agronomic applications serves the improvement of crop management. The latter is in the focus of precision agriculture which intends to optimize yield, fertilizer input, and crop protection. Besides, in some cropping systems vehicle-based sensing devices are less suitable because fields cannot be entered from certain growing stages onwards. This is true for rice, maize, sorghum, and many more crops. Consequently, UAV-based sensing approaches fill a niche of very high resolution data acquisition on the field scale in space and time. While mounting RGB digital compact cameras to low-weight UAVs (< 5 kg is well established, the miniaturization of sensors in the last years also enables hyperspectral data acquisition from those platforms. From both, RGB and hyperspectral data, vegetation indices (VIs are computed to estimate crop growth parameters. In this contribution, we compare two different sensing approaches from a low-weight UAV platform (< 5 kg for monitoring a nitrogen field experiment of winter wheat and a corresponding farmers’ field in Western Germany. (i A standard digital compact camera was flown to acquire RGB images which are used to compute the RGBVI and (ii NDVI is computed from a newly modified version of the Yara N-Sensor. The latter is a well-established tractor-based hyperspectral sensor for crop management and is available on the market since a decade. It was modified for this study to fit the requirements of UAV-based data acquisition. Consequently, we focus on three objectives in this contribution: (1 to evaluate the potential of the uncalibrated RGBVI for monitoring nitrogen status in winter wheat, (2 investigate the UAV-based performance of the modified Yara N-Sensor, and (3 compare the results of the two different UAV-based sensing approaches for winter wheat.

  13. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  14. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  15. New α-Pyridones with Quorum-Sensing Inhibitory Activity from Diversity-Enhanced Extracts of a Streptomyces sp. Derived from Marine Algae.

    Science.gov (United States)

    Du, Yuqi; Sun, Jian; Gong, Qianhong; Wang, Yi; Fu, Peng; Zhu, Weiming

    2018-02-28

    Four new α-pyrones (1-4) and eight known analogues (5-12) were identified from the secondary metabolites of Streptomyces sp. OUCMDZ-3436 derived from the marine green algae Enteromorpha prolifera. Seven new α-pyridones (14-20) were constructed by diversity-oriented synthesis, which has been an effective approach to expanding the chemical space of natural-product-like compounds. Compounds 16, 17, 19, and 20 were found to have inhibitory effect on the gene expression controlled by quorum sensing in Pseudomonas aeruginosa QSIS-lasI.

  16. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  17. Atmospheric weighting functions and surface partial derivatives for remote sensing of scattering planetary atmospheres in thermal spectral region: general adjoint approach

    International Nuclear Information System (INIS)

    Ustinov, Eugene A.

    2005-01-01

    An approach to formulation of inversion algorithms for remote sensing in the thermal spectral region in the case of a scattering planetary atmosphere, based on the adjoint equation of radiative transfer (Ustinov (JQSRT 68 (2001) 195; JQSRT 73 (2002) 29); referred to as Papers 1 and 2, respectively, in the main text), is applied to the general case of retrievals of atmospheric and surface parameters for the scattering atmosphere with nadir viewing geometry. Analytic expressions for corresponding weighting functions for atmospheric parameters and partial derivatives for surface parameters are derived. The case of pure atmospheric absorption with a scattering underlying surface is considered and convergence to results obtained for the non-scattering atmospheres (Ustinov (JQSRT 74 (2002) 683), referred to as Paper 3 in the main text) is demonstrated

  18. Intercomparison of phenological transition dates derived from the PhenoCam Dataset V1.0 and MODIS satellite remote sensing.

    Science.gov (United States)

    Richardson, Andrew D; Hufkens, Koen; Milliman, Tom; Frolking, Steve

    2018-04-09

    Phenology is a valuable diagnostic of ecosystem health, and has applications to environmental monitoring and management. Here, we conduct an intercomparison analysis using phenological transition dates derived from near-surface PhenoCam imagery and MODIS satellite remote sensing. We used approximately 600 site-years of data, from 128 camera sites covering a wide range of vegetation types and climate zones. During both "greenness rising" and "greenness falling" transition phases, we found generally good agreement between PhenoCam and MODIS transition dates for agricultural, deciduous forest, and grassland sites, provided that the vegetation in the camera field of view was representative of the broader landscape. The correlation between PhenoCam and MODIS transition dates was poor for evergreen forest sites. We discuss potential reasons (including sub-pixel spatial heterogeneity, flexibility of the transition date extraction method, vegetation index sensitivity in evergreen systems, and PhenoCam geolocation uncertainty) for varying agreement between time series of vegetation indices derived from PhenoCam and MODIS imagery. This analysis increases our confidence in the ability of satellite remote sensing to accurately characterize seasonal dynamics in a range of ecosystems, and provides a basis for interpreting those dynamics in the context of tangible phenological changes occurring on the ground.

  19. Development of a pH sensing membrane electrode based on a new calix[4]arene derivative.

    Science.gov (United States)

    Kormalı Ertürün, H Elif; Demirel Özel, Ayça; Sayın, Serkan; Yılmaz, Mustafa; Kılıç, Esma

    2015-01-01

    A new pH sensing poly(vinyl chloride) (PVC) membrane electrode was developed by using recently synthesized 5,17-bis(4-benzylpiperidine-1-yl)methyl-25,26,27,28-tetrahydroxy calix[4]arene as an ionophore. The effects of membrane composition, inner filling solution and conditioning solution on the potential response of the proposed pH sensing membrane electrode were investigated. An optimum membrane composition of 3% ionophore, 67% o-nitrophenyl octyl ether (o-NPOE) as plasticizer, 30% PVC was found. The electrode exhibited a near-Nernstian slope of 58.7±1.1 mV pH(-1) in the pH range 1.9-12.7 at 20±1 °C. It showed good selectivity for H(+) ions in the presence of some cations and anions and a longer lifetime of at least 12 months when compared with the other PVC membrane pH electrodes reported in the literature. Having a wide working pH range, it was not only applied as a potentiometric indicator electrode in various acid-base titrations, but also successfully employed in different real samples. It has good reproducibility and repeatability with a response time of 6-7s. Compared to traditional glass pH electrode, it exhibited excellent potentiometric response after being used in fluoride-containing media. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Metal organic frameworks-derived sensing material of SnO2/NiO composites for detection of triethylamine

    Science.gov (United States)

    Bai, Shouli; Liu, Chengyao; Luo, Ruixian; Chen, Aifan

    2018-04-01

    The SnO2/NiO composites were synthesized by hydrothermal followed by calcination using metal-organic framework (MOF) consisting of the ligand of p-benzene-dicarboxylic acid (PTA) and the Sn and Ni center ions as sacrificial templates. The structure and morphology of Sn/Ni-based MOF and SnO2/NiO composites were characterized by XRD, SEM, TEM, FT-IR, TG, XPS and Brunauer-Emmett-Teller analysis. Sensing experiments reveal that the SnO2/NiO composite with the molar ratio of 9:1 not only exhibits the highest response of 14.03 that is 3 times higher than pristine SnO2 to triethylamine at 70 °C, but also shows good selectivity. Such excellent performance is attributed to the MOF-driven strategy and the formation of p-n heterojunctions, because the metal ions can be highly dispersed and separated in the MOFs and can prevent the metal ions aggregation during the MOF decomposition process. The work is a novel route for synthesis of gas sensing material.

  1. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  2. Identification of Five Structurally Unrelated Quorum-Sensing Inhibitors of Pseudomonas aeruginosa from a Natural-Derivative Database

    DEFF Research Database (Denmark)

    Tan, Sean Yang-Yi; Chua, Song-Lin; Chen, Yicai

    2013-01-01

    QSI candidates. Three-dimensional structures of 3,040 natural compounds and their derivatives were obtained, after which molecular docking was performed using the QS receptor LasR as a target. Based on docking scores and molecular masses, 22 compounds were purchased to determine their efficacies...

  3. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  4. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    by the Millennium Ecosystem Assessment (Table1). Collectively, this primer synthesizes existing information in a new way that aims to support management of rivermouths as distinct and important ecosystems. The development and management decisions made around rivermouths today will shape the future of these ecosystems, and the human communities within them, well into the future. 1 The information presented in this paper was derived from discussions and draft documents of the Great Lakes Rivermouth Collaboratory. The Great Lakes Rivermouth Collaboratory was established by the U.S. Geological Survey's Great Lakes Science Center (USGS-GLSC) in collaboration with the Great Lakes Commission to engage the Great Lakes scientific community in sharing and documenting knowledge about freshwater rivermouth ecosystems. For more information, see http://www.glc.org/habitat/Rivermouth-Collaboratory.html.

  5. The Urban Fabric of the City as Its Affects Thermal Energy Responses Derived from Remote Sensing Data

    Science.gov (United States)

    Quattrochi, Dale A.; Luvall, Jeffrey C.; Estes, Maurice G., Jr.

    2000-01-01

    The physical geography of the city affects numerous aspects of its interlinked biophysical, social, and land-atmosphere characteristics - those attributes that come together to form the total urban environment. One approach to studying the multitude of interactions that occur as a result of urbanization is to view the city from a systems ecology perspective, where energy and material cycle into and out of the urban milieu. Thus, the urban ecosystem is synergistic in linking land, air, water, and living organisms in a vast network of interrelated physical, human, and biological process. Given the number and the shear complexity of the exchanges and, ultimately, their effects, that occur within the urban environment, we are focusing our research on looking at how the morphology or urban fabric of the city, drives thermal energy exchanges across the urban landscape. The study of thermal energy attributes for different cities provides insight into how thermal fluxes and characteristics are partitioned across the city landscape in response to each city's morphology. We are using thermal infrared remote sensing data obtained at a high spatial resolution from aircraft, along with satellite data, to identify and quantify thermal energy characteristics for 4 U.S. cities: Atlanta, GA, Baton Rouge, LA, Salt Lake City, UT, and Sacramento, CA. Analysis of how thermal energy is spatially distributed across the urban landscapes for these cities provides a unique perspective for understanding how the differing morphology of cities forces land-atmosphere exchanges, such as the urban heat island effect, as well as related meteorological and air quality interactions. Keyword: urban ecosystems, remote sensing, urban heat island

  6. Impact of Land Cover Change Induced by a Fire Event on the Surface Energy Fluxes Derived from Remote Sensing

    Directory of Open Access Journals (Sweden)

    Juan M. Sánchez

    2015-11-01

    Full Text Available Forest fires affect the natural cycle of the vegetation, and the structure and functioning of ecosystems. As a consequence of defoliation and vegetation mortality, surface energy flux patterns can suffer variations. Remote sensing techniques together with surface energy balance modeling offer the opportunity to explore these changes. In this paper we focus on a Mediterranean forest ecosystem. A fire event occurred in 2001 in Almodóvar del Pinar (Spain affecting a pine and shrub area. A two-source energy balance approach was applied to a set of Landsat 5-TM and Landsat 7-EMT+ images to estimate the surface fluxes in the area. Three post-fire periods were analyzed, six, seven, nine, and 11 years after the fire event. Results showed the regeneration of the shrub area in 6–7 years, in contrast to the pine area, where an important decrease in evapotranspiration, around 1 mm·day−1, remained. Differences in evapotranspiration were mitigated nine and 11 years after the fire in the pine area, whereas significant deviations in the rest of the terms of the energy balance equation were still observed. The combined effect of changes in the vegetation structure and surface variables, such as land surface temperature, albedo, or vegetation coverage, is responsible for these variations in the surface energy flux patterns.

  7. An Unsupervised Algorithm for Change Detection in Hyperspectral Remote Sensing Data Using Synthetically Fused Images and Derivative Spectral Profiles

    Directory of Open Access Journals (Sweden)

    Youkyung Han

    2017-01-01

    Full Text Available Multitemporal hyperspectral remote sensing data have the potential to detect altered areas on the earth’s surface. However, dissimilar radiometric and geometric properties between the multitemporal data due to the acquisition time or position of the sensors should be resolved to enable hyperspectral imagery for detecting changes in natural and human-impacted areas. In addition, data noise in the hyperspectral imagery spectrum decreases the change-detection accuracy when general change-detection algorithms are applied to hyperspectral images. To address these problems, we present an unsupervised change-detection algorithm based on statistical analyses of spectral profiles; the profiles are generated from a synthetic image fusion method for multitemporal hyperspectral images. This method aims to minimize the noise between the spectra corresponding to the locations of identical positions by increasing the change-detection rate and decreasing the false-alarm rate without reducing the dimensionality of the original hyperspectral data. Using a quantitative comparison of an actual dataset acquired by airborne hyperspectral sensors, we demonstrate that the proposed method provides superb change-detection results relative to the state-of-the-art unsupervised change-detection algorithms.

  8. Remote sensing and water quality indicators in the Korean West coast: Spatio-temporal structures of MODIS-derived chlorophyll-a and total suspended solids.

    Science.gov (United States)

    Kim, Hae-Cheol; Son, Seunghyun; Kim, Yong Hoon; Khim, Jong Seong; Nam, Jungho; Chang, Won Keun; Lee, Jung-Ho; Lee, Chang-Hee; Ryu, Jongseong

    2017-08-15

    The Yellow Sea is a shallow marginal sea with a large tidal range. In this study, ten areas located along the western coast of the Korean Peninsula are investigated with respect to remotely sensed water quality indicators derived from NASA MODIS aboard of the satellite Aqua. We found that there was a strong seasonal trend with spatial heterogeneity. In specific, a strong six-month phase-lag was found between chlorophyll-a and total suspended solid owing to their inversed seasonality, which could be explained by different dynamics and environmental settings. Chlorophyll-a concentration seemed to be dominantly influenced by temperature, while total suspended solid was largely governed by local tidal forcing and bottom topography. This study demonstrated the potential and applicability of satellite products in coastal management, and highlighted find that remote-sensing would be a promising tool in resolving orthogonality of large spatio-temporal scale variabilities when combining with proper time series analyses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Deriving Snow-Cover Depletion Curves for Different Spatial Scales from Remote Sensing and Snow Telemetry Data

    Science.gov (United States)

    Fassnacht, Steven R.; Sexstone, Graham A.; Kashipazha, Amir H.; Lopez-Moreno, Juan Ignacio; Jasinski, Michael F.; Kampf, Stephanie K.; Von Thaden, Benjamin C.

    2015-01-01

    During the melting of a snowpack, snow water equivalent (SWE) can be correlated to snow-covered area (SCA) once snow-free areas appear, which is when SCA begins to decrease below 100%. This amount of SWE is called the threshold SWE. Daily SWE data from snow telemetry stations were related to SCA derived from moderate-resolution imaging spectro radiometer images to produce snow-cover depletion curves. The snow depletion curves were created for an 80,000 sq km domain across southern Wyoming and northern Colorado encompassing 54 snow telemetry stations. Eight yearly snow depletion curves were compared, and it is shown that the slope of each is a function of the amount of snow received. Snow-cover depletion curves were also derived for all the individual stations, for which the threshold SWE could be estimated from peak SWE and the topography around each station. A stations peak SWE was much more important than the main topographic variables that included location, elevation, slope, and modelled clear sky solar radiation. The threshold SWE mostly illustrated inter-annual consistency.

  10. City-Level Adult Stroke Prevalence in Relation to Remote Sensing Derived PM2.5 Adjusting for Unhealthy Behaviors and Medical Risk Factors

    Science.gov (United States)

    Hu, Z.

    2018-04-01

    This research explores the use of PM2.5 gird derived from remote sensing for assessing the effect of long-term exposure to PM2.5 (ambient air pollution of particulate matter with an aerodynamic diameter of 2.5 μm or less) on stroke, adjusting for unhealthy behaviors and medical risk factors. Health data was obtained from the newly published CDC "500 Cities Project" which provides city- and census tract-level small area estimates for chronic disease risk factors, and clinical preventive service use for the largest 500 cities in the United States. PM2.5 data was acquired from the "The Global Annual PM2.5 Grids from MODIS, MISR and SeaWiFS Aerosol Optical Depth (AOD), V1 (1998-2012)" datasets. Average PM2.5 were calculated for each city using a GIS zonal statistics function. Map data visualization and pattern comparison, univariate linear regression, and a multivariate linear regression model fitted using a generalized linear model via penalized maximum likelihood found that long-term exposure to ambient PM2.5 may increase the risk of stroke. Increasing physical activity, reducing smoking and body weight, enough sleeping, controlling diseases such as blood pressure, coronary heart disease, diabetes, and cholesterol, may mitigate the effect. PM2.5 grids derived from moderate resolution satellite remote sensing imagery may offer a unique opportunity to fill the data gap due to limited ground monitoring at broader scales. The evidence of raised stroke prevalence risk in high PM2.5 areas would support targeting of policy interventions on such areas to reduce pollution levels and protect human health.

  11. CITY-LEVEL ADULT STROKE PREVALENCE IN RELATION TO REMOTE SENSING DERIVED PM2.5 ADJUSTING FOR UNHEALTHY BEHAVIORS AND MEDICAL RISK FACTORS

    Directory of Open Access Journals (Sweden)

    Z. Hu

    2018-04-01

    Full Text Available This research explores the use of PM2.5 gird derived from remote sensing for assessing the effect of long-term exposure to PM2.5 (ambient air pollution of particulate matter with an aerodynamic diameter of 2.5 μm or less on stroke, adjusting for unhealthy behaviors and medical risk factors. Health data was obtained from the newly published CDC “500 Cities Project” which provides city- and census tract-level small area estimates for chronic disease risk factors, and clinical preventive service use for the largest 500 cities in the United States. PM2.5 data was acquired from the “The Global Annual PM2.5 Grids from MODIS, MISR and SeaWiFS Aerosol Optical Depth (AOD, V1 (1998–2012” datasets. Average PM2.5 were calculated for each city using a GIS zonal statistics function. Map data visualization and pattern comparison, univariate linear regression, and a multivariate linear regression model fitted using a generalized linear model via penalized maximum likelihood found that long-term exposure to ambient PM2.5 may increase the risk of stroke. Increasing physical activity, reducing smoking and body weight, enough sleeping, controlling diseases such as blood pressure, coronary heart disease, diabetes, and cholesterol, may mitigate the effect. PM2.5 grids derived from moderate resolution satellite remote sensing imagery may offer a unique opportunity to fill the data gap due to limited ground monitoring at broader scales. The evidence of raised stroke prevalence risk in high PM2.5 areas would support targeting of policy interventions on such areas to reduce pollution levels and protect human health.

  12. Cinnamaldehyde and cinnamaldehyde derivatives reduce virulence in Vibrio spp. by decreasing the DNA-binding activity of the quorum sensing response regulator LuxR

    Directory of Open Access Journals (Sweden)

    Van Calenbergh Serge

    2008-09-01

    Full Text Available Abstract Background To date, only few compounds targeting the AI-2 based quorum sensing (QS system are known. In the present study, we screened cinnamaldehyde and substituted cinnamaldehydes for their ability to interfere with AI-2 based QS. The mechanism of QS inhibition was elucidated by measuring the effect on bioluminescence in several Vibrio harveyi mutants. We also studied in vitro the ability of these compounds to interfere with biofilm formation, stress response and virulence of Vibrio spp. The compounds were also evaluated in an in vivo assay measuring the reduction of Vibrio harveyi virulence towards Artemia shrimp. Results Our results indicate that cinnamaldehyde and several substituted derivatives interfere with AI-2 based QS without inhibiting bacterial growth. The active compounds neither interfered with the bioluminescence system as such, nor with the production of AI-2. Study of the effect in various mutants suggested that the target protein is LuxR. Mobility shift assays revealed a decreased DNA-binding ability of LuxR. The compounds were further shown to (i inhibit biofilm formation in several Vibrio spp., (ii result in a reduced ability to survive starvation and antibiotic treatment, (iii reduce pigment and protease production in Vibrio anguillarum and (iv protect gnotobiotic Artemia shrimp against virulent Vibrio harveyi BB120. Conclusion Cinnamaldehyde and cinnamaldehyde derivatives interfere with AI-2 based QS in various Vibrio spp. by decreasing the DNA-binding ability of LuxR. The use of these compounds resulted in several marked phenotypic changes, including reduced virulence and increased susceptibility to stress. Since inhibitors of AI-2 based quorum sensing are rare, and considering the role of AI-2 in several processes these compounds may be useful leads towards antipathogenic drugs.

  13. Cinnamaldehyde and cinnamaldehyde derivatives reduce virulence in Vibrio spp. by decreasing the DNA-binding activity of the quorum sensing response regulator LuxR

    Science.gov (United States)

    Brackman, Gilles; Defoirdt, Tom; Miyamoto, Carol; Bossier, Peter; Van Calenbergh, Serge; Nelis, Hans; Coenye, Tom

    2008-01-01

    Background To date, only few compounds targeting the AI-2 based quorum sensing (QS) system are known. In the present study, we screened cinnamaldehyde and substituted cinnamaldehydes for their ability to interfere with AI-2 based QS. The mechanism of QS inhibition was elucidated by measuring the effect on bioluminescence in several Vibrio harveyi mutants. We also studied in vitro the ability of these compounds to interfere with biofilm formation, stress response and virulence of Vibrio spp. The compounds were also evaluated in an in vivo assay measuring the reduction of Vibrio harveyi virulence towards Artemia shrimp. Results Our results indicate that cinnamaldehyde and several substituted derivatives interfere with AI-2 based QS without inhibiting bacterial growth. The active compounds neither interfered with the bioluminescence system as such, nor with the production of AI-2. Study of the effect in various mutants suggested that the target protein is LuxR. Mobility shift assays revealed a decreased DNA-binding ability of LuxR. The compounds were further shown to (i) inhibit biofilm formation in several Vibrio spp., (ii) result in a reduced ability to survive starvation and antibiotic treatment, (iii) reduce pigment and protease production in Vibrio anguillarum and (iv) protect gnotobiotic Artemia shrimp against virulent Vibrio harveyi BB120. Conclusion Cinnamaldehyde and cinnamaldehyde derivatives interfere with AI-2 based QS in various Vibrio spp. by decreasing the DNA-binding ability of LuxR. The use of these compounds resulted in several marked phenotypic changes, including reduced virulence and increased susceptibility to stress. Since inhibitors of AI-2 based quorum sensing are rare, and considering the role of AI-2 in several processes these compounds may be useful leads towards antipathogenic drugs. PMID:18793453

  14. Novel redox species polyaniline derivative-Au/Pt as sensing platform for label-free electrochemical immunoassay of carbohydrate antigen 199

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Liyuan; Shan, Jiao; Feng, Feng; Ma, Zhanfang, E-mail: mazhanfang@cnu.edu.cn

    2016-03-10

    A novel electrochemical redox-active nanocomposite was synthesized by a one-pot method using N,N′-diphenyl-p-phenylediamine as monomer, and HAuCl{sub 4} and K{sub 2}PtCl{sub 4} as co-oxidizing agents. The as-prepared poly(N,N′-diphenyl-p-phenylediamine)-Au/Pt exhibited admirable electrochemical redox activity at 0.15 V, excellent H{sub 2}O{sub 2} electrocatalytic ability and favorable electron transfer ability. Based on these, the evaluation of the composite as sensing substrate for label-free electrochemical immunosensing to the sensitive detection of carbohydrate antigen 199 was described. This technique proved to be a prospective detection tool with a wide liner range from 0.001 U mL{sup −1} to 40 U mL{sup −1}, and a low detection limit of 2.3 × 10{sup −4} U mL{sup −1} (S/N = 3). In addition, this method was used for the analysis of human serum sample, and good agreement was obtained between the values and those of enzyme-linked immunosorbent assay, implying the potential application in clinical research. Importantly, the strategy of the present substrate could be extended to other polymer-based nanocomposites such as polypyrrole derivatives or polythiophene derivatives, and this could be of great significance for the electrochemical immunoassay. - Highlights: • A novel electrochemical redox composite PPPD-Au/Pt was synthesized by one-pot method. • PPPD-Au/Pt was used as sensing substrate for label-free electrochemical immunosensor. • The immunosensor showed wide detection range and ultralow detection limit for the detection of CA199.

  15. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  16. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  17. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  18. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  19. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  20. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  1. Lake Chad Total Surface Water Area as Derived from Land Surface Temperature and Radar Remote Sensing Data

    Directory of Open Access Journals (Sweden)

    Frederick Policelli

    2018-02-01

    Full Text Available Lake Chad, located in the middle of the African Sahel belt, underwent dramatic decreases in the 1970s and 1980s leaving less than ten percent of its 1960s surface water extent as open water. In this paper, we present an extended record (dry seasons 1988–2016 of the total surface water area of the lake (including both open water and flooded vegetation derived using Land Surface Temperature (LST data (dry seasons 2000–2016 from the NASA Terra MODIS sensor and EUMETSAT Meteosat-based LST measurements (dry seasons 1988–2001 from an earlier study. We also examine the total surface water area for Lake Chad using radar data (dry seasons 2015–2016 from the ESA Sentinel-1a mission. For the limited number of radar data sets available to us (18 data sets, we find on average a close match between the estimates from these data and the corresponding estimates from LST, though we find spatial differences in the estimates using the two types of data. We use these spatial differences to adjust the record (dry seasons 2000–2016 from MODIS LST. Then we use the adjusted record to remove the bias of the existing LST record (dry seasons 1988–2001 derived from Meteosat measurements and combine the two records. From this composite, extended record, we plot the total surface water area of the lake for the dry seasons of 1988–1989 through 2016–2017. We find for the dry seasons of 1988–1989 to 2016–2017 that the maximum total surface water area of the lake was approximately 16,800 sq. km (February and May, 2000, the minimum total surface water area of the lake was approximately 6400 sq. km (November, 1990, and the average was approximately 12,700 sq. km. Further, we find the total surface water area of the lake to be highly variable during this period, with an average rate of increase of approximately 143 km2 per year.

  2. Single Particle Dynamic Imaging and Fe3+ Sensing with Bright Carbon Dots Derived from Bovine Serum Albumin Proteins

    Science.gov (United States)

    Yang, Qingxiu; Wei, Lin; Zheng, Xuanfang; Xiao, Lehui

    2015-12-01

    In this work, we demonstrated a convenient and green strategy for the synthesis of highly luminescent and water-soluble carbon dots (Cdots) by carbonizing carbon precursors, i.e., Bovine serum albumin (BSA) nanoparticles, in water solution. Without post surface modification, the as-synthesized Cdots exhibit fluorescence quantum yield (Q.Y.) as high as 34.8% and display superior colloidal stability not only in concentrated salt solutions (e.g. 2 M KCl) but also in a wide range of pH solutions. According to the FT-IR measurements, the Cdots contain many carboxyl groups, providing a versatile route for further chemical and biological functionalization. Through conjugation of Cdots with the transacting activator of transcription (TAT) peptide (a kind of cell penetration peptide (CPP)) derived from human immunodeficiency virus (HIV), it is possible to directly monitor the dynamic interactions of CPP with living cell membrane at single particle level. Furthermore, these Cdots also exhibit a dosage-dependent selectivity toward Fe3+ among other metal ions, including K+, Na+, Mg2+, Hg2+, Co2+, Cu2+, Pb2+ and Al3+. We believed that the Cdots prepared by this strategy would display promising applications in various areas, including analytical chemistry, nanomedicine, biochemistry and so on.

  3. A Robust Algorithm of Multiquadric Method Based on an Improved Huber Loss Function for Interpolating Remote-Sensing-Derived Elevation Data Sets

    Directory of Open Access Journals (Sweden)

    Chuanfa Chen

    2015-03-01

    Full Text Available Remote-sensing-derived elevation data sets often suffer from noise and outliers due to various reasons, such as the physical limitations of sensors, multiple reflectance, occlusions and low contrast of texture. Outliers generally have a seriously negative effect on DEM construction. Some interpolation methods like ordinary kriging (OK are capable of smoothing noise inherent in sample points, but are sensitive to outliers. In this paper, a robust algorithm of multiquadric method (MQ based on an Improved Huber loss function (MQ-IH has been developed to decrease the impact of outliers on DEM construction. Theoretically, the improved Huber loss function is null for outliers, quadratic for small errors, and linear for others. Simulated data sets drawn from a mathematical surface with different error distributions were employed to analyze the robustness of MQ-IH. Results indicate that MQ-IH obtains a good balance between efficiency and robustness. Namely, the performance of MQ-IH is comparative to those of the classical MQ and MQ based on the Classical Huber loss function (MQ-CH when sample points follow a normal distribution, and the former outperforms the latter two when sample points are subject to outliers. For example, for the Cauchy error distribution with the location parameter of 0 and scale parameter of 1, the root mean square errors (RMSEs of MQ-CH and the classical MQ are 0.3916 and 1.4591, respectively, whereas that of MQ-IH is 0.3698. The performance of MQ-IH is further evaluated by qualitative and quantitative analysis through a real-world example of DEM construction with the stereo-images-derived elevation points. Results demonstrate that compared with the classical interpolation methods, including natural neighbor (NN, OK and ANUDEM (a program that calculates regular grid digital elevation models (DEMs with sensible shape and drainage structure from arbitrarily large topographic data sets, and two versions of MQ, including the

  4. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  5. Online Professional Development: A Primer

    Science.gov (United States)

    Bates, Meg S.; Phalen, Lena; Moran, Cheryl

    2016-01-01

    Many teachers are turning to online professional development to meet their learning needs, but the vast array of available opportunities may be overwhelming. This article provides a framework for making sense of common online teacher learning opportunities. It also suggests situations where online professional development may be most useful and…

  6. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  7. A derivative photoelectrochemical sensing platform for 4-nitrophenolate contained organophosphates pesticide based on carboxylated perylene sensitized nano-TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongbo [College of Chemistry and Engineering, Yangzhou University, 88 South University Avenue, Yangzhou 225002 (China); College of Chemistry and Biology Engineering, Yancheng Institute of Technology, 9 Yingbin Avenue, Yancheng 224051 (China); Li, Jing [College of Chemistry and Biology Engineering, Yancheng Institute of Technology, 9 Yingbin Avenue, Yancheng 224051 (China); Xu, Qin; Yang, Zhanjun [College of Chemistry and Engineering, Yangzhou University, 88 South University Avenue, Yangzhou 225002 (China); Hu, Xiaoya, E-mail: xyhu@yzu.edu.cn [College of Chemistry and Engineering, Yangzhou University, 88 South University Avenue, Yangzhou 225002 (China)

    2013-03-05

    Highlights: ► A novel enzymeless photoelectrochemical sensor for 4-nitrophenolate contained OPs. ► Sensors have performances of rapid response, good sensitivity and selectivity. ► PTCA as sensitizer can form ultrastable thin film and is economic as well. ► The strategy extends the application of PTCA for photoelectrochemical sensor. - Abstract: A novel visible light sensitized photoelectrochemical sensing platform was constructed based on the perylene-3,4,9,10-tetracarboxylic acid/titanium dioxide (PTCA/TiO{sub 2}) heterojunction as the photoelectric beacon. PTCA was synthesized via facile steps of hydrolysis and neutralization reaction, and then the PTCA/TiO{sub 2} heterojunction was easily prepared by coating PTCA on nano-TiO{sub 2} surface. The resulting photoelectric beacon was characterized by transmission electron microscope, scanning electron microscopy, X-ray diffractometry, FTIR spectroscopy, and ultraviolet and visible spectrophotometer. Using parathion-methyl as a model, after a simple hydrolyzation process, p-nitrophenol as the hydrolysate of parathion-methyl could be obtained, the fabricated derivative photoelectrochemical sensor showed good performances with a rapid response, instrument simple and portable, low detection limit (0.08 nmol L{sup −1}) at a signal-to-noise ratio of 3, and good selectivity against other pesticides and possible interferences. It had been successfully applied to the detection of parathion-methyl in green vegetables and the results agreed well with that by GC–MS. This strategy not only extends the application of PTCA, but also presents a simple, economic and novel methodology for photoelectrochemical sensing.

  8. A Multi-Band Analytical Algorithm for Deriving Absorption and Backscattering Coefficients from Remote-Sensing Reflectance of Optically Deep Waters

    Science.gov (United States)

    Lee, Zhong-Ping; Carder, Kendall L.

    2001-01-01

    A multi-band analytical (MBA) algorithm is developed to retrieve absorption and backscattering coefficients for optically deep waters, which can be applied to data from past and current satellite sensors, as well as data from hyperspectral sensors. This MBA algorithm applies a remote-sensing reflectance model derived from the Radiative Transfer Equation, and values of absorption and backscattering coefficients are analytically calculated from values of remote-sensing reflectance. There are only limited empirical relationships involved in the algorithm, which implies that this MBA algorithm could be applied to a wide dynamic range of waters. Applying the algorithm to a simulated non-"Case 1" data set, which has no relation to the development of the algorithm, the percentage error for the total absorption coefficient at 440 nm a (sub 440) is approximately 12% for a range of 0.012 - 2.1 per meter (approximately 6% for a (sub 440) less than approximately 0.3 per meter), while a traditional band-ratio approach returns a percentage error of approximately 30%. Applying it to a field data set ranging from 0.025 to 2.0 per meter, the result for a (sub 440) is very close to that using a full spectrum optimization technique (9.6% difference). Compared to the optimization approach, the MBA algorithm cuts the computation time dramatically with only a small sacrifice in accuracy, making it suitable for processing large data sets such as satellite images. Significant improvements over empirical algorithms have also been achieved in retrieving the optical properties of optically deep waters.

  9. Synthesis and Characterization of PEDOT Derivative with Carboxyl Group and Its Chemo/Bio Sensing Application as Nanocomposite, Immobilized Biological and Enhanced Optical Materials

    International Nuclear Information System (INIS)

    Zhang, Long; Wen, Yangping; Yao, Yuanyuan; Xu, Jingkun; Duan, Xuemin; Zhang, Ge

    2014-01-01

    Graphical abstract: Electropolymerization of C4-EDOT-COOH and corresponding polymer's sensing application for environmental, pharmaceutical, biology and food. -- Highlights: •C4-EDOT-COOH monomer with good solubility in water was synthesized by an efficient five-step route. •That acidic conditions were favorable for the electropolymerization of C4-EDOT-COOH. •The resulting high-quality polymer film can be employed for the fabrication of chemo/bio-sensors and optical sensors. •These as-prepared sensors can be applied to the simple, fast and sensitive detection of different analytes. -- Abstract: Various electrochemical chemo/bio-sensors and optical sensors are facilely explored for the sensitive determination of biomolecules, drug molecules, environmental pollutants, and metal ions using a carboxylic-functionalized poly(3,4-ethylenedioxythiophene) derivative (PC4), which is easily obtained by the direct electropolymerization of a water-soluble 4-((2,3-dihydrothieno[3,4-b][1,4] dioxin-2-yl) methoxy)-4-oxobutanoic acid (C4-EDOT-COOH) monomer in a microemulsion system. The effect of different pH values on the electropolymerization of C4-EDOT-COOH monomer is investigated, and the as-prepared PC4 film is characterized by electrochemical method, infrared spectrum, and scanning electron microscope. The resulting high-quality PC4 film as a sensing material not only can combine with various biologically active species via covalent linkage and inorganic materials via layer-by-layer self-assembly for the construction of electrochemical chemo/bio-sensors, but also excellent optical performance of PC4 can be employed for the fabrication of optical sensors. These as-prepared chemo/bio-sensors can be applied to the simple, fast and sensitive detection of environmental pollutants, pharmaceuticals, hazardous substances, and biological active substance and nutrients present in food by means of electrochemistry, ultraviolet and fluorescence spectroscopy. Satisfactory results

  10. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  11. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  12. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  13. Modulating the Global Response Regulator, LuxO of V. cholerae Quorum Sensing System Using a Pyrazine Dicarboxylic Acid Derivative (PDCApy: An Antivirulence Approach

    Directory of Open Access Journals (Sweden)

    M. Hema

    2017-10-01

    Full Text Available Vibrio cholerae is a Gram-negative pathogen which causes acute diarrhoeal disease, cholera by the expression of virulence genes through quorum sensing (QS mechanism. The QS circuit of V. cholerae is controlled by the global quorum regulator, LuxO, which at low cell density (LCD state produces major virulence factors such as, toxin co-regulated pilus (TCP and cholera toxin (CT to mediate infection. On the contrary, at the high cell density (HCD state the virulent genes are downregulated and the vibrios are detached from the host intestinal epithelial cells, promoted by HapA protease. Hence, targeting the global regulator LuxO would be a promising approach to modulate the QS to curtail V. cholerae pathogenesis. In our earlier studies, LuxO targeted ligand, 2,3 pyrazine dicarboxylic acid (PDCA and its derivatives having desired pharmacophore properties were chemically synthesized and were shown to have biofilm inhibition as well as synergistic activity with the conventionally used antibiotics. In the present study, the QS modulatory effect of the PDCA derivative with pyrrolidine moiety designated as PDCApy against the V. cholerae virulence gene expression was analyzed at various growth phases. The data significantly showed a several fold reduction in the expression of the genes, tcp and ct whereas the expression of hapR was upregulated at the LCD state. In addition, PDCApy reduced the adhesion and invasion of the vibrios onto the INT407 intestinal cell lines. Collectively, our data suggest that PDCApy could be a potential QS modulator (QSM for the antivirulence therapeutic approach.

  14. SACRA - global data sets of satellite-derived crop calendars for agricultural simulations: an estimation of a high-resolution crop calendar using satellite-sensed NDVI

    Science.gov (United States)

    Kotsuki, S.; Tanaka, K.

    2015-01-01

    To date, many studies have performed numerical estimations of food production and agricultural water demand to understand the present and future supply-demand relationship. A crop calendar (CC) is an essential input datum to estimate food production and agricultural water demand accurately with the numerical estimations. CC defines the date or month when farmers plant and harvest in cropland. This study aims to develop a new global data set of a satellite-derived crop calendar for agricultural simulations (SACRA) and reveal advantages and disadvantages of the satellite-derived CC compared to other global products. We estimate global CC at a spatial resolution of 5 min (≈10 km) using the satellite-sensed NDVI data, which corresponds well to vegetation growth and death on the land surface. We first demonstrate that SACRA shows similar spatial pattern in planting date compared to a census-based product. Moreover, SACRA reflects a variety of CC in the same administrative unit, since it uses high-resolution satellite data. However, a disadvantage is that the mixture of several crops in a grid is not considered in SACRA. We also address that the cultivation period of SACRA clearly corresponds to the time series of NDVI. Therefore, accuracy of SACRA depends on the accuracy of NDVI used for the CC estimation. Although SACRA shows different CC from a census-based product in some regions, multiple usages of the two products are useful to take into consideration the uncertainty of the CC. An advantage of SACRA compared to the census-based products is that SACRA provides not only planting/harvesting dates but also a peak date from the time series of NDVI data.

  15. The effects of pressure sensor acoustics on airdata derived from a High-angle-of-attack Flush Airdata Sensing (HI-FADS) system

    Science.gov (United States)

    Whitmore, Stephen A.; Moes, Timothy R.

    1991-01-01

    The accuracy of a nonintrusive high angle-of-attack flush airdata sensing (HI-FADS) system was verified for quasi-steady flight conditions up to 55 deg angle of attack during the F-18 High Alpha Research Vehicle (HARV) Program. The system is a matrix of nine pressure ports arranged in annular rings on the aircraft nose. The complete airdata set is estimated using nonlinear regression. Satisfactory frequency response was verified to the system Nyquist frequency (12.5 Hz). The effects of acoustical distortions within the individual pressure sensors of the nonintrusive pressure matrix on overall system performance are addressed. To quantify these effects, a frequency-response model describing the dynamics of acoustical distortion is developed and simple design criteria are derived. The model adjusts measured HI-FADS pressure data for the acoustical distortion and quantifies the effects of internal sensor geometries on system performance. Analysis results indicate that sensor frequency response characteristics very greatly with altitude, thus it is difficult to select satisfactory sensor geometry for all altitudes. The solution used presample filtering to eliminate resonance effects, and short pneumatic tubing sections to reduce lag effects. Without presample signal conditioning the system designer must use the pneumatic transmission line to attenuate the resonances and accept the resulting altitude variability.

  16. Sol-gel derived multiwalled carbon nanotubes ceramic electrode modified with molecularly imprinted polymer for ultra trace sensing of dopamine in real samples

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, Bhim Bali, E-mail: prof.bbpd@yahoo.com [Department of Chemistry, Faculty of Science, Banaras Hindu University, Varanasi 221 005 (India); Kumar, Deepak; Madhuri, Rashmi; Tiwari, Mahavir Prasad [Department of Chemistry, Faculty of Science, Banaras Hindu University, Varanasi 221 005 (India)

    2011-08-01

    Highlights: > MWCNTs-CE was prepared by silane acrylate which provides a nanometer thin MIP film. > The sensor was modified by iniferter and MIP using 'surface grafting-from approach'. > A comparative study was performed between differentially designed ceramic electrodes. > The sensor can detect dopamine in real samples with LODs (0.143-0.154 ng mL{sup -1}). - Abstract: A new class of composite electrodes made of sol-gel derived ceramic-multiwalled carbon nanotubes is used for the growth of a nanometer thin film adopting 'surface grafting-from approach'. For this the multiwalled carbon nanotubes-ceramic electrode surface is first modified with an iniferter (benzyl N,N-diethyldithiocarbamate) and then dopamine imprinted polymer, under UV irradiation, for differential pulse anodic stripping voltammetric sensing of dopamine in aqueous, blood serum, cerebrospinal fluid, and pharmaceutical samples (detection limit 0.143-0.154 ng mL{sup -1}, 3{sigma}), without any cross reactivity, interferences and false-positive contributions. Such composite electrodes offer higher stability, electron kinetics, and renewable porous surface of larger electroactive area (with insignificant capacitance) than carbon ceramic electrodes. Additional cyclic voltammetry (stripping mode) and chronocoulometry experiments were performed to explore electrodics and kinetics of electro-oxidation of dopamine.

  17. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  18. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  19. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  20. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  1. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  2. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  3. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  4. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  5. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  6. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  7. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  8. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  9. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  10. Integrating effective drought index (EDI) and remote sensing derived parameters for agricultural drought assessment and prediction in Bundelkhand region of India

    Science.gov (United States)

    Padhee, S. K.; Nikam, B. R.; Aggarwal, S. P.; Garg, V.

    2014-11-01

    Drought is an extreme condition due to moisture deficiency and has adverse effect on society. Agricultural drought occurs when restraining soil moisture produces serious crop stress and affects the crop productivity. The soil moisture regime of rain-fed agriculture and irrigated agriculture behaves differently on both temporal and spatial scale, which means the impact of meteorologically and/or hydrological induced agriculture drought will be different in rain-fed and irrigated areas. However, there is a lack of agricultural drought assessment system in Indian conditions, which considers irrigated and rain-fed agriculture spheres as separate entities. On the other hand recent advancements in the field of earth observation through different satellite based remote sensing have provided researchers a continuous monitoring of soil moisture, land surface temperature and vegetation indices at global scale, which can aid in agricultural drought assessment/monitoring. Keeping this in mind, the present study has been envisaged with the objective to develop agricultural drought assessment and prediction technique by spatially and temporally assimilating effective drought index (EDI) with remote sensing derived parameters. The proposed technique takes in to account the difference in response of rain-fed and irrigated agricultural system towards agricultural drought in the Bundelkhand region (The study area). The key idea was to achieve the goal by utilizing the integrated scenarios from meteorological observations and soil moisture distribution. EDI condition maps were prepared from daily precipitation data recorded by Indian Meteorological Department (IMD), distributed within the study area. With the aid of frequent MODIS products viz. vegetation indices (VIs), and land surface temperature (LST), the coarse resolution soil moisture product from European Space Agency (ESA) were downscaled using linking model based on Triangle method to a finer resolution soil moisture product

  11. Ellagic acid derivatives from Terminalia chebula Retz. downregulate the expression of quorum sensing genes to attenuate Pseudomonas aeruginosa PAO1 virulence.

    Directory of Open Access Journals (Sweden)

    Sajal Sarabhai

    Full Text Available BACKGROUND: Burgeoning antibiotic resistance in Pseudomonas aeruginosa has necessitated the development of anti pathogenic agents that can quench acylhomoserine lactone (AHL mediated QS with least risk of resistance. This study explores the anti quorum sensing potential of T. chebula Retz. and identification of probable compounds(s showing anti QS activity and the mechanism of attenuation of P. aeruginosa PAO1 virulence factors. METHODS AND RESULTS: Methanol extract of T. chebula Retz. fruit showed anti QS activity using Agrobacterium tumefaciens A136. Bioactive fraction (F7, obtained by fractionation of methanol extract using Sephadex LH20, showed significant reduction (p<0.001 in QS regulated production of extracellular virulence factors in P. aeruginosa PAO1. Biofilm formation and alginate were significantly (p<0.05 reduced with enhanced (20% susceptibility to tobramycin. Real Time PCR of F7 treated P. aeruginosa showed down regulation of autoinducer synthase (lasI and rhlI and their cognate receptor (lasR and rhlR genes by 89, 90, 90 and 93%, respectively. Electrospray Ionization Mass Spectrometry also showed 90 and 64% reduction in the production of 3-oxo-C(12HSL and C(4HSL after treatment. Decrease in AHLs as one of the mechanisms of quorum quenching by F7 was supported by the reversal of inhibited swarming motility in F7-treated P. aeruginosa PAO1 on addition of C(4HSL. F7 also showed antagonistic activity against 3-oxo-C(12HSL-dependent QS in E. coli bioreporter. C. elegans fed on F7-treated P. aeruginosa showed enhanced survival with LT50 increasing from 24 to 72 h. LC-ESI-MS of F7 revealed the presence of ellagic acid derivatives responsible for anti QS activity in T. chebula extract. CONCLUSIONS: This is the first report on anti QS activity of T. chebula fruit linked to EADs which down regulate the expression of lasIR and rhlIR genes with concomitant decrease in AHLs in P. aeruginosa PAO1 causing attenuation of its virulence factors

  12. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  13. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  14. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  15. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  16. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  17. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  18. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  19. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  20. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  1. Atmosphere aerosol/dust composition over central Asia and western Siberia derived from snow/ice core records and calibrated with NASA remote sensing data

    Science.gov (United States)

    Aizen, V. B.; Aizen, E. M.; Joswiak, D. R.; Surazakov, A. B.; Takeuchi, N.

    2007-12-01

    The vast arid and semi-arid regions of central Asia, Mongolia, and Northern China are the world's second largest source of atmospheric mineral dust. In recent years, severe dust storms in Asia have intensified in frequency, duration, and areal coverage. However, limited spatial and temporal extent of aerosol measurements precludes definitive statements to be made regarding relationship between the Asian aerosol generation and climate. It has been well known that glaciers are the natural archives of environmental records related to past climate and aerosol generation. In our research, we utilized central Asian and western Siberia shallow ice-core records recovered from Altai, Tien Shan and Pamir mountain glaciers. Despite the fact that ice-core data may extend climate/aerosol records back in time, their sparse coverage is inadequate to document aerosol spatial distribution. The NASA products from Aura, Terra and Aqua satellite missions address this gap identifying aerosol sources, transport pathways, and area of deposition. The main objective of our research is to evaluate an affect of climate variability on dynamics of Asian aerosol loading to atmosphere and changes in aerosol transport pathways. Dust particle, major and rare earth element analysis from dust aerosols deposited and accumulated in Altai, Tien Shan and Pamir glaciers suggests that loess from Tajikistan, Afghanistan and north-western China are main sources of aerosol loading into the upper troposphere over the central Asia and western Siberia. At the same time, the soluble ionic component of the ice-cores, related to aerosol generated from evaporate deposits, demonstrated both anthropogenic and natural impacts on atmospheric chemistry over these regions. Large perturbations of Ca2+ derived from CaCO3- rich dust transported from Goby Desert to Altai and Tien Shan. Origin and pathway of the ice-core aerosol depositions for the last 10-years were identified through calibrating ice-core records with dust

  2. α-Amino Acid Derived Benzimidazole-Linked Rhodamines: A Case of Substitution Effect at the Amino Acid Site toward Spiro Ring Opening for Selective Sensing of Al3+ Ions.

    Science.gov (United States)

    Majumdar, Anupam; Mondal, Subhendu; Daniliuc, Constantin G; Sahu, Debashis; Ganguly, Bishwajit; Ghosh, Sourav; Ghosh, Utpal; Ghosh, Kumaresh

    2017-08-07

    α-Amino acid derived benzimidazole-linked rhodamines have been synthesized, and their metal ion sensing properties have been evaluated. Experimentally, l-valine- and l-phenylglycine-derived benzimidazole-based rhodamines 1 and 2 selectively recognize Al 3+ ion in aqueous CH 3 CN (CH 3 CN/H 2 O 4/1 v/v, 10 mM tris HCl buffer, pH 7.0) over the other cations by exhibiting color and "turn-on" emission changes. In contrast, glycine-derived benzimidazole 3 remains silent in the recognition event and emphasizes the role of α-substitution of amino acid undertaken in the design. The fact has been addressed on the basis of the single-crystal X-ray structures and theoretical calculations. Moreover, pink 1·Al 3+ and 2·Al 3+ ensembles selectively sensed F - ions over other halides through a discharge of color. Importantly, compounds 1 and 2 are cell permeable and have been used as imaging reagents for the detection of Al 3+ uptake in human lung carcinoma cell line A549.

  3. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  4. Nanosyntax: A short primer to a new approach to language

    Directory of Open Access Journals (Sweden)

    Michal Starke

    2010-01-01

    Full Text Available Nanosyntax is a new approach to the architecture of language, designed to make (better sense of the new empirical picture emerging from recent years of syntactic research. It is a large-scale project, addressing a wide array of issues, ranging from big issues such as the modularity of language, to fine details, such as the derivation of allomorphy in irregular patterns of given languages and its interaction with syntactic structures.

  5. Percepción de alimentos en el primer lustro de vida: aspectos innatos, causalidad y modificaciones derivadas de la exposición / Food perception in the first lustrum of life: innate aspects, causality and modifications derived from repeated experiencies.

    OpenAIRE

    Alejandro Chacón Villalobos

    2011-01-01

    ResumenEste trabajo de revisión bibliográfica describe el concepto de la percepción sensorial innata de los niños y niñas hacia los alimentos, así como los procesos por medio de los cuales esta se modifica y enriquece a través de la interacción y las experiencias alimentarias durante el primer lustro de vida. Además, la importancia del marco afectivo y social en el que este proceso formativo se da. Tanto los espacios y contextos donde se consumen y se promocionan los alimentos durante la eda...

  6. ZIF-8 derived hexagonal-like α-Fe2O3/ZnO/Au nanoplates with tunable surface heterostructures for superior ethanol gas-sensing performance

    Science.gov (United States)

    Chen, Ying; Li, Hui; Ma, Qian; Che, Quande; Wang, Junpeng; Wang, Gang; Yang, Ping

    2018-05-01

    A series of hexagonal-like α-Fe2O3/ZnO/Au nanoplate heterostructures with tunable morphologies and superior ethanol gas-sensing performance were successfully synthesized via the facile multi-step reaction processes. Hexagonal-like α-Fe2O3 nanoplates with uniform size around 150 nm are employed as new sensor substrates for loading the well-distributed ZnO and Au nanoparticles with adjustable size distribution on the different surfaces. Brunauer-EmmeQ-Teller (BET) surface areas of α-Fe2O3 and α-Fe2O3/ZnO samples are evaluated to be 37.94 and 61.27 m2/g, respectively, while α-Fe2O3/ZnO/Au composites present the highest value of 79.08 m2/g. These α-Fe2O3-based functional materials can exhibit outstanding sensing properties to ethanol. When the ethanol concentration is 100 ppm, the response value of α-Fe2O3/ZnO/Au composites can reach up to 170, which is 14.6 and 80.3 times higher than that of α-Fe2O3/ZnO and pure α-Fe2O3, respectively. The recycling stability and long-time effectiveness can be availably maintained within 30 days, as well as the response and recovery times are shortened to 4 and 5 s, respectively. Significantly, the response value of α-Fe2O3/ZnO/Au composite is still up to 63 at an operating temperature of 280 °C even though the ethanol concentration decreases to 10 ppm. The enhanced gas sensing mechanism would be focused on the synergistic effects of phase compositions, surface heterogeneous structures, large specific surface area, and the selective depositions of Au nanoparticles in α-Fe2O3/ZnO/Au sensors. The synergistic effect of different surface heterostructures referring to α-Fe2O3/Au and α-Fe2O3/ZnO/Au and their novel electron transport processes on the surfaces are first investigated and discussed in details. It is expected that hexagonal-like α-Fe2O3/ZnO/Au nanoplate heterostructures with excellent sensing performance can be the promising highly-sensitive materials in the actual application for monitoring and detecting ethanol.

  7. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  8. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  9. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  10. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  11. Remote Sensing and Water Quality Indicators in the West Flood Canal Semarang City: Spatio-temporal Structures of Lansat-8 Derived Chlorophyll-a and Total Suspended Solids

    Science.gov (United States)

    Subiyanto, Sawitri

    2017-12-01

    One of the waters that has been contaminated by industrial waste and domestic waste is the waters of West Flood Canal in Semarang City which is the estuary of the river system, which passes through the Western City of Semarang which is dense with residential and industrial. So, it is necessary to have information about the assessment of water quality in the estuary of the West Flood Canal. Remote sensing technology can analyze the results of recording the spectral characteristics of water with water quality parameters. One of the parameters for assessing water quality is Chlorophyll-a and Total Suspended Solid, can be estimated through remote sensing technology using multispectral Lansat-8 Satellite images data from April, June, and August, 2017 and there are three selected algorithms. Based on the results of TSS and Chlorophyll-A processing, the TSS shows values greater than or equal to 100 which can be said that West Flood Canal is damaged (hypertrophic). While the chlorophyll-a shows a value less than 100 indicating Eutrophic status (threatened). This is caused by the number of suspended materials in the water surface and also because of the disturbance of water vegetation in the form of weeds that destroy the function of the actual West Canal Flood.

  12. Using vegetation structure estimates derived from multi-source remote sensing to predict dynamics of a semi-arid ecosystem in the western US

    Science.gov (United States)

    Shrestha, R.; Mitchell, J. J.; Glenn, N. F.; Flores, A. N.

    2014-12-01

    The distribution of species and vegetation types across the western US are expected to shift in response to climate change. Previous studies have documented the change in fire regime and the increasing fire-invasive grass cycle occurring in the western U.S. The change in vegetation structure due to climate change and invasive species alters the fuel load, making these ecosystems vulnerable to high-severity fire. Synergistic remote sensing data, such as hyperspectral data and high-resolution lidar, can be leveraged to capture the composition and structural variability of short-statured semiarid vegetation (e.g. sagebrush, annual grasses). We use a random-forests based fusion technique to integrate multi-source airborne data (hyperspectral and LiDAR) and generate spatially-explicit estimates of vegetation composition and structure (biomass, cover, density, height, LAI) and associated uncertainty across a climate and elevation gradient in southern Idaho. The results will be used to initialize an individual-based terrestrial biosphere model (Ecosystem Demography, ED2) and estimate structural dynamics under future scenarios. This study will provide a basis for understanding feedback mechanisms related to changing climate conditions, fire regimes and patterns of non-native plant invasion. The forthcoming field and remote sensing collection campaigns are also designed for parameterizing a dryland shrub plant functional type in the ED2 model.

  13. Time-sensitive remote sensing

    CERN Document Server

    Lippitt, Christopher; Coulter, Lloyd

    2015-01-01

    This book documents the state of the art in the use of remote sensing to address time-sensitive information requirements. Specifically, it brings together a group of authors who are both researchers and practitioners, who work toward or are currently using remote sensing to address time-sensitive information requirements with the goal of advancing the effective use of remote sensing to supply time-sensitive information. The book addresses the theoretical implications of time-sensitivity on the remote sensing process, assessments or descriptions of methods for expediting the delivery and improving the quality of information derived from remote sensing, and describes and analyzes time-sensitive remote sensing applications, with an emphasis on lessons learned. This book is intended for remote sensing scientists, practitioners (e.g., emergency responders or administrators of emergency response agencies), and students, but will also be of use to those seeking to understand the potential of remote sensing to addres...

  14. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  15. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  16. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  17. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  18. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  19. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  20. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  1. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  2. Remote Sensing

    CERN Document Server

    Khorram, Siamak; Koch, Frank H; van der Wiele, Cynthia F

    2012-01-01

    Remote Sensing provides information on how remote sensing relates to the natural resources inventory, management, and monitoring, as well as environmental concerns. It explains the role of this new technology in current global challenges. "Remote Sensing" will discuss remotely sensed data application payloads and platforms, along with the methodologies involving image processing techniques as applied to remotely sensed data. This title provides information on image classification techniques and image registration, data integration, and data fusion techniques. How this technology applies to natural resources and environmental concerns will also be discussed.

  3. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

    Science.gov (United States)

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

    2018-01-01

    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  6. Nanostructure and Volatile Organic Compounds Sensing Properties of α-Fe2O3/Reduced Graphene Oxide Nanocomposite Derived by Spray Method

    Science.gov (United States)

    Zolghadr, S.; Kimiagar, S.; Khojier, K.

    2017-12-01

    This paper investigates the α-Fe2O3/reduced graphene oxide (rGO) nanocomposite as a volatile organic compounds (VOCs) sensor. The α-Fe2O3/reduced graphene oxide nanocomposites of about 370 nm thickness were synthesized by a spray method with different rGO contents (3%, 4%, and 5%) on SiO2/Si substrates. The samples were structurally and morphologically characterized by x-ray diffraction, and field emission scanning electron microscopy. These analyses showed that an increase in rGO content decreases the crystallinity of the samples. In order to study the VOCs sensing properties, the sensitivity and selectivity of the samples were tested with different VOCs vapors including ethanol, methanol, toluene, benzene, and formic acid in the temperature range of 200-400°C. The results show that the α-Fe2O3/rGO nanocomposites are more selective to ethanol than the other vapors, while an increase in rGO content decreases the sensitivity of the samples. The α-Fe2O3/rGO (3%)-based ethanol sensor also shows a good stability with respect to relative humidity in the range of 20-50% with a 1-ppm detection limit at the operating temperature of 280°C.

  7. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  8. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  9. Science & the Senses: Perceptions & Deceptions

    Science.gov (United States)

    Stansfield, William D.

    2012-01-01

    Science requires the acquisition and analysis of empirical (sense-derived) data. Given the same physical objects or phenomena, the sense organs of all people do not respond equally to these stimuli, nor do their minds interpret sensory signals identically. Therefore, teachers should develop lectures on human sensory systems that include some…

  10. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  11. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  12. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  13. Glucose Sensing

    CERN Document Server

    Geddes, Chris D

    2006-01-01

    Topics in Fluorescence Spectroscopy, Glucose Sensing is the eleventh volume in the popular series Topics in Fluorescence Spectroscopy, edited by Drs. Chris D. Geddes and Joseph R. Lakowicz. This volume incorporates authoritative analytical fluorescence-based glucose sensing reviews specialized enough to be attractive to professional researchers, yet also appealing to the wider audience of scientists in related disciplines of fluorescence. Glucose Sensing is an essential reference for any lab working in the analytical fluorescence glucose sensing field. All academics, bench scientists, and industry professionals wishing to take advantage of the latest and greatest in the continuously emerging field of glucose sensing, and diabetes care & management, will find this volume an invaluable resource. Topics in Fluorescence Spectroscopy Volume 11, Glucose Sensing Chapters include: Implantable Sensors for Interstitial Fluid Smart Tattoo Glucose Sensors Optical Enzyme-based Glucose Biosensors Plasmonic Glucose Sens...

  14. Make Sense?

    DEFF Research Database (Denmark)

    Gyrd-Jones, Richard; Törmälä, Minna

    Purpose: An important part of how we sense a brand is how we make sense of a brand. Sense-making is naturally strongly connected to how we cognize about the brand. But sense-making is concerned with multiple forms of knowledge that arise from our interpretation of the brand-related stimuli......: Declarative, episodic, procedural and sensory. Knowledge is given meaning through mental association (Keller, 1993) and / or symbolic interaction (Blumer, 1969). These meanings are centrally related to individuals’ sense of identity or “identity needs” (Wallpach & Woodside, 2009). The way individuals make...... sense of brands is related to who people think they are in their context and this shapes what they enact and how they interpret the brand (Currie & Brown, 2003; Weick, Sutcliffe, & Obstfeld, 2005; Weick, 1993). Our subject of interest in this paper is how stakeholders interpret and ascribe meaning...

  15. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  16. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  17. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  18. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  19. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  20. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  1. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  2. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  3. PEMETAAN FAKTOR C YANG DITURUNKAN DARI BERBAGAI INDEKS VEGETASI DATA PENGINDERAAN JAUH SEBAGAI MASUKAN PEMODELAN EROSI DI DAS MERAWU (C Factor Mapping Derived from Various Vegetation Indeces of Remotely Sensed Data for Erosion Modeling at Merawu Catchment

    Directory of Open Access Journals (Sweden)

    Bambang Sulistyo

    2011-03-01

    Full Text Available ABSTRAK Penelitian ini bertujuan untuk mengkaji berbagai indeks vegetasi yang diturunkan dari data penginderaan jauh dalam pemetaan faktor C sebagai masukan dalam pemodelan erosi USLE (Universal Soil Loss Equation. Metode yang digunakan dalam penelitian ini adalah dengan menganalisis data penginderaan jauh Landsat 7 ETM + sehingga menghasilkan berbagai indeks vegetasi yang kemudian dilakukan analisis korelasi dengan Faktor C yang diukur di lapangan pada 45 lokasi. Dari analisis ini diperoleh suatu model untuk pemetaan faktor C (C model dari berbagai indeks vegetasi. Peta faktor C yang diperoleh kemudian dilakukan validasi pada 48 lokasi sehingga akan diketahui keakuratan hasil pemodelan. Dalam penelitian ini dikaji 11 (sebelas indeks vegetasi yang diturunkan dari data penginderaan jauh, yaitu ARVI, MSAVI, TVI, VIF, NDVI, TSAVI, SAVI, EVI, RVI, DVI, dan PVI. Hasil penelitian menunjukkan bahwa dari 11 indeks vegetasi yang dikaji terdapat 8 indeks vegetasi yang menghasilkan peta faktor C dengan ketelitian yang tinggi, yaitu MSAVI, TVI, VIF, NDVI, TSAVI, SAVI, EVI, dan RVI. Indeks vegetasi yang menggunakan rumus yang lebih kompleks menghasilkan koefisien korelasi yang lebih tinggi dibanding dengan indeks vegetasi yang menggunakan rumus yang sederhana. Indeks vegetasi yang mempertimbangkan latar belakang tanah (MSAVI dan TSAVI mempunyai koefisien korelasi lebih tinggi dibanding dengan koefisien korelasi yang tidak mempertimbangkan latar belakang tanah. ABSTRACT The research was aim at studying C factor mapping derived from various vegetation indices of remotely-sensed data as input for USLE (Universal Soil Loss Equation erosion modeling at Merawu Catchment. Methodology applied was by analyzing remote sensing data of Landsat 7 ETM+ to obtain various vegetation indices for correlation analysis with C Factor measured directly from 45 locations on the field. The analysis resulted models for C factor mapping from various vegetation indices (Cmodel. These

  4. The effect of inflation on the morphology-derived rheological parameters of lava flows and its implications for interpreting remote sensing data - A case study on the 2014/2015 eruption at Holuhraun, Iceland

    Science.gov (United States)

    Kolzenburg, S.; Jaenicke, J.; Münzer, U.; Dingwell, D. B.

    2018-05-01

    Morphology-derived lava flow rheology is a frequently used tool in volcanology and planetary science to determine rheological parameters and deduce the composition of lavas on terrestrial planets and their moons. These calculations are usually based on physical equations incorporating 1) lava flow driving forces: gravity, slope and flow-rate and 2) morphological data such as lava flow geometry: flow-width, -height or shape of the flow outline. All available methods assume that no geometrical changes occur after emplacement and that the measured flow geometry reflects the lava's apparent viscosity and/or yield strength during emplacement. It is however well-established from terrestrial examples that lava flows may inflate significantly after the cessation of flow advance. This inflation affects, in turn, the width-to-height ratio upon which the rheological estimates are based and thus must result in uncertainties in the determination of flow rheology, as the flow height is one of the key parameters in the morphology-based deduction of flow properties. Previous studies have recognized this issue but, to date, no assessment of the magnitude of this error has been presented. This is likely due to a lack of digital elevation models (DEMs) at sufficiently high spatial and temporal resolution. The 2014/15 Holuhraun eruption in central Iceland represents one of the best monitored large volume (1.5 km3) lava flow fields (85 km2) to date. An abundance of scientific field and remote sensing data were collected during its emplacement. Moreover, inflation plays a key role in the emplacement dynamics of the late stage of the lava field. Here, we use a time series of high resolution DEMs acquired by the TanDEM-X satellite mission prior, during and after the eruption to evaluate the error associated with the most common methods of deriving lava flow rheology from morphological parameters used in planetary science. We can distinguish two dominant processes as sources of error in

  5. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  6. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  7. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  8. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  9. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  10. Remote earth sensing experiments

    Energy Technology Data Exchange (ETDEWEB)

    Trifonov, Yu V

    1981-01-01

    Description of data devices for deriving multi-spectral measuring television measurement data of middle and high resolution through use of second generation Meteor-type satellites. Options for developing a permanent and active remote sensing system in USSR are discussed. It is noted that the present experiment is an important step in that direction. Design and structural data for this particular device and its application in the experiment are covered.

  11. Percepción de alimentos en el primer lustro de vida: aspectos innatos, causalidad y modificaciones derivadas de la exposición / Food perception in the first lustrum of life: innate aspects, causality and modifications derived from repeated experiencies.

    Directory of Open Access Journals (Sweden)

    Alejandro Chacón Villalobos

    2011-12-01

    Full Text Available ResumenEste trabajo de revisión bibliográfica describe el concepto de la percepción sensorial innata de los niños y niñas hacia los alimentos, así como los procesos por medio de los cuales esta se modifica y enriquece a través de la interacción y las experiencias alimentarias durante el primer lustro de vida. Además, la importancia del marco afectivo y social en el que este proceso formativo se da. Tanto los espacios y contextos donde se consumen y se promocionan los alimentos durante la edad preescolar, el grado de disciplina impuesta, y el nivel de autodeterminación permitido a los menores tienen, en conjunto, un impacto que perdura a lo largo de toda la vida del ser humano. Por ello, la adecuada gestión de las experiencias sensoriales orientadas a generar improntas positivas en el hogar y en el aula, es de gran importancia para educadores y padres de familia por igual. La neofobia y la aversión a los alimentos, así como el rol de los medios de comunicación, son también abordadas complementariamente.AbstractThis paper review describes the innate sensorial perception of the children towards foods, as well as the processes by means of which this perception modifies and enriches through the interaction and the exposure to food during the first five years of life. It evaluates, in addition, the importance of the affective and social frame in which this formative process occurs. The spaces and contexts in which the foods are both consumed and promoted, the degree of imposed discipline, and the level of self-determination allowed to the minors, have altogether an impact that lasts throughout the entire lifespan of the human being. For this reason, a suitable management of the sensorial experiences oriented to generate positive impressions at the home and at the classroom, is of great importance for both educators and parents. Food neophobia and aversion, as well as the roll of mass media are also explained complementarily.

  12. Synthesis and Electrical and Gas Sensing Properties of Some 5-(Quinolinylmethylene-2-thioxodihydropyrimidine-4,6(1H,5H-dione and 5-(Quinolinylmethylenepyrimidine-2,4,6(1H,3H,5H-trione Derivatives

    Directory of Open Access Journals (Sweden)

    H. Kerim Beker

    2013-01-01

    Full Text Available Eight new 5-(quinolinylmethylenebarbituric acid derivatives were synthesized by the reaction of 1,3-dimethylbarbituric acid and 1,3-diethyl-2-thiobarbituric acid with quinoline-4-carboxaldehydes and several quinoline-2-carboxaldehydes via Knoevenagel condensation. The novel compounds were characterized by 1H NMR, 13C NMR, mass, IR, and UV-visible spectral data and elemental analyses. d.c. and a.c. conduction properties of the compounds were investigated in the frequency range of 40–105 Hz and temperature range 295–440 K. The d.c. results showed an activated conductivity dependence on temperature for all films. Obtained data reveal that a.c. conductivity obeys the relation and exponent is found to decrease by increasing temperature. The analysis of the a.c. conduction data showed that the CBH model is the dominant conduction mechanism for the electron transport in the films. Gas sensing properties of the films for the volatile organic compounds (VOCs were also investigated in the same temperature range. Maximum sensitivity to VOCs was observed at around 360 K for compound 6.

  13. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  14. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  15. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  16. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  17. Passive infrared motion sensing technology

    International Nuclear Information System (INIS)

    Doctor, A.P.

    1994-01-01

    In the last 10 years passive IR based (8--12 microns) motion sensing has matured to become the dominant method of volumetric space protection and surveillance. These systems currently cost less than $25 to produce and yet use traditionally expensive IR optics, filters, sensors and electronic circuitry. This IR application is quite interesting in that the volumes of systems produced and the costs and performance level required prove that there is potential for large scale commercial applications of IR technology. This paper will develop the basis and principles of operation of a staring motion sensor system using a technical approach. A model for the motion of the target is developed and compared to the background. The IR power difference between the target and the background as well as the optical requirements are determined from basic principles and used to determine the performance of the system. Low cost reflective and refractive IR optics and bandpass IR filters are discussed. The pyroelectric IR detector commonly used is fully discussed and characterized. Various schemes for ''false alarms'' have been developed and are also explained. This technology is also used in passive IR based motion sensors for other applications such as lighting control. These applications are also discussed. In addition the paper will discuss new developments in IR surveillance technology such as the use of linear motion sensing arrays. This presentation can be considered a ''primer'' on the art of Passive IR Motion Sensing as applied to Surveillance Technology

  18. Pervasive sensing

    Science.gov (United States)

    Nagel, David J.

    2000-11-01

    The coordinated exploitation of modern communication, micro- sensor and computer technologies makes it possible to give global reach to our senses. Web-cameras for vision, web- microphones for hearing and web-'noses' for smelling, plus the abilities to sense many factors we cannot ordinarily perceive, are either available or will be soon. Applications include (1) determination of weather and environmental conditions on dense grids or over large areas, (2) monitoring of energy usage in buildings, (3) sensing the condition of hardware in electrical power distribution and information systems, (4) improving process control and other manufacturing, (5) development of intelligent terrestrial, marine, aeronautical and space transportation systems, (6) managing the continuum of routine security monitoring, diverse crises and military actions, and (7) medicine, notably the monitoring of the physiology and living conditions of individuals. Some of the emerging capabilities, such as the ability to measure remotely the conditions inside of people in real time, raise interesting social concerns centered on privacy issues. Methods for sensor data fusion and designs for human-computer interfaces are both crucial for the full realization of the potential of pervasive sensing. Computer-generated virtual reality, augmented with real-time sensor data, should be an effective means for presenting information from distributed sensors.

  19. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  20. Nonsense and sense suppression abilities of original and derivative Methanosarcina mazei pyrrolysyl-tRNA synthetase-tRNA(Pyl pairs in the Escherichia coli BL21(DE3 cell strain.

    Directory of Open Access Journals (Sweden)

    Keturah A Odoi

    Full Text Available Systematic studies of nonsense and sense suppression of the original and three derivative Methanosarcina mazei PylRS-tRNA(Pyl pairs and cross recognition between nonsense codons and various tRNA(Pyl anticodons in the Escherichia coli BL21(DE3 cell strain are reported. tRNA(CUA(Pyl is orthogonal in E. coli and able to induce strong amber suppression when it is co-expressed with pyrrolysyl-tRNA synthetase (PylRS and charged with a PylRS substrate, N(ε-tert-butoxycarbonyl-L-lysine (BocK. Similar to tRNA(CUA(Pyl, tRNA(UUA(Pyl is also orthogonal in E. coli and can be coupled with PylRS to genetically incorporate BocK at an ochre mutation site. Although tRNA(UUA(Pyl is expected to recognize a UAG codon based on the wobble hypothesis, the PylRS-tRNA(UUA(Pyl pair does not give rise to amber suppression that surpasses the basal amber suppression level in E. coli. E. coli itself displays a relatively high opal suppression level and tryptophan (Trp is incorporated at an opal mutation site. Although the PylRS-tRNA(UCA(Pyl pair can be used to encode BocK at an opal codon, the pair fails to suppress the incorporation of Trp at the same site. tRNA(CCU(Pyl fails to deliver BocK at an AGG codon when co-expressed with PylRS in E. coli.

  1. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  2. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  3. On higher derivative gravity

    International Nuclear Information System (INIS)

    Accioly, A.J.

    1987-01-01

    A possible classical route conducting towards a general relativity theory with higher-derivatives starting, in a sense, from first principles, is analysed. A completely causal vacuum solution with the symmetries of the Goedel universe is obtained in the framework of this higher-derivative gravity. This very peculiar and rare result is the first known vcuum solution of the fourth-order gravity theory that is not a solution of the corresponding Einstein's equations.(Author) [pt

  4. A primer on exterior differential calculus

    Directory of Open Access Journals (Sweden)

    Burton D.A.

    2003-01-01

    Full Text Available A pedagogical application-oriented introduction to the cal­culus of exterior differential forms on differential manifolds is presented. Stokes' theorem, the Lie derivative, linear con­nections and their curvature, torsion and non-metricity are discussed. Numerous examples using differential calculus are given and some detailed comparisons are made with their tradi­tional vector counterparts. In particular, vector calculus on R3 is cast in terms of exterior calculus and the traditional Stokes' and divergence theorems replaced by the more powerful exterior expression of Stokes' theorem. Examples from classical continuum mechanics and spacetime physics are discussed and worked through using the language of exterior forms. The numerous advantages of this calculus, over more traditional ma­chinery, are stressed throughout the article. .

  5. Light front field theory: an advanced primer

    International Nuclear Information System (INIS)

    Martinovic, L.

    2007-01-01

    We present an elementary introduction to quantum field theory formulated in terms of Dirac's light front variables. In addition to general principles and methods, a few more specific topics and approaches based on the author's work will be discussed. Most of the discussion deals with massive two-dimensional models formulated in a finite spatial volume starting with a detailed comparison between quantization of massive free fields in the usual field theory and the light front (LF) quantization. We discuss basic properties such as relativistic invariance and causality. After the LF treatment of the soluble Federbush model, a LF approach to spontaneous symmetry breaking is explained and a simple gauge theory - the massive Schwinger model in various gauges is studied. A LF version of bosonization and the massive Thirring model are also discussed. A special chapter is devoted to the method of discretized light cone quantization and its application to calculations of the properties of quantum solitons. The problem of LF zero modes is illustrated with the example of the two/dimensional Yukawa model. Hamiltonian perturbation theory in the LF formulation is derived and applied to a few simple processes to demonstrate its advantages. As a byproduct, it is shown that the LF theory cannot be obtained as a 'light-like' limit of the usual field theory quantized on a initial space-like surface. A simple LF formulation of the Higgs mechanism is then given Since our intention was to provide a treatment of the light front quantization accessible to postgradual students, an effort was made to discuss most of the topics pedagogically and number of technical details and derivations are contained in the appendices (Author)

  6. Conversational sensing

    Science.gov (United States)

    Preece, Alun; Gwilliams, Chris; Parizas, Christos; Pizzocaro, Diego; Bakdash, Jonathan Z.; Braines, Dave

    2014-05-01

    Recent developments in sensing technologies, mobile devices and context-aware user interfaces have made it pos- sible to represent information fusion and situational awareness for Intelligence, Surveillance and Reconnaissance (ISR) activities as a conversational process among actors at or near the tactical edges of a network. Motivated by use cases in the domain of Company Intelligence Support Team (CoIST) tasks, this paper presents an approach to information collection, fusion and sense-making based on the use of natural language (NL) and controlled nat- ural language (CNL) to support richer forms of human-machine interaction. The approach uses a conversational protocol to facilitate a ow of collaborative messages from NL to CNL and back again in support of interactions such as: turning eyewitness reports from human observers into actionable information (from both soldier and civilian sources); fusing information from humans and physical sensors (with associated quality metadata); and assisting human analysts to make the best use of available sensing assets in an area of interest (governed by man- agement and security policies). CNL is used as a common formal knowledge representation for both machine and human agents to support reasoning, semantic information fusion and generation of rationale for inferences, in ways that remain transparent to human users. Examples are provided of various alternative styles for user feedback, including NL, CNL and graphical feedback. A pilot experiment with human subjects shows that a prototype conversational agent is able to gather usable CNL information from untrained human subjects.

  7. Remote RemoteRemoteRemote sensing potential for sensing ...

    African Journals Online (AJOL)

    Remote RemoteRemoteRemote sensing potential for sensing potential for sensing potential for sensing potential for sensing potential for sensing potential for sensing potential for sensing potential for sensing potential for sensing potential for sensing p. A Ngie, F Ahmed, K Abutaleb ...

  8. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  9. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  10. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  11. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  12. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  13. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  14. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  15. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  16. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  17. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  18. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  19. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  20. HORIZON SENSING

    Energy Technology Data Exchange (ETDEWEB)

    Larry G. Stolarczyk

    2003-03-18

    With the aid of a DOE grant (No. DE-FC26-01NT41050), Stolar Research Corporation (Stolar) developed the Horizon Sensor (HS) to distinguish between the different layers of a coal seam. Mounted on mining machine cutter drums, HS units can detect or sense the horizon between the coal seam and the roof and floor rock, providing the opportunity to accurately mine the section of the seam most desired. HS also enables accurate cutting of minimum height if that is the operator's objective. Often when cutting is done out-of-seam, the head-positioning function facilitates a fixed mining height to minimize dilution. With this technology, miners can still be at a remote location, yet cut only the clean coal, resulting in a much more efficient overall process. The objectives of this project were to demonstrate the feasibility of horizon sensing on mining machines and demonstrate that Horizon Sensing can allow coal to be cut cleaner and more efficiently. Stolar's primary goal was to develop the Horizon Sensor (HS) into an enabling technology for full or partial automation or ''agile mining''. This technical innovation (R&D 100 Award Winner) is quickly demonstrating improvements in productivity and miner safety at several prominent coal mines in the United States. In addition, the HS system can enable the cutting of cleaner coal. Stolar has driven the HS program on the philosophy that cutting cleaner coal means burning cleaner coal. The sensor, located inches from the cutting bits, is based upon the physics principles of a Resonant Microstrip Patch Antenna (RMPA). When it is in proximity of the rock-coal interface, the RMPA impedance varies depending on the thickness of uncut coal. The impedance is measured by the computer-controlled electronics and then sent by radio waves to the mining machine. The worker at the machine can read the data via a Graphical User Interface, displaying a color-coded image of the coal being cut, and direct the machine

  1. High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

    Science.gov (United States)

    Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

    2012-01-01

    The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

  2. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  3. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  4. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  5. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  6. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  7. Plasmonic sensing

    DEFF Research Database (Denmark)

    Mogensen, Klaus Bo

    2015-01-01

    Plasmonic sensors typically rely on detection of changes in the refractive index of the surrounding medium. Here, an alternative approach is reported based on electrical surface screening and controlled dissolution of ultrasmall silver nanoparticles (NPs; R ... in the plasmon band. This is demonstrated by using the strong nucleophiles, cyanide and cysteamine, as ligands. The “dissolution paths” in terms of peak wavelength and amplitude shifts differ significantly between different types of analytes, which are suggested as a means to obtain selectivity of the detection...... that cannot be obtained by traditional refractive index sensing, without the use of bioprobes. A simple modified Drude model is used to account for shifts in the plasmon band position due to electrical charging. Here, a screening parameter is introduced in the expression for the free electron density...

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  11. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    Science.gov (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  12. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  13. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  14. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  15. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  16. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  17. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  18. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  19. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  20. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  1. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  2. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  3. Navigation: Whence Our Sense of Direction?

    Science.gov (United States)

    Gallistel, C R

    2017-02-06

    Behavioral data have long implied our sense of direction derives from global environmental shape; electrophysiological evidence, however, has seemed to imply it derives from salient non-geometric landmarks. Experiments on the re-establishment of place fields in disoriented mice now align the electrophysiological data with the behavioral data. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  5. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  6. Sensitivity analysis in remote sensing

    CERN Document Server

    Ustinov, Eugene A

    2015-01-01

    This book contains a detailed presentation of general principles of sensitivity analysis as well as their applications to sample cases of remote sensing experiments. An emphasis is made on applications of adjoint problems, because they are more efficient in many practical cases, although their formulation may seem counterintuitive to a beginner. Special attention is paid to forward problems based on higher-order partial differential equations, where a novel matrix operator approach to formulation of corresponding adjoint problems is presented. Sensitivity analysis (SA) serves for quantitative models of physical objects the same purpose, as differential calculus does for functions. SA provides derivatives of model output parameters (observables) with respect to input parameters. In remote sensing SA provides computer-efficient means to compute the jacobians, matrices of partial derivatives of observables with respect to the geophysical parameters of interest. The jacobians are used to solve corresponding inver...

  7. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  8. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  10. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  11. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  12. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  13. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  14. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  15. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  16. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  17. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  18. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  19. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  20. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  1. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  2. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  3. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  4. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  5. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  6. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  8. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  9. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  10. Sensing the wind profile

    Energy Technology Data Exchange (ETDEWEB)

    Pena, A.

    2009-03-15

    This thesis consists of two parts. The first is a synopsis of the theoretical progress of the study that is based on a number of journal papers. The papers, which constitute the second part of the report, aim to analyze, measure, and model the wind prole in and beyond the surface layer by combining observations from cup anemometers with lidars. The lidar is necessary to extend the measurements on masts at the Horns Rev offshore wind farm and over at land at Hoevsoere, Denmark. Both sensing techniques show a high degree of agreement for wind speed measurements performed at either sites. The wind speed measurements are averaged for several stability conditions and compare well with the surface-layer wind profile. At Hoevsoere, it is sufficient to scale the wind speed with the surface friction velocity, whereas at Horns Rev a new scaling is added, due to the variant roughness length. This new scaling is coupled to wind prole models derived for flow over the sea and tested against the wind proles up to 160 m at Horns Rev. The models, which account for the boundary-layer height in stable conditions, show better agreement with the measurements than compared to the traditional theory. Mixing-length parameterizations for the neutral wind prole compare well with length-scale measurements up to 300 m at Hoevsoere and 950 m at Leipzig. The mixing-length-derived wind proles strongly deviate from the logarithmic wind prole, but agree better with the wind speed measurements. The length-scale measurements are compared to the length scale derived from a spectral analysis performed up to 160 m at Hoevsoere showing high agreement. Mixing-length parameterizations are corrected to account for stability and used to derive wind prole models. These compared better to wind speed measurements up to 300 m at Hoevsoere than the surface-layer wind prole. The boundary-layer height is derived in nearneutral and stable conditions based on turbulent momentum uxes only and in unstable conditions

  11. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  12. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  13. Natural Biowaste-Cocoon-Derived Granular Activated Carbon-Coated ZnO Nanorods: A Simple Route To Synthesizing a Core-Shell Structure and Its Highly Enhanced UV and Hydrogen Sensing Properties.

    Science.gov (United States)

    Saravanan, Adhimoorthy; Huang, Bohr-Ran; Kathiravan, Deepa; Prasannan, Adhimoorthy

    2017-11-15

    Granular activated carbon (GAC) materials were prepared via simple gas activation of silkworm cocoons and were coated on ZnO nanorods (ZNRs) by the facile hydrothermal method. The present combination of GAC and ZNRs shows a core-shell structure (where the GAC is coated on the surface of ZNRs) and is exposed by systematic material analysis. The as-prepared samples were then fabricated as dual-functional sensors and, most fascinatingly, the as-fabricated core-shell structure exhibits better UV and H 2 sensing properties than those of as-fabricated ZNRs and GAC. Thus, the present core-shell structure-based H 2 sensor exhibits fast responses of 11% (10 ppm) and 23.2% (200 ppm) with ultrafast response and recovery. However, the UV sensor offers an ultrahigh photoresponsivity of 57.9 A W -1 , which is superior to that of as-grown ZNRs (0.6 A W -1 ). Besides this, switching photoresponse of GAC/ZNR core-shell structures exhibits a higher switching ratio (between dark and photocurrent) of 1585, with ultrafast response and recovery, than that of as-grown ZNRs (40). Because of the fast adsorption ability of GAC, it was observed that the finest distribution of GAC on ZNRs results in rapid electron transportation between the conduction bands of GAC and ZNRs while sensing H 2 and UV. Furthermore, the present core-shell structure-based UV and H 2 sensors also well-retained excellent sensitivity, repeatability, and long-term stability. Thus, the salient feature of this combination is that it provides a dual-functional sensor with biowaste cocoon and ZnO, which is ecological and inexpensive.

  14. Comparative study on upconversion luminescence and temperature sensing of α- and β-NaYF{sub 4}:Yb{sup 3+}/Er{sup 3+} nano-/micro-crystals derived from a microwave-assisted hydrothermal route

    Energy Technology Data Exchange (ETDEWEB)

    Tong, Lili [Department of Physics, Dalian Maritime University, Dalian 116026 (China); Li, Xiangping, E-mail: lixp@dlmu.edu.cn [Department of Physics, Dalian Maritime University, Dalian 116026 (China); Hua, Ruinian [College of Life Science, Dalian Nationalities University, Dalian 116600 (China); Li, Xuejing; Zheng, Hui; Sun, Jiashi; Zhang, Jinsu; Cheng, Lihong [Department of Physics, Dalian Maritime University, Dalian 116026 (China); Chen, Baojiu, E-mail: chenmbj@sohu.com [Department of Physics, Dalian Maritime University, Dalian 116026 (China)

    2015-11-15

    Yb{sup 3+}/Er{sup 3+} co-doped α- and β-phase NaYF{sub 4} nano-/micro-crystals were prepared through a microwave-assisted hydrothermal route. The crystal structure and microscopic morphology of the samples were characterized by means of X-ray diffraction (XRD) and scanning electron microscopy (SEM). Frequency upconverted emissions from the two thermally coupled excited state {sup 2}H{sub 11/2} and {sup 4}S{sub 3/2} levels of Er{sup 3+} in both phases of phosphors were recorded at temperatures ranging from room temperature to 573 K under 980 nm infrared laser excitation. The time scanning upconversion spectra were investigated in detail to reveal the thermal effect induced by laser irradiation and the luminescent thermal stability of the two phases NaYF{sub 4} polycrystals. Comparison of the upconversion luminescence and the sensitivity between the two phases NaYF{sub 4} polycrystals indicated that β-phase NaYF{sub 4} won much stronger luminescent intensity, better luminescent thermal stability, and higher temperature sensitivity. - Highlights: • Yb{sup 3+}/Er{sup 3+} codoped NaYF{sub 4} were prepared by a microwave-assisted hydrothermal route. • The UC luminescence and temperature sensing properties were studied. • Comparison of the UCL and the sensitivity between α- and β-phase samples were done. • Thermal effect and UCL thermo-stability were studied by time scanning UCL spectra. • β-phase sample won much better luminescent and temperature sensing properties.

  15. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  16. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  17. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  18. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  19. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  20. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  1. Global Derivatives

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    approaches to dealing in the global business environment." - Sharon Brown-Hruska, Commissioner, Commodity Futures Trading Commission, USA. "This comprehensive survey of modern risk management using derivative securities is a fine demonstration of the practical relevance of modern derivatives theory to risk......" provides comprehensive coverage of different types of derivatives, including exchange traded contracts and over-the-counter instruments as well as real options. There is an equal emphasis on the practical application of derivatives and their actual uses in business transactions and corporate risk...... management situations. Its key features include: derivatives are introduced in a global market perspective; describes major derivative pricing models for practical use, extending these principles to valuation of real options; practical applications of derivative instruments are richly illustrated...

  2. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  3. Optical display for radar sensing

    Science.gov (United States)

    Szu, Harold; Hsu, Charles; Willey, Jefferson; Landa, Joseph; Hsieh, Minder; Larsen, Louis V.; Krzywicki, Alan T.; Tran, Binh Q.; Hoekstra, Philip; Dillard, John T.; Krapels, Keith A.; Wardlaw, Michael; Chu, Kai-Dee

    2015-05-01

    Boltzmann headstone S = kB Log W turns out to be the Rosette stone for Greek physics translation optical display of the microwave sensing hieroglyphics. The LHS is the molecular entropy S measuring the degree of uniformity scattering off the sensing cross sections. The RHS is the inverse relationship (equation) predicting the Planck radiation spectral distribution parameterized by the Kelvin temperature T. Use is made of the conservation energy law of the heat capacity of Reservoir (RV) change T Δ S = -ΔE equals to the internal energy change of black box (bb) subsystem. Moreover, an irreversible thermodynamics Δ S > 0 for collision mixing toward totally larger uniformity of heat death, asserted by Boltzmann, that derived the so-called Maxwell-Boltzmann canonical probability. Given the zero boundary condition black box, Planck solved a discrete standing wave eigenstates (equation). Together with the canonical partition function (equation) an average ensemble average of all possible internal energy yielded the celebrated Planck radiation spectral (equation) where the density of states (equation). In summary, given the multispectral sensing data (equation), we applied Lagrange Constraint Neural Network (LCNN) to solve the Blind Sources Separation (BSS) for a set of equivalent bb target temperatures. From the measurements of specific value, slopes and shapes we can fit a set of Kelvin temperatures T's for each bb targets. As a result, we could apply the analytical continuation for each entropy sources along the temperature-unique Planck spectral curves always toward the RGB color temperature display for any sensing probing frequency.

  4. Mobile Sensing Systems

    Science.gov (United States)

    Macias, Elsa; Suarez, Alvaro; Lloret, Jaime

    2013-01-01

    Rich-sensor smart phones have made possible the recent birth of the mobile sensing research area as part of ubiquitous sensing which integrates other areas such as wireless sensor networks and web sensing. There are several types of mobile sensing: individual, participatory, opportunistic, crowd, social, etc. The object of sensing can be people-centered or environment-centered. The sensing domain can be home, urban, vehicular… Currently there are barriers that limit the social acceptance of mobile sensing systems. Examples of social barriers are privacy concerns, restrictive laws in some countries and the absence of economic incentives that might encourage people to participate in a sensing campaign. Several technical barriers are phone energy savings and the variety of sensors and software for their management. Some existing surveys partially tackle the topic of mobile sensing systems. Published papers theoretically or partially solve the above barriers. We complete the above surveys with new works, review the barriers of mobile sensing systems and propose some ideas for efficiently implementing sensing, fusion, learning, security, privacy and energy saving for any type of mobile sensing system, and propose several realistic research challenges. The main objective is to reduce the learning curve in mobile sensing systems where the complexity is very high. PMID:24351637

  5. Mobile sensing systems.

    Science.gov (United States)

    Macias, Elsa; Suarez, Alvaro; Lloret, Jaime

    2013-12-16

    Rich-sensor smart phones have made possible the recent birth of the mobile sensing research area as part of ubiquitous sensing which integrates other areas such as wireless sensor networks and web sensing. There are several types of mobile sensing: individual, participatory, opportunistic, crowd, social, etc. The object of sensing can be people-centered or environment-centered. The sensing domain can be home, urban, vehicular… Currently there are barriers that limit the social acceptance of mobile sensing systems. Examples of social barriers are privacy concerns, restrictive laws in some countries and the absence of economic incentives that might encourage people to participate in a sensing campaign. Several technical barriers are phone energy savings and the variety of sensors and software for their management. Some existing surveys partially tackle the topic of mobile sensing systems. Published papers theoretically or partially solve the above barriers. We complete the above surveys with new works, review the barriers of mobile sensing systems and propose some ideas for efficiently implementing sensing, fusion, learning, security, privacy and energy saving for any type of mobile sensing system, and propose several realistic research challenges. The main objective is to reduce the learning curve in mobile sensing systems where the complexity is very high.

  6. Mobile Sensing Systems

    Directory of Open Access Journals (Sweden)

    Elsa Macias

    2013-12-01

    Full Text Available Rich-sensor smart phones have made possible the recent birth of the mobile sensing research area as part of ubiquitous sensing which integrates other areas such as wireless sensor networks and web sensing. There are several types of mobile sensing: individual, participatory, opportunistic, crowd, social, etc. The object of sensing can be people-centered or environment-centered. The sensing domain can be home, urban, vehicular… Currently there are barriers that limit the social acceptance of mobile sensing systems. Examples of social barriers are privacy concerns, restrictive laws in some countries and the absence of economic incentives that might encourage people to participate in a sensing campaign. Several technical barriers are phone energy savings and the variety of sensors and software for their management. Some existing surveys partially tackle the topic of mobile sensing systems. Published papers theoretically or partially solve the above barriers. We complete the above surveys with new works, review the barriers of mobile sensing systems and propose some ideas for efficiently implementing sensing, fusion, learning, security, privacy and energy saving for any type of mobile sensing system, and propose several realistic research challenges. The main objective is to reduce the learning curve in mobile sensing systems where the complexity is very high.

  7. Cooperative Spectrum Sensing over Non-Identical Nakagami Fading Channels

    KAUST Repository

    Rao, Anlei

    2012-09-08

    Previous works in cooperative spectrum sensing assumed that the channels for sensing and reporting are independent identical distributed (i.i.d). A more practical and appropriate assumption, however, should be that the sensing channels and reporting channels are independent but not necessarily identically distributed (i.n.i.d). In this paper, we derive the false-alarm probability and the detection probability of cooperative spectrum sensing with energy fusion over i.n.i.d Nakagami fading channels. Selected numerical results show that cooperative spectrum sensing still gives considerably better performance results even over i.n.i.d fading channels.

  8. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  9. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  10. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  11. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  12. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  13. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  14. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  15. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  16. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  17. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  18. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  19. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  20. Nano-bio-sensing

    CERN Document Server

    Carrara, Sandro

    2011-01-01

    This book examines state-of-the-art applications of nano-bio-sensing. It brings together researchers from nano-electronics and bio-technology, providing multidisciplinary content from nano-structures fabrication to bio-sensing applications.

  1. Introduction to remote sensing

    CERN Document Server

    Cracknell, Arthur P

    2007-01-01

    Addressing the need for updated information in remote sensing, Introduction to Remote Sensing, Second Edition provides a full and authoritative introduction for scientists who need to know the scope, potential, and limitations in the field. The authors discuss the physical principles of common remote sensing systems and examine the processing, interpretation, and applications of data. This new edition features updated and expanded material, including greater coverage of applications from across earth, environmental, atmospheric, and oceanographic sciences. Illustrated with remotely sensed colo

  2. Sense of moving

    DEFF Research Database (Denmark)

    Christensen, Mark Schram; Grünbaum, Thor

    2017-01-01

    In this chapter, we assume the existence of a sense of “movement activity” that arises when a person actively moves a body part. This sense is usually supposed to be part of sense of agency (SoA). The purpose of the chapter is to determine whether the already existing experimental paradigms can...

  3. Financial Derivatives

    DEFF Research Database (Denmark)

    Wigan, Duncan

    2013-01-01

    Contemporary derivatives mark the development of capital and constitute a novel form of ownership. By reconfiguring the temporal, spatial and legal character of ownership derivatives present a substantive challenge to the tax collecting state. While fiscal systems are nationally bounded...... and inherently static, capital itself is unprecedentedly mobile, fluid and fungible. As such derivatives raise the specter of ‘financial weapons of mass destruction’....

  4. Financial Derivatives

    OpenAIRE

    Janečková, Alena

    2011-01-01

    1 Abstract/ Financial derivatives The purpose of this thesis is to provide an introduction to financial derivatives which has been, from the legal perspective, described in a not satisfactory manner as quite little literature that can be found about this topic. The main objectives of this thesis are to define the term "financial derivatives" and its particular types and to analyse legal nature of these financial instruments. The last objective is to try to draft future law regulation of finan...

  5. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  6. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  7. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  8. Amino alcohol- (NPS-2143 and quinazolinone-derived calcilytics (ATF936 and AXT914 differentially mitigate excessive signalling of calcium-sensing receptor mutants causing Bartter syndrome Type 5 and autosomal dominant hypocalcemia.

    Directory of Open Access Journals (Sweden)

    Saskia Letz

    Full Text Available Activating calcium sensing receptor (CaSR mutations cause autosomal dominant hypocalcemia (ADH characterized by low serum calcium, inappropriately low PTH and relative hypercalciuria. Four activating CaSR mutations cause additional renal wasting of sodium, chloride and other salts, a condition called Bartter syndrome (BS type 5. Until today there is no specific medical treatment for BS type 5 and ADH. We investigated the effects of different allosteric CaSR antagonists (calcilytics on activating CaSR mutants.All 4 known mutations causing BS type 5 and five ADH mutations were expressed in HEK 293T cells and receptor signalling was studied by measurement of intracellular free calcium in response to extracellular calcium ([Ca2+]o. To investigate the effect of calcilytics, cells were stimulated with 3 mM [Ca2+]o in the presence or absence of NPS-2143, ATF936 or AXT914.All BS type 5 and ADH mutants showed enhanced signalling activity to [Ca2+]o with left shifted dose response curves. In contrast to the amino alcohol NPS-2143, which was only partially effective, the quinazolinone calcilytics ATF936 and AXT914 significantly mitigated excessive cytosolic calcium signalling of all BS type 5 and ADH mutants studied. When these mutants were co-expressed with wild-type CaSR to approximate heterozygosity in patients, ATF936 and AXT914 were also effective on all mutants.The calcilytics ATF936 and AXT914 are capable of attenuating enhanced cytosolic calcium signalling activity of CaSR mutations causing BS type 5 and ADH. Quinazolinone calcilytics might therefore offer a novel treatment option for patients with activating CaSR mutations.

  9. Sensing behaviour in healthcare design

    DEFF Research Database (Denmark)

    Thorpe, Julia Rosemary; Hysse Forchhammer, Birgitte; Maier, Anja

    2017-01-01

    We are entering an era of distributed healthcare that should fit and respond to individual needs, behaviour and lifestyles. Designing such systems is a challenging task that requires continuous information about human behaviour on a large scale, for which pervasive sensing (e.g. using smartphones...... specifically on activity and location data that can easily be obtained from smartphones or wearables. We further demonstrate how these are applied in healthcare design using an example from dementia care. Comparing a current and proposed scenario exemplifies how integrating sensor-derived information about...... user behaviour can support the healthcare design goals of personalisation, adaptability and scalability, while emphasising patient quality of life....

  10. National Satellite Land Remote Sensing Data Archive

    Science.gov (United States)

    Faundeen, John L.; Kelly, Francis P.; Holm, Thomas M.; Nolt, Jenna E.

    2013-01-01

    The National Satellite Land Remote Sensing Data Archive (NSLRSDA) resides at the U.S. Geological Survey's (USGS) Earth Resources Observation and Science (EROS) Center. Through the Land Remote Sensing Policy Act of 1992, the U.S. Congress directed the Department of the Interior (DOI) to establish a permanent Government archive containing satellite remote sensing data of the Earth's land surface and to make this data easily accessible and readily available. This unique DOI/USGS archive provides a comprehensive, permanent, and impartial observational record of the planet's land surface obtained throughout more than five decades of satellite remote sensing. Satellite-derived data and information products are primary sources used to detect and understand changes such as deforestation, desertification, agricultural crop vigor, water quality, invasive plant species, and certain natural hazards such as flood extent and wildfire scars.

  11. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  12. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  13. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  14. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  15. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  16. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  17. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  18. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  19. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  20. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  1. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  2. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  3. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  4. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  5. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  6. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  7. Solid-state electrical conductivity and alcohol sensing properties of radio frequency sputtered thin films of Ti4+ doped eskolaite Cr2O3 derived from citrate combustion technique

    International Nuclear Information System (INIS)

    Pokhrel, Suman; Huo Lihua; Zhao Hui; Gao Shan

    2008-01-01

    Fine powder of Cr 1.8 Ti 0.2 O 3 (CTO) was prepared by citrate combustion technique followed by compacting into discs of 40 mm diameter. Discs were used as radio frequency sputtering targets and coated on a hollow ceramic tube of 4 mm length comprising two Au-electrodes with 4-probe contact and on Al 2 O 3 slices with interdigitated gold electrodes. The films were characterized by X-ray diffraction, X-ray photoelectron spectroscopy and atomic force microscopy techniques. The resistance of the film derived from alternate current impedance measurement in ambient air was found to decrease with increasing temperature. The activation energy was found to be 0.39 eV. These films were exposed to various concentrations of alcohols followed by determination of sensor response, reversibility, potential stability and reproducibility. The sensor response was attributed to the surface catalytic reaction of R-OH with O - (ads) to form adsorbed R-CHO

  8. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  9. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  10. Optical remote sensing

    CERN Document Server

    Prasad, Saurabh; Chanussot, Jocelyn

    2011-01-01

    Optical remote sensing relies on exploiting multispectral and hyper spectral imagery possessing high spatial and spectral resolutions respectively. These modalities, although useful for most remote sensing tasks, often present challenges that must be addressed for their effective exploitation. This book presents current state-of-the-art algorithms that address the following key challenges encountered in representation and analysis of such optical remotely sensed data: challenges in pre-processing images, storing and representing high dimensional data, fusing different sensor modalities, patter

  11. REMOTE SENSING IN OCEANOGRAPHY.

    Science.gov (United States)

    remote sensing from satellites. Sensing of oceanographic variables from aircraft began with the photographing of waves and ice. Since then remote measurement of sea surface temperatures and wave heights have become routine. Sensors tested for oceanographic applications include multi-band color cameras, radar scatterometers, infrared spectrometers and scanners, passive microwave radiometers, and radar imagers. Remote sensing has found its greatest application in providing rapid coverage of large oceanographic areas for synoptic and analysis and

  12. Hyperspectral sensing of forests

    Science.gov (United States)

    Goodenough, David G.; Dyk, Andrew; Chen, Hao; Hobart, Geordie; Niemann, K. Olaf; Richardson, Ash

    2007-11-01

    Canada contains 10% of the world's forests covering an area of 418 million hectares. The sustainable management of these forest resources has become increasingly complex. Hyperspectral remote sensing can provide a wealth of new and improved information products to resource managers to make more informed decisions. Research in this area has demonstrated that hyperspectral remote sensing can be used to create more accurate products for forest inventory, forest health, foliar biochemistry, biomass, and aboveground carbon than are currently available. This paper surveys recent methods and results in hyperspectral sensing of forests and describes space initiatives for hyperspectral sensing.

  13. LIGO sensing system performance

    CERN Document Server

    Landry, M

    2002-01-01

    The optical sensing subsystem of a LIGO interferometer is described. The system includes two complex interferometric sensing schemes to control test masses in length and alignment. The length sensing system is currently employed on all LIGO interferometers to lock coupled cavities on resonance. Auto-alignment is to be accomplished by a wavefront-sensing scheme which automatically corrects for angular fluctuations of the test masses. Improvements in lock stability and duration are noted when the wavefront auto-alignment system is employed. Preliminary results from the commissioning of the 2 km detector in Washington are shown.

  14. Intelligent environmental sensing

    CERN Document Server

    Mukhopadhyay, Subhas

    2015-01-01

    Developing environmental sensing and monitoring technologies become essential especially for industries that may cause severe contamination. Intelligent environmental sensing uses novel sensor techniques, intelligent signal and data processing algorithms, and wireless sensor networks to enhance environmental sensing and monitoring. It finds applications in many environmental problems such as oil and gas, water quality, and agriculture. This book addresses issues related to three main approaches to intelligent environmental sensing and discusses their latest technological developments. Key contents of the book include:   Agricultural monitoring Classification, detection, and estimation Data fusion Geological monitoring Motor monitoring Multi-sensor systems Oil reservoirs monitoring Sensor motes Water quality monitoring Wireless sensor network protocol  

  15. Advanced Remote Sensing Research

    Science.gov (United States)

    Slonecker, Terrence; Jones, John W.; Price, Susan D.; Hogan, Dianna

    2008-01-01

    'Remote sensing' is a generic term for monitoring techniques that collect information without being in physical contact with the object of study. Overhead imagery from aircraft and satellite sensors provides the most common form of remotely sensed data and records the interaction of electromagnetic energy (usually visible light) with matter, such as the Earth's surface. Remotely sensed data are fundamental to geographic science. The Eastern Geographic Science Center (EGSC) of the U.S. Geological Survey (USGS) is currently conducting and promoting the research and development of three different aspects of remote sensing science: spectral analysis, automated orthorectification of historical imagery, and long wave infrared (LWIR) polarimetric imagery (PI).

  16. Optical Remote Sensing Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The Optical Remote Sensing Laboratory deploys rugged, cutting-edge electro-optical instrumentation for the collection of various event signatures, with expertise in...

  17. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  18. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  19. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  20. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  1. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  2. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  3. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  4. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  5. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  6. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  7. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  8. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  9. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  10. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  11. Derivative chameleons

    International Nuclear Information System (INIS)

    Noller, Johannes

    2012-01-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂ μ φ∂ μ φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂ μ φ∂ μ φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type

  12. Derivative chameleons

    Energy Technology Data Exchange (ETDEWEB)

    Noller, Johannes, E-mail: johannes.noller08@imperial.ac.uk [Theoretical Physics, Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2BZ (United Kingdom)

    2012-07-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂{sub μ}φ∂{sup μ}φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂{sub μ}φ∂{sup μ}φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type.

  13. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  14. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  15. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  16. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Electricity derivatives

    CERN Document Server

    Aïd, René

    2015-01-01

    Offering a concise but complete survey of the common features of the microstructure of electricity markets, this book describes the state of the art in the different proposed electricity price models for pricing derivatives and in the numerical methods used to price and hedge the most prominent derivatives in electricity markets, namely power plants and swings. The mathematical content of the book has intentionally been made light in order to concentrate on the main subject matter, avoiding fastidious computations. Wherever possible, the models are illustrated by diagrams. The book should allow prospective researchers in the field of electricity derivatives to focus on the actual difficulties associated with the subject. It should also offer a brief but exhaustive overview of the latest techniques used by financial engineers in energy utilities and energy trading desks.

  18. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  19. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  20. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  1. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  2. Remote Sensing Digital Image Analysis An Introduction

    CERN Document Server

    Richards, John A

    2013-01-01

    Remote Sensing Digital Image Analysis provides the non-specialist with a treatment of the quantitative analysis of satellite and aircraft derived remotely sensed data. Since the first edition of the book there have been significant developments in the algorithms used for the processing and analysis of remote sensing imagery; nevertheless many of the fundamentals have substantially remained the same.  This new edition presents material that has retained value since those early days, along with new techniques that can be incorporated into an operational framework for the analysis of remote sensing data. The book is designed as a teaching text for the senior undergraduate and postgraduate student, and as a fundamental treatment for those engaged in research using digital image processing in remote sensing.  The presentation level is for the mathematical non-specialist.  Since the very great number of operational users of remote sensing come from the earth sciences communities, the text is pitched at a leve...

  3. Calcium sensing in exocytosis

    DEFF Research Database (Denmark)

    Gustavsson, Natalia; Wu, Bingbing; Han, Weiping

    2012-01-01

    an increase in intracellular calcium levels. Besides the triggering role, calcium signaling modulates the precise amount and kinetics of vesicle release. Thus, it is a central question to understand the molecular machineries responsible for calcium sensing in exocytosis. Here we provide an overview of our...... current understanding of calcium sensing in neurotransmitter release and hormone secretion....

  4. Sense and Sensibility

    NARCIS (Netherlands)

    Austen, Jane

    2005-01-01

    Two sisters of opposing temperament but who share the pangs of tragic love provide the subjects for Sense and Sensibility. Elinor, practical and conventional, the epitome of sense, desires a man who is promised to another woman. Marianne, emotional and sentimental, the epitome of sensibility, loses

  5. Mobile teleoperator remote sensing

    International Nuclear Information System (INIS)

    Hall, E.L.

    1986-01-01

    Sensing systems are an important element of mobile teleoperators and robots. This paper discusses certain problems and limitations of vision and other sensing systems with respect to operations in a radiological accident environment. Methods which appear promising for near-term improvements to sensor technology are described. 3 refs

  6. Deterministic Compressed Sensing

    Science.gov (United States)

    2011-11-01

    39 4.3 Digital Communications . . . . . . . . . . . . . . . . . . . . . . . . . 40 4.4 Group Testing ...deterministic de - sign matrices. All bounds ignore the O() constants. . . . . . . . . . . 131 xvi List of Algorithms 1 Iterative Hard Thresholding Algorithm...sensing is information theoretically possible using any (2k, )-RIP sensing matrix . The following celebrated results of Candès, Romberg and Tao [54

  7. Hyperspectral remote sensing

    CERN Document Server

    Eismann, Michael

    2012-01-01

    Hyperspectral remote sensing is an emerging, multidisciplinary field with diverse applications that builds on the principles of material spectroscopy, radiative transfer, imaging spectrometry, and hyperspectral data processing. This book provides a holistic treatment that captures its multidisciplinary nature, emphasizing the physical principles of hyperspectral remote sensing.

  8. Mapping sense(s) of place

    DEFF Research Database (Denmark)

    Skovse, Astrid Ravn; Hovy, Dirk; Johannsen, Anders Trærup

    2016-01-01

    , the question of how to tap into this constitutes a methodological challenge to researchers (Latham 2003, Hall 2009). This paper presents an experimental method aimed at eliciting data on sense of place and everyday mobility in a feasible and low-tech manner through the use of mental maps and mobility maps...... for answering questions about the relationship between places, speakers and linguistic practice....

  9. Hydroball string sensing system

    International Nuclear Information System (INIS)

    Hurwitz, M.J.; Ekeroth, D.E.; Squarer, D.

    1991-01-01

    This patent describes a hydroball string sensing system for a nuclear reactor having a core containing a fluid at a fluid pressure. It comprises a tube connectable to the nuclear reactor so that the fluid can flow within the tube at a fluid pressure that is substantially the same as the fluid pressure of the nuclear reactor core; a hydroball string including - a string member having objects positioned therealong with a specified spacing, the object including a plurality of hydroballs, and bullet members positioned at opposing ends of the string member; first sensor means, positioned outside a first segment of the tube, for sensing one of the objects being positioned within the first segment, and for providing a sensing signal responsive to the sensing of the first sensing means

  10. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  11. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  12. Computation of Mie derivatives.

    Science.gov (United States)

    Li, Yang; Bowler, Nicola

    2013-07-10

    Analytical expressions are obtained for the derivatives of Mie scattering coefficients with respect to the electrical radius of the spherical scattering particle, and to the relative permittivity and permeability of both the particle and the surrounding medium. Their corresponding approximate expressions are developed to avoid numerical overflow based on the logarithmic derivative of Riccati-Bessel functions. The analytical expressions have been verified by comparing their results with those calculated by analytical expressions developed by Mathematica. Compared with the numerical derivative, the analytical expressions and approximate expressions show a higher accuracy and are 2.0 and 2.8 times, respectively, faster in the case of a single magnetodielectric sphere. Generally, for spheres with an electrical radius in a large range, the approximate expressions can yield acceptable accuracy and computation time up to a high order. This work can be used in the design of nonmetallic metamaterials, and in the retrieval of aerosol properties from remote sensing data. An example calculation is given for the design of an optical, all-dielectric, mu-negative metamaterial consisting of a simple cubic array of tellurium nanoparticles.

  13. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  14. SEMANTIC DERIVATION OF BORROWINGS

    Directory of Open Access Journals (Sweden)

    Shigapova, F.F.

    2017-09-01

    Full Text Available The author carried out the contrastive analysis of the word спикер borrowed into Russian from English and the English word speaker. The findings of the analysis include confirm (1 different derivational abilities and functions of the borrowed word and the native word; (2 distinctive features in the definitions, i.e. semantic structures, registered in monolingual non-abridged dictionaries; (3 heterogeneous parameters of frequencies recorded in the National Corpus of the Russian language and the British National Corpus; (4 absence of bilingual equivalent collocations with words спикер and speaker. The collocations with words studied revealed new lexical and connotative senses in the meaning of the word. Relevance of the study conducted is justified by the new facts revealed about the semantic adaptation of the borrowed word in the system of the Russian language and its paradigmatic and syntagmatic connections in the system of the recipient language.

  15. Original and Derived Judgment

    DEFF Research Database (Denmark)

    Foss, Kirsten; Foss, Nicolai Juul; Klein, Peter G.

    2007-01-01

    Recent work links entrepreneurship to the economic theory of the firm, using the concept of entrepreneurship as judgment introduced by Frank Knight. When judgment is complementary to other assets, it makes sense for entrepreneurs to hire labour and to own assets. The entrepreneur's role, then...... to subordinates, who exercise derived judgment. We call these employees `proxy-entrepreneurs', and ask how the firm's organizational structure - its formal and informal systems of rewards and punishments, rules for settling disputes and renegotiating agreements, means of evaluating performance and so on - can...... be designed to encourage forms of proxy entrepreneurship that increase firm value while discouraging actions that destroy value. Building on key ideas from the entrepreneurship literature, Austrian economics and the economic theory of the firm, we develop a framework for analysing the trade-off between...

  16. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  17. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  18. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  19. Compressed sensing & sparse filtering

    CERN Document Server

    Carmi, Avishy Y; Godsill, Simon J

    2013-01-01

    This book is aimed at presenting concepts, methods and algorithms ableto cope with undersampled and limited data. One such trend that recently gained popularity and to some extent revolutionised signal processing is compressed sensing. Compressed sensing builds upon the observation that many signals in nature are nearly sparse (or compressible, as they are normally referred to) in some domain, and consequently they can be reconstructed to within high accuracy from far fewer observations than traditionally held to be necessary. Apart from compressed sensing this book contains other related app

  20. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  1. Remote Sensing Information Gateway

    Science.gov (United States)

    Remote Sensing Information Gateway, a tool that allows scientists, researchers and decision makers to access a variety of multi-terabyte, environmental datasets and to subset the data and obtain only needed variables, greatly improving the download time.

  2. Hyperspectral remote sensing

    National Research Council Canada - National Science Library

    Eismann, Michael Theodore

    2012-01-01

    ..., and hyperspectral data processing. While there are many resources that suitably cover these areas individually and focus on specific aspects of the hyperspectral remote sensing field, this book provides a holistic treatment...

  3. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  4. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  5. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  6. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  7. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  8. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  9. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  11. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  12. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  13. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  14. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  15. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  16. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  17. Visual sensing of fluoride ions by dipyrrolyl derivatives bearing

    Indian Academy of Sciences (India)

    withdrawing quinone or dicyano functionalities in their architecture permit the detection of fluoride ions under visual (naked-eye) as well as optical (absorption and fluorescence) and electrochemical conditions in organic solvents.

  18. A Diarylethene Derived Chemosensor for Colorimetric Sensing of Cu2+

    Science.gov (United States)

    Pu, Shouzhi; Sun, Qi; Zheng, Chunhong

    2017-07-01

    A diarylethene bearing a 8-hydroxyquinoline-linked salicylhydrazide Schift base unit has been synthesized. In CH3CN, the conpound displayed a highly selective and sensitive response to Cu2+ via perceptible color and UV-vis absorbance changes among the other tested metal ions. In the presence of Cu2+, the peak at 341 nm disappeared and concomitantly a new charge transfer absorption band emerged at 381 and 450 nm. Moreover, the compound formed host-guest complexe in 1:1 stoichiometry.

  19. Dynamical Functional Theory for Compressed Sensing

    DEFF Research Database (Denmark)

    Cakmak, Burak; Opper, Manfred; Winther, Ole

    2017-01-01

    the Thouless Anderson-Palmer (TAP) equations corresponding to the ensemble. Using a dynamical functional approach we are able to derive an effective stochastic process for the marginal statistics of a single component of the dynamics. This allows us to design memory terms in the algorithm in such a way...... that the resulting fields become Gaussian random variables allowing for an explicit analysis. The asymptotic statistics of these fields are consistent with the replica ansatz of the compressed sensing problem....

  20. Database derived microsatellite markers (SSRs) for cultivar differentiation in Brassica oleracea

    DEFF Research Database (Denmark)

    Louarn, Sébastien Jean Yves; Torp, Anna Maria; Holme, I.B.

    2007-01-01

     Fifty-nine Brassica oleracea cultivars, belonging to five botanical varieties, were evaluated for microsatellite (SSR) polymorphisms using 11 database sequence derived primer pairs. The cultivars represented 12 broccoli (Brassica oleracea var. italica), ten Brussels sprouts (B. o. var. gemmifera...

  1. Analysis of inheritance mode in chrysanthemum using EST-derived SSR markers

    NARCIS (Netherlands)

    Park, Sang Kun; Arens, Paul; Esselink, Danny; Lim, Jin Hee; Shin, Hak Ki

    2015-01-01

    To study the inheritance mode of hexaploid chrysanthemum (random or preferential chromosome pairing), a segregation analysis was carried out using SSR markers derived from chrysanthemum ESTs in the public domain. A total of 248 EST-SSR primer pairs were screened in chrysanthemum cultivars

  2. A primer on counterparty valuation adjustments in South Africa

    Directory of Open Access Journals (Sweden)

    Gary Wayne van Vuuren

    2014-11-01

    Full Text Available Counterparty valuation adjustment (CVA risk accounts for losses due to the deterioration in credit quality of derivative counterparties with large credit spreads. Of the losses attributed to counterparty credit risk incurred during the financial crisis of 2008-9 were due to CVA risk; the remaining third were due to actual defaults. Regulatory authorities have acknowledged and included this risk in the new Basel III rules. The capital implications of CVA risk in the South African milieu are explored, as well as the sensitivity of CVA risk components to market variables. Proposed methodologies for calculating changes in CVA are found to be unstable and unreliable at high average spread levels.

  3. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  4. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  5. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  6. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  7. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  8. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  9. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  10. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  11. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  12. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  13. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  14. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  15. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  16. A primer on binge eating disorder diagnosis and management.

    Science.gov (United States)

    Citrome, Leslie

    2015-12-01

    Binge eating disorder (BED) is the most common eating disorder, with an estimated lifetime prevalence of 2.6% among U.S. adults, yet often goes unrecognized. In the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5), BED is defined by recurrent episodes of binge eating (eating in a discrete period of time an amount of food larger than most people would eat in a similar amount of time under similar circumstances and a sense of lack of control over eating during the episode), occurring on average at least once a week for 3 months, and associated with marked distress. It can affect both men and women, regardless if they are at normal weight, overweight, or obese, and regardless of their ethnic or racial group. Psychiatric comorbidities are very common, with 79% of adults with BED also experiencing anxiety disorders, mood disorders, impulse control disorders, or substance use disorders; almost 50% of persons with BED have ≥ 3 psychiatric comorbidities. Multiple neurobiological explanations have been proffered for BED, including dysregulation in reward center and impulse control circuitry, with potentially related disturbances in dopamine neurotransmission and endogenous μ-opioid signaling. Additionally, there is interplay between genetic influences and environmental stressors. Psychological treatments such as cognitive behavioral interventions have been recommended as first line and are supported by meta-analytic reviews. Unfortunately, routine medication treatments for anxiety and depression do not necessarily ameliorate the symptoms of BED; however, at present, there is one approved agent for the treatment of moderate to severe BED-lisdexamfetamine, a stimulant that was originally approved for the treatment of attention deficit hyperactivity disorder.

  17. Dynamic devices: A primer on pickups and kickers

    Energy Technology Data Exchange (ETDEWEB)

    Goldberg, D.A.; Lambertson, G.R.

    1991-11-01

    A charged-particle beam generates electromagnetic fields which in turn interact with the beam's surroundings. These interactions can produce fields which act back on the beam itself, or, if the surroundings'' are of suitably designed form (e.g., sensing electrodes with electrical connection to the outside world''), can provide information on various properties of the beam; such electrodes are generally known as pickups. Similarly, charged- particle beams respond to the presence of externally imposed electromagnetic fields; devices used to generate such fields are generally known as kickers. As we shall show, the behavior of an electrode system when it functions as a pickup is intimately related to its behavior as a kicker. A number of papers on pickup behavior have appeared in recent years in most of which the primary emphasis has been on beam instrumentation; there have also been several workshops on the subject. There have been several papers which have treated both pickup and kicker behavior of a particular electrode system, but this has been done in the context of discussing a specialized application, such as a stochastic cooling system. The approach in the present paper is similar to that of earlier works by one of the authors, which is to provide a unified treatment of pickup and kicker behavior, and, it is hoped, to give the reader an understanding which is both general and fundamental enough to make the above references easily accessible to him. As implied by the revised title, we have done the re-writing with the non-expert in mind. We have made the introduction both lengthier and more detailed, and done the same with much of the explanatory material and discussion.

  18. Dynamic devices: A primer on pickups and kickers

    Energy Technology Data Exchange (ETDEWEB)

    Goldberg, D.A.; Lambertson, G.R.

    1991-11-01

    A charged-particle beam generates electromagnetic fields which in turn interact with the beam`s surroundings. These interactions can produce fields which act back on the beam itself, or, if the ``surroundings`` are of suitably designed form (e.g., sensing electrodes with electrical connection to the ``outside world``), can provide information on various properties of the beam; such electrodes are generally known as pickups. Similarly, charged- particle beams respond to the presence of externally imposed electromagnetic fields; devices used to generate such fields are generally known as kickers. As we shall show, the behavior of an electrode system when it functions as a pickup is intimately related to its behavior as a kicker. A number of papers on pickup behavior have appeared in recent years in most of which the primary emphasis has been on beam instrumentation; there have also been several workshops on the subject. There have been several papers which have treated both pickup and kicker behavior of a particular electrode system, but this has been done in the context of discussing a specialized application, such as a stochastic cooling system. The approach in the present paper is similar to that of earlier works by one of the authors, which is to provide a unified treatment of pickup and kicker behavior, and, it is hoped, to give the reader an understanding which is both general and fundamental enough to make the above references easily accessible to him. As implied by the revised title, we have done the re-writing with the non-expert in mind. We have made the introduction both lengthier and more detailed, and done the same with much of the explanatory material and discussion.

  19. Dynamic devices: A primer on pickups and kickers

    International Nuclear Information System (INIS)

    Goldberg, D.A.; Lambertson, G.R.

    1991-11-01

    A charged-particle beam generates electromagnetic fields which in turn interact with the beam's surroundings. These interactions can produce fields which act back on the beam itself, or, if the ''surroundings'' are of suitably designed form (e.g., sensing electrodes with electrical connection to the ''outside world''), can provide information on various properties of the beam; such electrodes are generally known as pickups. Similarly, charged- particle beams respond to the presence of externally imposed electromagnetic fields; devices used to generate such fields are generally known as kickers. As we shall show, the behavior of an electrode system when it functions as a pickup is intimately related to its behavior as a kicker. A number of papers on pickup behavior have appeared in recent years in most of which the primary emphasis has been on beam instrumentation; there have also been several workshops on the subject. There have been several papers which have treated both pickup and kicker behavior of a particular electrode system, but this has been done in the context of discussing a specialized application, such as a stochastic cooling system. The approach in the present paper is similar to that of earlier works by one of the authors, which is to provide a unified treatment of pickup and kicker behavior, and, it is hoped, to give the reader an understanding which is both general and fundamental enough to make the above references easily accessible to him. As implied by the revised title, we have done the re-writing with the non-expert in mind. We have made the introduction both lengthier and more detailed, and done the same with much of the explanatory material and discussion

  20. Health Participatory Sensing Networks

    Directory of Open Access Journals (Sweden)

    Andrew Clarke

    2014-01-01

    Full Text Available The use of participatory sensing in relation to the capture of health-related data is rapidly becoming a possibility due to the widespread consumer adoption of emerging mobile computing technologies and sensing platforms. This has the potential to revolutionize data collection for population health, aspects of epidemiology, and health-related e-Science applications and as we will describe, provide new public health intervention capabilities, with the classifications and capabilities of such participatory sensing platforms only just beginning to be explored. Such a development will have important benefits for access to near real-time, large-scale, up to population-scale data collection. However, there are also numerous issues to be addressed first: provision of stringent anonymity and privacy within these methodologies, user interface issues, and the related issue of how to incentivize participants and address barriers/concerns over participation. To provide a step towards describing these aspects, in this paper we present a first classification of health participatory sensing models, a novel contribution to the literature, and provide a conceptual reference architecture for health participatory sensing networks (HPSNs and user interaction example case study.

  1. Sensing in tissue bioreactors

    Science.gov (United States)

    Rolfe, P.

    2006-03-01

    Specialized sensing and measurement instruments are under development to aid the controlled culture of cells in bioreactors for the fabrication of biological tissues. Precisely defined physical and chemical conditions are needed for the correct culture of the many cell-tissue types now being studied, including chondrocytes (cartilage), vascular endothelial cells and smooth muscle cells (blood vessels), fibroblasts, hepatocytes (liver) and receptor neurones. Cell and tissue culture processes are dynamic and therefore, optimal control requires monitoring of the key process variables. Chemical and physical sensing is approached in this paper with the aim of enabling automatic optimal control, based on classical cell growth models, to be achieved. Non-invasive sensing is performed via the bioreactor wall, invasive sensing with probes placed inside the cell culture chamber and indirect monitoring using analysis within a shunt or a sampling chamber. Electroanalytical and photonics-based systems are described. Chemical sensing for gases, ions, metabolites, certain hormones and proteins, is under development. Spectroscopic analysis of the culture medium is used for measurement of glucose and for proteins that are markers of cell biosynthetic behaviour. Optical interrogation of cells and tissues is also investigated for structural analysis based on scatter.

  2. Titulación académica y posibilidades de acceso al primer empleo

    Directory of Open Access Journals (Sweden)

    ET. OTROS

    2009-11-01

    Full Text Available RESUMEN: El presente artículo realiza una revisión sobre el estado de la cuestión de la temática focalizada y recoge una investigación de carácter cualitativo. La técnica de recogida de información utilizada ha sido la entrevista. La investigación abordada versa sobre un estudio de caso, acerca de la titulación académica de los empleados de una empresa del sector del comercio en España y sus posibilidades de acceso al primer empleo.De la investigación se desprende que existe una estrecha relación entre la formación y el empleo llegando a convertirse en uno de los mayores condicionantes para la consecución y mantenimiento de éste. Los titulados medios y universitarios no encuentran dificultades para optar al primer empleo en el sector del comercio en España, debido a que todos presentan un nivel de estudios superior al solicitado para el trabajo que realizan en los primeros años de su vida laboral. A pesar de que el nivel de estudios no asegura la obtención del primer empleo coloca a las personas en una situación privilegiada para lograrlo, así la formación ofrece una predisposición para conseguirlo. Con todo, es recomendable desarrollar procedimientos para ofrecer una educación inicial más adaptada al contexto laboral de cada titulación académica que propicien un grado de exigencia coherente con la capacitación profesional.ABSTRACT: The present article is a review on the state of art of the topic starting from a qualitative approach. The technique Lised to collect data was the interview. This is a case study about the academic degrees of the employees of a company in the business sector in Spain and their possibilities of obtaining their first job.One conclusión is the cióse relationship between training and employment and how the former is one of the greatest conditioners in attaining and maintaining the latter. Persons with secondary diplomas and university degrees have no difficulties in gaining their first job

  3. The expanding Universe a primer on relativistic cosmology

    CERN Document Server

    Heacox, William D

    2015-01-01

    Cosmology - the science of the Universe at large - has experienced a renaissance in the decades bracketing the turn of the twenty-first century. Exploring our emerging understanding of cosmology, this text takes two complementary points of view: the physical principles underlying theories of cosmology, and the observable consequences of models of Universal expansion. The book develops cosmological models based on fundamental physical principles, with mathematics limited to the minimum necessary to keep the material accessible for students of physics and astronomy at the advanced undergraduate level. A substantial review of general relativity leading up to the Einstein field equations is included, with derivations of explicit formulations connecting observable features of the Universe to models of its expansion. Self-contained and up to date in respect of modern observations, the text provides a solid theoretical grounding in modern cosmology while preparing readers for the changes that will inevitably come fr...

  4. A primer on QSAR/QSPR modeling fundamental concepts

    CERN Document Server

    Roy, Kunal; Das, Rudra Narayan

    2015-01-01

    This brief goes back to basics and describes the Quantitative structure-activity/property relationships (QSARs/QSPRs) that represent predictive models derived from the application of statistical tools correlating biological activity (including therapeutic and toxic) and properties of chemicals (drugs/toxicants/environmental pollutants) with descriptors representative of molecular structure and/or properties. It explains how the sub-discipline of Cheminformatics is used for many applications such as risk assessment, toxicity prediction, property prediction and regulatory decisions apart from drug discovery and lead optimization. The authors also present, in basic terms, how QSARs and related chemometric tools are extensively involved in medicinal chemistry, environmental chemistry and agricultural chemistry for ranking of potential compounds and prioritizing experiments. At present, there is no standard or introductory publication available that introduces this important topic to students of chemistry and phar...

  5. Chirality sensing with stereodynamic copper(I) complexes.

    Science.gov (United States)

    De Los Santos, Zeus A; Legaux, Nicholas M; Wolf, Christian

    2017-11-01

    Three Cu(I) complexes derived from stereodynamic diphosphine ligands were synthesized and used for chirality sensing. The coordination of diamines and amino acids to these complexes generates distinct circular dichroism signals. The chiroptical sensor response allows determination of the absolute configuration and the enantiomeric excess of the analyte at low concentrations. This method is operationally simple, fast, and attractive for high-throughput sensing applications. © 2017 Wiley Periodicals, Inc.

  6. DARLA: Data Assimilation and Remote Sensing for Littoral Applications

    Science.gov (United States)

    2017-03-01

    at reasonable logistical or financial costs . Remote sensing provides an attractive alternative. We discuss the range of different sensors that are...DARLA: Data Assimilation and Remote Sensing for Littoral Applications Final Report Award Number: N000141010932 Andrew T. Jessup Chris Chickadel...20. Radermacher, M., M. Wengrove, J. V. de Vries, and R. Holman (2014), Applicability of video-derived bathymetry estimates to nearshore current

  7. Electroactive polymers for sensing

    Science.gov (United States)

    2016-01-01

    Electromechanical coupling in electroactive polymers (EAPs) has been widely applied for actuation and is also being increasingly investigated for sensing chemical and mechanical stimuli. EAPs are a unique class of materials, with low-moduli high-strain capabilities and the ability to conform to surfaces of different shapes. These features make them attractive for applications such as wearable sensors and interfacing with soft tissues. Here, we review the major types of EAPs and their sensing mechanisms. These are divided into two classes depending on the main type of charge carrier: ionic EAPs (such as conducting polymers and ionic polymer–metal composites) and electronic EAPs (such as dielectric elastomers, liquid-crystal polymers and piezoelectric polymers). This review is intended to serve as an introduction to the mechanisms of these materials and as a first step in material selection for both researchers and designers of flexible/bendable devices, biocompatible sensors or even robotic tactile sensing units. PMID:27499846

  8. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  9. Remote Sensing of shallow sea floor for digital earth environment

    International Nuclear Information System (INIS)

    Yahya, N N; Hashim, M; Ahmad, S

    2014-01-01

    Understanding the sea floor biodiversity requires spatial information that can be acquired from remote sensing satellite data. Species volume, spatial patterns and species coverage are some of the information that can be derived. Current approaches for mapping sea bottom type have evolved from field observation, visual interpretation from aerial photography, mapping from remote sensing satellite data along with field survey and hydrograhic chart. Remote sensing offers most versatile technique to map sea bottom type up to a certain scale. This paper reviews the technical characteristics of signal and light interference within marine features, space and remote sensing satellite. In addition, related image processing techniques that are applicable to remote sensing satellite data for sea bottom type digital mapping is also presented. The sea bottom type can be differentiated by classification method using appropriate spectral bands of satellite data. In order to verify the existence of particular sea bottom type, field observations need to be carried out with proper technique and equipment

  10. A Primer on the Government of Alberta’s Budget

    Directory of Open Access Journals (Sweden)

    Ronald D. Kneebone

    2013-01-01

    Full Text Available Provincial budgets may normally make for dry reading, but in Alberta’s case, there is plenty of suspense lurking inside the pages — and that’s not necessarily a good thing. Your average family may know certain things about balancing a budget: keeping spending roughly in line with income; not relying on volatile, unpredictable income streams to cover expenses; and not leaving the kids with an inheritance of significant debt. But look at how Alberta has been managing its budget in the last decade, and it is obvious that the provincial government is breaking a lot of the financial management rules that most Albertans are disciplined enough to live by at home. A clear way to get a sense of how the Alberta government has managed its finances is by analyzing how much provincial program spending relies on depleting provincial savings, either in the form of savings funds or non-renewable resource deposits, such as oil and gas. By 2011, Alberta’s “Budget Gap” had grown to almost the same level it was in 1993, when the province was forced to adopt wrenching budget cuts in order to close what had become a yawning gap between revenue and costs amounting to $4,000 in spending for every man, woman and child in the province. This paper suggests there are three key questions that should be posed to our government and to any political party seeking to represent our interests as our government: 1. How tolerant are they of annual deficits? Do they advocate a strategy of relatively lower levels of government spending and/or higher tax rates, so as to avoid deficits no matter the state of the economy? Or will they tolerate deficits during economic slowdowns to enable higher levels of spending and/or lower tax rates? 2. To what extent are they willing to trust the payment of health-care costs and the costs of education and social assistance to oil and gas royalties as opposed to taxation? 3. How, exactly, does one define investments in social

  11. Sensing of RNA viruses

    DEFF Research Database (Denmark)

    Jensen, Søren; Thomsen, Allan Randrup

    2012-01-01

    pathogen-associated molecular patterns have emerged in great detail. This review presents an overview of our current knowledge regarding the receptors used to detect RNA virus invasion, the molecular structures these receptors sense, and the involved downstream signaling pathways.......Our knowledge regarding the contribution of the innate immune system in recognizing and subsequently initiating a host response to an invasion of RNA virus has been rapidly growing over the last decade. Descriptions of the receptors involved and the molecular mechanisms they employ to sense viral...

  12. Remote sensing image fusion

    CERN Document Server

    Alparone, Luciano; Baronti, Stefano; Garzelli, Andrea

    2015-01-01

    A synthesis of more than ten years of experience, Remote Sensing Image Fusion covers methods specifically designed for remote sensing imagery. The authors supply a comprehensive classification system and rigorous mathematical description of advanced and state-of-the-art methods for pansharpening of multispectral images, fusion of hyperspectral and panchromatic images, and fusion of data from heterogeneous sensors such as optical and synthetic aperture radar (SAR) images and integration of thermal and visible/near-infrared images. They also explore new trends of signal/image processing, such as

  13. Introduction to remote sensing

    CERN Document Server

    Campbell, James B

    2012-01-01

    A leading text for undergraduate- and graduate-level courses, this book introduces widely used forms of remote sensing imagery and their applications in plant sciences, hydrology, earth sciences, and land use analysis. The text provides comprehensive coverage of principal topics and serves as a framework for organizing the vast amount of remote sensing information available on the Web. Including case studies and review questions, the book's four sections and 21 chapters are carefully designed as independent units that instructors can select from as needed for their courses. Illustrations in

  14. Radar Remote Sensing

    Science.gov (United States)

    Rosen, Paul A.

    2012-01-01

    This lecture was just a taste of radar remote sensing techniques and applications. Other important areas include Stereo radar grammetry. PolInSAR for volumetric structure mapping. Agricultural monitoring, soil moisture, ice-mapping, etc. The broad range of sensor types, frequencies of observation and availability of sensors have enabled radar sensors to make significant contributions in a wide area of earth and planetary remote sensing sciences. The range of applications, both qualitative and quantitative, continue to expand with each new generation of sensors.

  15. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  16. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  17. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  18. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  19. Logical Normativity and Common Sense Reasoning

    Directory of Open Access Journals (Sweden)

    Evandro Agazzi

    2011-04-01

    Full Text Available Logic, considered as a technical discipline inaugurated by Aristotle and typically represented by the variety of the modern logical calculi, constitutes a clarification and refinement of a conviction and practice present in common sense, that is, the fact that humans believe that truth can be acquired not only by immediate evidence, but also by means of arguments. As a first step logic can be seen as a “descriptive” record of the main forms of the arguments present in common sense, but the fact that some of these patterns can actually allow for the derivation of false consequences from true premises imposes the task of making explicit what patterns correspond to a “correct reasoning” and what not. At this point logic (that contains the presentation of such patterns appears endowed with a “normative” characteristic. This amounts to saying that logical calculi are intended to adequately mirror the intuitive notion of “logical consequence” and in this sense they cannot be totally arbitrary or conventional, but must satisfy certain basic requirements such as the conditions of soundness and (as far as possible of semantic completeness. In such a way they are “judged” according to the fundamental requirements present at the level of common sense and appear as “idealizations” of the kinds of reasoning practiced in common sense. For this reason also several kinds of logical calculi are fully justified since they make explicit in an idealized form the concrete ways of reasoning that are imposed by the particular domain of reference of the discipline in which they are used and which are basically recognized in common sense.

  20. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  1. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  2. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  3. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  4. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  5. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  6. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  7. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  8. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  9. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  10. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  11. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  12. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  13. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  14. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  15. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  16. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  17. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  18. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  19. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  20. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.