WorldWideScience

Sample records for semisolid agar medium

  1. Evaluation of semisolid agar method for antifungal susceptibility test of T. rubrum

    Directory of Open Access Journals (Sweden)

    Sultana Razia

    2016-08-01

    Full Text Available Background: With increasing fungal disease many newer antifungal drugs are available with different spectrum of activ­ity. Antifungal susceptibility test will help clinicians for selection of effective drug and thereby treatment of patient. Objective: The study was undertaken to perform a simple screening drug susceptibility test of T. rnbrum by Semi Solid Agar Antifungal Susceptibility (SAAS Method: Perfonnance of susceptibility method was assessed by comparing the MICs of three commonly prescribed antifungal agents namely- tluconazole (FCZ, itraconazole (ITZ and terbinafine (TER to the CLSI (Clinical and Laboratory Standard Institute recommended M-38, a broth microdilution method. Results: In SAAS method, among twenty nine T. rubrum, twenty five (86.2% were susceptible (MIC range 0.5-64 µg/ml to Fluconazole (FCZ and four (13.7% were resistant (MIC value >64 µg/ml. In broth microdilution method, among twenty nine T. rubrum, twenty six (89.6% were susceptible (MIC range 0.3-64 µg/ml to FCZ and three (10.3% were resistant (MIC value >64 µg/ml. In case of both ITZ and TER, all were susceptible (MIC range 0.3-64 µg/ml to both methods. The SAAS method demonstrated the susceptibility pattern of T. rubrum against FCZ, ITZ and TER usually within 72 to 96 hours after organism isolation and results were concordance with the results of CLSI broth microdilution method. Conclusion: Though it is a newer method with proper standardization of the test method, SAAS method is simple and easily applicable screening method for susceptibility testing of antifungal agents against dermatophytes in any microbiology laboratories.

  2. In vitro propagation of Morus alba L. in semisolid culture medium.

    Directory of Open Access Journals (Sweden)

    Enrique Salas Barbosa

    2005-04-01

    Full Text Available Apical buds as explants were used with the objective to propagate in vitro mulberry plants in semisolid MS culture medium suplemented with 6-BAP and KIN in their establishment and, with different combinations of 6-BAP with ANA in the multiplication phase. In vitro plants were evaluated during the acclimatization phase. It is necessary to supplement the basal MS culture media with 0.5 mg.l-1 of 6-BAP to induce the sprouting and, 0.5 mg.l-1 of 6-BAP and 0.5 mg.l-1 of ANA to multiply the mulberry by nodal segments. In the acclimatization phase a 95% of survival, 30.2 cm of height, 9.8 leaves and 2.02 g.plant-1 of dry mass was observed. In vitro propagation of mulberry was achieved as an alternative for plants production. Key words: acclimatization, apical buds, establishment, explant, shooting

  3. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  4. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  5. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  6. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  7. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  8. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  9. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  10. Semisolid Metal Processing Consortium

    Energy Technology Data Exchange (ETDEWEB)

    Apelian,Diran

    2002-01-10

    Mathematical modeling and simulations of semisolid filling processes remains a critical issue in understanding and optimizing the process. Semisolid slurries are non-Newtonian materials that exhibit complex rheological behavior. There the way these slurries flow in cavities is very different from the way liquid in classical casting fills cavities. Actually filling in semisolid processing is often counter intuitive

  11. Identification of non-streptococcal organisms from human dental plaque grown on the Streptococcus-selective medium mitis-salivarius agar.

    Science.gov (United States)

    Kim, Yeon-Hee; Lee, Si Young

    2015-02-01

    Mitis-salivarius (MS) agar has been used widely in microbial epidemiological studies because oral viridans streptococci can be selectively grown on this medium. Even though the previous findings reported the limited selecting power of MS agar for streptococcus strains, the identities of non-streptococcal strains from human oral samples which can grow on this medium are not clear yet. In this study, we identified non-streptococcal organisms grown on MS agar plates by polymerase chain reaction (PCR) amplification and sequencing of the 16S ribosomal RNA (rRNA) gene. Eighty bacterial colonies on MS plates were isolated from plaque samples, and bacterial identification was achieved with the rapid ID 32 Strep system and mini API reader. The bacterial colonies identified as non-streptococci by the API system were selected for further identification. The 16S rRNA gene was amplified by PCR and verified using DNA sequencing analysis for identification. Sequences were compared with those of reference organisms in the genome database of the National Center for Biotechnology Information using the Basic Local Alignment Search Tool (BLAST). Among the 11 isolated non-streptococcal strains on MS plates, 3 strains were identified as Actinomyces naeslundii, 7 strains were identified as Actinomyces oris and 1 strain were identified as Actinomyces sp. using Blastn. In this study, we showed that some oral Actinomyces species can grow on Streptococcus-selective MS agar plates. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  13. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  14. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  15. Novo meio seletivo-indicador para detecção de Aeromonas e Plesiomonas: ágar UNISC New selective indicator medium for detection of Aeromonas and Plesiomonas: UNISC agar

    Directory of Open Access Journals (Sweden)

    Marion Pereira da Rocha

    2008-08-01

    Full Text Available Avaliou-se um novo meio seletivo-indicador (ágar UNISC para o isolamento de enteropatógenos clássicos e Aeromonas e Plesiomonas shigelloides. A capacidade de fermentação da xilose é indicada pela coloração amarela (fermentadores ou azul (não fermentadores que, aliada à prova da oxidase, constitui-se em indicador para a detecção de Aeromonas spp e Plesiomonas shigelloides. A produtividade e seletividade, avaliadas pelos índice de contagem absoluta e índice de contagem relativa indicam-no como uma alternativa aos coprocultivos clássicos porque permite, num só meio, o isolamento de Escherichia coli, Shigella spp, Salmonella spp, bem como, Aeromonas spp e Plesiomonas shigelloides, favorecendo o diagnóstico laboratorial das gastroenterites.We evaluated a new selective indicator medium (UNISC Agar for isolation of classical enteropathogens, Aeromonas spp and Plesiomonas shigelloides. The xylose fermentation capacity is indicated by a yellow color (fermenting agents or blue (no fermenting agent. This, together with the oxidase test, establishes it as an indicator for detecting Aeromonas and Plesiomonas shigelloides. Its productivity and selectivity, as assessed using the absolute count index and relative count index, indicate it as an alternative to the classical feces culturing media. This is because, in a single medium, it enables isolation of Escherichia coli, Shigella spp and Salmonella spp, in addition to Aeromonas and Plesiomonas shigelloides, thereby favoring the laboratory diagnosis of gastroenteritis.

  16. Digital monitoring of mycelium growth kinetics and vigor of shiitake (Lentinula edodes (Berk. Pegler on agar medium Monitoramento digital do crescimento e vigor do shiitake (Lentinula edodes (Berk. Pegler em meio de cultura

    Directory of Open Access Journals (Sweden)

    Renato Mamede de Castro Montini

    2006-03-01

    Full Text Available The mycelium growth kinetics and vigor of shiitake (Lentinula edodes (Berk. Pegler strains LE 96/17, LE 98/51, LE 98/53, and LE 98/56 were studied under different agar medium compositions. The strains were from the mycological collection of the Módulo de Cogumelos, Faculdade de Ciências Agronômicas, Unesp-Botucatu, Brazil. Mycelium fragments from stock cultures were transferred to Petri dishes with Sawdust extract-Dextrose-Agar medium. The area of growth and vigor (density of the mycelia were daily recorded with a digital camera, during incubation, until the complete colonization of the Petri dish. The images were analyzed by the freeware UTHSCSA ImageTool, v. 2.0, developed by the University of Texas Health Science Center, San Antonio. The kinetics of mycelium growth, as measured by the mycelium area (mm², has as a deterministic component an exponential function of Gompertz. The vigor, as evaluated by mycelium color in gray scale, was similar for all strains, reached a maximal value between the 4th and 5th day of incubation and decreased further on. The velocity of growth of L. edodes strains was lower in enriched culture media, while vigor was higher. Digital monitoring permits a objective evaluation of the growth kinetics of L. edodes in vitro.Avaliou-se o crescimento e vigor das linhagens LE 96/17, LE 98/51, LE 98/53 e LE 98/56 de Lentinula edodes (Berk Pegler em diferentes composições de meio de cultura. As linhagens foram provenientes da Micoteca do Módulo de Cogumelos da Faculdade de Ciências Agronômicas, Unesp, Campus de Botucatu. Os isolados foram obtidos por propagação vegetativa, pela transferência asséptica do micélio para o meio de cultura de extrato de serragem-dextrose-ágar. O crescimento e vigor do micélio foi fotografado diariamente com uma câmera digital, durante a incubação, até a colonização total da placa de Petri. As imagens foram analisadas pelo programa UTHSCSA ImageTool (freeware, versão 2

  17. Perceived creaminess of semi-solid foods

    NARCIS (Netherlands)

    Wijk, R.A.de; Terpstra, M.E.J.; Janssen, A.M.; Prinz, J.F.

    2006-01-01

    Results of sensory, physiological and physico-chemical studies from our laboratory on perceived creaminess of semi-solids foods are reviewed. Most results stem from studies using model vanilla custard desserts, allowing systematic variation of fat, flavor and thickener properties. The

  18. Contribution to the rheological testing of pharmaceutical semisolids.

    Science.gov (United States)

    Siska, B; Snejdrova, E; Machac, I; Dolecek, P; Martiska, J

    2018-01-22

    Rheological behaviour of pharmaceutical semisolid preparations significantly affects manufacturing process, administration, stability, homogeneity of incorporated drug, accuracy of dosing, adhesion in the place of application, drug release, and resulting therapeutic effect of the product. We performed test of consistency by penetrometry, rotational, oscillation and creep tests, and squeeze and tack tests of model samples to introduce methods suitable for characterization and comparison of semisolids in practice. Penetrometry is a simple method allowing sorting the semisolids to low and high stress-resistant materials but deficient for rheological characterization of semisolids. Value of yield stress, generally considered to be appropriate feature of semisolids, is significantly influenced by the method of testing and the way of evaluation. The hysteresis loops of model semisolids revealed incomplete thixotropy, therefore, three-step thixotropy test was employed. Semisolids showed nonlinear response in the creep phase of tests and partial recovery of structure by storing energy in the recovery phase. Squeeze and tack tests seem to be convenient ways for comparison of semisolids. Our study can contribute to a better understanding of different flow behaviour of semisolids given by different physicochemical properties of excipients and can bring useful approaches to evaluation and comparison of semisolids in practice.

  19. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  20. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  1. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  2. Performance of the EUCAST disk diffusion method, the CLSI agar screen method, and the Vitek 2 automated antimicrobial susceptibility testing system for detection of clinical isolates of Enterococci with low- and medium-level VanB-type vancomycin resistance

    DEFF Research Database (Denmark)

    Hegstad, Kristin; Giske, Christian G; Haldorsen, Bjørg

    2014-01-01

    faecium (n=18) strains with and without nonsusceptibility to vancomycin was examined blindly in Danish (n=5), Norwegian (n=13), and Swedish (n=10) laboratories using the EUCAST disk diffusion method (n=28) and the CLSI agar screen (n=18) or the Vitek 2 system (bioMérieux) (n=5). The EUCAST disk diffusion...... method (very major error [VME] rate, 7.0%; sensitivity, 0.93; major error [ME] rate, 2.4%; specificity, 0.98) and CLSI agar screen (VME rate, 6.6%; sensitivity, 0.93; ME rate, 5.6%; specificity, 0.94) performed significantly better (P=0.02) than the Vitek 2 system (VME rate, 13%; sensitivity, 0.87; ME...... rate, 0%; specificity, 1). The performance of the EUCAST disk diffusion method was challenged by differences in vancomycin inhibition zone sizes as well as the experience of the personnel in interpreting fuzzy zone edges as an indication of vancomycin resistance. Laboratories using Oxoid agar (P

  3. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  4. Method and apparatus for semi-solid material processing

    Science.gov (United States)

    Han, Qingyou [Knoxville, TN; Jian, Xiaogang [Knoxville, TN; Xu, Hanbing [Knoxville, TN; Meek, Thomas T [Knoxville, TN

    2009-02-24

    A method of forming a material includes the steps of: vibrating a molten material at an ultrasonic frequency while cooling the material to a semi-solid state to form non-dendritic grains therein; forming the semi-solid material into a desired shape; and cooling the material to a solid state. The method makes semi-solid castings directly from molten materials (usually a metal), produces grain size usually in the range of smaller than 50 .mu.m, and can be easily retrofitted into existing conventional forming machine.

  5. Near net shape forming unsing semi-solid metal forming

    CSIR Research Space (South Africa)

    Govender, G

    2005-10-01

    Full Text Available (NRC) – UBE • Semi-Solid Rheocasting (SSR) – MIT • New Semi-Solid Casting – Hitachi • Sub-liquidus Casting (SLC) –JLH Technologies & THT Presses • Slurry on Demand (SoD) – AEMP 2005 Contech –USA Citation – USA Intermet – USA Stampal - ITALY... Stampal - producing engine brackets for Fiat PUNTO 50000 pcs per month New Rheocasting (NRC) - UBE 2005 Semi-Solid Rheocasting – MIT 2005 Hitachi Process 2005 SLC Process 2005 Advantages and Disadvantages of Rheocasting Advantages Disadvantages...

  6. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  7. Stationary semi-solid battery module and method of manufacture

    Science.gov (United States)

    Slocum, Alexander; Doherty, Tristan; Bazzarella, Ricardo; Cross, III, James C.; Limthongkul, Pimpa; Duduta, Mihai; Disko, Jeffry; Yang, Allen; Wilder, Throop; Carter, William Craig; Chiang, Yet-Ming

    2015-12-01

    A method of manufacturing an electrochemical cell includes transferring an anode semi-solid suspension to an anode compartment defined at least in part by an anode current collector and an separator spaced apart from the anode collector. The method also includes transferring a cathode semi-solid suspension to a cathode compartment defined at least in part by a cathode current collector and the separator spaced apart from the cathode collector. The transferring of the anode semi-solid suspension to the anode compartment and the cathode semi-solid to the cathode compartment is such that a difference between a minimum distance and a maximum distance between the anode current collector and the separator is maintained within a predetermined tolerance. The method includes sealing the anode compartment and the cathode compartment.

  8. Micropropagation of Alstroemeria in liquid medium using slow release of medium components

    NARCIS (Netherlands)

    Klerk, de G.J.M.; Brugge, ter J.

    2010-01-01

    Alstroemeria rhizomes were micropropagated on semi-solid medium (AM) and in liquid medium (LM). In LM, growth was much enhanced (ca. 70%). Adequate gas exchange was crucial. This was obtained by agitation and in static medium by a sufficient large contact area of the explant and the gaseous

  9. Semi-solid electrodes having high rate capability

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, Yet-Ming; Duduta, Mihai; Holman, Richard; Limthongkul, Pimpa; Tan, Taison

    2017-11-28

    Embodiments described herein relate generally to electrochemical cells having high rate capability, and more particularly to devices, systems and methods of producing high capacity and high rate capability batteries having relatively thick semi-solid electrodes. In some embodiments, an electrochemical cell includes an anode and a semi-solid cathode. The semi-solid cathode includes a suspension of an active material of about 35% to about 75% by volume of an active material and about 0.5% to about 8% by volume of a conductive material in a non-aqueous liquid electrolyte. An ion-permeable membrane is disposed between the anode and the semi-solid cathode. The semi-solid cathode has a thickness of about 250 .mu.m to about 2,000 .mu.m, and the electrochemical cell has an area specific capacity of at least about 7 mAh/cm.sup.2 at a C-rate of C/4. In some embodiments, the semi-solid cathode slurry has a mixing index of at least about 0.9.

  10. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  11. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  12. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  13. Semi-solid electrodes having high rate capability

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, Yet-Ming; Duduta, Mihai; Holman, Richard; Limthongkul, Pimpa; Tan, Taison

    2017-11-28

    Embodiments described herein relate generally to electrochemical cells having high rate capability, and more particularly to devices, systems and methods of producing high capacity and high rate capability batteries having relatively thick semi-solid electrodes. In some embodiments, an electrochemical cell includes an anode, a semi-solid cathode that includes a suspension of an active material and a conductive material in a liquid electrolyte, and an ion permeable membrane disposed between the anode and the cathode. The semi-solid cathode has a thickness in the range of about 250 .mu.m-2,500 .mu.m, and the electrochemical cell has an area specific capacity of at least 5 mAh/cm.sup.2 at a C-rate of C/2.

  14. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  15. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  16. [THE NATIONAL NUTRIENT MEDIUM FOR DIAGNOSTIC OF PURULENT BACTERIAL MENINGITIS].

    Science.gov (United States)

    Podkopaev, Ya V; Domotenko, L V; Morozova, T P; Khramov, M K; Shepelin, A P

    2015-05-01

    The national growth mediums were developed for isolating and cultivating of main agents of purulent bacterial meningitis--haemophilus agar, chocolate agar, PBM-agar. The growing and selective characteristics of developed growth mediums are examined. The haemophilus agar ensures growth of Haemophilus influenzae. The chocolate agar, PBM-agar ensure growth of Neisseria meningitidis, Streptococcus pneumoniae and Haemophilus influenzae. By growing characteristics, the national growth mediums match foreign analogues. Under application of growth mediums with selective additions it is possible to achieve selective isolation of main agents of purulent bacterial meningitis with inhibition of growth of microbes-associates.

  17. Crecimiento y habilidad decolorante potencial de Hyphomycetes (Deuteromycetes de Río Santiago sobre medio agarizado suplementado con cromóforos sintéticos Growth and potential decolorizing ability of Hyphomycetes (Deuteromycetes from Río Santiago on agar medium supplemented with synthetic chromophores

    Directory of Open Access Journals (Sweden)

    Romina Liberto

    2005-12-01

    by the toluidine blue dye, while M. parvum was inhibited by that chromophore. Methyl red only inhibited to M. parvum and T. aristata. The 3 strains tested revealed ability to decolorize the medium supplemented with methyl red and toluidine blue. D. triramosum decolorized also the medium with congo red and crystal violet, and T. aristata produced also the decolorization of the agar medium with crystal violet and neutral red. None of the fungi studied decolorized the media with brilliant green, eosin and rose bengal.

  18. Semisolid liver infusion tryptose supplemented with human urine allows growth and isolation of Trypanosoma cruzi and Trypanosoma rangeli clonal lineages

    Directory of Open Access Journals (Sweden)

    Emanuella Francisco Fajardo

    2016-06-01

    Full Text Available Abstract: INTRODUCTION This work shows that 3% (v/v human urine (HU in semisolid Liver Infusion Tryptose (SSL medium favors the growth of Trypanosoma cruzi and T. rangeli. METHODS Parasites were plated as individual or mixed strains on SSL medium and on SSL medium with 3% human urine (SSL-HU. Isolate DNA was analyzed using polymerase chain reaction (PCR and pulsed-field gel electrophoresis (PFGE. RESULTS SSL-HU medium improved clone isolation. PCR revealed that T. cruzi strains predominate on mixed-strain plates. PFGE confirmed that isolated parasites share the same molecular karyotype as parental cell lines. CONCLUSIONS SSL-HU medium constitutes a novel tool for obtaining T. cruzi and T. rangeli clonal lineages.

  19. Gongronema Latifolium delays gastric emptying of semi-solid meals ...

    African Journals Online (AJOL)

    The aim of the study was to investigate sonographically the effect of Gongronema latifolium on gastric emptying of semi-solid meals in diabetic dogs. Twenty-five alloxan-induced diabetic dogs were randomly allotted into five groups of five dogs each in a randomised placebo-controlled study. These are placebo, prokinetic ...

  20. Nutritional composition of bioproducts generated from semi-solid ...

    African Journals Online (AJOL)

    Nutritional composition of bioproducts generated from semi-solid fermentation of pineapple peel by edible mushrooms. Raiane Áila Teixeira Souza, Tamiris Rio Branco da Fonseca, Larissa de Souza Kirsch, Larissa Svetlana Cavalcante Silva, Mircella Marialva Alecrim, Raimundo Felipe da Cruz Filho, Maria Francisca ...

  1. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  2. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    of large spots, which we then wash with water to assess adhesion and rub cells completely off the agar surface to assess invasion into the agar. We eliminate the need for streaking cells onto agar, which affects the invasion of cells into the agar. In general, we observed that haploid strains that invade agar are always adhesive, yet not all adhesive strains can invade agar medium. Our approach can be used in conjunction with other assays to carefully dissect the differentiation steps and requirements of yeast signal transduction, differentiation, quorum sensing, and biofilm formation.

  3. Development of rheometer for semi-solid highmelting point alloys

    Directory of Open Access Journals (Sweden)

    LIU Wen

    2005-11-01

    Full Text Available A rheometer for semi-solid high-melting point alloys was developed based on the principle of a double-bucket rheometer, with which the solidifying of semi-solid high-melting point alloy melt could be effectively controlled by the control of temperature and the outer force-field; and different microstructures have also been obtained. This rheometer can be used to investigate the rheological behavior under different conditions by changing the Theological parameters. By way of full-duplex communication between the computer and each sensor, automatic control of the test equipment and real- timemeasurement of rheological parameters were realized. Finally, the influencing factors on torque are also quantitatively analyzed.

  4. Effect of temperature on viscoelastic properties of semisolid dairy desserts

    OpenAIRE

    Tárrega, Amparo; Durán, Luis; Costell, Elvira

    2003-01-01

    The “natillas”, semisolid dairy dessert of wide consumption in Spain, is composed of milk, starch, hydrocolloids, sugars, colorants and aromas. The particular characteristics of some ingredients, like fat content of milk, type of starch, and/or type and concentration of hydrocolloids, and their crossed interactions, will be reflected in notable differences in their rheological and sensory properties. Little information is available on the differences to be found in commercial samples of this ...

  5. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  7. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  8. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  9. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  10. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  11. Reproducibility of esophageal scintigraphy using semi-solid yoghurt

    Energy Technology Data Exchange (ETDEWEB)

    Imai, Yukinori; Kinoshita, Manabu; Asakura, Yasushi; Kakinuma, Tohru; Shimoji, Katsunori; Fujiwara, Kenji; Suzuki, Kenji; Miyamae, Tatsuya [Saitama Medical School, Moroyama (Japan)

    1999-10-01

    Esophageal scintigraphy is a non-invasive method which evaluate esophageal function quantitatively. We applied new technique using semi-solid yoghurt, which can evaluate esophageal function in a sitting position. To evaluate the reproducibility of this method, scintigraphy were performed in 16 healthy volunteers. From the result of four swallows except the first one, the mean coefficients of variation in esophageal transit time and esophageal emptying time were 12.8% and 13.4% respectively (interday variation). As regards the interday variation, this method had also good reproducibility from the result on the 2 separate days. (author)

  12. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  13. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  14. Semi-solid state fermentation of bagasse for hydrogen production; the cost-effective approach in Indian context

    International Nuclear Information System (INIS)

    Singh, S.P.; Asthana, R.K.; Singh, A.P.

    2006-01-01

    Semi-solid state fermentation route of hydrogen production from agro-waste sugar cane bagasse was tried using the photosynthetic bacterium Rhodopseudomonas (BHU strain-1) and the non-photosynthetic Enterobacter aerogenes MTCC2822. The process seems an alternative to submerged fermentation that requires high volumes of nutrient broth. Bagasse (10 g) pre-hydrolyzed with NaOH (2%, w/v) was coated with Ca-alginate (1.5%, v/v) containing Rhodopseudomonas and E. aerogenes in the co-immobilized state (300 μg bacterial biomass ml -1 ). The fermenting medium was just 150 ml to sustain the moistened bagasse in a 0.5 L fermenter kept in light. A parallel set of free bacterial cells served as control. Hydrogen production by the immobilized sets reached 30 L within 60 h with the average rate of 0.177 L H 2 h -1 . For free cells, the values for hydrogen output (20 L) or the rate 0.1125 L H 2 h -1 were approximately 1.5-fold low. It is proposed that semi-solid fermentation route of hydrogen production from bagasse will be a cost-effective technology in countries generating this agro-waste. (authors)

  15. Semi-solid state fermentation of bagasse for hydrogen production; the cost-effective approach in Indian context

    Energy Technology Data Exchange (ETDEWEB)

    Singh, S.P.; Asthana, R.K.; Singh, A.P. [Centre of Advanced Study in Botany, Banaras Hindu University, Varanasi-221005, (India)

    2006-07-01

    Semi-solid state fermentation route of hydrogen production from agro-waste sugar cane bagasse was tried using the photosynthetic bacterium Rhodopseudomonas (BHU strain-1) and the non-photosynthetic Enterobacter aerogenes MTCC2822. The process seems an alternative to submerged fermentation that requires high volumes of nutrient broth. Bagasse (10 g) pre-hydrolyzed with NaOH (2%, w/v) was coated with Ca-alginate (1.5%, v/v) containing Rhodopseudomonas and E. aerogenes in the co-immobilized state (300 {mu}g bacterial biomass ml{sup -1}). The fermenting medium was just 150 ml to sustain the moistened bagasse in a 0.5 L fermenter kept in light. A parallel set of free bacterial cells served as control. Hydrogen production by the immobilized sets reached 30 L within 60 h with the average rate of 0.177 L H{sub 2} h{sup -1}. For free cells, the values for hydrogen output (20 L) or the rate 0.1125 L H{sub 2} h{sup -1} were approximately 1.5-fold low. It is proposed that semi-solid fermentation route of hydrogen production from bagasse will be a cost-effective technology in countries generating this agro-waste. (authors)

  16. Development of novel Alicyclobacillus spp. isolation medium.

    Science.gov (United States)

    Chang, S; Kang, D-H

    2005-01-01

    To develop a new isolation medium with higher recovery rates of Alicyclobacillus spp. SK agar was developed with optimized incubation temperature, pH, acidulant, Tween 80 concentration and divalent cation addition. Results indicate that detection of Alicyclobacillus spp. by SK agar was significantly higher (P > 0.05) than those obtained by K agar, orange serum agar, and potato dextrose agar. Current media used for Alicyclobacillus spp. isolation still resulted in high numbers of false negative products. The sensitivity of SK agar to Alicyclobacillus spp. allows detection of low numbers of Alicyclobacillus spp. and also provides a more higher isolation results compared with currently used media. SK agar will be useful to the fruit juice industry to obtain more accurate numbers of contaminant Alicyclobacillus spp. With this media, false negative samples can be reduced, and the likelihood of exported products being rejected can be greatly reduced.

  17. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  18. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  19. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  1. Trend and Development of Semisolid Metal Joining Processing

    Directory of Open Access Journals (Sweden)

    M. N. Mohammed

    2015-01-01

    Full Text Available The semisolid metal joining (SSMJ process or thixojoining process has recently been developed based on the principles of SSM processing, which is a technology that involves the formation of metal alloys between solidus and liquidus temperatures. Thixojoining has many potential benefits, which has encouraged researchers to carry out feasibility studies on various materials that could be utilized in this process and which could transform the production of metal components. This paper reviews the findings in the literature to date in this evolving field, specifically, the experimental details, technology considerations for industrialization, and advantages and disadvantages of the various types of SSMJ methods that have been proposed. It also presents details of the range of materials that have been joined by using the SSMJ process. Furthermore, it highlights the huge potential of this process and future directions for further research.

  2. Semisolid forming of S48C steel grade

    Science.gov (United States)

    Plata, Gorka; Lozares, Jokin; Azpilgain, Zigor; Hurtado, Iñaki; Loizaga, Iñigo; Idoyaga, Zuriñe

    2017-10-01

    Steel production and component manufacturing industries have to face the challenge of globalization, trying to overcome the economic pressure to remain competitive. Moreover, the lightweighting trend of the latter years implies an even higher challenge to maintain the steel use. Therefore, advanced manufacturing processes will be the cornerstone. In this field, Semisolid forming (SSF) has demonstrated the capability of obtaining complex geometries and saving raw material and energy. Despite it is complicated the SSF of sound components, in Mondragon Unibertsitatea it has been successfully demonstrated the capability of producing strong enough automotive components with 42CrMo4 steel grade. In this work, we demonstrate the capability of SSF S48C steel grade with great mechanical properties.

  3. Modeling steel deformation in the semi-solid state

    CERN Document Server

    Hojny, Marcin

    2017-01-01

    This book addresses selected aspects of steel-deformation modelling, both at very high temperatures and under the conditions in which the liquid and the solid phases coexist. Steel-deformation modelling with its simultaneous solidification is particularly difficult due to its specificity and complexity. With regard to industrial applications and the development of new, integrated continuous casting and rolling processes, the issues related to modelling are becoming increasingly important. Since the numerous industrial tests that are necessary when traditional methods are used to design the process of continuous casting immediately followed by rolling are expensive, new modelling concepts have been sought. Comprehensive tests were applied to solve problems related to the deformation of steel with a semi-solid core. Physical tests using specialist laboratory instruments (Gleeble 3800thermo-mechanical simulator, NANOTOM 180 N computer tomography, Zwick Z250 testing equipment, 3D blue-light scanning systems), and...

  4. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  5. Vaginal semisolid products: Technological performance considering physiologic parameters.

    Science.gov (United States)

    Machado, Rita Monteiro; Palmeira-de-Oliveira, Ana; Martinez-de-Oliveira, José; Palmeira-de-Oliveira, Rita

    2017-11-15

    Vaginal semisolid products are frequently used to treat vaginal infections and atrophy-related symptoms of menopause. Formulations composition and the methods for their characterization, especially those developed concerning the target epithelia, are key tools to predict in vivo results at early stages of product development. However, recent studies on this subject have been almost exclusively focused on anti-HIV preparations. The aim of this work consists on improving traditional characterization methods by using physiological parameters in order to construct predictive tools to characterize a new ideal vaginal semisolid formulation whatever target it may have. Ten vaginal antimicrobial and hormonal products already available in the market were studied (Gino-Canesten®, Sertopic®, Dermofix®, Gyno-pevaryl®, Lomexin®, Gino Travogen®, Dalacin V®, Ovestin®, Blissel®, Colpotrophine®). Furthermore, Universal Placebo gel and Replens® were used for comparison. Products were characterized in terms of: pH and buffering capacity in a vaginal fluid simulant (VFS); osmolality - directly and upon dilution in VFS; textural parameters (firmness, adhesiveness and bioadhesion) using vaginal ex vivo porcine epithelium; and viscosity (including VFS dilution at 37°C and after administration on an ex vivo model). Interestingly, the majority of the tested commercial vaginal formulations did not present technological characteristics close to the ideal ones when tested under target biological conditions. The inclusion of such methodologic adaptations is expected to optimize cost-efficiency of new formulations development by predicting efficacy and safety profiles at early stages of product development. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Texture and mouthfeel of semi-solid foods : commercial mayonnaises, dressings, custard desserts and warm sauces

    NARCIS (Netherlands)

    Weenen, H.; Gemert, van L.J.; Doorn, van J.M.; Dijksterhuis, G.B.; Wijk, de R.A.

    2003-01-01

    Texture and mouthfeel sensations of three groups of semisolid foodstuffs (mayonnaises and dressings, custard desserts and warm sauces) were characterised, measured, evaluated and compared based on quantitative descriptive sensory analysis of commercial products. Six groups of texture attributes were

  7. Texture and mouthfeel of semisolid foods: Commercial mayonnaises, dressings, custard desserts and warm sauces

    NARCIS (Netherlands)

    Weenen, H.; Gemert, L.J. van; Doorn, J.M. van; Dijksterhuis, G.B.; Wijk, R.A. de

    2003-01-01

    Texture and mouthfeel sensations of three groups of semisolid foodstuffs (mayonnaises and dressings, custard desserts and warm sauces) were characterised, measured, evaluated and compared based on quantitative descriptive sensory analysis of commercial products. Six groups of texture attributes were

  8. Microstructural Evolution during DPRM Process of Semisolid Ledeburitic D2 Tool Steel

    OpenAIRE

    M. N. Mohammed; M. Z. Omar; J. Syarif; Z. Sajuri; M. S. Salleh; K. S. Alhawari

    2013-01-01

    Semisolid metal processing is a relatively new technology that offers several advantages over liquid processing and solid processing because of the unique behaviour and characteristic microstructure of metals in this state. With the aim of finding a minimum process chain for the manufacture of high-quality production at minimal cost for forming, the microstructural evolution of the ledeburitic AISI D2 tool steel in the semisolid state was studied experimentally. The potential of the direct pa...

  9. Semi-solid electrode cell having a porous current collector and methods of manufacture

    Science.gov (United States)

    Chiang, Yet-Ming; Carter, William Craig; Cross, III, James C.; Bazzarella, Ricardo; Ota, Naoki

    2017-11-21

    An electrochemical cell includes an anode, a semi-solid cathode, and a separator disposed therebetween. The semi-solid cathode includes a porous current collector and a suspension of an active material and a conductive material disposed in a non-aqueous liquid electrolyte. The porous current collector is at least partially disposed within the suspension such that the suspension substantially encapsulates the porous current collector.

  10. Loss of the ability to generate large burst-forming unit-like megakaryocytic colonies from thawed cord blood in semisolid cultures after short term suspension culture.

    Science.gov (United States)

    Eskola, M; Bäckman, S; Möttönen, S; Kekomäki, R

    2015-04-01

    Total colony-forming cells from thawed cord blood units (CBUs) include megakaryocytic colony-forming units (CFU-Mks), which survive the freezing process. The aim of this study was to evaluate whether different megakaryocytic progenitors from unseparated CBUs survive the freezing process and a short-term liquid culture. Thawed samples of CBUs were cultured in liquid medium. During the cultures, serial samples were drawn to assess the growth of different megakaryocytic progenitors in a semisolid collagen medium with identical cytokines as in the liquid medium. Megakaryocytic cells were detected using immunohistochemistry and flow cytometry. In suspension culture, the megakaryocytic progenitors almost completely lost the ability to generate large (burst-forming unit-like, BFU-like) megakaryocytic colonies in semisolid cultures (large colonies, median count per chamber d0: 7.25 vs. d7: 1.5; P culture in suspension resulted in the decline of small colonies as well (d7: 16.0 vs. d14: 5.75; P = 0.0088). Total CFU-Mk count declined from 23.3 (range 12.5-34.0) at d0 to 7.25 (range 1.0-13.5) at d14 (P culture after a short suspension culture. Small CFU-Mks were observed throughout the cultures. It may be that the BFU-Mk colonies matured and acquired CFU-Mk behaviour. © 2014 International Society of Blood Transfusion.

  11. Microstructure of Semi-Solid 6063 Alloy Fabricated by Radial Forging Combined with Unidirectional Compression Recrystallization and Partial Melting Process

    Directory of Open Access Journals (Sweden)

    Wang Yongfei

    2017-01-01

    Full Text Available Radial forging combined with unidirectional compression (RFCUM is introduced in recrystallization and partial melting (RAP to fabricate semi-solid 6063 aluminum alloy, which can be defined as a process of RFCUM-RAP. In this study, the microstructures of semi-solid 6063 alloy prepared by semi-solid isothermal treatment (SSIT and RFCUM-RAP processes are investigated. The results show that, the solid grains of semi-solid alloy prepared by SSIT are large and irregular. However, solid grains of semi-solid billet prepared by RFCUC-RAP are fine and spherical. Additionally, during RFCUC-RAP process, with the increase of isothermal holding time, the shape of solid grain is more and more spherical, but the size of solid grain is gradually increased. To obtain ideal semi-solid microstructure, the optimal isothermal holding temperature and time are 630 °C and 5~10 min, respectively.

  12. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  13. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  14. VALIDATION OF EPA METHOD 1682: SALMONELLA IN BIOSOLIDS BY MODIFIED, SEMISOLID RAPPAPORT-VASSILIADIS (MSRV) MEDIUM

    Science.gov (United States)

    Treated biosolids may be applied to land as a crop nutrient and soil conditioner. However, land application of biosolids may pose the risk of releasing pathogens into the environment if disinfection and use criteria established by EPA at 40 CFR part 503 are not met. Among these c...

  15. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  16. Esophageal transit scintigraphy in healthy volunteers using TC-99M sulphur colloid semisolid jelly

    International Nuclear Information System (INIS)

    Ashwani Sood; Kumar, U.; Gambhir, S.; Sewatkar, A.B.; Kheruka, S.C.; Dube, V.

    2004-01-01

    Functional symptoms caused by esophageal motor disorders are very common. The esophageal transit scintigraphy has been done using liquid and solid meals to understand pathophysiology of esophageal motor disorders better. The present study was aimed to develop and standardize a stable and easily acceptable radioactive semisolid meal for esophageal transit scintigraphy. Semisolid jelly incorporated with Tc-99m sulphur colloid was prepared from the commercially available edible jelly powder-containing gelatin. The tracer stability was investigated by in-vitro method up to 4 hours to test the affinity of tracer and mechanical stability of semisolid meal. The amount of semisolid meal per bolus was also standardized in relation to ease of swallowing and free passage of it through whole of esophagus. The additional objective was to establish the normal esophageal transit scintigraphic parameters. Materials and methods: A total of 31 normal volunteers were studied. The esophageal transit scintigraphy was performed in supine and sitting positions thrice using single bolus of 2 gm semisolid jelly containing 7.4 MBq (200uCi) of tracer for the acquisition period of 192 seconds. The esophageal emptying time for 50% (T50) and for 90% (T90) were calculated by computer analysis in addition to generation of condensed dynamic images. Results: The 50% and 90% whole esophageal emptying time are given below in the table in sitting and supine positions respectively.(P<0.05). Conclusions: Condensed dynamic images revealed normal transit pattern without delay or stasis and fragmentation of bolus through the esophagus. The stability and homogeneity of tracer in the semisolid meal provided a simple and reliable method for carrying out esophageal transit scintigraphy. It was found that this bolus was well accepted by normal volunteers and values obtained were well within the acceptable range. Thus we established the normal values in our laboratory and also standardized a semisolid meal with

  17. Chemical ageing and transformation of diffusivity in semi-solid multi-component organic aerosol particles

    Science.gov (United States)

    Pfrang, C.; Shiraiwa, M.; Pöschl, U.

    2011-07-01

    Recent experimental evidence underlines the importance of reduced diffusivity in amorphous semi-solid or glassy atmospheric aerosols. This paper investigates the impact of diffusivity on the ageing of multi-component reactive organic particles approximating atmospheric cooking aerosols. We apply and extend the recently developed KM-SUB model in a study of a 12-component mixture containing oleic and palmitoleic acids. We demonstrate that changes in the diffusivity may explain the evolution of chemical loss rates in ageing semi-solid particles, and we resolve surface and bulk processes under transient reaction conditions considering diffusivities altered by oligomerisation. This new model treatment allows prediction of the ageing of mixed organic multi-component aerosols over atmospherically relevant timescales and conditions. We illustrate the impact of changing diffusivity on the chemical half-life of reactive components in semi-solid particles, and we demonstrate how solidification and crust formation at the particle surface can affect the chemical transformation of organic aerosols.

  18. Rheologic behaviors of A356 aluminum alloy billet produced by semisolid continuous casting process

    Directory of Open Access Journals (Sweden)

    Shuming XING

    2004-08-01

    Full Text Available The experiments for rheologic behaviors of semisolid continous casting billets of A356 alloy in semisolid state has been carried out with a multifunctional rheometer. The results show that the deformation rate increases with loading time, the maximum strain reaches 120% (which is one time larger than that of traditional casting billet and the strain can be rapidly eliminated to 10% after unloading. Moreover, there is a critic stress for billet deformation even in semisolid state, which is named as critic shear stress. This stress increases with the decreasing of heating time. The rheologic behaviors can be expressed by five elements mechanical model and can be modified with the increasing of heating time.

  19. A selective and differential medium for Vibrio harveyi.

    Science.gov (United States)

    Harris, L; Owens, L; Smith, S

    1996-01-01

    A new medium, termed Vibrio harveyi agar, has been developed for the isolation and enumeration of V. harveyi. It is possible to differentiate V. harveyi colonies from the colonies of strains representing 15 other Vibrio species with this medium. This medium has been shown to inhibit the growth of two strains of marine Pseudomonas spp. and two strains of marine Flavobacterium spp. but to allow the growth of Photobacterium strains. Colonies displaying typical V. harveyi morphology were isolated from the larval rearing water of a commercial prawn hatchery with V. harveyi agar as a primary isolation medium and were positively identified, by conventional tests, as V. harveyi. This agar displays great potential as a primary isolation medium and offers significant advantages over thiosulfate-citrate-bile salts-sucrose agar as a medium for differentiating V. harveyi from other marine and estuarine Vibrio species. PMID:8795252

  20. On the hot cracking susceptibility of a semisolid aluminium 6061 weld: Application of a coupled solidification- thermomechanical model

    International Nuclear Information System (INIS)

    Rajani, H R Zareie; Phillion, A B

    2015-01-01

    A coupled solidification-thermomechanical model is presented that investigates the hot tearing susceptibility of an aluminium 6061 semisolid weld. Two key phenomena are considered: excessive deformation of the semisolid weld, initiating a hot tear, and the ability of the semisolid weld to heal the hot tear by circulation of the molten metal. The model consists of two major modules: weld solidification and thermomechanical analysis. 1) By means of a multi-scale model of solidification, the microstructural evolution of the semisolid weld is simulated in 3D. The semisolid structure, which varies as a function of welding parameters, is composed of solidifying grains and a network of micro liquid channels. The weld solidification module is utilized to obtain the solidification shrinkage. The size of the micro liquid channels is used as an indicator to assess the healing ability of the semisolid weld. 2) Using the finite element method, the mechanical interaction between the weld pool and the base metal is simulated to capture the transient force field deforming the semisolid weld. Thermomechanical stresses and shrinkage stresses are both considered in the analysis; the solidification contractions are extracted from the weld solidification module and applied to the deformation simulation as boundary conditions. Such an analysis enables characterization of the potential for excessive deformation of the weld. The outputs of the model are used to study the effect of welding parameters including welding current and speed, and also welding constraint on the hot cracking susceptibility of an aluminium alloy 6061 semisolid weld. (paper)

  1. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  2. Equivalency testing of TTC Tergitol 7 agar (ISO 9308-1:2000) with five culture media for the detection of E. coli in water samples in Greece.

    Science.gov (United States)

    Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G

    2010-01-01

    In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.

  3. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  4. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  5. Semi-solid near-net shape rheocasting of heat treatable wrought aluminum alloys

    CSIR Research Space (South Africa)

    Curle, UA

    2010-09-01

    Full Text Available Flexibility of the CSIR-RCS, induction stirring with simultaneous air cooling process, in combination with high pressure die casting is successfully demonstrated by semi-solid rheocasting of plates performed on commercial 2024, 6082 and 7075 wrought...

  6. 3D primary grain shapes resulting from semi-solid metal processing

    CSIR Research Space (South Africa)

    Curle, Ulyate A

    2017-07-01

    Full Text Available ) size. Are these 2D globules also spherical in shape in 3D or are these 2D shapes remnants of the 3D shapes after sectioning along planes? An Al-Si-Mg alloy is semi-solid processed using a patented processing coil that induces contactless stirring while...

  7. T5 heat treatment of semi-solid metal processed aluminium alloy F357

    CSIR Research Space (South Africa)

    Moller, H

    2009-04-01

    Full Text Available The T5 heat treatment of semi-solid metal (SSM) processed alloy F357 was investigated by considering the effects of cooling rate and natural aging after casting, as well as artificial aging parameters on tensile properties. In addition, the tensile...

  8. Relative importance of cohesion and adhesion for sensory stickiness of semisolid foods

    NARCIS (Netherlands)

    Dunnewind, B.; Janssen, A.M.; Vliet, T. van; Weenen, H.

    2004-01-01

    The relative importance of cohesion and adhesion for sensory stickness of semisolid foods was investigated using a texture analyzers. Products included commercial mayon-naises, custard desserts and warm sauces which varied in apparent viscosity between 0.3 and 18.3 Pa.s. It was observed that the

  9. Phase Evolution and Mechanical Behavior of the Semi-Solid SIMA Processed 7075 Aluminum Alloy

    Directory of Open Access Journals (Sweden)

    Behzad Binesh

    2016-02-01

    Full Text Available Microstructural and mechanical behaviors of semi-solid 7075 aluminum alloy were investigated during semi-solid processing. The strain induced melt activation (SIMA process consisted of applying uniaxial compression strain at ambient temperature and subsequent semi-solid treatment at 600–620 °C for 5–35 min. Microstructures were characterized by scanning electron microscope (SEM, energy dispersive spectroscopy (EDS, and X-ray diffraction (XRD. During the isothermal heating, intermetallic precipitates were gradually dissolved through the phase transformations of α-Al + η (MgZn2 → liquid phase (L and then α-Al + Al2CuMg (S + Mg2Si → liquid phase (L. However, Fe-rich precipitates appeared mainly as square particles at the grain boundaries at low heating temperatures. Cu and Si were enriched at the grain boundaries during the isothermal treatment while a significant depletion of Mg was also observed at the grain boundaries. The mechanical behavior of different SIMA processed samples in the semi-solid state were investigated by means of hot compression tests. The results indicated that the SIMA processed sample with near equiaxed microstructure exhibits the highest flow resistance during thixoforming which significantly decreases in the case of samples with globular microstructures. This was justified based on the governing deformation mechanisms for different thixoformed microstructures.

  10. Effect of technological parameters on formability of semi-solid rheological casting-forging 6061 alloy

    Directory of Open Access Journals (Sweden)

    Jianbo TAN

    2016-02-01

    Full Text Available The 6061 alloy cooling curve is determined by analysis software, and the 6061 semi-solid alloy is prepared by manual paddling process. The primary solid fraction is tested through prepared water quenched samples under different temperature. With H1F100 type servo press and cup type test mold, the forming of the 6061 semi-solid alloy rheological casting-forging is made. The influence of alloy temperature, forming pressure, upper mould temperature and holding time on the formability of 6061 alloy is researched. The results show that within the same set of mold completing casting and forging of the alloy is feasible. Along with the increase of the alloy temperature and the upper mould temperature, the formability of finished products becomes better. Under this experimentation, when the temperature of the semi-solid alloy is amongst 642 ℃ to 645 ℃ and the upper mould preheating temperature is amongst 200 ℃ to 300 ℃, casting defects such as cold insulation will form in the casting-forging sample of semi-solid 6061 alloy with the prolongation of holding time.

  11. Semi-solid high pressure die casting of metal matrix composites produced by liquid state processing

    CSIR Research Space (South Africa)

    Ivanchev, L

    2012-10-01

    Full Text Available stirring. The composite was then transferred to a High Pressure Die Casting (HPDC) machine in the semi-solid state. The micron size particles were found to be predominantly in the intergranular eutectic while the nano-particles were predominantly...

  12. Tribological properties of rice starch in liquid and semi-solid food model systems

    NARCIS (Netherlands)

    Liu, K.; Stieger, M.A.; Linden, van der E.; Velde, van de Fred

    2016-01-01

    This study investigated the tribological and rheological properties of liquid and semi-solid food model systems containing micro-granular rice starch. Native (uncooked) and gelatinized rice starch dispersions, o/w emulsions and emulsion-filled gelatin gels were studied as food model systems. Native

  13. Study on the rheoformability of semi-solid 7075 wrought aluminum alloy using seed process =

    Science.gov (United States)

    Zhao, Qinfu

    Semisolid metal forming is becoming more and more attractive in the foundry industry due to its low cost and easy operation to produce high quality near-net-shape components. Over the past years, semisolid forming technique is mainly applied on the casting aluminum alloys due to their superior castability because of low melting temperature and viscosity. In semisolid forming field, thixoforming has been majorly used which involves of reheating the billet into semisolid state followed by casting process. Rheocasting is a more economic semisolid processing compared to thixoforming, which the semisolid billet is produced directly from liquid phase. The SEED process is one of reliable rheocasting techniques to produce high quality semisolid billets. To produce high quality semisolid billets, their unique rheological properties have been the most important issue need to be fully investigated. The aim of present project is to produce high quality semisolid AA7075 billets by SEED process and analyze their rheological properties under various process conditions. The effect of the SEED processing parameters and grain refiners on the semisolid microstructure and rheoformability were investigated. The deformation and rheological behavior of the semisolid billets of AA7075 base and its grain-refined alloys were studied using parallel-plate viscometer. In the first part, the evolution of liquid fraction to temperature of semisolid AA7075 alloy was investigated using Differential Scanning Calorimetry (DSC). It was found that the liquidus and solidus temperature of AA7075 alloy were 631 °C and 490°C respectively. And the corresponding temperatures of solid fraction of 40% and 60% were 622°C and 610°C, which was recognized as the temperature window for semisolid forming of this alloy. In the second part, the semisolid slurries were rheocasted using SEED technology and the effect of the SEED process parameters like swirling frequency and demolding temperature on evolution of

  14. The effect of saliva composition on texture perception of semi-solids

    NARCIS (Netherlands)

    Engelen, L.; Keybus, P.A.M. van den; Wijk, R.A. de; Veerman, E.C.I.; Amerongen, A.V.N.; Bosman, F.; Prinz, J.F.; Bilt, A. van der

    2007-01-01

    Saliva is expected to be of significance for the perception of food stimuli in the mouth. Mixing the food with saliva, including breakdown and dilution, is considered to be of large importance for semi-solids as these products are masticated without chewing. It is known that there are large

  15. Instrumental and sensory quantification of oral coatings retained after swallowing semi-solid foods

    NARCIS (Netherlands)

    Prinz, J.F.; Huntjens, L.; Wijk, de R.A.

    2006-01-01

    After a mouthful of food has been swallowed, some food material is always retained in the mouth. With semi-solid foods this is in the form of a coating that adheres to the oral mucosa. The amount and location of this material may play an important role in food sensations. In this study two

  16. Simulation and experimental verification of the filling process of semi-solid die forging for cup shell

    Directory of Open Access Journals (Sweden)

    Jianbo TAN

    2015-06-01

    Full Text Available The filling mold process of semi-solid alloy blank influences severely the forming and properties of finished piece. In this paper, DEFORM is applied to simulate the process of cup-type 6061 alloy die forging casting. The influences of the temperature of semi-solid alloy blank, preheating temperature, and downward press speed of pressure head on process of mold filling and velocity field are investigated. The results show that the mold filling of semi-solid alloy paste smoothly fills along the whole of mould cavity in “total wall thickness” form when the temperature of semi-solid alloy blank is 620 ℃, preheating temperature of pressure head is 200 ℃ and speed of pressure head is 40 mm/s. Along with the increase of the preheating temperature of pressure head, the filling process of the semi-solid alloy paste trends toward stable when the temperature of semi-solid alloy blank is 620 ℃ and the speed of pressure head is 20 mm/s. Along with the increasing of the temperature of semi-solid alloy, the process of mould filling becomes off balance and the liquid becomes turbulent flow. The velocity field in the process of mould filling affects severely the structure uniformity of the finished product.

  17. Optimization of Casting Design Parameters on Fabrication of Reliable Semi-Solid Aluminum Suspension Control Arm

    Science.gov (United States)

    Ragab, Kh. A.; Bouaicha, A.; Bouazara, M.

    2017-09-01

    The semi-solid casting process has the advantage of providing reliable mechanical aluminum parts that work continuously in dynamic as control arm of the suspension system in automotive vehicles. The quality performance of dynamic control arm is related to casting mold and gating system designs that affect the fluidity of semi-solid metal during filling the mold. Therefore, this study focuses on improvement in mechanical performance, depending on material characterization, and casting design optimization, of suspension control arms made of A357 aluminum semi-solid alloys. Mechanical and design analyses, applied on the suspension arm, showed the occurrence of mechanical failures at unexpected weak points. Metallurgical analysis showed that the main reason lies in the difficult flow of semi-solid paste through the thin thicknesses of a complex geometry. A design modification procedure is applied to the geometry of the suspension arm to avoid this problem and to improve its quality performance. The design modification of parts was carried out by using SolidWorks design software, evaluation of constraints with ABAQUS, and simulation of flow with ProCast software. The proposed designs showed that the modified suspension arm, without ribs and with a central canvas designed as Z, is considered as a perfect casting design showing an increase in the structural strength of the component. In this case, maximum von Mises stress is 199 MPa that is below the yield strength of the material. The modified casting mold design shows a high uniformity and minim turbulence of molten metal flow during semi-solid casting process.

  18. Gastric Emptying of Elemental Liquid Diets Versus Semisolid Diets in Bedridden Gastrostomy-fed Patients.

    Science.gov (United States)

    Horiuchi, Akira; Sakai, Ryosei; Tamaki, Michio; Kajiyama, Masashi; Tanaka, Naoki; Morikawa, Akio

    2018-03-21

    Aspiration is a common problem in bedridden gastrostomy-fed patients. We compared gastric emptying of an elemental liquid diet and a commercial semisolid diet in bedridden gastrostomy-fed patients. Study 1: from January 2013 to December 2016, consecutive bedridden patients receiving percutaneous endoscopic gastrostomy (PEG) semisolid feeding hospitalized due to aspiration pneumonia were switched to elemental liquid diet feedings. The frequency of defecation, tube feed contents aspirated from the trachea, and aspiration pneumonia during hospitalization were retrospectively reviewed. Study 2 was a randomized, crossover trial comparing C sodium acetate gastric emptying of a commercial elemental liquid or a commercial semisolid diet in bedridden PEG patients and controls. Study 1: 18 patients were enrolled. Elemental liquid diet was aspirated from the trachea in 1 (5.6%) (once in 24 observations); neither aspiration pneumonia nor diarrhea developed during elemental liquid diet feeding over 2 weeks observation. Study 2: 8 PEG patients and 8 healthy subjects were separately randomized to assess gastric emptying of the commercial elemental and semisolid diets. The elemental liquid diet was associated with a significant decrease of the 10%, 30%, or 50% emptying (excretion) time (Pbedridden PEG patients. They may prevent or reduce aspiration pneumonia compared with semisolid diets.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0/.

  19. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  20. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  1. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  2. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  3. Simulation and experimental verification of the filling process of semi-solid die forging for cup shell

    OpenAIRE

    Jianbo TAN; Zichao WANG; Dongxu WANG

    2015-01-01

    The filling mold process of semi-solid alloy blank influences severely the forming and properties of finished piece. In this paper, DEFORM is applied to simulate the process of cup-type 6061 alloy die forging casting. The influences of the temperature of semi-solid alloy blank, preheating temperature, and downward press speed of pressure head on process of mold filling and velocity field are investigated. The results show that the mold filling of semi-solid alloy paste smoothly fills along th...

  4. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  5. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation

    DEFF Research Database (Denmark)

    Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf

    2002-01-01

    trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...

  6. Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes

    Science.gov (United States)

    Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametes pubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

  7. Method of pyrolytic decomposition and coking of a mixture of finely distributed solid or semisolid carbonaceous material and hydrocarbon oils

    Energy Technology Data Exchange (ETDEWEB)

    1933-09-09

    A method of pyrolytic decomposition and coking of a mixture of finely distributed of solid or semi-solid carbonaceous material and hydrocarbon oils is disclosed whereby the mixture is exposed to a decomposition temperature and later is brought into the zone of decomposition where vapors are separated from the unvaporized residue and the vapors are exposed to fractional condensation for the purpose of obtaining a light product of distillation. The method is characterized by the mixture being exposed to heating by means of indirect exchange of heat in a heating zone or by means of a direct addition of a hot heat-conducting medium, or by means of both the mentioned indirect exchange of heat and direct heat under such conditions that the unvaporized residue obtained from the thus-heated mixture in the decomposition zone is transformed to solid coke in this zone by being heated to coking temperature in a comparatively thin layer on the surface of the decomposition zone that has been heated to a high temperature.

  8. Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.

    Science.gov (United States)

    Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.

  9. Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.

    Directory of Open Access Journals (Sweden)

    Juan C Gonzalez

    Full Text Available Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM, and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1 and 60 kDa (Lac2. Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1 of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.

  10. Development of magnesium semi-solid injection molding; Magnesium han`yoyu shashutsu seikei gijutsu no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, K; Sakate, N; Ishida, K; Yamamoto, Y; Nishimura, K [Mazda Motor Corp., Hiroshima (Japan)

    1997-10-01

    Magnesium semi-solid injection molding is safety and clean process. We have investigated influence of molding conditions on mechanical properties and dimension accuracy of products by semi-solid injection molding. As a result it was proved that the accuracy of products by this process is superior to die casting. This advantage as well as better mechanical properties can be utilized for net shape molding of some automobile parts. 4 refs., 8 figs., 3 tabs.

  11. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  12. Particle and liquid motion in semi-solid aluminium alloys: A quantitative in situ microradioscopy study

    International Nuclear Information System (INIS)

    Zabler, S.; Ershov, A.; Rack, A.; Garcia-Moreno, F.; Baumbach, T.; Banhart, J.

    2013-01-01

    Semi-solid melts exhibit a very unpredictable rheology and filling dynamics, when injected into thin-walled components. Optimization of the process requires an insight into the casting process during injection. For this purpose we injected semi-solid an Al–Ge alloy into two different thin channel geometries while recording high resolution radiographs at fast frame rates (up to 1000 images per s). Comparison of a bottleneck channel, which has previously been used for slower experiments, with a right-angle turn geometry reveals a significant influence of the channel shape on the flow behaviour of the particle–liquid mixture. While the bottleneck is quickly sealed with densified solid, turbulences in the right-angle turn apparently permit solid particles and clusters to move conjointly with the liquid and thus achieve a more complete filling. Single particle trajectories and rapid break-up of solid skeletons in such a system have been observed for the first time in situ

  13. Asymmetric battery having a semi-solid cathode and high energy density anode

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Taison; Chiang, Yet-Ming; Ota, Naoki; Wilder, Throop; Duduta, Mihai

    2017-11-28

    Embodiments described herein relate generally to devices, systems and methods of producing high energy density batteries having a semi-solid cathode that is thicker than the anode. An electrochemical cell can include a positive electrode current collector, a negative electrode current collector and an ion-permeable membrane disposed between the positive electrode current collector and the negative electrode current collector. The ion-permeable membrane is spaced a first distance from the positive electrode current collector and at least partially defines a positive electroactive zone. The ion-permeable membrane is spaced a second distance from the negative electrode current collector and at least partially defines a negative electroactive zone. The second distance is less than the first distance. A semi-solid cathode that includes a suspension of an active material and a conductive material in a non-aqueous liquid electrolyte is disposed in the positive electroactive zone, and an anode is disposed in the negative electroactive zone.

  14. Rheology of StelliteTM 21 Alloy in Semi-Solid State

    Directory of Open Access Journals (Sweden)

    Sołek K.

    2016-12-01

    Full Text Available The main objective of this study was to conduct an analysis of the rheological properties of StelliteTM 21 alloy in the semi-solid state, as the results could be used for identifying the appropriate temperature range for thixoforming of this alloy, and a secondary objective of the experimental work was the development of mathematical model of the alloy’s apparent viscosity. Such viscosity models are necessary for numerical simulations of the thixoforming processes. The StelliteTM 21 alloy exhibits high hardness and thus shaping in the semi-solid state is promising route of production of parts from this alloy. Within the confines of experimental work the measurement methods of the rheological properties at high temperatures was developed. They are based on the use of specially designed viscometer equipped with high temperature furnace.

  15. Rheological behavior of semi-solid 7075 aluminum alloy at steady state

    Directory of Open Access Journals (Sweden)

    Li Yageng

    2014-03-01

    Full Text Available The further application of semi-solid processing lies in the in-depth fundamental study like rheological behavior. In this research, the apparent viscosity of the semi-solid slurry of 7075 alloy was measured using a Couette type viscometer. The effects of solid fraction and shearing rate on the apparent viscosity of this alloy were investigated under different processing conditions. It can be seen that the apparent viscosity increases with an increase in the solid fraction from 10% to 50% (temperature 620 篊 to 630 篊 at steady state. When the solid fraction was fixed, the apparent viscosity can be decreased by altering the shearing rate from 61.235 s-1 to 489.88 s-1 at steady state. An empirical equation that shows the effects of solid fraction and shearing rate on the apparent viscosity is fitted. The microstructure of quenched samples was examined to understand the alloy抯 rheological behavior.

  16. Semi-Solid and Solid Dosage Forms for the Delivery of Phage Therapy to Epithelia

    Science.gov (United States)

    Petrovski, Steve; Chan, Hiu Tat; Angove, Michael J.; Tucci, Joseph

    2018-01-01

    The delivery of phages to epithelial surfaces for therapeutic outcomes is a realistic proposal, and indeed one which is being currently tested in clinical trials. This paper reviews some of the known research on formulation of phages into semi-solid dosage forms such as creams, ointments and pastes, as well as solid dosage forms such as troches (or lozenges and pastilles) and suppositories/pessaries, for delivery to the epithelia. The efficacy and stability of these phage formulations is discussed, with a focus on selection of optimal semi-solid bases for phage delivery. Issues such as the need for standardisation of techniques for formulation as well as for assessment of efficacy are highlighted. These are important when trying to compare results from a range of experiments and across different delivery bases. PMID:29495355

  17. Semi-solid dosage form of clonazepam for rapid oral mucosal absorption.

    Science.gov (United States)

    Sakata, Osamu; Machida, Yoshiharu; Onishi, Hiraku

    2011-07-01

    In order to obtain an alternative to the intravenous (i.v.) dosage form of clonazepam (CZ), an oral droplet formulation of CZ was developed previously; however, the droplet was physically unstable. Therefore, in the present study, it was attempted to develop an easily-handled dosage form, which was more physically stable and allowed rapid drug absorption from oral mucosa. A semi-solid dosage form, composed of polyethylene glycol 1500 (PEG), CZ, and oleic acid (OA) at 37/1/2 (w/w) and named PEG/CZ/OA, and a semi-solid dosage form containing PEG and CZ at 39/1 (w/w), called PEG/CZ, were prepared. Their physical stability in air at room temperature and oral mucosal absorption in rats were investigated. The semi-solid dosage forms were much more stable physically than the droplet, that is, no recrystallization of CZ was observed for at least 8 days. The effective concentration for humans and rats (20 ng/mL or more) was achieved within 30 min after buccal administration for both PEG/CZ/OA and PEG/CZ. The plasma concentration increased gradually and less varied at each time point for PEG/CZ/OA. PEG/CZ/OA was found to show more rapid and higher absorption of CZ in buccal administration than in sublingual administration. Buccal administration with the semi-solid dosage PEG/CZ with or without OA was suggested to be a possibly useful novel dosage form as an alternative to i.v. injection.

  18. Study on the Microstructure and Liquid Phase Formation in a Semisolid Gray Cast Iron

    Science.gov (United States)

    Benati, Davi Munhoz; Ito, Kazuhiro; Kohama, Kazuyuki; Yamamoto, Hajime; Zoqui, Eugenio José

    2017-10-01

    The development of high-quality semisolid raw materials requires an understanding of the phase transformations that occur as the material is heated up to the semisolid state, i.e., its melting behavior. The microstructure of the material plays a very important role during semisolid processing as it determines the flow behavior of the material when it is formed, making a thorough understanding of the microstructural evolution essential. In this study, the phase transformations and microstructural evolution in Fe2.5C1.5Si gray cast iron specially designed for thixoforming processes as it was heated to the semisolid state were observed using in situ high-temperature confocal laser scanning microscopy. At room temperature, the alloy has a matrix of pearlite and ferrite with fine interdendritic type D flake graphite. During heating, the main transformations observed were graphite precipitation inside the grains and at the austenite grain boundaries; graphite flakes and graphite precipitates growing and becoming coarser with the increasing temperature; and the beginning of melting at around 1413 K to 1423 K (1140 °C to 1150 °C). Melting begins with the eutectic phase ( i.e., the carbon-rich phase) and continues with the primary phase (primary austenite), which is consumed as the temperature increases. Melting of the eutectic phase composed by coarsened interdendritic graphite flakes produced a semi-continuous liquid network homogeneously surrounding and wetting the dendrites of the solid phase, causing grains to detach from each other and producing the intended solid globules immersed in liquid.

  19. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  20. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  1. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  2. Tailorable Burning Behavior of Ti14 Alloy by Controlling Semi-Solid Forging Temperature.

    Science.gov (United States)

    Chen, Yongnan; Yang, Wenqing; Zhan, Haifei; Zhang, Fengying; Huo, Yazhou; Zhao, Yongqing; Song, Xuding; Gu, Yuantong

    2016-08-16

    Semi-solid processing (SSP) is a popular near-net-shape forming technology for metals, while its application is still limited in titanium alloy mainly due to its low formability. Recent works showed that SSP could effectively enhance the formability and mechanical properties of titanium alloys. The processing parameters such as temperature and forging rate/ratio, are directly correlated with the microstructure, which endow the alloy with different chemical and physical properties. Specifically, as a key structural material for the advanced aero-engine, the burn resistant performance is a crucial requirement for the burn resistant titanium alloy. Thus, this work aims to assess the burning behavior of Ti14, a kind of burn resistant alloy, as forged at different semi-solid forging temperatures. The burning characteristics of the alloy are analyzed by a series of burning tests with different burning durations, velocities, and microstructures of burned sample. The results showed that the burning process is highly dependent on the forging temperature, due to the fact that higher temperatures would result in more Ti₂Cu precipitate within grain and along grain boundaries. Such a microstructure hinders the transport of oxygen in the stable burning stage through the formation of a kind of oxygen isolation Cu-enriched layer under the burn product zone. This work suggests that the burning resistance of the alloy can be effectively tuned by controlling the temperature during the semi-solid forging process.

  3. Semi-solid metal forming of beryllium-reinforced aluminum alloys

    International Nuclear Information System (INIS)

    Haws, W.; Lane, L.; Marder, J.; Nicholas, N.

    1995-01-01

    A Powder Metallurgy (PM) based, Semi-Solid Metal (SSM) forming process has been developed to produce low cost near-net shapes of beryllium-reinforced aluminum alloys. Beryllium acts as a reinforcing additive to the aluminum, in which there is nearly no mutual solid solubility. The modulus of elasticity of the alloy dramatically increases, while the density and thermal expansion coefficient decrease with increasing beryllium content. The material is suitable for complex thermal management and vibration resistance applications, as well as for airborne components which are density and stiffness sensitive. The forming process involves heating a blank of the material to a temperature at which the aluminum is semi-solid and the beryllium is solid. The semi-solid blank is then injected without turbulence into a permanent mold. High quality, near net shape components can be produced which are functionally superior to those produced by other permanent mold processes. Dimensional accuracy is equivalent to or better than that obtained in high pressure die casting. Cost effectiveness is the primary advantage of this technique compared to other forming processes. The advantages and limitations of the process are described. Physical and mechanical property data are presented, as well as directions for future investigation

  4. Chemical ageing and transformation of diffusivity in semi-solid multi-component organic aerosol particles

    Directory of Open Access Journals (Sweden)

    C. Pfrang

    2011-07-01

    Full Text Available Recent experimental evidence underlines the importance of reduced diffusivity in amorphous semi-solid or glassy atmospheric aerosols. This paper investigates the impact of diffusivity on the ageing of multi-component reactive organic particles approximating atmospheric cooking aerosols. We apply and extend the recently developed KM-SUB model in a study of a 12-component mixture containing oleic and palmitoleic acids. We demonstrate that changes in the diffusivity may explain the evolution of chemical loss rates in ageing semi-solid particles, and we resolve surface and bulk processes under transient reaction conditions considering diffusivities altered by oligomerisation. This new model treatment allows prediction of the ageing of mixed organic multi-component aerosols over atmospherically relevant timescales and conditions. We illustrate the impact of changing diffusivity on the chemical half-life of reactive components in semi-solid particles, and we demonstrate how solidification and crust formation at the particle surface can affect the chemical transformation of organic aerosols.

  5. Characterization of semi-solid processing of aluminium alloy 7075 with Sc and Zr additions

    Energy Technology Data Exchange (ETDEWEB)

    Rogal, Ł., E-mail: l.rogal@imim.pl [Institute of Metallurgy and Materials Science of the Polish Academy of Sciences, 25 Reymonta St., 30-059 Krakow (Poland); Dutkiewicz, J. [Institute of Metallurgy and Materials Science of the Polish Academy of Sciences, 25 Reymonta St., 30-059 Krakow (Poland); Atkinson, H.V. [The University of Leicester, Department of Engineering University Road, Leicester, LE1 7RH (United Kingdom); Lityńska-Dobrzyńska, L.; Czeppe, T. [Institute of Metallurgy and Materials Science of the Polish Academy of Sciences, 25 Reymonta St., 30-059 Krakow (Poland); Modigell, M. [RWTH Aachen—Department of Mechanical Process Engineering, 55 Templergraben St., Aachen (Germany)

    2013-09-15

    For thixoforming (semi-solid processing) it is necessary to have a fine globular microstructure in a semi-solid range. Here this has been obtained for 7075 aluminium alloy by addition of modifying agents: 0.5 weight % of scandium and zirconium. The thixoforming process was carried out at 632 °C which gave about 23 volume % of liquid phase. The microstructure of the thixo-formed part (a rotor) consisted of globular grains surrounded by precipitates of secondary phase. The average hardness of thixo-formed parts was 105 HV{sub 5} and the tensile strength 300 MPa. T6 heat treatments were performed with solutionisation at 450 °C for 30 min and 10 h. In both cases the ageing time was set as 18 h at 120 °C. The heat treatments led to an increase in average tensile strength up to 495 MPa. Transmission Electron Microscopy (TEM) analysis enabled the identification of precipitates of the metastable dispersoids of L1{sub 2}–Al{sub 3} (Zr, Sc) and η′ (MgZn{sub 2}) phases in the alloy after the thixoforming and T6 treatment. The measurements of rheological properties of 7075Al alloy with Sc and Zr additions in the semi-solid range indicated an increase of particle size and spheroidization leading to an observable decrease of viscosity during isothermal shearing. A shear rate jump experiment showed that with increasing shear rate the viscosity rapidly falls.

  6. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  7. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  8. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  10. Isolation of nontuberculous mycobacteria from soil using Middlebrook 7H10 agar with increased malachite green concentration.

    Science.gov (United States)

    Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican

    2017-12-01

    Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.

  11. Hygroscopic influence on the semisolid-to-liquid transition of secondary organic materials.

    Science.gov (United States)

    Bateman, Adam P; Bertram, Allan K; Martin, Scot T

    2015-05-14

    The effect of relative humidity (RH) on the rebound of particles composed of isoprene, α-pinene, and toluene secondary organic materials (SOMs) was studied. A three-arm impaction apparatus was used to study rebound from 5 to 95% RH at 298 K. Calibration experiments using sucrose particles of variable but known viscosities showed that the transition from rebounding to adhering particles occurred for a change in viscosity from 100 to 1 Pa s, corresponding to a transition from semisolid to liquid material. The experimentally determined rebound fractions of the studied SOMs were compared with results from a model of the rebound processes of hard particles, taking into account the particle kinetic energy, van der Waals forces, and RH-dependent capillary forces. For low RH values, the hard-particle model explained the diameter-dependent rebound behavior for all studied SOMs. For elevated RH, however, the experimental observations deviated from the model predictions. On the basis of the calibration experiments using sucrose particles as well as a comparison between the observations and the predictions of the hard-particle model, the interpretation is made that a semisolid-to-liquid transition occurred at elevated RH. Material softening, increased adhesion, or a combination of the two implied the action of additional modes of energy relaxation that were not included in the hard-particle model. The RH threshold for the semisolid-to-liquid phase transition was 40% RH for isoprene SOM, 70% for toluene SOM, and 70% for α-pinene SOM. A correlation between the rebound fraction and the hygroscopic growth factor G was demonstrated, implying that absorbed water volume was a dominant governing factor of the semisolid-to-liquid transition for the studied classes of SOM. Simple heuristic rules based on G of 1.15 for the semisolid-to-liquid phase transition could be used for prognostication of the SOM phase in modeling applications at 298 K. With respect to atmospheric processes, the

  12. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  13. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  14. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  15. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  16. Research on Candida dubliniensis in a Brazilian yeast collection obtained from cardiac transplant, tuberculosis, and HIV-positive patients, and evaluation of phenotypic tests using agar screening methods.

    Science.gov (United States)

    Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso

    2011-09-01

    The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 °C; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 °C. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  18. An automatic granular structure generation and finite element analysis of heterogeneous semi-solid materials

    International Nuclear Information System (INIS)

    Sharifi, Hamid; Larouche, Daniel

    2015-01-01

    The quality of cast metal products depends on the capacity of the semi-solid metal to sustain the stresses generated during the casting. Predicting the evolution of these stresses with accuracy in the solidification interval should be highly helpful to avoid the formation of defects like hot tearing. This task is however very difficult because of the heterogeneous nature of the material. In this paper, we propose to evaluate the mechanical behaviour of a metal during solidification using a mesh generation technique of the heterogeneous semi-solid material for a finite element analysis at the microscopic level. This task is done on a two-dimensional (2D) domain in which the granular structure of the solid phase is generated surrounded by an intergranular and interdendritc liquid phase. Some basic solid grains are first constructed and projected in the 2D domain with random orientations and scale factors. Depending on their orientation, the basic grains are combined to produce larger grains or separated by a liquid film. Different basic grain shapes can produce different granular structures of the mushy zone. As a result, using this automatic grain generation procedure, we can investigate the effect of grain shapes and sizes on the thermo-mechanical behaviour of the semi-solid material. The granular models are automatically converted to the finite element meshes. The solid grains and the liquid phase are meshed properly using quadrilateral elements. This method has been used to simulate the microstructure of a binary aluminium–copper alloy (Al–5.8 wt% Cu) when the fraction solid is 0.92. Using the finite element method and the Mie–Grüneisen equation of state for the liquid phase, the transient mechanical behaviour of the mushy zone under tensile loading has been investigated. The stress distribution and the bridges, which are formed during the tensile loading, have been detected. (paper)

  19. Semi-solid A356 alloy slurry for rheocasting prepared by a new process

    Directory of Open Access Journals (Sweden)

    Liu Zheng

    2013-05-01

    Full Text Available To obtain the semi-solid slurry with uniform and fine structure morphology that satisfies the requirement of rheocasting process, a new process for preparing semi-solid Al alloy slurry was developed, in which local chilling was combined with low superheat pouring and slight electromagnetic stirring (LSPSEMS. The morphology and the size of primary α-Al in the A356 alloy slurry prepared with the new process, i.e., LSPSEMS with local chilling, were investigated using MIAPS image analyzing software, and the grain refinement mechanism was discussed. The results indicate that the semi-solid primary phase consists of particle-like or globular-like α-Al, and the morphology and grain size of primary α-Al in the slurry can be markedly improved by the new process. The fine primary α-Al distributes uniformly in the slurry, which satisfies the requirement of rheocasting. Compared with the alloy prepared by LSPSEMS, the average equal-area-circle grain diameter of primary α-Al in semi-solid A356 alloy ingot prepared by the new process is decreased from 85.6 μm to 68.8 μm at the central area, 112.6 μm to 77.6 μm at the transition area and is 84.7 μm in the edge area, respectively. The corresponding shape factor of primary α-Al is increased from 0.78 to 0.83, 0.54 to 0.77 and 0.28 to 0.59, respectively. In addition, the pouring temperature could be suitably raised from 620-630 ℃ of the traditional process to 650 ℃ using this technique, which is convenient for practical operation. The mechanism of grain refinement, in the new process, is that the local chilling quickens up the temperature decrease in the center of the melt. The nuclei could not grow up in a short time so the finer grains are formed in the melt.

  20. Semisolid matrix-filled hard gelatin capsules for rapid dissolution of amlodipine besilate: Development and assessment

    Directory of Open Access Journals (Sweden)

    Vijay K Tyagi

    2013-01-01

    Full Text Available The objective of the study was to prepare semisolid capsules (SSCs of poorly water-soluble drug amlodipine besilate (AB using a combination of technologies involving solid dispersion (SD preparation and converting it into semisolid matrix filled in hard gelatin capsules (termed as SSCs with the aim of reducing lag time in drug release and to improve the dissolution rate. AB is used for its anti-arrhythmic, anti-anginal, and anti-hypertensive activity. These are the emergency activities which should be treated as fast as possible like in the case of angina attack (heart attack. Any lag time that is generated due to its poor dissolution can add on in this emergency and that can be avoided by developing a readily dissolvable formulation: SDs of AB. SD of AB was prepared by fusion method using varying combinations of Poloxamer 407 and Plasdone S630. A total of nine batches (SD1−SD9 were characterized for the in vitro dissolution behavior in phosphate buffer pH7.4. SD8 with 95.8% cumulative drug release in 60 min, t50% = 4.1 min and DE 30 Min = 84.2% were selected for the development of the semisolid matrix. Differential scanning calorimetry of SD8 revealed molecular dispersion of AB and Plasdone S630 in Poloxamer 407. SD8 was then formulated as SSCs using gelucire 44/14 and PEG 400 as semisolid components and PEG 6000 as a suspending agent to achieve the reduction in lag time for drug release. A total of seven SSC formulations were prepared and evaluated for drug release. Formulation of SSC4 showed maximum cumulative drug release (CDR of 98.9% within 20 min that was almost a threefold reduction in the time required to achieve similar CDR by SD of AB. Thus, SSCs present an excellent approach to enhance the dissolution as well as to reduce the lag time of dissolution for poor water-soluble drugs especially to those therapeutic classes that are intended for faster onset of action.

  1. Direct observation of grain rotations during coarsening of a semisolid Al-Cu alloy

    DEFF Research Database (Denmark)

    Dake, Jules M.; Oddershede, Jette; Sørensen, Henning O.

    2016-01-01

    ideal arrangements of constituent powders while ignoring their underlying crystallinity, achieve at best a qualitative description of the rearrangement, densification, and coarsening of powder compacts during thermal processing. Treating a semisolid Al-Cu alloy as a model system for late-stage sintering......Sintering is a key technology for processing ceramic and metallic powders into solid objects of complex geometry, particularly in the burgeoning field of energy storage materials. The modeling of sintering processes, however, has not kept pace with applications. Conventional models, which assume...

  2. Liquid Segregation Phenomenological Behaviors of Ti14 Alloy during Semisolid Deformation

    Directory of Open Access Journals (Sweden)

    Y. N. Chen

    2014-05-01

    Full Text Available The liquid segregation phenomenon and its effect on deformation mechanism of Ti14 alloy in semisolid metal processing were investigated by thermal simulation test. Microstructure of depth profile was determined by cross-section quantitative metallography, and liquid segregation phenomenon was described by Darcy's law. The results show that segregation phenomenon was affected by solid fraction, strain rate, and deformation rate. More liquid segregated from center to edge portion with high strain rate and/or deformation ratio as well as low solid fraction, which caused different distribution of dominating deformation mechanism. The relationship between liquid segregation and main deformation mechanism was also discussed by phenomenological model.

  3. Optimisation de la fermentation en milieu semi-solide pour la ...

    African Journals Online (AJOL)

    Objectif : Evaluer trois équipements pour la fermentation de la pâte destinée à préparer l'ablo (pâte cuite à la vapeur) puis, l'influence de la température, de la durée de fermentation et du taux de levure ajoutée à la pâte. Méthodologie et résultats : La pâte semi-solide a été fermentée durant quatre heures à température ...

  4. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  5. Predicting the constitutive behavior of semi-solids via a direct finite element simulation: application to AA5182

    Science.gov (United States)

    Phillion, A. B.; Cockcroft, S. L.; Lee, P. D.

    2009-07-01

    The methodology of direct finite element (FE) simulation was used to predict the semi-solid constitutive behavior of an industrially important aluminum-magnesium alloy, AA5182. Model microstructures were generated that detail key features of the as-cast semi-solid: equiaxed-globular grains of random size and shape, interconnected liquid films, and pores at the triple-junctions. Based on the results of over fifty different simulations, a model-based constitutive relationship which includes the effects of the key microstructure features—fraction solid, grain size and fraction porosity—was derived using regression analysis. This novel constitutive equation was then validated via comparison with both the FE simulations and experimental stress/strain data. Such an equation can now be used to incorporate the effects of microstructure on the bulk semi-solid flow stress within a macro- scale process model.

  6. Predicting the constitutive behavior of semi-solids via a direct finite element simulation: application to AA5182

    International Nuclear Information System (INIS)

    Phillion, A B; Cockcroft, S L; Lee, P D

    2009-01-01

    The methodology of direct finite element (FE) simulation was used to predict the semi-solid constitutive behavior of an industrially important aluminum-magnesium alloy, AA5182. Model microstructures were generated that detail key features of the as-cast semi-solid: equiaxed-globular grains of random size and shape, interconnected liquid films, and pores at the triple-junctions. Based on the results of over fifty different simulations, a model-based constitutive relationship which includes the effects of the key microstructure features—fraction solid, grain size and fraction porosity—was derived using regression analysis. This novel constitutive equation was then validated via comparison with both the FE simulations and experimental stress/strain data. Such an equation can now be used to incorporate the effects of microstructure on the bulk semi-solid flow stress within a macro- scale process model

  7. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  8. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  9. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  10. Microstructural evolution and thixoformability of semi-solid aluminum 319s alloy during re-melting

    International Nuclear Information System (INIS)

    Hu, X.G.; Zhu, Q.; Lu, H.X.; Zhang, F.; Li, D.Q.; Midson, S.P.

    2015-01-01

    The aim of this paper is to characterize both microstructural evolution and thixoformability during partial melting of semi-solid 319s alloy. The thixoformability criteria of 319s was initially investigated by thermodynamic analysis. In-situ observation of partial re-melting was performed by a Confocal Laser Scanning Microscope to determine the effect of heating rate on melting characteristics. Meanwhile, the microstructural evolution of 319s alloy at extremely low heating rate was also investigated in order to understand the mechanism of re-melting process. The studies demonstrated that 319s alloy is suitable for thixocasting because of the controllable liquid fraction in the operating window of 15 °C. The process window was effected by both temperature and heating time. The primary particles evolution in 319s alloy can be divided into four stages, and the coarsening rate during isothermal test is 227 μm 3 /s. The effective method to obtain desirable microstructure is to manage the time in the semi-solid state by controlling heating rate and soaking time. - Highlights: • The thixoformability of 319s is discussed by using SPSC and thermodynamic analysis. • The re-melting processes at different heating rate are in-situ observed. • We identified the four stages of microstructural evolution during re-melting. • The coarsening rate K for 319s during isothermal test is identified. • The variation tendency of Si particle size with increasing time is reported

  11. Semi-solid twin-roll casting process of magnesium alloy sheets

    International Nuclear Information System (INIS)

    Watari, H.; Davey, K.; Rasgado, M.T. Alonso; Haga, T.; Koga, N.

    2004-01-01

    An experimental approach has been performed to ascertain the effectiveness of semi-solid strip casting using a horizontal twin roll caster. The demand for light-weight products with high strength has grown recently due to the rapid development of automobile and aircraft technology. One key to such development has been utilization of magnesium alloys, which can potentially reduce the total product weight. However, the problems of utilizing magnesium alloys are still mainly related to high manufacturing cost. One of the solutions to this problem is to develop magnesium casting-rolling technology in order to produce magnesium sheet products at competitive cost for commercial applications. In this experiment, magnesium alloy AZ31B was used to ascertain the effectiveness of semi-solid roll strip casting for producing magnesium alloy sheets. The temperature of the molten magnesium, and the roll speeds of the upper and lower rolls, (which could be changed independently), were varied to find an appropriate manufacturing condition. Rolling and heat treatment conditions were changed to examine which condition would be appropriate for producing wrought magnesium alloys with good formability. Microscopic observation of the crystals of the manufactured wrought magnesium alloys was performed. It has been found that a limiting drawing ratio of 2.7 was possible in a warm deep drawing test of the cast magnesium alloy sheets after being hot rolled

  12. Semisolid slurry of 7A04 aluminum alloy prepared by electromagnetic stirring and Sc, Zr additions

    Directory of Open Access Journals (Sweden)

    Jun-wen Zhao

    2017-05-01

    Full Text Available Slurry preparation is one of the most critical steps for semisolid casting, and its primary goal is to prepare slurry with uniformly distributed fine globules. In this work, electromagnetic stirring (EMS and the addition of Sc and Zr elements were used to prepare semisolid slurry of 7A04 aluminum alloy in a large diameter slurry maker. The effects of different treatments on the microstructure, composition and their radial homogeneity were investigated. The results show that, compared to the slurry without any treatment, large volume slurry with finer and more uniform microstructure can be obtained when treated by EMS, Sc, or Zr additions individually. EMS is more competent in the microstructural and chemical homogenization of the slurry while Sc and Zr additions are more excellent in its microstructural refinement. The combined treatment of EMS, Sc and Zr produces premium 7A04 aluminum alloy slurry with uniformly distributed fine α-Al globules and composition. The interaction mechanism between EMS and Sc and Zr additions was also discussed.

  13. Microstructural evolution during DPRM process of semisolid ledeburitic D2 tool steel.

    Science.gov (United States)

    Mohammed, M N; Omar, M Z; Syarif, J; Sajuri, Z; Salleh, M S; Alhawari, K S

    2013-01-01

    Semisolid metal processing is a relatively new technology that offers several advantages over liquid processing and solid processing because of the unique behaviour and characteristic microstructure of metals in this state. With the aim of finding a minimum process chain for the manufacture of high-quality production at minimal cost for forming, the microstructural evolution of the ledeburitic AISI D2 tool steel in the semisolid state was studied experimentally. The potential of the direct partial remelting (DPRM) process for the production of AISI D2 with a uniform globular microstructure was revealed. The liquid fraction was determined using differential scanning calorimetry. The microstructures of the samples were investigated using an optical microscope and a scanning electron microscope equipped with an energy dispersive spectroscopy analyser, while X-ray phase analysis was performed to identify the phase evolution and the type of carbides. Mechanical characterisation was completed by hardness measurements. The typical microstructure after DPRM consists of metastable austenite which was located particularly in the globular grains (average grain size about 50 μ m), while the remaining interspaces were filled by precipitated eutectic carbides on the grain boundaries and lamellar network.

  14. Microstructural Evolution during DPRM Process of Semisolid Ledeburitic D2 Tool Steel

    Directory of Open Access Journals (Sweden)

    M. N. Mohammed

    2013-01-01

    Full Text Available Semisolid metal processing is a relatively new technology that offers several advantages over liquid processing and solid processing because of the unique behaviour and characteristic microstructure of metals in this state. With the aim of finding a minimum process chain for the manufacture of high-quality production at minimal cost for forming, the microstructural evolution of the ledeburitic AISI D2 tool steel in the semisolid state was studied experimentally. The potential of the direct partial remelting (DPRM process for the production of AISI D2 with a uniform globular microstructure was revealed. The liquid fraction was determined using differential scanning calorimetry. The microstructures of the samples were investigated using an optical microscope and a scanning electron microscope equipped with an energy dispersive spectroscopy analyser, while X-ray phase analysis was performed to identify the phase evolution and the type of carbides. Mechanical characterisation was completed by hardness measurements. The typical microstructure after DPRM consists of metastable austenite which was located particularly in the globular grains (average grain size about 50 μm, while the remaining interspaces were filled by precipitated eutectic carbides on the grain boundaries and lamellar network.

  15. Simulation of Semi-Solid Material Mechanical Behavior Using a Combined Discrete/Finite Element Method

    Science.gov (United States)

    Sistaninia, M.; Phillion, A. B.; Drezet, J.-M.; Rappaz, M.

    2011-01-01

    As a necessary step toward the quantitative prediction of hot tearing defects, a three-dimensional stress-strain simulation based on a combined finite element (FE)/discrete element method (DEM) has been developed that is capable of predicting the mechanical behavior of semisolid metallic alloys during solidification. The solidification model used for generating the initial solid-liquid structure is based on a Voronoi tessellation of randomly distributed nucleation centers and a solute diffusion model for each element of this tessellation. At a given fraction of solid, the deformation is then simulated with the solid grains being modeled using an elastoviscoplastic constitutive law, whereas the remaining liquid layers at grain boundaries are approximated by flexible connectors, each consisting of a spring element and a damper element acting in parallel. The model predictions have been validated against Al-Cu alloy experimental data from the literature. The results show that a combined FE/DEM approach is able to express the overall mechanical behavior of semisolid alloys at the macroscale based on the morphology of the grain structure. For the first time, the localization of strain in the intergranular regions is taken into account. Thus, this approach constitutes an indispensible step towards the development of a comprehensive model of hot tearing.

  16. Analysis of semi-solid processing for metal matrix composite synthesis using factorial design

    Directory of Open Access Journals (Sweden)

    Kratus Ranieri

    2012-02-01

    Full Text Available The main goal in this work is to conduct a quantitative analysis of the mechanical stir casting process for obtaining particulate metal matrix composites. A combined route of stirring at semi-solid state followed by stirring at liquid state is proposed. A fractional factorial design was developed to investigate the influence and interactions of factors as: time, rotation, initial fraction and particle size, on the incorporated fraction. The best incorporations were obtained with all factors at high levels, as well as that very long stirring periods have no strong influence being particle size and rotation the most important factors on the incorporated fraction. Particle wetting occurs during stirring at semi-solid state, highlighting the importance of the interactions between particles and the alloy globularized phase. The role of the alloying element Mg as a wettability-promoting agent is discussed. The shear forces resulting from the stirring system is emphasized and understood as the effect of rotation itself added to the propeller blade geometry.

  17. Modelling and optimization of semi-solid processing of 7075 Al alloy

    Science.gov (United States)

    Binesh, B.; Aghaie-Khafri, M.

    2017-09-01

    The new modified strain-induced melt activation (SIMA) process presented by Binesh and Aghaie-Khafri was optimized using a response surface methodology to improve the thixotropic characteristics of semi-solid 7075 alloy. The responses, namely the average grain size and the shape factor, were considered as functions of three independent input variables: effective strain, isothermal holding temperature and time. Mathematical models for the responses were developed using the regression analysis technique, and the adequacy of the models was validated by the analysis of variance method. The calculated results correlated fairly well with the experiments. It was found that all the first- and second-order terms of the independent parameters and the interactive terms of the effective strain and holding time were statistically significant for the responses. In order to simultaneously optimize the responses, the desirable values for the effective strain, holding temperature and time were predicted to be 5.1, 609 °C and 14 min, respectively, when employing the desirability function approach. Based on the optimization results, a significant improvement in the average grain size and shape factor of the semi-solid slurry prepared by the new modified SIMA process was observed.

  18. Microstructural Evolution during DPRM Process of Semisolid Ledeburitic D2 Tool Steel

    Science.gov (United States)

    Mohammed, M. N.; Omar, M. Z.; Syarif, J.; Sajuri, Z.; Salleh, M. S.; Alhawari, K. S.

    2013-01-01

    Semisolid metal processing is a relatively new technology that offers several advantages over liquid processing and solid processing because of the unique behaviour and characteristic microstructure of metals in this state. With the aim of finding a minimum process chain for the manufacture of high-quality production at minimal cost for forming, the microstructural evolution of the ledeburitic AISI D2 tool steel in the semisolid state was studied experimentally. The potential of the direct partial remelting (DPRM) process for the production of AISI D2 with a uniform globular microstructure was revealed. The liquid fraction was determined using differential scanning calorimetry. The microstructures of the samples were investigated using an optical microscope and a scanning electron microscope equipped with an energy dispersive spectroscopy analyser, while X-ray phase analysis was performed to identify the phase evolution and the type of carbides. Mechanical characterisation was completed by hardness measurements. The typical microstructure after DPRM consists of metastable austenite which was located particularly in the globular grains (average grain size about 50 μm), while the remaining interspaces were filled by precipitated eutectic carbides on the grain boundaries and lamellar network. PMID:24223510

  19. Gastric emptying time (GET) with Tc-99m-labeled semisolid meal in diabetic patients

    International Nuclear Information System (INIS)

    Tada, Akira; Koizumi, Kiyoshi; Aburano, Tamio; Bunko, Hisashi; Tonami, Norihisa

    1984-01-01

    Measurement of gastric emptying in diabetic gastroenteropathy is of interest because of the gastric atony that may produce signs and symptoms of visceral neuropathy. The purpose of this study is to present the result of GET measurements in diabetic patients. The correlation between GET and complications, fasting blood sugar (FBS), duration of disease, age, sex, and HbAlc was evaluated. Included in this study were 21 diabetic patients. Fourteen patients had diabetic complications such as peripheral neuropathy, autonomic neuropathy, nephropathy and retinopathy. Following an overnight fast, semisolid test meal mixed with 200 uCi of Tc-99m Sn-colloid was ingested by the patients. In nine normal volunteers, the GET range previously established by this method in our institution was from 47 to 78 minutes (mean 62.5 +- 7.7). In the patients with diabetic complication, particulary with triopathy, GET was significantly prolonged compared to those of normal subjects and diabetic patients without complication. On the contrary, four out of seven patients without complications, showed rapid emptying than normal subjects. This rapid emptying may reveal the early stage of pathophysiological change in diabetics. No correlation between GET and FBS, duration of disease, age, sex and HbAlc was seen. This test of radiolabeled semisolid meal was found to provide a convenient, safe and effective diagnostic tool to examine gastric emptying function in diabetic patients. (author)

  20. Gastric emptying time (GET) with Tc-99m-labeled semisolid meal in diabetic patients

    Energy Technology Data Exchange (ETDEWEB)

    Tada, Akira; Koizumi, Kiyoshi; Aburano, Tamio; Bunko, Hisashi; Tonami, Norihisa [Kanazawa Univ. (Japan). School of Medicine

    1984-01-01

    Measurement of gastric emptying in diabetic gastroenteropathy is of interest because of the gastric atony that may produce signs and symptoms of visceral neuropathy. The purpose of this study is to present the result of GET measurements in diabetic patients. The correlation between GET and complications, fasting blood sugar (FBS), duration of disease, age, sex, and HbAlc was evaluated. Included in this study were 21 diabetic patients. Fourteen patients had diabetic complications such as peripheral neuropathy, autonomic neuropathy, nephropathy and retinopathy. Following an overnight fast, semisolid test meal mixed with 200 uCi of Tc-99m Sn-colloid was ingested by the patients. In nine normal volunteers, the GET range previously established by this method in our institution was from 47 to 78 minutes (mean 62.5 +- 7.7). In the patients with diabetic complication, particulary with triopathy, GET was significantly prolonged compared to those of normal subjects and diabetic patients without complication. On the contrary, four out of seven patients without complications, showed rapid emptying than normal subjects. This rapid emptying may reveal the early stage of pathophysiological change in diabetics. No correlation between GET and FBS, duration of disease, age, sex and HbAlc was seen. This test of radiolabeled semisolid meal was found to provide a convenient, safe and effective diagnostic tool to examine gastric emptying function in diabetic patients.

  1. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    Science.gov (United States)

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  2. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  3. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  4. DEVELOPMENT AND EVALUATION OF A SELECTIVE AND INDICATIVE MEDIUM FOR ISOLATION OF ACTINOBACILLUS-PLEUROPNEUMONIAE FROM TONSILS

    DEFF Research Database (Denmark)

    Jakobsen, Marianne; Nielsen, Jens

    1995-01-01

    In order to isolate ActinobacillIus pleuropneumoniae from mixed bacterial flora a selective and indicative medium was developed. The optimal concentrations of antibiotics were determined for selective chocolate agar (S-TSA) and selective blood agar (S-MBA) using a set of 25 strains of A. pleuropn......In order to isolate ActinobacillIus pleuropneumoniae from mixed bacterial flora a selective and indicative medium was developed. The optimal concentrations of antibiotics were determined for selective chocolate agar (S-TSA) and selective blood agar (S-MBA) using a set of 25 strains of A...

  5. Influence of temper condition on microstructure and mechanical properties of semisolid metal processed Al–Si–Mg alloy A356

    CSIR Research Space (South Africa)

    Moller, H

    2009-01-01

    Full Text Available The microstructures and mechanical properties of strontium modified semisolid metal high pressure die cast A356 alloy are presented. The alloy A356-F (as cast) has a globular primary grain structure containing a fine eutectic. Solution treatment...

  6. A Microstructural Evaluation of Friction Stir Welded 7075 Aluminum Rolled Plate Heat Treated to the Semi-Solid State

    Directory of Open Access Journals (Sweden)

    Ava Azadi Chegeni

    2018-01-01

    Full Text Available Two rolled plates of 7075 aluminum alloy were used as starting material. The plates were welded using a simultaneous double-sided friction stir welding (FSW process. One way of obtaining feedstock materials for Semi-solid processing or thixoforming is via deformation routes followed by partial melting in the semi-solid state. As both the base plate materials and the friction weld area have undergone extensive deformation specimens were subjected to a post welding heat-treatment in the semi-solid range at a temperature of 628 °C, for 3 min in order to observe the induced microstructural changes. A comparison between the microstructural evolution and mechanical properties of friction stir welded plates was performed before and after the heat-treatment in the Base Metal (BM, the Heat Affected Zone (HAZ, the Thermomechanically Affected Zone (TMAZ and the Nugget Zone (NZ using optical microscopy, Scanning Electron microscopy (SEM and Vickers hardness tests. The results revealed that an extremely fine-grained structure, obtained in the NZ after FSW, resulted in a rise of hardness from the BM to the NZ. Furthermore, post welding heat-treatment in the semi-solid state gave rise to a consistent morphology throughout the material which was similar to microstructures obtained by the thixoforming process. Moreover, a drop of hardness was observed after heat treatment in all regions as compared to that in the welded microstructure.

  7. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  8. Performance of Chromogenic Candida agar and CHROMagar Candida in recovery and presumptive identification of monofungal and polyfungal vaginal isolates.

    Science.gov (United States)

    Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan

    2010-02-01

    Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.

  9. Fabrication of metal matrix composite by semi-solid powder processing

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yufeng [Iowa State Univ., Ames, IA (United States)

    2011-01-01

    Various metal matrix composites (MMCs) are widely used in the automotive, aerospace and electrical industries due to their capability and flexibility in improving the mechanical, thermal and electrical properties of a component. However, current manufacturing technologies may suffer from insufficient process stability and reliability and inadequate economic efficiency and may not be able to satisfy the increasing demands placed on MMCs. Semi-solid powder processing (SPP), a technology that combines traditional powder metallurgy and semi-solid forming methods, has potential to produce MMCs with low cost and high efficiency. In this work, the analytical study and experimental investigation of SPP on the fabrication of MMCs were explored. An analytical model was developed to understand the deformation mechanism of the powder compact in the semi-solid state. The densification behavior of the Al6061 and SiC powder mixtures was investigated with different liquid fractions and SiC volume fractions. The limits of SPP were analyzed in terms of reinforcement phase loading and its impact on the composite microstructure. To explore adoption of new materials, carbon nanotube (CNT) was investigated as a reinforcing material in aluminum matrix using SPP. The process was successfully modeled for the mono-phase powder (Al6061) compaction and the density and density distribution were predicted. The deformation mechanism at low and high liquid fractions was discussed. In addition, the compaction behavior of the ceramic-metal powder mixture was understood, and the SiC loading limit was identified by parametric study. For the fabrication of CNT reinforced Al6061 composite, the mechanical alloying of Al6061-CNT powders was first investigated. A mathematical model was developed to predict the CNT length change during the mechanical alloying process. The effects of mechanical alloying time and processing temperature during SPP were studied on the mechanical, microstructural and

  10. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A selective and differential medium for Vibrio harveyi.

    OpenAIRE

    Harris, L; Owens, L; Smith, S

    1996-01-01

    A new medium, termed Vibrio harveyi agar, has been developed for the isolation and enumeration of V. harveyi. It is possible to differentiate V. harveyi colonies from the colonies of strains representing 15 other Vibrio species with this medium. This medium has been shown to inhibit the growth of two strains of marine Pseudomonas spp. and two strains of marine Flavobacterium spp. but to allow the growth of Photobacterium strains. Colonies displaying typical V. harveyi morphology were isolated...

  12. Mydriatics release from solid and semi-solid ophthalmic formulations using different in vitro methods.

    Science.gov (United States)

    Pescina, Silvia; Macaluso, Claudio; Gioia, Gloria Antonia; Padula, Cristina; Santi, Patrizia; Nicoli, Sara

    2017-09-01

    The aim of the present paper was the development of semi-solid (hydrogels) and solid (film) ophthalmic formulations for the controlled release of two mydriatics: phenylephrine and tropicamide. The formulations - based on polyvinylalcohol and hyaluronic acid - were characterized, and release studies were performed with three different in vitro set-ups, i.e. Franz-type diffusion cell, vial method and inclined plane; for comparison, a solution and a commercial insert, both clinically used to induce mydriasis, were evaluated. Both gels and film allowed for a controlled release of drugs, appearing a useful alternative for mydriatics administration. However, the release kinetic was significantly influenced by the method used, highlighting the need for optimization and standardization of in vitro models for the evaluation of drug release from ophthalmic dosage forms.

  13. Mechanical behaviour of Nd-Fe-B alloys in the semi-solid state

    International Nuclear Information System (INIS)

    Oliveira, I.L.; Sinka, V.; Ferrante, M.

    1996-01-01

    Two alloys with composition Nd 17.6 Fe 75.3 B1.2 Cu 5.9 and Nd 15.9 Fe 77.7 B 5 Cu 1.4 were vacuum induction melted and cast into cylindrical ingots. Samples with 12.3 and 13 mm diameter were deformed with different rates and deformation ratios. One alloy was deformed at 800 deg C between two parallel disks under constant load. Results show that these alloys behave as no-Newtonian fluids. This fact gives a better understanding of both magnetic and crystallographic texture development. Also, changes were detected in the behaviour of semisolid in the course of deformation. (author)

  14. Synchrotron radiography of direct-shear in semi-solid alloys

    International Nuclear Information System (INIS)

    Gourlay, C M; Nagira, T; Nakatsuka, N; Yasuda, H; Dahle, A K; Uesugi, K

    2012-01-01

    Understanding phenomena occurring at the scale of the crystals during the deformation of semi-solid alloys is important for the development of physically-based rheological models. A range of deformation mechanisms have been proposed including agglomeration and disagglomeration, viscoplastic deformation of the solid skeleton, and granular phenomena such as jamming and dilatancy. This paper overviews in-situ experiments that directly image crystal-scale deformation mechanisms in equiaxed Al alloys at solid fractions shortly after the crystals have impinged to form a loose crystal network. Direct evidence is presented for granular deformation mechanisms including shear-induced dilation in both equiaxed-dendritic and globular microstructures. Modelling approaches suitable for capturing this behaviour are then discussed.

  15. Semisolid forming of 44MnSiV6 microalloyed steel

    Science.gov (United States)

    Plata, Gorka; Lozares, Jokin; Hurtado, Iñaki; Azpilgain, Zigor; Idoyaga, Zuriñe

    2018-05-01

    Globalisation is forcing many sectors to be more cost-effective due to the low manpower cost of developing countries. This, in combination with European trends of green production and reduction of emissions, enhances the necessity of advanced technologies to remain at the forefront of the market. It is precisely in this field where the Semisolid forming (SSF) exhibits a great potential. In Mondragon Unibertsitatea, it has been demonstrated the capability of producing sound components of 42CrMo4 and S48C steels by saving material, energy and attaining as hot forged properties. To make the process even more cost-effective, it has also been proved the capacity of SSF 44MnSiV6 microalloyed steel that enables the striking of the post processing heat treatment.

  16. Effects of grain refinement on the rheological behaviors of semisolid hypoeutectic Al-Si alloys

    International Nuclear Information System (INIS)

    Yan, M.; Luo, W.

    2007-01-01

    The paper experimentally investigated the effects of grain refinement on the rheological response of Al and hypoeutectic Al-Si alloys. Selected refiners included K 2 TiF 6 , K 2 TiF 6 plus graphite and Al-5Ti-B. The apparent viscosity of semisolid Al alloys was measured during solidification. Samples at different solid fractions were quenched to observe the microstructure. It was found that grain refinement drastically lowered the apparent viscosity of Al-Si alloys. Among selected refiners, the effect of Al-5Ti-B was the best. The effect of K 2 TiF 6 plus graphite was better than that of K 2 TiF 6 . Silicon contents in Al alloys affected the apparent viscosity. With increasing silicon content the apparent viscosity decreased, resulted from promotion of silicon to both refining effects of titanium and boron

  17. A mucosa-mimetic material for the mucoadhesion testing of thermogelling semi-solids.

    Science.gov (United States)

    da Silva, Jéssica Bassi; Khutoryanskiy, Vitaliy V; Bruschi, Marcos L; Cook, Michael T

    2017-08-07

    Mucosa-mimetic materials are synthetic substrates which aim to replace animal tissue in mucoadhesion experiments. One potential mucosa-mimetic material is a hydrogel comprised of N-acryloyl-d-glucosamine and 2-hydroxyethylmethacrylate, which has been investigated as a surrogate for animal mucosae in the mucoadhesion testing of tablets and solution formulations. This study aims to investigate the efficacy of this mucosa-mimetic material in the testing of thermogelling semi-solid formulations, which transition from solution to gel upon warming. Two methods for assessing mucoadhesion have been used; tensile testing and a flow-through system, which allow for investigation under dramatically different conditions. It was found that the mucosa-mimetic material was a good surrogate for buccal mucosa using both testing methods. This material may be used to replace animal tissue in these experiments, potentially reducing the number of laboratory animals used in studies of this type. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Semi-solid microbial fermentation of rice and wheat straw for protein enrichment and increased digestibility

    Energy Technology Data Exchange (ETDEWEB)

    Balasubramanya, R.H.; Bhatawdekar, S.P.

    1980-12-01

    Rice and wheat straws were hydrolyzed in various concentrations of sulfuric acid at different temperatures and different water: substrate ratios. The maximum amount of sugars of about 30-34% was released when heated at 121 degrees C with 0.5 N H2SO4 at a water: substrate ratio of 3:1. The pH of the hydrolyzed straws was raised to 5.0-5.5 with 5 N NH4OH. Such ammoniated straws were inoculated with the cultures of Penicillium funiculosum Thom. and Candida utilis (Henneb.) Lodder and Kreger-van Rij, and fermentation was carried out on semi-solid substrate for 5-7 days at room temperature. The fermentation resulted in 37-180% increase in crude protein, 23-100% increase in crude fat and 20-30% increase in the digestibility. (Refs. 29).

  19. [A nutrient medium for the isolation and cultivation of Campylobacter].

    Science.gov (United States)

    Temirkhanova, Z U; Gashimova, P Sh; Safonova, N V; Moroz, A F; Khazenson, L V

    1999-01-01

    Campylobacter agar, nutrient medium intended for the isolation of bacteria of the genus Campylobacter from clinical material, has been developed. The composition of the medium includes sprat hydrolysate, aerotolerant additive (ferric sulfate--oxide, sodium pyruvate, sodium pyrosulfite), sodium glutaminate, agar. The selective properties of the medium are ensured by introducing the mixture of antibiotics consisting of polymyxin B, rifampicin, amphotericin B, ristomycin. The balanced composition of Campylobacter agar ensures the aerotolerance of Campylobacter organisms and gives the optimal conditions for their growth when the inoculated material is cultivated in the atmosphere made up of the mixture of three gases (5% of oxygen, 10% of carbon dioxide, 85% of nitrogen), as well as under the conditions of a "candle vessel". The medium suppresses the development of the associative microflora diluted 10(-1). As shown in the trial of the quality of Campylobacter agar by the inoculation of material taken from patients with acute enteric infections, agricultural animals and monkeys, the medium has pronounced selective, properties with regard to extraneous microflora, while ensuring the isolation of Campylobacter on the level of the control medium.

  20. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  1. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  2. New low-viscosity overlay medium for viral plaque assays

    Directory of Open Access Journals (Sweden)

    Garten Wolfgang

    2006-08-01

    Full Text Available Abstract Background Plaque assays in cell culture monolayers under solid or semisolid overlay media are commonly used for quantification of viruses and antiviral substances. To overcome the pitfalls of known overlays, we tested suspensions of microcrystalline cellulose Avicel RC/CL™ as overlay media in the plaque and plaque-inhibition assay of influenza viruses. Results Significantly larger plaques were formed under Avicel-containing media, as compared to agar and methylcellulose (MC overlay media. The plaque size increased with decreasing Avicel concentration, but even very diluted Avicel overlays (0.3% ensured formation of localized plaques. Due to their low viscosity, Avicel overlays were easier to use than methylcellulose overlays, especially in the 96-well culture plates. Furthermore, Avicel overlay could be applied without prior removal of the virus inoculum thus facilitating the assay and reducing chances of cross-contamination. Using neuraminidase inhibitor oseltamivir carboxylate, we demonstrated applicability of the Avicel-based plaque reduction assay for testing of antiviral substances. Conclusion Plaque assay under Avicel-containing overlay media is easier, faster and more sensitive than assays under agar- and methylcellulose overlays. The assay can be readily performed in a 96-well plate format and seems particularly suitable for high-throughput virus titrations, serological studies and experiments on viral drug sensitivity. It may also facilitate work with highly pathogenic agents performed under hampered conditions of bio-safety labs.

  3. Inactivation of pathogenic bacteria inoculated onto a Bacto™ agar model surface using TiO2-UVC photocatalysis, UVC and chlorine treatments.

    Science.gov (United States)

    Yoo, S; Ghafoor, K; Kim, S; Sun, Y W; Kim, J U; Yang, K; Lee, D-U; Shahbaz, H M; Park, J

    2015-09-01

    The aim of this study was to study inactivation of different pathogenic bacteria on agar model surface using TiO2-UV photocatalysis (TUVP). A unified food surface model was simulated using Bacto(™) agar, a routinely used microbial medium. The foodborne pathogenic bacteria Escherichia coli K12 (as a surrogate for E. coli O157:H7), Salmonella Typhimurium, Staphylococcus aureus and Listeria monocytogenes were inoculated onto the agar surface, followed by investigation of TUVP-assisted inactivation and morphological changes in bacterial cells. The TUVP process showed higher bacterial inactivation, particularly for Gram-negative bacteria, than UVC alone and a control (dark reaction). A TUVP treatment of 17·2 mW cm(-2) (30% lower than the UVC light intensity) reduced the microbial load on the agar surface by 4·5-6·0 log CFU cm(-2). UVC treatment of 23·7 mW cm(-2) caused 3·0-5·3 log CFU cm(-2) reduction. The use of agar model surface is effective for investigation of bacterial disinfection and TUVP is a promising nonthermal technique. The results showing effects of photocatalysis and other treatments for inactivation of bacterial pathogens on model surface can be useful for applying such processes for disinfection of fruit, vegetables and other similar surfaces. © 2015 The Society for Applied Microbiology.

  4. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  5. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  6. The effect of additives on release and in vitro skin retention of flavonoids from emulsion and gel semisolid formulations.

    Science.gov (United States)

    Dyja, R; Jankowski, A

    2017-08-01

    To assess the effect of two different additives (propylene glycol (PG) and polyethylene glycol 400 (PEG 400)) on release and in vitro skin retention of quercetin and chrysin from semisolid bases (amphiphilic creams and acidic carbomer gels). For obtaining semisolid formulations, flavonoids were pre-dissolved in the liquid (PG or PEG 400) or directly suspended in the semisolid base. Three chrysin formulations ('cream 0', 'PG-cream' and 'PEG 400-cream') and five quercetin formulations ('cream 0', 'PG cream', 'PEG 400 cream', 'gel 0' and 'PG gel') were prepared. The release studies were carried out in Franz diffusion cells by means of a cellulose membrane. The porcine ear skin was used in in vitro skin retention studies. The dissolution was a prerequisite to increase the release rates of tested flavonoids from obtained semisolid formulations. The cumulative amount of chrysin released after 6 h from 'PEG 400 cream' containing partly dissolved form of that flavonoid was higher than that from 'cream 0' or 'PG cream' containing its suspended form. The formulations containing quercetin dissolved in PG ('PG cream', 'PG gel') or PEG 400 ('PEG 400 cream') exhibited higher release rates of that flavonoid than corresponding semisolid suspensions ('cream 0' or 'gel 0'). The effects of both liquid additives (PG and PEG 400) on the cumulative amount of quercetin released after 6 h were comparable. However, there was no correlation between the release rate and the skin retention. The amounts of the flavonoids found in the skin were strongly affected by the type of the used solvent. While PG increased the skin retention of both flavonoids, PEG 400 had no effect on chrysin skin retention and delayed quercetin skin absorption. The proper choice of the solvent added to the semisolid base is crucial for enhanced skin delivery of the tested flavonoids. PG is more efficient absorption promoter than PEG 400 of both chrysin and quercetin. © 2017 Society of Cosmetic Scientists and the Soci

  7. Semi-selective medium for Fusarium graminearum detection in seed samples

    Directory of Open Access Journals (Sweden)

    Marivane Segalin

    2010-12-01

    Full Text Available Fungi of the genus Fusarium cause a variety of difficult to control diseases in different crops, including winter cereals and maize. Among the species of this genus Fusarium graminearum deserves attention. The aim of this work was to develop a semi-selective medium to study this fungus. In several experiments, substrates for fungal growth were tested, including fungicides and antibiotics such as iprodiona, nystatin and triadimenol, and the antibacterial agents streptomycin and neomycin sulfate. Five seed samples of wheat, barley, oat, black beans and soybeans for F. graminearum detection by using the media Nash and Snyder agar (NSA, Segalin & Reis agar (SRA and one-quarter dextrose agar (1/4PDA; potato 50g; dextrose 5g and agar 20g, either unsupplemented or supplemented with various concentrations of the antimicrobial agents cited above. The selected components and concentrations (g.L-1 of the proposed medium, Segalin & Reis agar (SRA-FG, were: iprodiona 0.05; nystatin 0,025; triadimenol 0.015; neomycin sulfate 0.05; and streptomycin sulfate, 0.3 added of ¼ potato sucrose agar. In the isolation from seeds of cited plant species, the sensitivity of this medium was similar to that of NSA but with de advantage of maintaining the colony morphological aspects similar to those observed in potato-dextrose-agar medium.

  8. Bacterial growth on Mueller Hinton medium sterilized by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Eisenberg, E. (Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center); Bogokowsky, B.; Altmann, G. (Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School)

    1981-12-01

    The possibility of radiosterilization of culture media for the cultivation of bacteria was investigated. Mueller Hinton agar, a medium widely used for the propagation of some fastidious pathogenic bacteria, was sterilized with 1.0 and 1.5 Mrad doses of ..gamma..-radiation. Bacteria belonging to seven different species grew as well on the radiosterilized medium as on medium sterilized by heat in a conventional way. Reduction in colony size was observed on the radiosterilized medium with Staphylococcus aureus and Shigella boydii. Neisseria meningitidis, the most fastidious bacterium tested, did not grow at all. The addition of small amounts of catalase corrected the deleterious radiation effect and all bacteria tested could be successfully grown on irradiated Mueller Hinton agar supplemented with up to 11 Keil units catalase per liter medium.

  9. Mechanical behavior and microstructure during compression of semi-solid ZK60-RE magnesium alloy at high solid content

    International Nuclear Information System (INIS)

    Shan Weiwei; Luo Shoujing

    2007-01-01

    Mechanical behavior during compression of semi-solid ZK60-RE magnesium alloy at high solid content is researched in this paper. The alloy was prepared from ZK60 alloy and rare earth elements by casting, equal channel angular extruding, and liquidus forging. Semi-solid isothermal pre-treatment was carried out to make the grains globular before the compression. Here, several groups of true strain-true stress curves with different variables during compression are given to make comparisons of their mechanical behaviors. Liquid paths were the most essential to deformation, and its variation during compression depends on the strain rate. Here, thixotropic strength is defined as the true stress at the first peak in the true stress-true strain curve

  10. Research progress on microstructure evolution of semi-solid aluminum alloys in ultrasonic field and their rheocasting

    Directory of Open Access Journals (Sweden)

    Wu Shusen

    2014-07-01

    Full Text Available The effects of ultrasonic vibration (UV treatment on microstructure of semi-solid aluminum alloys and the application of UV in rheocasting process are reviewed. Good semi-solid slurry can be produced by high-intensity UV process for aluminum alloys. The microstructures of Al-Si, Al-Mg and Al-Cu alloys produced by rheocasting assisted with UV are compact and with fine grains. The mechanical properties of the UV treated alloys are increased by about 20%-30%. Grain refinement of the alloys is generally considered because of cavitation and acoustic streaming caused by UV. Apart from these mechanisms, a hypothesis of the fuse of dendrite root caused by capillary infiltration in the ultrasonic field, as well as a mechanism of crystallites falling off from the mould-wall and crystal multiplication by mechanical vibration effect in indirect ultrasonic vibration are proposed to explain the microstructure evolution of the alloys.

  11. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  12. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  13. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  14. Combinational approach using solid dispersion and semi-solid matrix technology to enhance in vitro dissolution of telmisartan

    Directory of Open Access Journals (Sweden)

    Syed Faisal Ali

    2016-02-01

    Full Text Available The present investigation was focused to formulate semi-solid capsules (SSCs of hydrophobic drug telmisartan (TLMS by encapsulating semi-solid matrix of its solid dispersion (SD in HPMC capsules. The combinational approach was used to reduce the lag time in drug release and improvise its dissolution. SDs of TLMS was prepared using hot fusion method by varying the combinations of Pluronic-F68, Gelucire 50/13 and Plasdone S630. A total of nine batches (SD1-SD9 were characterized for micromeritic properties, in vitro dissolution behavior and surface characterization. SD4 with 52.43% cumulative drug release (CDR in phosphate buffer, pH 7.4, in 120 min, t50% 44.2 min and DE30min 96.76% was selected for the development of semi-solid capsules. Differential scanning calorimetry of SD4 revealed molecular dispersion of TLMS in Pluronic-F68. SD4 was formulated into SSCs using Gelucire 44/14 and PEG 400 as semi-solid components and PEG 6000 as a suspending agent to achieve reduction in lag time for effective drug dissolution. SSC6 showed maximum in vitro drug dissolution 97.49 % in phosphate buffer, pH 7.4 with in 20 min that was almost a three folds reduction in the time required to achieve similar dissolution by SD. Thus, SSCs present an excellent approach to enhance in vitro dissolution as well as to reduce the lag time of dissolution for poorly water soluble drugs especially to those therapeutic classes that are intended for faster onset of action. Developed approach based on HPMC capsules provided a better alternative to target delivery of telmisartan to the vegetarian population.

  15. Determination of drug content in semisolid formulations by non-invasive spectroscopic methods: FTIR - ATR, - PAS, - Raman and PDS

    International Nuclear Information System (INIS)

    Gotter, B; Hein, J; Neubert, R H H; Faubel, W; Heissler, St

    2010-01-01

    This study elucidates the potential use of photothermal deflection spectroscopy (PDS), FTIR photoacoustic (FTIR-PAS), FT Raman, and FTIR-attenuated total reflection (FTIR-ATR) spectroscopy as analytical tools for investigating the drug content in semisolid formulations. Regarding the analytical parameters, this study demonstrates the photothermal beam deflection to be definitely comparable to well established spectroscopic methods for this purpose. The correlation coefficients range from 0.990 to 0.999. Likewise, repeatability and limit of detection are comparable.

  16. Energy Saving Melting and Revert Reduction Technology: Innovative Semi-Solid Metal (SSM) Processing

    Energy Technology Data Exchange (ETDEWEB)

    Diran Apelian

    2012-08-15

    Semi-solid metal (SSM) processing has emerged as an attractive method for near-net-shape manufacturing due to the distinct advantages it holds over conventional near-net-shape forming technologies. These advantages include lower cycle time, increased die life, reduced porosity, reduced solidification shrinkage, improved mechanical properties, etc. SSM processing techniques can not only produce the complex dimensional details (e.g. thin-walled sections) associated with conventional high-pressure die castings, but also can produce high integrity castings currently attainable only with squeeze and low-pressure permanent mold casting processes. There are two primary semi-solid processing routes, (a) thixocasting and (b) rheocasting. In the thixocasting route, one starts from a non-dendritic solid precursor material that is specially prepared by a primary aluminum manufacturer, using continuous casting methods. Upon reheating this material into the mushy (a.k.a. "two-phase") zone, a thixotropic slurry is formed, which becomes the feed for the casting operation. In the rheocasting route (a.k.a. "slurry-on-demand" or "SoD"), one starts from the liquid state, and the thixotropic slurry is formed directly from the melt via careful thermal management of the system; the slurry is subsequently fed into the die cavity. Of these two routes, rheocasting is favored in that there is no premium added to the billet cost, and the scrap recycling issues are alleviated. The CRP (Trade Marked) is a process where the molten metal flows through a reactor prior to casting. The role of the reactor is to ensure that copious nucleation takes place and that the nuclei are well distributed throughout the system prior to entering the casting cavity. The CRP (Trade Marked) has been successfully applied in hyper-eutectic Al-Si alloys (i.e., 390 alloy) where two liquids of equal or different compositions and temperatures are mixed in the reactor and creating a SSM slurry. The process has been mostly

  17. Semisolid casting with ultrasonically melt-treated billets of Al-7mass%Si alloys

    Directory of Open Access Journals (Sweden)

    Yoshiki Tsunekawa

    2012-02-01

    Full Text Available The demand for high performance cast aluminum alloy components is often disturbed by increasing impurity elements, such as iron accumulated from recycled scraps. It is strongly required that coarse plate-like iron compound of モ-Al5FeSi turns into harmless form without the need for applying refining additives or expensive virgin ingots. The microstructural modification of Al-7mass%Si alloy billets with different iron contents was examined by applying ultrasonic vibration during the solidification. Ultrasonically melt-treated billets were thixocast right after induction heating up to the semisolid temperature of 583 ìC, the microstructure and tensile properties were evaluated in the thixocast components. Globular primary メ-Al is required to fill up a thin cavity in thixocasting, so that the microstructural modification by ultrasonic melt-treatment was firstly confirmed in the billets. With ultrasonic melt-treatment in the temperature range of 630 ìC to 605 ìC, the primary メ-Al transforms itself from dendrite into fine globular in morphology. The coarse plate-like モ-Al5FeSi compound becomes markedly finer compared with those in non-treated billets. Semisolid soaking up to 583 ìC, does not appreciably affect the size of モ-Al5FeSi compounds; however, it affects the solid primary メ-Al morphology to be more globular, which is convenient for thixocasting. After thixocasting with preheated billets, eutectic silicon plates are extremely refined due to the rapid solidification arising from low casting temperature. The tensile strength of thixocast samples with different iron contents does not change much even at 2mass% of iron, when thixocast with ultrasonically melt-treated billets. However, thixocast Al-7mass%Si-2mass%Fe alloy with non-treated billets exhibits an inferior strength of 80 MPa, compared with 180 MPa with ultrasonically melt-treated billets. The elongation is also improved by about a factor of two in thixocastings with

  18. Increase in colony-forming efficiency in soft agar of thymus cells from radiation-induced thymomas of NIH Swiss mice

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Nobuko; Takamori, Yasuhiko; Hori, Yasuharu [Radiation Center of Osaka Prefecture, Sakai (Japan)

    1982-03-01

    Colony-forming efficiency in soft agar of radiation-induced thymoma in NIH Swiss mice was determined in the presence of cultured medium of reticulo-epitherial cells from normal thymus of NIH Swiss mouse as conditioned medium. A similar experiment was done with thymomas spontaneously developed in AKR mice. Most of colonies developed in soft agar were not composed of thymic lymphoma cells, but of macrophage-like cells. The ratio of the number of colonies to that of the seeded cells significantly increased in thymomas comparing with that in normal thymus. This result corresponded with the increased number of macrophages in thymoma, as determined by counting phagocytic cells of adherent cells.

  19. Microstructure of Semi-Solid Billets Produced by Electromagnetic Stirring and Behavior of Primary Particles during the Indirect Forming Process

    Directory of Open Access Journals (Sweden)

    Chul Kyu Jin

    2018-04-01

    Full Text Available An A356 alloy semi-solid billet was fabricated using electromagnetic stirring. After inserting the semi-solid billet into an indirect die, a thin plate of 1.2 mm thickness was fabricated by applying compression. The microstructure of the semi-solid billets fabricated in various stirring conditions (solid fraction and stirring force were analyzed. The deformation and behavior of the primary α-Al particles were analyzed for various parameters (solid fraction, die friction, compression rate, and compression pressure. In the stirred billets, a globular structure was dominant, while a dendrite structure was dominant in the unstirred billets. As the solid fraction decreased and the stirring current increased, the equivalent diameter and roundness of the primary α-Al particles decreased. The primary α-Al particle sizes were reduced as the compressing velocity increased, while a greater number of particles could move as the compressing pressure increased. As the path over which the motion occurred became smoother, the fluidity of the particles improved. Under compression, bonded primary α-Al particles became separated into individual particles again, as the bonds were broken. As wearing caused by friction and collisions between the particles during this motion occurred, the particle sizes were reduced, and the particle shapes become increasingly spheroid.

  20. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  1. Microstructural evolution and rheological properties of AA6063 alloy produced by semisolid processing (SIMA and MHD)

    International Nuclear Information System (INIS)

    Bustos, O.; Leiva, R.; Sanchez, C.; Ordonez, S.; Carvajal, L.; Mannheim, R.

    2007-01-01

    In this work the rheological behaviour and the microstructural evolution of alloy AA6063 submitted to two different processing routes were studied: cold deformation and partial fusion (SIMA process) and magneto hydrodynamic stirring during its solidification (MHD process). The microstructural evolution during the isothermal holding was studied to verify if the Ost wald ripening mechanisms, classic growth and coalescence, are applicable to alloys made by these processing routes. The rheological properties were evaluated using a compression rheometer with parallel plates and digital capture of position and time data. Compression tests were made in short cylinders extracted from ingots that showed: a dendritic microstructure typical of as cast material, a typical microstructure of cold deformed material and a microstructure of materials obtained by MHD process. It was found that a globular microstructure has a typical behaviour of a fluid when being formed in semisolid state, contrary to the behaviour of the as cast dendritic microstructure. In addition, the mechanisms that operate in the microstructural evolution during the isothermal holdings were verified, through metallographic analysis. (Author) 29 refs

  2. Quantification of active ingredients in semi-solid pharmaceutical formulations by near infrared spectroscopy.

    Science.gov (United States)

    Schlegel, Lisa B; Schubert-Zsilavecz, Manfred; Abdel-Tawab, Mona

    2017-08-05

    Near infrared (NIR) spectroscopy is increasingly gaining significance in the pharmaceutical industry for quality and in-process control. However, the potential of this method for quantitative quality control in pharmacies has long been neglected and little data is available on its application in analysis of creams and ointments. This study evaluated the applicability of NIR spectrometer with limited wavelength range (1000-1900nm) for quantitative quality control of six different dermatological semi-solid pharmaceutical preparations. Each contained a frequently used active ingredient in a common concentration either in a water-free lipid base or in an aqueous cream matrix. Based on direct NIR transflectance measurements through standardized glass beakers and partial least squares (PLS) multivariate calibration, quantitative models were generated comparing several data pre-processing methods Whereas difficulties were observed for mixtures containing 2% (w/w) metronidazole or 4% (w/w) erythromycin, content determination was possible with sufficient accuracy for salicylic acid (5 % (w/w)) and urea (10% (w/w)) in hydrophilic as well as in lipophilic formulations meeting the limit of a maximum deviation of±5% (relative) from the reference values. Exemplarily, one of the methods was successfully validated according to the EMA Guideline, determining several figures of merit such as specificity, linearity, accuracy, precision and robustness. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Formation of semisolid, oligomerized aqueous SOA: lab simulations of cloud processing.

    Science.gov (United States)

    Hawkins, Lelia N; Baril, Molly J; Sedehi, Nahzaneen; Galloway, Melissa M; De Haan, David O; Schill, Gregory P; Tolbert, Margaret A

    2014-02-18

    Glyoxal, methylglyoxal, glycolaldehyde, and hydroxyacetone form N-containing and oligomeric compounds during simulated cloud processing with small amines. Using a novel hygroscopicity tandem differential mobility analysis (HTDMA) system that allows varied humidification times, the hygroscopic growth (HG) of each of the resulting products of simulated cloud processing was measured. Continuous water uptake (gradual deliquescence) was observed beginning at ∼ 40% RH for all aldehyde-methylamine products. Particles containing ionic reaction products of either glyoxal or glycine were most hygroscopic, with HG between 1.16 and 1.20 at 80% RH. Longer humidification times (up to 20 min) produced an increase in growth factors for glyoxal-methylamine (19% by vol) and methylglyoxal-methylamine (8% by vol) aerosol, indicating that unusually long equilibration times can be required for HTDMA measurements of such particles. Glyoxal- and methylglyoxal-methylamine aerosol particles shattered in Raman microscopy impact-flow experiments, revealing that the particles were semisolid. Similar experiments on glycolaldehyde- and hydroxyacetone-methylamine aerosol found that the aerosol particles were liquid when dried for glyoxal > glycolaldehyde = hydroxyacetone, likely caused by the speed of oligomer formation in each system.

  4. Exploring imperfect squeezing flow measurements in a Teflon geometry for semisolid foods.

    Science.gov (United States)

    Terpstra, M E J; Janssen, A M; Linden, E van der

    2007-11-01

    The method of imperfect lubricated squeezing flow in a Teflontrade mark geometry has been explored for the characterization of elongational behavior of custard and mayonnaise. Two Newtonian products, one of low (0.07 Pas) and one of high (18 Pas) shear viscosity, were used as references. Measurements of custards and mayonnaises did not behave according to either the theory of lubricated or nonlubricated squeezing flow, as there were effects of the initial sample height and compression speed. Also, calculated values for the flow index were not as we had expected. The same was true for the Newtonian samples. An important factor explaining the effect of compression speed was the presence of a certain amount of friction, rendering both lubricated theory and nonlubricated theory nonapplicable. Correcting for (pseudo-) thixotropic behavior of custard and mayonnaise appears to be an effective way of obtaining realistic values for the flow index. The presence of buoyancy also affected the results, especially in the case of low viscous products and the effect of initial sample height. Other factors that played a role in the results were yield stress for custard and mayonnaise and instrumental artifacts associated with the imperfect setup of the measurement, especially for the highly viscous products. Quantitatively correcting the results for all of these factors is not possible at this point. Although the imperfect squeezing flow technique in a Teflon geometry is a very practical way to measure semisolids such as custard and mayonnaise under (partly) elongational deformation, the results should be regarded as more qualitative than quantitative.

  5. Effect of semisolid formulation of persea americana mill (avocado) oil on wound healing in rats.

    Science.gov (United States)

    de Oliveira, Ana Paula; Franco, Eryvelton de Souza; Rodrigues Barreto, Rafaella; Cordeiro, Daniele Pires; de Melo, Rebeca Gonçalves; de Aquino, Camila Maria Ferreira; E Silva, Antonio Alfredo Rodrigues; de Medeiros, Paloma Lys; da Silva, Teresinha Gonçalves; Góes, Alexandre José da Silva; Maia, Maria Bernadete de Sousa

    2013-01-01

    The aim of this study was to evaluate the wound-healing activity of a semisolid formulation of avocado oil, SSFAO 50%, or avocado oil in natura, on incisional and excisional cutaneous wound models in Wistar rats. An additional objective was to quantify the fatty acids present in avocado oil. On the 14th day, a significant increase was observed in percentage wound contraction and reepithelialization in the groups treated with 50% SSFAO or avocado oil compared to the petroleum jelly control. Anti-inflammatory activity, increase in density of collagen, and tensile strength were observed inSSFAO 50% or avocado oil groups, when compared to control groups. The analysis of the components of avocado oil by gas chromatography detected the majority presence of oleic fatty acid (47.20%), followed by palmitic (23.66%), linoleic (13.46%) docosadienoic (8.88%), palmitoleic (3.58%), linolenic (1.60%), eicosenoic (1.29%), and myristic acids (0.33%). Our results show that avocado oil is a rich source of oleic acid and contains essential fatty acids. When used in natura or in pharmaceutical formulations for topical use, avocado oil can promote increased collagen synthesis and decreased numbers of inflammatory cells during the wound-healing process and may thus be considered a new option for treating skin wounds.

  6. Cultivo inicial in vitro de gemas axilares de Ananas comosus (L. Merr., em meio líquido/sólido, na presença/ausência de luz In nitial in vitro culture of axillary buds of Ananas comosus (L. Merr. in liquid/semi-solid culture medium, in the presence/absence of light

    Directory of Open Access Journals (Sweden)

    Sarah Brandão Santa Cruz Barboza

    2009-01-01

    Full Text Available A capacidade regenerativa de gemas axilares de abacaxizeiro cv. Pérola (Ananas comosus (L. Merr. foi avaliada em meio de cultivo líquido e gelificado, na presença e ausência de luz, com o objetivo de produzir material para subsequentes fases da micropropagação. Os explantes foram estabelecidos, por 60 dias, em meio MS acrescido de 0,63 μM de ANA e 2,5 μM de BAP. O delineamento experimental foi inteiramente casualizado, constituído com quatro tratamentos (meio líquido com e sem ponte de papel de filtro e meio gelificado com ágar a 6,0 g L-1 e com Phytagel® a 3,0 g L-1, com quatro repetições e cinco explantes por repetição. Diferentes volumes de meio líquido (2,5 mL; 5,0 mL e 10,0 mL também foram avaliados, usando-se quatro repetições por volume de meio de cultura. Maior número de brotos foi obtido na presença de luz, em meio líquido sem ponte de papel de filtro, onde 80% dos explantes se diferenciaram em brotos. Na ausência de luz, 68,8% a 87,5% dos explantes não regeneraram brotos. Explantes cultivados em volumes de 5,0 mL ou 2,5 mL de meio MS líquido, acrescido de 0,63 μM de ANA e 2,5 μM de BAP, na presença de luz, constitui um protocolo adequado para cultivo inicial de gemas axilares e regeneração de brotos de abacaxizeiro.The regenerative capacity of buds from lateral sprouts of the pineapple cv. Pérola (Ananas comosus (L. Merr. was evaluated in liquid and semi-solid medium, under light and dark conditions, with the objective of producing materials for subsequent phase of micropropagation. The explants were established for 60 days in basal MS medium, supplemented with 0.63 μM NAA and 2.5 μM BAP. The statistical design was completely randomized with four treatments (liquid medium with and without filter paper bridge, and semi-solid medium gellified with agar and phytagel®, four repetitions and five explants per experimental unit. Different volumes of liquid medium (2.5 mL, 5.0 mL, and 10.0 mL were also

  7. Phosphate-Catalyzed Hydrogen Peroxide Formation from Agar, Gellan, and κ-Carrageenan and Recovery of Microbial Cultivability via Catalase and Pyruvate.

    Science.gov (United States)

    Kawasaki, Kosei; Kamagata, Yoichi

    2017-11-01

    Previously, we reported that when agar is autoclaved with phosphate buffer, hydrogen peroxide (H 2 O 2 ) is formed in the resulting medium (PT medium), and the colony count on the medium inoculated with environmental samples becomes much lower than that on a medium in which agar and phosphate are autoclaved separately (PS medium) (T. Tanaka et al., Appl Environ Microbiol 80:7659-7666, 2014, https://doi.org/10.1128/AEM.02741-14). However, the physicochemical mechanisms underlying this observation remain largely unknown. Here, we determined the factors affecting H 2 O 2 formation in agar. The H 2 O 2 formation was pH dependent: H 2 O 2 was formed at high concentrations in an alkaline or neutral phosphate buffer but not in an acidic buffer. Ammonium ions enhanced H 2 O 2 formation, implying the involvement of the Maillard reaction catalyzed by phosphate. We found that other gelling agents (e.g., gellan and κ-carrageenan) also produced H 2 O 2 after being autoclaved with phosphate. We then examined the cultivability of microorganisms from a fresh-water sample to test whether catalase and pyruvate, known as H 2 O 2 scavengers, are effective in yielding high colony counts. The colony count on PT medium was only 5.7% of that on PS medium. Catalase treatment effectively restored the colony count of PT medium (to 106% of that on PS medium). In contrast, pyruvate was not as effective as catalase: the colony count on sodium pyruvate-supplemented PT medium was 58% of that on PS medium. Given that both catalase and pyruvate can remove H 2 O 2 from PT medium, these observations indicate that although H 2 O 2 is the main cause of reduced colony count on PT medium, other unknown growth-inhibiting substances that cannot be removed by pyruvate (but can be by catalase) may also be involved. IMPORTANCE The majority of bacteria in natural environments are recalcitrant to laboratory culture techniques. Previously, we demonstrated that one reason for this is the formation of high H 2 O

  8. Identification and antibiotic sensitivity test of bacteria from stools of ...

    African Journals Online (AJOL)

    One hundred and fifty stool samples from 65 female and 85 male patients with acute diarrhoea from the Central Hospital, Agbor (Nigeria) were examined to ascertain the likelihood of cholera outbreak in Agbor. The samples were preserved in Carey-Blair semi-solid medium, inoculated directly on blood agar, McConkey agar ...

  9. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  10. Study of the microstructural evolution and rheological behavior by semisolid compression between parallel plate of the alloy A356 solidified under a continuously rotating magnetic field

    International Nuclear Information System (INIS)

    Leiva L, Ricardo; Sanchez V, Cristian; Mannheim C, Rodolfo; Bustos C, Oscar

    2004-01-01

    This work presents a study of the rheological behavior of the alloy A356, with and without continuous magnetic agitation during its solidification, in semisolid state. The evaluation was performed using a parallel plate compression rheometer with the digital recording of position and time data. The microstructural evolution was also studied at the start and end of the semisolid compression test. The procedure involved tests of short cylinders extracted from billets with a non dendritic microstructure cast under a continuously rotating magnetic field. These pieces were tested in different solid fractions, at constant charges and at constant deformation velocities. When the test is carried out at a constant charge the equation can be determined that governs the rheological behavior of the material in semisolid state following a power grade of two Ostwald-de-Waele parameters. But when the test is done at a constant deformation speed the flow behavior of the material can be described in the semisolid shaping process. The results obtained show that the morphology of the phases present in the microstructure is highly relevant to its rheological behavior. A globular coalesced rosette to rosette type microstructure was found to have the typical behavior of a fluid when shaped in a semisolid state but a cast dendritic structure did not behave this way. Also the Arrhenius type dependence of viscosity with temperature was established (CW)

  11. Determinants of Early Introduction of Solid, Semi-Solid or Soft Foods among Infants Aged 3–5 Months in Four Anglophone West African Countries

    Directory of Open Access Journals (Sweden)

    Abukari I. Issaka

    2014-07-01

    Full Text Available This study was conducted to explore and identify factors associated with the practice of early introduction of solid, semi-solid or soft foods among infants aged 3–5 months in four Anglophone West African countries. Data sources for the analyses were the latest Demographic and Health Survey datasets of the 4 countries, namely Ghana (GDHS, 2008, Liberia (LDHS, 2007, Nigeria (NDHS, 2013 and Sierra Leone (SLDHS, 2008. Multiple logistic regression methods were used to analyze the factors associated with early introduction of solid, semi-solid or soft foods among infants aged 3–5 months, using individual-, household- and community-level determinants. The sample consisted of 2447 infants aged 3–5 months from four Anglophone West African countries: 166 in Ghana, 263 in Liberia, 1658 in Nigeria and 360 in Sierra Leone. Multivariable analyses revealed the individual factors associated with early introduction of solid, semi-solid or soft foods in these countries. These included increased infant’s age, diarrhea, acute respiratory infection and newborns perceived to be small by their mothers. Other predictors of early introduction of solid, semi-solid or soft foods were: mothers with no schooling, young mothers and fathers who worked in an agricultural industry. Public health interventions to improve exclusive breastfeeding practices by discouraging early introduction of solid, semi-solid or soft foods are needed in all 4 countries, targeting especially mothers at risk of introducing solid foods to their infants early.

  12. Learning about the energy density of liquid and semi-solid foods.

    Science.gov (United States)

    Hogenkamp, P S; Stafleu, A; Mars, M; de Graaf, C

    2012-09-01

    People learn about a food's satiating capacity by exposure and consequently adjust their energy intake. To investigate the effect of energy density and texture on subsequent energy intake adjustments during repeated consumption. In a randomized crossover design, participants (n=27, age: 21±2.4 years, body mass index: 22.2±1.6 kg m(-2)) repeatedly consumed highly novel foods that were either low-energy-dense (LE: 30 kcal per 100 g) or high-energy-dense (HE: 130 kcal per 100 g), and either liquid or semi-solid, resulting in four product conditions. In each condition, a fixed portion of test food was consumed nine times as an obligatory part of breakfast, lunch and dinner on 3 consecutive days. All meals continued with an ad libitum buffet; food items for evening consumption were provided and the intake (kcal per day) was measured. Buffet intake depended on energy density and day of consumption of the test foods (day*energy interaction: P=0.02); daily buffet intake increased from day 1 (1745±577 kcal) to day 3 (1979±567 kcal) in the LE conditions; intake did not change in the HE conditions (day 1: 1523±429 kcal, day 3: 1589±424 kcal). Food texture did not affect the intake (P=0.56). Intake did depend on energy density of the test foods; participants increased their buffet intake over days in response to learning about the satiating capacity of the LE foods, but did not change buffet intake over days when repeatedly consuming a HE food as part of their meal. The adjustments in intake were made irrespective of the food texture.

  13. Issues in the validation of CFD modelling of semi-solid metal forming

    International Nuclear Information System (INIS)

    Ward, P.J.; Atkinson, H.V.; Kirkwood, D.H.; Liu, T.Y.; Chin, S.B.

    2000-01-01

    Modelling of die filling during semi-solid metal processing (thixoforming) places particular demands on the CFD package being used. Not only are the velocities of the metal slurry in the die very high, the viscosity is too. Furthermore, the viscosity changes with shear rate (i.e. with changes in cross sectional area of the region the slurry travels through) and with time, as the injected material is thixotropic. The CFD software therefore requires good free surface tracking, accurate implicit solutions of the flow equations (as the CPU times for explicit solutions at high viscosities are impractical) and a model that adequately describes the slurry thixotropy. Finally, reliable, experimentally determined viscosity data are required. This paper describes the experiments on tin-lead and aluminium alloy slurries using compressive tests and rotating cylinder viscometry, followed by modelling using FLOW-3D. This package is known for its ability to track free surfaces accurately. Compressive tests allow rapid changes in shear rate to be imparted to the slurry, without wall slip, while the simple geometry of the viscometer makes it possible to compare analytical and numerical solutions. It is shown that the implicit viscous solver in its original form can reproduce the general trends found in the compressive and viscometry tests. However, sharp changes in shear rate lead to overestimation of pressure gradients in the slurry, making it difficult to separate these effects from those due to thixotropic breakdown. In order to achieve this separation, it is necessary to implement a more accurate implicit solver, which is currently under development. (author)

  14. Reactivity of liquid and semisolid secondary organic carbon with chloride and nitrate in atmospheric aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bingbing [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); O' Brien, Rachel E. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Univ. of the Pacific, Stockton, CA (United States); Kelly, Stephen T. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Shilling, John E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Moffet, Ryan C. [Univ. of the Pacific, Stockton, CA (United States); Gilles, Mary K. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Laskin, Alexander [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2015-05-14

    Constituents of secondary organic carbon (SOC) in atmospheric aerosols are often mixed with inorganic components and compose a significant mass fraction of fine particulate matter in the atmosphere. Interactions between SOC and other condensed-phase species are not well understood. Here, we investigate the reactions of liquid-like and semi-solid SOC from ozonolysis of limonene (LSOC) and α-pinene (PSOC) with NaCl using a set of complementary micro-spectroscopic analyses. These reactions result in chloride depletion in the condensed phase, release of gaseous HCl, and formation of organic salts. The reactions attributed to acid displacement by SOC acidic components are driven by the high volatility of HCl. Similar reactions can take place in SOC/NaNO₃ particles. The results show that an increase in SOC mass fraction in the internally mixed SOC/NaCl particles leads to higher chloride depletion. Glass transition temperatures and viscosity of PSOC were estimated for atmospherically relevant conditions. Data show that the reaction extent depends on SOC composition, particle phase state and viscosity, mixing state, temperature, relative humidity (RH), and reaction time. LSOC shows slightly higher potential to deplete chloride than PSOC. Higher particle viscosity at low temperatures and RH can hinder these acid displacement reactions. Formation of organic salts from these overlooked reactions can alter particle physiochemical properties and may affect their reactivity and ability to act as cloud condensation and ice nuclei. The release and potential recycling of HCl and HNO₃ from reacted aerosol particles may have important implications for atmospheric chemistry.

  15. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  16. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  17. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  18. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  19. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    Science.gov (United States)

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  20. Evaluation and enhancement of physical stability of semi-solid dispersions containing piroxicam into hard gelatin capsules.

    Science.gov (United States)

    Karataş, Ayşegül; Bekmezci, Serife

    2013-01-01

    The aim of the study was to investigate the physical stability of the semi-solid dispersions into the hard gelatine capsules prepared with Gelucire 44/14, Labrasol and different additives such as microcrystalline cellulose (MCC), mannitol and lactose (alpha-monohydrate) used for enhancing the stability of the formulations. The master dispersion prepared with only Gelucire 44/14 (20% w/w) and Labrasol (80% w/w) was stored in a refrigerator (5 +/- 3 degrees C), while the modified dispersions with the additives (2% w/w) were kept in a climatic chamber (25 +/- 2 degrees C / 60 +/- 5% RH) for 12 months. Dissolution tests of the semi-solid dispersions were performed in media with different pH's immediatly after preparation and after 3, 6 and 12 months of storage. FTIR and DSC studies were also carried out at the same time points. The ideal storage condition for the master dispersion was found to be at 5 degrees C. The addition of MCC, mannitol and lactose (alpha-monohydrate) to the original dispersion afforded a solidification effect on the formulation at room temperature and showed the same dissolution behavior (not less than 85% of piroxicam within 30 min in pH 1.2, 4.5 and 6.8; and water) with the master. The dispersion including lactose was stable at 25 degrees C for 12 months. However, the ideal period of storage for the modified dispersions including MCC and mannitol was 6 months at 25 degrees C. FTIR and DSC results both confirmed the amorphous state of piroxicam in all semi-solid dispersions under storage conditions for 12 months.

  1. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  2. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  3. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  4. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  5. CONTRIBUTION TO DETERMINING THE BIOCHEMICAL COMPOSITION OF THE WATER CHESTNUT TRAPA NATANS L. LAKE OUBEIRA EL-KALA AND DEVELOPMENT OF NUTRIENT AGAR

    Directory of Open Access Journals (Sweden)

    MOHAMED SAHLI

    2015-10-01

    Full Text Available This work is aims to determining the biochemical composition of the flour water chestnut seeds and the development of a nutrient agar for bacteria and fungi in the presence and absence of oxytetracycline. The culture medium consists of the filtrate recovered after dispersion of the flour of the seeds in distilled water and the agar. The results show in the absence of oxytetracycline, bacterial and fungal strains develop. In the presence of the antibiotic to 0.25 mg·mL-1 and 0.5 mg·mL-1 bacteria are completely inhibited whereas fungi evolve. Statistical analysis reveals the existence of a very highly significant difference (P ≤ 0.001 between the effects of different concentrations of the bactericide deploying Pyrenophora tritici and Septoria nodorum. There is no influence of antibacterial concentrations on the growth of Fusarium sp.

  6. The Effect of Temperature and Rotational Speed on Structure and Mechanical Properties of Cast Cu Base Alloy (Cu-Al-Si-Fe) Welded by Semisolid Stir Joining Method

    Science.gov (United States)

    Ferasat, Keyvan; Aashuri, Hossein; Kokabi, Amir Hossein; Shafizadeh, Mahdi; Nikzad, Siamak

    2015-12-01

    Semisolid stir joining has been under deliberation as a possible method for joining of copper alloys. In this study, the effect of temperature and rotational speed of stirrer on macrostructure evaluation and mechanical properties of samples were investigated. Optical microscopy and X-ray diffraction were performed for macro and microstructural analysis. A uniform micro-hardness profile was attained by semisolid stir joining method. The ultimate shear strength and bending strength of welded samples were improved in comparison with the cast sample. There is also lower area porosity in welded samples than the cast metal. The mechanical properties were improved by increasing temperature and rotational speed of the joining process.

  7. Semi-solid process of 2024 wrought aluminum alloy by strain induced melt activation

    Directory of Open Access Journals (Sweden)

    Surachai Numsarapatnuk

    2013-10-01

    Full Text Available The aim of this study is to develop a production process of a fine globular structure feedstock of the 2024 aluminumalloy suitable for subsequent semi-solid forming. The 2024 wrought aluminum alloy was first annealed to reduce the effect ofwork hardening. Then, strain was induced in the alloy by cold compression. After that the microstructural evolution duringpartial melting was investigated. The samples were subjected to full annealing at 415°C for 3 hrs prior to cold compression of40% reduction of area (RA with 3 mm/min strain rate. After that samples were partially melted at 620°C with varying holdingtime from 0 to 60 min followed by water quenching. The grain size and the average grain diameter of solid grains weremeasured using the linear intercept method. The globularization was interpreted in terms of shape factor. Liquid fraction andthe distribution of the eutectic liquid was also investigated. It was found that during partial melting, the globular morphologywas formed by the liquid wetting and fragmentation of high angle boundaries of recrystallized grains. The suitable semi-solidmicrostructure was obtained from a condition of full annealing, 40% cold working and partial melting at 620°C for 6 minholding time. The near globular grains obtained in the range of 0-60 min consisted of uniform spheroid grains with an averagegrain diameter ranged from 73 to 121 m, quenched liquid fraction was approximately 13–27% and the shape factor was greaterthan 0.6. At a holding time of less than 6 min, grain coarsening was dominant by the immigration of high-angle grainboundaries. At a longer holding time, liquid fraction increased and Ostwald ripening was dominant. The coarsening rateconstant for the 2024 Al alloy was 400.36 mm3.s-1. At a soaking time of 60 min, it was found that a minimum diameter differencewas 1.06% with coarsening index n=3 in a power law equation. The non-dendritic slug of 2024 alloy was rapid compressedinto a disc with 90%RA

  8. Interface analysis of A1 matrix composites produced by hot isostatic pressing, squeeze casting and semi-solid processing

    International Nuclear Information System (INIS)

    Shamsul, J.B.; Zainal Arifin Ahmad; Faaizulaswad, M.S.; Azmi, R.

    2000-01-01

    The interface analysis has been carried out an aluminium based composites system produced by hot isostatic pressing, squeeze casting and semi-solid processing. A range of different fabrication techniques has been used to produce different types of microstructure of Al 2124 (Al-Cu-Mg) reinforced with 5 weight % SiC particles. Blending followed by hot isostatic pressing is used to fabricate composite I. Composite II was 6061 (Al-Si-Mg) wrought aluminium alloy reinforced with fibres of alumina-silica (V f = 0.58) and fabricated by squeeze casting. Finally, A356 (AlSi7Mg0.3) alloy was reinforced with 20 Vol.% of SiC particles (13 μm) and namely as composite III. Composite III is fabricated by semi-solid processing. Interface analysis was done by optical microscopy, scanning and transmission electron microscopy. Composite I exhibited good interface bonding and dislocation was also observed near the interface. Elements such as Al, Fe, Cr, Mn were found near the interface of composite II and intermetallic of iron rich inclusion and Mg 2 Si were observed near the interface of composite III. (Author)

  9. In situ X-ray observation of semi-solid deformation and failure in Al-Cu alloys

    Energy Technology Data Exchange (ETDEWEB)

    Phillion, A.B., E-mail: andre.phillion@ubc.ca [School of Engineering, University of British Columbia, 3333 University Way, Kelowna, BC, V1V 1V7 (Canada); Hamilton, R.W.; Fuloria, D.; Leung, A.C.L.; Rockett, P. [Department of Materials, Imperial College London, Prince Consort Road, London SW7 2BP (United Kingdom); Connolley, T. [Diamond Light Source Ltd., Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom); Lee, P.D. [Department of Materials, Imperial College London, Prince Consort Road, London SW7 2BP (United Kingdom)

    2011-02-15

    Semi-solid deformation has been directly observed in an Al-12 wt.% Cu alloy through the combination of real-time synchrotron X-ray radiography and a bespoke high-temperature tensile tester over a range of fraction solid from 0.35 to 0.98. During deformation at low and moderate fraction solids, the X-ray radiographs indicate that there is significant feeding of interdendritic liquid in the region of strain localization prior to crack formation. Furthermore, the measured load required to initiate localized tensile deformation was found to be similar over the range of fraction solid 0.35 to 0.66. At higher fraction solids, the radiographic observations are consistent with classical hot tearing behaviour: limited liquid flow due to low permeability; void nucleation and coalescence; and final failure. Based on these results, a three-stage mechanism for semi-solid failure is proposed which includes the effects of liquid flow and micro-neck formation.

  10. Importance of crystallinity of anchoring block of semi-solid amphiphilic triblock copolymers in stabilization of silicone nanoemulsions.

    Science.gov (United States)

    Le Kim, Trang Huyen; Jun, Hwiseok; Nam, Yoon Sung

    2017-10-01

    Polymer emulsifiers solidified at the interface between oil and water can provide exceptional dispersion stability to emulsions due to the formation of unique semi-solid interphase. Our recent works showed that the structural stability of paraffin-in-water emulsions highly depends on the oil wettability of hydrophobic block of methoxy poly(ethylene glycol)-block-poly(ε-caprolactone) (mPEG-b-PCL). Here we investigate the effects of the crystallinity of hydrophobic block of triblock copolymer-based emulsifiers, PCLL-b-PEG-b-PCLL, on the colloidal properties of silicone oil-in-water nanoemulsions. The increased ratio of l-lactide to ε-caprolactone decreases the crystallinity of the hydrophobic block, which in turn reduces the droplet size of silicone oil nanoemulsions due to the increased chain mobility at the interface. All of the prepared nanoemulsions are very stable for a month at 37°C. However, the exposure to repeated freeze-thaw cycles quickly destabilizes the nanoemulsions prepared using the polymer with the reduced crystallinity. This work demonstrates that the anchoring chain crystallization in the semi-solid interphase is critically important for the structural robustness of nanoemulsions under harsh physical stresses. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Multiphase Model of Semisolid Slurry Generation and Isothermal Holding During Cooling Slope Rheoprocessing of A356 Al Alloy

    Science.gov (United States)

    Das, Prosenjit; Samanta, Sudip K.; Mondal, Biswanath; Dutta, Pradip

    2018-04-01

    In the present paper, we present an experimentally validated 3D multiphase and multiscale solidification model to understand the transport processes involved during slurry generation with a cooling slope. In this process, superheated liquid alloy is poured at the top of the cooling slope and allowed to flow along the slope under the influence of gravity. As the melt flows down the slope, it progressively loses its superheat, starts solidifying at the melt/slope interface with formation of solid crystals, and eventually exits the slope as semisolid slurry. In the present simulation, the three phases considered are the parent melt as the primary phase, and the solid grains and air as secondary phases. The air phase forms a definable air/liquid melt interface as the free surface. After exiting the slope, the slurry fills an isothermal holding bath maintained at the slope exit temperature, which promotes further globularization of microstructure. The outcomes of the present model include prediction of volume fractions of the three different phases considered, grain evolution, grain growth, size, sphericity and distribution of solid grains, temperature field, velocity field, macrosegregation and microsegregation. In addition, the model is found to be capable of making predictions of morphological evolution of primary grains at the onset of isothermal coarsening. The results obtained from the present simulations are validated by performing quantitative image analysis of micrographs of the rapidly oil-quenched semisolid slurry samples, collected from strategic locations along the slope and from the isothermal slurry holding bath.

  12. Three-dimensional granular model of semi-solid metallic alloys undergoing solidification: Fluid flow and localization of feeding

    International Nuclear Information System (INIS)

    Sistaninia, M.; Phillion, A.B.; Drezet, J.-M.; Rappaz, M.

    2012-01-01

    A three-dimensional (3-D) granular model which simulates fluid flow within solidifying alloys with a globular microstructure, such as that found in grain refined Al alloys, is presented. The model geometry within a representative volume element (RVE) consists of a set of prismatic triangular elements representing the intergranular liquid channels. The pressure field within the liquid channels is calculated using a finite elements (FEs) method assuming a Poiseuille flow within each channel and flow conservation at triple lines. The fluid flow is induced by solidification shrinkage and openings at grain boundaries due to deformation of the coherent solid. The granular model predictions are validated against bulk data calculated with averaging techniques. The results show that a fluid flow simulation of globular semi-solid materials is able to reproduce both a map of the 3-D intergranular pressure and the localization of feeding within the mushy zone. A new hot cracking sensitivity coefficient is then proposed. Based on a mass balance performed over a solidifying isothermal volume element, this coefficient accounts for tensile deformation of the semi-solid domain and for the induced intergranular liquid feeding. The fluid flow model is then used to calculate the pressure drop in the mushy zone during the direct chill casting of aluminum alloy billets. The predicted pressure demonstrates that deep in the mushy zone where the permeability is low the local pressure can be significantly lower than the pressure predicted by averaging techniques.

  13. Comparison of the semisolid shear behaviour of Al-7Si-0.35Mg alloys produced by two casting methods

    Energy Technology Data Exchange (ETDEWEB)

    Wang, H.; StJohn, D.H. [Queensland Univ., St. Lucia, QLD (Australia). Cooperative Res. Centre for Alloy and Solidification Technol.; Davidson, C.J. [Cooperative Research Centre for Alloy and Solidification Technology, CSIRO Mfg. Science and Technology, Kenmore, QLD (Australia); Couper, M.J. [Cooperative Research Centre for Alloy and Solidification Technology, Comalco Aluminium Ltd., Thomastown, Vic. (Australia)

    2000-07-01

    Al-7%Si-0.35%Mg alloys, with and without grain refiner addition, were produced by casting into cylindrical moulds. Their microstructure and shear behaviour in the semisolid state were compared with a standard thixotropic 356 alloy that was produced by electromagnetic stirring (EMS). The as-cast microstructures of the cast materials consisted of equiaxed grains with rosette-dendritic morphology, while the EMS material was made up of very fine and rosette-like grains but with a significant number of large grains or agglomerates. After partial remelting and isothermal holding, the cast materials lost their dendritic nature and became globular. The EMS material continued to contain large globular particles after isothermal holding. The shear behaviour of the semisolid materials was measured by a direct shear test. The shear resistance was high if the material had a dendritic microstructure, and was reduced after a globular microstructure developed during isothermal holding. The shear strength for the three alloy conditions studied varied with isothermal holding time and this was related to microstructural differences between the alloys. (orig.)

  14. Antimicrobial activity of sugar-based semisolid polyherbal ayurvedic formulation: Chyawanprash

    Directory of Open Access Journals (Sweden)

    Mohammad Ahmed Khan

    2016-01-01

    Full Text Available Objective: This study evaluated the antimicrobial activity of chloroform (CHCl3 extracts of chyawanprash (Dabur India Ltd., Uttar Pradesh, India and hydrolyzed chyawanprash against Escherichia coli and Staphylococcus aureus on nutrient agar media using cup plate method. Materials and Methods: CHCl3extracts of chyawanprash were prepared directly as well as by previously hydrolyzing with dilute HCl. Three test groups of 10, 20, and 50 mg/ml were prepared for each CHCl3extract, whereas ampicillin 20 mg/ml was used as standard group. Further, six agar plates were prepared for each group, i.e., three for E. coli and three for S. aureus. Cups were bored on each plate with the help of steel cup borer and cups on each plate were marked for identification. Extracts of different concentrations (i.e., 10, 20, and 50 mg/ml were poured into cups and all plates were then incubated at 37°C for 48 h. After incubation, plates were observed for bacterial growth and zone of inhibition were measured. Results: Results showed that both CHCl3as well as hydrolyzed CHCl3extract of chyawanprash showed concentration-dependent antimicrobial activity. The largest zone of inhibition was observed at the concentration of 50 mg/ml of both CHCl3extracts of chyawanprash (12.7 ± 1.5 mm for E. coli and 15.0 ± 1.0 mm for S. aureus and hydrolyzed chyawanprash (14.3 ± 0.6 mm for E. coli and 16.3 ± 0.6 mm for S. aureus. Conclusion: Chyawanprash possesses promising potential for use as an antimicrobial agent.

  15. New milk medium for germ tube and chlamydoconidia production by Candida albicans.

    Science.gov (United States)

    Jitsurong, S; Kiamsiri, S; Pattararangrong, N

    1993-08-01

    A new medium consisting of UHT milk, tween 80 and agar is described for the development of both germ tube and chlamydoconidia by Candida albicans. In total 172 isolates from clinical specimens, including C. albicans (112), C. guilliermondii (4), C. krusei (3), C. parasilopsis (16). C. tropicalis (28), Torulopsis glabrata (6) and Trichosporon beigellii (3), were examined in this medium by using the standard method. A higher percentage (98.2%) of germ tube production by C. albicans was found in this medium than in undiluted serum (90.2%). In addition, only C. albicans was found to be able to produce a high percentage of chlamydoconidia (95.5%) after 48 hours' incubation. In comparison with the conventional medium, corn meal tween 80 agar (21.4%), this new medium gives a significantly higher percentage and abundance of chlamydoconidia production. Being simple, cheap and easy to prepare, the new milk medium is proposed as very practical in the clinical mycology laboratory.

  16. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  17. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  18. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  19. Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

    1969-07-15

    In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

  20. Selective medium for culture of Mycoplasma hyopneumoniae.

    Science.gov (United States)

    Cook, Beth S; Beddow, Jessica G; Manso-Silván, Lucía; Maglennon, Gareth A; Rycroft, Andrew N

    2016-11-15

    The fastidious porcine respiratory pathogen Mycoplasma hyopneumoniae has proven difficult to culture since it was first isolated in 1965. A reliable solid medium has been particularly challenging. Moreover, clinical and pathological samples often contain the fast-growing M. hyorhinis which contaminates and overgrows M. hyopneumoniae in primary culture. The aim of this study was to optimise the culture medium for recovery of M. hyopneumoniae and to devise a medium for selection of M. hyopneumoniae from clinical samples also containing M. hyorhinis. The solid medium devised by Niels Friis was improved by use of Purified agar and incorporation of DEAE-dextran. Addition of glucose or neutralization of acidity in liquid medium with NaOH did not improve the final yield of viable organisms or alter the timing of peak viability. Analysis of the relative susceptibility of M. hyopneumoniae and M. hyorhinis strains to four antimicrobials showed that M. hyopneumoniae is less susceptible than M. hyorhinis to kanamycin. This was consistent in all UK and Danish strains tested. A concentration of 2μg/ml of kanamycin selectively inhibited the growth of all M. hyorhinis tested, while M. hyopneumoniae was able to grow. This forms the basis of an effective selective culture medium for M. hyopneumoniae. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Comparative evaluation of Strepto B ID chromogenic medium and Granada media for the detection of Group B streptococcus from vaginal samples of pregnant women.

    Science.gov (United States)

    Tazi, Asmaa; Réglier-Poupet, Hélène; Dautezac, François; Raymond, Josette; Poyart, Claire

    2008-06-01

    Two types of selective media, the chromogenic medium Strepto B ID and two non-chromogenic media Strepto B agar and the Granada medium, were tested and compared to blood agar plates (BAP) for screening of Group B streptococcus vaginal colonization in pregnant women. All tested media were comparable in terms of sensitivity however, their use in routine laboratories may markedly facilitate the rapid detection of GBS in vaginal samples.

  2. The electrophoretic softness of the surface of Staphylococcus epidermidis cells grown in a liquid medium and on a solid agar

    NARCIS (Netherlands)

    Kiers, PJM; van der Mei, HC; Busscher, HJ; Bos, R.R.M.

    Many Staphylococcus epidermidis strains possess capsule or slime layers and consequently the staphylococcal cell surface should be regarded as a soft, polyelectrolyte layer allowing electrophoretic fluid flow through a layer of fixed charges. The presence of such a soft layer decreases the energy

  3. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  4. X-ray tomography studies on porosity and particle size distribution in cast in-situ Al-Cu-TiB{sub 2} semi-solid forged composites

    Energy Technology Data Exchange (ETDEWEB)

    Mathew, James; Mandal, Animesh [School of Minerals, Metallurgical and Materials Engineering, Indian Institute of Technology, Bhubaneswar (India); Warnett, Jason; Williams, Mark A. [WMG, University of Warwick, Coventry CV4 7AL (United Kingdom); Chakraborty, Madhusudan [Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Kharagpur (India); Srirangam, Prakash, E-mail: p.srirangam@warwick.ac.uk [WMG, University of Warwick, Coventry CV4 7AL (United Kingdom)

    2016-08-15

    X-ray computed tomography (XCT) was used to characterise the internal microstructure and clustering behaviour of TiB{sub 2} particles in in-situ processed Al-Cu metal matrix composites prepared by casting method. Forging was used in semi-solid state to reduce the porosity and to uniformly disperse TiB{sub 2} particles in the composite. Quantification of porosity and clustering of TiB{sub 2} particles was evaluated for different forging reductions (30% and 50% reductions) and compared with an as-cast sample using XCT. Results show that the porosity content was decreased by about 40% due to semi-solid forging as compared to the as-cast condition. Further, XCT results show that the 30% forging reduction resulted in greater uniformity in distribution of TiB{sub 2} particles within the composite compared to as-cast and the 50% forge reduction in semi-solid state. These results show that the application of forging in semi-solid state enhances particle distribution and reduces porosity formation in cast in-situ Al-Cu-TiB{sub 2} metal matrix composites. - Highlights: •XCT was used to visualise 3D internal structure of Al-Cu-TiB{sub 2} MMCs. •Al-Cu-TiB{sub 2} MMC was prepared by casting using flux assisted synthesis method. •TiB{sub 2} particles and porosity size distribution were evaluated. •Results show that forging in semi-solid condition decreases the porosity content and improve the particle dispersion in MMCs.

  5. Effect of initial as-cast microstructure on semisolid microstructure of AZ91D alloy during the strain-induced melt activation process

    International Nuclear Information System (INIS)

    Wang, J.G.; Lin, H.Q.; Li, Y.Q.; Jiang, Q.C.

    2008-01-01

    The effects of different as-cast microstructures which were initially cast in graphite, metal, sand and firebrick moulds, respectively on the semisolid microstructure of AZ91D alloy, have been investigated during the strain-induced melt activation (SIMA) process. The experimental results showed that the moulds with high cooling capacity could produce the fine-grained as-cast microstructure in which the fine α-Mg dendrites were surrounded by a narrow layer of eutectic mixtures. After compressive deformation, in the fine-grained as-cast microstructure, the more systemic strain energy would be gradually accumulated and abundantly stored due to uniform inner crystal lattice distortion, so the recrystallization was easily induced by the stored strain energy at the elevated temperature. As a channel for the diffusion of atoms, the subgrain boundary along which Al element was enriched, foremost melted above the eutectic temperature and resulted in the separation of neighboring subgrains from primary dendrites. Therefore, the refining role of recrystallization on the microstructural evolution from dendrite to globular particles in morphology was easier to play in the fine-grained as-cast microstructure, which was advantageous for the production of fine-grained semisolid microstructure. Additionally, in the fine-grained as-cast microstructure, the melting fracture of narrow secondary dendritic arms was easy to occur in their roots, which also attributed to the production of fine globular grains in semisolid microstructure from primary dendrites. The finer dendrites in the initial as-cast alloy could evolve into the finer globular grains with relatively small grain size distribution range in the semisolid microstructure during partial remelting; therefore, the finer the dendrites in the initial as-cast microstructure, the better were the tensile properties of the evolved semisolid microstructure

  6. Preparation and evaluation of valsartan by a novel semi-solid self-microemulsifying delivery system using Gelucire 44/14.

    Science.gov (United States)

    Zhao, Kun; Yuan, Yue; Wang, Hui; Li, Panpan; Bao, Zhihong; Li, Yue

    2016-10-01

    The aim of the present study was to develop a novel semi-solid self-microemulsifying drug delivery system (SMEDDS) using Gelucire(®) 44/14 as oil with strong solid character to improve the oral bioavailability of poorly soluble drug valsartan. The solubility of valsartan in various excipients was determined, the pseudo-ternary phase diagram was constructed in order to screen the optimal excipients, and DSC analysis was performed to evaluate the melting point of SMEDDS. The optimal drug-loaded SMEDDS formulation was consisted of 30% Gelucire(®) 44/14 (oil), 40% Solutol(®) HS 15 (surfactant), and 30% Transcutol(®) P (cosurfactant) (w/w) with 80 mg valsartan/g excipients. The average droplet sizes of the optimized blank and drug-loaded SMEDDS formulations were 26.20 ± 1.43 and 33.34 ± 2.15 nm, and the melting points of them were 35.6 and 36.8 °C, respectively. The in vitro dissolution rate of optimal semi-solid SMEDDS was increased compared with commercial capsules, resulting in the 2.72-fold and 2.97-fold enhancement of Cmax and AUC0-t after oral administration in rats, respectively. These results indicated that the novel semi-solid SMEDDS formulation could potentially improve the oral bioavailability of valsartan, and the semi-solid SMEDDS was a desirable system than the traditional liquid SMEDDS because it was convenient for preparation, storage and transportation due to semi-solid state at room temperature and melted state at body temperature.

  7. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  8. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  9. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  10. A Method Based on Semi-Solid Forming for Eliminating Coarse Dendrites and Shrinkage Porosity of H13 Tool Steel

    Directory of Open Access Journals (Sweden)

    Yifeng Guo

    2018-04-01

    Full Text Available A method called forging solidifying metal (FSM, which is applied for eliminating coarse dendrites and shrinkage porosity defects of ferrous alloys was proposed based on semi-solid forming technology (SSF. To verify its feasibility, the effects of liquid fraction (FL on the microstructure of the deformed H13 steel were investigated experimentally. The coarse dendrites structure still existed and cracks appeared when the 0.1/s 50% FSM method was carried out at ~20% FL. What is significantly different from that is, the elimination of the coarse dendrites structure and shrinkage porosity defects became more significant, when this method was conducted at the end of solidification (FL < 10%. The microstructure of H13 steel was significantly refined and also became dense in such condition.

  11. Effect of guar gum and fiber-enriched wheat bran on gastric emptying of a semisolid meal in healthy subjects

    Energy Technology Data Exchange (ETDEWEB)

    Rydning, A.; Berstad, A.; Berstad, T.; Hertzenberg, L.

    1985-01-01

    The effect of physiological doses of guar gum (Guarem), 5 g, and fiber-enriched wheat bran (Fiberform), 10.5 g, on gastric emptying was studied by two different methods in healthy subjects: by a simple isotope localization monitor placed over the upper part of the abdomen, and by gamma camera. The fiber preparations were added to a semisolid meal consisting of wheatmeal porridge and juice, using technetium-99 DTPA as a marker. The gamma camera showed no effect of fiber on gastric emptying. The isotope localization monitor, however, indicated that Fiberform prevented postprandial accumulation of the meal within the upper part of stomach. The simple isotope localization monitor cannot be recommended for measurements of gastric emptying.

  12. Numerical simulation of the induction heating of hybrid semi-finished materials into the semi-solid state

    Science.gov (United States)

    Seyboldt, Christoph; Liewald, Mathias

    2017-10-01

    Current research activities at the Institute for Metal Forming Technology (IFU) of the University of Stuttgart are focusing on the manufacturing of hybrid components using semi-solid forming strategies. As part of the research project "Hybrid interaction during and after thixoforging of multi-material systems", which is founded by the German Research Foundation (DFG), a thixoforging process for producing hybrid components with cohesive metal-to-metal connections is developed. In this context, this paper deals with the numerical simulation of the inductive heating process of hybrid semi-finished materials, consisting of two different aluminium alloys. By reason of the skin effect that leads to inhomogeneous temperature distributions during inductive heating processes, the aluminium alloy with the higher melting point is thereby assembled in the outer side and the alloy with the lower melting point is assembled in the core of the semi-finished material. In this way, the graded heat distribution can be adapted to the used materialś flow properties that are heavily heat dependent. Without this graded heat distribution a proper forming process in the semi-solid state will not be possible. For numerically modelling the inductive heating system of the institute, a coupling of the magnetostatic and the thermal solver was realized by using Ansys Workbench. While the electromagnetic field and its associated heat production rate were solved in a frequency domain, the temperature development was solved in the time based domain. The numerical analysis showed that because of the high thermal conductivity of the aluminium, which leads to a rapid temperature equalization in the semi-finished material, the heating process has to be fast and with a high frequency for produce most heat in the outer region of the material. Finally, the obtained numerical results were validated with experimental heating tests.

  13. Bacterial growth on Mueller Hinton medium sterilized by γ-radiation

    International Nuclear Information System (INIS)

    Eisenberg, E.; Bogokowsky, B.; Altmann, G.; Tel Aviv Univ.

    1981-01-01

    The possibility of radiosterilization of culture media for the cultivation of bacteria was investigated. Mueller Hinton agar, a medium widely used for the propagation of some fastidious pathogenic bacteria, was sterilized with 1.0 and 1.5 Mrad doses of γ-radiation. Bacteria belonging to seven different species grew as well on the radiosterilized medium as on medium sterilized by heat in a conventional way. Reduction in colony size was observed on the radiosterilized medium with Staphylococcus aureus and Shigella boydii. Neisseria meningitidis, the most fastidious bacterium tested, did not grow at all. The addition of small amounts of catalase corrected the deleterious radiation effect and all bacteria tested could be successfully grown on irradiated Mueller Hinton agar supplemented with up to 11 Keil units catalase per liter medium. (author)

  14. Prospective Comparison of a New Chromogenic Medium, MRSASelect, to CHROMagar MRSA and Mannitol-Salt Medium Supplemented with Oxacillin or Cefoxitin for Detection of Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Stoakes, Luba; Reyes, Romina; Daniel, Janis; Lennox, Gwen; John, Michael A.; Lannigan, Robert; Hussain, Zafar

    2006-01-01

    MRSASelect agar was compared to CHROMagar, mannitol-salt agar with oxacillin, and mannitol-salt agar with cefoxitin (MSA-CFOX) for the isolation of methicillin-resistant Staphylococcus aureus (MRSA). The sensitivities and specificities were 97.3% and 99.8%, 82.9% and 99.1%, 80.2% and 79%, and 99.1% and 84.8%, respectively. MSA-CFOX and MRSASelect had a high sensitivity. MRSASelect, however, was more specific and proved to be a more reliable and rapid medium for the detection of MRSA. PMID:16455933

  15. Selective medium for the isolation of Bacteroides gingivalis.

    OpenAIRE

    Hunt, D E; Jones, J V; Dowell, V R

    1986-01-01

    Bacteroides gingivalis has been implicated in various forms of periodontal disease and may be responsible for other diseases in humans. The role of B. gingivalis in disease has been difficult to assess, because it is inhibited by most selective media commonly used by clinical laboratories to aid in isolating gram-negative, nonsporeforming anaerobes. We have developed a new medium, Bacteroides gingivalis agar, which contains bacitracin, colistin, and nalidixic acid as selective agents. This me...

  16. Comparison of different agar diffusion methods for the detection of residues in the kidneys of pigs treated with antimicrobial drugs.

    Science.gov (United States)

    Korkeala, H; Sorvettula, O; Mäki-Petäys, O; Hirn, J

    1983-01-01

    Residue analyses of the kidneys of twenty-six pigs treated with various antimicrobial drugs 20 h before slaughter and of eleven untreated pigs were performed. The effects of storage temperature of the kidneys, and of sampling location, on the residue analysis were also studied. No method alone was sufficient for the detection of residues. Oxytetracycline residues could be detected at pH 6, dihydrostreptomycin residues at pH 8, and sulphonamide residues if trimethoprim was present in the medium. Chloramphenicol, penicillin G procaine, tylosin and lincomycin residues were not detectable with the methods used. The concentration of ampicillin decreased during the storage of samples at +4°C. Most methods also yielded zones of inhibition for the frozen kidneys from untreated pigs. It seems necessary to use agar media of two different pH values: the addition of trimethoprim to the medium is also needed. The use of fresh pig kidneys, and samples containing both kidney medulla and kidney cortex, is recommended in residue analysis. Copyright © 1983. Published by Elsevier Ltd.

  17. CHROMagar Orientation Medium Reduces Urine Culture Workload

    Science.gov (United States)

    Manickam, Kanchana; Karlowsky, James A.; Adam, Heather; Lagacé-Wiens, Philippe R. S.; Rendina, Assunta; Pang, Paulette; Murray, Brenda-Lee

    2013-01-01

    Microbiology laboratories continually strive to streamline and improve their urine culture algorithms because of the high volumes of urine specimens they receive and the modest numbers of those specimens that are ultimately considered clinically significant. In the current study, we quantitatively measured the impact of the introduction of CHROMagar Orientation (CO) medium into routine use in two hospital laboratories and compared it to conventional culture on blood and MacConkey agars. Based on data extracted from our Laboratory Information System from 2006 to 2011, the use of CO medium resulted in a 28% reduction in workload for additional procedures such as Gram stains, subcultures, identification panels, agglutination tests, and biochemical tests. The average number of workload units (one workload unit equals 1 min of hands-on labor) per urine specimen was significantly reduced (P < 0.0001; 95% confidence interval [CI], 0.5326 to 1.047) from 2.67 in 2006 (preimplementation of CO medium) to 1.88 in 2011 (postimplementation of CO medium). We conclude that the use of CO medium streamlined the urine culture process and increased bench throughput by reducing both workload and turnaround time in our laboratories. PMID:23363839

  18. Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

    Science.gov (United States)

    Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

    2014-05-01

    A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

  19. Effects of extracellular matrix proteins on macrophage differentiation, growth, and function: comparison of liquid and agar culture systems

    Science.gov (United States)

    Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Both spaceflight and skeletal unloading suppress the haematopoietic differentiation of macrophages (Sonnenfeld et al., Aviat. Space Environ. Med., 61:648-653, 1990; Armstrong et al., J. Appl. Physiol., 75:2734-2739, 1993). The mechanism behind this reduction in haematopoiesis has yet to be elucidated. However, changes in bone marrow extracellular matrix (ECM) may be involved. To further understand the role of ECM products in macrophage differentiation, we have performed experiments evaluating the effects of fibronectin, laminin, collagen type I, and collagen type IV on macrophage development and function. Bone marrow-derived macrophages cultured on four different ECM substrates in liquid culture medium showed less growth than those cultured on plastic. Significant morphological differences were seen on each of the substrates used. Phenotypically and functionally, as measured by class II major histocompatibility molecule (MHCII) expression, MAC-2 expression, and the secretion of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha), these macrophages were similar. In contrast, bone marrow-derived macrophages cultured in suspension, using agar, showed no difference in growth when exposed to ECM proteins. However, IL-6 and TNF-alpha secretion was affected by fibronectin, laminin, collagen type I, and collagen type IV in a concentration-dependent manner. We conclude that the ECM products fibronectin, laminin, collagen type I, and collagen type IV have profound effects on macrophage development and function. Additionally, we suggest that an ECM-supplemented agar culture system provides an environment more analogous to in vivo bone marrow than does a traditional liquid culture system.

  20. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  1. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  2. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  3. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  4. Simple low cost differentiation of Candida auris from Candida haemulonii complex using CHROMagar Candida medium supplemented with Pal's medium.

    Science.gov (United States)

    Kumar, Anil; Sachu, Arun; Mohan, Karthika; Vinod, Vivek; Dinesh, Kavitha; Karim, Shamsul

    Candida auris is unique due to its multidrug resistance and misidentification as Candida haemulonii by commercial systems. Its correct identification is important to avoid inappropriate treatments. To develop a cheap method for differentiating C. auris from isolates identified as C. haemulonii by VITEK2. Fifteen C. auris isolates, six isolates each of C. haemulonii and Candida duobushaemulonii, and one isolate of Candida haemulonii var. vulnera were tested using CHROMagar Candida medium supplemented with Pal's agar for better differentiation. On CHROMagar Candida medium supplemented with Pal's agar all C. auris strains showed confluent growth of white to cream colored smooth colonies at 37°C and 42°C after 24 and 48h incubation and did not produce pseudohyphae. The isolates of the C. haemulonii complex, on the contrary, showed poor growth of smooth, light-pink colonies at 24h while at 48h the growth was semiconfluent with the production of pseudohyphae. C. haemulonii complex failed to grow at 42°C. We report a rapid and cheap method using CHROMagar Candida medium supplemented with Pal's agar for differentiating C. auris from isolates identified as C. haemulonii by VITEK2. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Protocolo para produção de material propagativo de batata em meio líquido Protocol for potato propagative material production in liquid medium

    Directory of Open Access Journals (Sweden)

    Jonny Everson Scherwinski Pereira

    2003-09-01

    Full Text Available Os meios semi-sólidos são os mais utilizados em trabalhos de micropropagação, mas há indícios de que o estado físico dos meios de cultura influencia a multiplicação dos cultivos. O objetivo deste trabalho foi estabelecer um protocolo para a multiplicação de material propagativo de batata em meio de cultura líquido. Explantes de batata da cultivar Eliza, com uma gema axilar, foram cultivados em seis diferentes meios de cultura, com (semi-sólido ou sem (líquido a adição do solidificante ágar. Após 21 dias de cultivo, o meio de cultura que proporcionou os melhores resultados para crescimento e taxa de multiplicação teve sua composição modificada com o objetivo de melhorar a eficiência de multiplicação de cinco cultivares em meio líquido. Foi também avaliada a necessidade de agitação dos cultivos em meio líquido. Houve ganho na eficiência de multiplicação in vitro da batata, quando se utiliza meio de cultura líquido. Os melhores resultados são obtidos quando o material é cultivado em meio constituído pelos sais de MS na concentração plena, acrescido de ácido pantotênico (5,0 mg L-1, tiamina (1,0 mg L-1, ácido giberélico (0,25 mg L-1 e sacarose (20 g L-1, sob agitação constante.Semi-solid media are more commonly used in studies of micropropagation, but the physical state of the culture media seems to influence the growth and multiplication rate of the cultivation. The objective of this work was to establish a protocol for in vitro multiplication of potato in liquid culture media. Potato explants, cultivar Eliza, with an axillary bud, were cultivated in six different culture media, with (semi-solid or without (liquid the addition of agar. After 21 days, the culture medium that provided the best results for growth and multiplication rate had the composition modified with the objective of improving the efficiency of in vitro multiplication of five cultivars in liquid medium. The need of agitation was also

  6. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  7. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  10. Effects of solid-medium type on routine identification of bacterial isolates by use of matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    Science.gov (United States)

    Anderson, Neil W; Buchan, Blake W; Riebe, Katherine M; Parsons, Lauren N; Gnacinski, Stacy; Ledeboer, Nathan A

    2012-03-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for the identification of bacteria. Factors that may alter protein profiles, including growth conditions and presence of exogenous substances, could hinder identification. Bacterial isolates identified by conventional methods were grown on various media and identified using the MALDI Biotyper (Bruker Daltonics, Billerica, MA) using a direct smear method and an acid extraction method. Specimens included 23 Pseudomonas isolates grown on blood agar, Pseudocel (CET), and MacConkey agar (MAC); 20 Staphylococcus isolates grown on blood agar, colistin-nalidixic acid agar (CNA), and mannitol salt agar (MSA); and 25 enteric isolates grown on blood agar, xylose lysine deoxycholate agar (XLD), Hektoen enteric agar (HE), salmonella-shigella agar (SS), and MAC. For Pseudomonas spp., the identification rate to genus using the direct method was 83% from blood, 78% from MAC, and 94% from CET. For Staphylococcus isolates, the identification rate to genus using the direct method was 95% from blood, 75% from CNA, and 95% from MSA. For enteric isolates, the identification rate to genus using the direct method was 100% from blood, 100% from MAC, 100% from XLD, 92% from HE, and 87% from SS. Extraction enhanced identification rates. The direct method of MALDI-TOF analysis of bacteria from selective and differential media yields identifications of varied confidence. Notably, Staphylococci spp. from CNA exhibit low identification rates. Extraction enhances identification rates and is recommended for colonies from this medium.

  11. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  12. Effects of silicon, copper and iron on static and dynamic properties of alloy 206 (aluminum-copper) in semi-solids produced by the SEED process

    Science.gov (United States)

    Lemieux, Alain

    The advantages of producing metal parts by rheocasting are generally recognised for common foundry alloys of Al-Si. However, other more performing alloys in terms of mechanical properties could have a great interest in specialized applications in the automotive industry, while remaining competitive in the forming. Indeed, the growing demand for more competitive products requires the development of new alloys better suited to semi-solid processes. Among others, Al-Cu alloys of the 2XX series are known for their superior mechanical strength. However, in the past, 2XX alloys were never candidates for pressure die casting. The main reason is their propensity to hot tearing. Semi-solid processes provide better conditions for molding with the rheological behavior of dough and molding temperatures lower reducing this type of defect. In the initial phase, this research has studied factors that reduce hot tearing susceptibility of castings produced by semi-solid SEED of alloy 206. Subsequently, a comparative study on the tensile properties and fatigue was performed on four variants of the alloy 206. The results of tensile strength and fatigue were compared with the specifications for applications in the automotive industry and also to other competing processes and alloys. During this study, several metallurgical aspects were analyzed. The following main points have been validated: i) the main effects of compositional variations of silicon, iron and copper alloy Al-Cu (206) on the mechanical properties, and ii) certain relationships between the mechanism of hot cracking and the solidification rate in semi-solid. Parts produced from the semi-solid paste coming from the SEED process combined with modified 206 alloys have been successfully molded and achieved superior mechanical properties than the requirements of the automotive industry. The fatigue properties of the two best modified 206 alloys were higher than those of A357 alloy castings and are close to those of the

  13. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  14. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  15. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  16. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  17. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  18. Nanometer, submicron and micron sized aluminum powder prepared by semi-solid mechanical stirring method with addition of ceramic particles

    International Nuclear Information System (INIS)

    Qin, X.H.; Jiang, D.L.; Dong, S.M.

    2004-01-01

    Composite powder, which is a mixture of Al/Al 2 O 3 composite particles and nanometer, submicron and micron sized aluminum powder, was prepared by semi-solid mechanical stirring method with addition of Al 2 O 3 ceramic particles. The ceramic particles have an average diameter of 80 μm and a volume fraction of 15% in the slurry. The methods used to measure the size distribution of particles greater than 50 μm and less than 50 μm were sieve analysis and photosedimentation, respectively. The surface morphology and transverse sections of the composite powder of different sizes were examined by scanning electron microscope (SEM), optical microscope and auger electron spectroscopy (AES). The results indicate that the composite powder prepared in present work have a wide size distribution ranging from less than 50-900 μm, and the aluminum particles and Al/Al 2 O 3 composite particles are separated and isolated. The particles greater than 200 μm and less than 50 μm are almost pure aluminum powder. The rate of conversion of ingot aluminum into particles less than 1 μm containing nanometer and submicron sizes is 1.777 wt.% in this work. The aluminum powder of different sizes has different shape and surface morphology, quasi-spherical in shape with rough surface for aluminum particles of micron scale, irregular in shape for aluminum particles of submicron scale, and quite close to a globular or an excellent globular in shape for aluminum particles of nanometer size. On the other hand, the surface of ceramic particle was coated by aluminum particles with maximum thickness less than 10 μm containing nanometer and submicron sizes as a single layer. It is suggested that the surface of ceramic particles can provide more nucleation sites for solidification of liquid aluminum and the nucleation of liquid aluminum can take place readily, grow and adhere on the surface of ceramic particles, although it is poorly wetted by the liquid aluminum and the semi-solid slurry can

  19. Rheo-processing of an alloy specifically designed for semi-solid metal processing based on the Al-Mg-Si system

    International Nuclear Information System (INIS)

    Patel, J.B.; Liu, Y.Q.; Shao, G.; Fan, Z.

    2008-01-01

    Semi-solid metal (SSM) processing is a promising technology for forming alloys and composites to near-net shaped products. Alloys currently used for SSM processing are mainly conventional aluminium cast alloys. This is an obstacle to the realisation of full potential of SSM processing, since these alloys were originally designed for liquid state processing and not for semi-solid state processing. Therefore, there is a significant need for designing new alloys specifically for semi-solid state processing to fulfil its potential. In this study, thermodynamic calculations have been carried out to design alloys based on the Al-Mg-Si system for SSM processing via the 'rheo-route'. The suitability of a selected alloy composition has been assessed in terms of the criteria considered by the thermodynamic design process, mechanical properties and heat treatability. The newly designed alloy showed good processability with rheo-processing in terms of good control of solid fraction during processing and a reasonably large processing window. The mechanical property variation was very small and the alloy showed good potential for age hardening by T5 temper heat treatment after rheo-processing

  20. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  1. Effect of a Semisolid Formulation of Linum usitatissimum L. (Linseed Oil on the Repair of Skin Wounds

    Directory of Open Access Journals (Sweden)

    Eryvelton de Souza Franco

    2012-01-01

    Full Text Available The purpose of this study was to investigate the effects of a semisolid formulation of linseed oil, SSFLO (1%, 5%, or 10% or in natura linseed oil on skin wounds of rats. We used wound models, incisional and excisional, to evaluate, respectively, the contraction/reepithelialization of the wound and resistance to mechanical traction. The groups (n=6 treated with SSFLO (1% or 5% began the process of reepithelialization, to a significant extent (P<.05, on the sixth day, when compared to the petroleum jelly control group. On 14th day for the groups treated with SSFLO (1% or 5%, 100% reepithelialization was found, while in the petroleum jelly control group, this was only 33.33%. Our study showed that topical administration of SSFLO (1% or 5% in excisional wounds allowed reepithelialization in 100% of treated animals. Therefore, a therapeutic potential of linseed oil, when used at low concentrations in the solid pharmaceutical formulations, is suggested for the process of dermal repair.

  2. Birch Bark Dry Extract by Supercritical Fluid Technology: Extract Characterisation and Use for Stabilisation of Semisolid Systems

    Directory of Open Access Journals (Sweden)

    Markus Armbruster

    2017-03-01

    Full Text Available Triterpene compounds like betulin, betulinic acid, erythrodiol, oleanolic acid and lupeol are known for many pharmacological effects. All these substances are found in the outer bark of birch. Apart from its pharmacological effects, birch bark extract can be used to stabilise semisolid systems. Normally, birch bark extract is produced for this purpose by extraction with organic solvents. Employing supercritical fluid technology, our aim was to develop a birch bark dry extract suitable for stabilisation of lipophilic gels with improved properties while avoiding the use of toxic solvents. With supercritical carbon dioxide, three different particle formation methods from supercritical solutions have been tested. First, particle deposition was performed from a supercritical solution in an expansion chamber. Second, the Rapid Expansion of Supercritical Solutions (RESS method was used for particle generation. Third, a modified RESS-procedure, forming the particles directly into the thereby gelated liquid, was developed. All three methods gave yields from 1% to 5.8%, depending on the techniques employed. The triterpene composition of the three extracts was comparable: all three gave more stable oleogels compared to the use of an extract obtained by organic solvent extraction. Characterizing the rheological behaviour of these gels, a faster gelling effect was seen together with a lower concentration of the extract required for the gel formation with the supercritical fluid (SCF-extracts. This confirms the superiority of the supercritical fluid produced extracts with regard to the oleogel forming properties.

  3. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  4. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  5. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  7. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  8. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  9. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  10. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  11. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  12. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  13. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  14. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  15. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  16. The effect of sporulation medium on Alicyclobacillus acidoterrestris guaiacol production in apple juice

    OpenAIRE

    Molva, Çelenk; Baysal, Ayşe Handan

    2016-01-01

    The present study evaluated the effect of sporulation medium on guaiacol formation from vanillin and vanillic acid by Alicyclobacillus acidoterrestris DSM 3922 in the reconstituted apple juice (pH 3.82, °Brix 11.3). For sporulation, potato dextrose agar and Bacillus acidoterrestris agar were used. After heat-activation, spores were turned into vegetative cells and inoculated into juice samples to a final concentration of 103 or 105 CFU/mL. Samples were incubated at 37 °C for 264 h and guaiaco...

  17. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  18. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  19. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  1. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  2. The fungicidal and phytotoxic properties of benomyl and PPM in supplemented agar media supporting transgenic arabidopsis plants for a Space Shuttle flight experiment

    Science.gov (United States)

    Paul, A. L.; Semer, C.; Kucharek, T.; Ferl, R. J.

    2001-01-01

    Fungal contamination is a significant problem in the use of sucrose-enriched agar-based media for plant culture, especially in closed habitats such as the Space Shuttle. While a variety of fungicides are commercially available, not all are equal in their effectiveness in inhibiting fungal contamination. In addition, fungicide effectiveness must be weighed against its phytotoxicity and in this case, its influence on transgene expression. In a series of experiments designed to optimize media composition for a recent shuttle mission, the fungicide benomyl and the biocide "Plant Preservative Mixture" (PPM) were evaluated for effectiveness in controlling three common fungal contaminants, as well as their impact on the growth and development of arabidopsis seedlings. Benomyl proved to be an effective inhibitor of all three contaminants in concentrations as low as 2 ppm (parts per million) within the agar medium, and no evidence of phytotoxicity was observed until concentrations exceeded 20 ppm. The biocide mix PPM was effective as a fungicide only at concentrations that had deleterious effects on arabidopsis seedlings. As a result of these findings, a concentration of 3 ppm benomyl was used in the media for experiment PGIM-01 which flew on shuttle Columbia mission STS-93 in July 1999.

  3. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  4. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  5. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  6. Glycine-containing selective medium for isolation of Legionellaceae from environmental specimens.

    Science.gov (United States)

    Wadowsky, R M; Yee, R B

    1981-11-01

    Glycine, at a final concentration of 0.3%, has been shown to be an excellent selective agent for the isolation of Legionellaceae. Stock cultures of Legionella pneumophila were not inhibited on buffered charcoal-yeast extract agar containing the amino acid. Among the other Legionellaceae tested, only one of two strains of L. dumoffii and two of six strains of L. micdadei were appreciably inhibited. This medium permitted the isolation of L. pneumophila from environmental specimens with marked inhibition of many non-Legionellaceae bacteria. The selectivity of the medium was subsequently improved by the incorporation of vancomycin (5 microgram/ml) and polymyxin B (100 U/ml). This selective medium, glycine-vancomycin-polymyxin B agar, should facilitate the recovery of Legionellaceae from environmental sources.

  7. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  8. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  9. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  10. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  11. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  12. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  13. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  14. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  15. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  16. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  17. The addition of locust bean gum but not water delayed the gastric emptying rate of a nutrient semisolid meal in healthy subjects

    Directory of Open Access Journals (Sweden)

    Björgell Ola

    2003-06-01

    Full Text Available Abstract Background Most of the previous studies regarding the effects of gel-forming fibres have considered the gastric emptying of liquid or solid meals after the addition of pectin or guar gum. The influence of locust bean gum, on gastric emptying of nutrient semisolid meals in humans has been less well studied, despite its common occurrence in foods. Using a standardised ultrasound method, this study was aimed at investigating if the gastric emptying in healthy subjects could be influenced by adding locust been gum, a widely used thickening agent, or water directly into a nutrient semisolid test meal. Methods The viscosity of a basic test meal (300 g rice pudding, 330 kcal was increased by adding Nestargel (6 g, 2.4 kcal, containing viscous dietary fibres (96.5% provided as seed flour of locust bean gum, and decreased by adding 100 ml of water. Gastric emptying of these three test meals were evaluated in fifteen healthy non-smoking volunteers, using ultrasound measurements of the gastric antral area to estimate the gastric emptying rate (GER. Results The median value of GER with the basic test meal (rice pudding was estimated at 63 %, (range 47 to 84 %, (the first quartile = 61 %, the third quartile = 69 %. Increasing the viscosity of the rice pudding by adding Nestargel, resulted in significantly lower gastric emptying rates (p p = 0.28 compared to the GER of the basic test meal. Conclusions We conclude that the addition of locust bean gum to a nutrient semisolid meal has a major impact on gastric emptying by delaying the emptying rate, but that the addition of water to this test meal has no influence on gastric emptying in healthy subjects.

  18. Factors Associated with Early Introduction of Formula and/or Solid, Semi-Solid or Soft Foods in Seven Francophone West African Countries

    Directory of Open Access Journals (Sweden)

    Abukari I. Issaka

    2015-01-01

    Full Text Available The aim of this study was to identify factors associated with early introduction of formula and/or solid, semi-solid or soft foods to infants aged three to five months in seven Francophone West African countries. The sources of data for the analyses were the most recent Demographic and Health Survey datasets of the seven countries, namely Benin (BDHS, 2012, Burkina Faso (BFDHS, 2010, Cote d’Ivoire (CIDHS, 2011–2012, Guinea (GDHS, 2012, Mali (MDHS, 2012–2013, Niger (NDHS, 2012 and Senegal (SDHS, 2010. The study used multiple logistic regression methods to analyse the factors associated with early introduction of complementary feeding using individual-, household- and community-level determinants. The sample was composed of 4158 infants aged between three and five months with: 671 from Benin, 811 from Burkina Faso, 362 from Cote d’Ivoire, 398 from Guinea, 519 from Mali, 767 from Niger and 630 from Senegal. Multiple analyses indicated that in three of the seven countries (Benin, Guinea and Senegal, infants who suffered illnesses, such as diarrhoea and acute respiratory infection, were significantly more likely to be introduced to formula and/or solid, semi-solid or soft foods between the age of three and five months. Other significant factors included infants who: were born in second to fourth position (Benin, whose mothers did not attend any antenatal clinics (Burkina Faso and Niger, were male (Cote d’Ivoire and Senegal, lived in an urban areas (Senegal, or were delivered by traditional birth attendants (Guinea, Niger and Senegal. Programmes to discourage early introduction of formula and/or solid, semi-solid or soft foods in these countries should target the most vulnerable segments of the population in order to improve exclusive breastfeeding practices and reduce infant mortality.

  19. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  20. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  1. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  2. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  3. Semisolid meal enriched in oat bran decreases plasma glucose and insulin levels, but does not change gastrointestinal peptide responses or short-term appetite in healthy subjects

    DEFF Research Database (Denmark)

    Juvonen, Kristiina R.; Salmenkallio-Marttila, Marjatta; Lyly, Marika

    2011-01-01

    types and amounts of DF exert are still poorly understood. METHODS AND RESULTS: We investigated the effects of wheat and oat brans alone and as combination in semisolid food matrix on postprandial appetite profile and gastrointestinal (GI) hormonal responses. Twenty healthy, normal-weight subjects (5...... including 5 g wheat bran DF + 5 g oat bran DF. Blood samples were drawn before and 15, 30, 45, 60, 90, 120 and 180 min after the test meals to determine plasma glucose, ghrelin, peptide YY (PYY) and serum insulin concentrations. Subjective profiles of appetite were assessed using visual analogue scales (VAS...

  4. Proliferation and glucosinolates accumulation of broccoli adventitious roots in liquid medium

    Science.gov (United States)

    Nhut, Nguyen Minh; Tien, Le Thi Thuy

    2017-09-01

    Cotyledons from 7-day-old in vitro broccoli seedling were used as explant source in adventitious root induction on MS medium supplemented with 30 g/l sucrose, 1.6 mg/l IBA and 7 g/l agar. Adventitious roots from cotyledons were transferred to liquid medium containing the same components as rooting medium for two weeks, then subcultured to MS medium with diferent sugar, macrominerals and casein hydrolysate concentrations. The best adventitious root growth was observed in half-strength MS medium supplemented with 40 g/l sucrose, 600 mg/l casein hydrolysate and 1.6 mg/l IBA (growth index of 4.00 in about 14 culture days with inoculum density of 1.0 g fresh weight / 30 ml of culture medium). The culturing process can be stopped on the 28th day for root biomass and on the 35th day for glucosinolates.

  5. Thin-layer agar (TL7H11 for rapid isolation of Mycobacterium tuberculosis in sputum specimens

    Directory of Open Access Journals (Sweden)

    Habiba Binte Alam

    2016-08-01

    Full Text Available Background: Tuberculosis (TB remains one of the major causes of death from a single infectious agent worldwide. The early detection of new cases of pulmonary tuberculosis is an important goal in tuberculosis control program.Objective: 1n this study, thin layer agar (TLA culture was compared with Lowenstein-Jensen (LJ culture for rapid detection of pulmonary tuberculosis. Methods: It was a cross sectional study conducted in National Tuberculosis Reference Labora­tory (NTRL of National Institute of Disease of Chest and Hospital (NIDCH, Dhaka, from July 2010 to June 2011. A total of 100 sputum smear positive for acid fast bacilli (AFB by Z-N staining, pulmonary tuberculosis patients were included in this study. Samples were processed by modified Petroff method and then cultured on thin layer 7H11(TL7H11 plates and L-J tubes. TL7H11 plates were observed microscopically for rnicrocolony growth once a week for 6 weeks, and L-J tubes were observed once a week for 8 weeks. Results: The recovery rates of mycobacteria on only TLA, only LJ and on both media were 90%, 97% and 88% respectively. Overall positivity was 99% in both L-J and TLA media. Mean time for detection of mycobacteria on TLA was 9.04±1.66 days compared to 21.78±6.19 days on L-J media. The rate of contamination was higher (6% in L-J media than in TLA media (4%. Conclusion: The TL7H11 media can be used as an alternative to the Lowenstein-Jensen medium for early isolation of mycobacteria in resource constrained settings.

  6. Cross-Permeability of the Semisolid Region in Directional Solidification: A Combined Phase-Field and Lattice-Boltzmann Simulation Approach

    Science.gov (United States)

    Böttger, B.; Haberstroh, C.; Giesselmann, N.

    2016-01-01

    Based on the results of microstructure simulations, fluid flow through the semisolid region during directional solidification of the technical Ni-base alloy 718 has been studied. Three-dimensional microstructures at different positions in the semisolid region were obtained by using a multicomponent multiphase-field model that was online coupled to a commercial thermodynamic database. For the range of five different primary dendrite distances λ 1 between 50 µm and 250 µm, the flow velocity and the permeability perpendicular to the dendrite growth direction was evaluated by using a proprietary Lattice-Boltzmann model. The commercial CFD software ANSYS FLUENT was alternatively applied for reference. Consistent values of the average flow velocity along the dendrites were obtained for both methods. From the results of the fluid flow simulations, the cross-permeability was evaluated as a function of temperature and fraction liquid for each of the five different primary dendrite distances λ 1. The obtained permeability values can be approximated by a single analytical function of the fraction liquid and λ 1 and are discussed and compared with known relations from the literature.

  7. Characterization of Newly Developed Semisolid Stir Joining Method for Cast Cu Base Alloy (Cu-Al-Si-Fe) and Effect of Stirrer Type on Uniformity of Microstructure

    Science.gov (United States)

    Ferasat, Keyvan; Aashuri, Hossein; Kokabi, Amir Hossein; Nikzad, Siamak; Shafizadeh, Mahdi

    2015-02-01

    In this research, the semisolid stir joining method was used to overcome the problem of hot cracking in welding aluminum and silicon bronzes. Moreover, the effects of grooved and cylindrical tools on the microstructure and mechanical properties of samples were examined. After welding specimens, mechanical tests were carried out to find differences between the cast and welded samples. Optical microscopy and scanning electron microscopy were used to study microstructure. X-ray diffraction was used to investigate compounds formed during casting and welding. The solidus and liquidus temperatures of the alloy were measured by differential scanning calorimetry. In this study, the temperature of the work pieces was raised to 1203 K (930 °C) that is in the semisolid region, and the weld seams were stirred by two different types of tools at the speed of 1600 rpm. Macro and micro-structural analyses show uniformity in the phase distribution for specimens welded by cylindrical tool. Desirable and uniform mechanical properties obtained when the cylindrical tool was used.

  8. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  9. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  10. Potato dextrose agar antifungal susceptibility testing for yeasts and molds: evaluation of phosphate effect on antifungal activity of CMT-3.

    Science.gov (United States)

    Liu, Yu; Tortora, George; Ryan, Maria E; Lee, Hsi-Ming; Golub, Lorne M

    2002-05-01

    The broth macrodilution method (BMM) for antifungal susceptibility testing, approved by the National Committee for Clinical Laboratory Standards (NCCLS), was found to have deficiencies in testing of the antifungal activity of a new type of antifungal agent, a nonantibacterial chemically modified tetracycline (CMT-3). The high content of phosphate in the medium was found to greatly increase the MICs of CMT-3. To avoid the interference of phosphate in the test, a new method using potato dextrose agar (PDA) as a culture medium was developed. Eight strains of fungi, including five American Type Culture Collection strains and three clinical isolates, were used to determine the MICs of amphotericin B and itraconazole with both the BMM and the PDA methods. The MICs of the two antifungal agents determined with the PDA method showed 99% agreement with those determined with the BMM method within 1 log(2) dilution. Similarly, the overall reproducibility of the MICs with the PDA method was above 97%. Three other antifungal agents, fluconazole, ketoconazole, and CMT-3, were also tested in parallel against yeasts and molds with both the BMM and the PDA methods. The MICs of fluconazole and ketoconazole determined with the PDA method showed 100% agreement within 1 log(2) dilution of those obtained with the BMM method. However, the MICs of CMT-3 determined with the BMM method were as high as 128 times those determined with the PDA method. The effect of phosphate on the antifungal activity of CMT-3 was evaluated by adding Na2HPO4 to PDA in the new method. It was found that the MIC of CMT-3 against a Penicillium sp. increased from 0.5 microg/ml (control) to 2.0 microg/ml when the added phosphate was used at a concentration of 0.8 mg/ml, indicating a strong interference of Na2HPO4 with the antifungal activity of CMT-3. Except for fluconazole, all the other antifungal agents demonstrated clear end points among the yeasts and molds tested. Nevertheless, with its high reproducibility

  11. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  12. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  13. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  14. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  15. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  16. Cultivation characteristics and gene expression profiles of Aspergillus oryzae by membrane-surface liquid culture, shaking-flask culture, and agar-plate culture.

    Science.gov (United States)

    Imanaka, Hiroyuki; Tanaka, Soukichi; Feng, Bin; Imamura, Koreyoshi; Nakanishi, Kazuhiro

    2010-03-01

    We cultivated a filamentous fungus, Aspergillus oryzae IAM 2706 by three different cultivation methods, i.e., shaking-flask culture (SFC), agar-plate culture (APC), and membrane-surface liquid culture (MSLC), to elucidate the differences of its behaviors by different cultivation methods under the same media, by measuring the growth, secretion of proteases and alpha-amylase, secreted protein level, and gene transcriptional profile by the DNA microarray analysis. The protease activities detected by MSLC and APC were much higher than that by SFC, using both modified Czapek-Dox (mCD) and dextrin-peptone-yeast extract (DPY) media. The alpha-amylase activity was detected in MSLC and APC in a much larger extent than that in SFC when DPY medium was used. On the basis of SDS-PAGE analyses and N-terminal amino acid sequences, 6 proteins were identified in the supernatants of the culture broths using DPY medium, among which oryzin (alkaline protease) and alpha-amylase were detected at a much higher extent for APC and MSLC than those for SFC while only oryzin was detected in mCD medium, in accordance with the activity measurements. A microarray analysis for the fungi cultivated by SFC, APC, and MSLC using mCD medium was carried out to elucidate the differences in the gene transcriptional profile by the cultivation methods. The gene transcriptional profile obtained for the MSLC sample showed a similar tendency to the APC sample while it was quite different from that for the SFC sample. Most of the genes specifically transcribed in the MSLC sample versus those in the SFC sample with a 10-fold up-regulation or higher were unknown or predicted proteins. However, transcription of oryzin gene was only slightly up-regulated in the MSLC sample and that of alpha-amylase gene, slightly down-regulated. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. A new insight into high-strength Ti62Nb12.2Fe13.6Co6.4Al5.8 alloys with bimodal microstructure fabricated by semi-solid sintering.

    Science.gov (United States)

    Liu, L H; Yang, C; Kang, L M; Qu, S G; Li, X Q; Zhang, W W; Chen, W P; Li, Y Y; Li, P J; Zhang, L C

    2016-03-31

    It is well known that semi-solid forming could only obtain coarse-grained microstructure in a few alloy systems with a low melting point, such as aluminum and magnesium alloys. This work presents that semi-solid forming could also produce novel bimodal microstructure composed of nanostructured matrix and micro-sized (CoFe)Ti2 twins in a titanium alloy, Ti62Nb12.2Fe13.6Co6.4Al5.8. The semi-solid sintering induced by eutectic transformation to form a bimodal microstructure in Ti62Nb12.2Fe13.6Co6.4Al5.8 alloy is a fundamentally different approach from other known methods. The fabricated alloy exhibits high yield strength of 1790 MPa and plastic strain of 15.5%. The novel idea provides a new insight into obtaining nano-grain or bimodal microstructure in alloy systems with high melting point by semi-solid forming and into fabricating high-performance metallic alloys in structural applications.

  18. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  20. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  2. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  3. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  4. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  7. Selective medium for the isolation of Bacteroides gingivalis.

    Science.gov (United States)

    Hunt, D E; Jones, J V; Dowell, V R

    1986-03-01

    Bacteroides gingivalis has been implicated in various forms of periodontal disease and may be responsible for other diseases in humans. The role of B. gingivalis in disease has been difficult to assess, because it is inhibited by most selective media commonly used by clinical laboratories to aid in isolating gram-negative, nonsporeforming anaerobes. We have developed a new medium, Bacteroides gingivalis agar, which contains bacitracin, colistin, and nalidixic acid as selective agents. This medium allowed B. gingivalis to be isolated from oral specimens with little difficulty and also allowed B. gingivalis to be isolated from phenotypically similar Bacteroides species, such as B. asaccharolyticus and B. endodontalis, with which it can easily be confused.

  8. Glycine-containing selective medium for isolation of Legionellaceae from environmental specimens.

    OpenAIRE

    Wadowsky, R M; Yee, R B

    1981-01-01

    Glycine, at a final concentration of 0.3%, has been shown to be an excellent selective agent for the isolation of Legionellaceae. Stock cultures of Legionella pneumophila were not inhibited on buffered charcoal-yeast extract agar containing the amino acid. Among the other Legionellaceae tested, only one of two strains of L. dumoffii and two of six strains of L. micdadei were appreciably inhibited. This medium permitted the isolation of L. pneumophila from environmental specimens with marked i...

  9. Concept medium programme

    DEFF Research Database (Denmark)

    Bjerrum, Peter

    2005-01-01

    The present essay is an attempt to determine the architectural project of the 21st century in relation to a modern conception of space as the medium of architecture, and of sociality as its program......The present essay is an attempt to determine the architectural project of the 21st century in relation to a modern conception of space as the medium of architecture, and of sociality as its program...

  10. Application of a modified culture medium for the simultaneous counting of molds and yeasts and detection of aflatoxigenic strains of Aspergillus flavus and Aspergillus parasiticus.

    Science.gov (United States)

    Jaimez, J; Fente, C A; Franco, C M; Cepeda, A; Vázquez, B I

    2003-02-01

    Molds and yeasts from 91 samples of feed and raw materials used in feed formulation were enumerated on a new culture medium to which a beta cyclodextrin (beta-W7M 1.8-cyclodextrin) had been added. This medium was compared with other media normally used in laboratories for the routine analysis of fungi, such as Sabouraud agar, malt agar supplemented with 2% dextrose, and potato dextrose agar. When a t test for paired data (0.05 significance level, 95% confidence interval) was applied, no statistically significant differences between the results obtained with the new culture medium and those obtained with the other media used to enumerate molds and yeasts were found. For the evaluation of contamination due to aflatoxin for all of the samples, Sabouraud agar and yeast extract agar, both supplemented with 0.3% beta-W7M 1.8-cyclodextrin, and APA (aflatoxin-producing ability) medium were used. Aflatoxin was detected in 21% of the feed samples and in 23% of the raw-material samples analyzed, with maximal amounts of 2.8 and 6.0 microg of aflatoxin B1 per kg, respectively, being detected. In any case, the aflatoxin contents found exceeded the legally stipulated limits. The t test for paired data (0.05 significance level, 95% confidence interval) did not show statistically significant differences between the results obtained with the different culture media used for the detection of aflatoxins. The advantage of the new medium developed (Sabouraud agar with 0.3% beta-W7M 1.8-cyclodextrin) is that it allows simultaneous fungal enumeration and determination (under UV light) of the presence of aflatoxin-producing strains without prior isolation and culture procedures involving expensive and/or complex specific media and thus saves work, time, and money.

  11. Composites Strengthened with Graphene Platelets and Formed in Semisolid State Based on α and α/β MgLiAl Alloys

    Science.gov (United States)

    Dutkiewicz, Jan; Rogal, Łukasz; Fima, Przemyslaw; Ozga, Piotr

    2018-05-01

    MgLiAl base composites strengthened with graphene platelets were prepared by semisolid processing of ball-milled alloy chips with 2% of graphene platelets. Composites strengthened with graphene platelets show higher hardness and yield stress than the cast alloys, i.e., 160 MPa as compared to 90 MPa for as-cast alloy MgLi9Al1.5. Mechanical properties for MgLiAl-based composites were similar or higher than for composites based on conventional AZ91 or WE43 alloys. The strengthening however was not only due to the presence of graphene, but also phases resulting from the reaction between carbon and lithium, i.e., Li2C2 carbide. Graphene platelets were located at globules boundaries resulting from semisolid processing for all investigated composites. Graphene platelets were in agglomerates forming continuous layers at grain boundaries in the composite based on the alloy MgLi4.5Al1.5. The shape of agglomerates was more complex and wavy in the composite based on MgLi9Al1.5 alloy most probably due to lithium-graphene reaction. Electron diffraction from the two-phase region α + β in MgLi9Al1.5 indicated that [001]α and [110]β directions are rotated about 4° from the ideal relationship [001] hex || [110] bcc phases. It showed higher lattice rotation than in earlier studies what is most probably caused by lattice slip and rotation during semisolid pressing causing substantial deformation particularly within the β phase. Raman spectroscopy studies confirmed the presence of graphene platelets within agglomerates and in addition the presence mainly of Li2C2 carbides in composites based on MgLi4.5Al1.5 and Mg9Li1.5Al alloys. From the character of Raman spectra refinement of graphene platelets was found in comparison with their initial size. The graphene areas without carbides contain graphene nanoplatelets with lateral dimension close to initial graphene sample. Electron diffraction allowed to confirm the presence of Li2C2 carbide at the surface of agglomerates found from

  12. Incubation of premise plumbing water samples on Buffered Charcoal Yeast Extract agar at elevated temperature and pH selects for Legionella pneumophila.

    Science.gov (United States)

    Veenendaal, Harm R; Brouwer-Hanzens, Anke J; van der Kooij, Dick

    2017-10-15

    Worldwide, over 90% of the notified cases of Legionnaires' disease are caused by Legionella pneumophila. However, the standard culture medium for the detection of Legionella in environmental water samples, Buffered Charcoal Yeast Extract (BCYE) agar of pH 6.9 ± 0.4 with or without antimicrobial agents incubated at 36 ± 1 °C, supports the growth of a large diversity of Legionella species. BCYE agar of elevated pH or/and incubation at elevated temperature gave strongly reduced recoveries of most of 26 L. non-pneumophila spp. tested, but not of L. pneumophila. BCYE agar of pH 7.3 ± 0.1, incubated at 40 ± 0.5 °C (BCYE pH 7.3/40 °C) was tested for selective enumeration of L. pneumophila. Of the L. non-pneumophila spp. tested, only L. adelaidensis and L. londiniensis multiplied under these conditions. The colony counts on BCYE pH 7.3/40 °C of a L. pneumophila serogroup 1 strain cultured in tap water did not differ significantly from those on BCYE pH 6.9/36 °C when directly plated and after membrane filtration and showed repeatability's of 13-14%. By using membrane filtration L. pneumophila was detected in 58 (54%) of 107 Legionella-positive water samples from premise plumbing systems under one or both of these culture conditions. The L. pneumophila colony counts (log-transformed) on BCYE pH 7.3/40 °C were strongly related (r 2  = 0.87) to those on BCYE pH 6.9/36 °C, but differed significantly (p < 0.05) by a mean of - 0.12 ± 0.30 logs. L. non-pneumophila spp. were detected only on BCYE pH 6.9/36 °C in 49 (46%) of the samples. Hence, BCYE pH 7.3/40 °C can facilitate the enumeration of L. pneumophila and their isolation from premise plumbing systems with culturable L. non-pneumophila spp., some of which, e.g. L. anisa, can be present in high numbers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Improved Medium for Selecting Nitrate-Nonutilizing (nit) Mutants of Verticillium dahliae.

    Science.gov (United States)

    Korolev, N; Katan, T

    1997-10-01

    ABSTRACT Nitrate-nonutilizing (nit) mutants are commonly used to determine vegetative compatibility between isolates of Verticillium dahliae by complementation (heterokaryon) testing. These mutants emerge spontaneously as chlorate-resistant sectors growing out of partially restricted, wild-type colonies on chlorate-amended media. The commonly used chlorate media are based on minimal medium (MMC) or cornmeal agar (CMC), amended with potassium chlorate. nit mutants recovered on these media constituted 10 to 36%(on MMC) and 25 to 45%(on CMC) of the apparently resistant sectors. An improved water agar chlorate medium (WAC) is described that is more effective for selecting chlorate-resistant nit mutants. WAC medium consists of agar (2%), glucose (0.02%), and potassium chlorate (2 to 5%). On WAC, growth of most V. dahliae isolates was strongly inhibited, and 66 to 100%(average >80%) of the chlorate-resistant sectors formed were nit mutants. Most mutants were characterized as nit1, and about 6% as NitM.

  14. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  15. Multivariate analysis of nystatin and metronidazole in a semi-solid matrix by means of diffuse reflectance NIR spectroscopy and PLS regression.

    Science.gov (United States)

    Baratieri, Sabrina C; Barbosa, Juliana M; Freitas, Matheus P; Martins, José A

    2006-01-23

    A multivariate method of analysis of nystatin and metronidazole in a semi-solid matrix, based on diffuse reflectance NIR measurements and partial least squares regression, is reported. The product, a vaginal cream used in the antifungal and antibacterial treatment, is usually, quantitatively analyzed through microbiological tests (nystatin) and HPLC technique (metronidazole), according to pharmacopeial procedures. However, near infrared spectroscopy has demonstrated to be a valuable tool for content determination, given the rapidity and scope of the method. In the present study, it was successfully applied in the prediction of nystatin (even in low concentrations, ca. 0.3-0.4%, w/w, which is around 100,000 IU/5g) and metronidazole contents, as demonstrated by some figures of merit, namely linearity, precision (mean and repeatability) and accuracy.

  16. The effect of guar gum and fiber-enriched wheat bran on gastric emptying of a semisolid meal in healthy subjects

    International Nuclear Information System (INIS)

    Rydning, A.; Berstad, A.; Berstad, T.; Hertzenberg, L.

    1985-01-01

    The effect of physiological doses of guar gum (Guarem), 5 g, and fiber-enriched wheat bran (Fiberform), 10.5 g, on gastric emptying was studied by two different methods in healthy subjects: by a simple isotope localization monitor placed over the upper part of the abdomen, and by gamma camera. The fiber preparations were added to a semisolid meal consisting of wheatmeal porridge and juice, using technetium-99 DTPA as a marker. The gamma camera showed no effect of fiber on gastric emptying. The isotope localization monitor, however, indicated that Fiberform prevented postprandial accumulation of the meal within the upper part of stomach. The simple isotope localization monitor cannot be recommended for measurements of gastric emptying

  17. Identification of the steel viscosity and dynamic yield stress for the numerical modelling of casting simulations in the semi-solid state

    Directory of Open Access Journals (Sweden)

    Solek K.

    2017-03-01

    Full Text Available Conditions of some casting processes cause flow of both liquid and semi-liquid metal alloys inside the die cavity. Generally, the continuous casting, squeeze casting or thixoforming could be classified as such processes. Design or optimisation of casting technology using numerical simulations requires knowledge of the rheological properties. The main objective of the experimental work, presented in this publication, is an analysis of the viscosity of 1.2080 (X210Cr12 high carbon steel in liquid and semisolid state. The secondary purpose of the experimental work was a development of the viscosity models used in continuous casting and thixoforming simulations. The significant achievement of this particular study was identification of thixotropy phenomenon which occurs not only during thixoforming, but also during magnetohydrodynamic stirring in continuous casting processes.

  18. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  19. The Interstellar Medium

    CERN Document Server

    Lequeux, James

    2005-01-01

    Describing interstellar matter in our galaxy in all of its various forms, this book also considers the physical and chemical processes that are occurring within this matter. The first seven chapters present the various components making up the interstellar matter and detail the ways that we are able to study them. The following seven chapters are devoted to the physical, chemical and dynamical processes that control the behaviour of interstellar matter. These include the instabilities and cloud collapse processes that lead to the formation of stars. The last chapter summarizes the transformations that can occur between the different phases of the interstellar medium. Emphasizing methods over results, "The Interstellar Medium" is written for graduate students, for young astronomers, and also for any researchers who have developed an interest in the interstellar medium.

  20. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  1. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  2. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  4. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  5. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  6. Identification of non-Listeria spp. bacterial isolates yielding a β-D-glucosidase-positive phenotype on Agar Listeria according to Ottaviani and Agosti (ALOA).

    Science.gov (United States)

    Angelidis, Apostolos S; Kalamaki, Mary S; Georgiadou, Sofia S

    2015-01-16

    Agar Listeria according to Ottaviani and Agosti (ALOA) is the mandatory medium used for the detection and enumeration of Listeria monocytogenes in foods according to the official International Organization for Standardization (ISO) methods. On ALOA, Listeria spp. appear as bluish-green colonies due to the production of β-D-glucosidase, an enzyme that cleaves 5-bromo-4-chloro-3-indolyl-β-D-glucopyranoside, a chromogenic substrate included in the formulation of the medium. The present work reports on bacterial isolates (n=64) from ready-to-eat soft cheeses, which are able to grow on ALOA, forming bluish-green colonies and therefore phenotypically resemble Listeria spp. All isolates were also capable of growing on the selective media PALCAM and RAPID L'mono. The isolates were characterised with biochemical tests including those specified in the ISO standards for the confirmation of Listeria spp. and identified via partial sequencing of their 16S rRNA gene. According to sequencing results the isolates represented 12 different bacterial species or species-groups belonging to seven different genera: Bacillus spp. (B. circulans, B. clausii, B. licheniformis and B. oleronius), Cellulosimicrobium spp. (C. funkei), Enterococcus spp. (E. faecalis, E. faecium/durans), Kocuria spp. (K. kristinae), Marinilactibacillus spp. (M. psychrotolerans), Rothia spp. (R. terrae) and Staphylococcus spp. (S. sciuri and S. saprophyticus subsp. saprophyticus/xylosus). Cellulosimicrobium spp. have never been previously isolated from foods. These results significantly extend the list of bacteria previously known as capable of growing on ALOA as bluish-green colonies and suggest that there may be room for further improvement in the medium's inhibitory properties towards non-Listeria spp., Gram-positive bacteria present in foods. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  8. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  9. Optical recording medium

    International Nuclear Information System (INIS)

    Andriech, A.; Bivol, V.; Tridukh, G.; Tsiuleanu, D.

    2002-01-01

    The invention relates of the micro- and optoelectronics, computer engineering ,in particular, to tjhe optical information media and may be used in hilography. Summary of the invention consists in that the optical image recording medium, containing a dielectric substrates, onto one surface of which there are placed in series a transparent electricity conducting layer, a photo sensitive recording layer of chalcogenic glass and a thin film electrode of aluminium, is provided with an optically transparent protective layer, applied into the thin film electrode. The result of the invention consists in excluding the dependence of chemical processes course into the medium upon environmental conditions

  10. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  11. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  12. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  13. Roentgen contrast medium

    International Nuclear Information System (INIS)

    Tamborski, C.

    1989-01-01

    The patent deals with a roentgen contrast medium containing a perfluorinebrominealkylether of the formula C m F 2m+1 OC n F 2n Br dispersed in water, preferentially in the presence of a non-ionic dispersing agent such as a fluorinated amidoaminoxide. 2 tabs

  14. Radon in geological medium

    Energy Technology Data Exchange (ETDEWEB)

    Hricko, J [GEOCOMPLEX, a.s., Bratislava (Slovakia)

    1996-12-31

    The paper presented deals with behavior of the radon in geological medium and with some results of the radon survey in Bratislava and Kosice regions. 1) The a{sub v} has been detected in the holes 0.80 m deep. The density of observations - 3 reference areas (one represents 20 stations) per 1 km{sup 2}. The radon risk maps in 1:25000 and 1:50000 scales have been compiled. The 56.8% of the project area lies in low radon risk, 37.6% in medium radon risk and 5.6% in high radon risk. Follow-up monitoring of the equivalent volume radon activity (EVRA) at the flats, located in the areas with high radon risk of the surface layer, has showed values several times higher than Slovak limits (Marianka, Raca, Vajnory). The evidence that neotectonic is excellent medium for rising up emanation to the subsurface layer, is shown on the map. The tectonic zone of Liscie udolie in Bratislava-Karlova Ves area has been clearly detected by profile radon survey (a{sub v} > 50 kBq/m{sup 3}). 2) At present, northern half of the area of Kosice in question was covered by radon survey. The low and medium radon risks have been observed here, while localities with high radon risk are small in extent. The part of radon risk and soil permeability map from northern Kosice area is shown. (J.K.) 3 figs., 2 refs.

  15. Radon in geological medium

    International Nuclear Information System (INIS)

    Hricko, J.

    1995-01-01

    The paper presented deals with behavior of the radon in geological medium and with some results of the radon survey in Bratislava and Kosice regions. 1) The a v has been detected in the holes 0.80 m deep. The density of observations - 3 reference areas (one represents 20 stations) per 1 km 2 . The radon risk maps in 1:25000 and 1:50000 scales have been compiled. The 56.8% of the project area lies in low radon risk, 37.6% in medium radon risk and 5.6% in high radon risk. Follow-up monitoring of the equivalent volume radon activity (EVRA) at the flats, located in the areas with high radon risk of the surface layer, has showed values several times higher than Slovak limits (Marianka, Raca, Vajnory). The evidence that neotectonic is excellent medium for rising up emanation to the subsurface layer, is shown on the map. The tectonic zone of Liscie udolie in Bratislava-Karlova Ves area has been clearly detected by profile radon survey (a v > 50 kBq/m 3 ). 2) At present, northern half of the area of Kosice in question was covered by radon survey. The low and medium radon risks have been observed here, while localities with high radon risk are small in extent. The part of radon risk and soil permeability map from northern Kosice area is shown. (J.K.) 3 figs., 2 refs

  16. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  17. Isolation and in vitro culture of trypanosomes from Leptodactylus ocellatus from the Atlantic Forest in a new experimental culture medium.

    Science.gov (United States)

    Lemos, M; Souza, C S F; da Costa, S C Gonçalves; Souto-Padrón, T; D'Agosto, M

    2013-02-01

    The purpose of this study was to verify the in vitro development of Trypanosoma sp. isolated from Leptodactylus ocellatus frogs under a new protocol using a biphasic medium composed of Novy, McNeal, and Nicolle (NNN) blood agar medium as a solid phase and liver infusion, brain heart infusion, and tryptose (LIBHIT) medium as a liquid phase. Blood forms, collected by cardiac puncture or after the maceration of different organs, were inoculated in culture tubes containing the biphasic medium composed by NNN and LIBHIT. Trypanosomes were observed 4 days postinoculation; most bloodstream trypomastigotes had differentiated into epimastigotes and amastigotes by this time. Trypomastigotes were again observed in older cultures (7 days). Parasites were successfully subcultured for 8 mo in this medium and successfully cryopreserved. The present study provides a new protocol medium for the isolation and culture of anuran trypanosomes.

  18. Evaluation of a Chromogenic Culture Medium for Isolation of Clostridium difficile within 24 Hours ▿

    Science.gov (United States)

    Perry, John D.; Asir, Kerry; Halimi, Diane; Orenga, Sylvain; Dale, Joanne; Payne, Michelle; Carlton, Ruth; Evans, Jim; Gould, F. Kate

    2010-01-01

    Rapid and effective methods for the isolation of Clostridium difficile from stool samples are desirable to obtain isolates for typing or to facilitate accurate diagnosis of C. difficile-associated diarrhea. We report on the evaluation of a prototype chromogenic medium (ID C. difficile prototype [IDCd]) for isolation of C. difficile. The chromogenic medium was compared using (i) 368 untreated stool samples that were also inoculated onto CLO medium, (ii) 339 stool samples that were subjected to alcohol shock and also inoculated onto five distinct selective agars, and (iii) standardized suspensions of 10 C. difficile ribotypes (untreated and alcohol treated) that were also inoculated onto five distinct selective agars. Two hundred thirty-six isolates of C. difficile were recovered from 368 untreated stool samples, and all but 1 of these strains (99.6%) were recovered on IDCd within 24 h, whereas 74.6% of isolates were recovered on CLO medium after 48 h. Of 339 alcohol-treated stool samples cultured onto IDCd and five other selective agars, C. difficile was recovered from 218 samples using a combination of all media. The use of IDCd allowed recovery of 96.3% of isolates within 24 h, whereas 51 to 83% of isolates were recovered within 24 h using the five other media. Finally, when they were challenged with pure cultures, all 10 ribotypes of C. difficile generated higher colony counts on IDCd irrespective of alcohol pretreatment or duration of incubation. We conclude that IDCd is an effective medium for isolation of C. difficile from stool samples within 24 h. PMID:20739493

  19. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  20. Effect of culture medium on propagation and phenotype of corneal stroma-derived stem cells.

    Science.gov (United States)

    Sidney, Laura E; Branch, Matthew J; Dua, Harminder S; Hopkinson, Andrew

    2015-12-01

    The limbal area of the corneal stroma has been identified as a source of mesenchymal-like stem cells, which have potential for exploitation as a cell therapy. However, the optimal culture conditions are disputed and few direct media comparisons have been performed. In this report, we evaluated several media types to identify the optimal for inducing an in vitro stem cell phenotype. Primary human corneal stroma-derived stem cells (CSSCs) were extracted from corneoscleral rims. Culture in seven different media types was compared: Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS); M199 with 20% FBS; DMEM-F12 with 20% serum replacement, basic fibroblast growth factor and leukemia inhibitory factor (SCM); endothelial growth medium (EGM); semi-solid MethoCult; serum-free keratinocyte medium (K-SFM); and StemPro-34. Effects on proliferation, morphology, protein and messenger RNA expression were evaluated. All media supported proliferation of CSSCs with the exception of K-SFM and StemPro-34. Morphology differed between media: DMEM produced large cells, whereas EGM produced very small cells. Culture in M199 produced a typical mesenchymal stromal cell phenotype with high expression of CD105, CD90 and CD73 but not CD34. Culture in SCM produced a phenotype more reminiscent of a progenitor cell type with expression of CD34, ABCG2, SSEA-4 and PAX6. Culture medium can significantly influence CSSC phenotype. SCM produced a cell phenotype closest to that of a pluripotent stem cell, and we consider it to be the most appropriate for development as a clinical-grade medium for the production of CSSC phenotypes suitable for cell therapy. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  1. Concept medium program

    DEFF Research Database (Denmark)

    Bjerrum, Peter

    2003-01-01

    The present essays is an attempt to dertermine the architecural project of the 21st century in realation to a modern conception of space as the medium of architecture, and of society as its program. This attempt adopts the internal point of view of an architect in describing a modern architectural...... project within the framework: concept - program, these notions being concieved as spatial representations primarily and immediately "given" to architecture....

  2. Propagação in vitro de Oncidium baueri Lindl. (Orchidaceae sem uso de ágar = In vitro orchid propagation of Oncidium baueri (Orchidaceae without the use of agar

    Directory of Open Access Journals (Sweden)

    Ricardo Tadeu de Faria

    2006-01-01

    Full Text Available O trabalho teve como objetivo a propagação in vitro de Oncidium baueri(Orchidaceae sem uso de ágar como agente solidificante do meio de cultura. As sementes foram germinadas em meio Murashige e Skoog (MS, 1962 modificado com a metade da concentração de macronutrientes. As plântulas, ao atingirem em média 1 cm de altura, foram subcultivadas para frascos de plástico de 600 mL, contendo 200 mL do mesmo meionutritivo utilizado para a germinação. Os tratamentos avaliados foram: 7 g de ágar por litro + meio 1/2 MS líquido; espuma de poliuretano picada + meio 1/2 MS líquido; esfagno + meio 1/2 MS líquido; areia grossa + meio 1/2 MS líquido. Oito meses após o início do experimento, as variáveis analisadas foram: altura da parte aérea, comprimento da maior raiz, número de brotações, número de raízes e matéria fresca total. As análises estatísticas demonstram que os tratamentos contendo esfagno ou areia não são indicados para substituírem o ágar, porém o tratamento com espuma de poliuretano picada proporcionou um ótimo enraizamento e ótimo desenvolvimento vegetativo das plântulas, sendo, portanto, uma alternativa eficiente e de menor custo para a substituição do ágar na propagação in vitro deOncidium baueri.This research aims at studying the in vitro propagation of Oncidium baueri (Orchidaceae without the use of agar as a solidifying agent of culture medium. The seeds were germinated in Murashige and Skoog medium (MS, 1962 modified with half of the macronutrients concentrations. When the seedlings reach an average height of 1 cm, they were subcultivated in 600 mL plastic flasks containing 200 mL of the same nutritive medium used for germination. The evaluated treatments were: 7 g of agar per liter + 1/2 MS medium liquid; chopped (polyurethane foam + 1/2 MS medium liquid; sphagnum + 1/2 MSmedium liquid; thick sand + 1/2MS medium liquid. The evaluated variables after 8 months of study were: aerial part height, tallest

  3. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  4. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  5. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

  6. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Effects of immersion disinfection of agar-alginate combined impressions on the surface properties of stone casts.

    Science.gov (United States)

    Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki

    2016-01-01

    This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.

  8. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    Science.gov (United States)

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  10. Evaluatie van de membraanfiltratiemethode op mCP-agar voor bepaling van sporen van Clostridium perfringens in water

    NARCIS (Netherlands)

    Schets FM; Medema GJ; LWL

    1995-01-01

    Current Dutch and European drinking water standards include criteria for spores of sulphite reducing clostridia. This has some inherent disadvantages. The reproducibility of the enumeration method for spores of sulphite reducing clostridia (SSRC) in Sulphite Cycloserine Agar (SCA) is poor. Some

  11. A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

    Science.gov (United States)

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

    2014-09-01

    A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Short communication: The effect of changing temperature and agar concentration at proliferation stage in the final success of Aleppo pine somatic embryogenesis

    Directory of Open Access Journals (Sweden)

    Catia Pereira

    2018-01-01

    Full Text Available Aim of the study: The effect of physical and chemical conditions at proliferation stage was evaluated in order to elucidate if this stage is the determinant phase to induce a marked effect in Pinus halepensis somatic embryogenesis. Area of study: The study was conducted in research laboratories of Neiker (Arkaute, Spain. Material and methods: Pinus halepensis embryonal masses from ten embryogenic cell lines subjected to nine treatments (tissues cultured at three temperatures on media supplemented with three agar concentrations at proliferation stage. Main results: Significant differences were observed among different proliferation conditions months later at the end of maturation, germination and acclimatization stages. Research highlights: Aleppo pine embryonal masses are cultured under standard conditions on a culture medium supplemented with 4.5 g/L Gelrite® at 23ºC. However, better results in terms of plantlet production can be obtained proliferating the embryonal masses at 18ºC in a culture media with significantly lower water availability.

  13. Rapid Detection and Identification of Candidemia by Direct Blood Culturing on Solid Medium by Use of Lysis-Centrifugation Method Combined with Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry (MALDI-TOF MS)

    Science.gov (United States)

    Idelevich, Evgeny A.; Grünastel, Barbara

    2016-01-01

    ABSTRACT Candida sepsis is a life-threatening condition with increasing prevalence. In this study, direct blood culturing on solid medium using a lysis-centrifugation procedure enabled successful Candida species identification by matrix-assisted laser desorption–ionization time of flight mass spectrometry on average 3.8 h (Sabouraud agar) or 7.4 h (chocolate agar) before the positivity signal for control samples in Bactec mycosis-IC/F or Bactec Plus aerobic/F bottles, respectively. Direct culturing on solid medium accelerated candidemia diagnostics compared to that with automated broth-based systems. PMID:27795344

  14. Rapid Detection and Identification of Candidemia by Direct Blood Culturing on Solid Medium by Use of Lysis-Centrifugation Method Combined with Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS).

    Science.gov (United States)

    Idelevich, Evgeny A; Grünastel, Barbara; Becker, Karsten

    2017-01-01

    Candida sepsis is a life-threatening condition with increasing prevalence. In this study, direct blood culturing on solid medium using a lysis-centrifugation procedure enabled successful Candida species identification by matrix-assisted laser desorption-ionization time of flight mass spectrometry on average 3.8 h (Sabouraud agar) or 7.4 h (chocolate agar) before the positivity signal for control samples in Bactec mycosis-IC/F or Bactec Plus aerobic/F bottles, respectively. Direct culturing on solid medium accelerated candidemia diagnostics compared to that with automated broth-based systems. Copyright © 2016 American Society for Microbiology.

  15. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0–64.0 μg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  16. Hypertonic sabouraud dextrose agar as a substrate for differentiation of Candida dubliniensis.

    Science.gov (United States)

    Akgül, Oncü; Cerikçioğlu, Nilgün

    2009-06-01

    In this study, we aimed to detect the proportion of Candida dubliniensis among yeast strains previously identified as C. albicans by using several phenotypic methods and PCR.For this purpose, we screened 300 strains by using phenotypic tests suggested for the identification of C. dubliniensis in the literature, but we detected high proportion of false-positive reactions. Only two strains (0.6%) were detected as true C. dubliniensis by PCR and API ID 32C methods. Moreover, these two strains gave the expected results with all the phenotypic tests, including modified salt tolerance test for C. dubliniensis.In conclusion, none of the phenotypic methods, except for the modified salt tolerance test, revealed 100% successful results in discrimination of C. albicans and C. dubliniensis species. However, in the tobacco agar test, the rate of false positivity was as low as 0.6%. We suggest that in the case of absence of PCR and other automatized identification systems, these two phenotypic tests can be used in routine laboratories to obtain a presumptive result.

  17. Internal properties assessment in agar wood trees using ultrasonic velocity measurement

    International Nuclear Information System (INIS)

    Mohd Noorul Ikhsan Mohamed; Mohamad Pauzi Ismail; Mat Rasol Awang; Mohd Fajri Osman; Fakhruzi, M.; Hashim, M.M.

    2010-01-01

    This paper presents the application of ultrasonic velocity in agar wood trees (Aquilaria crassna) with the purpose of evaluating the relationship of the ultrasonic velocity to the variations of internal properties of trees. In this study, three circular cross-sectional discs from the freshly cut tree were selected as samples. First sample with a big hole (decay) in the middle, second sample with internal resinous and the last one is the sample with no defects. The through transmission ultrasonic testing method was carried out using Tico ultrasonic pulse velocity tester which is from Switzerland. Two-dimensional image of internal properties evaluation by an ultrasonic investigation was obtained using Matlab. The results showed that the ultrasonic wave cannot pass through the internal decay or resinous so that the wave went round it and thus ultrasonic wave velocity significantly decreased by increasing the hole or resinous. The difference in color of the image generated by Matlab software based on variation of ultrasonic velocity between the internal decay area and its surrounding area was obvious. Therefore, the properties of internal properties of the three could be detected by ultrasonic line imaging technique. (author)

  18. Functional properties of edible agar-based and starch-based films for food quality preservation.

    Science.gov (United States)

    Phan, The D; Debeaufort, F; Luu, D; Voilley, A

    2005-02-23

    Edible films made of agar (AG), cassava starch (CAS), normal rice starch (NRS), and waxy (glutinous) rice starch (WRS) were elaborated and tested for a potential use as edible packaging or coating. Their water vapor permeabilities (WVP) were comparable with those of most of the polysaccharide-based films and with some protein-based films. Depending on the environmental moisture pressure, the WVP of the films varies and remains constant when the relative humidity (RH) is >84%. Equilibrium sorption isotherms of these films have been measured; the Guggenheim-Anderson-de Boer (GAB) model was used to describe the sorption isotherm and contributed to a better knowledge of hydration properties. Surface hydrophobicity and wettability of these films were also investigated using the sessile drop contact angle method. The results obtained suggested the migration of the lipid fraction toward evaporation surface during film drying. Among these polysaccharide-based films, AG-based film and CAS-based film displayed more interesting mechanical properties: they are transparent, clear, homogeneous, flexible, and easily handled. NRS- and WRS-based films were relatively brittle and have a low tension resistance. Microstructure of film cross section was observed by environmental scanning electron microscopy to better understand the effect of the structure on the functional properties. The results suggest that AG-based film and CAS-based films, which show better functional properties, are promising systems to be used as food packaging or coating instead of NRS- and WRS-based films.

  19. Acidity Tunable Ionic Liquids as Catalysts for Conversion of Agar into Mixed Sugars

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Churl; Kim, Hoon Sik [Kyung Hee Univ., Seoul (Korea, Republic of); Ryu, Hyun Jin; Kim, Sang Hyoun; Yoon, Jeong Jun; Kim, Yong Jin [Korea Institute of Industrial Technology, Cheonan (Korea, Republic of)

    2010-02-15

    To summarize, various factors affecting yields of Gal, AG, and 5-HMF formation during saccharification were investigated using agar as a substrate in the presence of several bisulfate-based acidic ionic liquids as catalysts. The result was compared with employing sulfuric acid from the viewpoint of sugar yields and 5-HMF formation. [Bmim][HSO{sub 4}], [Hmim][HSO{sub 4}], [Morph] [HSO{sub 4}], [Bu{sub 4}N][HSO{sub 4}], [Bu{sub 4}P][HSO{sub 4}], [Chol][HSO{sub 4}] showed moderate to high yields of Gal and AG with a remarkable decrease in 5-HMF formation compared with sulfuric acid. Among them, [Chol][HSO{sub 4}] ionic liquid was found to exhibit the highest yield of sugars with an acceptable concentration of 5-HMF that does not inhibit the fermentation process. Generally, there are five major bottom lines for a bioethanol process to be economically viable: the feedstock must be plentiful, inexpensive, in high energy conversion rate, in low demand for food industry, and finally, has to be cultivated in sustainable systems.

  20. Unraveling the nuclear and chloroplast genomes of an agar producing red macroalga, Gracilaria changii (Rhodophyta, Gracilariales).

    Science.gov (United States)

    Ho, Chai-Ling; Lee, Wei-Kang; Lim, Ee-Leen

    2018-03-01

    Agar and agarose have wide applications in food and pharmaceutical industries. Knowledge on the genome of red seaweeds that produce them is still lacking. To fill the gap in genome analyses of these red algae, we have sequenced the nuclear and organellar genomes of an agarophyte, Gracilaria changii. The partial nuclear genome sequence of G. changii has a total length of 35.8Mb with 10,912 predicted protein coding sequences. Only 39.4% predicted proteins were found to have significant matches to protein sequences in SwissProt. The chloroplast genome of G. changii is 183,855bp with a total of 201 open reading frames (ORFs), 29 tRNAs and 3 rRNAs predicted. Five genes: ssrA, leuC and leuD CP76_p173 (orf139) and pbsA were absent in the chloroplast genome of G. changii. The genome information is valuable in accelerating functional studies of individual genes and resolving evolutionary relationship of red seaweeds. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Comparison of three techniques for production goat lentivirus antigen used in the agar gel immunodifusion test

    Directory of Open Access Journals (Sweden)

    Raymundo Rizaldo Pinheiro

    2005-12-01

    Full Text Available The Caprine Arthritis Encephalitis (CAE is a disease who cause considerable economic losses, including loss in the milk production and reduction of the useful life of the animal. In the diagnosis of this disease the agar gel immunodifusion test (AGID is used worldwide as the selection test. The objective of thid work was to test three different concentrations of bovine fetal serum (BFS in the production of the antigen (Ag for the diagnosis of the CAE virus (CAEV, to verify amongst the three methods the most efficient concentration and which the antigen concentration of the antigen produced is appropriate for the test. The method of the AMICON and the concentration of the Ag for dialysis was indicated, however the system AMICON, despite the implantation costs, promoted minor loss of antigen, little time expense in the processing and greater simplicity. With relation to the amount of BFS placed after the viral inoculation it was verified that 5% of BFS the amount that presented better resulted. The antigen concentration 100 times was more indicated, therefore it allowed the diagnosis of the CAEV for two proteins (gp 135 and p28. The concentration of the Ag for precipitation/ultracentrifugation, used for imunoenzimatic tests, did not present resulted satisfactory used in the AGID.

  2. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2 μg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125 μg/mL for both antimicrobials. The MIC90 were 4 μg/mL and 2 μg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from São Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  3. Theoretical and experimental NMR studies on muscimol from fly agaric mushroom (Amanita muscaria)

    Science.gov (United States)

    Kupka, Teobald; Wieczorek, Piotr P.

    2016-01-01

    In this article we report results of combined theoretical and experimental NMR studies on muscimol, the bioactive alkaloid from fly agaric mushroom (Amanita muscaria). The assignment of 1H and 13C NMR spectra of muscimol in DMSO-d6 was supported by additional two-dimensional heteronuclear correlated spectra (2D NMR) and gauge independent atomic orbital (GIAO) NMR calculations using density functional theory (DFT). The effect of solvent in theoretical calculations was included via polarized continuum model (PCM) and the hybrid three-parameter B3LYP density functional in combination with 6-311++G(3df,2pd) basis set enabled calculation of reliable structures of non-ionized (neutral) molecule and its NH and zwitterionic forms in the gas phase, chloroform, DMSO and water. GIAO NMR calculations, using equilibrium and rovibrationally averaged geometry, at B3LYP/6-31G* and B3LYP/aug-cc-pVTZ-J levels of theory provided muscimol nuclear magnetic shieldings. The theoretical proton and carbon chemical shifts were critically compared with experimental NMR spectra measured in DMSO. Our results provide useful information on its structure in solution. We believe that such data could improve the understanding of basic features of muscimol at atomistic level and provide another tool in studies related to GABA analogs.

  4. [Variations in hyperbilirrubinemia in low birth weight newborns under phototherapy and continous or discontinous agar oral administration (author's transl)].

    Science.gov (United States)

    Colomer, J; Moya, M; Marco, V; De Paredes, C; Escrivá, F; Vila, R

    1975-06-01

    Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.

  5. Simulation of the infiltration process of a ceramic open-pore body with a metal alloy in semi-solid state to design the manufacturing of interpenetrating phase composites

    Science.gov (United States)

    Schomer, Laura; Liewald, Mathias; Riedmüller, Kim Rouven

    2018-05-01

    Metal-ceramic Interpenetrating Phase Composites (IPC) belong to a special subcategory of composite materials and reveal enhanced properties compared to conventional composite materials. Currently, IPC are produced by infiltration of a ceramic open-pore body with liquid metal applying high pressure and I or high temperature to avoid residual porosity. However, these IPC are not able to gain their complete potential, because of structural damages and interface reactions occurring during the manufacturing process. Compared to this, the manufacturing of IPC using the semi-solid forming technology offers great perspectives due to relative low processing temperatures and reduced mechanical pressure. In this context, this paper is focusing on numerical investigations conducted by using the FLOW-3D software for gaining a deeper understanding of the infiltration of open-pore bodies with semi-solid materials. For flow simulation analysis, a geometric model and different porous media drag models have been used. They have been adjusted and compared to get a precise description of the infiltration process. Based on these fundamental numerical investigations, this paper also shows numerical investigations that were used for basically designing a semi-solid forming tool. Thereby, the development of the flow front and the pressure during the infiltration represent the basis of the evaluation. The use of an open and closed tool cavity combined with various geometries of the upper die shows different results relating to these evaluation arguments. Furthermore, different overflows were designed and its effects on the pressure at the end of the infiltration process were investigated. Thus, this paper provides a general guideline for a tool design for manufacturing of metal-ceramic IPC using semi-solid forming.

  6. Analysis of High Quality Agar wood Oil Chemical Compounds By Means Of SPME/ GC-MS and Z-Score Technique

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-γ-eudesmol, aromadendrene, β-agar ofuran, α-agar ofuran and γ-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)

  7. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  8. DENSE MEDIUM CYCLONE OPTIMIZATON

    Energy Technology Data Exchange (ETDEWEB)

    Gerald H. Luttrell; Chris J. Barbee; Peter J. Bethell; Chris J. Wood

    2005-06-30

    Dense medium cyclones (DMCs) are known to be efficient, high-tonnage devices suitable for upgrading particles in the 50 to 0.5 mm size range. This versatile separator, which uses centrifugal forces to enhance the separation of fine particles that cannot be upgraded in static dense medium separators, can be found in most modern coal plants and in a variety of mineral plants treating iron ore, dolomite, diamonds, potash and lead-zinc ores. Due to the high tonnage, a small increase in DMC efficiency can have a large impact on plant profitability. Unfortunately, the knowledge base required to properly design and operate DMCs has been seriously eroded during the past several decades. In an attempt to correct this problem, a set of engineering tools have been developed to allow producers to improve the efficiency of their DMC circuits. These tools include (1) low-cost density tracers that can be used by plant operators to rapidly assess DMC performance, (2) mathematical process models that can be used to predict the influence of changes in operating and design variables on DMC performance, and (3) an expert advisor system that provides plant operators with a user-friendly interface for evaluating, optimizing and trouble-shooting DMC circuits. The field data required to develop these tools was collected by conducting detailed sampling and evaluation programs at several industrial plant sites. These data were used to demonstrate the technical, economic and environmental benefits that can be realized through the application of these engineering tools.

  9. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  10. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  11. Preparation and application of agar/alginate/collagen ternary blend functional food packaging films.

    Science.gov (United States)

    Wang, Long-Feng; Rhim, Jong-Whan

    2015-09-01

    Ternary blend agar/alginate/collagen (A/A/C) hydrogel films with silver nanoparticles (AgNPs) and grapefruit seed extract (GSE) were prepared. Their performance properties, transparency, tensile strength (TS), water vapor permeability (WVP), water contact angle (CA), water swelling ratio (SR), water solubility (WS), and antimicrobial activity were determined. The A/A/C film was highly transparent, and both AgNPs and GSE incorporated blend films (A/A/C(AgNPs) and A/A/C(GSE)) exhibited UV-screening effect, especially, the A/A/C(GSE) film had high UV-screening effect without sacrificing the transmittance. In addition, the A/A/C blend films formed efficient hydrogel film with the water holding capacity of 23.6 times of their weight. Both A/A/C(AgNPs) and A/A/C(GSE) composite films exhibited strong antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli) food-borne pathogenic bacteria. The test results of fresh potatoes packaging revealed that all the A/A/C ternary blend films prevented forming of condensed water on the packaged film surface, both A/A/C(AgNPs) and A/A/C(GSE) composite films prevented greening of potatoes during storage. The results indicate that the ternary blend hydrogel films incorporated with AgNPs or GSE can be used not only as antifogging packaging films for highly respiring fresh agriculture produce, but also as an active food packaging system utilizing their strong antimicrobial activity. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Perbedaan Cara Penyebaran Suspensi terhadap Jumlah Bakteri pada Media Eosin Methylene Blue Agar

    Directory of Open Access Journals (Sweden)

    Ahmad Nuzuludin Kadri

    2015-06-01

    Full Text Available Dalam rangka pengawasan mutu secara biologis dilakukan pengujian laboratorium untuk mengisolasi dan melakukan jumlah penghitungan jumlah bakteri patogen (enumerasi. Tujuan dari penelitian ini adalah untuk mengetahui perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok, mikropipet dan ose terhadap jumlah bakteri yang terhitung pada media Eosin Methylene Blue Agar. Sampel diambil dari air susu kambing yang kemudian dihitung jumlah bakteri-nya dengan tiga kelompok perlakuan yaitu menggunakan batang gelas bengkok, mikropipet dan ose. Data hasil penelitian dianalisis menggunakan sidik ragam, bila hasilnya berbeda nyata maka dilanjutkan dengan uji Duncan. Jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok, mikropipet dan ose per ml berturut-turut mengandung 9.722.222 cfu, 68.944.444 cfu dan 116.444.444 cfu. Dengan sidik ragam, perlakuan cara penyebaran dengan menggunakan mikropipet dan ose berbeda sangat nyata (P<0,01 terhadap jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok. Setelah di uji dengan uji Duncan, rata-rata jumlah bakteri yang terhitung dengan menggunakan mikropipet dan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan batang gelas bengkok, sedangkan rata-rata jumlah bakteri yang terhitung menggunakan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan mikropipet. Kesimpulan dari penelitian ini adalah terdapat perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok,mikropipet dan ose terhadap jumlah bakteri pada media EMBA. Penyebaran bakteri menggunakan ose lebih banyak (P<0,01 dibandingkan mikropipet dan batang gelas bengkok. Sedangkan penyebaran bakteri menggunakan mikropipet lebih banyak (P<0,01 dibandingkan dengan gelas bengkok.

  13. Halococcus agarilyticus sp. nov., an agar-degrading haloarchaeon isolated from commercial salt.

    Science.gov (United States)

    Minegishi, Hiroaki; Echigo, Akinobu; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Usami, Ron

    2015-05-01

    Two agar-degrading halophilic archaeal strains, 62 E(T) and 197 A, were isolated from commercial salt samples. Cells were non-motile cocci, approximately 1.2-2.0 µm in diameter and stained Gram-negative. Colonies were pink-pigmented. Strain 62 E(T) was able to grow with 24-30% (w/v) NaCl (optimum, 27%), at pH 6.5-8.5 (optimum, pH 7.5) and at 22-47 °C (optimum, 42 °C). The 16S rRNA gene sequences of strains 62 E(T) and 197 A were identical, and the level of DNA-DNA relatedness between them was 90 and 90% (reciprocally). The closest relative was Halococcus saccharolyticus JCM 8878(T) with 99.7% similarity in 16S rRNA orthologous gene sequences, followed by Halococcus salifodinae JCM 9578(T) (99.6%), while similarities with other species of the genus Halococcus were equal to or lower than 95.1%. The rpoB' gene tree strongly supported that the two strains were members of the genus Halococcus . Mean DNA-DNA relatedness between strain 62 E(T) and H. saccharolyticus JCM 8878(T) and H. salifodinae JCM 9578(T) was 46 and 44%, respectively. The major polar lipids were archaeol derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, derived from both C20C20 and C20C25 archaeol, and sulfated diglycosyl archaeol-1. Several unidentified glycolipids were present. Based on the phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halococcus , for which the name Halococcus agarilyticus sp. nov. is proposed. The type strain is 62 E(T) ( = JCM 19592(T) =KCTC 4143(T)). © 2015 IUMS.

  14. Microstructures and Tensile Properties of Al–Cu Matrix Composites Reinforced with Nano-Sized SiCp Fabricated by Semisolid Stirring Process

    Directory of Open Access Journals (Sweden)

    Feng Qiu

    2017-02-01

    Full Text Available The nano-sized SiCp/Al–Cu composites were successfully fabricated by combining semisolid stirring with ball milling technology. Microstructures were examined by an olympus optical microscope (OM, field emission scanning electron microscope (FESEM and transmission electron microscope (TEM. Tensile properties were studied at room temperature. The results show that the α-Al dendrites of the composites were strongly refined, especially in the composite with 3 wt. % nano-sized SiCp, of which the morphology of the α-Al changes from 200 μm dendritic crystal to 90 μm much finer equiaxial grain. The strength and ductility of the composites are improved synchronously with the addition of nano-sized SiCp particles. The as-cast 3 wt. % nano-sized SiCp/Al–Cu composite displays the best tensile properties, i.e., the yield strength, ultimate tensile strength (UTS and fracture strain increase from 175 MPa, 310 MPa and 4.1% of the as-cast Al–Cu alloy to 220 MPa, 410 MPa and 6.3%, respectively. The significant improvement in the tensile properties of the composites is mainly due to the refinement of the α-Al dendrites, nano-sized SiCp strengthening, and good interface combination between the SiCp and Al–Cu alloys.

  15. A Whole-Genome Microarray Study of Arabidopsis thaliana Semisolid Callus Cultures Exposed to Microgravity and Nonmicrogravity Related Spaceflight Conditions for 5 Days on Board of Shenzhou 8

    Directory of Open Access Journals (Sweden)

    Svenja Fengler

    2015-01-01

    Full Text Available The Simbox mission was the first joint space project between Germany and China in November 2011. Eleven-day-old Arabidopsis thaliana wild type semisolid callus cultures were integrated into fully automated plant cultivation containers and exposed to spaceflight conditions within the Simbox hardware on board of the spacecraft Shenzhou 8. The related ground experiment was conducted under similar conditions. The use of an in-flight centrifuge provided a 1 g gravitational field in space. The cells were metabolically quenched after 5 days via RNAlater injection. The impact on the Arabidopsis transcriptome was investigated by means of whole-genome gene expression analysis. The results show a major impact of nonmicrogravity related spaceflight conditions. Genes that were significantly altered in transcript abundance are mainly involved in protein phosphorylation and MAPK cascade-related signaling processes, as well as in the cellular defense and stress responses. In contrast to short-term effects of microgravity (seconds, minutes, this mission identified only minor changes after 5 days of microgravity. These concerned genes coding for proteins involved in the plastid-associated translation machinery, mitochondrial electron transport, and energy production.

  16. Aluminum powder size and microstructure effects on properties of boron nitride reinforced aluminum matrix composites fabricated by semi-solid powder metallurgy

    International Nuclear Information System (INIS)

    Chen, Cunguang; Guo, Leichen; Luo, Ji; Hao, Junjie; Guo, Zhimeng; Volinsky, Alex A.

    2015-01-01

    Al matrix composite reinforced by hexagonal boron nitride (h-BN) with nearly full densification was successfully fabricated by the semi-solid powder metallurgy technique. The h-BN/Al composites were synthesized with elemental pure Al powder size of d_5_0=35, 12 and 2 μm. The powder morphology and the structural characteristics of the composites were analyzed using X-ray diffraction, scanning and transmission electron microscopy. The density, Brinell hardness and compressive behavior of the samples were characterized. Density measurement of the Al composites revealed that the composite densification can be effectively promoted by plenty of embedded liquid phase under pressure. Composites prepared using Al powder with varying granularity showed different grain characteristics, and in situ recrystallization occurred inside the original grains with 35 μm Al powder. A sharp interface consisting of Al/Al_2O_3/h-BN was present in the composites. Both the compressive strength and the fracture strain of the investigated composites increased with the decrease of the Al powder size, along with the Brinell hardness. The composite with 2 μm Al powder exhibited the highest relative density (99.3%), Brinell harness (HB 128), compressive strength (763 MPa) and fracture strain (0.299).

  17. Matrix effect on leaching of Bisphenol A diglycidyl ether (BADGE) from epoxy resin based inner lacquer of aluminium tubes into semi-solid dosage forms.

    Science.gov (United States)

    Lipke, Uwe; Haverkamp, Jan Boris; Zapf, Thomas; Lipperheide, Cornelia

    2016-04-01

    To study the impact of different semi-solid dosage form components on the leaching of Bisphenol A (BPA) and Bisphenol A diglycidyl ether (BADGE) from the epoxy resin-based inner lacquer of aluminium tubes, the tubes were filled with different matrix preparations and stored at an elevated temperature. Despite compliance with the European Standards EN 15348 and EN 15766 on porosity and polymerisation of internal coatings of aluminium tubes, the commercially available tubes used in the study contained an increased amount of polymerisation residues, such as unbound BPA, BADGE and BADGE derivatives in the lacquer, as determined by acetonitrile extraction. Storage of Macrogol ointments in these tubes resulted in an almost quantitative migration of the unbound polymerisation residues from the coating into the ointment. In addition, due to alterations observed in the RP-HPLC chromatograms of the matrix spiked with BADGE and BADGE derivatives it is supposed that the leachates can react with formulation components. The contamination of the medicinal product by BPA, BADGE and BADGE derivatives can be precluded by using aluminium tubes with an internal lacquer with a low degree of unbound polymerisation residues. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Colony formation by sublethally heat-injured Zygosaccharomyces rouxii as affected by solutes in the recovery medium and procedure for sterilizing medium.

    Science.gov (United States)

    Golden, D A; Beuchat, L R

    1990-01-01

    Recovery and colony formation by healthy and sublethally heat-injured cells of Zygosaccharomyces rouxii as influenced by the procedure for sterilizing recovery media (YM agar [YMA], wort agar, cornmeal agar, and oatmeal agar) were investigated. Media were supplemented with various concentrations of glucose, sucrose, glycerol, or sorbitol and sterilized by autoclaving (110 degrees C, 15 min) and by repeated treatment with steam (100 degrees C). An increase in sensitivity was observed when heat-injured cells were plated on glucose-supplemented YMA at an aw of 0.880 compared with aws of 0.933 and 0.998. Colonies which developed from unheated and heated cells on YMA at aws of 0.998 and 0.933 generally exceeded 0.5 mm in diameter within 3.5 to 4 days of incubation at 25 degrees C, whereas colonies formed on YMA at an aw of 0.880 typically did not exceed 0.5 mm in diameter until after 5.5 to 6.5 days of incubation. The number of colonies exceeding 0.5 mm in diameter which were formed by heat-injured cells on YMA at an aw of 0.880 was 2 to 3 logs less than the total number of colonies detected, i.e., on YMA at an aw of 0.933 and using no limits of exclusion based on colony diameter. A substantial portion of cells which survived heat treatment were sublethally injured as evidenced by increased sensitivity to a suboptimum aw (0.880). In no instance was recovery of Z. rouxii significantly affected by medium sterilization procedure when glucose or sorbitol was used as the aw-suppressing solute.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2403251

  19. Colony formation by sublethally heat-injured Zygosaccharomyces rouxii as affected by solutes in the recovery medium and procedure for sterilizing medium.

    Science.gov (United States)

    Golden, D A; Beuchat, L R

    1990-08-01

    Recovery and colony formation by healthy and sublethally heat-injured cells of Zygosaccharomyces rouxii as influenced by the procedure for sterilizing recovery media (YM agar [YMA], wort agar, cornmeal agar, and oatmeal agar) were investigated. Media were supplemented with various concentrations of glucose, sucrose, glycerol, or sorbitol and sterilized by autoclaving (110 degrees C, 15 min) and by repeated treatment with steam (100 degrees C). An increase in sensitivity was observed when heat-injured cells were plated on glucose-supplemented YMA at an aw of 0.880 compared with aws of 0.933 and 0.998. Colonies which developed from unheated and heated cells on YMA at aws of 0.998 and 0.933 generally exceeded 0.5 mm in diameter within 3.5 to 4 days of incubation at 25 degrees C, whereas colonies formed on YMA at an aw of 0.880 typically did not exceed 0.5 mm in diameter until after 5.5 to 6.5 days of incubation. The number of colonies exceeding 0.5 mm in diameter which were formed by heat-injured cells on YMA at an aw of 0.880 was 2 to 3 logs less than the total number of colonies detected, i.e., on YMA at an aw of 0.933 and using no limits of exclusion based on colony diameter. A substantial portion of cells which survived heat treatment were sublethally injured as evidenced by increased sensitivity to a suboptimum aw (0.880). In no instance was recovery of Z. rouxii significantly affected by medium sterilization procedure when glucose or sorbitol was used as the aw-suppressing solute.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Computation as Medium

    DEFF Research Database (Denmark)

    Jochum, Elizabeth Ann; Putnam, Lance

    2017-01-01

    Artists increasingly utilize computational tools to generate art works. Computational approaches to art making open up new ways of thinking about agency in interactive art because they invite participation and allow for unpredictable outcomes. Computational art is closely linked...... to the participatory turn in visual art, wherein spectators physically participate in visual art works. Unlike purely physical methods of interaction, computer assisted interactivity affords artists and spectators more nuanced control of artistic outcomes. Interactive art brings together human bodies, computer code......, and nonliving objects to create emergent art works. Computation is more than just a tool for artists, it is a medium for investigating new aesthetic possibilities for choreography and composition. We illustrate this potential through two artistic projects: an improvisational dance performance between a human...

  1. Spiegel. Medium. Kunst

    DEFF Research Database (Denmark)

    Kacunko, Slavko

    of this kind as the marks of a meta-complex of method out of which new models of the image continually arise. The waxing intangibility of proliferating images be they of the mind, in dreams, through gestures, and the equally rampant growth of microstructuring in allocations of knowledge lay a challenge before...... to research. As a void in the apprehension of the world, the mirror obtained a scholarly perspective and the more so in areas beyond its own qualities as a medium, i.e. in images and metaphor, the paradigms of all research looking to image and text. This investigation sets out to comprehend paradoxes......, and space (albeit no expanse) is there to consider the methodological pros and cons of such a selective approach. Even in this synopsis, it has to be and can be stated that what makes for the affinities between psychological, literary and image-research approaches in research on the mirror is the shared...

  2. The diffuse interstellar medium

    Science.gov (United States)

    Cox, Donald P.

    1990-01-01

    The last 20 years of the efforts to understand the diffuse ISM are reviewed, with recent changes of fundamental aspects being highlighted. Attention is given to the interstellar pressure and its components, the weight of the ISM, the midplane pressure contributions, and pressure contributions at 1 kpc. What velocity dispersions, cosmic ray pressure, and magnetic field pressure that can be expected for a gas in a high magnetic field environment is addressed. The intercloud medium is described, with reference to the work of Cox and Slavin (1989). Various caveats are discussed and a number of areas for future investigation are identified. Steps that could be taken toward a successful phase segregation model are discussed.

  3. Effect of EDTA on Pb(II) Uptake and Translocation by Tumbleweed (Salsola Kali): Agar and Hydroponics Studies

    Energy Technology Data Exchange (ETDEWEB)

    de la Rosa, Guadalupe; Gardea-Torresdey, Jorge L.; Peralta-Videa, Jose R.; Aldrich, Mary

    2004-03-31

    Environmental accumulation of Pb represents a worldwide health hazard. While conventional cleanup techniques are generally expensive and soil disturbing, phytoremediation represents an inexpensive friendly option for the removal of contaminants from soil and water. In this research, tumbleweed (Salsola kali) plants exposed for 15 days to Pb(NO3)2 at 80 and 125 ppm in hydroponics and agar media, demonstrated a high capacity to uptake lead. The results showed that the plants cultivated in agar accumulated 25563, 5534 and 2185 mg Pb kg-1 DW in roots, stems and leaves, respectively. Moreover, Pb concentrations found in hydroponically grown tumbleweed plants tissues were 30744, 1511 and 1421 mg kg-1 DW in roots, stems and leaves, respectively. It was observed that EDTA enhanced Pb translocation. No Pb phytotoxic effects were observed during the experimental time period. Cellular structural features were also observed using TEM.

  4. The growth of Treponema hyodysenteriae and other porcine intestinal spirochaetes in a liquid medium.

    Science.gov (United States)

    Lemcke, R M; Bew, J; Burrows, M R; Lysons, R J

    1979-05-01

    A new simple method for the preparation of a liquid medium containing rabbit serum for the propagation of Treponema hyodysenteriae and other porcine intestinal spirochaetes is described. The medium, when dispensed in shallow layers and sealed under 10 per cent CO2 in nitrogen, had a redox potential not greater than -125mV and an initial pH of about 6.9 when buffered with bicarbonate. Growth of T hyodysenteriae developed more rapidly and viable counts reached higher levels at 42 degrees C than at 37 degrees C. Viable counts increased at least 10,000-fold after two to five days' incubation, depending on the temperature. Growth could be initiated from small inocula that failed to produce colonies on blood agar. Using a 1 per cent inoculum, the medium supported the growth of two strains of T hyodysenteriae through 10 serial passages.

  5. Variation in Microbial Identification System Accuracy for Yeast Identification Depending on Commercial Source of Sabouraud Dextrose Agar

    OpenAIRE

    Kellogg, James A.; Bankert, David A.; Chaturvedi, Vishnu

    1999-01-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc.) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system’s accuracy.

  6. Variation in Microbial Identification System accuracy for yeast identification depending on commercial source of Sabouraud dextrose agar.

    Science.gov (United States)

    Kellogg, J A; Bankert, D A; Chaturvedi, V

    1999-06-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc. ) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system's accuracy.

  7. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  8. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  9. Implementation of the Thin Layer Agar Method for Diagnosis of Smear-Negative Pulmonary Tuberculosis in a Setting with a High Prevalence of Human Immunodeficiency Virus Infection in Homa Bay, Kenya▿ †

    Science.gov (United States)

    Martin, Anandi; Munga Waweru, Peter; Babu Okatch, Fred; Amondi Ouma, Naureen; Bonte, Laurence; Varaine, Francis; Portaels, Françoise

    2009-01-01

    The objective of this study was to evaluate the performance of a low-cost method, the thin layer agar (TLA) method, for the diagnosis of smear-negative patients. This prospective study was performed in Homa Bay District Hospital in Kenya. Out of 1,584 smear-negative sputum samples, 212 (13.5%) were positive by culture in Löwenstein-Jensen medium (LJ) and 220 (14%) were positive by the TLA method. The sensitivities of LJ and TLA were 71% and 74%, respectively. TLA could become an affordable method for the diagnosis of smear-negative tuberculosis in resource-limited settings, with results available within 2 weeks. PMID:19494065

  10. Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface

    Science.gov (United States)

    Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan

    2016-01-01

    The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.

  11. Irradiation of silver and agar/silver nanoparticles with argon, oxygen glow discharge plasma, and mercury lamp.

    Science.gov (United States)

    Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R

    2014-01-01

    The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.

  12. Addition of Carbon to the Culture Medium Improves the Detection Efficiency of Aflatoxin Synthetic Fungi

    Directory of Open Access Journals (Sweden)

    Tadahiro Suzuki

    2016-11-01

    Full Text Available Aflatoxin (AF is a harmful secondary metabolite that is synthesized by the Aspergillus species. Although AF detection techniques have been developed, techniques for detection of AF synthetic fungi are still required. Techniques such as plate culture methods are continually being modified for this purpose. However, plate culture methods require refinement because they suffer from several issues. In this study, activated charcoal powder (carbon was added to a culture medium containing cyclodextrin (CD to enhance the contrast of fluorescence and improve the detection efficiency for AF synthetic fungi. Two culture media, potato dextrose agar and yeast extract sucrose agar, were investigated using both plate and liquid cultures. The final concentrations of CD and carbon in the media were 3 mg/mL and 0.3 mg/mL, respectively. Addition of carbon improved the visibility of fluorescence by attenuating approximately 30% of light scattering. Several fungi that could not be detected with only CD in the medium were detected with carbon addition. The carbon also facilitated fungal growth in the potato dextrose liquid medium. The results suggest that addition of carbon to media can enhance the observation of AF-derived fluorescence.

  13. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  14. Compared production behavior of borax and unborax premixed SiC reinforcement Al7Si-Mg-TiB alloys composites with semi-solid stir casting method

    Science.gov (United States)

    Haryono, M. B.; Sulardjaka, Nugroho, Sri

    2016-04-01

    The present study was aimed to investigate the effect of borax additive on physical and mechanical properties of Al7Si-Mg-TiB with the reinforcement of silicon carbide. In this case, the different weight percentage from the reinforcement of SiC (10, 15, and 20% wt), and the borax additive (ratio 1:4) were homogenously added into the matrix by employing the semi-solid stir casting method at the temperature of 590°C. Al7Si-Mg-TiB melted in an electric resistance furnace at 800°C for 25 minutes and the holding time of 5 minutes; SiC was stirred with borax inside the chamber and heated at the temperature of 250°C for 25 minutes. Then, it melted by lowing the temperature into 590°C. The SiC-borax mixture was added into the electric resistance furnace, and automatically stirred by the stirrer at a constant speed (500 rpm for 3 minutes) in the composite A17Si-Mg-TiB. It melted when heated at 750°C for 17minutes,then, casting was performed on the prepared mould. The characterizations of Al7Si-Mg-TiB-SiC/borax were porosity, hardness, and microstructure on the Al7Si-Mg-TiB-SiC/ borax. The porosity of AMC tended to increase along with the increaseof the wt% SiC (1.4%-3.6%); however, borax additive underwent a decrease in porosity (0.14%-1.3%). Further, hardness tended to improve along with the increase of wt% SiC. The unboraxmixture had 79,6 HRB up to 94 HRB. Whereas, the borax additive mixture had 105,8 HRB up to 121 HRB.

  15. Somatic embryogenesis on Musa AAAB, cv. FHIA-18, using liquids culture mediums

    Directory of Open Access Journals (Sweden)

    Luis A. Barranco

    2002-04-01

    Full Text Available Homogenous cell suspensions were iniciated from somatic embryos in the globular stage and the greatest volume of cell biomass on multiplying the suspensions at a density of 3.0% PCV. From the fifteenth day in culture medium for the formation of embryos, structures consisting of proembryos and somatic embryos in the globular stage started to form. With respect to the densities studied, the best results were obtained with 100 mgFW, where 1 871 SE.l-1 formed with a weight of 248 mgFW.l-1 after 30 days. With an initial density of 0.6 gFW in the culture medium for secondary multiplication, an increase of 42.9-fold the initial amount of fresh weight was obtained; after 60 days of culture 15 985 SE.l-1 were obtained. The greatest percentage of maturation was obtained with 400 mgFW with 70% of mature somatic embryos. The positive effect of Biobras-6 (brassinosteroid analogous was confirmed, with a concentration of 0.01 mg.l-1 the best germination percentages were obtained in liquid and semisolid culture medium. Embryo germination in temporaly inmersion (RITA was achieved with an inoculum density of 0.5 gFW for system with 85% germination. One thousand plants obtained from somatic embryos were taken to ex vitro environment, along with plants derived from conventional micropropagation (shoot tips to carry out studies on the possible presence of somaclonal variation. During the first cycle of production, the plants derived from the two methods in vitro culture showed differences with respect to the plants derived from corms in height, diameter and number of suckers. In the second production cycle, the plants from somatic embryos showed similar characteristics to the plants derived from shoot tip and corms with respect to the morphological parameters evaluated, with only 0.2% of the plants with phenotypic changes. Key Words: Banana, cellular density, germination, somaclonal variability, somatic embryo

  16. Mesons in the nuclear Medium

    CERN Document Server

    Kotulla, M

    2006-01-01

    We discuss recent experimental results on the modification of hadron properties in a nuclear medium. Particular emphasis is placed on an $\\omega$ production experiment performed by the CBELSA/TAPS collaboration at the ELSA accelerator. The data shows a smaller $\\omega$ meson mass together with a significant increase of its width in the nuclear medium.

  17. Development of a chemically defined medium for the production of the antibiotic platensimycin by Streptomyces platensis.

    Science.gov (United States)

    Falzone, Maria; Martens, Evan; Tynan, Heather; Maggio, Christian; Golden, Samantha; Nayda, Vasyl; Crespo, Emmanuel; Inamine, Gregory; Gelber, Michael; Lemence, Ryan; Chiappini, Nicholas; Friedman, Emily; Shen, Ben; Gullo, Vincent; Demain, Arnold L

    2013-11-01

    The actinomycete Streptomyces platensis produces two compounds that display antibacterial activity: platensimycin and platencin. These compounds were discovered by the Merck Research Laboratories, and a complex insoluble production medium was reported. We have used this medium as our starting point in our studies. In a previous study, we developed a semi-defined production medium, i.e., PM5. In the present studies, by varying the concentration of the components of PM5, we were able to develop a superior semi-defined medium, i.e., PM6, which contains a higher concentration of lactose. Versions of PM6, containing lower concentrations of all components, were also found to be superior to PM5. The new semi-defined production media contain dextrin, lactose, MOPS buffer, and ammonium sulfate in different concentrations. We determined antibiotic production capabilities using agar diffusion assays and chemical assays via thin-layer silica chromatography and high-performance liquid chromatography. We reduced crude nutrient carryover from the seed medium by washing the cells with distilled water. Using these semi-defined media, we determined that addition of the semi-defined component soluble starch stimulated antibiotic production and that it and dextrin could both be replaced with glucose, resulting in the chemically defined medium, PM7.

  18. Natural Medium for Growing of Endophytic Bacteria from Solanaceae in Malang-Indonesia

    Directory of Open Access Journals (Sweden)

    Purnawati Arika

    2016-01-01

    Full Text Available Endophytic bacteria are important microorganisms having potential as biocontrol agents for many pathogens. Until now, the growth of it always uses semi-synthetic or synthetic medium so it was difficult to be used by farmers in the field and it was expensive to have its propagation as biocontrol agents. Based on the problem, this research will study the natural medium as propagation medium of Endophytic bacteria. It had natural ingredients such as soybean, chicken broth, egg, worms, snail, sorghum and they were easy to get by farmers. This study used endophytic bacteria from Solanaceae in Malang- Indonesia. Four isolates of endophytic bacteria were grown in agar and liquid medium with ingredients of corn flour, soybean flour, sorghum flour, snail flour, and worm flour. There is no difference in the incubation period, color, shape, and surface colony. The population in medium with snail flour ingredients at a concentration of 107 cfu/ml is the highest and snail flour is the best medium for growing endophytic bacteria.

  19. Enumerating actinomycetes in compost bioaerosols at source—Use of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 °C and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  20. High internal phase agar hydrogel dispersions in cocoa butter and chocolate as a route towards reducing fat content.

    Science.gov (United States)

    Skelhon, Thomas S; Olsson, Patrik K A; Morgan, Adam R; Bon, Stefan A F

    2013-09-01

    Reducing the fat content of chocolate formulations is a major challenge for the confectionery industry. We report the suspension of aqueous microgel agar particles of up to 80% v/v within sunflower oil, cocoa butter, and ultimately chocolate. The optimised emulsification process involves a shear-cooling step. We demonstrate the versatility of our method when applied to white, milk, and dark chocolate formulations, whilst preserving the desired polymorph V of the cocoa butter matrix. In addition, we show that this technology can be used as a strategy to disperse alcoholic beverages into chocolate confectionery.

  1. A Direct Quantitative Agar-Plate Based Assay for Analysis of Pseudomonas protegens PF-5 Degradation of Polyurethane Films (Postprint)

    Science.gov (United States)

    2014-10-02

    was dissolved in methanol ; Irogran (1 g) was dissolved in 25 mL THF; and AS-P108 was prepared by adding 0.3 g of catalyst to 10 g of resin and then... Selected results are in Supple- mental Information. 3. Results 3.1. General growth characteristics of Pf-5 on M9/citrate agar plates Dilutions of P...minimal. An IR map with the color scale corresponding to the in- tensity of the 1735 cm1 carbonyl absorbance from the urethane and ester components is

  2. Pions in the nuclear medium

    International Nuclear Information System (INIS)

    Chanfray, G.

    1996-07-01

    We discuss various aspects of pion physics in the nuclear medium. We first study s-wave pion-nucleus interaction in connection with chiral symmetry restoration and quark condensate in the nuclear medium. We then address the question of p-wave pion-nucleus interaction and collective pionic modes in nuclei and draw the consequences for in medium ππ correlations especially in the scalar-isoscalar channel. We finally discuss the modification of the rho meson mass spectrum at finite density and/or temperature in connection with relativistic heavy ion collisions

  3. Fluconazole-containing agar Sabouraud dextrose plates are not useful when screening for susceptibility in Candida albicans.

    Science.gov (United States)

    Bordallo-Cardona, M A; Marcos-Zambrano, L J; Gómez G de la Pedrosa, E; Escribano, P; Bouza, E; Guinea, J; Cantón, R

    2017-04-01

    Fluconazole is an alternative for candidemic patients who are not critically ill. Fluconazole is mainly fungistatic and does not completely inhibit visual Candida albicans growth. We studied the usefulness of fluconazole-containing Sabouraud dextrose agar plates for detecting susceptibility to fluconazole in C. albicans. Adjusted inocula of 19 isolates were transferred directly onto fluconazole-containing Sabouraud dextrose plates (concentrations ranging from 0.125 mg/L to 128 mg/L). The fluconazole MIC in fresh isolates and after growth on the fluconazole-containing plate at 128 mg/L was recorded following the EUCAST EDef 7.2 guidelines. Then isolates were classified according to their degree of trailing production, based on microdilution procedure. All isolates were able to grow on all fluconazole-containing plates, even those isolates susceptible to fluconazole. In fact, we selected isolates with different degrees of trailing based on microdilution procedures. 50% of isolates classified as heavy trailers, 35.71% as moderate trailers, and 14.28% as slight trailers. The use of fluconazole-containing Sabouraud dextrose agar plates was not a reliable method to detect fluconazole susceptibility in C. albicans isolates; growth of the isolates was a trailing effect rather than true resistance.

  4. In vitro fermentation and prebiotic potential of novel low molecular weight polysaccharides derived from agar and alginate seaweeds.

    Science.gov (United States)

    Ramnani, Priya; Chitarrari, Roberto; Tuohy, Kieran; Grant, John; Hotchkiss, Sarah; Philp, Kevin; Campbell, Ross; Gill, Chris; Rowland, Ian

    2012-02-01

    Fermentation properties and prebiotic potential of novel low molecular weight polysaccharides (LMWPs) derived from agar and alginate bearing seaweeds was investigated. Ten LMWPs were supplemented to pH, temperature controlled anaerobic batch cultures inoculated with human feces from three donors, in triplicate. Microbiota changes were monitored using Fluorescent in-situ hybridization and short chain fatty acids, the fermentation end products were analysed using gas chromatography. Of the ten LMWPs tested, Gelidium seaweed CC2253 of molecular weight 64.64 KDa showed a significant increase in bifidobacterial populations from log(10) 8.06 at 0 h to log(10) 8.55 at 24 h (p = 0.018). For total bacterial populations, alginate powder CC2238 produced a significant increase from log(10) 9.01 at 0 h to log(10) 9.58 at 24 h (p = 0.032). No changes were observed in the other bacterial groups tested viz. Bacteroides, Lactobacilli/Enterococci, Eubacterium rectale/Clostridium coccoides and Clostridium histolyticum. The polysaccharides also showed significant increases in total SCFA production, particularly acetic and propionic acids, indicating that they were readily fermented. In conclusion, some LMWPs derived from agar and alginate bearing seaweeds were fermented by gut bacteria and exhibited potential to be used a novel source of prebiotics. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Determination of in vitro synergy for dual antimicrobial therapy against resistant Neisseria gonorrhoeae using Etest and agar dilution.

    Science.gov (United States)

    Wind, Carolien M; de Vries, Henry J C; van Dam, Alje P

    2015-03-01

    In response to antimicrobial resistance of Neisseria gonorrhoeae to last-resort extended-spectrum cephalosporins, combination therapy of azithromycin+ceftriaxone is now recommended. Dual therapy can be effective to treat monoresistant strains as well as multidrug-resistant strains, preferably employing the effect of in vitro synergy. As reports on in vitro synergy of azithromycin+ceftriaxone in N. gonorrhoeae are conflicting, in this study an evaluation of this combination was performed using a cross-wise Etest method and agar dilution. Synergy was defined as a fractional inhibitory concentration index (FICI) of ≤0.5. To identify other dual treatment options for gonorrhoea, in vitro synergy was evaluated for 65 dual antimicrobial combinations using Etest. Azithromycin, cefixime, ceftriaxone, colistin, ertapenem, fosfomycin, gentamicin, minocycline, moxifloxacin, rifampicin, spectinomycin and tigecycline were screened for synergy in all possible combinations. No synergy or antagonism was found for any of the 65 combinations. The geometric mean FICI ranged from 0.82 to 2.00. The mean FICI of azithromycin+ceftriaxone was 1.18 (Etest) and 0.55 (agar dilution). The difference between both methods did not result in a difference in interpretation of synergy. Ceftriaxone-resistant strain F89 was tested in all combinations and no synergy was found for any of them. Most importantly, the ceftriaxone minimum inhibitory concentration of F89 was not decreased below the breakpoint with any concentration of azithromycin. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  6. In-line UV spectroscopy for the quantification of low-dose active ingredients during the manufacturing of pharmaceutical semi-solid and liquid formulations.

    Science.gov (United States)

    Bostijn, N; Hellings, M; Van Der Veen, M; Vervaet, C; De Beer, T

    2018-07-12

    UltraViolet (UV) spectroscopy was evaluated as an innovative Process Analytical Technology (PAT) - tool for the in-line and real-time quantitative determination of low-dosed active pharmaceutical ingredients (APIs) in a semi-solid (gel) and a liquid (suspension) pharmaceutical formulation during their batch production process. The performance of this new PAT-tool (i.e., UV spectroscopy) was compared with an already more established PAT-method based on Raman spectroscopy. In-line UV measurements were carried out with an immersion probe while for the Raman measurements a non-contact PhAT probe was used. For both studied formulations, an in-line API quantification model was developed and validated per spectroscopic technique. The known API concentrations (Y) were correlated with the corresponding in-line collected preprocessed spectra (X) through a Partial Least Squares (PLS) regression. Each developed quantification method was validated by calculating the accuracy profile on the basis of the validation experiments. Furthermore, the measurement uncertainty was determined based on the data generated for the determination of the accuracy profiles. From the accuracy profile of the UV- and Raman-based quantification method for the gel, it was concluded that at the target API concentration of 2% (w/w), 95 out of 100 future routine measurements given by the Raman method will not deviate more than 10% (relative error) from the true API concentration, whereas for the UV method the acceptance limits of 10% were exceeded. For the liquid formulation, the Raman method was not able to quantify the API in the low-dosed suspension (0.09% (w/w) API). In contrast, the in-line UV method was able to adequately quantify the API in the suspension. This study demonstrated that UV spectroscopy can be adopted as a novel in-line PAT-technique for low-dose quantification purposes in pharmaceutical processes. Important is that none of the two spectroscopic techniques was superior to the other

  7. Medium modifications of vector mesons

    International Nuclear Information System (INIS)

    Pant, L.M.

    2004-01-01

    The omega photoproduction in nuclear medium with the ELSA facility at Bonn and the present status of the HADES collaboration to investigate the in-medium hadron properties in proton, heavy ions and hadron induced reactions at GSI, Darmstadt are presented. Efforts are under way to utilise the electron beam at Indore for experimental hadron physics in order to step into the intermediate energy nuclear physics regime. The skeletal outline of the high energy electron beam now available at CAT, Indore is discussed

  8. Medium effects in direct reactions

    International Nuclear Information System (INIS)

    Karakoc, M; Bertulani, C

    2013-01-01

    We discuss medium corrections of the nucleon-nucleon (NN) cross sections and their influence on direct reactions at intermediate energies ≳50 MeV/nucleon. The results obtained with free NN cross sections are compared with those obtained with a geometrical treatment of Pauli-blocking and Dirac-Bruecker methods. We show that medium corrections may lead to sizable modifications for collisions at intermediate energies and that they are more pronounced in reactions involving weakly bound nuclei.

  9. Performance of Hitchens-Pike-Todd-Hewitt medium for group B streptococcus screening in pregnant women.

    Directory of Open Access Journals (Sweden)

    Simone Cristina Castanho Sabaini de Melo

    Full Text Available Group B streptococcus (GBS, which commonly colonizes the female genital tract and rectum, can cause infections in newborns with varying severity, possibly leading to death. The aim of the present study was to evaluate Hitchens-Pike-Todd-Hewitt (HPTH medium performance for GBS screening in pregnant women. A descriptive analytical cross-sectional study was performed with 556 pregnant women, of which 496 were at 35-37 weeks of gestation and 60 were at ≥ 38 weeks of gestation. The study was conducted from September 2011 to March 2014 in northern Paraná, Brazil. Vaginal and anorectal clinical specimens from each pregnant woman were plated on sheep blood agar (SBA and seeded on HPTH medium and Todd-Hewitt enrichment broth. Of the 496 pregnant women at 35-37 weeks of gestation, 141 (28.4% were positive for GBS, based on the combination of the three culture media and clinical specimens. The GBS colonization rates that were detected by each medium were 22.2% for HPTH medium, 21.2% for SBA, and 13.1% for Todd-Hewitt enrichment broth. Of the 60 pregnant women at ≥ 38 weeks of gestation, seven (11.7% were positive for GBS. These results demonstrate that HPTH medium and SBA were more sensitive than Todd-Hewitt enrichment broth for GBS screening in pregnant women and good GBS recovery in culture, indicating that the two media should be used together for vaginal and anorectal specimens.

  10. Detection of Xanthomonas axonopodis pv. Phaseoli and Pseudomonas savastanoi pv. Phaseolicola on bean seed using a Milk-tween medium

    Directory of Open Access Journals (Sweden)

    Popović Tatjana

    2012-01-01

    Full Text Available Bean production is threaten by phytopathogenic bacteria causing agents of blights, Xanthomonas axonopodis pv. phaseoli (Xap and Pseudomonas savastanoi pv. phaseolicola (Psp. Since there is no satisfactory chemical control for the disease, the recommended measures are preventive and include use of healthy seed, crop rotation, deep plowing and use of resistant cultivars. In this work we involved a detection method for isolation of Xap and Psp from bean seed to semi-selective medium Milk Agar Tween (MT. On this medium, Xap formed yellow, mucoid and convex colonies with two hydrolysis zones (less milk and more enlightened, and Psp formed whitish-cream, flat and round colonies. The identification of Xap and Psp was confirmed using the ELISA and PCR. Due to its selectivity, easy preparation and possibility of simultaneous detection of bacteria Xap and Psp, MT medium can be recommended for routine test of seed health for local seed or seed from import.

  11. Biomimetic synthesis of hollow calcium carbonate with the existence of the agar matrix and bovine serum albumin

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Jianhua, E-mail: fjh2008@126.com; Wu, Gang; Qing, Chengsong

    2016-01-01

    Proteins play important roles in the process of biomineralization. Vaterite and calcite have been synthesized by the reaction of Na{sub 2}CO{sub 3} and CaCl{sub 2} in the bovine serum albumin (BSA) and agar system. The samples have been characterized by Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). The shape of CaCO{sub 3} crystal has been analyzed by scanning electronic microscopy (SEM). The results show that calcite is a single product in the absence of BSA, but the product is a mixture of calcite and vaterite in the presence of BSA. The spheral shell of CaCO{sub 3} crystal was obtained when the concentration of BSA increased to 9.0 mg/mL. - Highlights: • Biomimetic synthesis of hollow calcium carbonate • Calcification mechanisms in the presence of both protein and polysaccharides • Biomineralization under the action of protein and polysaccharides.

  12. In vitro susceptibility of filamentous fungi to copper nanoparticles assessed by rapid XTT colorimetry and agar dilution method.

    Science.gov (United States)

    Ghasemian, E; Naghoni, A; Tabaraie, B; Tabaraie, T

    2012-12-01

    Metal nanoparticles and their uses in various aspects have recently drawn a great deal of attention. One of the major applications is that it can be used as an antimicrobial agent. They can be considered in approaches targeted to decrease the harms caused by microorganisms, specifically fungi, threatening the medical and industrial areas. The aim of this study was to investigate the antifungal activity of synthesized copper nanoparticles (CuNPs) against four filamentous fungi including Alternaria alternata, Aspergillus flavus, Fusarium solani, and Penicillium chrysogenum. Zerovalent copper nanoparticles of mean size 8nm were synthesized by inert gas condensation (IGC) method. The antifungal activity of these synthesized copper nanoparticles was measured against selected fungi by using two different techniques including agar dilution method and XTT reduction assay. The minimal inhibitory concentrations (MICs) for copper nanoparticles by agar dilution method were less or equal to 40mg/L for P. chrysogenum, less or equal to 60mg/L for A. alternata, less or equal to 60mg/L for F. solani, and less or equal to 80mg/L for A. flavus. And also MICs obtained by XTT reduction assay ranged from 40 to 80mg/L. Our data demonstrated that the copper nanoparticles inhibited fungal growth, but the fungal sensitivity to copper nanoparticles varies depending on the fungal species. Therefore, it is advisable that the minimal inhibitory concentrations (MICs) be examined before using these compounds. It is hoped that, in future, copper nanoparticles could replace some antifungal agents, making them applicable to many different medical devices and antimicrobial control system. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  13. Equilibrium and kinetic modelling of Cd(II) biosorption by algae Gelidium and agar extraction algal waste.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2006-01-01

    In this study an industrial algal waste from agar extraction has been used as an inexpensive and effective biosorbent for cadmium (II) removal from aqueous solutions. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction. Equilibrium data follow both Langmuir and Redlich-Peterson models. The parameters of Langmuir equilibrium model are q(max)=18.0 mgg(-1), b=0.19 mgl(-1) and q(max)=9.7 mgg(-1), b=0.16 mgl(-1), respectively for Gelidium and the algal waste. Kinetic experiments were conducted at initial Cd(II) concentrations in the range 6-91 mgl(-1). Data were fitted to pseudo-first- and second-order Lagergren models. For an initial Cd(II) concentration of 91 mgl(-1) the parameters of the pseudo-first-order Lagergren model are k(1,ads)=0.17 and 0.87 min(-1); q(eq)=16.3 and 8.7 mgg(-1), respectively, for Gelidium and algal waste. Kinetic constants vary with the initial metal concentration. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model. The model successfully predicts Cd(II) concentration profiles and provides significant insights on the biosorbents performance. The homogeneous diffusivity, D(h), is in the range 0.5-2.2 x10(-8) and 2.1-10.4 x10(-8)cm(2)s(-1), respectively, for Gelidium and algal waste.

  14. Black-box modeling to estimate tissue temperature during radiofrequency catheter cardiac ablation: feasibility study on an agar phantom model

    International Nuclear Information System (INIS)

    Blasco-Gimenez, Ramón; Lequerica, Juan L; Herrero, Maria; Hornero, Fernando; Berjano, Enrique J

    2010-01-01

    The aim of this work was to study linear deterministic models to predict tissue temperature during radiofrequency cardiac ablation (RFCA) by measuring magnitudes such as electrode temperature, power and impedance between active and dispersive electrodes. The concept involves autoregressive models with exogenous input (ARX), which is a particular case of the autoregressive moving average model with exogenous input (ARMAX). The values of the mode parameters were determined from a least-squares fit of experimental data. The data were obtained from radiofrequency ablations conducted on agar models with different contact pressure conditions between electrode and agar (0 and 20 g) and different flow rates around the electrode (1, 1.5 and 2 L min −1 ). Half of all the ablations were chosen randomly to be used for identification (i.e. determination of model parameters) and the other half were used for model validation. The results suggest that (1) a linear model can be developed to predict tissue temperature at a depth of 4.5 mm during RF cardiac ablation by using the variables applied power, impedance and electrode temperature; (2) the best model provides a reasonably accurate estimate of tissue temperature with a 60% probability of achieving average errors better than 5 °C; (3) substantial errors (larger than 15 °C) were found only in 6.6% of cases and were associated with abnormal experiments (e.g. those involving the displacement of the ablation electrode) and (4) the impact of measuring impedance on the overall estimate is negligible (around 1 °C)

  15. CHROMagar COL-APSE: a selective bacterial culture medium for the isolation and differentiation of colistin-resistant Gram-negative pathogens

    DEFF Research Database (Denmark)

    Abdul Momin, Muhd Haziq F; Bean, David C; Hendriksen, Rene S.

    2017-01-01

    medium (SuperPolymyxin). Methodology. The medium was challenged with 84 isolates, including polymyxin B (POL B)-susceptible and -resistant type strains and colistin (COL)-resistant organisms recovered from human and animal samples. Susceptibility to COL and POL B was determined by agar dilution and broth...... microtitre dilution. The lower limit for the detection of COL-resistant organisms was also calculated for both CHROMagar COL-APSE and SuperPolymyxin media. The ability to isolate and correctly differentiate COL-resistant organisms within mixed cultures was also assessed and compared using both media. Results...

  16. Properties of the nuclear medium

    International Nuclear Information System (INIS)

    Baldo, M; Burgio, G F

    2012-01-01

    We review our knowledge on the properties of the nuclear medium that have been studied, over many years, on the basis of many-body theory, laboratory experiments and astrophysical observations. Throughout the presentation particular emphasis is placed on the possible relationship and links between the nuclear medium and the structure of nuclei, including the limitations of such an approach. First we consider the realm of phenomenological laboratory data and astrophysical observations and the hints they can give on the characteristics that the nuclear medium should possess. The analysis is based on phenomenological models, that however have a strong basis on physical intuition and an impressive success. More microscopic models are also considered, and it is shown that they are able to give invaluable information on the nuclear medium, in particular on its equation of state. The interplay between laboratory experiments and astrophysical observations is particularly stressed, and it is shown how their complementarity enormously enriches our insights into the structure of the nuclear medium. We then introduce the nucleon–nucleon interaction and the microscopic many-body theory of nuclear matter, with a critical discussion about the different approaches and their results. The Landau–Fermi liquid theory is introduced and briefly discussed, and it is shown how fruitful it can be in discussing the macroscopic and low-energy properties of the nuclear medium. As an illustrative example, we discuss neutron matter at very low density, and it is shown how it can be treated within the many-body theory. The general bulk properties of the nuclear medium are reviewed to indicate at which stage of our knowledge we stand, taking into account the most recent developments both in theory and experiments. A section is dedicated to the pairing problem. The connection with nuclear structure is then discussed, on the basis of the energy density functional method. The possibility of

  17. Development of selective and differential medium for Shigella sonnei using three carbohydrates (lactose, sorbitol, and xylose) and X-Gal.

    Science.gov (United States)

    Na, G N; Kim, S A; Kwon, O C; Rhee, M S

    2015-08-01

    The aim of this study was to develop a new selective and differential medium for isolating Shigella sonnei (designated 3SD medium). The new medium was based on three carbohydrates (lactose, sorbitol, and xylose) and a chromogenic substrate (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, X-Gal). S. sonnei cannot ferment lactose, sorbitol, or xylose, but can ferment X-Gal, which generates turquoise-blue colonies with rough edges. Other bacteria (54 strains of foodborne pathogens and spoilage bacteria) produced visually distinct colonies on 3SD medium (colorless or pink-violet colonies), or their growth was inhibited on 3SD medium. The optimum concentration of 50 mg/L X-Gal was selected because it yielded the highest level of morphological discrimination between S. sonnei and other bacteria, and this concentration was cost-effective. Bile salt concentration optimization was performed using healthy, heat-injured, and acid-injured S. sonnei. The recovery rate differed significantly depending on the bile salt concentration; media containing >1.0 g/L bile salt showed significantly lower recovery of stress-injured cells than medium containing 0.5 g/L bile salt (P<0.05). Growth of all Gram-positive bacteria was inhibited on medium containing 0.5 g/L bile salt; therefore, this concentration was used as the optimal concentration. Previous media used to isolate Shigella spp. (MacConkey, xylose lysine desoxycholate, and Salmonella-Shigella agar) showed poor performance when used to support the growth of injured S. sonnei cells, whereas 3SD medium supported a high growth rate of injured and healthy cells (equivalent to that obtained with nutrient-rich tryptic soy agar). To validate the performance of 3SD medium with real specimens, S. sonnei and other bacteria were spiked into samples such as untreated water, carrot, salad, and oyster. 3SD medium showed superior specificity (100%) and sensitivity (100%) for S. sonnei, and yielded no false-positive or false-negative results

  18. A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

    Science.gov (United States)

    Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

    2012-06-01

    A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

  19. Detection of group B streptococci in Lim broth by use of group B streptococcus peptide nucleic acid fluorescent in situ hybridization and selective and nonselective agars.

    Science.gov (United States)

    Montague, Naomi S; Cleary, Timothy J; Martinez, Octavio V; Procop, Gary W

    2008-10-01

    The sensitivity, specificity, and positive and negative predictive values for the detection of group B streptococci from Lim enrichment broth with sheep blood agar (SBA), with selective Streptococcus agar (SSA), and by a peptide nucleic acid fluorescent in situ hybridization (PNA FISH) assay were as follows: for culture on SBA, 68.4%, 100%, 100%, and 87.9%, respectively; for culture on SSA, 85.5%, 100%, 100%, and 94.1%, respectively; and for the PNA FISH assay, 97.4%, 98.3%, 96.1%, and 98.9%, respectively.

  20. Corrigendum to “Rheological properties of agar and carrageenan from Ghanaian red seaweeds” [Food Hydrocolloids 63 (2017) 50–58

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2018-01-01

    . G., Penninkhof, B., Rudolph, B., & De Ruiter, G. A. (1999). A novel high-performance anion-exchange chromatographic method for the analysis of carrageenans and agars containing 3,6-anhydrogalactose. Analytical Biochemistry, 268, 213-222. Table 3 Overview of seaweed type (hydrocolloid source......), hydrocolloid extraction method (direct water-extraction or after alkali treatment), hydrocolloid and monomer1 yields, and sulfate levels [data given as means ± SD]. Different roman superscript letters indicate significant differences (P agar yields, monosaccharides...

  1. Evaluation of risk factors in patients with vulvovaginal candidiasis and the value of chromID Candida agar versus CHROMagar Candida for recovery and presumptive identification of vaginal yeast species.

    Science.gov (United States)

    Guzel, Ahmet Bariş; Ilkit, Macit; Akar, Tuba; Burgut, Refik; Demir, S Cansun

    2011-01-01

    Vulvovaginal candidiasis (VVC), particularly the recurrent form, remains an intractable problem for clinicians, microbiologists, and patients. It is essential to confirm the clinical diagnosis by mycological methods and avoid empirical therapy. The recovery of yeast in fungal culture, such as on Sabouraud dextrose agar, remains the gold standard for diagnosis. In this investigation, we examined 474 participants, including 122 (25.7%) with acute VVC cases, 249 (52.5%) who had recurrent VVC (RVVC) cases, and 103 (21.7%) healthy controls. We also administered a questionnaire to obtain information on patient lifestyle and medical, gynecological, and sexual history. In addition, we compared the performance of chromID Candida agar (CAN2) to CHROMagar Candida (CAC) and Sabouraud dextrose agar with gentamicin and chloramphenicol (SGC2). The yeasts were identified by conventional methods including the germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX system. We detected yeasts in 60 of 122 (49.2%) patients with acute VVC cases, 110 of 249 (44.2%) with RVVC cases, and in 35 of 103 (34%) healthy controls (P = 0.07). A total of 205 samples were found to be positive for fungi (43.2%), of which 176 (85.9%) were monofungal, and 29 (14.1%) were polyfungal. In addition, 198 of these samples (96.6%) were positive on CAN2, 195 (95.1%) on CAC, 189 (92.2%) on SGC2, and 183 (89.3%) samples on all three (P = 0.17). The 234 yeast isolates recovered were C. albicans (n = 118), C. glabrata (n = 82), C. kefyr (n = 11), C. krusei (n = 9), C. lipolytica (n = 3), C. colliculosa (n = 2), C. parapsilosis (n = 2), C. pelliculosa (n = 2), C. tropicalis (n = 2), and other species of Candida (n = 3). Of the 29 polyfungal populations, 28 (96.6%) were detected in CAN2, 25 in (86.2%) CAC, and 25 (86.2%) on both (P = 0.35). Notably, we detected the high predominance of C. albicans+C. glabrata (86.2%) in polyfungal populations. Briefly, the detection of C

  2. Fontes de nitrogênio, polpa de banana e ágar no desenvolvimento in vitro de plântulas de orquídea Nitrogen sources, banana pulp and agar in the orchid seedlings in vitro development

    Directory of Open Access Journals (Sweden)

    Moacir Pasqual

    2009-06-01

    Full Text Available Foram realizados dois experimentos com o objetivo de estudar os efeitos de fontes de nitrogênio, polpa de banana e ágar no desenvolvimento in vitro de orquídea Cattleya loddigesii. O primeiro experimento constituiu-se de NH4NO3 (0; 25; 50; 75 e 100% da formulação de 330 mg L-1 e KNO3 (0; 25; 50 e 100% da formulação de 380 mg L-1 acrescidas ao meio MS. No segundo experimento, os tratamentos consistiram de concentrações de ágar (0; 2; 4; 6 e 8 g L-1, no meio de cultura Knudson C, acrescido de polpa de banana nanica (0; 50; 100; 150 e 200 g L-1 em todas as combinações possíveis. Após a inoculação as culturas foram mantidas em sala de crescimento com irradiância em torno de 35 μmol m-2 s-1, temperatura de 25±1ºC e fotoperíodo de 16 horas, por 90 dias. Com base no peso da matéria fresca das plântulas, número de raízes, comprimento da parte aérea e comprimento da maior raiz, a adição de 17,5 a 41,16% da formulação original de NH4NO3 ao meio MS proporcionou melhor desenvolvimento in vitro em plântulas de Cattleya loddigesii. Maior número de folhas foi obtido com a adição ao meio MS de 100% da formulação original de NH4NO3 e 50% de KNO3. A multiplicação in vitro de plântulas de orquídea Cattleya loddigesii é viável em meio Knudson C líquido com a utilização de 128,42 g L-1 de polpa de banana nanica.Two experiments were carried out in order to evaluate the effects of nitrogen sources, banana pulp and agar on Cattleya loddigesii seedlings development in vitro. In the first experiment were tested NH4NO3 at 0; 25; 50; 75 and 100% (330 mg L-1 formulation and KNO3 0; 25; 50 and 100% (380 mg L-1 formulation added to MS medium. The second experiment consisted of different agar concentrations (0; 2; 4; 6 and 8 g L-1, banana nanica pulp (0; 50; 100; 150 and 200 g L-1 in all the possible combinations added to Knudson C medium. After inoculation the plantlets were maintained in growth room with irradiancy around 35

  3. 1 Medium Regiment, (SAHA), SAA

    African Journals Online (AJOL)

    Scientia Militaria: South African Journal of Military Studies. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 16, No 4 (1986) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. 1 Medium Regiment, (S.A.H.A.), ...

  4. Hadron photoproduction at medium energy

    International Nuclear Information System (INIS)

    Dainton, J.B.

    1985-04-01

    Results from measurements of multibody photoproduction at medium incident photon energy (2.8 to 4.8 GeV) are presented and discussed. Particular emphasis is placed on topics which are not well understood and which therefore motivate experiments with the upgraded electron accelerator and storage ring ELSA at the University of Bonn, FR Germany. (author)

  5. Animal Locomotion in Different Mediums

    Indian Academy of Sciences (India)

    Wetlands are repositories of unique biodiversity. Wetlandorganisms are well adapted to their habitat, lying at theinterface of aquatic and terrestrial environments. In order tounderstand their adaptations in a better way, it is essential tograsp the basic properties of the medium in which variousorganisms live. This is attempted ...

  6. A selective medium for the enumeration and differentiation of Lactobacillus delbrueckii ssp. bulgaricus.

    Science.gov (United States)

    Nwamaioha, Nwadiuto O; Ibrahim, Salam A

    2018-06-01

    Modified reinforced clostridial medium (mRCM) was developed and evaluated for the differential enumeration of Lactobacillus delbrueckii ssp. bulgaricus. Lactobacillus bulgaricus, an important species of lactic acid bacteria with health benefits, is used in the production of yogurt and other fermented foods. Our results showed that supplementing reinforced clostridial medium with 0.025% CaCl 2 , 0.01% uracil, and 0.2% Tween 80 (mRCM) significantly enhanced the growth rate of L. bulgaricus RR and ATCC 11842 strains as measured by the optical densities of these strains after 12 h of incubation at 42°C. The bacterial populations (plate count) of the RR and ATCC 11842 strains were 0.76 and 0.77 log cfu/g higher in mRCM than in de Man, Rogosa, and Sharpe and reinforced clostridial medium media, respectively. Conversely, the population counts for other bacterial species (Bifidobacterium, Lactobacillus rhamnosus, and Lactobacillus reuteri) were significantly inhibited in the mRCM medium. The addition of aniline blue dye to mRCM (mRCM-blue) improved the selectivity of L. bulgaricus in mixed lactic bacterial cultures compared with de Man, Rogosa, and Sharpe medium and lactic agar with regard to colony appearance and morphology. The mRCM-blue performed better than the conventional medium in culturing, enumerating, and differentiating L. bulgaricus. Therefore, mRCM-blue could be used as a selective medium to enhance the growth and differentiation of L. bulgaricus in order to meet the increasing demand for this beneficial species of bacteria. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Antimicrobial test of Roselle (Hibiscus sabdariffa L. ethanol extract againts Porphyromonas gingivalis and Streptococcus sanguis using agar method (In vitro study

    Directory of Open Access Journals (Sweden)

    Lenni Indriani

    2016-08-01

    Full Text Available The use of natural materials in the world of health tends to increase every single year, including  in dentistry. Due to the increased of resistance to antibiotics, the development and new innovations to obtain a new antimicrobial agent. Some potential sources of plants have been studied. One of the natural plants is used as drinks, food, medicine and antimicrobial agent is Hibiscus sabdariffa Linn commonly known as Roselle. Several major Gram-negative bacteria are related to periodontal disease such as Porphyromonas gingivalis (P.gingivalis, The dominant species of Gram-positive including Streptococcus sanguis(S.sanguis. The purpose of this in vitro study is to evaluate the Roselle ethanol extract against P.gingivalis bacteria (Gram negative bacteria and S. sanguis (Gram positive bacteria with a concentration of 2.5%, 5%, 7.5% and 10%. The in vitro study of antibacterial effectiveness of Roselle (Hibiscus sabdariffa L. ethanol extract on P.gingivalis and S. sanguis. Natrium Agar (NA solution was poured into a glass plate which had previously been sterilized and then left in place until the medium solidified. P.gingivalis and S.sanguis bacterial cultures were inoculated with inscribed which had solidified. Then put paper disk which had previously been saturated with Roselle extract samples with a concentration of 2.5%, 5%, 7.5% and 10%, and the negative control at the surface of the medium (Ampicillin and incubated for 1 day. Clear zone is formed then observed and measured. There are 24 samples, consisting of 12 samples  P.gingivalis and S.sanguis 12 samples, given intervention roselle flower extract with four types of concentrations to determine the minimum inhibitory consentration (MIC. The observations show that the extensive zone of inhibition concentration of 2.5% a broad zone of inhibition is the smallest among other concentration, both of S.sanguins and P.gingivalis. Meanwhile, the average increases the

  8. Rheological Analysis of Semi-Solid A380.0 Aluminium Alloy / Analiza Właściwości Reologicznych Stopu Aluminium A380.0 W Stanie Stało-Ciekłym

    Directory of Open Access Journals (Sweden)

    Solek K.

    2015-12-01

    Full Text Available Knowledge of the rheological properties is crucial for the numerical modeling of technological processes. The main objective of this study was to conduct an analysis of the rheological properties of A380.0 (AlSi9Cu3(Fe aluminium alloy in the semi-solid state. The results could be used for identification of temperature range of the alloy, where thixoforming processes could be executed. Another purpose of the experimental work could be development of the mathematical models of the alloy apparent viscosity. The significant achievement of this particular study is an application of a viscometer which was specially designed for material tests executed at high temperatures, such as the measurement of liquid or semi-liquid aluminium viscosity. This paper presents the results of a rheological analysis of aluminium alloy.

  9. A novel DTI-QA tool: Automated metric extraction exploiting the sphericity of an agar filled phantom.

    Science.gov (United States)

    Chavez, Sofia; Viviano, Joseph; Zamyadi, Mojdeh; Kingsley, Peter B; Kochunov, Peter; Strother, Stephen; Voineskos, Aristotle

    2018-02-01

    To develop a quality assurance (QA) tool (acquisition guidelines and automated processing) for diffusion tensor imaging (DTI) data using a common agar-based phantom used for fMRI QA. The goal is to produce a comprehensive set of automated, sensitive and robust QA metrics. A readily available agar phantom was scanned with and without parallel imaging reconstruction. Other scanning parameters were matched to the human scans. A central slab made up of either a thick slice or an average of a few slices, was extracted and all processing was performed on that image. The proposed QA relies on the creation of two ROIs for processing: (i) a preset central circular region of interest (ccROI) and (ii) a signal mask for all images in the dataset. The ccROI enables computation of average signal for SNR calculations as well as average FA values. The production of the signal masks enables automated measurements of eddy current and B0 inhomogeneity induced distortions by exploiting the sphericity of the phantom. Also, the signal masks allow automated background localization to assess levels of Nyquist ghosting. The proposed DTI-QA was shown to produce eleven metrics which are robust yet sensitive to image quality changes within site and differences across sites. It can be performed in a reasonable amount of scan time (~15min) and the code for automated processing has been made publicly available. A novel DTI-QA tool has been proposed. It has been applied successfully on data from several scanners/platforms. The novelty lies in the exploitation of the sphericity of the phantom for distortion measurements. Other novel contributions are: the computation of an SNR value per gradient direction for the diffusion weighted images (DWIs) and an SNR value per non-DWI, an automated background detection for the Nyquist ghosting measurement and an error metric reflecting the contribution of EPI instability to the eddy current induced shape changes observed for DWIs. Copyright © 2017 Elsevier

  10. A comparison of a new centrifuge sugar flotation technique with the agar method for the extraction of immature Culicoides (Diptera: Ceratopogonidae) life stages from salt marsh soils.

    Science.gov (United States)

    Two sampling techniques, agar extraction (AE) and centrifuge sugar flotation extraction (CSFE) were compared to determine their relative efficacy to recover immature stages of Culicoides spp from salt marsh substrates. Three types of samples (seeded with known numbers of larvae, homogenized field s...

  11. Comparison of real-time PCR with disk diffusion, agar screen and E-test methods for detection of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Shariati, Laleh; Validi, Majid; Tabatabaiefar, Mohammad Amin; Karimi, Ali; Nafisi, Mohammad Reza

    2010-12-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a nosocomial pathogen. Our main objective was to compare oxacillin disk test, oxacillin E-test, and oxacillin agar screen for detection of methicillin resistance in S. aureus, using real-time PCR for mecA as the "gold standard" comparison assay. 196 S. aureus isolates were identified out of 284 Staphylococcus isolates. These isolates were screened for MRSA with several methods: disk diffusion, agar screen (6.0 μg/ml), oxacillin E-test, and real-time PCR for detection of mecA gene. Of the 196 S. aureus isolates tested, 96 isolates (49%) were mecA-positive and 100 isolates (51%) mecA-negative. All methods tested had a statistically significant agreement with real-time PCR. E-test was 100% sensitive and specific for mecA presence. The sensitivity and specificity of oxacillin agar screen method were 98 and 99%, respectively and sensitivity and specificity of oxacillin disk diffusion method were 95 and 93%, respectively. In the present study, oxacillin E-test is proposed as the best phenotypic method. For economic reasons, the oxacillin agar screen method (6.0 μg/ml), which is suitable for the detection of MRSA, is recommended due to its accuracy and low cost.

  12. Development of edible films from tapioca starch and agar, enriched with red cabbage (Brassica oleracea) as a sausage deterioration bio-indicator

    Science.gov (United States)

    Aditya Wardana, Ata; Dewanti Widyaningsih, Tri

    2017-12-01

    Sausage spoilage has been identified as a cause of some food poisoning cases. Development of a bioindicator film is one of the alternative methods to detect sausage deterioration. The objectives of this paper were to develop a bioindicator edible films (BEF) from tapioca starch (TS), agar, and red cabbage juice (RC), and to evaluate its performance on sausage deterioration detection. The experiment had a 3x3 randomized factorial experimental design (agar: 3, 5, 7% by weight of TS; RC: 10, 15, 20% v/v based on 100% of suspension). Glycerol was used as the plasticizer. The results showed that the addition of agar into the film solution increased the thickness, elongation, and tensile strength, and decreased water vapour transmission rate (WVTR). While the addition of RC increased the thickness, but decreased elongation, tensile strength, and WVTR. BEF consisting of 2% tapioca starch, 7% (w/w) agar and 10 % (v/v) RC was chosen to apply on sausage. It could detect an increase in the microbial population and in the pH variations as result of sausage deterioration at 24, 48, and 72 h shown through color changes of BEF from bright purple at 0 h to light purple, dark purple-blue, and purple-green color respectively.

  13. Development of a D-amino acids electrochemical sensor based on immobilization of thermostable D-Proline dehydrogenase within agar gel membrane

    International Nuclear Information System (INIS)

    Tani, Yuji; Tanaka, Katsuhito; Yabutani, Tomoki; Mishima, Yuji; Sakuraba, Haruhiko; Ohshima, Toshihisa; Motonaka, Junko

    2008-01-01

    A novel biosensor for determination of D-amino acids (DAAs) in biological samples by using an electrode based on immobilization of a thermostable D-Proline dehydrogenase (D-Pro DH) within an agar gel membrane was developed. The electrode was simply prepared by spin-coating the agar solution with the D-Pro DH on a glassy carbon (GC) electrode. An electrocatalytic oxidation current of 2,6-dichloroindophenol (DCIP) was observed at -100 mV vs. Ag/AgCl with the addition of 5 and 20 mmol L -1 D-proline. The current response and its relative standard deviation were 0.15 μA and 7.6% (n = 3), respectively, when it was measured in a pH 8.0 phosphate buffer solution containing 10 mmol L -1 D-proline and 0.5 mmol L -1 DCIP at 50 deg. C. The current response of D-proline increased with increase of the temperature of the sample solution up to 70 deg. C. The electrocatalytic response at the D-Pro DH/agar immobilized electrode subsequently maintained for 80 days. Finally, the D-Pro DH/agar immobilized electrode was applied to determination of DAAs in a human urine sample. The determined value of DAAs in the human urine and its R.S.D. were 1.39 ± 0.12 mmol L -1 and 8.9% (n = 3), respectively

  14. Two-dimensional network formation of cardiac myocytes in agar microculture chip with 1480 nm infrared laser photo-thermal etching.

    Science.gov (United States)

    Kojima, Kensuke; Moriguchi, Hiroyuki; Hattori, Akihiro; Kaneko, Tomoyuki; Yasuda, Kenji

    2003-11-01

    We have developed a new method that enables agar microstructures to be used to cultivate cells and that allows cell network patterns to be controlled. The method makes use of non-contact three-dimensional photo-thermal etching with a 1480 nm infrared focused laser beam, which is strongly absorbed by water and agar gel, to form the shapes of agar microstructures. It allows microstructures to be easily formed in an agar layer within a few minutes, with cell-culture holes formed by the spot heating of a 100 mW laser and tunnels by the tracing of a 100 microm s(-1), 40 mW laser. We cultivated rat cardiac myocytes in adjacent microstructures and observed synchronized beating in them 90 min after they had made physical contact. Our results indicate that the system can make and use microstructures for cell-network cultivation in a minimal amount of time without any expensive microfabrication facilities or complicated procedures.

  15. Experimenting with a Visible Copper-Aluminum Displacement Reaction in Agar Gel and Observing Copper Crystal Growth Patterns to Engage Student Interest and Inquiry

    Science.gov (United States)

    Xu, Xinhua; Wu, Meifen; Wang, Xiaogang; Yang, Yangyiwei; Shi, Xiang; Wang, Guoping

    2016-01-01

    The reaction process of copper-aluminum displacement in agar gel was observed at the microscopic level with a stereomicroscope; pine-like branches of copper crystals growing from aluminum surface into gel at a constant rate were observed. Students were asked to make hypotheses on the pattern formation and design new research approaches to prove…

  16. Characterization of a novel alkaline arylsulfatase from Marinomonas sp. FW-1 and its application in the desulfation of red seaweed agar.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Xu, Jiachao; Gao, Xin; Fu, Xiaoting

    2015-10-01

    A bacterial strain capable of hydrolyzing sulfate ester bonds of p-nitrophenyl sulfate (pNPS) and agar was isolated from the coast area of Qingdao, China. It was identified as Marinomonas based on its 16S rRNA gene sequence and named as Marinomonas sp. FW-1. An arylsulfatase with a recovery of 13 % and a fold of 12 was purified to a homogeneity using ion exchange and gel filtration chromatographies. The enzyme was composed of a single polypeptide chain with the molecular mass of 33 kDa estimated using SDS-PAGE. The optimal pH and temperature of arylsulfatase were pH 9.0 and 45, respectively. Arylsulfatase was stable over pH 8-11 and at temperature below 55 °C. The K m and V max of this enzyme for the hydrolysis of pNPS were determined to be 13.73 and 270.27 μM/min, respectively. The desulfation ratio against agar from red seaweed Gelidium amansii and Gracilaria lemaneiformis were 86.11 and 89.61 %, respectively. There was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated G. amansii agar and that of the commercial agarose. Therefore, this novel alkaline arylsulfatase might have a great potential for application in enzymatic conversion of agar to agarose.

  17. A modified MacConkey agar for selective enumeration of necrotoxigenic E. coli O55 and probiotic E. coli Nissle 1917

    Czech Academy of Sciences Publication Activity Database

    Šplíchalová, Alla; Šplíchal, Igor; Sonnenborn, U.; Rada, V.

    2014-01-01

    Roč. 103, SEP 2014 (2014), s. 82-86 ISSN 0167-7012 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : MacConkey agar * E. coil O55 * NTEC Subject RIV: CE - Biochemistry Impact factor: 2.026, year: 2014

  18. Screening of tannin acyl hydrolase (E.C.3.1.1.20) producing tannery effluent fungal isolates using simple agar plate and SmF process.

    Science.gov (United States)

    Murugan, K; Saravanababu, S; Arunachalam, M

    2007-03-01

    Industrially important tannase producing fungi were isolated from tannery effluent using simple agar plate method. The isolates were screened by submerged fermentation using auto-controlled bioreactor. The colony diameter on the solid surface media shows high correlation with quantitative production of tannase. The isolate Aspergillus niger shows maximum production of both extracellular and intracellular enzyme.

  19. Holographic Renormalization in Dense Medium

    International Nuclear Information System (INIS)

    Park, Chanyong

    2014-01-01

    The holographic renormalization of a charged black brane with or without a dilaton field, whose dual field theory describes a dense medium at finite temperature, is investigated in this paper. In a dense medium, two different thermodynamic descriptions are possible due to an additional conserved charge. These two different thermodynamic ensembles are classified by the asymptotic boundary condition of the bulk gauge field. It is also shown that in the holographic renormalization regularity of all bulk fields can reproduce consistent thermodynamic quantities and that the Bekenstein-Hawking entropy is nothing but the renormalized thermal entropy of the dual field theory. Furthermore, we find that the Reissner-Nordström AdS black brane is dual to a theory with conformal matter as expected, whereas a charged black brane with a nontrivial dilaton profile is mapped to a theory with nonconformal matter although its leading asymptotic geometry still remains as AdS space

  20. Medium modifications with recoil polarization

    Energy Technology Data Exchange (ETDEWEB)

    Brand, J.F.J. van den [Nationaal Instituut voor Kernfysica en Hoge Energiefysica, Amsterdam (Netherlands); Ent, R. [CEBAF, Newport News, VA (United States)

    1994-04-01

    The authors show that the virtual Compton scattering process allows for a precise study of the off-shell electron-nucleon vertex. In a separable model, they show the sensitivity to new unconstrained structure functions of the nucleon, beyond the usual Dirac and Pauli form factors. In addition, they show the sensitivity to bound nucleon form factors using the reaction 4He({rvec e},e{prime},{rvec p}){sup 3}H. A nucleon embedded in a nucleus represents a complex system. Firstly, the bound nucleon is necessarily off-shell and in principle a complete understanding of the dynamical structure of the nucleon is required in order to calculate its off-shell electromagnetic interaction. Secondly, one faces the possibility of genuine medium effects, such as for example quark-exchange contributions. Furthermore, the electromagnetic coupling to the bound nucleon is dependent on the nuclear dynamics through the self-energy of the nucleon in the nuclear medium.

  1. Medium modifications with recoil polarization

    International Nuclear Information System (INIS)

    Brand, J.F.J. van den; Ent, R.

    1994-01-01

    The authors show that the virtual Compton scattering process allows for a precise study of the off-shell electron-nucleon vertex. In a separable model, they show the sensitivity to new unconstrained structure functions of the nucleon, beyond the usual Dirac and Pauli form factors. In addition, they show the sensitivity to bound nucleon form factors using the reaction 4He(rvec e,e',rvec p) 3 H. A nucleon embedded in a nucleus represents a complex system. Firstly, the bound nucleon is necessarily off-shell and in principle a complete understanding of the dynamical structure of the nucleon is required in order to calculate its off-shell electromagnetic interaction. Secondly, one faces the possibility of genuine medium effects, such as for example quark-exchange contributions. Furthermore, the electromagnetic coupling to the bound nucleon is dependent on the nuclear dynamics through the self-energy of the nucleon in the nuclear medium

  2. Kemampuan tumbuh Ecoli DH5 kompeten dalam 'medium minimal' mengandung dekstran untuk mengembangkan metode seleksi klon gen dekstranase

    Directory of Open Access Journals (Sweden)

    Afaf Baktir

    2001-06-01

    Full Text Available Dextranase gene cloning so far have used selection method base on halo formation around he recombinant dex colony grown on LB-blue dextran agar plate. The difficulty of the cloning process is in the selection of dex positive clone. As an example, for obtaining dex gene it has been screened about 36500 colonies. The reason that it was difficult to determine Dex positive clone because dextran hydrolysis by primary recombinant E.coli cells in LB-blue dextran medium was too weak. In the present research, we have designed a minimal medium contained dextran and low concentration of yeast extract to reduce difficulty and to increase accuracy and reproducibility determining of recombinant dex E.coli.In this experiment, dex positive cloned was simulated by competent E.coli grown in medium contained dextranase. The minimal medium designed consist of dextran 1% + yeast extract 0.01% +KH2PO4 0.1% + MgSO4 0.24% + NaCl 0.1% + CaCl2 0.01%. this medium have proved can distinguish between recombinant E.coli dex and other E.coli ie. The competent E.coli can grow well in this medium which was supplied by dextranase, but without dextranase this competent E.coli did not or limited grow

  3. Medium Theory and Social Systems

    DEFF Research Database (Denmark)

    Tække, Jesper

      the  possibility  for  observation both of a social micro and a social macro level from a medium perspective. In the next  section  the paper  frames  the macro  level by  a  tentative  synthesis of  the medium  theory  and  the  sociological systems theory briefly describing a socio......-evolutionary process where new media alter  the societal capacity to handle complexity  in  time and space.  In  this section it becomes probable  that  by  means  of  different  media,  social  systems  give  different  possibilities  for  actual  social  performance.  In a way,  social  systems  themselves can be......  seen as medium  for  formation. Finally  the  paper  takes  the micro  level  perspective  by  applying  the  theory  to  newsgroups,  interpreting  them as self-organizing interactive systems giving a differentiated and diversified scope for social  inclusion.  ...

  4. Mutations in Arabidopsis thaliana genes involved in the tryptophan biosynthesis pathway affect root waving on tilted agar surfaces

    Science.gov (United States)

    Rutherford, R.; Gallois, P.; Masson, P. H.

    1998-01-01

    Arabidopsis thaliana roots grow in a wavy pattern upon a slanted surface. A novel mutation in the anthranilate synthase alpha 1 (ASA1) gene, named trp5-2wvc1, and mutations in the tryptophan synthase alpha and beta 1 genes (trp3-1 and trp2-1, respectively) confer a compressed root wave phenotype on tilted agar surfaces. When trp5-2wvc1 seedlings are grown on media supplemented with anthranilate metabolites, their roots wave like wild type. Genetic and pharmacological experiments argue that the compressed root wave phenotypes of trp5-2wvc1, trp2-1 and trp3-1 seedlings are not due to reduced IAA biosynthetic potential, but rather to a deficiency in L-tryptophan (L-Trp), or in a L-Trp derivative. Although the roots of 7-day-old seedlings possess higher concentrations of free L-Trp than the shoot as a whole, trp5-2wvc1 mutants show no detectable alteration in L-Trp levels in either tissue type, suggesting that a very localized shortage of L-Trp, or of a L-Trp-derived compound, is responsible for the observed phenotype.

  5. Comparison of agar gel immunodiffusion test, enzyme-linked immunosorbent assay and PCR in diagnostics of enzootic bovine leukosis

    Directory of Open Access Journals (Sweden)

    Malovrh Tadej

    2005-01-01

    Full Text Available Bovine leukaemia virus (BLV is a retrovirus that induces a chronic infection in cattle. Once infected, cattle remain virus carriers for life and start to show an antibody response within a few weeks after infection. Eradication and control of the disease are based on early diagnostics and segregation of the carriers. The choice of a diagnostic method depends on the eradication programme, money resources and characteristics of the herd to be analysed. The agar gel immunodiffusion (AGID test has been the serological test of choice for routine diagnosis of serum samples. Nevertheless, in more recent years, the enzyme-linked immunosorbent assay (ELISA has replaced the AGID for large scale testing. For this purpose, commercially available BLV-ELISA kits were compared to the AGID and to the polymerase chain reaction (PCR method performed with two sets of primers, amplifying env region. The ELISA kit based on the p24 core protein was found to be less specific and served as a screening test. The ELISA kit based on the envelope glycoprotein (gpSI served as a verification test and gave a good correlation with the AGID test and PCR method. However, ELISA showed a higher sensitivity than AGID. The p24 based ELiSA was useful for screening a large number of samples, whereas gp51 based ELISA, AGID and PCR were more important for detecting the antibody response against the individual BLV-proteins and therefore for verification of the infection with BLV.

  6. Thermal, mechanical, and physical properties of seaweed/sugar palm fibre reinforced thermoplastic sugar palm Starch/Agar hybrid composites.

    Science.gov (United States)

    Jumaidin, Ridhwan; Sapuan, Salit M; Jawaid, Mohammad; Ishak, Mohamad R; Sahari, Japar

    2017-04-01

    The aim of this research is to investigate the effect of sugar palm fibre (SPF) on the mechanical, thermal and physical properties of seaweed/thermoplastic sugar palm starch agar (TPSA) composites. Hybridized seaweed/SPF filler at weight ratio of 25:75, 50:50 and 75:25 were prepared using TPSA as a matrix. Mechanical, thermal and physical properties of hybrid composites were carried out. Obtained results indicated that hybrid composites display improved tensile and flexural properties accompanied with lower impact resistance. The highest tensile (17.74MPa) and flexural strength (31.24MPa) was obtained from hybrid composite with 50:50 ratio of seaweed/SPF. Good fibre-matrix bonding was evident in the scanning electron microscopy (SEM) micrograph of the hybrid composites' tensile fracture. Fourier transform infrared spectroscopy (FT-IR) analysis showed increase in intermolecular hydrogen bonding following the addition of SPF. Thermal stability of hybrid composites was enhanced, indicated by a higher onset degradation temperature (259°C) for 25:75 seaweed/SPF composites than the individual seaweed composites (253°C). Water absorption, thickness swelling, water solubility, and soil burial tests showed higher water and biodegradation resistance of the hybrid composites. Overall, the hybridization of SPF with seaweed/TPSA composites enhances the properties of the biocomposites for short-life application; that is, disposable tray, plate, etc. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Kinetics and equilibrium modelling of lead uptake by algae Gelidium and algal waste from agar extraction industry.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-05-08

    Pb(II) biosorption onto algae Gelidium, algal waste from agar extraction industry and a composite material was studied. Discrete and continuous site distribution models were used to describe the biosorption equilibrium at different pH (5.3, 4 and 3), considering competition among Pb(II) ions and protons. The affinity distribution function of Pb(II) on the active sites was calculated by the Sips distribution. The Langmuir equilibrium constant was compared with the apparent affinity calculated by the discrete model, showing higher affinity for lead ions at higher pH values. Kinetic experiments were conducted at initial Pb(II) concentrations of 29-104 mgl(-1) and data fitted to pseudo-first Lagergren and second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch mass transfer kinetic model, which successfully predicts Pb(II) concentration profiles at different initial lead concentration and pH, and provides significant insights on the biosorbents performance. Average values of homogeneous diffusivity, D(h), are 3.6 x 10(-8); 6.1 x 10(-8) and 2.4 x 10(-8)cm(2)s(-1), respectively, for Gelidium, algal waste and composite material. The concentration of lead inside biosorbent particles follows a parabolic profile that becomes linear near equilibrium.

  8. Kinetics and equilibrium modelling of lead uptake by algae Gelidium and algal waste from agar extraction industry

    International Nuclear Information System (INIS)

    Vilar, Vitor J.P.; Botelho, Cidalia M.S.; Boaventura, Rui A.R.

    2007-01-01

    Pb(II) biosorption onto algae Gelidium, algal waste from agar extraction industry and a composite material was studied. Discrete and continuous site distribution models were used to describe the biosorption equilibrium at different pH (5.3, 4 and 3), considering competition among Pb(II) ions and protons. The affinity distribution function of Pb(II) on the active sites was calculated by the Sips distribution. The Langmuir equilibrium constant was compared with the apparent affinity calculated by the discrete model, showing higher affinity for lead ions at higher pH values. Kinetic experiments were conducted at initial Pb(II) concentrations of 29-104 mg l -1 and data fitted to pseudo-first Lagergren and second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch mass transfer kinetic model, which successfully predicts Pb(II) concentration profiles at different initial lead concentration and pH, and provides significant insights on the biosorbents performance. Average values of homogeneous diffusivity, D h , are 3.6 x 10 -8 ; 6.1 x 10 -8 and 2.4 x 10 -8 cm 2 s -1 , respectively, for Gelidium, algal waste and composite material. The concentration of lead inside biosorbent particles follows a parabolic profile that becomes linear near equilibrium

  9. Kinetics and equilibrium modelling of lead uptake by algae Gelidium and algal waste from agar extraction industry

    Energy Technology Data Exchange (ETDEWEB)

    Vilar, Vitor J.P. [Laboratory of Separation and Reaction Engineering (LSRE), Departamento de Engenharia Quimica, Faculdade de Engenharia da Universidade do Porto, Rua Dr. Roberto Frias, 4200-465 Porto (Portugal); Botelho, Cidalia M.S. [Laboratory of Separation and Reaction Engineering (LSRE), Departamento de Engenharia Quimica, Faculdade de Engenharia da Universidade do Porto, Rua Dr. Roberto Frias, 4200-465 Porto (Portugal); Boaventura, Rui A.R. [Laboratory of Separation and Reaction Engineering (LSRE), Departamento de Engenharia Quimica, Faculdade de Engenharia da Universidade do Porto, Rua Dr. Roberto Frias, 4200-465 Porto (Portugal)]. E-mail: bventura@fe.up.pt

    2007-05-08

    Pb(II) biosorption onto algae Gelidium, algal waste from agar extraction industry and a composite material was studied. Discrete and continuous site distribution models were used to describe the biosorption equilibrium at different pH (5.3, 4 and 3), considering competition among Pb(II) ions and protons. The affinity distribution function of Pb(II) on the active sites was calculated by the Sips distribution. The Langmuir equilibrium constant was compared with the apparent affinity calculated by the discrete model, showing higher affinity for lead ions at higher pH values. Kinetic experiments were conducted at initial Pb(II) concentrations of 29-104 mg l{sup -1} and data fitted to pseudo-first Lagergren and second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch mass transfer kinetic model, which successfully predicts Pb(II) concentration profiles at different initial lead concentration and pH, and provides significant insights on the biosorbents performance. Average values of homogeneous diffusivity, D {sub h}, are 3.6 x 10{sup -8}; 6.1 x 10{sup -8} and 2.4 x 10{sup -8} cm{sup 2} s{sup -1}, respectively, for Gelidium, algal waste and composite material. The concentration of lead inside biosorbent particles follows a parabolic profile that becomes linear near equilibrium.

  10. Mitogenomes from type specimens, a genotyping tool for morphologically simple species: ten genomes of agar-producing red algae.

    Science.gov (United States)

    Boo, Ga Hun; Hughey, Jeffery R; Miller, Kathy Ann; Boo, Sung Min

    2016-10-14

    DNA sequences from type specimens provide independent, objective characters that enhance the value of type specimens and permit the correct application of species names to phylogenetic clades and specimens. We provide mitochondrial genomes (mitogenomes) from archival type specimens of ten species in agar-producing red algal genera Gelidium and Pterocladiella. The genomes contain 43-44 genes, ranging in size from 24,910 to 24,970 bp with highly conserved gene synteny. Low Ka/Ks ratios of apocytochrome b and cytochrome oxidase genes support their utility as markers. Phylogenies of mitogenomes and cox1+rbcL sequences clarified classification at the genus and species levels. Three species formerly in Gelidium and Pterocladia are transferred to Pterocladiella: P. media comb. nov., P. musciformis comb. nov., and P. luxurians comb. and stat. nov. Gelidium sinicola is merged with G. coulteri because they share identical cox1 and rbcL sequences. We describe a new species, Gelidium millariana sp. nov., previously identified as G. isabelae from Australia. We demonstrate that mitogenomes from type specimens provide a new tool for typifying species in the Gelidiales and that there is an urgent need for analyzing mitogenomes from type specimens of red algae and other morphologically simple organisms for insight into their nomenclature, taxonomy and evolution.

  11. Comparison of agar dilution and antibiotic gradient strip test with broth microdilution for susceptibility testing of swine Brachyspira species.

    Science.gov (United States)

    Mirajkar, Nandita S; Gebhart, Connie J

    2016-03-01

    Production-limiting diseases in swine caused by Brachyspira are characterized by mucohemorrhagic diarrhea (B. hyodysenteriae and "B. hampsonii") or mild colitis (B. pilosicoli), while B. murdochii is often isolated from healthy pigs. Emergence of novel pathogenic Brachyspira species and strains with reduced susceptibility to commonly used antimicrobials has reinforced the need for standardized susceptibility testing. Two methods are currently used for Brachyspira susceptibility testing: agar dilution (AD) and broth microdilution (BMD). However, these tests have primarily been used for B. hyodysenteriae and rarely for B. pilosicoli. Information on the use of commercial susceptibility testing products such as antibiotic gradient strips is lacking. Our main objective was to validate and compare the susceptibility results, measured as the minimum inhibitory concentration (MIC), of 6 antimicrobials for 4 Brachyspira species (B. hyodysenteriae, "B. hampsonii", B. pilosicoli, and B. murdochii) by BMD and AD (tiamulin, valnemulin, lincomycin, tylosin, and carbadox) or antibiotic gradient strip (doxycycline) methods. In general, the results of a high percentage of all 4 Brachyspira species differed by ±1 log2 dilution or less by BMD and AD for tiamulin, valnemulin, lincomycin, and tylosin, and by BMD and antibiotic gradient strip for doxycycline. The carbadox MICs obtained by BMD were 1-5 doubling dilutions different than those obtained by AD. BMD for Brachyspira was quicker to perform with less ambiguous interpretation of results when compared with AD and antibiotic gradient strip methods, and the results confirm the utility of BMD in routine diagnostics. © 2016 The Author(s).

  12. The effectiveness of processed grapefruit-seed extract as an antibacterial agent: I. An in vitro agar assay.

    Science.gov (United States)

    Reagor, Lee; Gusman, Jean; McCoy, Lana; Carino, Edith; Heggers, John P

    2002-06-01

    Grapefruit-seed extract (GSE) Citricidal has, in recent reports, been reported to be successful in combating a variety of common infectious agents. In our study, drops of concentrated grapefruit-seed extract were tested for antibacterial properties against a number of gram-positive and gram-negative organisms. Sixty-seven (67) distinct biotypes were tested for their susceptibilities to the GSE as well as to 5 other topical antibacterials (Silvadene, Sulfamylon, Bactroban, Nitrofurazone, and Silvadene, Nystatin). Wells were punched into Mueller-Hinton agar plates, which were then inoculated with the organism to be tested; each well was then inoculated with one of the antibacterial agents. After an overnight incubation period, the plates were checked for zones of bacterial susceptibility around the individual wells, with a measured susceptibility zone diameter of 10 mm or more considered a positive result. The GSE was consistently antibacterial against all of the biotypes tested, with susceptibility zone diameters equal to or greater than 15 mm in each case. Our preliminary data thus suggest an antibacterial characteristic to GSE that is comparable to that of proven topical antibacterials. Although the GSE appeared to have a somewhat greater inhibitory effect on gram-positive organisms than on gram-negative organisms, its comparative effectiveness against a wide range of bacterial biotypes is significant.

  13. Effect of seaweed on mechanical, thermal, and biodegradation properties of thermoplastic sugar palm starch/agar composites.

    Science.gov (United States)

    Jumaidin, Ridhwan; Sapuan, Salit M; Jawaid, Mohammad; Ishak, Mohamad R; Sahari, Japar

    2017-06-01

    The aim of this paper is to investigate the characteristics of thermoplastic sugar palm starch/agar (TPSA) blend containing Eucheuma cottonii seaweed waste as biofiller. The composites were prepared by melt-mixing and hot pressing at 140°C for 10min. The TPSA/seaweed composites were characterized for their mechanical, thermal and biodegradation properties. Incorporation of seaweed from 0 to 40wt.% has significantly improved the tensile, flexural, and impact properties of the TPSA/seaweed composites. Scanning electron micrograph of the tensile fracture showed homogeneous surface with formation of cleavage plane. It is also evident from TGA results that thermal stability of the composites were enhanced with addition of seaweed. After soil burial for 2 and 4 weeks, the biodegradation of the composites was enhanced with addition of seaweed. Overall, the incorporation of seaweed into TPSA enhances the properties of TPSA for short-life product application such as tray, plate, etc. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The use of antibiotics to improve phage detection and enumeration by the double-layer agar technique

    Directory of Open Access Journals (Sweden)

    Ferreira Eugénio C

    2009-07-01

    Full Text Available Abstract Background The Double-Layer Agar (DLA technique is extensively used in phage research to enumerate and identify phages and to isolate mutants and new phages. Many phages form large and well-defined plaques that are easily observed so that they can be enumerated when plated by the DLA technique. However, some give rise to small and turbid plaques that are very difficult to detect and count. To overcome these problems, some authors have suggested the use of dyes to improve the contrast between the plaques and the turbid host lawns. It has been reported that some antibiotics stimulate bacteria to produce phages, resulting in an increase in final titer. Thus, antibiotics might contribute to increasing plaque size in solid media. Results Antibiotics with different mechanisms of action were tested for their ability to enhance plaque morphology without suppressing phage development. Some antibiotics increased the phage plaque surface by up to 50-fold. Conclusion This work presents a modification of the DLA technique that can be used routinely in the laboratory, leading to a more accurate enumeration of phages that would be difficult or even impossible otherwise.

  15. Microanalysis of Organic Pigments in Ancient Textiles by Surface-Enhanced Raman Scattering on Agar Gel Matrices

    Directory of Open Access Journals (Sweden)

    Marilena Ricci

    2016-01-01

    Full Text Available We review some new methods based on surface-enhanced Raman scattering (SERS for the nondestructive/minimally invasive identification of organic colorants in objects whose value or function precludes sampling, such as historic and archeological textiles, paintings, and drawing. We discuss in detail the methodology we developed for the selective extraction and identification of anthraquinones and indigoids in the typical concentration used in textiles by means of an ecocompatible homogeneous nanostructured agar matrix. The extraction system was modulated according to the chemical properties of the target analyte by choosing appropriate reagents for the extraction and optimizing the extraction time. The system has been found to be extremely stable, easy to use and produce, easy to store, and at the same time able to be analyzed even after long time intervals, maintaining its enhancement properties unaltered, without the detriment of the extracted compound. Highly structured SERS band intensities have been obtained from the extracted dyes adopting laser light excitations at 514.5 and 785 nm of a micro-Raman setup. This analytical method has been found to be extremely safe for the analyzed substrates, thus being a promising procedure for the selective analysis and detection of molecules at low concentration in the field of artworks conservation.

  16. Synthesis and characterization of high-surface-area millimeter-sized silica beads with hierarchical multi-modal pore structure by the addition of agar

    Energy Technology Data Exchange (ETDEWEB)

    Han, Yosep; Choi, Junhyun [Department of Mineral Resources and Energy Engineering, Chonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do 561–756 (Korea, Republic of); Tong, Meiping, E-mail: tongmeiping@iee.pku.edu.cn [The Key Laboratory of Water and Sediment Sciences, Ministry of Education, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Kim, Hyunjung, E-mail: kshjkim@jbnu.ac.kr [Department of Mineral Resources and Energy Engineering, Chonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do 561–756 (Korea, Republic of)

    2014-04-01

    Millimeter-sized spherical silica foams (SSFs) with hierarchical multi-modal pore structure featuring high specific surface area and ordered mesoporous frameworks were successfully prepared using aqueous agar addition, foaming and drop-in-oil processes. The pore-related properties of the prepared spherical silica (SSs) and SSFs were systematically characterized by field emission-scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), small-angle X-ray diffraction (SAXRD), Hg intrusion porosimetry, and N{sub 2} adsorption–desorption isotherm measurements. Improvements in the BET surface area and total pore volume were observed at 504 m{sup 2} g{sup −1} and 5.45 cm{sup 3} g{sup −1}, respectively, after an agar addition and foaming process. Despite the increase in the BET surface area, the mesopore wall thickness and the pore size of the mesopores generated from the block copolymer with agar addition were unchanged based on the SAXRD, TEM, and BJH methods. The SSFs prepared in the present study were confirmed to have improved BET surface area and micropore volume through the agar loading, and to exhibit interconnected 3-dimensional network macropore structure leading to the enhancement of total porosity and BET surface area via the foaming process. - Highlights: • Millimeter-sized spherical silica foams (SSFs) are successfully prepared. • SSFs exhibit high BET surface area and ordered hierarchical pore structure. • Agar addition improves BET surface area and micropore volume of SSFs. • Foaming process generates interconnected 3-D network macropore structure of SSFs.

  17. Medium energy ion scattering (MEIS)

    International Nuclear Information System (INIS)

    Dittmann, K.; Markwitz, A.

    2009-01-01

    This report gives an overview about the technique and experimental study of medium energy ion scattering (MEIS) as a quantitative technique to determine and analyse the composition and geometrical structure of crystalline surfaces and near surface-layers by measuring the energy and yield of the backscattered ions. The use of a lower energy range of 50 to 500 keV accelerated ions impinging onto the target surface and the application of a high-resolution electrostatic energy analyser (ESA) makes medium energy ion scattering spectroscopy into a high depth resolution and surface-sensitive version of RBS with less resulting damage effects. This report details the first steps of research in that field of measurement technology using medium energetic backscattered ions detected by means of a semiconductor radiation detector instead of an ESA. The study of medium energy ion scattering (MEIS) has been performed using the 40 keV industrial ion implanter established at GNS Sciences remodelled with supplementary high voltage insulation for the ion source in order to apply voltages up to 45 kV, extra apertures installed in the beamline and sample chamber in order to set the beam diameter accurately, and a semiconductor radiation detector. For measurement purposes a beam of positive charged helium ions accelerated to an energy of about 80 keV has been used impinging onto target surfaces of lead implanted into silicon (PbSi), scandium implanted into aluminium (ScAl), aluminium foil (Al) and glassy carbon (C). First results show that it is possible to use the upgraded industrial implanter for medium energy ion scattering. The beam of 4 He 2+ with an energy up to 88 keV has been focussed to 1 mm in diameter. The 5 nA ion beam hit the samples under 2 x 10 -8 mbar. The results using the surface barrier detector show scattering events from the samples. Cooling of the detector to liquid nitrogen temperatures reduced the electronic noise in the backscattering spectrum close to zero. A

  18. [Development and Evaluation of a New Selective Culture Medium, KBM Anaero RS-GNR, for Detection of Anaerobic Gram Negative Rods].

    Science.gov (United States)

    Narita, Taeko; Kato, Kyohei; Hanaiwa, Hiroki; Harada, Tetsuhiro; Funashima, Yumiko; Akiwa, Makoto; Sekiguchi, Jun-Ichiro; Nagasawa, Zenzo; Umemura, Tsukuru

    2017-03-22

    The laboratory culture methods for isolating drug-resistant pathogens has been the gold standard in medical microbiology, and play pivotal roles in the overall management of infectious diseases. Recently, several reports have emphasized the development of antibiotics-resistance among anaerobic gram-negative rods, especially Genus Bacteroides and Prevotella . Therefore, a selective culture method to detect these pathogens is needed. We developed here the new selective culture medium, termed "KBM Anaero RS-GNR," for detecting anaerobic Gram-negative rods. Growth capability and selectivity of the agar medium were assessed by using the pure culture suspensions of more than 100 bacterial strains as well as the 13 samples experimentally contaminated with these bacterial strains. This new medium, "KBM Anaero RS-GNR," successfully showed the selective isolation of anaerobic Gram-negative rods. Compared with commercially available medium, "PV Brucella HK Agar, " which is also designed to detect anaerobic Gram-negative rods, there was no significant difference of the overall detection efficiency between two media. However, "KBM Anaero RS-GNR" showed superior to selectivity for anaerobic Gram-negative rods, especially from the samples contaminated with Candida species. Thus, the culture method using KBM Anaero RS-GNR is relevant for isolation of anaerobic Gram-negative rods especially from clinical specimens.

  19. Accretion from an inhomogeneous medium

    International Nuclear Information System (INIS)

    Livio, M.; Soker, N.; Koo, M. de; Savonije, G.J.

    1986-01-01

    The problem of accretion by a compact object from an inhomogeneous medium is studied in the general γnot=1 case. The mass accretion rate is found to decrease with increasing γ. The rate of accretion of angular momentum is found to be significantly lower than the rate at which angular momentum is deposited into the Bondi-Hoyle, symmetrical, accretion cylinder. The consequences of the results are studied for the cases of neutron stars accreting from the winds of early-type companions and white dwarfs and main-sequence stars accreting from winds of cool giants. (author)

  20. A Heterogeneous Medium Analytical Benchmark

    International Nuclear Information System (INIS)

    Ganapol, B.D.

    1999-01-01

    A benchmark, called benchmark BLUE, has been developed for one-group neutral particle (neutron or photon) transport in a one-dimensional sub-critical heterogeneous plane parallel medium with surface illumination. General anisotropic scattering is accommodated through the Green's Function Method (GFM). Numerical Fourier transform inversion is used to generate the required Green's functions which are kernels to coupled integral equations that give the exiting angular fluxes. The interior scalar flux is then obtained through quadrature. A compound iterative procedure for quadrature order and slab surface source convergence provides highly accurate benchmark qualities (4- to 5- places of accuracy) results