46 CFR 42.09-35 - Additional survey requirements for wood-hull vessels.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false Additional survey requirements for wood-hull vessels. 42.09-35 Section 42.09-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES... Additional survey requirements for wood-hull vessels. (a) In addition to the requirements in § 42.09-25, the...

Impact of 2000–2050 climate change on fine particulate matter (PM2.5 air quality inferred from a multi-model analysis of meteorological modes

Directory of Open Access Journals (Sweden)

D. J. Jacob

2012-12-01

Full Text Available Studies of the effect of climate change on fine particulate matter (PM2.5 air quality using general circulation models (GCMs show inconsistent results including in the sign of the effect. This reflects uncertainty in the GCM simulations of the regional meteorological variables affecting PM2.5. Here we use the CMIP3 archive of data from fifteen different IPCC AR4 GCMs to obtain improved statistics of 21st-century trends in the meteorological modes driving PM2.5 variability over the contiguous US. We analyze 1999–2010 observations to identify the dominant meteorological modes driving interannual PM2.5 variability and their synoptic periods T. We find robust correlations (r > 0.5 of annual mean PM2.5 with T, especially in the eastern US where the dominant modes represent frontal passages. The GCMs all have significant skill in reproducing present-day statistics for T and we show that this reflects their ability to simulate atmospheric baroclinicity. We then use the local PM2.5-to-period sensitivity (dPM2.5/dT from the 1999–2010 observations to project PM2.5 changes from the 2000–2050 changes in T simulated by the 15 GCMs following the SRES A1B greenhouse warming scenario. By weighted-average statistics of GCM results we project a likely 2000–2050 increase of ~ 0.1 μg m−3 in annual mean PM2.5 in the eastern US arising from less frequent frontal ventilation, and a likely decrease albeit with greater inter-GCM variability in the Pacific Northwest due to more frequent maritime inflows. Potentially larger regional effects of 2000–2050 climate change on PM2.5 may arise from changes in temperature, biogenic emissions, wildfires, and vegetation, but are still unlikely to affect annual PM2.5 by more than 0.5 μg m−3.

MKB and SMB in the Northern countries

International Nuclear Information System (INIS)

Broden, K.; Andersson, K.

2001-12-01

A meeting on Environmental Impact Assessment and Strategic Environmental Assessment has been held in Turku, Finland, August 22-24 2001. It was held within the framework of two NKS projects: SOS-3 (Radioactive waste) and SOS- 1 (Risk assessment and strategies for safety). The meeting included presenta- tions, discussions and a study visit to the final repository for low- and intermedi- ate level radioactive waste and the intermediate storage for spent nuclear fuel at Olkiluoto. Abstract in Danish: Inom ramen for NKS-projekten SOS-3 (Avfall) och SOS-1 (Riskvaardering och strategi for saakerhet) har ett seminarium om miljokonsekvensbeskrivningar och strategisk miljokonsekvensbedomning haallits i Aabo 22-24 augusti, 2001. Seminariet omfattade foredrag, diskussioner samt en studieresa till Olkoluoto daar besok gjordes till mellanlagret for anvaant braansle och till slutforvaret for laag- och medelaktivt avfall. Under forutsaattning att styrelsen for NKS samtycker kommer ett nytt MKB- seminarium att haallas i Osthammar 2002. (au)

MKB and SMB in the Northern countries[Environmental impact assessment; Strategic environmental assessment; Radiactive waste disporal]; MKB och SMB i Norden

Energy Technology Data Exchange (ETDEWEB)

Broden, K. [Studsvik RadWaste AB (Sweden); Andersson, K. [Krinta konsult (Sweden)

2001-12-01

A meeting on Environmental Impact Assessment and Strategic Environmental Assessment has been held in Turku, Finland, August 22-24 2001. It was held within the framework of two NKS projects: SOS-3 (Radioactive waste) and SOS- 1 (Risk assessment and strategies for safety). The meeting included presenta- tions, discussions and a study visit to the final repository for low- and intermedi- ate level radioactive waste and the intermediate storage for spent nuclear fuel at Olkiluoto. Abstract in Danish: Inom ramen for NKS-projekten SOS-3 (Avfall) och SOS-1 (Riskvaardering och strategi for saakerhet) har ett seminarium om miljokonsekvensbeskrivningar och strategisk miljokonsekvensbedomning haallits i Aabo 22-24 augusti, 2001. Seminariet omfattade foredrag, diskussioner samt en studieresa till Olkoluoto daar besok gjordes till mellanlagret for anvaant braansle och till slutforvaret for laag- och medelaktivt avfall. Under forutsaattning att styrelsen for NKS samtycker kommer ett nytt MKB- seminarium att haallas i Osthammar 2002. (au)

SAFARI 2000 TOMS Aerosol Index Data, Southern Africa, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — ABSTRACT: Daily Aerosol Index (AI) data from Earth Probe (EP) Total Ozone Mapping Spectrometer (TOMS) for the period of August 12-September 25, 2000 were processed...

Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration

Czech Academy of Sciences Publication Activity Database

Sigler, Karel; Gášková, D.

2002-01-01

Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology

ANALISIS EKSPOR CRUDE PALM OIL (CPO INDONESIA DI UNI EROPA TAHUN 2000-2011

Directory of Open Access Journals (Sweden)

Nur Azizah

2017-06-01

Full Text Available Penelitian ini memiliki tujuan untuk menganalisis sejauh mana pengaruh produksi, kurs, harga CPO Internasional, GDP, dan dummy kebijakan Renewable Energy Directive 2009 (RED09 terhadap ekspor CPO Indonesia di Uni Eropa tahun 2000-2011. Metode penelitian yang digunakan untuk menganalisis faktor-faktor yang memengaruhi ekspor CPO Indonesia di kawasan Uni Eropa adalah analisis data panel. Penelitian ini menggunakan data sekunder berupa data cross section enam negara tujuan ekspor di kawasan Uni Eropa selama kurun waktu tahun 2000-2011. Enam negara yang dimaksud adalah Jerman, Italia, Belanda, Rusia, Spanyol, Ukrania yang memiliki jumlah ekspor CPO terbanyak dari Indonesia. Komoditas yang menjadi objek penelitian adalah CPO dengan kode Harmonized System 15111000. Hasil penelitian ini menunjukkan bahwa variabel produksi dan GDP berpengaruh positif dan signifikan terhadap volume ekspor CPO Indonesia di Uni Eropa. Harga CPO Internasional, kurs dan kebijakan RED09 terbukti tidak berpengaruh signifikan terhadap volume ekspor CPO Indonesia di Uni Eropa. This study aims to analyze the extent of the influence of production, exchange, International CPO prices, GDP, and the policy dummy Renewable Energy Directive 2009 (RED09 on Indonesia's CPO exports to the EU in 2000-2011. The method used to analyze the affect of factors of Indonesia's CPO export demanded to the European Union is a panel data analysis. This study uses secondary data, they are cross section data is six counties of export destinations in the European Union during the period of 2000-2011. Six countries in question are Germany, Italy, Netherlands, Russia, Spain, Ukraine which have the highest number of Indonesian CPO exports. The commoditiy which one of the object of the research is the CPO with 15111000 Harmonized System code. The results of this study indicate that the variables of production and GDP exchange are have positive impact and significant on the volume of Indonesian CPO exports to

Chemical, physical, and other data collected using bottle casts from the ALASKA from as part of the California Cooperative Fisheries Investigation (CALCOFI) project, from 09 February 1972 to 25 February 1972 (NCEI Accession 8900059)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, and other data were collected using bottle casts from the ALASKA from February 09, 1972 to February 25, 1972. Data were submitted by Scripps...

END-OF-YEAR-CLOSURE 2000/2001

CERN Document Server

Human Resources Division

2000-01-01

As announced in Weekly Bulletin Nº 3/2000, the Laboratory will be closed from Saturday 23 December 2000 to Sunday 7 January 2001 inclusive. This period consists of 16 days: 4 days' official holiday, i.e. 24, 25 and 31 December 2000 and 1 January 2001; 6 days' special paid leave in accordance with Article R II 4.34 of the Staff Regulations, i.e. 27, 28 and 29 December 2000 and 3, 4 and 5 January 2001; 3 Saturdays, i.e. 23 and 30 December 2000 and 6 January 2001; 2 days, 26 December 2000 to compensate for 24 December 2000 and 2 January 2001 to compensate for 31 December 2000 (Article R II 4.33 of the Staff Regulations); 1 Sunday, i.e. 7 January 2001. The first working day in the New Year will be Monday 8 January 2001. Further information will be available from Division Secretariats, specifically concerning the conditions applicable to members of the personnel who are required to work during this period.

ons theologische seminarium

African Journals Online (AJOL)

Breedee: Rotterdam, 19--. C.H. Irwin het 'n “goedkoop en degelijk .... 21 Vir hom, sien die uitstekende biografie van Erasmus: a.w. Vir 'n evaluering van die boekie, dies., 155 e.v.. 22 Die boekie is ..... 63 Erasmus (a.w., 150 e.v.) wys daarop hoedat J.M. Gibson Johannes du Plessis beïnvloed het. Du Plessis het dus aan die ...

Temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the AURORA AUSTRALIS in the Indian Ocean from 1991-09-25 to 1991-10-27 (NODC Accession 0116370)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0116370 includes chemical, discrete sample, physical and profile data collected from AURORA AUSTRALIS in the Indian Ocean from 1991-09-25 to...

Temperature data from vessels using XBT casts as part of the NOAA Shipboard Environmental Data Acquisition System Program from 1999-12-25 to 2000-08-29 (NODC Accession 0000294)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Temperature data were collected from multiple ships from December 25, 1999 to August 29, 2000. Data were submitted Atlantic Oceanographic and Meteorological...

Assessment of annual whole-body occupational radiation exposure in education, research and industrial sectors in Ghana (2000-09)

International Nuclear Information System (INIS)

Hasford, F.; Owusu-banahene, J.; Otoo, F.; Adu, S.; Sosu, E. K.; Amoako, J. K.; Darko, E. O.; Emi-reynolds, G.; Nani, E. K.; Boadu, M.; Arwui, C. C.; Yeboah, J.

2008-01-01

Institutions in the education, research and industrial sectors in Ghana are quite few in comparison to the medical sector. Occupational exposure to radiation in the education, research and industrial sectors in Ghana have been analysed for a 10 y period between 2000 and 2009, by extracting dose data from the database of the Radiation Protection Inst. (Ghana)) Atomic Energy Commission. Thirty-four institutions belonging to the three sectors were monitored out of which ∼65 % were in the industrial sector. During the 10 y study period, monitored institutions ranged from 18 to 23 while the exposed workers ranged from 246 to 156 between 2000 and 2009. Annual collective doses received by all the exposed workers reduced by a factor of 2 between 2000 and 2009. This is seen as a reduction in annual collective doses in education/research and industrial sectors by ∼39 and ∼62 %, respectively, for the 10 y period. Highest and least annual collective doses of 182.0 man mSv and 68.5 man mSv were all recorded in the industrial sector in 2000 and 2009, respectively. Annual average values for dose per institution and dose per exposed worker decreased by 49 and 42.9 %, respectively, between 2000 and 2009. Average dose per exposed worker for the 10 y period was least in the industrial sector and highest in the education/research sector with values 0.6 and 3.7 mSv, respectively. The mean of the ratio of annual occupationally exposed worker (OEW) doses for the industrial sector to the annual OEW doses for the education/research sector was 0.67, a suggestion that radiation protection practices are better in the industrial sector than they are in the education/research sector. Range of institutional average effective doses within the education/research and industrial sectors were 0.059-6.029, and 0.110-2.945 mSv, respectively. An average dose per all three sectors of 11.87 mSv and an average dose per exposed worker of 1.12 mSv were realised for the entire study period. The entire

Number of radiological examinations in Finland in 2000

CERN Document Server

Hakanen, A

2002-01-01

STUK (Radiation and Nuclear Safety Authority) collected the number of radiological examinations in Finland in 2000. The work was based on a decree of the ministry of social affairs and health on the medical use of radiation. The work was done in cooperation with the Finnish work group of nomenclature of radiological examinations and procedures and professor Seppo Soimakallio. In 2000, ca. 4.1 million x-ray examinations were made in Finland. In 1984 and in 1995, the numbers were ca. 4.6 million and 4.2 million, respectively, indicating that the total number of x-ray examinations has remained nearly unaltered. The proportions of conventional x-ray examinations, computed tomography examinations, angiographic and interventional procedures were ca. 93.5 %, 5.0 %, 0.9 % and 0.6 %, respectively. The reported number of ultrasound examinations was ca. 0.5 million. The reported number of MRI examinations was ca. 0.1 million.

Atmospheric Surface Layer Characterization: Preliminary Desert Lapse Rate Study 22-25 August 2000

National Research Council Canada - National Science Library

Elliott, Doyle

2003-01-01

Results of the August 2000 Desert Lapse Rate (DLR) Experiment are presented. The DLR Experiment was performed to document the night-to-day transition effects on the desert Atmospheric Surface Layer (ASL...

Compatibility of butorphanol and droperidol in 0.9% sodium chloride injection.

Science.gov (United States)

Chen, Fu-Chao; Fang, Bao-Xia; Li, Peng; Yang, Jin-Guo; Zhou, Ben-Hong

2013-03-15

The compatibility and stability of butorphanol tartrate and droperidol in polyvinyl chloride (PVC) bags and glass bottles stored at 4°C and 25°C for up to 15 days were studied. Admixtures were assessed initially and for 15 days after preparation in PVC bags and glass bottles using 0.9% sodium chloride injection as a diluent and stored at 4°C and 25°C. The initial drug concentrations were 0.08 mg/mL for butorphanol tartrate and 0.05 mg/mL for droperidol. Samples were withdrawn from each container immediately after preparation and at predetermined intervals (2, 4, 8, 24, 48, 72, 120, 168, 240, and 360 hours after preparation). The solutions were visually inspected for precipitation, cloudiness, and discoloration at each sampling interval. Drug concentrations were determined using a validated high-pressure liquid chromatography method. After 15 days of storage, all formulations tested retained >98% of the initial concentrations of both drugs. The drug mixtures were clear in appearance, and no color change or precipitation was observed. Throughout this period, pH values remained stable. Admixtures of butorphanol tartrate 0.08 mg/mL and droperidol 0.05 mg/mL in 0.9% sodium chloride injection were stable for at least 360 hours when stored in PVC bags or glass bottles at 4°C and 25°C and protected from light.

Authorship Trends in Spine Publications from 2000 to 2015.

Science.gov (United States)

Haws, Brittany E; Khechen, Benjamin; Movassaghi, Kamran; Yom, Kelly H; Guntin, Jordan A; Cardinal, Kaitlyn L; Shoshana, Noah B; Singh, Kern

2018-02-06

Literature review. To examine changes in authorship characteristics for Spine publications from the year 2000-2015. Scientific publications are considered an indication of academic achievement for physicians. Recently, authorship trends have been investigated, however, limited information is available on this topic within spine-specific literature. Original research articles published in Spine in the years 2000, 2005, 2010, and 2015 were evaluated. Authorship characteristics were collected for each article, including the number of authors and institutions per publication, first and last author gender, publication origin, and highest degree held by the first and last author. Trends over time were analyzed using numeric and visual descriptive analyses including percentages, means, standard deviations, and graphs. An average of 506 articles per year were published in Spine during the years 2000, 2005, 2010, and 2015. The number of articles written by ≥ 10 authors increased during this time (0.9% to 14.4%). There was a substantial increase in the number of multiple institutional affiliations (33.6% to 68.7%) and articles originating from outside North America (47.6% to 55.7%) from 2000 to 2015. The percentage of first authors with bachelor's degrees was higher in 2015 (6.6%) as compared to 2000 (1.4%), and more last authors were identified as MD/PhDs in 2015 (19.2%) than in 2000 (10.0%). Similar female representation was noted for first and last authorship for all years evaluated. The results of this study demonstrate increases in authors per article published in Spine from 2000 to 2015. Additionally, first authors were more likely to hold bachelor's degrees over time. This may be attributed to increasing competition in spine-related fields, necessitating earlier research exposure to aid in academic achievement. Interestingly, the percentage of female authorship has not changed significantly over time, in contrast with much of the previous literature. 2.

Urban and Rural Ozone Pollution Over Lusaka (Zambia, 15.5S, 25E) During SAFARI-2000 (September 2000)

Science.gov (United States)

Thompson, Anne M.; Herman, J. R.; Witte, J. C.; Phahlane, A.; Coetzee, G. J. R.; Mukula, C.; Hudson, R. D.; Frolov, A. D.; Bhartia, P. K. (Technical Monitor)

2001-01-01

In early September, throughout south central Africa, seasonal clearing of dry vegetation and the production of charcoal for cooking leads to intense smoke haze and ozone formation. Ozone soundings made over Lusaka during a six-day period in early September 2000 recorded layers of high ozone (greater than 125 ppbv at 5 km) during two stagnant periods, interspersed by a frontal passage that reduced boundary layer ozone by 30 percent. Smoke aerosol column variations aloft and total ozone were monitored by a sun photometer. During the 6-day measurement period, surface ozone concentrations ranged from 50-95 ppbv and integrated tropospheric ozone from the soundings was 39- 54 Dobson Units (note 1.3 km elevation at the launch site). High ozone concentrations above the mixed and inversion layers were advected from rural burning regions in western Zambia where SAFARI aircraft and ground-based instruments observed intense biomass fires and elevated aerosol and trace gas amounts. TOMS tropospheric ozone and smoke aerosols products show the distribution of biomass burning and associated pollution throughout southern Africa in September 2000. Animations of satellite images and trajectories confirm pollutant recirculation over south central African fires, exit of ozone from Mozambique and Tanzania to the Indian Ocean and the characteristic buildup of tropospheric ozone over the Atlantic from western African outflow.

What Really Happened in The Hague? Report on the COP 6. Part I. 13 - 25 November 2000, The Hague, The Netherlands

International Nuclear Information System (INIS)

Buchner, B.K.

2001-06-01

This paper investigates the occurrences at the Sixth Conference of the Parties (CoP) to the 1992 United Nations Framework Convention on Climate Change (UNFCCC) which took place in The Hague, Netherlands, from 13-25 November of 2000. Since the conference did not reach an agreement there exists a broad interest in knowing what really happened during the negotiations. The aim of the analysis is to give greater insight to reasons of the climate talks' failure and to progress made during the negotiations. Following the discussions of the issues surrounding the talks in The Hague, the paper will also look forward as to possible solutions and ideas for an eventual agreement

Trends in radiology in Finland between 1995 and 2000

International Nuclear Information System (INIS)

Hakanen, Arvi; Jaervinen, Hannu; Soimakallio, Seppo

2003-01-01

The aim of this study was to demonstrate the applicability of a joint nomenclature, i.e., the examination coding system used in Finland, for making a nationwide summary of the radiological examinations and interventional procedures. Another objective was to find trends in radiological practices in Finland between 1995 and 2000 by comparing the nationwide summaries made by Radiation and Nuclear Safety Authority (STUK). An inquiry for the numbers of radiological examinations performed in 2000 was sent to 473 medical radiation users, i.e., safety license holders obtained from the registry maintained by STUK. In 2000, the proportions of plain radiography, contrast-enhanced radiography, angiography, computed tomography and radiological interventional procedures were approximately 91.1, 1.4, 0.9, 5.0, and 1.5%, respectively (distribution of medical examinations). Between 1995 and 2000, the number of medical X-ray examinations showed a slight decrease from ca. 4.2 million to ca. 4.1 million. During the investigated five years period the frequency of contrast enhanced radiography diminished ca. 50% while the frequency of computed tomography increased ca. 20%. The reported number of ultrasonographic examinations showed a slight increase to approximately 0.5 million, whereas the reported number of MRI examinations increased approximately twofold to approximately 0.1 million. The observed trends in radiological practices are useful in attempts to optimize the resources of STUK in the field of radiological protection. (orig.)

Trends in salaries of obstetrics-gynecology faculty, 2000-01 to 2008-09.

Science.gov (United States)

Rayburn, William F; Fullilove, Anne M; Scroggs, James A; Schrader, Ronald M

2011-01-01

We sought to determine whether downward trends in inflation-adjusted salaries (1989-99) continued for obstetrics and gynecology faculty. Data were gathered from the Faculty Salary Survey from the Association of American Medical Colleges for academic years 2001 through 2009. We compared median physician salaries adjusted for inflation according to rank and specialty. While faculty compensation increased by 24.8% (2.5% annually), change in salaries was comparable to the cumulative inflation rate (21.3%). Salaries were consistently highest among faculty in gynecologic oncology (P keeping pace with inflation. Copyright © 2011 Mosby, Inc. All rights reserved.

Energy: global prospects 1985-2000

International Nuclear Information System (INIS)

Wilson, C.L.

1978-01-01

The results from the evaluation of global energy resources up to year 2000, done by the Group of Energetic Strategy of Energy Studies are presented. The studies were concentrated in the fuel supply and demand for the next 25 years, such as: petroleum, natural gas, coal and nuclear energy. The national and international energy policy are studied. (E.G.) [pt

16 CFR 0.9 - Organization structure.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...

Births: preliminary data for 2000.

Science.gov (United States)

Martin, J A; Hamilton, B E; Ventura, S J

2001-07-24

This report presents preliminary data for 2000 on births in the United States. U.S. data on births are shown by age, race, and Hispanic origin of mother. Data on marital status, prenatal care, cesarean delivery, and low birthweight are also presented. Data in this report are based on more than 96 percent of births for 2000. The records are weighted to independent control counts of births received in State vital statistics offices in 2000. Comparisons are made with 1999 final data. The number of births rose 3 percent between 1999 and 2000. The crude birth rate increased to 14.8 per 1,000 population in 2000, 2 percent higher than the 1999 rate. The fertility rate rose 3 percent to 67.6 per 1,000 women aged 15-44 years between 1999 and 2000. The birth rate for teenagers, which has been falling since 1991, declined 2 percent in 2000 to 48.7 births per 1,000 females aged 15-19 years, another historic low. The rate for teenagers 15-17 years fell 4 percent, and the rate for 18-19 year olds was down 1 percent. Since 1991, rates have fallen 29 percent for teenagers 15-17 years and 16 percent for teenagers 18-19 years. Birth rates for all of the older age groups increased for 1999-2000: 1 percent among women aged 20-24 years, 3 percent for women aged 25-29 years, and 5 percent for women in their thirties. Rates for women aged 40-54 years were also up for 2000. The birth rate for unmarried women increased 2 percent to 45.2 births per 1,000 unmarried women aged 15-44 years in 2000, but was still lower than the peak reached in 1994. The number of births to unmarried women was up 3 percent, the highest number ever reported in the United States. However, the number of births to unmarried teenagers declined. The proportion of women who began prenatal care in the first trimester of pregnancy (83.2 percent) did not improve for 2000, nor did the rate of low birthweight (7.6 percent). The total cesarean rate rose for the fourth consecutive year to 22.9 percent, the result of both a

Fra seminarium til skole

DEFF Research Database (Denmark)

Christiansen, Rene B

2014-01-01

towards experimental description”. Denne definition er formuleret af Ference Marton og understreger at fænomenografien er optaget af beskrivelser af menneskers oplevelser, hvad an-går udvalgte sociale fænomener og samtidig at udpege variationer inden for disse sociale fænomener. Fænomenografi fokuserer på...... for at udfolde deres intentioner om lærerarbejde”? Det andet forskningsspørgsmål adresserede adgangsproblematikker i forhold til forskning i skolen og lød: ”Hvordan kan man få adgang til og hvordan skal man forstå skolens hverdagspraksisser”? Gennem afhandlingen er begge spørgsmål blevet diskuteret både...... var både tale om den faktiske, fysiske adgang til en skole, når man dukker op på matriklen og går omkring og ser, hvad der sker. I afhandlingen vises at der det mest af tiden ikke sker noget – der er rig mulighed for at gå omkring, med mindre man italesætter sin intention med at være der. Til eksempel...

Report of the First Community Consultation on the Responsible Collection and Use of Samples for Genetic Research, September 25-26, 2000

Energy Technology Data Exchange (ETDEWEB)

Greenberg, Judith H.

2002-05-22

The First Community Consultation on the Responsible Collection and Use of Samples for Genetic Research was held in Bethesda, Maryland, on September 25-26, 2000. The consultation was convened by the National Institute of General Medical Sciences (NIGMS) of the National Institutes of Health (NIH). Approximately 120 individuals participated in the consultation, half from a broad range of communities and populations, and half from government. The participants shared their views and concerns about population- and community-based genetic research, expanding the focus of the meeting from the collection and use of blood or other tissue samples for genetic research to broader issues and concerns about the conduct of genetic research in general with populations and communities.

Dicty_cDB: FC-BS09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS

33 CFR 151.09 - Applicability.

Science.gov (United States)

2010-07-01

....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...

Dicty_cDB: FC-AI09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik

14 CFR 25.341 - Gust and turbulence loads.

Science.gov (United States)

2010-01-01

... structural degrees of freedom including rigid body motions. (2) The shape of the gust must be: ER09FE96.018... § 25.1527. At sea level, the flight profile alleviation factor is determined by the following equation: EN08MR96.004 Zmo=Maximum operating altitude defined in § 25.1527. (7) When a stability augmentation system...

Delisting Process for Endangered Species and Relevance to Populations on Army Lands

Science.gov (United States)

2005-10-01

09/21/2004 Tinian monarch Recovered 11/11/1977 11/22/1983 Treefrog, pine barrens (FL pop.) New information discovered 09/13/1996 04/26/2000...Sand Association et al. 10-25-2001 Delist Positive (68 FR 52784) Plymouth redbelly turtle National Wilderness Institute 02-03-1997 Delist NOT

Swedish deep repository siting programme. Guide to the documentation of 25 years of geoscientific research (1976-2000)

Energy Technology Data Exchange (ETDEWEB)

Milnes, Alan Geoffrey [GEA Consulting, Uppsala (Sweden)

2002-03-01

Since the mid-1970s, the Swedish Nuclear Fuel and Waste Management Company (SKB) has been carrying out geoscientific research and feasibility studies aimed at identifying suitable sites for deep repositories in the Precambrian basement of the Baltic Shield. The documentation of this research effort forms an extensive body of material which is exceptionally wide-ranging and which is generally little known outside the Swedish nuclear waste community. This has now been compiled in the form of a 'documentation guide' in order to make the research results more easily accessible to the scientific community at large, and to show how they relate to their 'nearest surroundings', i.e. the relevant academic scientific literature and the documentation of similar research by other institutions, in Sweden and in other countries (Finland, Canada). The documentation covers the period 1976-2000 and contains ca. 850 citations, of which about half are technical reports published by SKB and its forerunners. In the main body of the guide (Chapters 2-9), the material is arranged thematically and the scope of the documentation in each theme is described and commented in short texts, showing the interrelationships between the individual reports and scientific papers, with appropriate cross-references. Early chapters (2-5, and 7) cover general themes: bedrock geology, fracturing, glaciation and crustal dynamics, deep groundwater, and geosphere transport, each subdivided into citation groups under headings which are of particular interest to the Swedish deep repository siting programme. Later chapters (6, and 8-9) include thumbnail sketches of the Swedish study sites (Finnsjoen, Fjaellveden, Gideaa, Kamlunge, Klipperaas, Sternoe), the underground laboratory sites of Stripa and Aespoe, and comparable sites in Finland and Canada, as well as the complete documentation to the feasibility studies carried out in eight Swedish municipalities between 1993 and 2000 (Storuman

Swedish deep repository siting programme. Guide to the documentation of 25 years of geoscientific research (1976-2000)

International Nuclear Information System (INIS)

Milnes, Alan Geoffrey

2002-03-01

Since the mid-1970s, the Swedish Nuclear Fuel and Waste Management Company (SKB) has been carrying out geoscientific research and feasibility studies aimed at identifying suitable sites for deep repositories in the Precambrian basement of the Baltic Shield. The documentation of this research effort forms an extensive body of material which is exceptionally wide-ranging and which is generally little known outside the Swedish nuclear waste community. This has now been compiled in the form of a 'documentation guide' in order to make the research results more easily accessible to the scientific community at large, and to show how they relate to their 'nearest surroundings', i.e. the relevant academic scientific literature and the documentation of similar research by other institutions, in Sweden and in other countries (Finland, Canada). The documentation covers the period 1976-2000 and contains ca. 850 citations, of which about half are technical reports published by SKB and its forerunners. In the main body of the guide (Chapters 2-9), the material is arranged thematically and the scope of the documentation in each theme is described and commented in short texts, showing the interrelationships between the individual reports and scientific papers, with appropriate cross-references. Early chapters (2-5, and 7) cover general themes: bedrock geology, fracturing, glaciation and crustal dynamics, deep groundwater, and geosphere transport, each subdivided into citation groups under headings which are of particular interest to the Swedish deep repository siting programme. Later chapters (6, and 8-9) include thumbnail sketches of the Swedish study sites (Finnsjoen, Fjaellveden, Gideaa, Kamlunge, Klipperaas, Sternoe), the underground laboratory sites of Stripa and Aespoe, and comparable sites in Finland and Canada, as well as the complete documentation to the feasibility studies carried out in eight Swedish municipalities between 1993 and 2000 (Storuman, Malaa, Nykoeping

Structural and electric properties of La{sub 0.7}Sr{sub 0.25}Na{sub 0.05}Mn{sub 0.9}Ti{sub 0.1}O{sub 3} ceramics

Energy Technology Data Exchange (ETDEWEB)

Kossi, S. EL., E-mail: safwene666@hotmail.com [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Rhouma, F.I.H. [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Laboratoire de Photovoltaique, Centre de Recherches et des Tehnologies de l' Energie, BP Hammam-Lif 2050 (Tunisia); Dhahri, J. [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Khirouni, K. [Laboratoire de Physique des Matériaux et des Nanomatériaux Appliquée à L’environnement, Faculté des Sciences de Gabes Cité Erriadh, 6079 Gabes (Tunisia)

2014-05-01

This work studies structural and various electrical properties of polycrystalline La{sub 0.7}Sr{sub 0.25} Na{sub 0.05} Mn{sub 0.9}Ti{sub 0.1}O{sub 3} (LSNMTi), which were prepared by standard solid state reaction technique. The formation of a single phase rhombohedral structure of the composition was confirmed by the X-ray diffraction study. The electrical behavior of sintered pellets investigated by impedance spectra has shown frequency dependent behavior. Both conductivity and electric modulus formalisms have been used to study the relaxation dynamics of charge carriers. The variation of ac conductivity with frequency at different temperatures obeys the universal Jonscher's power law (σ{sub ac}αw).

15 CFR 995.25 - Quality management system.

Science.gov (United States)

2010-01-01

... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Quality management system. 995.25... § 995.25 Quality management system. (a) Quality management system for CEVADs. (1) CEVAD shall operate a quality management system, based on ISO 9001-2000 or equivalent, which embraces all elements of the...

Childhood death rates declined in Sweden from 2000 to 2014 but deaths from external causes were not always investigated.

Science.gov (United States)

Otterman, Gabriel; Lahne, Klara; Arkema, Elizabeth V; Lucas, Steven; Janson, Staffan; Hellström-Westas, Lena

2018-03-08

Countries that conduct systematic child death reviews report a high proportion of modifiable characteristics among deaths from external causes, and this study examined the trends in Sweden. We analysed individual-level data on external, ill-defined and unknown causes from the Swedish cause of death register from 2000 to 2014, and mortality rates were estimated for children under the age of one and for those aged 1-14 and 15-17 years. Child deaths from all causes were 7914, and 2006 (25%) were from external, ill-defined and unknown causes: 610 (30%) were infants, 692 (34%) were 1-14 and 704 (35%) were 15-17. The annual average was 134 cases (range 99-156) during the study period. Mortality rates from external, ill-defined and unknown causes in children under 18 fell 19%, from 7.4 to 6.0 per 100 000 population. A sizeable number of infant deaths (8.0%) were registered without a death certificate during the study period, but these counts were lower in children aged 1-14 (1.3%) and 15-17 (0.9%). Childhood deaths showed a sustained decline from 2000 to 2014 in Sweden and a quarter were from external, ill-defined or unknown causes. Systematic, interagency death reviews could yield information that could prevent future deaths. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

High Efficiency EBCOT with Parallel Coding Architecture for JPEG2000

Directory of Open Access Journals (Sweden)

Chiang Jen-Shiun

2006-01-01

Full Text Available This work presents a parallel context-modeling coding architecture and a matching arithmetic coder (MQ-coder for the embedded block coding (EBCOT unit of the JPEG2000 encoder. Tier-1 of the EBCOT consumes most of the computation time in a JPEG2000 encoding system. The proposed parallel architecture can increase the throughput rate of the context modeling. To match the high throughput rate of the parallel context-modeling architecture, an efficient pipelined architecture for context-based adaptive arithmetic encoder is proposed. This encoder of JPEG2000 can work at 180 MHz to encode one symbol each cycle. Compared with the previous context-modeling architectures, our parallel architectures can improve the throughput rate up to 25%.

Emissions and measure analysis of fine particles 2000-2020; Emissionen und Massnahmenanalyse Feinstaub 2000-2020

Energy Technology Data Exchange (ETDEWEB)

Joerss, Wolfram; Handke, Volker [Institut fuer Zukunftsstudien und Technologiebewertung gGmbH (IZT), Berlin (Germany)

2007-08-15

With this study, the Federal Environmental Agency's emission inventory on total suspended particles and the fine fractions PM{sub 1}0 and PM{sub 2}.5 was updated. On that basis, a reference scenario was developed for anthropogenic emissions of particulate matter up to the years 2010, 2015 and 2020. In addition, potential additional emission reduction measures were systematically collected and quantified. At the source groups which contribute most strongly to the emissions there are clear differences between the fine fractions and in the course of time. In particular, with the total fine the emission freight is very broadly distributed over many source groups. With PM{sub 2}.5, the emissions are more strongly concentrated on a limited number of source groups. The decrease of the emissions in the years between 2000 and 2020 in the reference scenario takes place in source groups with high portions of PM{sub 2}.5 of the emissions of total fine particles.

Emissions and measure analysis of fine particles 2000-2020; Emissionen und Massnahmenanalyse Feinstaub 2000-2020

Energy Technology Data Exchange (ETDEWEB)

Joerss, Wolfram; Handke, Volker [Institut fuer Zukunftsstudien und Technologiebewertung gGmbH (IZT), Berlin (Germany)

2007-08-15

With this study, the Federal Environmental Agency's emission inventory on total suspended particles and the fine fractions PM{sub 1}0 and PM{sub 2}.5 was updated. On that basis, a reference scenario was developed for anthropogenic emissions of particulate matter up to the years 2010, 2015 and 2020. In addition, potential additional emission reduction measures were systematically collected and quantified. At the source groups which contribute most strongly to the emissions there are clear differences between the fine fractions and in the course of time. In particular, with the total fine the emission freight is very broadly distributed over many source groups. With PM{sub 2}.5, the emissions are more strongly concentrated on a limited number of source groups. The decrease of the emissions in the years between 2000 and 2020 in the reference scenario takes place in source groups with high portions of PM{sub 2}.5 of the emissions of total fine particles.

Increasing educational disparities in premature adult mortality, Wisconsin, 1990-2000.

Science.gov (United States)

Reither, Eric N; Peppard, Paul E; Remington, Patrick L; Kindig, David A

2006-10-01

Public health agencies have identified the elimination of health disparities as a major policy objective. The primary objective of this study is to assess changes in the association between education and premature adult mortality in Wisconsin, 1990-2000. Wisconsin death records (numerators) and US Census data (denominators) were compiled to estimate mortality rates among adults (25-64 years) in 1990 and 2000. Information on the educational status, sex, racial identification, and age of subjects was gathered from these sources. The effect of education on mortality rate ratios in 1990 and 2000 was assessed while adjusting for age, sex, and racial identification. Education exhibited a graded effect on mortality rates, which declined most among college graduates from 1990 to 2000. The relative rate of mortality among persons with less than a high school education compared to persons with a college degree increased from 2.4 to 3.1 from 1990-2000-an increase of 29%. Mortality disparities also increased, although to a lesser extent, among other educational groups. Despite renewed calls for the elimination of health disparities, evidence suggests that educational disparities in mortality increased from 1990 to 2000.

HEURISTIC EVALUATION FOR MOBILE APPLICATION (STUDI KASUS: APLIKASI DEPO AUTO 2000 TANJUNG API API PALEMBANG

Directory of Open Access Journals (Sweden)

Usman Ependi

2017-11-01

Full Text Available Heuristic evaluation merupakan salah satu bentuk usability testing perangkat lunak yang dinilai oleh pengguna (evaluator. Dalam melakukan heuristic evaluation instrumen penilaian terdiri dari sepuluh (10 pernyataan dengan lima pilihan jawaban dalam skala severity ratings. Dalam penelitian ini heuristic evaluation terhadap aplikasi Depo Auto 2000 Tanjung Api-Api Palembang yang dilakukan oleh 4 evaluator.  Hasil dari heuristic evaluation dikelompokkan kedalam  masing-masing instrumen yaitu visibility of system status dengan nilai 0,75, match between system and the real world dengan nilai 0,25, user control and freedom dengan nilai 0,25, consistency and standards dengan nilai 0,75, error prevention dengan nilai 1, recognition rather than recall dengan nilai 1,25, flexibility and efficiency of use dengan nilai 0,25, Aesthetic and minimalist design dengan nilai 0,25, help users recognize, diagnose, and recover from errors dengan nilai 1 dan Help and documentation dengan nilai 0. Dari hasil heuristic evaluation yang dilakukan menunjukkan bahwa evaluator memberikan nilai 0 dan 1 aplikasi Depo Atuo 2000 Tanjung Api-Api Palembang. Hasil penilaian tersebut menunjukkan bahwa aplikasi yang buat tidak ada masalah usability dan hanya memiliki cosmetic problem sehingga aplikasi Depo Auto 2000 Tanjung Api Api Palembang  dapat dinyatakan layak untuk didistribusikan kepada pengguna akhir (end user.

The Amorgos, Greece earthquake and tsunami of 09 July 1956: Focal mechanism and field survey

Science.gov (United States)

Okal, E. A.; Synolakis, C. E.; Yalciner, A. C.

2004-12-01

The earthquake of 09 July 1956 near the Greek island of Amorgos (M sub PAS = 7.8) is the largest event of the past 75 years in the Aegean. It created the most damaging tsunami to hit Greece in the past century, with reported run-up of 25 m on the Eastern coast of Amorgos. This prompted Ambraseys [1960] to propose that underwater landslides may have occurred. We use the PDFM method introduced by Reymond and Okal [2000] to invert a moment tensor from a limited set of spectral amplitudes of mantle waves. Our solution features a normal faulting mechanism (phi = 245 deg; delta = 67 deg; lambda = 281 deg.) and a moment of 3.9 * 10**27 dyn-cm. In parallel, we have started a systematic survey of tsunami run-up heights in the Aegean Islands and the Asia Minor coast of Turkey, through the interview of elderly witnesses of the tsunami. Our growing dataset presently includes 29 data points on seven islands and at eight villages on the Turkish Coast. We confirm a single run-up value of 20 m on Eastern Amorgos, with measured run-up limited to 8 m on Astypalea and at most 3 m at other locations (1 m on the Turkish coast). The uniqueness of the large run-up value, in the proximity of locales with milder values, does suggest that it could be due to the influence of a localized underwater landslide.

Registration of 'CP 09-2392' Sugarcane

Science.gov (United States)

CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...

Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds

International Nuclear Information System (INIS)

Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.

2007-01-01

The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound

Quantifying Future PM2.5 and Associated Health Effects Due to Changes in US Wildfires

Science.gov (United States)

Pierce, J. R.; Val Martin, M.; Ford, B.; Zelasky, S.; Heald, C. L.; Li, F.; Lawrence, D. M.; Fischer, E. V.

2017-12-01

Fine particulate matter (PM2.5) from landscape fires has been shown to adversely affect visibility, air quality and and health across the US. Fire activity is strongly related to climate and human activities. Predictions based on climate scenarios and future land cover projections that consider socioeconomic development suggest that fire activity will rise dramatically over the next decades. As PM2.5 is associated with increased mortality and morbidity rates, increases in emissions from landscape fires may alter the health burden on the US population. Here we present an analysis of the changes in future wildfire activity and consequences for PM2.5 and health over the US from 2000 to 2100. We employ the global Community Earth System Model (CESM) with the IPCC RCP projections. Within CESM, we use a process-based global fire parameterization to project future climate-driven and human-caused fire emissions. From these simulations, we determine the current and future impact on PM2.5 concentrations and visibility for different regions of the US, and we also calculate the mortality attributable to PM2.5 and wildfire-specific PM2.5 using existing concentration-response functions. Results show that although total PM2.5 concentrations in the US are projected to be similar in 2100 as in 2000, the dominant source of PM2.5 will change. Under the RCP8.5 climate projection and SSP3 population projection, non-fire emissions (mostly anthropogenic) are projected to decrease, but PM2.5 from CONUS and non-US wildfires is projected to increase from approximately 20% of all PM2.5 in 2000 to 80% of all PM2.5 in 2100. Furthermore, although the US population is expected to decline between 2000 and 2100, the mortality attributable to wildfire smoke is expected to increase from 25,000 deaths per year in 2000 to 75,000 deaths per year in 2100.

Stability of methadone hydrochloride in 0.9% sodium chloride injection in single-dose plastic containers.

Science.gov (United States)

Denson, D D; Crews, J C; Grummich, K W; Stirm, E J; Sue, C A

1991-03-01

The stability of methadone hydrochloride in 0.9% sodium chloride injection in flexible polyvinyl chloride containers was studied. Commercially available methadone hydrochloride 20 mg/mL and 25-mL single-dose bags of 0.9% sodium chloride injection were used. Six samples each were prepared at methadone hydrochloride concentrations of 1, 2, and 5 mg/mL. The solutions were stored at room temperature and were not protected from light. Immediately after preparation and after two, three, and four weeks of storage, each of the 18 samples was divided into three aliquots, each of which was analyzed in duplicate for methadone hydrochloride concentration by gas chromatography. There was less than 10% change in methadone hydrochloride concentration in any sample throughout the four-week study period. Methadone hydrochloride at concentrations of 1, 2, and 5 mg/mL prepared in commercially available flexible polyvinyl chloride containers of 0.9% sodium chloride injection and stored at room temperature without deliberate protection from light is stable for at least four weeks.

41 CFR 101-25.405 - Materials handling equipment.

Science.gov (United States)

2010-07-01

... 50 45 40 30 25 20 15 10 Straddle truck 15 50 50 50 45 45 45 40 40 35 35 30 25 20 15 10 Electric Fork... percentage of acquisition costs (years in use) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Gasoline Fork truck (2000 pounds to 6000 pounds) 8 50 45 40 30 25 20 15 10 Fork truck (over 6000 pounds) 10 50 45 40 35 30 25 20 15...

Fine particulate matter components and mortality in Greater Houston: Did the risk reduce from 2000 to 2011?

International Nuclear Information System (INIS)

Liu, Suyang; Zhang, Kai

2015-01-01

Fine particulate matter (less than 2.5 μm in aerodynamic diameter; PM_2_._5) pollution poses a major environmental threat in Greater Houston due to rapid economic growth and the numerous PM_2_._5 sources including ports, vehicles, and the largest petrochemical industry in the United States (U.S.). Our objectives were to estimate the short-term associations between the PM_2_._5 components and mortality during 2000–2011, and evaluate whether these associations have changed over time. A total of 333,317 deaths were included in our assessment, with an average of 76 deaths per day. We selected 17 PM_2_._5 components from the U.S. Environmental Protection Agency's Chemical Speciation Network, and then applied Poisson regression models to assess the associations between the PM_2_._5 components and mortality. Additionally, we repeated our analysis for two consecutive periods: 2000–2005 and 2006–2011. Interquartile range increases in ammonium (0.881 μg/m"3), nitrate (0.487 μg/m"3), sulfate (2.245 μg/m"3), and vanadium (0.004 μg/m"3) were associated with an increased risk in mortality of 0.69% (95% confidence interval (CI): 0.26, 1.12%), 0.38% (95% CI: 0.11, 0.66%), 0.61% (95% CI: 0.15, 1.06%), and 0.58% (95% CI: 0.12, 1.04%), respectively. Seasonal analysis suggested that the associations were strongest during the winter months. The association between PM_2_._5 mass and mortality decreased during 2000–2011, however, the PM_2_._5 components showed no notable changes in mortality risk over time. Our study indicates that the short-term associations between PM_2_._5 and mortality differ across the PM_2_._5 components and suggests that future air pollution control measures should not only focus on mass but also pollutant sources. - Highlights: • PM_2_._5 concentrations were associated with increased mortality risk. • A few major PM_2_._5 components were associated with increased mortality risk. • Associations were generally strongest in winter in Greater

XI International Symposium on Forensic Sciences, 25-27.09.2013, Bratislava

Directory of Open Access Journals (Sweden)

2014-10-01

Full Text Available 11.Międzynarodowe Sympozjum Kryminalistyczne odbyło się w dniach 25 do 27 września 2013 roku po raz kolejny w stolicy Republiki Słowackiej – Bratysławie. Wzięło w nim udział ponad 80-ciu delegatów z 18 krajów świata – w tym 16 europejskich, a także z Indii oraz Nowej Zelandii – a także przedstawicieli Interpolu oraz Europolu. Delegaci obecni na Sympozjum reprezentowali zarówno ośrodki akademickie, instytuty badawcze, laboratoria kryminalistyczne oraz organy ścigania. W Sympozjum wzięła udział grupa delegatów z Polski reprezentujących Centralne Laboratorium Kryminalistyczne Policji – Instytut Badawczy, Instytut Ekspertyz Sądowych, Uniwersytet Warmińsko-Mazurski w Olsztynie,Uniwersytet Medyczny w Białymstoku oraz Polskie Towarzystwo Kryminalistyczne.

iWork '09 pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.

Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069126)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...

Chemical, physical and profile oceanographic data collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069113)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...

Corrective Action Plan for Corrective Action Unit 143: Area 25 Contaminated Waste Dumps, Nevada Test Site, Nevada

International Nuclear Information System (INIS)

Gustafason, D.L.

2001-01-01

This Corrective Action Plan (CAP) has been prepared for Corrective Action Unit (CAU) 143: Area 25 Contaminated Waste Dumps, Nevada Test Site, Nevada, in accordance with the Federal Facility Agreement and Consent Order of 1996. This CAP provides the methodology for implementing the approved corrective action alternative as listed in the Corrective Action Decision Document (U.S. Department of Energy, Nevada Operations Office, 2000). The CAU includes two Corrective Action Sites (CASs): 25-23-09, Contaminated Waste Dump Number 1; and 25-23-03, Contaminated Waste Dump Number 2. Investigation of CAU 143 was conducted in 1999. Analytes detected during the corrective action investigation were evaluated against preliminary action levels to determine constituents of concern for CAU 143. Radionuclide concentrations in disposal pit soil samples associated with the Reactor Maintenance, Assembly, and Disassembly Facility West Trenches, the Reactor Maintenance, Assembly, and Disassembly Facility East Trestle Pit, and the Engine Maintenance, Assembly, and Disassembly Facility Trench are greater than normal background concentrations. These constituents are identified as constituents of concern for their respective CASs. Closure-in-place with administrative controls involves use restrictions to minimize access and prevent unauthorized intrusive activities, earthwork to fill depressions to original grade, placing additional clean cover material over the previously filled portion of some of the trenches, and placing secondary or diversion berm around pertinent areas to divert storm water run-on potential

Pressure effect on the transport properties of superconducting Li0.9MobO17bronze

International Nuclear Information System (INIS)

Filippini, C.E.; Boujida, M.; Marcus, J.; Schlenker, C.; Beille, J.

1989-01-01

The electrical resistivity of Li 0.9 Mo 6 O 17 single crystal has been studied between 1.5 K and 300 K under hydrostatic pressures up to 20 k bar. A large increase of the superconducting transition temperature, from 1.7 K to 2.5 K, is associated to a sharp decease of the temperature T m of the electronic, probably CDW instability

The association between serum biomarkers and disease outcome in influenza A(H1N1)pdm09 virus infection

DEFF Research Database (Denmark)

Davey, Richard T; Lynfield, Ruth; Dwyer, Dominic E

2013-01-01

Prospective studies establishing the temporal relationship between the degree of inflammation and human influenza disease progression are scarce. To assess predictors of disease progression among patients with influenza A(H1N1)pdm09 infection, 25 inflammatory biomarkers measured at enrollment wer...

2000 Annual report: synthesis; 2000 Resenia de actividades

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

This synthesis of the Annual Report 2000 present information of the main activities on the scope of the radiation protection and nuclear safety of the Nuclear Regulatory Authority (NRA) of the Argentina during 2000.

Variability and changes in selected climate elements in Madrid and Alicante in the period 2000-2014

Directory of Open Access Journals (Sweden)

Cielecka Katarzyna

2015-10-01

Full Text Available The aim of this study is to compare climatic conditions between the interior of the Iberian Peninsula and the southeastern coast of Spain. The article analyzes selected elements of climate over the last 15 years (2000-2014. Synoptic data from airport meteorological stations in Madrid Barajas and Alicante Elche were used. Attention was focused on annual air temperature, relative humidity and precipitation. The mean climatic conditions over the period 2000-2014 were compared with those over the 1961-1990 period which is recommended by WMO as climate normal and with data for the 1971-2000 coming from ‘Climate Atlas’ of Spanish meteorologists group AEMET. Two of climate elements discussed were characterized by significant changes. The annual air temperature was higher by about 0.2°C in Alicante and 0.9°C in Madrid in the period 2000-2014 compared to the 1961-1990. The current winters were colder than in years 1961-1990 at both stations. Gradual decrease in annual precipitation totals was observed at both stations. In 1961-1990 the annual average precipitation in Madrid amounted to 414 mm, while in Alicante it was 356 mm. However, in the recent years of 2000-2014 these totals were lower compared to 1961-1990 reaching 364.1 mm in the central part of Spain and 245.7 mm on the south-western coast.

Annual report 2000; Rapport annuel 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2002-07-01

This report presents the activities of the Cogema group, its reports on management and its financial situation for the year 2000: presentation of TOPCO, boards of directors, profile, main consolidated data, year 2000 highlights, group activities (mining-chemistry, enrichment, reprocessing-recycling, engineering, services, sustainable development, health and safety, quality policy, human resources, R and D, communication), organization chart of the consolidated Cogema group, financial statements, directory. (J.S.)

Estudo histopatológico do efeito do tenoxicam com água bidestilada ou com cloreto de sódio a 0,9% no endotélio venoso de coelhos Estudio histopatológico del efecto del tenoxican con agua bidestilada o con cloreto de sodio a 0,9% en el endotélio venoso de conejos Histopathologic study on the effects of tenoxicam with bidistilled water or with 0.9% sodium chloride in rabbits venous endothelium

Directory of Open Access Journals (Sweden)

Taylor Brandão Schnaider

2002-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Em estudo com células endoteliais de veias umbilicais humanas expostas à indometacina, foi observado aumento da atividade pró-coagulante. Estudo em coelhos comprovou a presença de trombose nas veias auriculares após administração de tenoxicam com seu diluente ou de seu diluente isolado. Não foram encontrados estudos na literatura consultada que tenham avaliado o endotélio venoso após a administração do tenoxicam, em seres humanos. O objetivo desta pesquisa foi avaliar se o tenoxicam com cloreto de sódio a 0,9% (NaCl a 0,9% provoca alterações no endotélio venoso de coelhos, como as observadas quando associado ao seu diluente (água bidestilada. MÉTODO: Noventa coelhos (2.000 - 3.500 g foram distribuídos aleatoriamente em dois grupos: Controle, com administração de NaCl a 0,9%; Experimento, com tenoxicam (20 mg associado à água bidestilada ou ao NaCl a 0,9%. O volume injetado nos dois grupos foi constante de 2 ml. A anestesia foi induzida com maleato de acepromazina, cloridrato de cetamina e cloridrato de xilazina, sendo a punção das veias auriculares caudais direita e esquerda realizada com agulha tipo borboleta 27G. Os animais foram mantidos no biotério por 6 h, 12 h e 24 h, novamente anestesiados e submetidos à eutanásia, sendo então realizada exérese das aurículas em sua base e posterior avaliação microscópica das veias. RESULTADOS: Observou-se trombose no grupo Experimento, numa porcentagem de 19,4% após administração do tenoxicam com água bidestilada e 22,2% após administração do tenoxicam com NaCl a 0,9%. No grupo Controle, em que foi injetado somente NaCl a 0,9%, nenhuma das veias apresentou trombose. CONCLUSÕES: Os resultados encontrados permitem concluir que o tenoxicam, com água bidestilada ou com solução de cloreto de sódio a 0,9%, produziu trombose nas veias em que foi injetado.JUSTIFICATIVA Y OBJETIVOS: En estudio con células endoteliales de venas umbilicales

40 CFR 61.09 - Notification of startup.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...

Hysterectomy trends in Australia, 2000-2001 to 2013-2014: joinpoint regression analysis.

Science.gov (United States)

Wilson, Louise F; Pandeya, Nirmala; Mishra, Gita D

2017-10-01

Hysterectomy is a common gynecological procedure, particularly in middle and high income countries. The aim of this paper was to describe and examine hysterectomy trends in Australia from 2000-2001 to 2013-2014. For women aged 25 years and over, data on the number of hysterectomies performed in Australia annually were sourced from the National Hospital and Morbidity Database. Age-specific and age-standardized hysterectomy rates per 10 000 women were estimated with adjustment for hysterectomy prevalence in the population. Using joinpoint regression analysis, we estimated the average annual percentage change over the whole study period (2000-2014) and the annual percentage change for each identified trend line segment. A total of 431 162 hysterectomy procedures were performed between 2000-2001 and 2013-2014; an annual average of 30 797 procedures (for women aged 25+ years). The age-standardized hysterectomy rate, adjusted for underlying hysterectomy prevalence, decreased significantly over the whole study period [average annual percentage change -2.8%; 95% confidence interval (CI) -3.5%, -2.2%]. The trend was not linear with one joinpoint detected in 2008-2009. Between 2000-2001 and 2008-2009 there was a significant decrease in incidence (annual percentage change -4.4%; 95% CI -5.2%, -3.7%); from 2008-2009 to 2013-2014 the decrease was minimal and not significantly different from zero (annual percentage change -0.1%; 95% CI -1.7%, 1.5%). A similar change in trend was seen in all age groups. Hysterectomy rates in Australian women aged 25 years and over have declined in the first decade of the 21st century. However, in the last 5 years, rates appear to have stabilized. © 2017 Nordic Federation of Societies of Obstetrics and Gynecology.

Fine particulate matter components and mortality in Greater Houston: Did the risk reduce from 2000 to 2011?

Energy Technology Data Exchange (ETDEWEB)

Liu, Suyang; Zhang, Kai, E-mail: Kai.Zhang@uth.tmc.edu

2015-12-15

Fine particulate matter (less than 2.5 μm in aerodynamic diameter; PM{sub 2.5}) pollution poses a major environmental threat in Greater Houston due to rapid economic growth and the numerous PM{sub 2.5} sources including ports, vehicles, and the largest petrochemical industry in the United States (U.S.). Our objectives were to estimate the short-term associations between the PM{sub 2.5} components and mortality during 2000–2011, and evaluate whether these associations have changed over time. A total of 333,317 deaths were included in our assessment, with an average of 76 deaths per day. We selected 17 PM{sub 2.5} components from the U.S. Environmental Protection Agency's Chemical Speciation Network, and then applied Poisson regression models to assess the associations between the PM{sub 2.5} components and mortality. Additionally, we repeated our analysis for two consecutive periods: 2000–2005 and 2006–2011. Interquartile range increases in ammonium (0.881 μg/m{sup 3}), nitrate (0.487 μg/m{sup 3}), sulfate (2.245 μg/m{sup 3}), and vanadium (0.004 μg/m{sup 3}) were associated with an increased risk in mortality of 0.69% (95% confidence interval (CI): 0.26, 1.12%), 0.38% (95% CI: 0.11, 0.66%), 0.61% (95% CI: 0.15, 1.06%), and 0.58% (95% CI: 0.12, 1.04%), respectively. Seasonal analysis suggested that the associations were strongest during the winter months. The association between PM{sub 2.5} mass and mortality decreased during 2000–2011, however, the PM{sub 2.5} components showed no notable changes in mortality risk over time. Our study indicates that the short-term associations between PM{sub 2.5} and mortality differ across the PM{sub 2.5} components and suggests that future air pollution control measures should not only focus on mass but also pollutant sources. - Highlights: • PM{sub 2.5} concentrations were associated with increased mortality risk. • A few major PM{sub 2.5} components were associated with increased mortality risk. �

Effect of air pollution control on life expectancy in the United States: an analysis of 545 U.S. counties for the period from 2000 to 2007.

Science.gov (United States)

Correia, Andrew W; Pope, C Arden; Dockery, Douglas W; Wang, Yun; Ezzati, Majid; Dominici, Francesca

2013-01-01

In recent years (2000-2007), ambient levels of fine particulate matter (PM2.5) have continued to decline as a result of interventions, but the decline has been at a slower rate than previous years (1980-2000). Whether these more recent and slower declines of PM2.5 levels continue to improve life expectancy and whether they benefit all populations equally is unknown. We assembled a data set for 545 U.S. counties consisting of yearly county-specific average PM2.5, yearly county-specific life expectancy, and several potentially confounding variables measuring socioeconomic status, smoking prevalence, and demographic characteristics for the years 2000 and 2007. We used regression models to estimate the association between reductions in PM2.5 and changes in life expectancy for the period from 2000 to 2007. A decrease of 10 μg/m in the concentration of PM2.5 was associated with an increase in mean life expectancy of 0.35 years (SD = 0.16 years, P = 0.033). This association was stronger in more urban and densely populated counties. Reductions in PM2.5 were associated with improvements in life expectancy for the period from 2000 to 2007. Air pollution control in the last decade has continued to have a positive impact on public health.

Ferroelectric and dielectric properties of BaTi0.9Zr0.1O3 doped with Li0.5Fe2.5O4 ceramics

Science.gov (United States)

Gajula, Ganapathi Rao; Buddiga, Lakshmi Rekha; Chidambara Kumar, K. N.; Ch, Arun Kumar; Samatha, K.; Kokkiragadda, Sreeramachandra Murthy; Dasari, Madhava Prasad

2018-06-01

We have prepared a composite BaTi0.9Zr0.1O3 (BTZr) doped with Li0.5Fe2.5O4 (LF) having chemical formulae (1- x) BTZr + (x) LF (x=0, 0.05, 0.1 and 0.15) conventional solid state reaction technique. We have sintered the grown composites at 1150 °C for 3 h. We have characterized the grown composites using XRD, FESEM, P-E loop tracer and LCR meter. The XRD measurements reveal the tetragonal nature of the composites. The morphological studies reveal that the composite exhibits dense microstructure with small pores. The P-E loops confirm that the composites exhibit remnant polarization and the coercive field increases with increasing concentration of Lithium Ferrite (LF). We have studied dielectric property of the composites by varying the temperature of the sample from 30 °C to 500 °C at 1 kHz, 10 kHz and also by varying the frequency from 1 Hz to 10 MHz at 30 °C. The dielectric property of BTZr has increased after doping LF in BTZr which reveals the enhancement of electrical properties of the grown composite.

Parameters of the CGCS 2000 Ellipsoid and Comparisons with GRS 80 and WGS 84

Directory of Open Access Journals (Sweden)

CHENG Pengfei

2016-02-01

Full Text Available According to the definition of China Geodetic Coordinate System 2000(CGCS 2000 and defined constants of the ellipsoid adopted by CGCS 2000,the other geometrical and physical parameters of this ellipsoid are derived and compared with that from GRS 80 and WGS 84,respectively.Meanwhile the coordinates and normal gravity on the CGCS 2000 ellipsoid are compared with that on WGS 84 and GRS 80.The difference between the normal gravity on CGCS 2000 ellipsoid and that on GRS 80 is about -143.54×10-8 m/s2,while it is 0.02×10-8 m/s2 compared to WGS 84.The longitudes of a point on these three ellipsoids are the same,but the maximum difference of latitude between CGCS 2000 and GRS 80 is 8.26×10-11 arc seconds,which is about 2.5×10-6 mm,and the maximum difference of latitude between CGCS 2000 and WGS 84 is 3.6×10-6 arc seconds,which is about 0.11 mm.

Chemical and physical oceanographic profile data collected from CTD casts aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater Horizon oil spill event (NODC Accession 0068955)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...

Exon: CBRC-MMUS-09-0206 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...

MODIFIKASI DAN EVALUASI KINERJA MESIN PENYAWUT UBIKAYU (MPB-09 Modification and Performance evaluation of a Cassava Chipper

Directory of Open Access Journals (Sweden)

I. K. Tastra

2012-05-01

Full Text Available High moisture of fresh cassava root (65-75 % wet basis need appropriate post harvest handling that can reduce lossesdue to delayed drying process. To accelerate drying process, a cassava chipper (MPB-09 was modified and evaluated for chipping fresh cassava root. This machine included hopper, horizontal chipping cylinder, 5.5 hp gasoline engine, belt, pulley, frame and cover. The performance evaluation of the cassava chipper was done using the combination of four type chipping cylinder (3, 4, 5 and 6 knife and three level chipping cylinder speed (400, 500, 600 Rpm. Regression analysis and homogeneity test of the regression coefficient was used to evaluate the the performance of the cassava chipper. Based on the optimum combination of the type of chipping cylinder and its speed, financial analysis was conducted to evaluate its feasibility. The optimum effective capacity of MPB-09 chipper was at horizontal chipping cylinder with 6 knife and rotation speed 600 rpm. At effective capacity 2.5 t/hour, investment cost Rp 7,500,000 /unit, effective working hours 160 hours/years, two operator cost Rp 200,000 /day and chipping cost Rp 50 /kg chip ; the unit cost (BP was Rp 22 /kg chip; the break-even point (BEP was 90.3 t chip/year; the pay back periodl (PBP was0.7 years; the net present value (NPV was Rp 24,473,739; the benefit cost ratio (B/C was 1.8 and the internal rate of return (IRR was 149.8 %. Based on the results of the financial analysis. it was concluded that MPB-09 chipper was feasible to be applied at farm level. ABSTRAK Kadar air umbi ubikayu yang tinggi (65-70 % bb saat panen memerlukan penanganan yang cepat guna mengurangisusut  mutu  akibat  keterlambatan  proses  pengeringan.  Untuk mempercepat proses pengeringan telah  dilakukan modifikasi mesin penyawut (MPB-09 dengan komponen pisau sawut masing-masing sebanyak 3, 4, 5 dan 6 buah per piringan dan dievaluasi kinerjanya pada putaran 400, 500 dan 600 Rpm. Evaluasi kinerja mesin MPB

The growth in newspaper coverage of tobacco control in China, 2000-2010

Directory of Open Access Journals (Sweden)

Gao Junling

2012-03-01

Full Text Available Abstract Background Media coverage of tobacco-related issues can potentially shape individual beliefs, attitudes and behaviors about tobacco use. This study aims to describe news coverage of tobacco control related issues in Chinese newspapers from 2000 to 2010. Methods All 1149 articles related to tobacco control were extracted from the Database of Chinese Important Newspapers and content analyzed for the period Jan 1, 2000 to Dec 31, 2010. The changing pattern of tobacco control topic, article type, viewpoint, and article origin, and their relationship were analysed. Results News coverage of tobacco control related issues increased significantly (p p χ2 = 24.09, p = 0.002 and article types (χ2 = 193.35, p Conclusion Chinese newspapers are giving increasing attention to tobacco control, but coverage remains lower than in the USA and Australia. Health workers need to give higher priority to efforts to increase news coverage beyond the present concentration around World No Tobacco Day and to develop strategies for making tobacco control issues more newsworthy to both national and local news outlets.

JAS'2000

CERN Multimedia

2000-01-01

Are you interested in beam dynamics? Do you work on the LHC injectors or CLIC or maybe feasibility studies fornew machines? Then this is for youJAS'2000: Joint CERN-Japan-JINR-Russia-US SchoolFrontiers of Accelerator Technology: High Quality Beams to be held on a river boat between St. Petersburg and Moscow 1 to 14 July 2000. For further information see eitherhttp://schools.web.cern.ch/Schools/CAS/ orhttp://www.indiana.edu/~uspas/programs/js/jas2000.html

Closure Report for Corrective Action Unit 143: Area 25 Contaminated Waste Dumps, Nevada Test Site, Nevada

International Nuclear Information System (INIS)

Tobiason, D. S.

2002-01-01

This Closure Report (CR) has been prepared for the Area 25 Contaminated Waste Dumps (CWD), Corrective Action Unit (CAU) 143 in accordance with the Federal Facility Agreement and Consent Order [FFACO] (FFACO, 1996) and the Nevada Division of Environmental Protection (NDEP)-approved Corrective Action Plan (CAP) for CAU 143: Area 25, Contaminated Waste Dumps, Nevada Test Site, Nevada. CAU 143 consists of two Corrective Action Sites (CASs): 25-23-09 CWD No.1, and 25-23-03 CWD No.2. The Area 25 CWDs are historic disposal units within the Area 25 Reactor Maintenance, Assembly, and Disassembly (R-MAD), and Engine Maintenance, Assembly, and Disassembly (E-MAD) compounds located on the Nevada Test Site (NTS). The R-MAD and E-MAD facilities originally supported a portion of the Nuclear Rocket Development Station in Area 25 of the NTS. CWD No.1 CAS 25-23-09 received solid radioactive waste from the R-MAD Compound (East Trestle and West Trench Berms) and 25-23-03 CWD No.2 received solid radioactive waste from the E-MAD Compound (E-MAD Trench)

Poverty Monitor 2000

NARCIS (Netherlands)

2000-01-01

Original title: Armoedemonitor 2000. The Poverty Monitor 2000 (Armoedemonitor 2000) contains the most up-to-date figures on poverty in the Netherlands. The data were collected and analysed by the Netherlands Institute for Social Research/SCP and Statistics Netherlands (CBS). The extent of

ADVISOR Users Conference Proceedings 2000 - Final Electronic version

Energy Technology Data Exchange (ETDEWEB)

NREL

2000-09-26

This is a compilation of papers presented at the ADVISOR (ADvanced Vehicle SimulatOR) Users Conference held in Costa Mesa, California, August 24-25, 2000. Major topics of the conference included modeling and simulation; partnering with the auto industry; co-simulation: partnering with the software industry in optimization and thermal modeling and geometric and mechanical modeling; forward-looking simulations coupled with ADVISOR; new concepts from universities; validation, vehicle development and applications.

Low NOx Burner Development Program - Final Report - 09/15/1996 - 09/30/2000

Energy Technology Data Exchange (ETDEWEB)

McClaine, Andrew W.

2000-09-30

This report describes the work performed to develop and demonstrate the VISTA combustor. The development effort was planned for three phases. Laboratory testing at a 1.5 and 6 MMBtu/hr scale was performed at thermo Power Corporation during the first phase. Also during the first phase, analytic modeling was performed to guide the design modifications evaluated in the experimental testing. Toward the end of the first phase, John Zink Company entered the program to participate in the design, evaluation, testing, and demonstration of a 30 MMBtu/hr combustor. The results of the second phase testing were to be used in the demonstration of the 30 MMBtu/hr combustor in a Koch Industries boiler. The program proceeded into the second phase. Two models of the VISTA combustor were tested. Measurements of the first stage NOx production were in the range anticipated to achieve the program goals, based on analytical modeling results. While testing the VISTA combustor at the John Zink facility, John Zink elected to discontinue the development of the VISTA combustor in favor of an alternative in-house concept. As a result, this program was terminated.

Epilepsy Research in Iran: a Scientometric Analysis of Publications Output During 2000-2014.

Science.gov (United States)

Rasolabadi, Masoud; Rasouli-Ghahfarkhi, Seyedeh Moloud; Ardalan, Marlin; Kalhor, Marya Maryam; Seidi, Jamal; Gharib, Alireza

2015-12-01

The aim of this study is to analyze the epilepsy research output of Iran in national and global contexts, as reflected in its publication output indexed in Scopus citation database during 2000-2014. This study was based on the publications of epilepsy research from Iranian authors retrieved Feb. 2015 from Scopus Citation database [www.scopus.com]. The string used to retrieve the data was developed using "epilepsy OR epilepsies" keywords in title, abstract and keywords and Iran in affiliation field was our main string. Cumulative publication output of Iran in epilepsy research consisted of 702 papers from 2000 to 2014, with an average number of 46.53 papers per year. The total publication output of Iran in epilepsy research increased from 2 papers in 2000 to 88 papers in 2014. Hence, with 702 paper, Iran ranked 25(th) among the top 25 countries with a global share of 0.82 %. Iranian publication average citation per paper increased from 0 in 2000 to 7.88 in 2014. Overall, the received citations were 3184 citations during those years. Iran is collaborating with 36 countries with no more than 244 of its papers (35% of its total papers). It is necessary to prepare conditions for epilepsy researchers to collaborate more with international scientific societies in order to produce more and high quality papers.

Awareness of the Japanese Society of Hypertension Guidelines for the Management of Hypertension (JSH 2000) and compliance to its recommendations: surveys in 2000 and 2004.

Science.gov (United States)

Ikeda, N; Hasegawa, T; Hasegawa, T; Saito, I; Saruta, T

2006-04-01

Clinic physicians' awareness of the Japanese hypertension guideline (JSH 2000) and compliance with its recommendations were assessed to derive policy implications for effective blood pressure control. Data were obtained from two postal questionnaire surveys conducted in 2000 and 2004, and subjects were 896 and 1425 clinic physicians, respectively, who were engaged in general internal medicine. Recognition rates of JSH 2000 were 63.1% (n = 822) before its announcement in 2000 and 94.4% (n = 1400) in 2004. Rates of access, familiarity and utilisation of JSH 2000 were 87.0, 81.6 and 68.9%, respectively (n = 1400) in 2004. As for major management strategies for low-risk hypertension: in 2000, for patients with 140-149/90-94 mmHg, 81.5% of 812 respondents performed lifestyle modification, and 11.2% prescribed medicines, whereas for patients with 150-159/95-99 mmHg, 71.7% of 807 respondents prescribed medicines, and 24.3% conducted lifestyle modification; in 2004, 90.0% of 1384 respondents conducted lifestyle modification, 22.6% prescribed medicines, 2.5% referred patients to other facilities, and 6.4% did nothing. In 2004, 68.9% of 1388 respondents agreed with the new definition of hypertension, whereas 17.1% preferred 160/95 mmHg. Respondents' age (Phypertensives in daily patient load (Phypertension management. One of the strategies for further enhancement in their compliance with JSH 2004 would be its dissemination to those who are old and/or do not see hypertensive patients so frequently.

Chemical and physical oceanographic profile data collected from CTD casts aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater Horizon oil spill event (NODC Accession 0069071)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...

CD206+ Cell Number Differentiates Influenza A (H1N1pdm09 from Seasonal Influenza A Virus in Fatal Cases

Directory of Open Access Journals (Sweden)

Heidi G. Rodriguez-Ramirez

2014-01-01

Full Text Available In 2009, a new influenza A (H1N1 virus affected many persons around the world. There is an urgent need for finding biomarkers to distinguish between influenza A (H1N1pdm09 and seasonal influenza virus. We investigated these possible biomarkers in the lung of fatal cases of confirmed influenza A (H1N1pdm09. Cytokines (inflammatory and anti-inflammatory and cellular markers (macrophages and lymphocytes subpopulation markers were analyzed in lung tissue from both influenza A (H1N1pdm09 and seasonal influenza virus. High levels of IL-17, IFN-γ, and TNF-α positive cells were identical in lung tissue from the influenza A (H1N1pdm09 and seasonal cases when compared with healthy lung tissue (P<0.05. Increased IL-4+ cells, and CD4+ and CD14+ cells were also found in high levels in both influenza A (H1N1pdm09 and seasonal influenza virus (P<0.05. Low levels of CD206+ cells (marker of alternatively activated macrophages marker in lung were found in influenza A (H1N1pdm09 when compared with seasonal influenza virus (P<0.05, and the ratio of CD206/CD14+ cells was 2.5-fold higher in seasonal and noninfluenza group compared with influenza A (H1N1pdm09 (P<0.05. In conclusion, CD206+ cells differentiate between influenza A (H1N1pdm09 and seasonal influenza virus in lung tissue of fatal cases.

Technical Report 2000; Memoria Tecnica 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

The technical memory 2000 of the Nuclear Regulatory Authority (NRA) of the Argentine Republic, compile the papers published in the subject on radiation protection and nuclear safety, safeguards and physical protection, and presented in congress or meetings of these specialities by personnel of the mentioned institution during 2000. In this edition the documents are presented on: Nuclear safety; Radiobiology; Occupational doses; Radiochemical; Environmental studies; Emergency plans; Radiation accidents; and International safeguards. Some of them are realized by agreements between the Nuclear Regulatory Authority of Argentina, universities and other national and international organizations.

Coccidioidomycosis-associated hospitalizations, California, USA, 2000-2011.

Science.gov (United States)

Sondermeyer, Gail; Lee, Lauren; Gilliss, Debra; Tabnak, Farzaneh; Vugia, Duc

2013-10-01

In the past decade, state-specific increases in the number of reported cases of coccidioidomycosis have been observed in areas of California and Arizona where the disease is endemic. Although most coccidioidomycosis is asymptomatic or mild, infection can lead to severe pulmonary or disseminated disease requiring hospitalization and costly disease management. To determine the epidemiology of cases and toll of coccidioidomycosis-associated hospitalizations in California, we reviewed hospital discharge data for 2000-2011. During this period, there were 25,217 coccidioidomycosis-associated hospitalizations for 15,747 patients and >$2 billion US in total hospital charges. Annual initial hospitalization rates increased from 2.3 initial hospitalizations/100,000 population in 2000 to 5.0 initial hospitalizations/100,000 population in 2011. During this period, initial hospitalization rates were higher for men than women, African Americans and Hispanics than Whites, and older persons than younger persons. In California, the increasing health- and cost-related effects of coccidioidomycosis-associated hospitalizations are a major public health challenge.

Report for fiscal 2000 on joint seminar for coal engineer training project; 2000 nendo sekitan gijutsusha yosei jigyo godo semina hokokusho

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-09-01

This paper summarizes the contents of the joint seminar for coal engineer training project in fiscal 2000, which has been held in Tokyo on September 25, 2000. The lectures included 'Coal Resources in Gunnedah Basin - Future Coal Supply Potential and Geophysical Exploration' by Ms. Julie Ann Moloney, senior geographical engineer at NSW Department of Mineral Resources, Australia, 'Human Resources Development for Coal Mining in Indonesia' by Mr. Bangun Usman Harahap at the Ministry of Mines and Energy in Indonesia, 'Queensland Rail, a strategic partner - linking Coal Producers to World Markets' by Mr. John Stuart Burrows at Coal Queensland Rail, Australia, and 'The export coal mines of western Canada - A review' by Mr. Ron Smyth, director BC Geological Survey Branch, Ministry of Energy and Mines, British Columbia, Canada. Questions and answers were exchanged actively for these lectures. (NEDO)

Evolución de los principales diagnósticos al alta hospitalaria de la población penitenciaria de la provincia de Valencia, 2000-2009 Evolution of the main diagnoses of hospital discharges amongst the prison population in Valencia, 2000-2009

Directory of Open Access Journals (Sweden)

I. Abad-Pérez

2011-10-01

Full Text Available El objetivo de nuestro trabajo ha sido cuantificar la demanda hospitalaria de origen penitenciario y caracterizar los principales diagnósticos como una medida de prevalencia y las patologías transmisibles y su evolución durante el periodo 2000-09. A partir del registro de altas del Consorcio Hospital General Universitario que atiende por convenio la demanda hospitalaria de los centros penitenciarios de Valencia provincia, se realizo un estudio transversal de las frecuencias de los diagnósticos y su distribución de acuerdo a las características personales. Se recuperaron 2.415 altas que tras la eliminación de inconsistencias aportaron 2.332 episodios de hospitalización. La edad media de los sujetos evolucionó desde 32,8 a 39,7 años. Los diagnósticos principales y secundarios agrupados (tabla 2 más frecuentes fueron: 1º. VIH (34,05%, 2º. Hepatitis C (14,67%, 3º. Dependencia Drogas (10,25%, 4º. Neumonías (8,58%, 5º. TBC (7,46%. A lo largo de la década se ha producido un cambio en el patrón infeccioso de la población penitenciaria que podemos considerar relacionado con: el envejecimiento relativo de la población reclusa, la sustitución de la vía intravenosa por otras vías no invasivas, el cambio relativo del origen nacional de los reclusos y los avances terapéuticos en el tratamiento de la infección por VIH.The aim of our study was to quantify the hospital demand originating from prisons and describe the main diagnoses as a measure of prevalence, as well as communicable diseases and their evolution during the period 2000-09. Using the discharge records of the University General Hospital under the terms of an agreement that meets the demand for hospitals from prisons in the province of Valencia, we carried out a cross-sectional study of the frequency distribution of diagnoses and their distribution according to personal characteristics. More than 2,415 discharges were recovered, which, after the removal of inconsistencies

Avatud õpe ja kaugkoolitus : sild üheksakümnendatest aastatest aastasse 2000 / Sirje Virkus

Index Scriptorium Estoniae

Virkus, Sirje, 1956-

1997-01-01

23.-25- juunini 1997. a. Budapesti Tehnikaülikoolis toimunud Euroopa Kaugkoolitusvõrgu konverentsist teemal "Avatud õpe ja kaugkoolitus : sild üheksakümnendatest aastatest aastasse 2000 : saavutused ja tulevikuväljavaated"

25 CFR 216.8 - Performance bond.

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false Performance bond. 216.8 Section 216.8 Indians BUREAU OF... RECLAMATION OF LANDS General Provisions § 216.8 Performance bond. (a) Upon approval of an exploration plan or mining plan, the operator shall be required to file a suitable performance bond of not less than $2,000...

Liha tootmine : [2000-2004 Eestis liikide kaupa, s.h. ka kitseliha] / Matti Piirsalu

Index Scriptorium Estoniae

Piirsalu, Matti, 1947-

2005-01-01

Ilmunud ka: Agriculture and the development of rural life : overview 2004/2005. - Tallinn, 2005, lk. 20-22. 2004. a. vähenes sealihatoodang 3%, lamba- ja kitseliha toodang 25%.Veise- ja linnuliha tootmine kasvas kubki 5%. Tabel: Lihatoodang aastatel 2000-2004

The energy turn of the year 2000; Le tournant energetique de l'an 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

The new laws on the energies market are going to change the commercial sector of the electric power market in France. The colloquium in two parts ( the 25 and 26 january 2000), constitutes a reflection on the future of this new market. The first part provides papers on examples of european market in Great Britain, Germany and Scandinavia and presents the strategies of marketers. The energy buyers of tomorrow will have to take appropriate risks to keep their competitiveness. The second part provides papers on the place of the cogeneration in this new market. The positive example of the United States and the negative example of the Germany are analyzed. giving answers to economic, legal, financial and technical problems. (A.L.B.)

Annual Report 2000

International Nuclear Information System (INIS)

2001-01-01

This document describes the research and development projects carried out at CIEMAT in the areas that form the basis of our activities; energy and environment, along with the objectives, scope and most significant results; information on human resources, as well as direct and indirect expenditures and cost of personnel is included for each project in order to given an idea of its real dimensions. The results complied here correspond to 2000 achievements. Finally, the predicted dedication of personnel with degrees presented in the general data for each project corresponds to the year 2000. We hope that this information will be of use to persons and institutions interested in CIEMAT activities and that it will stimulate collaboration with other researchers, technology centres and companies interested in the same and related subjects. Annex I and II compile some general data on CIEMAT FOR 2000: A flowchart, 2000 collaboration, financial and human resources (i), and a bibliography of articles published in national and international journals during 2000. (Author)

The reduction of summer sulfate and switch from summertime to wintertime PM2.5 concentration maxima in the United States

Science.gov (United States)

Chan, Elizabeth A. W.; Gantt, Brett; McDow, Stephen

2018-02-01

Exposure to particulate matter air pollution with a nominal mean aerodynamic diameter less than or equal to 2.5 μm (PM2.5) has been associated with health effects including cardiovascular disease and death. Here, we add to the understanding of urban and rural PM2.5 concentrations over large spatial and temporal scales in recent years. We used high-quality, publicly-available air quality monitoring data to evaluate PM2.5 concentration patterns and changes during the years 2000-2015. Compiling and averaging measurements collected across the U.S. revealed that PM2.5 concentrations from urban sites experienced seasonal maxima in both winter and summer. Within each year from 2000 to 2008, the maxima of urban summer peaks were greater than winter peaks. However, from 2012 to 2015, the maxima of urban summertime PM2.5 peaks were smaller than the urban wintertime PM2.5 maxima, due to a decrease in the magnitude of summertime maxima with no corresponding decrease in the magnitude of winter maxima. PM2.5 measurements at rural sites displayed summer peaks with magnitudes relatively similar to those of urban sites, and negligible to no winter peaks through the time period analyzed. Seasonal variations of urban and rural PM2.5 sulfate, PM2.5 nitrate, and PM2.5 organic carbon (OC) were also assessed. Summer peaks in PM2.5 sulfate decreased dramatically between 2000 and 2015, whereas seasonal PM2.5 OC and winter PM2.5 nitrate concentration maxima remained fairly consistent. These findings demonstrate that PM2.5 concentrations, especially those occurring in the summertime, have declined in the U.S. from 2000 to 2015. In addition, reduction strategies targeting sulfate have been successful and the decrease in PM2.5 sulfate contributed to the decline in total PM2.5.

Association between serum concentration of 25-hydroxyvitamin D [25(OH)D] and chronic periodontitis

Science.gov (United States)

Primasari, A.; Sihombing, K. P.

2018-03-01

Serum concentration of [25(OH)D] in Indonesia is at low level although Indonesia is one of Asia country which has a tropical climate. Vitamin D as an immunomodulatory agent invitro and in animal studies. However, data from clinical studies involvement vitamin D to chronic periodontitis are still controversy. The aim of this study was to evaluate the association between serum concentration of [25(OH)D] and chronic periodontitis. Totally 45 chronic periodontitis patients were analyzed. Spearman correlation models adjusted for subject and parameter included periodontal pocket depth (PPD), clinical attachment loss (CAL), and bleeding on probing (BOP) are analyzed. Totally 51.11% person have serum concentration of [25(OH)D] 21-50ng/mL were called insufficiency, and 15.56% is deficiency. Mean values of PPD >3mm indicating moderate criteria, CAL >4mm meaning severe criteria, and mean grade of BOP >2 degrees means the interdental papilla appears to be filled with little or much blood. Spearman correlation test results showed an inverse correlation between serum concentration of [25(OH)D] to the value of PPD, CAL, and BOP, however, was not statistically significant (r PPD -0.09; r CAL -0.118; r BOP 0.001, p>0.05). Insufficiency serum concentration of 25- hydroxyvitamin D [25(OH)D] was not associated significantly with PPD, CAL, and BOP of chronic periodontitis.

Report for fiscal 2000 on joint seminar for coal engineer training project; 2000 nendo sekitan gijutsusha yosei jigyo godo semina hokokusho

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-09-01

This paper summarizes the contents of the joint seminar for coal engineer training project in fiscal 2000, which has been held in Tokyo on September 25, 2000. The lectures included 'Coal Resources in Gunnedah Basin - Future Coal Supply Potential and Geophysical Exploration' by Ms. Julie Ann Moloney, senior geographical engineer at NSW Department of Mineral Resources, Australia, 'Human Resources Development for Coal Mining in Indonesia' by Mr. Bangun Usman Harahap at the Ministry of Mines and Energy in Indonesia, 'Queensland Rail, a strategic partner - linking Coal Producers to World Markets' by Mr. John Stuart Burrows at Coal Queensland Rail, Australia, and 'The export coal mines of western Canada - A review' by Mr. Ron Smyth, director BC Geological Survey Branch, Ministry of Energy and Mines, British Columbia, Canada. Questions and answers were exchanged actively for these lectures. (NEDO)

Programme wood/energy 2000-2006. Activity Report for 2000-2004; Programme national Bois-Energie 2000-2006. Rapport d'activites 2000-2004

Energy Technology Data Exchange (ETDEWEB)

NONE

2006-07-01

When ADEME launched its Wood fuel programme throughout all of France in late 1999, its aim was to guide this resource supply chain to maturity and stable development in all user sectors: domestic, multi-family housing, commercial/institutional and industrial applications. To this end the Wood fuel Programme 2000-2006 was assigned objectives and endowed with significant financial means for studies and coordination in order to support and carry out general-interest projects, piloted by ADEME. The stated goal was to replace fossil fuels, avoid carbon emissions and establish quality assurance standards for household firewood and wood-fired devices. This report makes a status of ADEME's Wood fuel programme for the 2000-2004 era: - Domestic heating: After a drop during the 1990's, figures since 1999 of sales of wood-fuel domestic heating equipment (closed heaters, glass-door fires and stoves) have shown a significant rise. On average over 30 years, wood consumption has risen to 7.2 million TOE (40 million cubic metres) per year; - Industry: It is thought there are 1000 wood-fired heaters (above 1 megawatt) used in French industry. These are found mainly in timber-based industries and in timber crushing plants. This amounts to a total power output of 2.5 gigawatts. In the primary and secondary wood processing industries, the increase in the number of wood-fired boilers and energy produced has reached 5% per year Results of a call for carbon energy projects (APEC) was 61 submitted of which 52 were selected; 9 projects pending (166.5 K of aid from ADEME); and 35 projects begun (1,649 K of aid from ADEME). - Local authority and service sector wood-fired heating systems: At the end of 2004, the number of local authority active boilers was 641, producing 430 megawatts. This is an increase of an average of 13% year on year since 2000. By the end of 2004, the target had already been met for the number of boilers being financed (1,090). By 2006 however we still need to

Workshop on decommissioning; Seminarium om avveckling

Energy Technology Data Exchange (ETDEWEB)

Broden, K. (ed.)

2005-12-15

A Nordic workshop on decommissioning of nuclear facilities was held at Risoe in Denmark September 13-15, 2005. The workshop was arranged by NKS in cooperation with the company Danish Decommissioning, DD, responsible for decommissioning of nuclear facilities at Risoe. Oral presentations were made within the following areas: International and national recommendations and requirements concerning decommissioning of nuclear facilities Authority experiences of decommissioning cases Decommissioning of nuclear facilities in Denmark Decommissioning of nuclear facilities in Sweden Plans for decommissioning of nuclear facilities in Norway Plans for decommissioning of nuclear facilities in Finland Decommissioning of nuclear facilities in German and the UK Decommissioning of nuclear facilities in the former Soviet Union Results from research and development A list with proposals for future work within NKS has been prepared based on results from group-work and discussions. The list contains strategic, economical and political issues, technical issues and issues regarding competence and communication. (au)

46 CFR 42.09-5 - All vessels-division into types.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...

Thermal regulation 2000: one year later; RT 2000: un an apres

Energy Technology Data Exchange (ETDEWEB)

NONE

2002-05-01

This meeting, organized by the research center of Gaz de France (Cegibat), aims at drawing up a progress status of the French thermal regulation (RT 2000), one year after its enforcement on June 1, 2000: status, experience feedback and recommendations; Gaz de France assistance and solutions; tools at the disposition of designers (labelling of equipments, simulation softwares..); practical examples of implementation of the RT 2000 in office buildings, residential buildings and sport complexes. (J.S.)

Performance improvement with ISO 9001:2000: a case of PKOC-II project

Energy Technology Data Exchange (ETDEWEB)

Behera, U.K.; Prasad, K.S.N. [Singareni Collieries Co. Ltd. (India)

2006-07-01

The present study is limited to the study of main step towards ISO 9001:2000 (QMS) development, implementation and improvements of PKOC-II project and the same are discussed. In line with increasing global concern for quality, environmental protection and occupational health and safety, Singareni Collieries Co. Ltd (SCCL) has taken the strategic decision to implement ISO 9001:2000 (QMS), ISO 14001:2004 EMS (environmental management system) and occupational health and safety assessment series 18001:1999 (OHSAS) at the PK OC-II project. This is the first project to implement all three management systems QMS, OHSAS, and EMS, in the Indian coal industry. 25 refs., 12 figs., 2 tabs.

Annual report 2008-09

International Nuclear Information System (INIS)

2009-01-01

The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).

The energy turn of the year 2000; Le tournant energetique de l'an 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

The new laws on the energies market are going to change the commercial sector of the electric power market in France. The colloquium in two parts ( the 25 and 26 january 2000), constitutes a reflection on the future of this new market. The first part provides papers on examples of european market in Great Britain, Germany and Scandinavia and presents the strategies of marketers. The energy buyers of tomorrow will have to take appropriate risks to keep their competitiveness. The second part provides papers on the place of the cogeneration in this new market. The positive example of the United States and the negative example of the Germany are analyzed. giving answers to economic, legal, financial and technical problems. (A.L.B.)

Quality of Diabetes Care in Germany Improved from 2000 to 2007 to 2014, but Improvements Diminished since 2007. Evidence from the Population-Based KORA Studies.

Directory of Open Access Journals (Sweden)

Michael Laxy

Full Text Available Little is known about the development of the quality of diabetes care in Germany. The aim of this study is to analyze time trends in patient self-management, physician-delivered care, medication, risk factor control, complications and quality of life from 2000 to 2014.Analyses are based on data from individuals with type 2 diabetes of the population-based KORA S4 (1999-2001, n = 150, F4 (2006-2008, n = 203, FF4 (2013/14, n = 212 cohort study. Information on patient self-management, physician-delivered care, medication, risk factor control and quality of life were assessed in standardized questionnaires and examinations. The 10-year coronary heart disease (CHD risk was calculated using the UKPDS risk engine. Time trends were analyzed using multivariable linear and logistic regression models adjusted for age, sex, education, diabetes duration, and history of cardiovascular disease.From 2000 to 2014 the proportion of participants with type 2 diabetes receiving oral antidiabetic/cardio-protective medication and of those reaching treatment goals for glycemic control (HbA1c<7%, 60% to 71%, p = 0.09, blood pressure (<140/80 mmHg, 25% to 69%, p<0.001 and LDL cholesterol (<2.6 mmol/l, 13% to 27%, p<0.001 increased significantly. However, improvements were generally smaller from 2007 to 2014 than from 2000 to 2007. Modeled 10-year CHD risk decreased from 30% in 2000 to 24% in 2007 to 19% in 2014 (p<0.01. From 2007 to 2014, the prevalence of microvascular complications decreased and quality of life increased, but no improvements were observed for the majority of indicators of self-management.Despite improvements, medication and risk factor control has remained suboptimal. The flattening of improvements and deteriorations in quality of (self- care since 2007 indicate that more effort is needed to improve quality of care and patient self-management. Due to selection or lead time bias an overestimation of quality of care improvements cannot be ruled out.

iMovie '09 & iDVD pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of iMovie '09 or iDVD, put this savvy Portable Genius to work. Want to quickly turn raw footage into a polished movie? Crop, rotate, or delete clips? Add background music or sound effects? Customize your iDVD themes? You'll find cool and useful Genius tips, insider secrets, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy iMovie '09 and iDVD to the max.

MIRCA2000—Global monthly irrigated and rainfed crop areas around the year 2000: A new high-resolution data set for agricultural and hydrological modeling

Science.gov (United States)

Portmann, Felix T.; Siebert, Stefan; DöLl, Petra

2010-03-01

To support global-scale assessments that are sensitive to agricultural land use, we developed the global data set of monthly irrigated and rainfed crop areas around the year 2000 (MIRCA2000). With a spatial resolution of 5 arc min (about 9.2 km at the equator), MIRCA2000 provides both irrigated and rainfed crop areas of 26 crop classes for each month of the year. The data set covers all major food crops as well as cotton. Other crops are grouped into categories (perennial, annual, and fodder grasses). It represents multicropping systems and maximizes consistency with census-based national and subnational statistics. According to MIRCA2000, 25% of the global harvested areas are irrigated, with a cropping intensity (including fallow land) of 1.12, as compared to 0.84 for the sum of rainfed and irrigated harvested crops. For the dominant crops (rice (1.7 million km2 harvested area), wheat (2.1 million km2), and maize (1.5 million km2)), roughly 60%, 30%, and 20% of the harvested areas are irrigated, respectively, and half of the citrus, sugar cane, and cotton areas. While wheat and maize are the crops with the largest rainfed harvested areas (1.5 million km2 and 1.2 million km2, respectively), rice is clearly the crop with the largest irrigated harvested area (1.0 million km2), followed by wheat (0.7 million km2) and maize (0.3 million km2). Using MIRCA2000, 33% of global crop production and 44% of total cereal production were determined to come from irrigated agriculture.

Bistand til risikovurdering (evt. ændringer af tidligere risikovurdering). Zea mays (MON863; MON863x810). Supplerende materiale til ansøgningen. Modtaget 07-09-2004, deadline 19-09-2004, svar 17-09-2004

DEFF Research Database (Denmark)

Kjellsson, Gøsta; Strandberg, Morten Tune

2012-01-01

"DMU har modtaget og vurderet de supplerende oplysninger (mail fra Skov- og Naturstyrelsen d. 07-09-2004) til ansøgningen om tilladelse til markedsføring af genetisk modificeret majs C/DE/02/09 (MON863 og MON863 x MON810). Vi har gennemgået oplysningerne i det tilsendte materiale for at se om de ...

FTS2000 network architecture

Science.gov (United States)

Klenart, John

1991-01-01

The network architecture of FTS2000 is graphically depicted. A map of network A topology is provided, with interservice nodes. Next, the four basic element of the architecture is laid out. Then, the FTS2000 time line is reproduced. A list of equipment supporting FTS2000 dedicated transmissions is given. Finally, access alternatives are shown.

Trends in inequalities in utilization of reproductive health services from 2000 to 2011 in Vietnam.

Science.gov (United States)

Duc, Nguyen Huu Chau; Nakamura, Keiko; Kizuki, Masashi; Seino, Kaoruko; Rahman, Mosiur

2015-01-01

This study aimed to examine changes in utilization of reproductive health services by wealth status from 2000 to 2011 in Vietnam. Data from the Vietnam Multiple Indicator Cluster Surveys in 2000, 2006, and 2011 were used. The subjects were 550, 1023, and 1363 women, respectively, aged between 15 and 49 years who had given birth in the previous one or two years. The wealth index, a composite measure of a household's ownership of selected assets, materials used for housing construction, and types of water access and sanitation facilities, was used as a measure of wealth status. Main utilization indicators were utilization of antenatal care services, receipt of a tetanus vaccine, receipt of blood pressure measurement, blood examination and urine examination during antenatal care, receipt of HIV testing, skilled birth attendance at delivery, health-facility-based delivery, and cesarean section delivery. Inequalities by wealth index were measured by prevalence ratios, concentration indices, and multivariable adjusted regression coefficients. Significant increase in overall utilization was observed in all indicators (all p skilled birth attendance, 0.29 in 2006 and 0.12 in 2011 for blood examination, and 0.18 in 2006 and 0.09 in 2011 for health-facility-based delivery. The multivariable adjusted regression coefficients of reproductive health service utilization by wealth category were 0.06 in 2000 and 0.04 in 2011 for antenatal care, 0.07 in 2000 and 0.05 in 2011 for skilled birth attendance, and 0.07 in 2006 and 0.05 in 2011 for health-facility-based delivery. More women utilized reproductive health services in 2011 than in 2000. Inequality by wealth status in utilization of antenatal care, skilled birth attendance, and health-facility-based delivery had been reduced.

Xingnaojing mPEG2000-PLA modified microemulsion for transnasal delivery: pharmacokinetic and brain-targeting evaluation.

Science.gov (United States)

Wen, Ran; Zhang, Qing; Xu, Pan; Bai, Jie; Li, Pengyue; Du, Shouying; Lu, Yang

2016-01-01

Xingnaojing microemulsion (XNJ-M) administered intranasally is used for stroke treatment. In order to decrease the XNJ-M-induced mucosal irritation, XNJ-M modified by mPEG2000-PLA (XNJ-MM) were prepared in a previous work. The present work aimed to assess the impact of mPEG2000-PLA on pharmacokinetic features and brain-targeting ability of XNJ-M. The bioavailability and brain-target effects of borneol and geniposide in XNJ-M and XNJ-MM were compared in mice after intravenous (i.v.) and intranasal (i.n.) administrations. Gas chromatography, high-performance liquid chromatography, and ultra-performance liquid chromatography/tandem mass spectrometry methods were developed for the quantification of borneol and geniposide. Blood and brain samples were collected from mice at different time points after i.v. and i.n. treatments with borneol at 8.0 mg/kg, geniposide at 4.12 mg/kg. In addition, near-infrared fluorescence dye, 1,1'-dioctadecyl-3,3,3',3'-tetramethyl indotricarbocyanine iodide was loaded into microemulsions to evaluate the brain-targeting ability of XNJ-M and XNJ-MM by near-infrared fluorescence imaging in vivo and ex vivo. For XNJ-M and XNJ-MM, the relative brain targeted coefficients (Re) were 134.59% and 198.09% (borneol), 89.70% and 188.33% (geniposide), respectively. Besides, significant near-infrared fluorescent signal was detected in the brain after i.n. administration of microemulsions, compared with that of groups for i.v. administration. These findings indicated that mPEG2000-PLA modified microemulsion improved drug entry into blood and brain compared with normal microemulsion: the introduction of mPEG2000-PLA in microemulsion resulted in brain-targeting enhancement of both fat-soluble and water-soluble drugs. These findings provide a basis for the significance of mPEG2000-PLA addition in microemulsion, defining its effects on the drugs in microemulsion.

Effect of MCM09, an active site-directed inhibitor of factor Xa, on B16-BL6 melanoma lung colonies in mice.

Science.gov (United States)

Rossi, C; Hess, S; Eckl, R W; di Lena, A; Bruno, A; Thomas, O; Poggi, A

2006-03-01

Treatment with anticoagulant drugs has shown potential inhibitory effect on tumor invasion, although the relationship with clotting inhibition was not clear. The aim of our study was to evaluate the potential antitumor activity of MCM09, a newly developed, active site-directed, small molecule inhibitor of factor Xa (FXa) [WO0216312], and to relate the findings to anticlotting potency. MCM09 (0.1-10 mg kg(-1)) or heparin (H; 10 mg kg(-1)) was injected intravenously (i.v.), with 5 x 10(4) B16-BL6 melanoma cells, in C57BL/6 mice. Mice were killed after 18 days, to count lung colonies. Ex vivo anticoagulant activity was measured by activated partial thromboplastin time (APTT) on mouse plasma. MCM09, a selective inhibitor of FXa (IC-50 = 2.4 nm against human FXa), inhibited in a dose-dependent manner B16-BL6 melanoma lung colonies in mice. Mean lung metastasis number was 20.9 +/- 4.8 in controls (n = 10), 1.2 +/- 0.4 in mice treated with H, 10 mg kg(-1) i.v. (P < 0.01), 0.9 +/- 0.3, 9.2 +/- 2.2 and 15.5 +/- 2.6 in mice treated with MCM09, at 10 (P < 0.01), 1 (P < 0.05) and 0.1 mg kg(-1) i.v. (ns), respectively. MCM09 (10 mg kg(-1) i.v.) significantly prolonged APTT (57.1 +/- 10.2 s) 30 min after i.v. injection when compared with controls (25.3 +/- 1.6 s; P < 0.05). Lung colonies were 74.2-72.6% reduced by MCM09 (10 mg kg(-1)) given 60 or 120 min before cells, but not by MCM09 given 60 min thereafter, suggesting a direct cell interaction as a mechanism underlying antitumor activity.

CTBTO Annual Report 2000

International Nuclear Information System (INIS)

2001-04-01

implement the commissioning plan for the IDC. We have now reached the stage of testing and evaluating the IDC and its data products. Since February 2000 the IDC has been distributing Standard Event Lists and Reviewed Event Bulletins to States Signatories for testing purposes. The IDC continues to work closely with the NDCs in order to develop their capacity to receive and utilize the IDC products. The implementation of the GCI is also progressing well, with a total of 44 satellite terminals having been installed, compared with 25 in 1999. The fifth GCI hub was installed and the frame relay infrastructure established to link the hubs to the IDC. On-site inspection (OSI) is provided for in the Treaty as a final verification measure which may be requested by a State Party. In 2000 States Signatories, supported by the PTS, made steady progress in the development of a draft text for the OSI Operational Manual, and some progress was also made with regard to the procurement of OSI equipment and the development of elements of the inspector training programme. As the PTS proceeded with the commissioning of the verification system, it also paid close attention to evaluation and quality assurance of activities related to the build-up of the verification regime and implemented measures to ensure appropriate integration of these activities within and between PTS Divisions. The year 2000 saw the consolidation of improvements initiated in the areas of administration, coordination and support, resulting in increased efficiencies in PTS administrative systems, including the procurement, document management, accounting and personnel management systems. Through a focused and coordinated outreach programme, the PTS was able to achieve practical results from its external relations, public information and international cooperation activities, as well as its legal services. Outreach efforts made by States Signatories as well as those of the PTS in cooperation with States Signatories contributed

The prevalence and distribution of Brucella melitensis in goats in Malaysia from 2000 to 2009.

Science.gov (United States)

Bamaiyi, P H; Hassan, L; Khairani-Bejo, S; ZainalAbidin, M; Ramlan, M; Adzhar, A; Abdullah, N; Hamidah, N H M; Norsuhanna, M M; Hashim, S N

2015-05-01

A study was conducted to describe the prevalence and distribution of zoonotic Brucella melitensis in goats in Peninsular Malaysia. Using serosurveillance data of the last decade (2000-2009) involving 119,799 goats and 3555 farms, the seroprevalence of brucellosis among goats was 0.91% (95% CI=0.86-0.96) and among farms was 7.09% (95% CI=6.27-7.98). The odds of brucellosis was significantly (PMalaysia. The infection was detected throughout Malaysia but at generally low seroprevalences with states like Perlis that border neighbouring countries having higher seroprevalence of brucellosis than other non-border states. Copyright © 2015 Elsevier B.V. All rights reserved.

17 CFR 210.12-09 - Valuation and qualifying accounts.

Science.gov (United States)

2010-04-01

... period Column C—Additions (1)—Charged to costs and expenses (2)—Charged to other accounts—describe Column... qualifying accounts and reserves by descriptive title. Group (a) those valuation and qualifying accounts... accounts. 210.12-09 Section 210.12-09 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...

The importance of dose, frequency and duration of vitamin D supplementation for plasma 25-hydroxyvitamin D.

Science.gov (United States)

Chao, Yi-Sheng; Brunel, Ludovic; Faris, Peter; Veugelers, Paul J

2013-10-11

The importance of dose, frequency and duration of vitamin D supplementation for plasma 25(OH)D levels is not well described and rarely reported for supplementation that exceeds 2000 IU per day. The objective is to examine dose, frequency and duration of supplementation in relation to plasma 25(OH)D in a large population-based sample. We accessed data on 2714 volunteers that contributed to 4224 visits and applied multilevel regression. Compared to not using supplements, a minimum regimen of 1000-2000 IU once or twice per week for one month was not effective in raising 25(OH)D. Compared to this minimum regimen, higher doses of 2000-3000, 3000-4000, and 5000 IU or more were associated with a 7.49, 13.19 and 30.22 nmol/L 25(OH)D increase, respectively; frequencies of three to four, five to six and seven times/week were associated with a 5.44, 16.52 and 30.69 nmol/L increase, respectively; and supplementation of five months or longer was associated with an increase of 6.68 nmol/L (p D. Whereas dose, frequency and duration of supplementation are important to healthy subjects committed to optimizing their nutritional status, to the design of clinical trials, individual characteristics and lifestyle contribute substantially to 25(OH)D.

Základní principy a problémy dendrochronologie

Czech Academy of Sciences Publication Activity Database

Dvorská, Jitka; Poláček, Lumír

2000-01-01

Roč. 25, - (2000), s. 435-442 ISSN 0231-5823. [Konference archeologů středověku České republiky a Slovenské republiky s hlavním zaměřením na středověké město a jeho zázemí /31./. Banská Bystrica, 27.09.1999-30.09.1999] Institutional research plan: CEZ:AV0Z8001916 Subject RIV: AC - Archeology, Anthropology, Ethnology

Výsledky záchranného archeologického výzkumu v areálu okolí baziliky sv. Václava ve Staré Boleslavi. Předběžná zpráva z let 1997-1998

Czech Academy of Sciences Publication Activity Database

Špaček, J.; Boháčová, Ivana

2000-01-01

Roč. 25, - (2000), s. 307-322 ISSN 0231-5823. [Konference archeologů středověku České republiky a Slovenské republiky s hlavním zaměřením na středověké město a jeho zázemí /31./. Banská Bystrica, 27.09.1999-30.09.1999] R&D Projects: GA ČR GA404/99/1060 Subject RIV: AC - Archeology, Anthropology, Ethnology

Evolução dos acidentes de trânsito em um grande centro urbano, 1991-2000 Traffic accidents in a metropolitan area in Brazil, 1991-2000

Directory of Open Access Journals (Sweden)

Zenaide Calazans de Oliveira

2008-02-01

Full Text Available Este estudo descreve a evolução dos acidentes de trânsito em Salvador, Bahia, Brasil, entre 1991 e 2000, utilizando-se dados do Departamento Estadual de Trânsito do Estado da Bahia. Calculou-se taxas globais dos acidentes de trânsito, vítimas e taxas padronizadas de mortalidade por habitante e por veículos, e comparou-se médias destes indicadores para antes (1991 a 1994 e após (1995 a 2000 a adoção de medidas de intervenção como o uso do cinto de segurança e o Código Nacional de Trânsito. As taxas de acidentes de trânsito e de vítimas apresentaram-se elevadas e estáveis. A mortalidade reduziu entre 1995 e 1998, (25,7/100 mil habitantes e 18,1/100 mil, respectivamente estabilizando-se posteriormente. A diferença entre médias das taxas de mortalidade foi estatisticamente significante (p A time series study described the trend in motor vehicle accidents from 1991 to 2000, using data from the State Transit Department in Salvador, Bahia State, Brazil. Rates were calculated for total motor vehicle accidents, number of casualties, and standardized mortality based on population and number of vehicles, comparing two periods (1991-1994 and 1995-2000, before and after the adoption of safety measures including compulsory seat belt use and the new National Transit Code (NTC. Vehicle accident and casualty rates were high and showed little variation during the study period. The mortality rate decreased from 25.7/100,000 inhabitants in 1995 to 18.1/100,000 in 1998 and remained stable thereafter. The only significant difference (p < 0.001 was in the mean motor vehicle accident mortality rate before and after the intervention. The case fatality rate decreased from 10.7% (1995 to 7% (2000. Although still representing a major public health problem in this important metropolitan area, the decrease in motor vehicle accident mortality was possibly due to interventions in 1995 and expanded NTC measures in 1998. Greater efforts to change driver and

European Stirling forum 2000. Proceedings; Europaeisches Stirling Forum 2000. Tagungsband

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

This document comprises all 42 papers presented at the 'European Stirling Forum 2000', held in Osnabrueck on February 22-24, 2000. Among others, the following subjects were discussed: Thermodynamics, new developments, Stirling engines, free piston heat pumps, flow optimisation of regenerators for Stirling engines, simulation for modelling of flow and heat transfer in the gas cycle of Stirling engines, design and performance, Stirling refrigerators, economic efficiency of biomass Stirling engines, power control of a Stirling CHP system, a Stirling refrigerator for ultralow temperatures in the refrigeration industry. [German] Das vorliegende Dokument enthaelt alle (42) Beitraege der Referenten des 'Europaeischen Stirling Forums 2000', das vom 22. bis 24. Februar 2000 in Osnabrueck stattgefunden hat. Einige der behandelten Themenschwerpunkte im Zusammenhang mit der Stirling-Maschine waren die Thermodynamik, neue Entwicklungen des Kreisprozesses, Heissgasmotoren, Freikolben-Waermepumpe, stroemungstechnische Optimierung von Regeneratoren fuer Stirling-Maschinen, Simulation zur Modellierung der Stroemung und Waermeuebertragung im Gaskreislauf von Stirling-Maschinen, Entwurf und Betriebsverhalten, Stirling-Kaeltemaschine, Wirtschaftlichkeit von Biomasse-Stirlingmotoren, Leistungsregelung eines Stirling-Blockheizkraftwerks, Anwendung eines Stirling-Kuehlers, zum Ultratiefkuehlen in der Kuehlindustrie. (AKF)

Internal migration and urbanization in China: impacts on population exposure to household air pollution (2000-2010).

Science.gov (United States)

Aunan, Kristin; Wang, Shuxiao

2014-05-15

Exposure to fine particles ≤ 2.5 μm in aerodynamic diameter (PM2.5) from incomplete combustion of solid fuels in household stoves, denoted household air pollution (HAP), is a major contributor to ill health in China and globally. Chinese households are, however, undergoing a massive transition to cleaner household fuels. The objective of the present study is to establish the importance of internal migration when it comes to the changing household fuel use pattern and the associated exposure to PM2.5 for the period 2000 to 2010. We also estimate health benefits of the fuel transition in terms of avoided premature deaths. Using China Census data on population, migration, and household fuel use for 2000 and 2010 we identify the size, place of residence, and main cooking fuel of sub-populations in 2000 and 2010, respectively. We combine these data with estimated exposure levels for the sub-populations and estimate changes in population exposure over the decade. We find that the population weighted exposure (PWE) for the Chinese population as a whole was reduced by 52 (36-70) μg/m(3) PM2.5 over the decade, and that about 60% of the reduction can be linked to internal migration. During the same period the migrant population, in total 261 million people, was subject to a reduced population weighted exposure (ΔPWE) of 123 (87-165) μg/m(3) PM2.5. The corresponding figure for non-migrants is 34 (23-47) μg/m(3). The largest ΔPWE was estimated for rural-to-urban migrants (138 million people), 214 (154-283) μg/m(3). The estimated annual health benefit associated with the reduced exposure in the total population is 31 (26-37) billion USD, corresponding to 0.4% of the Chinese GDP. Copyright © 2014 Elsevier B.V. All rights reserved.

Estudo morfométrico do efeito do tenoxicam com água bidestilada ou com cloreto de sódio a 0,9% no endotélio venoso, em coelhos

Directory of Open Access Journals (Sweden)

Schnaider Taylor Brandão

2002-01-01

Full Text Available Objetivo: Avaliar, pela morfometria, se o tenoxicam com água bidestilada (diluente ou com cloreto de sódio a 0,9% (NaCl 0,9% provoca alterações no endotélio venoso. Métodos: Foram utilizados 90 coelhos (Oryctolagus cuniculus, brancos, da linhagem Nova Zelândia, machos, com idade acima de 10 semanas, com peso variando entre 2000 e 3500 gramas, divididos em dois grupos denominados Experimento e Controle, que foram observados nos tempos de 6h, 12h e 24h. Administrou-se nas venae auriculares dextra e sinistra, tenoxicam com seu diluente ou com NaCl 0,9% no grupo Experimento e NaCl 0,9% no grupo Controle. Para análise estatística dos resultados foi aplicada a análise de variância a um critério: a em separado para cada grupo (Tenoxicam/NaCl 0,9%, Tenoxicam/Diluente e NaCl 0,9%, para comparar as medidas médias dos diâmetros dos núcleos das células endoteliais obtidas nos períodos de observação de 6h, 12h e 24h. Resultados: Observou-se que não ocorreram diferenças significantes entre as medidas médias dos diâmetros nucleares encontradas nos períodos de eutanásia de 6, 12 e 24h, em separado para cada grupo. As medidas médias dos diâmetros nucleares do grupo Controle foram significantemente maiores do que as observadas no grupo Experimento. Conclusão: O tenoxicam, com água bidestilada ou com cloreto de sódio a 0,9%, reduziu os diâmetros dos núcleos das células endoteliais nas venae em que foi injetado.

Rapport du congrès EUROCALL 2000 et du symposium InSTIL 2000 (Dundee, Ecosse

Directory of Open Access Journals (Sweden)

Pierre Machu

2000-12-01

Full Text Available Le congrès annuel de EUROCALL (2000 (European Association for Computer Assisted Language Learning s'est déroulé du 31 août au 2 septembre 2000 à l'Université d'Abertay-Dundee et avait pour thème : Innovations dans l'apprentissage des langues au troisième millénaire - Réseaux pour la formation continue, interdisciplinarité et réponse intelligente de la machine (voir le site EUROCALL 2000 (2000. Environ 230 délégués provenant de 30 pays se sont rassemblés à Dundee. Les séances plénières et les communications (présentation de recherches ou démonstrations s'articulaient par conséquent autour de sous-thèmes tels que recherche en acquisition d'une langue seconde et ALAO, exploitation ou conception de matériaux pour la toile, communication médiatisée par ordinateur, centres de langues et apprentissage des langues de spécialité, traitement du language naturel et technologie de la parole. La technologie de la parole était également au coeur des préoccupations et travaux des 80 participants au symposium d'InSTIL 2000 (2000 (Intégration des technologies de la parole dans l'apprentissage des langues qui s'est déroulé durant les deux jours précédant le congrès EUROCALL 2000. InSTIL 2000 était organisé par le groupe d'intérêts spéciaux (GIS InSTIL (2000, (Integrating Speech Technology in Language Learning issu des trois associations CALICO (2000 (Computer Assisted Language Instruction Consortium, EUROCALL (2000 et ISCA (2000 (International Speech Communication Association.

Veebruarikuus 2000 lahkunuid / Aare Ermel

Index Scriptorium Estoniae

Ermel, Aare, 1957-2013

2000-01-01

Surid : Autant-Lara, Claude prantsuse režissöör (5.08.1903-5.02.2000), Vadim, Roger ukraina päritolu prantsuse režissöör (26.01.1928-11.02.2000), Kedrova, Lila vene päritolu prantsuse näitlejanna (1918-16.02.2000), Martelli, Otello itaalia filmioperaator (19.05.1903-20.02.2000)

Programme wood/energy 2000-2006. Activity Report for 2000-2004

International Nuclear Information System (INIS)

2006-01-01

When ADEME launched its Wood fuel programme throughout all of France in late 1999, its aim was to guide this resource supply chain to maturity and stable development in all user sectors: domestic, multi-family housing, commercial/institutional and industrial applications. To this end the Wood fuel Programme 2000-2006 was assigned objectives and endowed with significant financial means for studies and coordination in order to support and carry out general-interest projects, piloted by ADEME. The stated goal was to replace fossil fuels, avoid carbon emissions and establish quality assurance standards for household firewood and wood-fired devices. This report makes a status of ADEME's Wood fuel programme for the 2000-2004 era: - Domestic heating: After a drop during the 1990's, figures since 1999 of sales of wood-fuel domestic heating equipment (closed heaters, glass-door fires and stoves) have shown a significant rise. On average over 30 years, wood consumption has risen to 7.2 million TOE (40 million cubic metres) per year; - Industry: It is thought there are 1000 wood-fired heaters (above 1 megawatt) used in French industry. These are found mainly in timber-based industries and in timber crushing plants. This amounts to a total power output of 2.5 gigawatts. In the primary and secondary wood processing industries, the increase in the number of wood-fired boilers and energy produced has reached 5% per year Results of a call for carbon energy projects (APEC) was 61 submitted of which 52 were selected; 9 projects pending (166.5 K of aid from ADEME); and 35 projects begun (1,649 K of aid from ADEME). - Local authority and service sector wood-fired heating systems: At the end of 2004, the number of local authority active boilers was 641, producing 430 megawatts. This is an increase of an average of 13% year on year since 2000. By the end of 2004, the target had already been met for the number of boilers being financed (1,090). By 2006 however we still need to generate a

Annual report 2000; Rapport annuel 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

This report presents the industrial activities and the financial results of the Framatome group (Framatome-SA) in 2000. and Siemens have merged their nuclear activities and have created Framatome-ANP (advanced nuclear power) owned by Framatome (66%) and Siemens (34%). This new society represents a turnover of 3 millions Euros and a staff of 13.000 employees. In the sector of connectors, FCI (Framatome Connectors International) has reinforced its second position in the world, FCI has enjoyed a high growth in the sector of telecommunication and has created a department dealing with optic fibers. 32% of the activities of Framatome-SA have been performed in France, 26% in North America and 42% in the rest of the world. In 2000 the trading results after having paid taxes reached 306 millions Euros, it represents 6.1% of the turnover. (A.C.)

National, regional, and worldwide estimates of stillbirth rates in 2015, with trends from 2000

DEFF Research Database (Denmark)

Blencowe, Hannah; Cousens, Simon; Jassir, Fiorella Bianchi

2016-01-01

) met the inclusion criteria, a 90% increase from 2009 estimates. The estimated average global SBR in 2015 was 18·4 per 1000 births, down from 24·7 in 2000 (25·5% reduction). In 2015, an estimated 2·6 million (uncertainty range 2·4-3·0 million) babies were stillborn, giving a 19% decline in numbers...... estimate SBRs and numbers for 195 countries, including trends from 2000 to 2015. METHODS: We collated SBR data meeting prespecified inclusion criteria from national routine or registration systems, nationally representative surveys, and other data sources identified through a systematic review, web...

R-2000 home health study : Homeowner health in R-2000 and new conventional homes

International Nuclear Information System (INIS)

Parekh, A.

2002-01-01

A field study was conducted by Health Canada and Natural Resources Canada (NRCan) to evaluate self-reported health symptoms by residents of R-2000 and conventional homes in Nova Scotia and New Brunswick. It involved 52 energy efficient R-2000 and 50 conventionally built houses. Health Canada collected and analyzed data concerning changes in occupant health after moving into R-2000 houses and similar conventional houses. Definite trends in improvements of respiratory symptoms of occupants in R-2000 houses were revealed, compared to the results obtained for occupants of conventional houses. New occupants of R-2000 houses reported significant improvement in indoor air quality in 94 per cent of cases, while only 77 per cent of conventional homeowners reported similar results. Fifty six per cent of the occupants of R-2000 homes reported a general improvement in their health, compared to 32 per cent in conventional houses. The testing of houses in other regions is being planned by Health Canada. tabs

THE SUBLUMINOUS AND PECULIAR TYPE Ia SUPERNOVA PTF 09dav

International Nuclear Information System (INIS)

Sullivan, M.; Ofek, E. O.; Blake, S.; Podsiadlowski, P.; Kasliwal, M. M.; Cooke, J.; Quimby, R.; Kulkarni, S. R.; Nugent, P. E.; Thomas, R. C.; Poznanski, D.; Howell, D. A.; Arcavi, I.; Gal-Yam, A.; Hook, I. M.; Mazzali, P.; Bildsten, L.; Bloom, J. S.; Cenko, S. B.; Law, N.

2011-01-01

PTF 09dav is a peculiar subluminous Type Ia supernova (SN) discovered by the Palomar Transient Factory (PTF). Spectroscopically, it appears superficially similar to the class of subluminous SN1991bg-like SNe, but it has several unusual features which make it stand out from this population. Its peak luminosity is fainter than any previously discovered SN1991bg-like SN Ia (M B ∼ -15.5), but without the unusually red optical colors expected if the faint luminosity were due to extinction. The photospheric optical spectra have very unusual strong lines of Sc II and Mg I, with possible Sr II, together with stronger than average Ti II and low velocities of ∼6000 km s -1 . The host galaxy of PTF09dav is ambiguous. The SN lies either on the extreme outskirts (∼41 kpc) of a spiral galaxy or in an very faint (M R ≥ -12.8) dwarf galaxy, unlike other 1991bg-like SNe which are invariably associated with massive, old stellar populations. PTF 09dav is also an outlier on the light-curve-width-luminosity and color-luminosity relations derived for other subluminous SNe Ia. The inferred 56 Ni mass is small (0.019 ± 0.003 M sun ), as is the estimated ejecta mass of 0.36 M sun . Taken together, these properties make PTF 09dav a remarkable event. We discuss various physical models that could explain PTF 09dav. Helium shell detonation or deflagration on the surface of a CO white dwarf can explain some of the features of PTF 09dav, including the presence of Sc and the low photospheric velocities, but the observed Si and Mg are not predicted to be very abundant in these models. We conclude that no single model is currently capable of explaining all of the observed signatures of PTF 09dav.

International nuclear power status 2000; International kernekraftstatus 2000

Energy Technology Data Exchange (ETDEWEB)

Lauritzen, B.; Majborn, B.; Nonboel, E.; Oelgaard, P.L. [eds.

2001-03-01

This report is the seventh in a series of annual reports on the international development of nuclear power with special emphasis on reactor safety. For 2000, the report contains: 1. General trends in the development of nuclear power. 2. Deposition of low-level radioactive waste. 3. Statistical information on nuclear power production (in 1999). 4. An overview of safety-relevant incidents in 2000. 5. The development in Sweden. 6. The development in Eastern Europe. 7. The development in the rest of the world. 8. Trends in the development of reactor types. 9. Trends in the development of the nuclear fuel cycle. (au)

Quasi-simultaneous ultraviolet, optical, and infrared observations of the BL Lacertae object PKS 0048-09

International Nuclear Information System (INIS)

Falomo, R.; Bouchet, P.; Maraschi, L.; Treves, A.; Tanzi, E.G.

1988-01-01

This paper reports on quasi-simultaneous UV, optical, and IR observations of the BL Lac object PKS 0048-09, carried out on January 7-9, 1987, when the object was in a moderately high optical state. The data were used to derive a detailed energy distribution from about 10 to the 14th to about 2.5 x 10 to the 15th Hz. A comparison of observations obtained on January 7-9, 1987, with observations on September 12, 1986, pertaining to a lower state of the source, indicates spectral hardening with increasing intensity on time scales of months. 26 references

Quasi-simultaneous ultraviolet, optical, and infrared observations of the BL Lacertae object PKS 0048-09

Energy Technology Data Exchange (ETDEWEB)

Falomo, R.; Bouchet, P.; Maraschi, L.; Treves, A.; Tanzi, E.G.

1988-12-01

This paper reports on quasi-simultaneous UV, optical, and IR observations of the BL Lac object PKS 0048-09, carried out on January 7-9, 1987, when the object was in a moderately high optical state. The data were used to derive a detailed energy distribution from about 10 to the 14th to about 2.5 x 10 to the 15th Hz. A comparison of observations obtained on January 7-9, 1987, with observations on September 12, 1986, pertaining to a lower state of the source, indicates spectral hardening with increasing intensity on time scales of months. 26 references.

Application of Auto CAD 2000

International Nuclear Information System (INIS)

Kim, Hyeong Jun

1999-11-01

This book deals with basic of AutoCAD, beginning AutoCAD 2000, using design center of AutoCAD 2000, adding drawing element with design center, drawing lines, using 2D edit command, making layer, hatching, dimensioning, entering letters on the floor plan, making 3D object, practice of 3D command, edition of 3D object, making solid, rendering object, and using internet in AutoCAD 2000. This book is introduction of AutoCAD 2000 for beginner.

International Youth Nuclear Congress 2000. Film

International Nuclear Information System (INIS)

OST Film Production Studio; YDRNS Information Technology Services, Ltd.

2001-01-01

This CD-ROM contains 28 minutes 30 seconds of video-film about programme of International Youth Nuclear Congress 2000 (IYNC 2000). There is documentary video-film about IYNC 2000, also presented are: the Opening panel of the IYNC 2000, every day work of IYNC 2000, Congress people; the fun run; Entertainment excursion in Bratislava, about excursion in Mochovce NPP as well as in IAEA

Consolidated results 2000. Forecasts 2001; Resultats consolides 2000. Perspectives 2001

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

This document presents an economic analysis of the Group Gaz De France consolidated results for the year 2000. The main topics are the evolution of the energy market, the great economic growth for the five businesses of the Group (exploration-production, trade, transport, distribution and services), financial results affected by the supply costs increase, the position reinforcement among the gas leaders in Europe and the highlights of 2000. (A.L.B.)

[Quality system Vision 2000].

Science.gov (United States)

Pasini, Evasio; Pitocchi, Oreste; de Luca, Italo; Ferrari, Roberto

2002-12-01

A recent document of the Italian Ministry of Health points out that all structures which provide services to the National Health System should implement a Quality System according to the ISO 9000 standards. Vision 2000 is the new version of the ISO standard. Vision 2000 is less bureaucratic than the old version. The specific requests of the Vision 2000 are: a) to identify, to monitor and to analyze the processes of the structure, b) to measure the results of the processes so as to ensure that they are effective, d) to implement actions necessary to achieve the planned results and the continual improvement of these processes, e) to identify customer requests and to measure customer satisfaction. Specific attention should be also dedicated to the competence and training of the personnel involved in the processes. The principles of the Vision 2000 agree with the principles of total quality management. The present article illustrates the Vision 2000 standard and provides practical examples of the implementation of this standard in cardiological departments.

Nationwide shifts in the double burden of overweight and underweight in Vietnamese adults in 2000 and 2005: two national nutrition surveys

Directory of Open Access Journals (Sweden)

Mai Le B

2011-01-01

Full Text Available Abstract Background In developing countries, overweight prevalence is increasing while underweight prevalence is still high. This situation is known as the double nutrition burden. Both underweight and overweight are related to increased risk of chronic non-communicable diseases, reduced well-being and quality of life. This study aims to compare the prevalence of overweight and underweight among Vietnamese adults in 2000 and 2005. Methods The study was based on two nationally representative surveys, the National Nutrition Survey 2000 (14,452 subjects and the National Adult Obesity Survey 2005 (17,213 subjects. Adults aged 25-64 years were sampled to be nationally representative. Multiple multinomial logistic regression analysis was used to investigate the association of underweight and overweight with socio-economic indicators. Results The distribution of BMI across the population and population groups indicated a shift towards higher BMI levels in 2005 as compared to 2000. The nationwide prevalence of overweight (BMI ≥ 25 kg/m2 and obesity (BMI ≥ 30 kg/m2 was 6.6% and 0.4% respectively in 2005, almost twice the rates of 2000 (3.5% and 0.2%. Using the Asian BMI cut-off of 23 kg/m2 the overweight prevalence was 16.3% in 2005 and 11.7% in 2000. In contrast, the underweight prevalence (BMI 2 of 20.9% in 2005 was lower than the rate of 25.0% in 2000. Women were more likely to be both underweight and overweight as compared to men in both 2000 and 2005. Urban residents were more likely to be overweight and less likely to be underweight as compared to rural residents in both years. The shifts from underweight to overweight were clearer among the higher food expenditure levels. Conclusions The double nutrition burden was clearly present in Vietnam. The distribution of BMI across the population groups generally indicated a shift towards higher BMI levels in 2005 as compared to 2000. The prevalence of overweight was increased while the declined level

Tunable exchange bias effect in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles at temperatures up to 250K

DEFF Research Database (Denmark)

Basith, M. A.; Khan, F. A.; Ahmmad, Bashir

2015-01-01

that the strength of the exchange bias effect is tunable by the field cooling. The HEB values are also found to be dependent on the temperature. This magnetically tunable exchange bias obtained at temperatures up to 250K in Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles may be worthwhile for potential applications.......The exchange bias (EB) effect has been observed in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles.The influence of magnetic field cooling on the exchange bias effect has also been investigated. The magnitude of the exchange bias field (HEB) increases with the cooling magnetic field, showing...

Eesti firmad olid esmakordselt messil Denkmal 2000 / üles kirjut. Ingrid Eylandt-Kuure

Index Scriptorium Estoniae

2000-01-01

Leipzigi messikeskuses 25.-28. X 2000. a. toimuva 4. muinsuskaitse ja linnauuenduse-alase messil oli ühisekspositsiooniga (põhiteemaks Tallinna tüüpiline elamu XV sajandist 1930. aastateni, boksi kujundaja Krista Veermets) väljas Eesti esindus: Tallinna Kultuuriväärtuste Amet, OÜ Arhitektuuribüroo Adrikorn & Rets, OÜ Vana Tallinn, AS KAR-Grupp. Messimuljeid

2000 Annual report: synthesis

International Nuclear Information System (INIS)

2001-01-01

This synthesis of the Annual Report 2000 present information of the main activities on the scope of the radiation protection and nuclear safety of the Nuclear Regulatory Authority (NRA) of the Argentina during 2000

4U 1907+09: an HMXB running away from the Galactic plane

Science.gov (United States)

Gvaramadze, V. V.; Röser, S.; Scholz, R.-D.; Schilbach, E.

2011-05-01

We report the discovery of a bow shock around the high-mass X-ray binary (HMXB) 4U 1907+09 using the Spitzer Space Telescope 24 μm data (after Vela X-1 the second example of bow shocks associated with HMXBs). The detection of the bow shock implies that 4U 1907+09 is moving through space with a high (supersonic) peculiar velocity. To confirm the runaway nature of 4U 1907+09, we measured its proper motion, which for an adopted distance to the system of 4 kpc corresponds to a peculiar transverse velocity of ≃ 160 ± 115 km s-1, meaning that 4U 1907+09 is indeed a runaway system. This also supports the general belief that most HMXBs possess high space velocities. The direction of motion of 4U 1907+09 inferred from the proper motion measurement is consistent with the orientation of the symmetry axis of the bow shock, and shows that the HMXB is running away from the Galactic plane. We also present the Spitzer images of the bow shock around Vela X-1 (a system similar to 4U 1907+09) and compare it with the bow shock generated by 4U 1907+09.

Building 2000

International Nuclear Information System (INIS)

Den Ouden, C.; Steemers, T.C.

1992-01-01

This is the first volume of Building 2000, a pilot project of the Commission's R and D-programme 'Solar Energy Applications to Buildings' with the purpose of encouraging the adoption of solar architecture in large buildings. In this first rich illustrated volume the results of the design studies illustrating passive solar architecture in buildings in the European Community are presented in particular for the building categories as mentioned in the subtitle. In a second volume, a similar series of studies is presented for the building categories: office buildings, public buildings and hotels and holiday complexes. Several Design Support Workshops were organized during the Building 2000 programme during which Building 2000 design teams could directly exchange ideas with the various design advice experts represented at these workshops. In the second part of the Building 2000 final report a summary of a selection of many reports is presented (15 papers), as produced by Design Support experts. Most of the design support activities resulted in changes of the various designs, as have been reported by the design teams in the brochures presented in the first part of this book. It is to be expected that design aids and simulation tools for passive solar options, daylighting concepts, comfort criteria etc., will be utilized more frequently in the future. This will result in a better exchange of information between the actual design practitioners and the European R and D community. This technology transfer will result in buildings with a higher quality with respect to energy and environmental issues

Building 2000

International Nuclear Information System (INIS)

Den Ouden, C.; Steemers, T.C.

1992-01-01

This is the second volume of Building 2000, a pilot project of the Commission's R and D-programme 'Solar Energy Applications to Buildings' with the purpose of encouraging the adoption of solar architecture in large buildings. In this second rich illustrated volume the results of the design studies illustrating passive solar architecture in buildings in the European Community are presented in particular for the building categories as mentioned in the subtitle. In the first volume, a similar series of studies is presented for the building categories: schools, laboratories and universities, and sports and educational centres. Several Design Support Workshops were organized during the Building 2000 programme during which Building 2000 design teams could directly exchange ideas with the various design advice experts represented at these workshops. In the second part of the Building 2000 final report a summary of a selection of many reports is presented (11 papers), as produced by Design Support experts. Most of the design support activities resulted in changes of the various designs, as have been reported by the design teams in the brochures presented in the first part of this book. It is to be expected that design aids and simulation tools for passive solar options, daylighting concepts, comfort criteria etc., will be utilized more frequently in the future. This will result in a better exchange of information between the actual design practitioners and the European R and D community. This technology transfer will result in buildings with a higher quality with respect to energy and environmental issues

Building 2000

Energy Technology Data Exchange (ETDEWEB)

Den Ouden, C [EGM Engineering BV, Dordrecht (Netherlands); Steemers, T C [Commission of the European Communities, Brussels (Belgium)

1992-01-01

This is the second volume of Building 2000, a pilot project of the Commission's R and D-programme 'Solar Energy Applications to Buildings' with the purpose of encouraging the adoption of solar architecture in large buildings. In this second rich illustrated volume the results of the design studies illustrating passive solar architecture in buildings in the European Community are presented in particular for the building categories as mentioned in the subtitle. In the first volume, a similar series of studies is presented for the building categories: schools, laboratories and universities, and sports and educational centres. Several Design Support Workshops were organized during the Building 2000 programme during which Building 2000 design teams could directly exchange ideas with the various design advice experts represented at these workshops. In the second part of the Building 2000 final report a summary of a selection of many reports is presented (11 papers), as produced by Design Support experts. Most of the design support activities resulted in changes of the various designs, as have been reported by the design teams in the brochures presented in the first part of this book. It is to be expected that design aids and simulation tools for passive solar options, daylighting concepts, comfort criteria etc., will be utilized more frequently in the future. This will result in a better exchange of information between the actual design practitioners and the European R and D community. This technology transfer will result in buildings with a higher quality with respect to energy and environmental issues.

Building 2000

Energy Technology Data Exchange (ETDEWEB)

Den Ouden, C [EGM Engineering BV, Dordrecht (Netherlands); Steemers, T C [Commission of the European Communities, Brussels (Belgium)

1992-01-01

This is the first volume of Building 2000, a pilot project of the Commission's R and D-programme 'Solar Energy Applications to Buildings' with the purpose of encouraging the adoption of solar architecture in large buildings. In this first rich illustrated volume the results of the design studies illustrating passive solar architecture in buildings in the European Community are presented in particular for the building categories as mentioned in the subtitle. In a second volume, a similar series of studies is presented for the building categories: office buildings, public buildings and hotels and holiday complexes. Several Design Support Workshops were organized during the Building 2000 programme during which Building 2000 design teams could directly exchange ideas with the various design advice experts represented at these workshops. In the second part of the Building 2000 final report a summary of a selection of many reports is presented (15 papers), as produced by Design Support experts. Most of the design support activities resulted in changes of the various designs, as have been reported by the design teams in the brochures presented in the first part of this book. It is to be expected that design aids and simulation tools for passive solar options, daylighting concepts, comfort criteria etc., will be utilized more frequently in the future. This will result in a better exchange of information between the actual design practitioners and the European R and D community. This technology transfer will result in buildings with a higher quality with respect to energy and environmental issues.

Compatibility of butorphanol with granisetron in 0.9% sodium chloride injection packaged in glass bottles or polyolefin bags.

Science.gov (United States)

Chen, Fu-Chao; Xiong, Hui; Liu, Hui-Min; Fang, Bao-Xia; Li, Peng

2015-08-15

The stability of admixtures containing butorphanol and granisetron in polyolefin bags and glass bottles stored at 4 and 25 °C was studied. Commercial solutions of butorphanol tartrate and granisetron hydrochloride were combined and further diluted with 0.9% sodium chloride injection to final concentrations of butorphanol tartrate 0.08 mg/mL and granisetron 0.03 or 0.06 mg/mL; the resulting mixtures were packaged in polyolefin bags and glass bottles. The admixtures were assessed for periods of up to 48 hours after storage at 25 °C without protection from room light and up to 14 days at 4 °C with protection from room light. The chemical stability of the admixtures was evaluated by a validated high-performance liquid chromatography (HPLC) method and by measurement of pH values. Solution appearance and color were assessed by observing the samples against room light and dark backgrounds. HPLC analysis demonstrated that the percentages of the initial concentrations of butorphanol and granisetron in the various solutions remained above 97% during the testing period. No changes in color or turbidity were observed in any of the prepared solutions. Throughout this period, pH values remained stable. Admixtures of butorphanol tartrate 0.08 mg/mL and granisetron 0.03 or 0.06 mg/mL in 0.9% sodium chloride injection in polyolefin bags or glass bottles remained stable for 48 hours when stored at 25 °C exposed to room light and for 14 days when stored at 4 °C protected from room light. Copyright © 2015 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

Trends in HIV testing, prevalence among first-time testers, and incidence in most-at-risk populations in Spain: the EPI-VIH Study, 2000 to 2009.

Science.gov (United States)

Diez, M; Bleda, M J; Varela, J R; Ordonana, J; Azpiri, M A; Vall, M; Santos, C; Viloria, L; de Armas, C; Urena, J M; Trullen, J; Pueyo, I; Martinez, B; Puerta, T; Vera, M; Sanz, I; Junquera, M L; Landa, M C; Martinez, E; Camara, M M; Belda, J; Bru, F J; Diaz, A

2014-11-27

During 2000 to 2009, data on people undergoing HIV testing and on those newly diagnosed with HIV were collected in a network of 20 Spanish clinics specialising in sexually transmitted infections and/or HIV testing and counselling. The number of tests performed, overall and disaggregated by different variables, was obtained. HIV prevalence among first-time testers and HIV incidence among repeat testers were calculated. To evaluate trends, joinpoint regression models were fitted. In total, 236,939 HIV tests were performed for 165,745 individuals. Overall HIV prevalence among persons seeking HIV testing was 2.5% (95% CI: 2.4 to 2.6). Prevalence was highest in male sex workers who had sex with other men (19.0% (95% CI: 16.7 to 21.4)) and was lowest in female sex workers (0.8% (95% CI: 0.7 to 0.9)). Significant trends in prevalence were observed in men who have sex with men (MSM) (increasing) and heterosexual individuals (decreasing). The incidence analysis included 30,679 persons, 64,104 person-years (py) of follow-up and 642 seroconversions. The overall incidence rate (IR) was 1.0/100 py (95% CI: 0.9/100 to 1.1/100). Incidence was significantly higher in men and transgender females than in women (1.8/100 py (95% CI: 1.6 to 1.9), 1.2/100 py (95% CI: 0.5 to 2.8) and 0.1/100 py (95% CI: 0.09 to 0.2) respectively) and increased with age until 35–39 years. IRs in MSM and people who inject drugs were significantly greater than in heterosexual individuals (2.5/100 py (95% CI: 2.3 to 2.7), 1.6/100 py (95% CI: 1.1 to 2.2) and 0.1/100 py (95% CI: 0.09 to 0.2) respectively), and an upward trend was observed in MSM. Our results call for HIV prevention to be reinforced in MSM and transgender women in Spain.

HIV-1 and its gp120 inhibits the influenza A(H1N1)pdm09 life cycle in an IFITM3-dependent fashion.

Science.gov (United States)

Mesquita, Milene; Fintelman-Rodrigues, Natalia; Sacramento, Carolina Q; Abrantes, Juliana L; Costa, Eduardo; Temerozo, Jairo R; Siqueira, Marilda M; Bou-Habib, Dumith Chequer; Souza, Thiago Moreno L

2014-01-01

HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle in vitro. We show here that exposure of A(H1N1)pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1)pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs) to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1)pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA) gene from in vitro experiments and from samples of HIV-1/A(H1N1)pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1)pdm09 co-infected patients during the recent influenza form 2009/2010.

HIV-1 and its gp120 inhibits the influenza A(H1N1pdm09 life cycle in an IFITM3-dependent fashion.

Directory of Open Access Journals (Sweden)

Milene Mesquita

Full Text Available HIV-1-infected patients co-infected with A(H1N1pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1pdm09 life cycle in vitro. We show here that exposure of A(H1N1pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA gene from in vitro experiments and from samples of HIV-1/A(H1N1pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1pdm09 co-infected patients during the recent influenza form 2009/2010.

National Beef Quality Audit-2000: survey of targeted cattle and carcass characteristics related to quality, quantity, and value of fed steers and heifers.

Science.gov (United States)

McKenna, D R; Roebert, D L; Bates, P K; Schmidt, T B; Hale, D S; Griffin, D B; Savell, J W; Brooks, J C; Morgan, J B; Montgomery, T H; Belk, K E; Smith, G C

2002-05-01

The National Beef Quality Audit-2000 was conducted to assess the current status ofthe quality and consistency of U.S. fed steers and heifers. Between May and November 2000, survey teams assessed hide condition (n = 43,415 cattle for color, brands, mud/manure), bruises (n = 43,595 carcasses), offal and carcass condemnation (n = 8,588 cattle), and carcass quality and yield information (n = 9,396 carcasses) in 30 U.S. beef packing plants. Hide colors were black (45.1%), red (31.0%), yellow (8.0%), Holstein (5.7%), gray (4.0%), white (3.2%), brown (1.7%), and brindle (1.3%). Brand frequencies were no (49.3%), one (46.2%), and two or more (4.4%), and brands were located on the butt (36.3%), side (13.7%), and shoulder (3.6%). Most cattle had no (18.0%) or a small amount (55.8%) of mud/manure on their hides, and they had no (77.3%) horns. Most carcasses (53.3%) were not bruised, 30.9% had one bruise, and 15.8% had multiple bruises. Bruise location and incidence were round (14.9%), loin (25.9%), rib (19.4%), chuck (28.2%), and brisket, flank, and plate (11.6%). Condemnation item and incidence were liver (30.3%), lungs (13.8%), tripe (11.6%), heads (6.2%), tongues (7.0%), and carcasses (0.1%). Carcass evaluation revealed these traits and frequencies: steer (67.9%), heifer (31.8%), and bullock (0.3%) sex-classes; dark-cutters (2.3%); A (96.6%), B (2.5%), and C or older (0.9%) overall maturities; and native (90.1%), dairy-type (6.9%), and Bos indicus (3.0%) breed-types. Mean USDA yield grade traits were USDA yield grade (3.0), carcass weight (356.9 kg), adjusted fat thickness (1.2 cm), longissimus muscle area (84.5 cm2), and kidney, pelvic, and heart fat (2.4%). USDA yield grades were Yield Grade 1 (12.2%), Yield Grade 2 (37.4%), Yield Grade 3 (38.6%), Yield Grade 4 (10.4%), and Yield Grade 5 (1.3%). Mean USDA quality grade traits were USDA quality grade (Select85), marbling score (Small23), overall maturity (A66), lean maturity (A65), and skeletal maturity (A67). Marbling

Power Systems Development Facility Gasification Test Run TC09

Energy Technology Data Exchange (ETDEWEB)

Southern Company Services

2002-09-30

This report discusses Test Campaign TC09 of the Kellogg Brown & Root, Inc. (KBR) Transport Gasifier train with a Siemens Westinghouse Power Corporation (Siemens Westinghouse) particle filter system at the Power Systems Development Facility (PSDF) located in Wilsonville, Alabama. The Transport Gasifier is an advanced circulating fluidized-bed gasifier designed to operate as either a combustor or a gasifier in air- or oxygen-blown mode of operation using a particulate control device (PCD). The Transport Gasifier was operated as a pressurized gasifier during TC09 in air- and oxygen-blown modes. Test Run TC09 was started on September 3, 2002, and completed on September 26, 2002. Both gasifier and PCD operations were stable during the test run, with a stable baseline pressure drop. The oxygen feed supply system worked well and the transition from air to oxygen was smooth. The gasifier temperature varied between 1,725 and 1,825 F at pressures from 125 to 270 psig. The gasifier operates at lower pressure during oxygen-blown mode due to the supply pressure of the oxygen system. In TC09, 414 hours of solid circulation and over 300 hours of coal feed were attained with almost 80 hours of pure oxygen feed.

National forest cover change in Congo Basin: deforestation, reforestation, degradation and regeneration for the years 1990, 2000 and 2005.

Science.gov (United States)

Céline, Ernst; Philippe, Mayaux; Astrid, Verhegghen; Catherine, Bodart; Musampa, Christophe; Pierre, Defourny

2013-04-01

This research refers to an object-based automatic method combined with a national expert validation to produce regional and national forest cover change statistics over Congo Basin. A total of 547 sampling sites systematically distributed over the whole humid forest domain are required to cover the six Central African countries containing tropical moist forest. High resolution imagery is used to accurately estimate not only deforestation and reforestation but also degradation and regeneration. The overall method consists of four steps: (i) image automatic preprocessing and preinterpretation, (ii) interpretation by national expert, (iii) statistic computation and (iv) accuracy assessment. The annual rate of net deforestation in Congo Basin is estimated to 0.09% between 1990 and 2000 and of net degradation to 0.05%. Between 2000 and 2005, this unique exercise estimates annual net deforestation to 0.17% and annual net degradation to 0.09%. An accuracy assessment reveals that 92.7% of tree cover (TC) classes agree with independent expert interpretation. In the discussion, we underline the direct causes and the drivers of deforestation. Population density, small-scale agriculture, fuelwood collection and forest's accessibility are closely linked to deforestation, whereas timber extraction has no major impact on the reduction in the canopy cover. The analysis also shows the efficiency of protected areas to reduce deforestation. These results are expected to contribute to the discussion on the reduction in CO2 emissions from deforestation and forest degradation (REDD+) and serve as reference for the period. © 2012 Blackwell Publishing Ltd.

Facilities Performance Indicators Report, 2008-09

Science.gov (United States)

Hills, Christina, Ed.

2010-01-01

This paper features another expanded Web-based Facilities Performance Indicators Report (FPI). The purpose of APPA's Facilities Performance Indicators is to provide a representative set of statistics about facilities in educational institutions. The 2008-09 iteration of the Web-based Facilities Performance Indicators Survey was posted and…

Bioengineering of Dental Tissues: Bibliometric Analysis 2000-2011.

Directory of Open Access Journals (Sweden)

Sebastián Zamorano

2014-03-01

Full Text Available Introduction: There has been a noticeable increase in experimental use and therapies based on stem cells over recent years. Nevertheless, there is a lack of information about this progress in the dental field, which makes it difficult to trace development and design policies. The purpose of this study, as a first approach to the subject, is to determine a bibliometric profile for the investigation related to bioengineering of dental tissue at a worldwide scale, based on the MEDLINE database, for the period 2000-2011. Methodology: A bibliometric study was carried out. Every article indexed in the MEDLINE database and associated with the terms “stem cells” and “tooth regeneration” for the period 2000-2011 was included. The analyzed variables were publishing date, country of origin, language and publication type (original or review, journal, author, associated university and tissue source (human or animal. Results: For the entire period included in the study, 257 articles were found. Of these, 149 corresponded to original Works published in English; 5 in other languages; 92 comprised literature reviews in English, 9 in other languages and 2 publications were included in the “others” category. The countries with the highest research productivity were the United States (24.51%, Japan (20.62% and China (17.90%, while Brazil (3.9% was the only Latin-American country found in the list. Animal tissues were used in 59.09% of them. The most productive authors were Ueda M (17 and Jin Y (11, whereas Fourth Military University (13, University of Tokyo (12 and Capital Medical University (10 had the largest number of publications. Conclusion: The United States, Japan and China concentrate about two thirds of the production. Latin-America was represented only by Brazil.

Cropland expansion in Brazil, 2000 to 2014

Science.gov (United States)

Zalles, V.; Hansen, M.; Potapov, P.; Stehman, S. V.; Tyukavina, A.; Pickens, A. H.; Okpa, C.; Aguilar, R.; John, N.; Chavez, S.

2017-12-01

Brazil has become a global leader in the production of commodity row crops such as soybean, sugarcane, cotton, and corn. Here, we employ 30m spatial resolution Landsat data to estimate cropland extent in the year 2000 and its subsequent expansion through 2014. A probability-based sample of reference data allows us to report unbiased estimates of national, biome, and state-scale area of crop expansion with associated uncertainties. We find an increase in Brazilian cropland extent from 26.0 Mha in 2000 to 46.1 Mha in 2014. The cropland frontier states of Maranhao, Tocantins, Piaui, Bahia (MATOPIBA), Mato Grosso, Mato Grosso do Sul, and Para all more than doubled in cropland extent. The states of Goias, Minas Gerais and Sao Paulo experienced >50% increases. The vast majority of expansion, 79%, occurred on repurposed pasture lands, and 20% from the conversion of natural vegetation. Area of converted Cerrado savannas was nearly 2.5 times that of Amazon forests, and accounted for over half of new cropland in MATOPIBA. Spatio-temporal dynamics of cropland expansion are reflected in market conditions, land use policies, and other factors. Continued extensification of cropland is a viable option across Brazil with attendant benefits for and challenges to development.

Per- and polyfluoroalkyl substances (PFAS) in American Red Cross adult blood donors, 2000-2015.

Science.gov (United States)

Olsen, Geary W; Mair, David C; Lange, Cleston C; Harrington, Laura M; Church, Timothy R; Goldberg, Corinne L; Herron, Ross M; Hanna, Hank; Nobiletti, John B; Rios, Jorge A; Reagen, William K; Ley, Carol A

2017-08-01

In 2015, thirteen per- and polyfluoroalkyl substances (PFAS), including perfluorohexanesulfonate (PFHxS), perfluorooctanesulfonate (PFOS), perfluorooctanoate (PFOA), perfluorononanoate (PFNA), and perfluorodecanoate (PFDA) were analyzed in human plasma that were collected from a total of 616 American Red Cross male and female blood donors (ages 20-69) at 6 regional blood collection centers. Plasma samples were analyzed using a validated solvent precipitation-isotope dilution direction-liquid chromatography tandem mass spectrometry method. The data were analyzed in conjunction with prior cross-sectional investigations [2000-2001 (n =645), 2006 (n =600), and 2010 (n =600)] to determine PFAS trends. Age- and sex-adjusted geometric mean serum (2000-2001) and plasma (2006, 2010, 2015) concentrations (ng/mL) were, respectively: PFHxS (2.3, 1.5, 1.3, 0.9); PFOS (35.1, 14.5, 8.4, 4.3); PFOA (4.7, 3.4, 2.4, 1.1); PFNA (0.6, 1.0, 0.8, 0.4); and PFDA (0.2, 0.3, 0.3, 0.1). The percentage decline in these geometric mean concentrations from 2000-2001 to 2015 were: PFHxS (61%); PFOS (88%); PFOA (77%); PFNA (33%); and PFDA (50%). The results indicate a continued decline of PFHxS, PFOS, and PFOA concentrations in American Red Cross blood donors. For the remaining PFAS measured in 2015, including the shorter chain perfluoroalkyls perfluorobutanesulfonate (PFBS) and perfluorohexanoate (PFHxA), the majority of samples were below the lower limit of quantitation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Annual report 2000

International Nuclear Information System (INIS)

2002-01-01

This report presents the activities of the Cogema group, its reports on management and its financial situation for the year 2000: presentation of TOPCO, boards of directors, profile, main consolidated data, year 2000 highlights, group activities (mining-chemistry, enrichment, reprocessing-recycling, engineering, services, sustainable development, health and safety, quality policy, human resources, R and D, communication), organization chart of the consolidated Cogema group, financial statements, directory. (J.S.)

Design study of a 25.5-MHz split coaxial RFQ

International Nuclear Information System (INIS)

Arai, Shigeaki; Imanishi, Akira; Morimoto, Teruhisa; Shibuya, Shinji; Tojyo, Eiki; Tokuda, Noboru.

1989-08-01

A 25.5-MHz split coaxial RFQ with modulated vanes is now being fabricated. The RFQ, 2.1 m in length and 0.9 m in diameter, will accelerate ions with a charge-to-mass ratio greater than 1/30 from 1 keV/n up to 45.4 keV/n. The design works on beam dynamics and cavity fabrication are reported. (author)

Environmental taxes 1991 - 2000 (2001)

International Nuclear Information System (INIS)

Anon.

2001-01-01

The statistics presents statements of environmental taxes for the period 1991-2000 (and budget figure for 2001). Environmental taxes is a collective concept for pollution, energy, transportation and resource related taxes. Income of the government from environmental taxes have increased from 30,0 billions DDK in 1991 to 60,6 billions DDK in 2000 - a little more than a doubling. The environmental taxes' part of the total taxes has increased from 7,5% in 1991 to 9,7% in 2000. In 2000 the energy taxes are 55%, the transportation taxes 38% and the pollution and resource taxes 7% of the environmental taxes. (EHS)

Warm weather conditions moderated the increase of power consumption in Finland in 2000

International Nuclear Information System (INIS)

Kangas, H.

2001-01-01

% and Olkiluoto 2 by 95.5%. The output of nuclear power in 2000 was 21.6 TWh. The amount of combined heat and power generation decreased slightly in 2000 compared to 1999. The decrease of power generation in district heating plants was about 0.4% lower than in 1999, being nearly 12.8 TWh in 2000. The decrease in industrial combined heat and power generation was nearly 1.3%. The output in 2000 was nearly 11.9 TWh. The share of combined heat and power generation in Finland of the total power generation in 2000 was 31%. Condensing power generation decreased by nearly 9% from the values of 1999. The condensing power output in 2000 was about 6.5 TWh. The retained import of electric power in 2000 was 11.9 TWh being about 7% higher than in 1999. The import from Sweden was 7.6 TWh. The import from Russia decreased by 13%. The power export in 2000 was 0.3 TWh. The share of retained import of electric power of the total power consumption in Finland was 15%. The number of customers increased in 2000 by 25 000, the total number of customers being now nearly 3 million. The average price of electric power (incl. taxes) decreased by 1.1%. The average price for households being 0.5 FIM/KWh and that of the medium-sized industry slightly over 0.3 FIM/KWh

Reliability and effect of sodium bicarbonate: buffering and 2000-m rowing performance.

Science.gov (United States)

Carr, Amelia J; Slater, Gary J; Gore, Christopher J; Dawson, Brian; Burke, Louise M

2012-06-01

The aim of this study was to determine the effect and reliability of acute and chronic sodium bicarbonate ingestion for 2000-m rowing ergometer performance (watts) and blood bicarbonate concentration [HCO3-]. In a crossover study, 7 well-trained rowers performed paired 2000-m rowing ergometer trials under 3 double-blinded conditions: (1) 0.3 grams per kilogram of body mass (g/kg BM) acute bicarbonate; (2) 0.5 g/kg BM daily chronic bicarbonate for 3 d; and (3) calcium carbonate placebo, in semi-counterbalanced order. For 2000-m performance and [HCO3-], we examined differences in effects between conditions via pairwise comparisons, with differences interpreted in relation to the likelihood of exceeding smallest worthwhile change thresholds for each variable. We also calculated the within-subject variation (percent typical error). There were only trivial differences in 2000-m performance between placebo (277 ± 60 W), acute bicarbonate (280 ± 65 W) and chronic bicarbonate (282 ± 65 W); however, [HCO3-] was substantially greater after acute bicarbonate, than with chronic loading and placebo. Typical error for 2000-m mean power was 2.1% (90% confidence interval 1.4 to 4.0%) for acute bicarbonate, 3.6% (2.5 to 7.0%) for chronic bicarbonate, and 1.6% (1.1 to 3.0%) for placebo. Postsupplementation [HCO3-] typical error was 7.3% (5.0 to 14.5%) for acute bicarbonate, 2.9% (2.0 to 5.7%) for chronic bicarbonate and 6.0% (1.4 to 11.9%) for placebo. Performance in 2000-m rowing ergometer trials may not substantially improve after acute or chronic bicarbonate loading. However, performances will be reliable with both acute and chronic bicarbonate loading protocols.

Validating year 2000 compliance

NARCIS (Netherlands)

A. van Deursen (Arie); P. Klint (Paul); M.P.A. Sellink

1997-01-01

textabstractValidating year 2000 compliance involves the assessment of the correctness and quality of a year 2000 conversion. This entails inspecting both the quality of the conversion emph{process followed, and of the emph{result obtained, i.e., the converted system. This document provides an

Thirteen years of oxcarbazepine exposures reported to US poison centers: 2000 to 2012.

Science.gov (United States)

Spiller, H A; Strauch, J; Essing-Spiller, S J; Burns, G

2016-10-01

Oxcarbazepine (OXC) is a 10-keto analogue of carbamazepine used in patients with partial and secondary generalized seizures. We evaluated ingestions of OXC reported to US poison centers for adverse effects from supratherapeutic doses and/or overdose. Retrospective analysis of data reported to National Poison Data System from single-substance OXC ingestions between January 2000 and December 2012. There were 18,867cases with a mean of 1451 exposures/year. The patients were predominantly adults with 5464 exposures in children effects were drowsiness (n = 4703, 25%), vomiting (n = 1559, 8%), tachycardia (n = 590, 3%), agitated (n = 342, 1.8%), hypotension (n = 178, 0.9%), electrolyte disturbance (n = 153, 0.8%), coma (n = 156, 0.8%), and seizures (n = 121, 0.6%). There were 176 patients with a major effect of which 31 involved were children and 1728 (9%) patients with moderate effects of which 300 involved were children. Five deaths were reported in adults. Intentional exposure (e.g. suicide) was the reason for exposure in 68% of patients with major effects and in all fatalities. Fifty-three percent of adults and 38% of children were managed in a health-care facility (HCF). HCF utilization levels remained consistent. Severe outcomes appear to be infrequent (<1%). Unlike other anticonvulsants OXC does not appear to be proconvulsant in overdose. Serious outcomes for OXC overdoses are unlikely in the pediatric patient. With only mild symptoms likely, observation at home may be appropriate for the majority of cases. In the adult population there appears to be few neurologic and cardiovascular complications even in the intentional exposure. © The Author(s) 2015.

Magnetic properties of Nd-deficient manganites Nd0.9-xCaxMnOy

International Nuclear Information System (INIS)

Troyanchuk, I.O.; Khomchenko, V.A.; Pastushonok, S.N.; Novitsky, O.A.; Pavlov, V.I.; Szymczak, H.

2006-01-01

X-ray diffraction and magnetic studies of neodymium deficient Nd 0.9-x Ca x MnO y (0= 0.9 MnO y samples have been prepared in the 2.85= g -orbitals of manganese ions. Composition with y=2.85 is antiferromagnet with T N =85K, whereas for more oxidized Nd 0.9 MnO y samples a coexistence of antiferromagnetic and ferromagnetic phases is suggested. Low-temperature magnetic phase transition which is accompanied by a negative magnetization appearance has been found in the Nd 0.9 MnO 2.90 compound. Magnetic behavior of Nd 0.9-x Ca x MnO y (0.1= 1-x Ca x MnO 3 series. Properties of the Nd 0.9-x Ca x MnO y (0=< x=<0.4) solid solutions are in agreement with a hypothesis according to which a part of Nd ions can be substituted by Mn ions

Hong Kong domestic health spending: financial years 1989/90 to 2008/09.

Science.gov (United States)

Tin, K Y K; Tsoi, P K O; Lee, Y H; Tsui, E L H; Lam, D W S; Chui, A W M; Lo, S V

2012-08-01

hospital services, there was an increasing trend over the period 1989/90 to 2008/09, likely as a result of policy directives to shift the emphasis from inpatient to day patient care. 1989/90 to 46.8% in 2002/03 and then dropped slightly to 43.1% in 2007/08, which was primarily driven by reduced expenditure of Hospital Authority. Compared with the preceding year, expenditure on hospitals increased by HK$2935 million in 2008/09, whereas the corresponding increase for providers of ambulatory health care was only HK$919 million. As a result, the hospital share rebounded a little to 44.0% of total health spending, whereas that of providers of ambulatory health care dropped to 29.1%. Without taking into account capital expenses (ie investment in medical facilities), public current expenditure on health amounted to HK$39 301 million (48.4% of total current expenditure) in 2008/09 with the remaining HK$41 885 million made up from private sources. Public current expenditure was mostly incurred at hospitals (76.1%), whereas private current expenditure was mostly incurred at providers of ambulatory health care (48.9%). Although both public and private spending were mostly expended on personal health care services and goods (91.8% of total current spending), the patterns of distribution among functional categories differed. Public expenditure was targeted at in-patient care (51.8%) and substantially less on out-patient care (25.1%). In comparison, private spending was mostly concentrated on out-patient care (42.6%), whereas in-patient care (23.4%) and medical goods outside the patient care setting (22.5%) accounted for the majority of the remaining share. Compared to the Organisation for Economic Cooperation and Development countries, Hong Kong has devoted a relatively low percentage of GDP to health care in the last decade. As a share of total spending, public funding (either general government revenue or social security funds) in Hong Kong was also lower than that in most economies

TMAP2000 Use

International Nuclear Information System (INIS)

Longhurst, G.R.; Merrill, B.J.; Jones, J.L.

2000-01-01

The TMAP Code was written in the late 1980s as a tool for safety analysis of systems involving tritium. Since then it was upgraded to TMAP4 and used in numerous applications including experiments supporting fusion safety predictions for advanced systems such as the International Thermonuclear Experimental Reactor (ITER), and estimates involving tritium production technologies. Its further upgrade to TMAP2000 was accomplished in response to several needs. TMAP and TMAP4 had the capacity to deal with only a single trap for diffusing gaseous species in solid structures. TMAP2000 has been revised to include up to three separate traps and to keep track separately of each of up to 10 diffusing species in each of the traps. A difficulty in the original code dealing with heteronuclear molecule formation such as HD and DT has been removed. Under equilibrium boundary conditions such as Sieverts' law, TMAP2000 generates heteronuclear molecular partial pressures when solubilities and partial pressures of the homonuclear molecular species and the equilibrium stoichiometry are provided. A further sophistication is the addition of non-diffusing surface species and surface binding energy dynamics options. Atoms such as oxygen or nitrogen on metal surfaces are sometimes important in molecule formation with diffusing hydrogen isotopes but do not themselves diffuse appreciably in the material. TMAP2000 will accommodate up to 30 such surface species, allowing the user to specify relationships between those surface concentrations and populations of gaseous species above the surfaces. Additionally, TMAP2000 allows the user to include a surface binding energy and an adsorption barrier energy and includes asymmetrical diffusion between the surface sites and regular diffusion sites in the bulk. All of the previously existing features for heat transfer, flows between enclosures, and chemical reactions within the enclosures have been retained, but the allowed problem size and complexity have

PREFACE: International Conference on Computing in High Energy and Nuclear Physics (CHEP'09)

Science.gov (United States)

Gruntorad, Jan; Lokajicek, Milos

2010-11-01

The 17th International Conference on Computing in High Energy and Nuclear Physics (CHEP) was held on 21-27 March 2009 in Prague, Czech Republic. CHEP is a major series of international conferences for physicists and computing professionals from the worldwide High Energy and Nuclear Physics community, Computer Science, and Information Technology. The CHEP conference provides an international forum to exchange information on computing experience and needs for the community, and to review recent, ongoing and future activities. Recent conferences were held in Victoria, Canada 2007, Mumbai, India in 2006, Interlaken, Switzerland in 2004, San Diego, USA in 2003, Beijing, China in 2001, Padua, Italy in 2000. The CHEP'09 conference had 600 attendees with a program that included plenary sessions of invited oral presentations, a number of parallel sessions comprising 200 oral and 300 poster presentations, and an industrial exhibition. We thanks all the presenters, for the excellent scientific content of their contributions to the conference. Conference tracks covered topics on Online Computing, Event Processing, Software Components, Tools and Databases, Hardware and Computing Fabrics, Grid Middleware and Networking Technologies, Distributed Processing and Analysis and Collaborative Tools. The conference included excursions to Prague and other Czech cities and castles and a banquet held at the Zofin palace in Prague. The next CHEP conference will be held in Taipei, Taiwan on 18-22 October 2010. We would like thank the Ministry of Education Youth and Sports of the Czech Republic and the EU ACEOLE project for the conference support, further to commercial sponsors, the International Advisory Committee, the Local Organizing Committee members representing the five collaborating Czech institutions Jan Gruntorad (co-chair), CESNET, z.s.p.o., Prague Andrej Kugler, Nuclear Physics Institute AS CR v.v.i., Rez Rupert Leitner, Charles University in Prague, Faculty of Mathematics and

FOREST AND WOODLAND COVER AND CHANGE IN COASTAL TANZANIA AND KENYA, 1990 TO 2000

DEFF Research Database (Denmark)

Tabor, Karyn; Burgess, Neil David; Mbilinyi, Boniface P.

2010-01-01

, and local knowledge. Analyses showed that around 6820 km2 of coastal forest habitat remained in ~2000 (2260 km2 in Kenya and 4560 km2 in Tanzania). In terms of change, a total of 424 km2 (6%) of forest was cleared between ~1990 and ~2000; 53 km2 in Kenya and 371 km2 in Tanzania. Rates of forest loss were 8...... times higher in unprotected areas than in protected sites such as Forest Reserves and National Parks. Key Biodiversity Areas had forest loss rates 2.5 times faster than protected areas while Alliance for Zero Extinction sites had the slowest rates of forest loss for the region. These baseline forest...

Vitreoscilla hemoglobin promotes Salecan production by Agrobacterium sp. ZX09.

Science.gov (United States)

Chen, Yun-mei; Xu, Hai-yang; Wang, Yang; Zhang, Jian-fa; Wang, Shi-ming

2014-11-01

Salecan is a novel exopolysaccharide produced by the strain Agrobacterium sp. ZX09, and it is composed of only glucose monomers. The unique chemical composition and excellent physicochemical properties make Salecan a promising material for applications in coagulation, lubrication, protection against acute liver injury, and alleviating constipation. In this study, we cloned the Vitreoscilla hemoglobin gene into a broad-host-range plasmid pCM158. Without antibiotic selection, there was negligible loss of the plasmid in the host Agrobacterium sp. ZX09 after one passage of cultivation. The expression of Vitreoscilla hemoglobin was demonstrated by carbon monoxide (CO) difference spectrum. The engineered strain Agrobacterium sp. ZX09 increased Salecan yield by 30%. The other physiological changes included its elevated respiration rate and cellular invertase activity.

Stability study of methotrexate in 0.9% sodium chloride injection and 5% dextrose injection with limit tests for impurities

DEFF Research Database (Denmark)

Nissen, Klaus; Bogedal Jorgensen, Lene; Lindegaard Berg, Dorthe

2017-01-01

Purpose. Results of an evaluation of the stability of methotrexate in 0.9% sodium chloride injection and 5% dextrose injection are presented. Methods. Methotrexate concentrated solution (100 mg/mL) was diluted to nominal concentrations of 0.2 and 20 mg/mL in infusion bags containing 0.9% sodium...... chloride injection or 5% dextrose injection. The filled bags were stored for 28 days at 25 °C and 60% relative humidity and protected from light. Samples were withdrawn for analysis on the day of preparation and after 3, 7, 14, 21, and 28 days. The test program included visual inspections, measurements...... in amounts of known and unknown degradation products were detected. In 5% dextrose injection, methotrexate at the higher concentration was stable for 28 days, with minor formation of degradation products; in the 0.2-mg/mL solution, however, methotrexate was stable for only 3 days. At later time points...

Analisis Risiko Pajanan PM2,5 di Udara Ambien Siang Hari terhadap Masyarakat di Kawasan Industri Semen

Directory of Open Access Journals (Sweden)

Randy Novirsa

2012-11-01

Full Text Available Salah satu dampak negatif industri pabrik semen terhadap kesehatan masyarakat adalah peningkatan risiko penyakit saluran pernapasan. Risiko tersebut banyak disebabkan oleh pajanan partikulat di udara, khususnya partikulat berukuran di bawah 2,5 mikron (PM2,5. Penelitian ini bertujuan menganalisis risiko pajanan PM2,5 di udara ambien siang hari pada masyarakat di kawasan industri semen. Risiko dihitung dengan metode Analisis Risiko Kesehatan Lingkungan berdasarkan metode Louvar yang menghasilkan nilai Intake pajanan yang diterima individu per hari berdasarkan nilai konsentrasi pajanan, pola aktivitas individu, dan nilai antropometri. Konsentrasi PM2,5 di lingkungan diukur pada 10 titik dengan radius 500 meter antartitik dari pusat pabrik, sedangkan pola aktivitas dan nilai antropometri diukur dengan menggunakan kuesioner pada 92 responden dewasa di kawasan pabrik. Hasil perhitungan risiko yang diterima seumur hidup (lifetime menunjukkan terdapat tiga area berisiko dengan nilai RQ > 1, yaitu Ring 2 (500 – 1.000 m, Ring 4 (1.500 – 2.000 m, dan Ring 5 (2.000 – 2.500 m. Daerah paling aman yang dapat dihuni oleh masyarakat di kawasan industri semen adalah di atas 2,5 km dari pusat industri dengan konsentrasi paling aman 0,028 mg/m3. Kata kunci: Industri semen, infeksi saluran pernapasan, partikulat PM2,5 Abstract One of the negative impacts of cement industry to public health is an increased risk of respiratory disease. These risks are caused by exposure to particulate matter in air, especially fine particulate matter which is smaller than 2,5 microns (PM2,5. This study aimed to analyze the risks of PM2,5 exposure in ambien air at noon on people around cement industry. Risk was calculated using Environmental Health Risk Analysis Method that generates value of individual exposure intake received per day. This value was generated based on the concentration of exposure, individual activity patterns, and anthropometric values. PM2,5 concentrations

Report about the agricultural situation in Austria 2000; Gruener Bericht 2000. Bericht ueber die Lage der oesterreichischen Landwirtschaft 2000

Energy Technology Data Exchange (ETDEWEB)

Poschacher, G; Panholzer, L; Hofer, O; Moravec, K; Fehrer, R; Brier, K [eds.

2001-07-01

In 2000 economic growth in Austria amounted to 3.2 %. The inflation rate rose from 0.6 % in 1999 to 2.3 % in 2000. Apart from the increase in crude oil price the rise in indirect taxes contributed as well to the upward trend of prices. According to Eurostat the unemployed rate went down to 3.7 %. According to the agricultural accounts agricultural incomes were rising again in 2000 for the first time since 1995 (+1.6 %). The final production of agriculture and forestry amounted to ATS 62.9 billion (+0.4 %, of which agriculture ATS 50.3 billion, and forestry ATS 12.6 billion). Whereas the yields in plant production decreased in particular due to the drought (-6.1 %), the gross yield from animal husbandry increased by 8.1 %. this rise is in particular due to the recovery of the pig market. According to the Austrian Institute of Economic Research (Wirtschafts-forschungsinstitut WIFO) direct payments rose compared to the year before by ATS 0.5 billion to ATS 17.8 billion. The share of agriculture and forestry in the GDP decreased to 1.3 %. According to WIFO the number of persons working full-time in the agricultural sector totalled 140,000 in 2000. The agricultural quota amounted to 4.0 %. In agricultural trade a rise was recorded again in exports (15.6 %) as well as in imports (14.7 %) in 2000 compared to the year 1999. Exports of agricultural goods totalled almost ATS 47 billion, of which two thirds were exports to EU member countries. Agricultural imports amounted to almost ATS 61 billion, of which three quarters came from EU member countries. The agricultural trade balance decreased to - ATS 14 billion. In 2000 the food industry was severely hi in particular by the current meat crises. European consumers organizations and associations call for the rethinking in the subsidisation policy and a promotion of organic farming. The core elements of the European foodstuffs model should be in particular security and safety, quality, origin, and diversity. In 2000 Austrian

First International Diagnosis Competition - DXC'09

Science.gov (United States)

Kurtoglu, tolga; Narasimhan, Sriram; Poll, Scott; Garcia, David; Kuhn, Lukas; deKleer, Johan; vanGemund, Arjan; Feldman, Alexander

2009-01-01

A framework to compare and evaluate diagnosis algorithms (DAs) has been created jointly by NASA Ames Research Center and PARC. In this paper, we present the first concrete implementation of this framework as a competition called DXC 09. The goal of this competition was to evaluate and compare DAs in a common platform and to determine a winner based on diagnosis results. 12 DAs (model-based and otherwise) competed in this first year of the competition in 3 tracks that included industrial and synthetic systems. Specifically, the participants provided algorithms that communicated with the run-time architecture to receive scenario data and return diagnostic results. These algorithms were run on extended scenario data sets (different from sample set) to compute a set of pre-defined metrics. A ranking scheme based on weighted metrics was used to declare winners. This paper presents the systems used in DXC 09, description of faults and data sets, a listing of participating DAs, the metrics and results computed from running the DAs, and a superficial analysis of the results.

Impacts of Stratospheric Sulfate Geoengineering on PM2.5

Science.gov (United States)

Robock, A.; Xia, L.; Tilmes, S.; Mills, M. J.; Richter, J.; Kravitz, B.; MacMartin, D.

2017-12-01

Particulate matter (PM) includes sulfate, nitrate, organic carbon, elemental carbon, soil dust, and sea salt. The first four components are mostly present near the ground as fine particulate matter with a diameter less than 2.5 µm (PM2.5), and these are of the most concern for human health. PM is efficiently scavenged by precipitation, which is its main atmospheric sink. Here we examine the impact of stratospheric climate engineering on this important pollutant and health risk, taking advantage of two sets of climate model simulations conducted at the National Center for Atmospheric Research. We use the full tropospheric and stratospheric chemistry version of the Community Earth System Model - Community Atmospheric Model 4 (CESM CAM4-chem) with a horizontal resolution of 0.9° x 1.25° lat-lon to simulate a stratospheric sulfate injection climate intervention of 8 Tg SO2 yr-1 combined with an RCP6.0 global warming forcing, the G4 Specified Stratospheric Aerosol (G4SSA) scenario. We also analyze the output from a 20-member ensemble of Community Earth System Model, version 1 with the Whole Atmosphere Community Climate Model as its atmospheric component (CESM1(WACCM)) simulations, also at 0.9° x 1.25° lat-lon resolution, with sulfur dioxide injection at 15°N, 15°S, 30°N, and 30°S varying in time to balance RCP8.5 forcing. While the CESM CAM4-chem model has full tropospheric and stratospheric chemistry, CESM1(WACCM) has an internally generated quasi-biennial oscillation and a comprehensive tropospheric and stratospheric sulfate aerosol treatment, but only stratospheric chemistry. For G4SSA, there are a global temperature reduction of 0.8 K and global averaged precipitation decrease of 3% relative to RCP6.0. The global averaged surface PM2.5 reduces about 1% compared with RCP6.0, mainly over Eurasian and East Asian regions in Northern Hemisphere winter. The PM2.5 concentration change is a combination of effects from tropospheric chemistry and precipitation

US EPA 2014 Fine Particulate Pollution (PM2.5) Season Review by City

Data.gov (United States)

U.S. Environmental Protection Agency — This web service contains the following layer: PM25Review35Cities_with2000to2014data. Full FGDC metadata records for each layer may be found by clicking the layer...

Barcelona - Talent Latent 09 / Ahto Sooaru

Index Scriptorium Estoniae

Sooaru, Ahto

2010-01-01

Fotonäitusest "Talent Latent 09" Barcelonas Arts Santa Monica kunstikeskuses. Loetletud näitusel eksponeeritud fotode autorid. Pikemalt Rafael Milach'i (sünd. 1978), Lucia Ganieva, Javier Marquerie Thomas'i (sünd. 1986), Amaury da Cunha (sünd. 1976) töödest. Lühidalt ka teistest näitustest Arts Santa Monica kunstikeskuses

Prompt $K_{S}^{0}$ production in $pp$ collisions at $\\sqrt{s}$ = 0.9 TeV

CERN Document Server

Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Agari, M; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Alfonsi, M; Alvarez Cartelle, P; Alves Jr, A.A; Amato, S; Amhis, Y; Amoraal, J; Anderson, J; Antunes Nobrega, R; Appleby, R; Aquines Gutierrez, O; Arefyev, A; Arrabito, L; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Bagaturia, Y; Bailey, D.S; Balagura, V; Baldini, W; Barber, G; Barham, C; Barlow, R.J; Barsuk, S; Basiladze, S; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Bellunato, T; Belous, K; Belyaev, I; Benayoun, M; Bencivenni, G; Bernet, R; Bernhard, R.P; Bettler, M-O; van Beuzekom, M; Bibby, J.H; Bifani, S; Bizzeti, A; Bjrnstad, P.M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bochin, B; Bonaccorsi, E; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bos, E; Bowcock, T.J.V; Bozzi, C; Brambach, T; van den Brand, J; Brarda, L; Bressieux, J; Brisbane, S; Britsch, M; Brook, N.H; Brown, H; Brusa, S; Buchler-Germann, A; Bursche, A; Buytaert, J; Cadeddu, S; Caicedo Carvajal, J.M; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Cameron, W; Camilleri, L; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carroll, J; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Chadaj, B; Charles, M; Charpentier, Ph; Cheng, J; Chiapolini, N; Chlopik, A; Christiansen, J; Ciambrone, P; Cid Vidal, X; Clark, P.J; Clarke, P.E.L; Clemencic, M; Cliff, H.V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Constantin, F; Conti, G; Contu, A; Cooke, P; Coombes, M; Corajod, B; Corti, G; Cowan, G.A; Currie, R; DAlmagne, B; DAmbrosio, C; DAntone, I; Da Silva, W; Dane, E; David, P; De Bonis, I; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J.M; De Paula, L; De Simone, P; Decamp, D; Decreuse, G; Degaudenzi, H; Deissenroth, M; Del Buono, L; Densham, C.J; Deplano, C; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Dima, M; Donleavy, S; Dornan, P; Dossett, D; Dovbnya, A; Dumps, R; Dupertuis, F; Dwyer, L; Dzhelyadin, R; Eames, C; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Eklund, L; d'Enterria, D; Esperante Pereira, D; Est`eve, L; Fanchini, E; Farber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Felici, G; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Flegel, W; Fontanelli, F; Forti, C; Forty, R; Fournier, C; Franek, B; Frank, M; Frei, C; Frosini, M; Fungueirino Pazos, J.L; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garrido, L; Gascon, D; Gaspar, C; Gaspar De Valenzuela Cue, A; Gassner, J; Gauvin, N; Gavillet, P; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gilitsky, Yu; Gligorov, V.V; Gobel, C; Golubkov, D; Golutvin, A; Gomes, A; Gong, G; Gong, H; Gordon, H; Grabalosa Gandara, M; Gracco, V; Graciani Diaz, R; Granado Cardoso, L.A; Grauges, E; Graziani, G; Grecu, A; Gregson, S; Guerrer, G; Gui, B; Gushchin, E; Guz, Yu; Guzik, Z; Gys, T; Haefeli, G; Haines, S.C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, P.F; He, J; Hennessy, K; Henrard, P; Hernando Morata, J.A; van Herwijnen, E; Hicheur, A; Hicks, E; Hilke, H.J; Hofmann, W; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R.S; Hutchcroft, D; Iacoangeli, F; Iakovenko, V; Iglesias Escudero, C; Ilgner, C; Imong, J; Jacobsson, R; Jahjah Hussein, M; Jamet, O; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; John, M; Johnson, D; Jones, C.R; Jost, B; Kapusta, F; Karbach, T.M; Kashchuk, A; Katvars, S; Keaveney, J; Kerzel, U; Ketel, T; Keune, A; Khalil, S; Khanji, B; Kim, Y.M; Knecht, M; Koblitz, S; Konoplyannikov, A; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kristic, R; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kudryashov, I; Kukulak, S; Kumar, R; Kvaratskheliya, T; La Thi, V.N; Lacarrere, D; Lai, A; Lambert, R.W; Lanfranchi, G; Langenbruch, C; Latham, T; Le Gac, R; Lees, J-P; Lef`evre, R; Leflat, A; Lefrancois, J; Lehner, F; Lenzi, M; Leroy, O; Lesiak, T; Li, L; Li, Y.Y; Li Gioi, L; Libby, J; Lieng, M; Lindner, R; Lindsey, S; Linn, C; Liu, B; Liu, G; Lochner, S; Lopes, J.H; Lopez Asamar, E; Lopez-March, N; Loveridge, P; Luisier, J; Mcharek, B; Machefert, F; Machikhiliyan, I.V; Maciuc, F; Maev, O; Magnin, J; Maier, A; Malde, S; Mamunur, R.M.D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Marki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martinez Santos, D; Massaferri, A; Mathe, Z; Matteuzzi, C; Matveev, V; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Mclean, C; Merk, M; Merkel, J; Merkin, M; Messi, R; Metlica, F.C.D; Miglioranzi, S; Minard, M-N; Moine, G; Monteil, S; Moran, D; Morant, J; Morris, J.V; Moscicki, J; Mountain, R; Mous, I; Muheim, F; Muresan, R; Murtas, F; Muryn, B; Musy, M; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nardulli, J; Nawrot, A; Nedos, M; Needham, M; Neufeld, N; Neustroev, P; Nicol, M; Nicolas, L; Nies, S; Niess, V; Nikitin, N; Noor, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Ostankov, A; Palacios, J; Palutan, M; Panman, J; Papadelis, A; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C.J; Passaleva, G; Patel, G.D; Patel, M; Paterson, S.K; Patrick, G.N; Patrignani, C; Pauna, E; Pauna (Chiojdeanu), C; Pavel (Nicorescu), C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D.L; Perez Trigo, E; Perez-Calero Yzquierdo, A; Perret, P; Pessina, G; Petrella, A; Petrolini, A; Picatoste Olloqui, E; Pie Valls, B; Piedigrossi, D; Pietrzyk, B; Pinci, D; Playfer, S; Plo Casasus, M; Poli-Lener, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Poss, S; Potterat, C; Powell, A; Pozzi, S; du Pree, T; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J.H; Rakotomiaramanana, B; Raniuk, I; Raven, G; Redford, S; Reece, W; dos Reis, A.C; Ricciardi, S; Riera, J; Rinnert, K; Roa Romero, D.A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Cobo, C; Rodriguez Perez, P; Rogers, G.J; Romanovsky, V; Rondan Sanabria, E; Rosello, M; Rospabe, G; Rouvinet, J; Roy, L; Ruf, T; Ruiz, H; Rummel, C; Rusinov, V; Sabatino, G; Saborido Silva, J.J; Sagidova, N; Sail, P; Saitta, B; Sakhelashvili, T; Salzmann, C; Sambade Varela, A; Sannino, M; Santacesaria, R; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savidge, T; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schmelling, M; Schmidt, B; Schneider, O; Schneider, T; Schopper, A; Schune, M-H; Schwemmer, R; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Serra, N; Serrano, J; Shao, B; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Shires, A; Sigurdsson, S; Simioni, E; Skottowe, H.P; Skwarnicki, T; Smale, N; Smith, A; Smith, A.C; Smith, N.A; Sobczak, K; Soler, F.J.P; Solomin, A; Somogy, P; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spiridenkov, E; Spradlin, P; Srednicki, A; Stagni, F; Stahl, S; Steiner, S; Steinkamp, O; Stenyakin, O; Stoica, S; Stone, S; Storaci, B; Straumann, U; Styles, N; Szczekowski, M; Szczypka, P; Szumlak, T; TJampens, S; Tarkovskiy, E; Teodorescu, E; Terrier, H; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Topp-Joergensen, S; Tran, M.T; Traynor, S; Trunk, U; Tsaregorodtsev, A; Tuning, N; Ukleja, A; Ullaland, O; Uwer, U; Vagnoni, V; Valenti, G; Van Lysebetten, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J.J; Veltri, M; Vervink, K; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, An; Voss, H; Wacker, K; Wandernoth, S; Wang, J; Ward, D.R; Webber, A.D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M.P; Williams, M; Wilson, F.F; Wishahi, J; Witek, M; Witzeling, W; Woodward, M.L; Wotton, S.A; Wyllie, K; Xie, Y; Xing, F; Yang, Z; Ybeles Smit, G; Young, R; Yushchenko, O; Zeng, M; Zhang, L; Zhang, Y; Zhelezov, A; Zverev, E

2010-01-01

The production of K_short mesons in pp collisions at a centre-of-mass energy of 0.9 TeV is studied with the LHCb detector at the Large Hadron Collider. The luminosity of the analysed sample is determined using a novel technique, involving measurements of the beam currents, sizes and positions, and is found to be 6.8 +/- 1.0 microbarn^-1. The differential prompt K_short production cross-section is measured as a function of the K_short transverse momentum and rapidity in the region 0 < pT < 1.6 GeV/c and 2.5 < y < 4.0. The data are found to be in reasonable agreement with previous measurements and generator expectations.

Stockholm, veebruar 2000 / Mati Laos

Index Scriptorium Estoniae

Laos, Mati

2000-01-01

9.-13. veebruarini 2000 Stockholmis toimunud Rootsi rahvusvahelisest mööblimessist ja valgustimessist Lightning 2000, kus oli ka Estoplasti valgusti "Valguse pooltoonid" (koostöös Hollandi ja Venemaa firmaga)

New record in import of electric power in 2000

International Nuclear Information System (INIS)

Anon.

2001-01-01

forest industry is 26.3 TWh, that of metal industry 7.1 TWh. Chemical industry consumed 5.9 TWh of electric power, and other industrial sectors 3.9 TWh. the industrial production in Finland increased by 11.5%. The power consumption of pulp and paper industry is estimated to grow, if the degrees of utilisation of the industry remain high, by 2.5 % in 2001. Metals industry and chemical industry are estimated to use about 1% more electricity in 2001 than in 2000, and the other industrial sectors about 2%. The average price of electric power decreased by 1.1% in 2000. The price for households was in the beginning of 2001 about 0.5 FIM/kWh, that for the medium-sized industry 0.302 FIM/kWh. The power transmission fees have decreased about 0.1% during the last year. The electricity taxes remained the same in 2000 as in 1999. The decrease in electricity prices has reduced the average electricity costs of households by 150-170 FIM and 500-550 FIM for electrically heated households

Documenting 15 Years (2000-2015) of SOPHE Achievements.

Science.gov (United States)

Alber, Julia M; Bernhardt, Jay M; Stellefson, Michael; Paige, Samantha R

2017-04-01

For over six decades, the Society for Public Health Education (SOPHE) has been a leading professional organization for the field of health education (HE). This historical research extends the work of Cissell and Bloom by investigating the recent history of SOPHE. The aims of this historical study were to (1) identify key SOPHE and HE events from 2000 to 2015, (2) describe key contributions of SOPHE to the HE field during this time period, and (3) identify potential future directions for SOPHE. Johnson and Christensen's five steps for historical research were followed to conduct an eDelphi study and one-on-one interviews. During the three-round eDelphi study, SOPHE officers ( n = 16) and senior staff ( n = 5), who served between 2000 and 2015, identified significant SOPHE's leaders and rated the importance of SOPHE's recent events. Key leaders ( n = 25) participated in semistructured interviews to describe their involvement in SOPHE, specific SOPHE activities, and future directions for SOPHE. Brief, structured intercept interviews were also conducted with student ( n = 10) and professional SOPHE members ( n = 11). Data collected during the eDelphi study were analyzed to determine central tendency statistics and percent agreement on each event evaluated in the second- and third-round surveys. Qualitative interview data were analyzed with NVivo using thematic analysis. Data from the eDelphi study revealed 29 SOPHE and 17 HE events that occurred between 2000 and 2015 as being "important" or "very important." Results from the thematic analysis revealed several themes in three areas: SOPHE accomplishments, benefits of SOPHE membership, and possible future directions for SOPHE to explore.

Prevention of mother-to-child transmission of human immunodeficiency virus among pregnant women using injecting drugs in Ukraine, 2000–10

Science.gov (United States)

Thorne, Claire; Semenenko, Igor; Malyuta, Ruslan

2012-01-01

Aims To compare clinical status, mother-to-child transmission (MTCT) rates, use of prevention of (PMTCT) interventions and pregnancy outcomes between HIV-infected injecting drug users (IDUs) and non-IDUs. Design and setting Prospective cohort study conducted in seven human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) Centres in Ukraine, 2000–10. Participants Pregnant HIV-infected women, identified before/during pregnancy or intrapartum, and their live-born infants (n = 6200); 1028 women followed post-partum. Measurements Maternal and delivery characteristics, PMTCT prophylaxis, MTCT rates, preterm delivery (PTD) and low birth weight (LBW). Findings Of 6200 women, 1111 (18%) reported current/previous IDU. The proportion of IDUs diagnosed with HIV before conception increased from 31% in 2000/01 to 60% in 2008/09 (P Ukraine have worse clinical status, poorer access to prevention of mother-to-child transmission prophylaxis and highly active antiretroviral therapy, more adverse pregnancy outcomes and higher risk of mother-to-child transmission than non-injecting drug user women. PMID:21819473

Energy situation. August 2000; Conjoncture energetique. Aout 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-09-01

This report makes a statement of the French energy consumption, demand, import and export since January 1998 and up to August 2000. Details are given separately for primary energy, solid mineral fuels, petroleum products, natural gas and electric power. (J.S.)

Technical Report 2000

International Nuclear Information System (INIS)

2001-01-01

The technical memory 2000 of the Nuclear Regulatory Authority (NRA) of the Argentine Republic, compile the papers published in the subject on radiation protection and nuclear safety, safeguards and physical protection, and presented in congress or meetings of these specialities by personnel of the mentioned institution during 2000. In this edition the documents are presented on: Nuclear safety; Radiobiology; Occupational doses; Radiochemical; Environmental studies; Emergency plans; Radiation accidents; and International safeguards. Some of them are realized by agreements between the Nuclear Regulatory Authority of Argentina, universities and other national and international organizations

Bookshelf 2000

Directory of Open Access Journals (Sweden)

Richard Price

2001-01-01

Full Text Available [First paragraph] Another year, another monumental stack of new books with Caribbeanist interest of one sort or another. NWIG reviewers have been contributing full essays on more than seventy such books each year, but that still leaves well over one hundred others deserving of mention in this residual wrap-up of the 2000 season. We are deeply grateful to those scholars who have taken the time to provide reviews. And we are pleased to announce that the 2000 edition of the Caribbeanist Hall of Shame (created for scholars who commit themselves to reviews but then neither provide them nor relinquish the book so someone else can take on the task has shrunk from a membership of 15 (in 1993, its inaugural year to just two (identified, as has become our custom, by first and last initials. Despite our gentle reminders, J—e F—s failed to review The Dominican Republic and the United States: From Imperialism to Transnationalism, edited by G. Pope Atkins & Larman C. Wilson (Athens: University of Georgia Press, 1998, paper, US$ 20.00 and B—a S—i never came through with a review of Constructing a Colonial People: Puerto Rico and the United States, 1898-1932, by Pedro A. Caban (Boulder CO: Westview Press, 1999, cloth US$ 60.00.

F00467: NOS Hydrographic Survey , Approaches to Delaware Bay, Delaware and New Jersey, 2000-09-09

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The National Oceanic and Atmospheric Administration (NOAA) has the statutory mandate to collect hydrographic data in support of nautical chart compilation for safe...

TIGER 2000

Data.gov (United States)

Kansas Data Access and Support Center — As suggested by the GIS Technical Advisory Committees DASC subcommittee, the DASC staff has imported and converted the U.S. Bureau of Census 2000 TIGER Line files...

Registro de pacientes con accidente cerebro vascular en un hospital público del Perú, 2000-2009 Registry of patients with stroke stated in a public hospital of Peru, 2000-2009

Directory of Open Access Journals (Sweden)

Ana Castañeda-Guarderas

2011-12-01

Full Text Available Estudio que describe las características de los registros de pacientes con accidente cerebro vascular (ACV, como diagnóstico causante de hospitalización en el Hospital Nacional Cayetano Heredia entre los años 2000 - 2009. Se obtuvieron 2225 registros de pacientes mayores de 18 años, con ACV. De acuerdo con la CIE-10, 1071 tenían el diagnóstico de ACV isquémico, 554 ACV hemorrágico, 183 hemorragia subaracnoidea, 49 isquémico hemorrágico, 10 crisis isquémica transitorias y en 358 no fue posible especificar el tipo. Se registraron 352 muertes (19,6 %, la mayoría en los primeros tres días. La razón hombre/mujer fue 1,09; la edad promedio 64,1 ± 17,2 años y la mediana del tiempo de hospitalización fue de nueve días. Las condiciones asociadas más frecuentes fueron hipertensión arterial, fibrilación auricular y diabetes mellitus tipo 2. La mortalidad descrita es la más alta informada en nuestro medio, es constante en todos los grupos de edad y mayor en mujeres.We performed a descriptive study taking on account the characteristics of the registries of the patients hospitalized at the Hospital Nacional Cayetano Heredia between the years 2000 and 2009 with stroke as hospitalization diagnosis. 2225 records were obtained from patients older than 18, with stroke. According to ICD-10, 1071 had diagnosis of ischemic stroke, 554 were hemorrhagic, 183 were subarachnoid hemorrhage, 49 were ischemic plus hemorrhagic, 10 were transient ischemic attack (TIA and in 358 we were unable to specify the type of stroke. 352 deaths were recorded (19.6 %, most of them during the first 3 days. The male / female ratio was 1.09, the mean age 64.1 ± 17.2 years and the median length of hospital stay was 9 days. The most common associated conditions were high blood pressure, atrial fibrillation and type 2 diabetes mellitus. The mortality found is the highest reported in our country, constant in all age groups and higher in women.

Mires of the Šumava Mountains: 13,000-years of their development and present-day biodiversity

Czech Academy of Sciences Publication Activity Database

Svobodová, Helena; Papáčková, Lenka

2000-01-01

Roč. 11, - (2000), s. 108-111 ISSN 1210-9606. [International conference PAGES on past global changes "Upper Pleistocene and Holocene climatic variations". Praha, 06.09.2000-09.09.2000] R&D Projects: GA ČR GA206/99/1411; GA AV ČR IAA6005603; GA AV ČR KSK2017602 Subject RIV: EF - Botanics

Learning power point 2000 easily

Energy Technology Data Exchange (ETDEWEB)

Mon, In Su; Je, Jung Suk

2000-05-15

This book introduces power point 2000, which gives descriptions what power point is, what we can do with power point 2000, is it possible to install power point 2000 in my computer? Let's run power point, basic of power point such as new presentation, writing letter, using text box, changing font size, color and shape, catching power user, insertion of word art and creating of new file. It also deals with figure, chart, graph, making multimedia file, presentation, know-how of power point for teachers and company workers.

Impact of Three Doses of Vitamin D3 on Serum 25(OH)D Deficiency and Insufficiency in At-Risk Schoolchildren.

Science.gov (United States)

Sacheck, Jennifer M; Van Rompay, Maria I; Chomitz, Virginia R; Economos, Christina D; Eliasziw, Misha; Goodman, Elizabeth; Gordon, Catherine M; Holick, Michael F

2017-12-01

We investigated the daily dose of vitamin D needed to achieve serum 25-hydroxyvitamin D [25(OH)D] sufficiency among schoolchildren at risk for deficiency. The Daily D Health Study was a randomized double-blind vitamin D supplementation trial among racially/ethnically diverse schoolchildren (n = 685) in the northeastern United States. Children were supplemented with vitamin D3 at 600, 1000, or 2000 IU/d for 6 months. Measurements included serum 25(OH)D at baseline (October to December), 3 months (January to March), 6 months (April to June), and 12 months (6 months after supplementation). At baseline, mean ± standard deviation serum 25(OH)D level was 22.0 ± 6.8 ng/mL, with 5.5% severely vitamin D deficient (D were found among black (17.9 ± 6.7 ng/mL) and Asian children (18.9 ± 4.8 ng/mL), with no baseline differences by weight status. Serum 25(OH)D increased over 6 months in all three dose groups. The 2000 IU/d group achieved a higher mean serum 25(OH)D level than the other two dose groups (33.1 vs 26.3 and 27.5 ng/mL; P D at 12 months. Children at risk for vitamin D deficiency benefited from daily sustained supplementation of 2000 IU/d compared with lower doses closer to the current recommended daily allowance for vitamin D intake. This benefit occurred over the winter months, when serum 25(OH)D level tend to fall. Copyright © 2017 Endocrine Society

Intraurban and Longitudinal Variability of Classical Pollutants in Kraków, Poland, 2000–2010

Directory of Open Access Journals (Sweden)

Hyunok Choi

2015-05-01

Full Text Available In spite of a dramatic decrease in anthropogenic emissions, ambient concentrations of major pollutants have not changed within many urban locations. To clarify the relationship between ambient air quality trend and the population exposures, we compared the intraurban versus temporal variability of the collocated measurements of five major air pollutants including particulate matter (PM with an aerodynamic diameter <10 µm (PM10, < 2.5 µm (PM2.5, tropospheric ozone (O3, sulfur dioxide (SO2, and nitrogen dioxide (NO2, in Kraków, Poland, during the 2000-2010 period. Strong seasonal trends and overall absence of spatial heterogeneity in PM10 and PM2.5, except in the traffic monitoring site, were observed across the monitoring network. The range of median PM2.5 concentrations during winter (54–64 µg/m3 was 3- to 4-times higher than the summer medians (15–26 µg/m3 across the sites during 2009-2010. Furthermore, large proportion of PM10 appears to be comprised of PM2.5 (PM2.5/PM10 concentration ratios range, 0.5–0.7. At each monitoring site, the Pearson’s correlation coefficients between PM2.5 and PM10 ranged between 0.944 and 0.963, suggesting a health-relevance of PM10 monitoring. One ln-unit increase in PM10 was associated with 92%–100% increase in PM2.5 concentrations in the same location. While PM10 did not demonstrate a clear temporal trend, SO2 concentrations steadily declined by 40% during the 2000–2010 period. Summertime median NO2 concentration was acutely elevated ‎(70 mg/m3 vs. 22 mg/m3 at the traffic oriented site compared to the city’s central monitoring site. The traffic and the industrial sites were associated with highest number of days during which 24-hour mean PM10 and PM2.5 concentrations exceeded the European Union standard. Steadily growing contributions by vehicular emissions appear to be associated with the absence of clear trend in PM10. Current practices of air quality control within Kraków may not be

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

2007-01-01

textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

Invasive Mechanical Ventilation in California Over 2000-2009: Implications for Emergency Medicine

Directory of Open Access Journals (Sweden)

Seshadri C. Mudumbai

2015-10-01

Full Text Available Introduction: Patients who require invasive mechanical ventilation (IMV often represent a sequence of care between the emergency department (ED and intensive care unit (ICU. Despite being the most populous state, little information exists to define patterns of IMV use within the state of California. Methods: We examined data from the masked Patient Discharge Database of California’s Office of Statewide Health Planning and Development from 2000-2009. Adult patients who received IMV during their stay were identified using the International Classification of Diseases 9th Revision and Clinical Modification procedure codes (96.70, 96.71, 96.72. Patients were divided into age strata (18-34yr, 35-64yr, and >65yr. Using descriptive statistics and regression analyses, for IMV discharges during the study period, we quantified the number of ED vs. non-ED based admissions; changes in patient characteristics and clinical outcome; evaluated the marginal costs for IMV; determined predictors for prolonged acute mechanical ventilation (PAMV, i.e. IMV>96hr; and projected the number of IMV discharges and ED-based admissions by year 2020. Results: There were 696,634 IMV discharges available for analysis. From 2000–2009, IMV discharges increased by 2.8%/year: n=60,933 (293/100,000 persons in 2000 to n=79,868 (328/100,000 persons in 2009. While ED-based admissions grew by 3.8%/year, non-ED-based admissions remained stable (0%. During 2000-2009, fastest growth was noted for 1 the 35–64 year age strata; 2 Hispanics; 3 patients with non-Medicare public insurance; and 4 patients requiring PAMV. Average total patient cost-adjusted charges per hospital discharge increased by 29% from 2000 (from $42,528 to $60,215 in 2014 dollars along with increases in the number of patients discharged to home and skilled nursing facilities. Higher marginal costs were noted for younger patients (ages 18-34yr, non-whites, and publicly insured patients. Some of the strongest predictors

W00114: NOS Hydrographic Survey , Outside Source Data Surveys Conducted in 2000, 2000-09-29

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The National Oceanic and Atmospheric Administration (NOAA) has the statutory mandate to collect hydrographic data in support of nautical chart compilation for safe...

W00118: NOS Hydrographic Survey , Outside Source Data Surveys Conducted in 2000, 2000-09-29

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The National Oceanic and Atmospheric Administration (NOAA) has the statutory mandate to collect hydrographic data in support of nautical chart compilation for safe...

W00117: NOS Hydrographic Survey , Outside Source Data Surveys Conducted in 2000, 2000-09-29

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The National Oceanic and Atmospheric Administration (NOAA) has the statutory mandate to collect hydrographic data in support of nautical chart compilation for safe...

W00115: NOS Hydrographic Survey , Outside Source Data Surveys Conducted in 2000, 2000-09-29

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The National Oceanic and Atmospheric Administration (NOAA) has the statutory mandate to collect hydrographic data in support of nautical chart compilation for safe...

W00116: NOS Hydrographic Survey , Outside Source Data Surveys Conducted in 2000, 2000-09-29

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The National Oceanic and Atmospheric Administration (NOAA) has the statutory mandate to collect hydrographic data in support of nautical chart compilation for safe...

Synthesis of Titania Particles by Vapour-Phase Decompositi on of Titanium Tetraisopropoxide

Czech Academy of Sciences Publication Activity Database

Moravec, Pavel; Smolík, Jiří; Levdansky, V.V.

2000-01-01

Roč. 31, Supp. 1 (2000), s. S927-S928 ISSN 0021-8502. [European Aerosol Conference 2000. Dublin, 03.09.2000-08.09.2000] R&D Projects: GA AV ČR IAA4072807 Institutional research plan: CEZ:AV0Z4072921 Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.071, year: 2000

National Wood-fuel Programme 2000-2006. Activity Report 2000-2006

International Nuclear Information System (INIS)

2008-01-01

When ADEME launched its Wood-fuel programme throughout all of France in late 1999, its aim was to guide this resource supply chain to maturity and stable development in all user sectors: domestic, multi-family housing, commercial/institutional and industrial applications. To this end the Wood-fuel Programme 2000-2006 was assigned objectives and endowed with significant financial means for studies and coordination in order to support and carry out general-interest projects, piloted by ADEME. The stated goal was to replace fossil fuels, avoid carbon emissions and establish quality assurance standards for household firewood and wood-fired devices. This report presents: 1 - the Wood Energy stakes for the environment, for employment, and for the economy, the biomass energy net benefits; 2 - the Wood Energy key figures: Production and consumption, Single-family homes and wood heating, Breakdown of types of devices used, Sales of wood-fired devices, Number of housing/institutional boilers in use, Number of industrial boilers in use; 3 - the Wood Energy objectives: Domestic heating, Industrial boiler plants, District heating for housing/institutional/commercial uses; 4 - the Wood Energy program operation: Program coordination by ADEME, Partnerships and State-Region planning agreements, 2000-2006 funding system (modified in 2004) and Other financial instruments; 5 - the 2000-2006 assessment: Main results, Conclusions and recommendations, Evaluation contributions: five key points, Evaluation of employment in the solid biofuels supply chain, Supply for community, institutional and commercial boilers; 6 - Information and communication: Initiatives supported or accompanied by ADEME between 2000 and 2004, Publications supported by ADEME. In appendix: fuels and energy content, regional assessments, national research program on bio-energies - PNRB 2006 (Review and stakes, PNRB results in 2006), wood heating R and D, studies funded by ADEME, 2006 ADEME's correspondents, glossary

IFP. Annual report 2000; IFP. Rapport annuel 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

This annual report presents the highlights of the year 2000 activities of the Institut Francais du Petrole (IFP): petroleum exploration, drilling and production, refining and petrochemistry, automotive engines and cogeneration turbines, natural gas technologies, environmental research, training activity, industrial partnerships, industrialization of processes, ISIS group. (J.S.)

The impact of China's vehicle emissions on regional air quality in 2000 and 2020: a scenario analysis

Directory of Open Access Journals (Sweden)

E. Saikawa

2011-09-01

Full Text Available The number of vehicles in China has been increasing rapidly. We evaluate the impact of current and possible future vehicle emissions from China on Asian air quality. We modify the Regional Emission Inventory in Asia (REAS for China's road transport sector in 2000 using updated Chinese data for the number of vehicles, annual mileage, and emission factors. We develop two scenarios for 2020: a scenario where emission factors remain the same as they were in 2000 (No-Policy, NoPol, and a scenario where Euro 3 vehicle emission standards are applied to all vehicles (except motorcycles and rural vehicles. The Euro 3 scenario is an approximation of what may be the case in 2020 as, starting in 2008, all new vehicles in China (except motorcycles were required to meet the Euro 3 emission standards. Using the Weather Research and Forecasting model coupled with Chemistry (WRF/Chem, we examine the regional air quality response to China's vehicle emissions in 2000 and in 2020 for the NoPol and Euro 3 scenarios. We evaluate the 2000 model results with observations in Japan, China, Korea, and Russia. Under NoPol in 2020, emissions of carbon monoxide (CO, nitrogen oxides (NO_x, non-methane volatile organic compounds (NMVOCs, black carbon (BC, and organic carbon (OC from China's vehicles more than double compared to the 2000 baseline. If all vehicles meet the Euro 3 regulations in 2020, however, these emissions are reduced by more than 50% relative to NoPol. The implementation of stringent vehicle emission standards leads to a large, simultaneous reduction of the surface ozone (O₃ mixing ratios and particulate matter (PM_2.5 concentrations. In the Euro 3 scenario, surface O₃ is reduced by more than 10 ppbv and surface PM_2.5 is reduced by more than 10 μg m⁻³ relative to NoPol in Northeast China in all seasons. In spring, surface O₃ mixing ratios and PM_2.5 concentrations in

75 FR 70090 - Special Conditions: Bombardier Inc. Model CL-600-2E25 Airplane, Operation Without Normal...

Science.gov (United States)

2010-11-17

... Performance Credit for Use of Automatic Power Reserve (APR), No. 25-167-SC, dated October 24, 2000 (same as CL...(b)(4), Lack of On/Off Switch for Automatic Takeoff Thrust Control System (ATTCS). 7. Section 25.841... can continue through safe flight and landing (including steering and braking on ground for airplanes...

Unigene BLAST: CBRC-GGAL-09-0012 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GGAL-09-0012 gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken liver cDNA library Gallus gallus cDNA clone pnl...1s.pk003.f8 5' similar to histidine-rich glycoprotein - bovine (fragments), mRNA sequence /clone=pnl

激光散射法测定磺胺嘧啶银原料粒度分布%Measurement of Particle Size Distribution of Sulfadiazine Silver by Laser Light Scattering Method

Institute of Scientific and Technical Information of China (English)

李洁; 李婷婷

2015-01-01

目的：建立激光散射法测定磺胺嘧啶银原料粒度分布。方法：采用Malvern Mastersizer 2000激光粒度分析仪；Hydro 2000 MU湿法进样器；泵速：2000 rpm ，样品折射率：1.679，颗粒吸收率：0.01，分散介质折射率：1.33，测量次数：5次；样品与背景测量时间：10 s，遮光度：10%～20%。结果：7批原料d（0.5）均小于10μm，RSD均小于6%，d（0.1）和d（0.9）均小于3.5μm和25μm， RSD均小于10%，符合《中国药典》相关要求。结论：所建立方法经考察，可用于磺胺嘧啶银原料的粒度测定。%Objective: To establish a laser light scattering method for the determination of particle size distribution for sulfadiazine silver. Methods:The Malvern Mastersizer 2000 laser size analyzer and the Hydro 2000 MU wet autosampler were used. The conditions of determination were as follows: the pump speed of 2000 rpm,the sample RI of 1.679, the sample absorption of 0.01,the measurement times of 5 times, the measurement time of background and sample of 10 s,and the obscuration of 10%-20%. Results:RSD of d(0.5) was lower than 6%,and that of d(0.1) and d(0.9) was lower than 10%. All the d(0.1) of 7 batches of sulfadiazine silver was less than 3.5μm, the d(0.5) was less than 10μm and the d(0.9) was less than 25μm which were all in line with the requirements of China Pharmacopeia. Conclusion:The method was simple, accurate and producible,which was suitable for the particle size control of sulfadiazine silver.

ICU-treated influenza A(H1N1 pdm09 infections more severe post pandemic than during 2009 pandemic: a retrospective analysis

Directory of Open Access Journals (Sweden)

Pekka Ylipalosaari

2017-11-01

Full Text Available Abstract Background We compared in a single mixed intensive care unit (ICU patients with influenza A(H1N1 pdm09 between pandemic and postpandemic periods. Methods Retrospective analysis of prospectively collected data in 2009–2016. Data are expressed as median (25th–75th percentile or number (percentile. Results Seventy-six influenza A(H1N1 pdm09 patients were admitted to the ICU: 16 during the pandemic period and 60 during the postpandemic period. Postpandemic patients were significantly older (60 years vs. 43 years, p < 0.001 and less likely to have epilepsy or other neurological diseases compared with pandemic patients (5 [8.3%] vs. 6 [38%], respectively; p = 0.009. Postpandemic patients were more likely than pandemic patients to have cardiovascular disease (24 [40%] vs. 1 [6%], respectively; p = 0.015, and they had higher scores on APACHE II (17 [13–22] vs. 14 [10–17], p = 0.002 and SAPS II (40 [31–51] vs. 31 [25–35], p = 0.002 upon admission to the ICU. Postpandemic patients had higher maximal SOFA score (9 [5–12] vs. 5 [4–9], respectively; p = 0.03 during their ICU stay. Postpandemic patients had more often septic shock (40 [66.7%] vs. 8 [50.0%], p = 0.042, and longer median hospital stays (15.0 vs. 8.0 days, respectively; p = 0.006. During 2015–2016, only 18% of the ICU- treated patients had received seasonal influenza vaccination. Conclusions Postpandemic ICU-treated A(H1N1 pdm09 influenza patients were older and developed more often septic shock and had longer hospital stays than influenza patients during the 2009 pandemic.

The impact of a 50% reduction of solid waste disposal in Canada on methane emissions from landfills in 2000

International Nuclear Information System (INIS)

Patenaude, L.M.F.; Owen, G.T.; Barclay, J.A.

1993-01-01

Canada's Green Plan established a goal of 50% reduction in municipal solid waste (MSW) disposal between 1988 and the year 2000. Canada has also committed to stabilizing greenhouse gas emissions at 1990 levels by 2000. MSW landfills are targeted since they account for a significant portion of anthropogenic methane emissions. Current composition and quantities of MSW were estimated. Using five scenarios for achieving a 50% reduction of waste disposed, the quantities and composition of waste managed were estimated through to the year 2000. A first-order decay model was used to estimate methane emissions from landfills of each scenario by varying the methane generation potential (L o ) based on the amount of biodegradable carbon in the MSW stream. Despite the overall reduction in waste, methane emissions are still projected on increase between 1990 and 2000 for scenarios with 25 to 45% of waste going to landfill in 2000. The estimated increases in methane emissions range from 2% for the high composting scenario to 16% for the high landfill scenario. In general, emissions peak during the 1990's and are decreasing by 2000. The projected increase in emissions is due to the 65--75% contribution of MSW landfilled before 1990. In conclusion, a significant reduction in methane emissions from landfills by 2000 will require methane recovery systems in addition to MSW reduction initiatives

Development of new exploration tools for seabed mineral resources - Result of R/V YOKOSUKA research cruise YK09-09 -

Science.gov (United States)

Harada, M.; Sayanagi, K.; Kasaya, T.; Sawa, T.; Goto, T.; Tada, N.; Ichihara, H.; Asada, M.; Nakajima, T.; Isezaki, N.

2009-12-01

Detailed information on subsurface structure under seafloor is necessary for the estimation of seabed resources such as the hydrothermal deposit and methane hydrate. Although advantages of geophysical exploration near seafloor are expected for the seabed resource survey, efficient method has not been well-established. The authors started a project to develop exploration tools for seabed resources under the financial support of MEXT-Japan. We carry out research and development mainly regarding measurement of the magnetic field with high-resolution and high-sampling rate electric exploration devices with accurately controlled active source signals. Developed tools will be mounted underwater platforms such as deep-tow system, ROV (remotely operated vehicle), and AUV (autonomous undersea vehicle). We carried out the research cruise (vessel: JAMSTEC R/V YOKOSUKA YK09-09, cruise period: 19-29 July 2009, area surveyed: Kumano-nada, off Kii Peninsula, Japan) to investigate the performance of developed equipments for magnetic exploration. We mounted an Overhauser and two flux-gate magnetometers on the deep-tow and the AUV URASHIMA. To inspect the efficiency of equipments, it is better to measure the magnetic anomaly which is caused by known magnetic source. Therefore, we made a magnetic target which is consisted of 50 neodymium magnets. Before the navigation, the magnetic target was put under water and its position was measured by the acoustic method. The depth of target is about 2,050 meters, and the measurement was performed in the circle of a radius of about 300 meters. The vehicles were navigated at heights of 25 meters for AUV, and about 15 meters for deep-tow. Each of underwater navigation was practiced for two times. Both performances were carried out successfully, which means that we detected the significant magnetic anomalies caused by the target. We will be able to estimate three-dimensional distribution of anomalous magnetic field, and the source property of

Changes in socioeconomic inequality in Indonesian children's cognitive function from 2000 to 2007: a decomposition analysis.

Science.gov (United States)

Maika, Amelia; Mittinty, Murthy N; Brinkman, Sally; Harper, Sam; Satriawan, Elan; Lynch, John W

2013-01-01

Measuring social inequalities in health is common; however, research examining inequalities in child cognitive function is more limited. We investigated household expenditure-related inequality in children's cognitive function in Indonesia in 2000 and 2007, the contributors to inequality in both time periods, and changes in the contributors to cognitive function inequalities between the periods. Data from the 2000 and 2007 round of the Indonesian Family Life Survey (IFLS) were used. Study participants were children aged 7-14 years (n = 6179 and n = 6680 in 2000 and 2007, respectively). The relative concentration index (RCI) was used to measure the magnitude of inequality. Contribution of various contributors to inequality was estimated by decomposing the concentration index in 2000 and 2007. Oaxaca-type decomposition was used to estimate changes in contributors to inequality between 2000 and 2007. Expenditure inequality decreased by 45% from an RCI = 0.29 (95% CI 0.22 to 0.36) in 2000 to 0.16 (95% CI 0.13 to 0.20) in 2007 but the burden of poorer cognitive function was higher among the disadvantaged in both years. The largest contributors to inequality in child cognitive function were inequalities in per capita expenditure, use of improved sanitation and maternal high school attendance. Changes in maternal high school participation (27%), use of improved sanitation (25%) and per capita expenditures (18%) were largely responsible for the decreasing inequality in children's cognitive function between 2000 and 2007. Government policy to increase basic education coverage for women along with economic growth may have influenced gains in children's cognitive function and reductions in inequalities in Indonesia.

Changes in socioeconomic inequality in Indonesian children's cognitive function from 2000 to 2007: a decomposition analysis.

Directory of Open Access Journals (Sweden)

Amelia Maika

Full Text Available BACKGROUND: Measuring social inequalities in health is common; however, research examining inequalities in child cognitive function is more limited. We investigated household expenditure-related inequality in children's cognitive function in Indonesia in 2000 and 2007, the contributors to inequality in both time periods, and changes in the contributors to cognitive function inequalities between the periods. METHODS: Data from the 2000 and 2007 round of the Indonesian Family Life Survey (IFLS were used. Study participants were children aged 7-14 years (n = 6179 and n = 6680 in 2000 and 2007, respectively. The relative concentration index (RCI was used to measure the magnitude of inequality. Contribution of various contributors to inequality was estimated by decomposing the concentration index in 2000 and 2007. Oaxaca-type decomposition was used to estimate changes in contributors to inequality between 2000 and 2007. RESULTS: Expenditure inequality decreased by 45% from an RCI = 0.29 (95% CI 0.22 to 0.36 in 2000 to 0.16 (95% CI 0.13 to 0.20 in 2007 but the burden of poorer cognitive function was higher among the disadvantaged in both years. The largest contributors to inequality in child cognitive function were inequalities in per capita expenditure, use of improved sanitation and maternal high school attendance. Changes in maternal high school participation (27%, use of improved sanitation (25% and per capita expenditures (18% were largely responsible for the decreasing inequality in children's cognitive function between 2000 and 2007. CONCLUSIONS: Government policy to increase basic education coverage for women along with economic growth may have influenced gains in children's cognitive function and reductions in inequalities in Indonesia.

CLC2000 land cover database of the Netherlands; monitoring land cover changes between 1986 and 2000

OpenAIRE

Hazeu, G.W.

2003-01-01

The 1986 CORINE land cover database of the Netherlands was revised and updated on basis of Landsat satellite images and ancillary data. Interpretation of satellite images from 1986 and 2000 resulted in the CLC2000, CLC1986rev and CLCchange databases. A standard European legend and production methodology was applied. Thirty land cover classes were discerned. Most extended land cover types were pastures (231), arable land (211) and complex cultivation patterns (242). Between 1986 and 2000 aroun...

AN INTRODUCTION TO WINDOWS 2000 AT CERN

CERN Document Server

2001-01-01

A demonstration of the new supported Windows environment for all the CERN personal computers (PC) will be given which is based on Windows 2000. This presentation will assume little or no familiarity with the PC, or NICE, and will concentrate on the services being offered to the users of PCs at CERN. How NICE 2000 can facilitate the work of all users, eventually becoming the key access point to all activities in the laboratory will be demonstrated. Date Title Language Location Speaker Fri 1/6 10:00 Une introduction à Windows 2000 au CERN F IT Auditorium (31/3-004) Alberto Pace Tue 5/6 10:00 Une introduction à Windows 2000 au CERN F LHC Auditorium (30/7th floor) Frederic Hemmer Tue 5/6 14:00 Une introduction à Windows 2000 au CERN F SL Auditorium (864/1s floor) Michel Bornand Tue 5/6 14:00 An introduction to Windows 2000 at CERN E IT Auditorium (31/3-004) Andreas Wagner Wed 6/6 14:00 Une introduction à Windows 2000 au CERN F SL ...

Trends in youth internet victimization: findings from three youth internet safety surveys 2000-2010.

Science.gov (United States)

Jones, Lisa M; Mitchell, Kimberly J; Finkelhor, David

2012-02-01

The purpose of this research was to explore the trends in youth reports of unwanted online sexual solicitation, harassment, and exposure to pornography over time. The study was based on three separate cross-sectional national telephone surveys of approximately 1,500 youth Internet users, aged 10 through 17 years. Data were collected in 2000, 2005, and 2010. Nine percent of youth reported an unwanted sexual solicitation in 2010. This continued the decline in unwanted sexual solicitations that occurred between 2000 (19%) and 2005 (13%), resulting in a total 50% decrease between 2000 and 2010. Twenty-three percent of youth reported an unwanted exposure to pornography, a decline from 34% in 2005, following an increase between 2000 and 2005 (25% to 34%). However, marking the only trend to show an increase over the past 5 years, 11% of youth reported an online harassment experience, which was an increase from 9% in 2005, and 6% in 2000. Some differences in these trends were noted for subgroups of youth across age, gender, and race. The trends in unwanted experiences online over the past decade identified by three Youth Internet Safety Surveys may contradict impressions that the general population, professionals, and the media have about what is happening. Trends provide evidence for some optimism that protective adaptations to the online environment have been successful; however, online harassment appears to be increasing for youth, particularly girls, and may require additional mobilization. Copyright © 2012 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

Bacillus velezensis CC09: A Potential 'Vaccine' for Controlling Wheat Diseases.

Science.gov (United States)

Kang, Xingxing; Zhang, Wanling; Cai, Xunchao; Zhu, Tong; Xue, Yarong; Liu, Changhong

2018-04-11

Biocontrol bacteria that can act like a "vaccine", stimulating plant resistance to pathogenic diseases, are still not fully elucidated. In this study, an endophytic bacterium, Bacillus velezensis CC09, labeled with green fluorescent protein, was tested for its colonization, migration, and expression of genes encoding iturin A synthetase within wheat tissues and organs as well as for protective effects against wheat take-all and spot blotch diseases. The results showed that strain CC09 not only formed biofilm on the root surface but was also widely distributed in almost every tissue, including the epidermis, cortex, and xylem vessels, and even migrated to stems and leaves, resulting in 66.67% disease-control efficacy (DCE) of take-all and 21.64% DCE of spot blotch. Moreover, the gene cluster encoding iturin A synthase under the control of the p itu promoter is expressed in B. velezensis CC09 in wheat tissues, which indicates that iturin A might contribute to the in-vivo antifungal activity and leads to the disease control. All these data suggested that strain CC09 can act like a 'vaccine' in the control of wheat diseases, with a single treatment inoculated on roots through multiple mechanisms.

Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09

Energy Technology Data Exchange (ETDEWEB)

Gustafsson, Jaana; Gustafsson, Christer (Malaa Geoscience AB (Sweden))

2010-01-15

This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility

Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09

International Nuclear Information System (INIS)

Gustafsson, Jaana; Gustafsson, Christer

2010-01-01

This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility

Neutral pion and $\\eta$ meson production in proton-proton collisions at $\\sqrt{s}$=0.9 TeV and $\\sqrt{s}$=7 TeV

CERN Document Server

Abelev, B.; Adamova, D.; Adare, A.M.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Agostinelli, A.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, N.; Masoodi, A.Ahmad; Ahn, S.U.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Molina, R.Alfaro; Alici, A.; Alkin, A.; Almaraz Avina, E.; Alt, T.; Altini, V.; Altinpinar, S.; Altsybeev, I.; Andrei, C.; Andronic, A.; Anguelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshauser, H.; Arbor, N.; Arcelli, S.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Arslandok, M.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bach, M.; Badala, A.; Baek, Y.W.; Bailhache, R.; Bala, R.; Ferroli, R.Baldini; Baldisseri, A.; Baldit, A.; Baltasar Dos Santos Pedrosa, F.; Ban, J.; Baral, R.C.; Barbera, R.; Barile, F.; Barnafoldi, G.G.; Barnby, L.S.; Barret, V.; Bartke, J.; Basile, M.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Beck, H.; Belikov, I.; Bellini, F.; Bellwied, R.; Belmont-Moreno, E.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bergmann, C.; Berzano, D.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, N.; Bianchi, L.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Blanco, F.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, F.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Boldizsar, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Bortolin, C.; Bose, S.; Bossu, F.; Botje, M.; Bottger, S.; Boyer, B.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broz, M.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Bugaiev, K.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Calvo Villar, E.; Camerini, P.; Canoa Roman, V.; Cara Romeo, G.; Carena, F.; Carena, W.; Carlin Filho, N.; Carminati, F.; Carrillo Montoya, C.A.; Casanova Diaz, A.; Caselle, M.; Castillo Castellanos, J.; Castillo Hernandez, J.F.; Casula, E.A.R.; Catanescu, V.; Cavicchioli, C.; Cepila, J.; Cerello, P.; Chang, B.; Chapeland, S.; Charvet, J.L.; Chattopadhyay, S.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chung, S.U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Coccetti, F.; Coffin, J.P.; Colamaria, F.; Colella, D.; Conesa Balbastre, G.; Conesa del Valle, Z.; Constantin, P.; Contin, G.; Contreras, J.G.; Cormier, T.M.; Corrales Morales, Y.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Alaniz, E.Cruz; Cuautle, E.; Cunqueiro, L.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Das, K.; Das, D.; Dash, A.; Dash, S.; De, S.; De Azevedo Moregula, A.; de Barros, G.O.V.; De Caro, A.; De Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gruttola, D.; Delagrange, H.; Del Castillo Sanchez, E.; Deloff, A.; Demanov, V.; De Marco, N.; Denes, E.; De Pasquale, S.; Deppman, A.; Erasmo, G.D.; de Rooij, R.; Di Bari, D.; Dietel, T.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Divia, R.; Djuvsland, O.; Dobrin, A.; Dobrowolski, T.; Dominguez, I.; Donigus, B.; Dordic, O.; Driga, O.; Dubey, A.K.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, M.R.; Dutta Majumdar, A.K.; Elia, D.; Emschermann, D.; Engel, H.; Erdal, H.A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Eyyubova, G.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fearick, R.; Fedunov, A.; Fehlker, D.; Feldkamp, L.; Felea, D.; Feofilov, G.; Fernandez Tellez, A.; Ferretti, A.; Ferretti, R.; Figiel, J.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Finogeev, D.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gagliardi, M.; Gago, A.; Gallio, M.; Gangadharan, D.R.; Ganoti, P.; Garabatos, C.; Garcia-Solis, E.; Garishvili, I.; Gerhard, J.; Germain, M.; Geuna, C.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Gianotti, P.; Girard, M.R.; Giubellino, P.; Gladysz-Dziadus, E.; Glassel, P.; Gomez, R.; Ferreiro, E.G.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Goswami, A.; Gotovac, S.; Grabski, V.; Graczykowski, L.K.; Grajcarek, R.; Grelli, A.; Grigoras, C.; Grigoras, A.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerra Gutierrez, C.; Guerzoni, B.; Guilbaud, M.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Han, B.H.; Hanratty, L.D.; Hansen, A.; Harmanova, Z.; Harris, J.W.; Hartig, M.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heckel, S.T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Huang, M.; Huber, S.; Humanic, T.J.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Incani, E.; Innocenti, P.G.; Innocenti, G.M.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, M.; Ivanov, V.; Ivanov, A.; Ivanytskyi, O.; Jacholkowski, A.; Jacobs, P.M.; Jancurova, L.; Jang, H.J.; Jangal, S.; Janik, R.; Janik, M.A.; Jayarathna, P.H.S.Y.; Jena, S.; Jimenez Bustamante, R.T.; Jirden, L.; Jones, P.G.; Jung, W.; Jung, H.; Jusko, A.; Kaidalov, A.B.; Kakoyan, V.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kanaki, K.; Kang, J.H.; Kaplin, V.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, P.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, J.H.; Kim, D.J.; Kim, D.W.; Kim, J.S.; Kim, M.; Kim, S.H.; Kim, S.; Kim, B.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Kluge, A.; Knichel, M.L.; Koch, K.; Kohler, M.K.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskikh, A.; Korneev, A.; Kottachchi Kankanamge Don, C.; Kour, R.; Kowalski, M.; Kox, S.; Koyithatta Meethaleveedu, G.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Krawutschke, T.; Kretz, M.; Krivda, M.; Krizek, F.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kurashvili, P.; Kurepin, A.B.; Kurepin, A.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; Ladron de Guevara, P.; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; La Rocca, P.; Lazzeroni, C.; Lea, R.; Le Bornec, Y.; Lee, S.C.; Lee, K.S.; Lefevre, F.; Lehnert, J.; Leistam, L.; Lenhardt, M.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Liu, L.; Loenne, P.I.; Loggins, V.R.; Loginov, V.; Lohn, S.; Lohner, D.; Loizides, C.; Loo, K.K.; Lopez, X.; Lopez Torres, E.; Lovhoiden, G.; Lu, X.G.; Luettig, P.; Lunardon, M.; Luo, J.; Luparello, G.; Luquin, L.; Luzzi, C.; Ma, R.; Ma, K.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Markert, C.; Martashvili, I.; Martinengo, P.; Martinez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Martynov, Y.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mayer, C.; Mazer, J.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mercado Perez, J.; Meres, M.; Miake, Y.; Michalon, A.; Midori, J.; Milano, L.; Milosevic, J.; Mischke, A.; Mishra, A.N.; Miskowiec, D.; Mitu, C.; Mlynarz, J.; Mohanty, A.K.; Mohanty, B.; Molnar, L.; Montano Zetina, L.; Monteno, M.; Montes, E.; Moon, T.; Morando, M.; Moreira De Godoy, D.A.; Moretto, S.; Morsch, A.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Nattrass, C.; Naumov, N.P.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nicassio, M.; Nielsen, B.S.; Niida, T.; Nikolaev, S.; Nikolic, V.; Nikulin, V.; Nikulin, S.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyanin, A.; Nyatha, A.; Nygaard, C.; Nystrand, J.; Obayashi, H.; Ochirov, A.; Oeschler, H.; Oh, S.K.; Oh, S.; Oleniacz, J.; Oppedisano, C.; Ortiz Velasquez, A.; Ortona, G.; Oskarsson, A.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Passfeld, A.; Pastircak, B.; Patalakha, D.I.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Perales, M.; Pereira De Oliveira Filho, E.; Peresunko, D.; Perez Lara, C.E.; Perez Lezama, E.; Perini, D.; Perrino, D.; Peryt, W.; Pesci, A.; Peskov, V.; Pestov, Y.; Petracek, V.; Petran, M.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Piyarathna, D.B.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta-Lerma, P.L.M.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Pop, A.; Porteboeuf-Houssais, S.; Pospisil, V.; Potukuchi, B.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puchagin, S.; Puddu, G.; Pulvirenti, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Qvigstad, H.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Ramirez Reyes, A.; Raniwala, S.; Raniwala, R.; Rasanen, S.S.; Rascanu, B.T.; Rathee, D.; Read, K.F.; Real, J.S.; Redlich, K.; Reichelt, P.; Reicher, M.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.P.; Reygers, K.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rodriguez Cahuantzi, M.; Rohr, D.; Rohrich, D.; Romita, R.; Ronchetti, F.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Roy, P.; Roy, C.; Rubio Montero, A.J.; Rui, R.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahu, P.K.; Saini, J.; Sakaguchi, H.; Sakai, S.; Sakata, D.; Salgado, C.A.; Sambyal, S.; Samsonov, V.; Sanchez Castro, X.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H.R.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Scott, P.A.; Segato, G.; Selyuzhenkov, I.; Senyukov, S.; Seo, J.; Serci, S.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabetai, A.; Shabratova, G.; Shahoyan, R.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddhanta, S.; Siemiarczuk, T.; Silvermyr, D.; Simonetti, G.; Singaraju, R.; Singh, R.; Singha, S.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Sogaard, C.; Soltz, R.; Son, H.; Song, J.; Song, M.; Soos, C.; Soramel, F.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Stan, I.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Steinpreis, M.; Stenlund, E.; Steyn, G.; Stocco, D.; Stolpovskiy, M.; Strabykin, K.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sukhorukov, M.; Sultanov, R.; Sumbera, M.; Susa, T.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Tagridis, C.; Takahashi, J.; J.Tapia Takaki, D.; Tauro, A.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thader, J.; Thomas, J.H.; Thomas, D.; Tieulent, R.; Timmins, A.R.; Tlusty, D.; Toia, A.; Torii, H.; Toscano, L.; Tosello, F.; Traczyk, T.; Truesdale, D.; Trzaska, W.H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T.S.; Ulery, J.; Ullaland, K.; Ulrich, J.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vajzer, M.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van der Kolk, N.; Vande Vyvre, P.; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vechernin, V.; Veldhoen, M.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernekohl, D.C.; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, L.; Vinogradov, Y.; Vinogradov, A.; Virgili, T.; Viyogi, Y.P.; Vodopyanov, A.; Voloshin, S.; Voloshin, K.; Volpe, G.; von Haller, B.; Vranic, D.; Ovrebekk, G.; Vrlakova, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, V.; Wan, R.; Wang, Y.; Wang, M.; Wang, D.; Wang, Y.; Watanabe, K.; Wessels, J.P.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilk, A.; Williams, M.C.S.; Windelband, B.; Karampatsos, L.Xaplanteris; Yang, H.; Yang, S.; Yano, S.; Yasnopolskiy, S.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I.K.; Yoon, J.; Yu, W.; Yuan, X.; Yushmanov, I.; Zach, C.; Zampolli, C.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zelnicek, P.; Zgura, I.S.; Zhalov, M.; Zhang, X.; Zhou, F.; Zhou, Y.; Zhou, D.; Zhu, X.; Zichichi, A.; Zimmermann, A.; Zinovjev, G.; Zoccarato, Y.; Zynovyev, M.

2013-07-16

The first measurements of the invariant differential cross sections of inclusive $\\pi^0$ and $\\eta$ meson production at mid-rapidity in proton-proton collisions at $\\sqrt{s}=0.9$ TeV and $\\sqrt{s}=7$ TeV are reported. The $\\pi^0$ measurement covers the ranges $0.425$ GeV/$c$ for these two energies, respectively. The production of $\\eta$ mesons was measured at $\\sqrt{s}=7$ TeV in the range $0.40.9$ TeV, overestimate those of $\\pi^0$ and $\\eta$ mesons at $\\sqrt{s}=7$ TeV, but agree with the measured $\\eta/\\pi^0$ ratio at $\\sqrt{s}=7$ TeV.

The epidemiology of firework-related injuries in the United States: 2000-2010.

Science.gov (United States)

Moore, Justin Xavier; McGwin, Gerald; Griffin, Russell L

2014-11-01

The purpose of this study is to examine the epidemiology of firework-related injuries among an emergency department (ED) nationally representative population of the United States for the years 2000-2010, including whether the type of firework causing the injury is differential by patient demographics and whether the severity of injury is associated with the firework type. The data analysed in this study was collected from the Consumer Product Safety Commission's (CPSC's) National Electronic Injury Surveillance System (NEISS). A total of 2812 injuries represented an estimated 97,562 firework-related injuries treated in emergency departments within the United States from 2000 to 2010. The incidence generally decreased over time. With respect to age, the rate was higher for children, with the highest rates being observed for 10-19 year olds (7.28 per 100,000 persons) and 0-9 year olds (5.45 per 100,000 persons). The injury rate was nearly three times higher for males compared to the female counterparts (4.48 vs. 1.57 per 100,000 persons). Females were less likely than males to severely injure themselves with all types of fireworks besides sparklers/novelty devices (OR 1.08, CI 0.26-4.38). The results from this suggest that firework-related injuries have decreased by nearly 30% over the 11-year period between 2000 and 2010. Moreover, there has been a decreasing trend in the type of firework causing injury for every firework type excluding the unspecified firework type. However, adolescents of 10-19 years old had the highest rate of injury for fireworks over the 11-year period. In addition odds of injury are differential by firework type. Understanding the specific types of fireworks may lead to better preventative methods and regulations. Moreover, preventative methods should be taken to reduce the rate of firework-related injuries among U.S. youths [1], and possibly more regulations and enforcement of laws geared towards prohibiting novice use of fireworks. Published

Annual Report 2000; Rapport annuel 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

This annual report gives the activities during the year 2000 and information about the General Direction of the Energy and Raw Materials (DGEMP) in France. The highlights of the year are discussed in the main following topics: public utilities, the Erika oil slick, the petroleum products prices increase, the energy efficiency national program, Eole 2005, the nuclear industry management. The french energy accounting, the publications and the organization of the DGEMP are also provided. (A.L.B.)

Annual North Dakota Elevator Marketing Report, 2008-09

Science.gov (United States)

2009-12-01

The Annual North Dakota Elevator Marketing Report for 2008-09 was prepared by Kimberly Vachal and Laurel Benson, : Upper Great Plains Transportation Institute. The authors gratefully acknowledge the assistance of the North Dakota : Grain Dealers Asso...

Meson 2000 Conference Summary lite

International Nuclear Information System (INIS)

Barnes, T.

2000-01-01

This short contribution is a late MESON2000 conference summary. As appropriate for the 600th anniversary of the Jagiellonian University, it begins with a brief summary of the last 600 years of European history and its place in hadron physics. Next a ''physicist chirality'' order parameter PC is introduced. When applied to MESON2000 plenary speakers this order parameter illustrates the separation of hadron physicists into disjoint communities. The individual plenary talks in MESON2000 are next sorted according to the subconference associated with each of the 36 plenary speakers. Finally, I conclude with a previously unreported Feynman story regarding the use of models in hadron physics. (author)

Career development. Opportunity 2000.

Science.gov (United States)

Adams, J

Opportunity 2000 is an initiative designed to increase the role of women in the workforce and to promote equal opportunities in the workplace. The NHS Management Executive has set up a women's unit to put Opportunity 2000 into practice and to develop more 'women-friendly' working practices. The unit has produced a good practice handbook. The article discusses the eight goals produced by the NHSME to be achieved by health authorities and trusts by this year.

Tax Information Series, December 2000

Science.gov (United States)

2001-03-14

to serve as an in-depth review or explanation of each topic discussed, rather its intent is to inform readers about updates in tax numerology and... NUMEROLOGY Tax Rates The 2000 federal income tax rates are: 15%, 28%, 31%, 36%, and 39.6%. The 2000 tax rates by filing status are

iWork '09 The Missing Manual

CERN Document Server

Clark, Josh

2009-01-01

With iWork '09: The Missing Manual, you'll quickly learn everything you need to know about Apple's incredible productivity programs, including the Pages word-processor, the Numbers spreadsheet, and the Keynote presentation program that Al Gore and Steve Jobs made famous. This book gives you crystal-clear and jargon-free explanations of iWork's capabilities, advantages, and limitations to help you produce stunning documents and cinema-quality digital presentations in no time.

Eurosites insights; image, implementation, interpretation and integration of Natura 2000 in European perspective; United Kingdom, Sweden, Spain, France and Hungary

NARCIS (Netherlands)

Neven, M.G.G.; Kistenkas, F.H.; Apeldoorn, van R.C.

2005-01-01

This comparative study analyses Natura 2000 nature conservation (EU Birds- and Habitats Directives) alongside the key issues of image, implementation, interpretation and integration. Having quickscanned the EU25, five member states have been selected for further investigation: UK, Sweden, Spain,

Annual report 2000; Rapport annuel 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

This year 2000 annual report of the CEA (atomic energy commissariat) gives a general overview of the CEA activities and organization in the domains of the defence, the nuclear energy the technological research and the fundamental research. It is presented in seven main parts: contribution to national defence, civil nuclear research, technological research for the industry, pushing back the frontiers of scientific knowledge in physics and life science, mastery of installations; institute for protection and nuclear safety, research resources. (A.L.B.)

Strategisch beheer C2000 : kiezen voor slagkracht

NARCIS (Netherlands)

Verdonck, Klooster & Associates (VKA); Het Expertice Centrum (HEC); WODC

2011-01-01

De invoering van C2000 heeft ertoe geleid dat er één landelijk systeem wordt gebruikt voor (groeps)communicatie voor en door de hulpdiensten. Daarnaast kent C2000 nog vele andere gebruikers zoals Defensieonderdelen, Douane, Kustwacht etc. C2000 moet in zowel de normale dag/dagelijkse

Relation of nutrient concentrations, nutrient loading, and algal production to changes in water levels in Kabetogama Lake, Voyageurs National Park, northern Minnesota, 2008-09

Science.gov (United States)

Christensen, Victoria G.; Maki, Ryan P.; Kiesling, Richard L.

2011-01-01

Nutrient enrichment has led to excessive algal growth in Kabetogama Lake, Voyageurs National Park, northern Minnesota. Water- and sediment-quality data were collected during 2008-09 to assess internal and external nutrient loading. Data collection was focused in Kabetogama Lake and its inflows, the area of greatest concern for eutrophication among the lakes of Voyageurs National Park. Nutrient and algal data were used to determine trophic status and were evaluated in relation to changes in Kabetogama Lake water levels following changes to dam operation starting in 2000. Analyses were used to estimate external nutrient loading at inflows and assess the potential contribution of internal phosphorus loading. Kabetogama Lake often was mixed vertically, except for a few occasionally stratified areas, including Lost Bay in the northeastern part of Kabetogama Lake. Stratification, combined with larger bottom-water nutrient concentrations, larger sediment phosphorus concentrations, and estimated phosphorus release rates from sediment cores indicate that Lost Bay may be one of several areas that may be contributing substantially to internal loading. Internal loading is a concern because nutrients may cause excessive algal growth including potentially toxic cyanobacteria. The cyanobacterial hepatotoxin, microcystin, was detected in 7 of 14 cyanobacterial bloom samples, with total concentrations exceeding 1.0 microgram per liter, the World Health Organization's guideline for finished drinking water for the congener, microcystin-LR. Comparisons of the results of this study to previous studies indicate that chlorophyll-a concentrations and trophic state indices have improved since 2000, when the rules governing dam operation changed. However, total-phosphorus concentrations have not changed significantly since 2000.

Plant safety in France 2000 until 2010; Anlagensicherheitspolitik in Frankreich 2000 bis 2010

Energy Technology Data Exchange (ETDEWEB)

Vallee, Agnes; Affeltranger, Bastien; Descourriere, Sandrine; Oger, Florence; Duval, Christophe; Gaucher, Rodolphe [Institut National de l' Environnement Industriel et des Risques (INERIS), 60 - Verneuil-en-Halatte (France)

2013-03-15

The study on the safety of industrial plants on France covers the following issues: The explosion in the operational area of AZF (plant Grande Paroisse) and the consequences; classified installations; the players of accident risks in France; realization of the accident prevention policy in France from 2000 to 2010; prevention of natural risks and consideration of these risks on the level of classified installations (NATECH accidents) in France from 2000 to 2010; further specific topics; actual activities and developments.

SAFARI 2000 PAR Measurements, Kalahari Transect, Botswana, Wet Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — Ceptometer data from a Decagon AccuPAR (Model PAR-80) were collected at four sites in Botswana during the SAFARI 2000 Kalahari Transect Wet Season Campaign (March,...

Biochemical and Pharmacological Characterizations of ESI-09 Based EPAC Inhibitors: Defining the ESI-09 “Therapeutic Window”

OpenAIRE

Yingmin Zhu; Haijun Chen; Stephen Boulton; Fang Mei; Na Ye; Giuseppe Melacini; Jia Zhou; Xiaodong Cheng

2015-01-01

The cAMP signaling cascade is one of the most frequently targeted pathways for the development of pharmaceutics. A plethora of recent genetic and pharmacological studies suggest that exchange proteins directly activated by cAMP (EPACs) are implicated in multiple pathologies. Selective EPAC inhibitors have been recently developed. One specific inhibitor, ESI-09, has been shown to block EPAC activity and functions, as well as to recapitulate genetic phenotypes of EPAC knockout mice when applied...

Project in fiscal 2000 of developing international standards for supporting new industries. Standardization of communication interface for open robots in production system; 2000 nendo shinki sangyo shiengata kokusai hyojun kaihatsu jigyo seika hokokusho. Seisan system nado ni okeru open robot yo tsushin interface no hyojunka

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-03-01

In order to realize the open use between robot controllers and personal computers on the communication level, R and D has been performed on the standard API required for structuring the applications to use robot information on the personal computers. A draft of the international standard was prepared. This paper summarizes the achievements in fiscal 2000. The current fiscal year has executed improvements on the standard API software, as well as the demonstration tests. The following achievements were obtained: problems in practical use based on the demonstration tests of RAO ver. 0.5 were extracted and rectified; the standard API (Ver0.9) given additional functions including file transfer was developed; the specifications for the standard API (Ver1.0) were compiled based on the result of discussions on the major application functions; as a result of the demonstration test on reliability of the standard API (Ver0.9), performances were verified when the API is connected under different structural and using conditions; and a resolution was made at the ISO/TC184/SC2 international conference that 'continuation is encouraged on the present R and D expected as a proposal for the new work items'. (NEDO)

Effects of Al-Mn-Ti-P-Cu master alloy on microstructure and properties of Al-25Si alloy

Directory of Open Access Journals (Sweden)

Xu Chunxiang

2013-09-01

Full Text Available To obtain a higher microstructural refining efficiency, and improve the properties and processing ability of hypereutectic Al-25Si alloy, a new environmentally friendly Al-20.6Mn-12Ti-0.9P-6.1Cu (by wt.% master alloy was fabricated; and its modification and strengthening mechanisms on the Al-25Si alloy were studied. The mechanical properties of the unmodified, modified and heat treated alloys were investigated. Results show that the optimal addition amount of the Al-20.6Mn-12Ti-0.9P-6.1Cu master alloy is 4wt.%. In this case, primary Si and eutectic Si as well as メ-Al phase were clearly refined, and this refining effect shows an excellent long residual action as it can be heat-retained for at least 5 h. After being T6 heat treated, the morphology of primary and eutectic Si in the Al-25Si alloys with the addition of 4wt.% Al-20.6Mn-12Ti-0.9P-6.1Cu alloy changes into particles and short rods. The average grain size of the primary and eutectic Si decreases from 250 レm (unmodified to 13.83 レm and 35 レm (unmodified to 7 レm; the メ-Al becomes obviously finer and the distribution of Si phases tends to be uniform and dispersed. Meanwhile, the tensile properties are improved obviously; the tensile strengths at room temperature and 300 ìC reach 241 MPa and 127 MPa, increased by 153.7% and 67.1%, respectively. In addition, the tensile fracture mechanism changes from brittle fracture for the alloy without modification to ductile fracture after modification. Modifying the morphology of Si phase and strengthening the matrix can effectively block the initiation and propagation of cracks, thus improving the strength of the hypereutectic Al-25Si alloy.

IAEA releases nuclear power statistics for 2000

International Nuclear Information System (INIS)

2001-01-01

According to data reported to the IAEA Power Reactor Information System, a total of 438 NPPs were operating around the world at the end of 2000. The total installed power from NPPs was 351 GWe. During 2000, six plants were connected to the grid, construction of three new nuclear reactors started, bringing the total number of reactors under construction to 31. Worldwide in 2000, total nuclear generated electricity increased to 2447.53 terawatt-hours. Cumulative worldwide operating experience from civil nuclear power reactors at the end of 2000 exceeded 9800 reactor years

Analogs of [L-(pEt)Phe 2 ] or [D-(pEt)Phe 2 ]oxytocin having an ŕ-helix inducing amino acid Aib or á-Ala in position 3 or 7 or 9

Czech Academy of Sciences Publication Activity Database

Slaninová, Jiřina; Nazarov, Elšan; Kunčarová, Pavla; Žertová, Miroslava; Koumentakos, S.; Magafa, V.; Pairas, G.; Theoderopoulos, D.; Cordopatis, P.

2000-01-01

Roč. 6, Supplement (2000), s. S218 ISSN 1075-2617. [European Peptide Symposium /26./. 10.09.2000-15.09.2000, Montpellier] R&D Projects: GA AV ČR KSK2055603 Institutional research plan: CEZ:AV0Z4055905 Subject RIV: CE - Biochemistry

Changes in Socioeconomic Inequality in Indonesian Children’s Cognitive Function from 2000 to 2007: A Decomposition Analysis

Science.gov (United States)

Maika, Amelia; Mittinty, Murthy N.; Brinkman, Sally; Harper, Sam; Satriawan, Elan; Lynch, John W.

2013-01-01

Background Measuring social inequalities in health is common; however, research examining inequalities in child cognitive function is more limited. We investigated household expenditure-related inequality in children’s cognitive function in Indonesia in 2000 and 2007, the contributors to inequality in both time periods, and changes in the contributors to cognitive function inequalities between the periods. Methods Data from the 2000 and 2007 round of the Indonesian Family Life Survey (IFLS) were used. Study participants were children aged 7–14 years (n = 6179 and n = 6680 in 2000 and 2007, respectively). The relative concentration index (RCI) was used to measure the magnitude of inequality. Contribution of various contributors to inequality was estimated by decomposing the concentration index in 2000 and 2007. Oaxaca-type decomposition was used to estimate changes in contributors to inequality between 2000 and 2007. Results Expenditure inequality decreased by 45% from an RCI = 0.29 (95% CI 0.22 to 0.36) in 2000 to 0.16 (95% CI 0.13 to 0.20) in 2007 but the burden of poorer cognitive function was higher among the disadvantaged in both years. The largest contributors to inequality in child cognitive function were inequalities in per capita expenditure, use of improved sanitation and maternal high school attendance. Changes in maternal high school participation (27%), use of improved sanitation (25%) and per capita expenditures (18%) were largely responsible for the decreasing inequality in children’s cognitive function between 2000 and 2007. Conclusions Government policy to increase basic education coverage for women along with economic growth may have influenced gains in children’s cognitive function and reductions in inequalities in Indonesia. PMID:24205322

About swarms of long-period earthquakes at volcano Nyamuragira of the Virunga region, Western Rift Valley of Africa (D.R. Congo

Directory of Open Access Journals (Sweden)

Rusangiza B.K.

2012-01-01

Full Text Available Swarms of Long Period earthquakes generated by the Nyamuragira volcano for the period from January 2000 to November 2006 before 21 January 2000, 5 February 2001, 25 July 2002, 8 May 2004 and 27 November 2006 Nyamuragira eruptions have been analyzed. Interest is focused on the frequency distribution of these earthquakes and on the variation of the m-value of observed earthquake swarms. It is found that m-values which generally vary between 0.9 and 1.6, and shifts towards larger values of 1.7 to 3.23 two to four months prior to eruptions of the volcano.

SAFARI 2000 MODIS Airborne Simulator Data, Southern Africa, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — This dataset contains the Moderate Resolution Imaging Spectroradiometer (MODIS) Airborne Simulator (MAS) multispectral data collected during the SAFARI 2000 project....

The Holocene Sedimentation in Sandstone Rockshelters of Northern Bohemia

Czech Academy of Sciences Publication Activity Database

Cílek, Václav

2000-01-01

Roč. 11, - (2000), s. 66-69 ISSN 1210-9606. [International Conference on Past Global Changes Upper Pleistocene and Holocene Climatic Variations. Prague, 06.09.2000-09.09.2000] Grant - others:US(XC) National Geographic Society 6330-98 "The last foragers of the Northern Europe" Institutional research plan: CEZ:AV0Z3013912 Subject RIV: DB - Geology ; Mineralogy http://geolines.gli.cas.cz/fileadmin/volumes/volume11/G11-066.pdf

17 CFR 8.09 - Review of investigation report.

Science.gov (United States)

2010-04-01

... PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.09 Review of investigation report. The disciplinary committee shall promptly review each investigation report. In the event the disciplinary committee determines that additional investigation or evidence is needed, it shall...

Particulate Emissions from Fluidised Bed Combustion of Ligite with Mineral Sorbents

Czech Academy of Sciences Publication Activity Database

Smolík, Jiří; Schwarz, Jaroslav; Ondráčková, Lucie; Veselý, Václav; Sýkorová, Ivana; Kučera, Jan; Havránek, Vladimír

2000-01-01

Roč. 31, Suppl. 1 (2000), s. S670-S671 ISSN 0021-8502. [European Aerosol Conference 2000. Dublin, 03.09.2000-08.09.2000] R&D Projects: GA ČR GA104/00/1297; GA AV ČR IAA2046904 Institutional research plan: CEZ:AV0Z4072921; CEZ:AV0Z3046908 Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.071, year: 2000

Year 2000 awareness

Energy Technology Data Exchange (ETDEWEB)

Holmes, C.

1997-11-01

This report contains viewgraphs on the challenges business face with the year 2000 software problem. Estimates, roadmaps, virtual factory software, current awareness, and world wide web references are given.

SAFARI 2000 Physical and Chemical Properties of Aerosols, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — SAFARI 2000 provided an opportunity to study aerosol particles produced by savanna burning. We used analytical transmission electron microscopy (TEM), including...

Updated atmospheric speciated mercury emissions from iron and steel production in China during 2000-2015

Science.gov (United States)

Wu, Qingru; Gao, Wei; Wang, Shuxiao; Hao, Jiming

2017-09-01

Iron and steel production (ISP) is one of the significant atmospheric Hg emission sources in China. Atmospheric mercury (Hg) emissions from ISP during 2000-2015 were estimated by using a technology-based emission factor method. To support the application of this method, databases of Hg concentrations in raw materials, technology development trends, and Hg removal efficiencies of air pollution control devices (APCDs) were constructed through national sampling and literature review. Hg input to ISP increased from 21.6 t in 2000 to 94.5 t in 2015. In the various types of raw materials, coking coal and iron concentrates contributed 35-46 and 25-32 % of the total Hg input. Atmospheric Hg emissions from ISP increased from 11.5 t in 2000 to 32.7 t in 2015 with a peak of 35.6 t in 2013. Pollution control promoted the increase in average Hg removal efficiency, from 47 % in 2000 to 65 % in 2015. During the study period, sinter/pellet plants and blast furnaces were the largest two emission processes. However, emissions from roasting plants and coke ovens cannot be ignored, which accounted for 22-34 % of ISP's emissions. Overall, Hg speciation shifted from 50/44/6 (gaseous elemental Hg (Hg0)/gaseous oxidized Hg (HgII)/particulate-bound Hg (Hgp)) in 2000 to 40/59/1 in 2015, which indicated a higher proportion of Hg deposition around the emission points. Future emissions of ISP were expected to decrease based on the comprehensive consideration crude-steel production, steel scrap utilization, energy saving, and pollution control measures.

AN INTRODUCTION TO WINDOWS 2000 AT CERN

CERN Multimedia

2001-01-01

A demonstration of the new supported Windows environment for all the CERN personal computers (PC) will be given which is based on Windows 2000. This presentation will assume little or no familiarity with the PC, or NICE, and will concentrate on the services being offered to the users of PCs at CERN. How NICE 2000 can facilitate the work of all users, eventually becoming the key access point to all activities in the laboratory will be demonstrated. Information: http://winservices.web.cern.ch/winservices/Seminars/Tutorials/ Date Title Language Location Speaker Fri 1/6 10:00 Une introduction à Windows 2000 au CERN F IT Auditorium (31/3-004) Alberto Pace Tue 5/6 10:00 Une introduction à Windows 2000 au CERN F LHC Auditorium (30/7th floor) Frederic Hemmer Tue 5/6 14:00 Une introduction à Windows 2000 au CERN F SL Auditorium (864/1s floor) Michel Bornand Tue 5/6 14:00 An introduction to Windows 2000 at CERN E IT Auditorium (31/3-004) Andreas Wagner ...

An industry response to recycle 2000

International Nuclear Information System (INIS)

Motl, G.P.; Loiselle, V.

1996-01-01

The US DOE is expected to issue a policy early this year articulating DOE's position on the recycle of DOE radioactive scrap metal. In anticipation of this 'Recycle 2000' initiative, the nuclear industry has formed a new trade association called the Association of Radioactive Metal Recyclers (ARMR). This article describes the Recycle 2000 initiative, provides some background on the ARMR and its membership, and identifies industry views on the actions to be taken and issues to be resolved in Recycle 2000 is to become a reality

Risøs virksomhedsregnskab 2000. Opfølgning på planerne for året 2000

DEFF Research Database (Denmark)

Rosendahl, L.; Aabling-Thomsen, E.; Kjems, J.K.(eds.)

2001-01-01

Risøs Virksomhedsregnskab 2000 er en opfølgning på planerne for Risøs virksomhed i 2000. Risøs bestyrelse skal som led i resultatkontrakten med IT- og Forskningsministeriet aflægge årlige rapporter om opfyldelsen af de fastlagte resultatkrav. Nærværenderapport indeholder data til brug for denne v...

Tumor Markers as a Possible Tool for Differential Diagnosis in Lung Diseases

Czech Academy of Sciences Publication Activity Database

Pikner, R.; Čertíková, G.; Topolčan, O.; Pešek, M.; Holubec, L.; Pecen, Ladislav; Spilková, I.; Paříková, I.

2000-01-01

Roč. 21, Suppl.1 (2000), s. 123 ISSN 1010-4283. [Meeting of the International Society for Oncodevelopmental Biology and Medicine /28./. 08.09.2000-13.09.2000, Munich] Grant - others:IGA MZ ČR(CZ) NC4780 Institutional research plan: AV0Z1030915

Connexion between Diabetes Mellitus and the Incidence of Tumor Diseases

Czech Academy of Sciences Publication Activity Database

Steinerová, A.; Topolčan, O.; Vlasák, J.; Holubec, L.; Svačina, Š.; Pecen, Ladislav; Matoulek, M.; Svobodová, S.; Pikner, R.

2000-01-01

Roč. 21, Suppl.1 (2000), s. 113 ISSN 1010-4283. [Meeting of the International Society for Oncodevelopmental Biology and Medicine /28./. 08.09.2000-13.09.2000, Munich] Grant - others:IGA MZ ČR(CZ) NC4780 Institutional research plan: AV0Z1030915

Oxytocinové receptory v hipokampu potkana po chronickém podávání amfetaminu

Czech Academy of Sciences Publication Activity Database

Nazarov, Elšan; Šída, P.; Slaninová, Jiřina; Klenerová, V.

2000-01-01

Roč. 94, č. 8 (2000), s. 647-648 ISSN 0009-2770. [Biochemický sjezd /17./. 07.09.2000-10.09.2000, Praha] R&D Projects: GA ČR GA204/99/1453 Institutional research plan: CEZ:AV0Z4055905 Subject RIV: CE - Biochemistry

NST Quarterly - April 2000 issue

International Nuclear Information System (INIS)

1999-01-01

NST Quarterly reports current development in Nuclear Science and Technology in Malaysia. In this issue it highlights MINT activities in genetic engineering. The articles summarized the improvement of orchids and tulips through genetic engineering and generating new varieties for the floriculture industry. It also reported, MINT won gold and silver at the International Invention 2000, 12-16 April 2000, Geneva

CLC2000 land cover database of the Netherlands; monitoring land cover changes between 1986 and 2000

NARCIS (Netherlands)

Hazeu, G.W.

2003-01-01

The 1986 CORINE land cover database of the Netherlands was revised and updated on basis of Landsat satellite images and ancillary data. Interpretation of satellite images from 1986 and 2000 resulted in the CLC2000, CLC1986rev and CLCchange databases. A standard European legend and production

NCBI nr-aa BLAST: CBRC-HSAP-09-0006 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0006 ref|ZP_00960995.1| pyruvate carboxylase [Roseovarius nubinhibens ...ISM] gb|EAP76566.1| pyruvate carboxylase [Roseovarius nubinhibens ISM] ZP_00960995.1 1.2 28% ...

Prevalência de sobrepeso e obesidade em adolescentes masculinos nas macrorregiões do Brasil, 1980-2000 Predominio del sobrepeso y obesidad en adolescentes masculinos de cinco regiones del Brasil, 1980-2000 Prevalence of overweight and obesity in male adolescents from five regions of Brazil, 1980-2000

Directory of Open Access Journals (Sweden)

Vera Lucia de Vasconcelos

2006-12-01

Full Text Available O objetivo deste estudo foi determinar a prevalência e a tendência temporal do sobrepeso/obesidade em adolescentes brasileiros do sexo masculino. Métodos: Utilizou-se como fonte de informações o Banco de Dados do Exército Brasileiro. Esses dados foram coletados entre 1980 e 2000 e consta de 4.031.297 adolescentes entre 17 e 19 anos de idade. Foram realizados cinco cortes transversais, e quantificou-se a prevalência do sobrepeso/obesidade. Considerou-se sobrepeso o índice de massa corporal (IMC entre 25 e 29,9 Kg/m2, e obesidade, IMC > 30 Kg/m2(OMS26. Em todos os estados brasileiros, a prevalência de sobrepeso foi maior que a de obesidade, apesar de a velocidade de incremento ter sido mais alta para obesidade. Ao ser comparada a prevalência do início (1980 com a do final do estudo (2000, observou-se, no Brasil, uma razão de prevalência de 2,58 para sobrepeso e de 8,18 para obesidade. As prevalências de sobrepeso/obesidade mostraram curvas ascensionais com tendência temporal crescente. As informações obtidas neste estudo apontam a necessidade de ações concretas para a prevenção de doenças crônicas em adultos jovens brasileiros.El objetivo de este estudio fué determinar el predominio y la tendencia temporal de sobrepeso / obesidad en brasileños de adolescentes del sexo masculino. Métodos: Se utilizó como fuente de información el banco de datos del Ejército brasileño. Esos datos eran reunido entre 1980 a 2000, y consiste en 4.031.297 adolescentes entre 17 y 19 años de edad. Se realizaron cinco cortes transversales y se cuantificó la prevalencia de sobrepeso/obesidad. Fué considerado sobrepeso el índice de masa corporal (IMC entre 25 y 29,9 Kg/m2, y la obesidad con el mismo índice IMC > 30 Kg/m2(OMS26. En todos los estados brasileños, el predominio de sobrepeso fué mayor que el de la obesidad, a pesar de la velocidad de incremento haber sido mayor para obesidad. La prevalência del principio ser comparado (1980

Closure Report for Corrective Action Unit 240: Area 25 Vehicle Washdown Nevada Test Site, Nevada

International Nuclear Information System (INIS)

Gustafason, D.L.

2001-01-01

The Area 25 Vehicle Washdown, Corrective Action Unit (CAU) 240, was clean-closed following the approved Corrective Action Decision Document closure alternative and in accordance with the Federal Facility Agreement and Consent Order (FFACO, 1996). The CAU consists of thee Corrective Action Sites (CASs): 25-07-01 - Vehicle Washdown Area (Propellant Pad); 25-07-02 - Vehicle Washdown Area (F and J Roads Pad); and 25-07-03 - Vehicle Washdown Station (RADSAFE Pad). Characterization activities indicated that only CAS 25-07-02 (F and J Roads Pad) contained constituents of concern (COCs) above action levels and required remediation. The COCs detected were Total Petroleum Hydrocarbons (TPH) as diesel, cesium-137, and strontium-90. The F and J Roads Pad may have been used for the decontamination of vehicles and possibly disassembled engine and reactor parts from Test Cell C. Activities occurred there during the 1960s through early 1970s. The F and J Roads Pad consisted of a 9- by 5-meter (m) (30- by 15-foot [ft]) concrete pad and a 14- by 13-m (46-by 43-ft) gravel sump. The clean-closure corrective action consisted of excavation, disposal, verification sampling, backfilling, and regrading. Closure activities began on August 21, 2000, and ended on September 19, 2000. Waste disposal activities were completed on December 12, 2000. A total of 172 cubic meters (223 cubic yards) of impacted soil was excavated and disposed. The concrete pad was also removed and disposed. Verification samples were collected from the bottom and sidewalls of the excavation and analyzed for TPH diesel and 20-minute gamma spectroscopy. The sample results indicated that all impacted soil above remediation standards was removed. The closure was completed following the approved Corrective Action Plan. All impacted waste was disposed in the Area 6 Hydrocarbon Landfill. All non-impacted debris was disposed in the Area 9 Construction Landfill and the Area 23 Sanitary Landfill

NCBI nr-aa BLAST: CBRC-GACU-09-0002 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0002 ref|YP_594114.1| amidohydrolase [Deinococcus geothermalis DSM 113...00] gb|ABF44040.1| amidohydrolase [Deinococcus geothermalis DSM 11300] YP_594114.1 5.5 28% ...

EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 25, Revision 2 (FGE.25Rev2): Aliphatic and aromatic hydrocarbons from chemical group 31

DEFF Research Database (Denmark)

Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister

The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 37 flavouring substances in the Flavouring Group Evaluation 25, Revision 2, using the Procedure in Commission Regulation (EC) No 1565/2000. None of the sub......The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 37 flavouring substances in the Flavouring Group Evaluation 25, Revision 2, using the Procedure in Commission Regulation (EC) No 1565/2000. None...... of the substances were considered to have genotoxic potential. The substances were evaluated through a stepwise approach (the Procedure) that integrates information on structure-activity relationships, intake from current uses, toxicological threshold of concern, and available data on metabolism and toxicity...... assessment of these flavouring substances, the specifications for the materials of commerce have also been considered. For five substances, the composition of the stereoisomeric mixture has to be specified further....

OFFICIAL HOLIDAYS IN 2000 AND END-OF-YEAR CLOSURE 2000/2001

CERN Multimedia

Division des ressources humaines

2000-01-01

(Application of Articles RÉII 4.33 and RÉII 4.34 of the Staff Regulations)Official holidays in 2000 (in addition to the end-of-year holidays): Friday, 21st April (Good Friday) Monday, 24th April (Easter Monday) Monday, 1st May Thursday, 1st June (Ascension Day)Monday, 12th June (Whit Monday) Thursday, 7th September ('Jeûne genevois')Annual closure of the site of the Organization and day of special leave granted by the Director-GeneralThe Laboratory will be closed from Saturday, 23rd December 2000 to Sunday, 7th January 2001 inclusive (without deduction of annual leave). The first working day in the New Year will be Monday, 8th January 2001.Human Resources DivisionTel. 74128

[Registry of patients with stroke stated in a public hospital of Peru, 2000-2009].

Science.gov (United States)

Castañeda-Guarderas, Ana; Beltrán-Ale, Guillermo; Casma-Bustamante, Renzo; Ruiz-Grosso, Paulo; Málaga, Germán

2011-12-01

We performed a descriptive study taking on account the characteristics of the registries of the patients hospitalized at the Hospital Nacional Cayetano Heredia between the years 2000 and 2009 with stroke as hospitalization diagnosis. 2225 records were obtained from patients older than 18, with stroke. According to ICD-10, 1071 had diagnosis of ischemic stroke, 554 were hemorrhagic, 183 were subarachnoid hemorrhage, 49 were ischemic plus hemorrhagic, 10 were transient ischemic attack (TIA) and in 358 we were unable to specify the type of stroke. 352 deaths were recorded (19.6 %), most of them during the first 3 days. The male / female ratio was 1.09, the mean age 64.1 ± 17.2 years and the median length of hospital stay was 9 days. The most common associated conditions were high blood pressure, atrial fibrillation and type 2 diabetes mellitus. The mortality found is the highest reported in our country, constant in all age groups and higher in women.

NCBI nr-aa BLAST: CBRC-GGAL-09-0008 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GGAL-09-0008 ref|XP_001568166.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43270.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568166.1 5e-61 23% ...

CDMA2000 Y WCDMA

Directory of Open Access Journals (Sweden)

Jaime Sánchez García

2005-01-01

Full Text Available Este artículo ofrece un panorama general de los sistemas de comunicaciones móviles celulares de tercera generación (3G que han tenido una mayor aceptación (CDMA2000 y WCDMA en el mercado, y una comparación basada en los puntos principales donde los sistemas difieren que indica las ventajas y desventajas de cada uno. Los sistemas de comunicaciones móviles celulares 3G ofrecen mayores capacidades de transmisión a los de segunda generación (2G, y permiten brindar, además de los tradicionales servicios de telefonía celular, servicios de comunicación de datos a velocidades más altas que los de 2G. Las redes CDMA2000 y WCDMA forman parte del estándar IMT-2000 definido por la Unión Internacional de Telecomunicaciones (ITU para sistemas de comunicaciones inalámbricas de tercera generación; éstas son redes de banda ancha que ofrecen mayores velocidades de transmisión de datos, servicios de internet y aplicaciones multimedia

EMPATH 2000

Energy Technology Data Exchange (ETDEWEB)

Arta Lorenta, I.

2014-07-01

The electric motor is a core element in each and every plant. EMPATH 2000 enables online monitoring of electric motors, thus detecting failures at an early stage. Since a plants unexpected shutdown due to an electric motors failure is out of the question, the use of online monitoring devices strikes as an absolute requirement. (Author)

Year 2000 assessment report, Los Alamos National Laboratory

Energy Technology Data Exchange (ETDEWEB)

Weir, D.

1998-04-21

The purpose of this report is to advise managers on the status of Year 2000 readiness at the Laboratory and provide a summary of critical issues to be addressed in order to ensure that the Year 2000 date rollover will not disrupt Laboratory Operations. The Laboratory`s Year 2000 council members are in the first phase of Year 2000 plans: gathering data and assessing the status of their divisions or programs. This first snapshot of the Laboratory Year 2000 readiness assessment is expected to grow and change over time as more refined assessments, plans, and schedules are developed and as more information becomes available. Here are findings to date: (1) Embedded systems` status not known. (2) Preliminary cost estimates for Year 2000 repairs, testing, and implementation are estimated to be at least $5.9 million, not including embedded systems. (3) The Laboratory is required to make unavoidable purchases of Year 2000-compliant products. (4) The Year 2000 short-term issue forces some long-term transition plans to be set aside. (5) The Laboratory is at risk for the following consequences if they can`t demonstrate an active Year 2000 program: risk of system failures; potential funding freezes by the OMB and DOE; legal liabilities; and risk to the UC contract. (6) The deadline for this project is immutable. (7) DOE is continually increasing reporting requirements, expanding from only DOE mission-essential to all operations. (7) DOE audit criticizes the Laboratory`s mission-essential systems planning.

NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0186 ref|XP_001213909.1| predicted protein [Aspergillus terreus NIH262...4] gb|EAU35178.1| predicted protein [Aspergillus terreus NIH2624] XP_001213909.1 0.076 27% ...

NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0074 ref|XP_001564659.1| dynein heavy chain, putative [Leishmania brazil...iensis] emb|CAM38725.1| dynein heavy chain, putative [Leishmania braziliensis] XP_001564659.1 7.8 31% ...

Registration of ‘CP 09-1822’ Sugarcane

Science.gov (United States)

‘CP 09-1822’ (Reg. No. __; PI 686942 sugarcane (a complex hybrid of Saccharum spp.) was released in June 2016 for commercial cultivation on sand (mineral) soils in Florida. This cultivar was developed through a collaborative sugarcane cultivar development program of the USDA-ARS, the University of F...

Annual report 2000

International Nuclear Information System (INIS)

2001-01-01

This document provides information on the activities of the Cea-Industry Group during the year 2000. The following topics are presented: the profile of the Cea-Industry Group, keys data for 2000, the nuclear fuel cycle, the nuclear power plants and nuclear services, the biomedical, the semiconductors, the financial aspects and the management report of the board of directors. A special interest is given to the new organization which has been set up and which will give birth to an industrial group of global dimension, named Topco for the present. By combining the activities of Cogema, Framatome ANP and their subsidiaries, the ''nuclear technologies'' business Topco, will regroup french expertise in the atom, from the fuel cycle to cleanup and dismantling, from services to engineering. (A.L.B.)

Annual report of JMTR, No.15. FY2000. April 1, 2000-March 31, 2001

Energy Technology Data Exchange (ETDEWEB)

NONE

2002-02-01

During the FY2000 (April 2000 to March 2001), the JMTR (Japan Materials Testing Reactor) was operated in 6 operation cycles (130 days) for irradiation studies on the IASCC of the LWR materials, development of actinide contained uranium-hydride fuels, development of fusion blanket materials, and so on. The total number of capsules and hydraulic rabbis irradiated were 132 and 79, respectively. Technology development programs were conducted in the following fields. As concerning to the utilization of JMTR, a irradiation facility for the IASCC studies, irradiation capsules for RPV surveillance specimen and automatic temperature control system for irradiation capsules were developed. New efficient production process was developed for pebble type tritium breeder material for fusion reactor blanket, and tritium generation/recovery behavior under irradiation was investigated using pebble packed test piece. This report summarizes these activities performed in the department of JMTR during the FY2000. (author)

Toward the year 2000.

Science.gov (United States)

1973-12-01

If the world population continues to grow at its present rate, in only about 35 more years there will be an additional 3.5 billion people. Although it is likely that the growth rate will slow down in the future, there will be an increase of between 2.3-3.5 billion people by the year 2000. At that time the Asian, African, and Latin American regions of the world will account for between 81-84% of world population, regardless of whether there is a fertility decline. Simultaneously, the populations of Europe and North America will decrease from 26 to between 16-19%. The People's Republic of China is now working to contain population increase, but despite the efforts for every 10 Chinese alive in 1970 there will be 15 in the year 2000. For the other 9 most populous less developed countries, there will be nearly 20 persons for every 10. As this figure is 12 in the year 2000 for every 10 Russians or Americans in 1970, a significant reduction in the growth rate of population in the 10 largest less developed countries would do much to reduce the world's population problems. The number of children born between now and the year 2000 depends on the fertility of all women in the childbearing ages during that period. Finally, as the population of the world continues to increase, there will be a marked concentration of the world's children in the poorer nations, and this will be a major problem in these developing countries.

Improving aqueous solubility and antitumor effects by nanosized gambogic acid-mPEG2000 micelles

Directory of Open Access Journals (Sweden)

Cai LL

2013-12-01

Full Text Available Lulu Cai,1,* Neng Qiu,2,* Mingli Xiang,3,* Rongsheng Tong,1 Junfeng Yan,1 Lin He,1 Jianyou Shi,1 Tao Chen,4 Jiaolin Wen,3 Wenwen Wang,3 Lijuan Chen31Department of Pharmacy, Sichuan Academy of Medical Science and Sichuan Provincial People's Hospital, 2College of Materials and Chemistry and Chemical Engineering, Chengdu University of Technology, 3State Key Laboratory of Biotherapy, West China Hospital, West China Medical School, Sichuan University, Chengdu, People's Republic of China; 4Faculty of Pharmacy, University of Montreal, Montreal, QC, Canada *These authors contributed equally to this paperAbstract: The clinical application of gambogic acid, a natural component with promising antitumor activity, is limited due to its extremely poor aqueous solubility, short half-life in blood, and severe systemic toxicity. To solve these problems, an amphiphilic polymer-drug conjugate was prepared by attachment of low molecular weight (ie, 2 kDa methoxy poly(ethylene glycol methyl ether (mPEG to gambogic acid (GA-mPEG2000 through an ester linkage and characterized by 1H nuclear magnetic resonance. The GA-mPEG2000 conjugates self-assembled to form nanosized micelles, with mean diameters of less than 50 nm, and a very narrow particle size distribution. The properties of the GA-mPEG2000 micelles, including morphology, stability, molecular modeling, and drug release profile, were evaluated. MTT (3-(4,5-dimethylthiazol-2-yl-2,5 diphenyl tetrazolium bromide tests demonstrated that the GA-mPEG2000 micelle formulation had obvious cytotoxicity to tumor cells and human umbilical vein endothelial cells. Further, GA-mPEG2000 micelles were effective in inhibiting tumor growth and prolonged survival in subcutaneous B16-F10 and C26 tumor models. Our findings suggest that GA-mPEG2000 micelles may have promising applications in tumor therapy.Keywords: gambogic acid, poly(ethylene glycol-drug conjugate, micelle, antitumor, toxicity

Demographic factors associated with smoking cessation during pregnancy in New South Wales, Australia, 2000-2011.

Science.gov (United States)

Passmore, Erin; McGuire, Rhydwyn; Correll, Patricia; Bentley, Jason

2015-04-18

Smoking during pregnancy increases the risk of adverse health outcomes for both the mother and the child. Rates of smoking during pregnancy, and rates of smoking cessation during pregnancy, vary between demographic groups. This study describes demographic factors associated with smoking cessation during pregnancy in New South Wales, Australia, and describes trends in smoking cessation in demographic subgroups over the period 2000 - 2011. Data were obtained from the New South Wales Perinatal Data Collection, a population-based surveillance system covering all births in New South Wales. Multivariate logistic regression was used to explore associations between smoking cessation during pregnancy and demographic factors. Between 2000 and 2011, rates of smoking cessation in pregnancy increased from 4.0% to 25.2%. Demographic characteristics associated with lower rates of smoking cessation during pregnancy included being a teenage mother, being an Aboriginal person, and having a higher number of previous pregnancies. Between 2000 and 2011, rates of smoking cessation during pregnancy increased dramatically across all demographic groups. However, specific demographic groups remain significantly less likely to quit smoking, suggesting a need for targeted efforts to promote smoking cessation in these groups.

Consolidated results 2000. Forecasts 2001

International Nuclear Information System (INIS)

2001-01-01

This document presents an economic analysis of the Group Gaz De France consolidated results for the year 2000. The main topics are the evolution of the energy market, the great economic growth for the five businesses of the Group (exploration-production, trade, transport, distribution and services), financial results affected by the supply costs increase, the position reinforcement among the gas leaders in Europe and the highlights of 2000. (A.L.B.)

NCBI nr-aa BLAST: CBRC-RMAC-09-0022 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RMAC-09-0022 ref|YP_026083.1| NADH dehydrogenase subunit 2 [Steinernema carpoc...apsae] gb|AAT00526.1| NADH dehydrogenase subunit 2 [Steinernema carpocapsae] YP_026083.1 1e-05 30% ...

Two-particle Bose--Einstein correlations in $pp$ collisions at $\\mathbf {\\sqrt{s} =}$ 0.9 and 7 TeV measured with the ATLAS detector

CERN Document Server

Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Almond, John; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batley, Richard; Battaglia, Marco; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boddy, Christopher Richard; Boehler, Michael; Boek, Thorsten Tobias; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozic, Ivan; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caudron, Julien; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Ye; Chen, Yujiao; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirkovic, Predrag; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Do Valle Wemans, André; Dobos, Daniel; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Dwuznik, Michal; Dyndal, Mateusz; Ebke, Johannes; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franconi, Laura; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Guan, Liang; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hoffman, Julia; Hoffmann, Dirk; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hopkins, Walter; Horii, Yasuyuki; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; La Rosa, Alessandro; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Lester, Christopher Michael; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Tadashi; Maeno Kataoka, Mayuko; Maevskiy, Artem; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marques, Carlos; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Mechnich, Joerg; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Narayan, Rohin; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Przysiezniak, Helenka; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Qureshi, Anum; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodrigues, Luis; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Matthew; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarkisyan-Grinbaum, Edward; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Sauvage, Gilles; Sauvan, Emmanuel; Savard, Pierre; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R~Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Velz, Thomas; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chao; Wang, Chiho; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wright, Michael; Wu, Mengqing; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz

2015-10-01

The paper presents studies of Bose--Einstein Correlations (BEC) for pairs of like-sign charged particles measured in the kinematic range $p_{\\rm T} >$ 100 MeV and $|\\eta|<$ 2.5 in proton--proton collisions at centre-of-mass energies of 0.9 and 7 TeV with the ATLAS detector at the CERN Large Hadron Collider. The integrated luminosities are approximately 7 $\\mu$b$^{-1}$, 190 $\\mu$b$^{-1}$ and 12.4 nb$^{-1}$ for 0.9 TeV, 7 TeV minimum-bias and 7 TeV high-multiplicity data samples, respectively. The multiplicity dependence of the BEC parameters characterizing the correlation strength and the correlation source size are investigated for charged-particle multiplicities of up to 240. A saturation effect in the multiplicity dependence of the correlation source size is observed using the high-multiplicity 7 TeV data sample. The dependence of the BEC parameters on the average transverse momentum of the particle pair is also investigated.

Microstructural evolution of nanostructured Ti0.9Al0.1N prepared by reactive ball-milling

International Nuclear Information System (INIS)

Bhaskar, U.K.; Bid, S.; Pradhan, S.K.

2011-01-01

Research highlights: → Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the 0.9 mol fraction of α-Ti (hcp) and 0.1 mol fraction of aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. The main features which are observed in the present study are stated below: 1.During ball-milling of α-Ti, the α-Ti phase partially converted to transient cubic β-Ti phase within 1 h of milling. 2.Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Complete formation of Ti 0.9 Al 0.1 N (fcc) is obtained at 7 h of milling which is lesser than complete formation time (9 h) of TiN. Doping Al atoms accelerates the formation of (TiAl)N phase. 3.The particle size of Ti 0.9 Al 0.1 N decrease rapidly up to 3 h and then increase slightly due to agglomeration effect. 4.The particle size of Ti 0.9 Al 0.1 N estimated from X-ray is in good agreement with that measured from HRTEM. - Abstract: Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the α-Ti (hcp) and aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient cubic β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. After 1 h of milling, all Al atoms are diffused into the α-Ti matrix. The transient β-Ti phase is noticed to form after 1 h of milling and disappears completely after 7 h of milling. Microstructure characterization of unmilled and ball-milled powders by analyzing XRD patterns employing the Rietveld structure refinement reveals the inclusion of Al and nitrogen atoms into the Ti lattice on the way to formation of Ti 0.9 Al 0.1 N

2000 LEPC Survey

Science.gov (United States)

This is the summary report of the 1999 nationwide Local Emergency Planning Committee survey, released in May 2000. It measured their levels of compliance and proactivity, roles in prevention and counter-terrorism, communication, and response plans.

Design, Build & Test of a Double Crystal Monochromator for Beamlines I09 & I23 at the Diamond Light Source

Science.gov (United States)

Kelly, J.; Lee, T.; Alcock, S.; Patel, H.

2013-03-01

A high stability Double Crystal Monochromator has been developed at The Diamond Light Source for beamlines I09 and I23. The design specification was a cryogenic, fixed exit, energy scanning monochromator, operating over an energy range of 2.1 - 25 keV using a Si(111) crystal set. The novel design concepts are the direct drive, air bearing Bragg axis, low strain crystal mounts and the cooling scheme. The instrument exhibited superb stability and repeatability on the B16 Test Beamline. A 20 keV Si(555), 1.4 μrad rocking curve was demonstrated. The DCM showed good stability without any evidence of vibration or Bragg angle nonlinearity.

Some observations on the synthesis and electrolytic properties of (Ba1-xCax (M0.9Y0.1O3, M = Ce, Zr-based samples modified with calcium

Directory of Open Access Journals (Sweden)

Dudek Magdalena

2016-03-01

Full Text Available In this paper, the impact of partial substitution of calcium for barium in (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr on physicochemical properties of the powders and sintered samples was investigated. The powders, with various contents of calcium (x = 0, 0.02, 0.05, 0.1, were prepared by means of thermal decomposition of organometallic precursors containing EDTA. All of the BaCeO3-based powders synthesised at 1100 °C were monophasic with a rhombohedral structure, however, completely cubic BaZrO3-based solid solutions were obtained at 1200 °C. A study of the sinterability of BaZr0.9Y0.1O3 and BaCe0.9Y0.1O3-based pellets was performed under non-isothermal conditions within a temperature range of 25 to 1200 °C. The partial substitution of barium for calcium in the (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr solid solution improved the sinterability of the samples in comparison to the initial BaCe0.9Y0.1O3 or BaZr0.9Y0.1O3. The relative density of calcium-modified BaCe0.9Y0.1O3-based samples reached approximately 95 to 97 % after sintering at 1500 °C for 2 h in air. The same level of relative density was achieved after sintering calcium-modified BaZr0.9Y0.1O3 at 1600 °C for 2 h. Analysis of the electrical conductivity from both series of investigated materials showed that the highest ionic conductivity, in air and wet 5 % H2 in Ar, was attained for the compositions of x = 0.02 to 0.05 (Ba1-xCax(M0.9Y0.1O3, M = Zr, Ce. The oxygen reduction reaction on the interface Pt│BaM0.9Y0.1O3, M = Ce, Zr was investigated using Pt microelectrodes. Selected samples of (Ba1-xCax (M0.9Y0.1O3, M = Zr, Ce were tested as ceramic electrolytes in hydrogen-oxygen solid oxide fuel cells operating at temperatures of 700 to 850 °C.

Registration of ‘CP 09-1430’ Sugarcane

Science.gov (United States)

‘CP 09-1430’ (Reg. No. ; PI 686940 sugarcane (a complex hybrid of Saccharum spp.) was developed and released (6 Jun. 2016) through cooperative research conducted by the USDA-ARS Sugarcane Field Station , Canal Point, the University of Florida, and the Florida Sugar Cane League, Inc. for use on ...

SAFARI 2000 C-130 Aerosol and Meteorological Data, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — ABSTRACT: The Met Office C-130 research aircraft was based at Windhoek, Namibia, between September 5-16, 2000, where it conducted a series of flights over Namibia as...

Union Gas Limited 2000 annual report

International Nuclear Information System (INIS)

2000-01-01

Financial information from Union Gas was presented along with a review of their operations throughout 2000. Union Gas is a major Canadian natural gas utility providing energy services to more than 1.1 million residential, commercial and industrial customers in more than 400 communities in Ontario. The company also provides natural gas storage and transportation services for other utilities and energy market participants in Ontario, Quebec and the United States. Revenue for 2000 was reported to be $1.6 billion, net income was $113 million and assets totaled $3.9 billion. Total throughput for 2000 was 35.8 billion cubic meters. Union Gas is a wholly-owned subsidiary of Westcoast Energy Inc. of Vancouver, British Columbia. In 2000, progress was made toward the introduction of performance-based regulation to replace the cost of service regulation currently in use. This initiative will enable the company to provide competitively priced services to customers, allowing them, along with shareholders to benefit from efficiency enhancements and new service offerings. tabs., figs

LULI 2000 activity report; LULI rapport annuel 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

This document gathers the main results obtained by scientists from the LULI (laboratory for the use of intense lasers) unit in 2000. It is made up of 58 short articles and is organized into 6 topics: 1) laser-matter interaction, 2) hydrodynamics, shocks, equations of state, 3) atom physics, X-ray lasers, 4) material treatment, 5) progress in optics for power lasers, and 6) instrumentation and other advances.

SAFARI 2000 C-130 Aerosol and Meteorological Data, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — The Met Office C-130 research aircraft was based at Windhoek, Namibia, between September 5-16, 2000, where it conducted a series of flights over Namibia as part of...

HAMMLAB 2000 overview

International Nuclear Information System (INIS)

Kvalem, J.

1998-01-01

In the form of a collection of overheads, this is an overview of HAMMLAB 2000. It also covers project organization, advisory groups, research agenda, status of simulators, status of software systems, VR Centre, Petro Hammlab and physical planning

Yearly energy balance sheets 2000-2001

International Nuclear Information System (INIS)

2003-01-01

The total supply of energy during the year 2001 rose by 7 per cent compared with the year 2000, from 588 TWh to 630 TWh. The supply of nuclear power increased by 27 per cent, whereas electricity from waterpower has remained still at approximately 80 TWh. During the year 2001 Sweden exported 18,5 TWh electricity and the import was 11,1 TWh. The use of petroleum products for electricity production was nearly the same, 3,5 TWh during 2001 compared with 3,6 TWh during 2000. The production of heat from petroleum products increased from 3,2 TWh 2000 to 4,3 TWh 2001. The explanation to that is mainly the large increasing of heavy fuel oil in district heating plants. The use of energy during the year 2001 increased by nearly 1 per cent compared with the year 2000, from 391 TWh to 394 TWh. The use of coal, coke, biomass fuels and petroleum products decreased a little between the years, whereas the use of gases, district heating and electricity rises. The industrial sectors energy use decreases a bit from 156 TWh for the year 2000 to 152 TWh the year 2001. An increasing use of gases and district heating can nevertheless be seen. The energy use within transport sector rises from 87 TWh to 88 TWh. Within the household sector there is an increasing use of energy between the years with a total of 3 TWh, from 91 TWh to 94 TWh. The households continue to reduce their use of petroleum products. The use of electricity and district heating increases, by 6 per cent and 15 per cent respectively, between year 2000 and 2001

Annual report 2000

International Nuclear Information System (INIS)

2001-01-01

This report presents the industrial activities and the financial results of the Framatome group (Framatome-SA) in 2000. and Siemens have merged their nuclear activities and have created Framatome-ANP (advanced nuclear power) owned by Framatome (66%) and Siemens (34%). This new society represents a turnover of 3 millions Euros and a staff of 13.000 employees. In the sector of connectors, FCI (Framatome Connectors International) has reinforced its second position in the world, FCI has enjoyed a high growth in the sector of telecommunication and has created a department dealing with optic fibers. 32% of the activities of Framatome-SA have been performed in France, 26% in North America and 42% in the rest of the world. In 2000 the trading results after having paid taxes reached 306 millions Euros, it represents 6.1% of the turnover. (A.C.)

The Indigenous World, 1999-2000 = El Mundo Indigena, 1999-2000.

Science.gov (United States)

Erni, Christian, Comp.; Parellada, Alejandro, Comp.

This annual publication (published separately in English and Spanish) examines political, social, environmental, and educational issues concerning indigenous peoples around the world during 1999-2000. Part 1 highlights news events and ongoing situations in specific countries in nine world regions: the Arctic, North America, Mexico and Central…

Beatlestudies 3, Proceedings of the Beatles 2000 Conference

OpenAIRE

Beatles 2000; Beatles 2000 Conference

2001-01-01

This book contains a selection of papers presented at the BEATLES 2000 Conference, held at the University of Jyvaskyla, Finland, from 15 to 18 June, 2000. The conference was organized by the Department of Music at the University of Jyvaskyla, the BEATLES 2000 research project, and Confennia Ltd.

Dynamic code block size for JPEG 2000

Science.gov (United States)

Tsai, Ping-Sing; LeCornec, Yann

2008-02-01

Since the standardization of the JPEG 2000, it has found its way into many different applications such as DICOM (digital imaging and communication in medicine), satellite photography, military surveillance, digital cinema initiative, professional video cameras, and so on. The unified framework of the JPEG 2000 architecture makes practical high quality real-time compression possible even in video mode, i.e. motion JPEG 2000. In this paper, we present a study of the compression impact using dynamic code block size instead of fixed code block size as specified in the JPEG 2000 standard. The simulation results show that there is no significant impact on compression if dynamic code block sizes are used. In this study, we also unveil the advantages of using dynamic code block sizes.

Res Sep 2014 Cover Tp 08.09.14.cdr

Indian Academy of Sciences (India)

Admin

2010). ISSN 0971-8044. Regn No.KRNAVBGE-340/2012-2014. Licenced to Post without prepayment No.6. Posted at MBC, GPO, Bangalore 560 001, 12.09.14. Registered with Registrar of Newspapers in India vide Regn. No. 66273/96.

NCBI nr-aa BLAST: CBRC-PTRO-09-0001 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PTRO-09-0001 ref|ZP_01444684.1| hypothetical protein R2601_22801 [Roseovarius ...sp. HTCC2601] gb|EAU45065.1| hypothetical protein R2601_22801 [Roseovarius sp. HTCC2601] ZP_01444684.1 0.32 34% ...

09 ISOLA Derive WEB 03.pmd

African Journals Online (AJOL)

Owner

when the political perturbations began in Ivory Coast after the death of President Houphouet-Boigny. In the early 2000, it migrated to the web to be practiced by the ... orale directe à un mode de communication écrit médiatisé par internet, je vais d'abord en présenter la genèse sous la forme selon laquelle il se pratique ...

Caracterización de neonatos con peso inferior a 2000 g Characterization of newborns with a birth weight under 2000 g

Directory of Open Access Journals (Sweden)

Odalys Martín Blanco

2008-09-01

Full Text Available INTRODUCCIÓN. Los niños con bajo peso al nacer son 20 veces más propensos a morir y presentan mayor morbilidad que los nacidos con buen peso. El objetivo de la presente investigación fue caracterizar a los recién nacidos con peso inferior a 2000 g, nacidos entre el 1ro. de enero del 2005 y el 31 de diciembre del 2006 en el Hospital Universitario "América Arias". MÉTODOS. Se realizó un estudio observacional, descriptivo-analítico, longitudinal y prospectivo, cuyo universo fueron los neonatos con peso inferior a 2000 g, nacidos en este período. En el análisis estadístico se utilizó la distribución de frecuencias, la media y la desviación estándar de la ganancia de peso, la talla, y las circunferencias cefálica y braquial. RESULTADOS. El 96,16 % de los pacientes estudiados nacieron con peso entre 1000 y 1999 g. El 93,27 % estuvo por debajo de las 36,6 semanas de gestación y en el 75,96 % de los casos el parto fue distócico. El 61,54 % de los neonatos tuvo peso adecuado para su edad gestacional. Predominaron los pacientes con factores de riesgo asociados. Más de la mitad presentó morbilidad asociada, principalmente por sepsis (25,96 %. Falleció el 10,58 % de los recién nacidos. CONCLUSIONES. Las principales causas del bajo peso de los recién nacidos fueron el embarazo múltiple y la enfermedad hipertensiva de la gestación. Las defunciones se comportaron por debajo de lo esperado. En los pacientes con crecimiento intrauterino retardado simétricos, la ganancia de peso y talla al alta fue significativamente mayor que en los asimétricos y adecuados para su edad gestacional.INTRODUCTION. Children with low birth weight are 20 times more prone to die and to have a greater morbidity than those with an adequate weight. The objective of this research was to characterize the newborn infants with a weight lower than 2000 g that were born between January 1st, 2005 and December 31st , 2006 in "America Arias" Children Hospital. METHODS

Meningen over abortus in West-Europa, 1981-2000 [Abortion attitudes in Western Europe, 1981-2000

OpenAIRE

Need, A.; Ultee, W.C.; Levels, M.; Tienen, M. van

2008-01-01

Summary Abortion attitudes in Western Europe, 1981-2000 This article answers descriptive and explanatory questions about abortion attitudes in Western Europe between 1981 and 2000. It explains country differences and trends in these attitudes with abortion laws of states, with the norms that prevail in churches and schools, and with opinions and behaviour of others in a society. Using the European and World Value Surveys, complemented with abortion statistics and information about abortion la...

Structural study of the capsid protein of Mason-Pfizer monkey virus

Czech Academy of Sciences Publication Activity Database

Benedíková, Jitka; Pichová, Iva; Ruml, T.; Rumlová, Michaela

2000-01-01

Roč. 94, č. 8 (2000), s. 522 ISSN 0009-2770. [Biochemický sjezd /17./. 07.09.2000-10.09.2000, Praha] R&D Projects: GA ČR GA203/00/1005; GA ČR GA203/98/P151 Institutional research plan: CEZ:AV0Z4055905 Subject RIV: CE - Biochemistry

The Solar Neighborhood. XXXX. Parallax Results from the CTIOPI 0.9 m Program: New Young Stars Near the Sun

Energy Technology Data Exchange (ETDEWEB)

Bartlett, Jennifer L.; Finch, Charlie T. [U.S. Naval Observatory, Washington, DC 20392 (United States); Lurie, John C. [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Riedel, Adric [California Institute of Technology, Pasadena, CA 91125 (United States); Ianna, Philip A.; Henry, Todd J. [RECONS Institute, Chambersburg, PA 17201 (United States); Jao, Wei-Chun [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30302 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Subasavage, John P., E-mail: jennifer.bartlett@navy.mil, E-mail: charlie.finch@usno.navy.mil, E-mail: lurie@uw.edu, E-mail: adric.riedel@gmail.com, E-mail: philianna3@gmail.com, E-mail: thenry@chara.gsu.edu, E-mail: jao@chara.gsu.edu, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: jsubasavage@nofs.usno.navy.mil [U.S. Naval Observatory, Flagstaff, AZ 86001 (United States)

2017-10-01

As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr{sup −1}, including 2MASS J02511490-0352459, which exceeds 2.″0 yr{sup −1}. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V  = 11–22 mag and spectral types M3.0V–L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na i and K i gravity indicators, H α measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ∼120 Myr.

The Solar Neighborhood. XXXX. Parallax Results from the CTIOPI 0.9 m Program: New Young Stars Near the Sun

Science.gov (United States)

Bartlett, Jennifer L.; Lurie, John C.; Riedel, Adric; Ianna, Philip A.; Jao, Wei-Chun; Henry, Todd J.; Winters, Jennifer G.; Finch, Charlie T.; Subasavage, John P.

2017-10-01

As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr-1, including 2MASS J02511490-0352459, which exceeds 2.″0 yr-1. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V = 11-22 mag and spectral types M3.0V-L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na I and K I gravity indicators, Hα measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ˜120 Myr.

The Indigenous World, 2000/2001 = El mundo indigena, 2000/2001.

Science.gov (United States)

Molbech, Anette, Ed.

This annual publication (published separately in English and Spanish) examines political, social, environmental, and educational issues concerning indigenous peoples around the world in 2000-01. Part 1 describes current situations and events in 11 world regions: the Arctic; North America; Mexico and Central America; South America; Australia and…

Estimation of excess mortality due to long-term exposure to PM2.5 in Japan using a high-resolution model for present and future scenarios

Science.gov (United States)

Goto, Daisuke; Ueda, Kayo; Ng, Chris Fook Sheng; Takami, Akinori; Ariga, Toshinori; Matsuhashi, Keisuke; Nakajima, Teruyuki

2016-09-01

Particulate matter with a diameter of less than 2.5 μm, known as PM2.5, can affect human health, especially in elderly people. Because of the imminent aging of society in the near future in most developed countries, the human health impacts of PM2.5 must be evaluated. In this study, we used a global-to-regional atmospheric transport model to simulate PM2.5 in Japan with a high-resolution stretched grid system (∼10 km for the high-resolution model, HRM) for the present (the 2000) and the future (the 2030, as proposed by the Representative Concentrations Pathway 4.5, RCP4.5). We also used the same model with a low-resolution uniform grid system (∼100 km for the low-resolution model, LRM). These calculations were conducted by nudging meteorological fields obtained from an atmosphere-ocean coupled model and providing emission inventories used in the coupled model. After correcting for bias, we calculated the excess mortality due to long-term exposure to PM2.5 among the elderly (over 65 years old) based on different minimum PM2.5 concentration (MINPM) levels to account for uncertainty using the simulated PM2.5 distributions to express the health effect as a concentration-response function. As a result, we estimated the excess mortality for all of Japan to be 31,300 (95% confidence intervals: 20,700 to 42,600) people in 2000 and 28,600 (95% confidence intervals: 19,000 to 38,700) people in 2030 using the HRM with a MINPM of 5.8 μg/m3. In contrast, the LRM resulted in underestimates of approximately 30% (for PM2.5 concentrations in the 2000 and 2030), approximately 60% (excess mortality in the 2000) and approximately 90% (excess mortality in 2030) compared to the HRM results. We also found that the uncertainty in the MINPM value, especially for low PM2.5 concentrations in the future (2030) can cause large variability in the estimates, ranging from 0 (MINPM of 15 μg/m3 in both HRM and LRM) to 95,000 (MINPM of 0 μg/m3 in HRM) people.

NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 ref|NP_001017377.1| progestin and adipoQ receptor family member I...V [Rattus norvegicus] gb|AAH92635.1| Progestin and adipoQ receptor family member IV [Rattus norvegicus] gb|EDM03772.1| progesti

Synthesis and characterization of structural, morphological and photosensor properties of Cu0.1Zn0.9S thin film prepared by a facile chemical method

Science.gov (United States)

Gubari, Ghamdan M. M.; Ibrahim Mohammed S., M.; Huse, Nanasaheb P.; Dive, Avinash S.; Sharma, Ramphal

2018-05-01

The Cu0.1Zn0.9S thin film was grown by facile chemical bath deposition (CBD) method on glass substrates at 60°C. The structural, morphological, photosensor properties of the as-grown thin film has been investigated. The structural and phase confirmation of the as-grown thin film was carried out by X-ray diffraction (XRD) technique and Raman spectroscopy. The FE-SEM images showed that the thin films are well covered with material on an entire glass substrate. From the optical absorption spectrum, the direct band gap energy for the Cu0.1Zn0.9S thin film was found to be ˜3.16 eV at room temperature. The electrical properties were measured at room temperature in the voltage range ±2.5 V, showed a drastic enhancement in current under light illumination with the highest photosensitivity of ˜72 % for 260 W.

KURRI progress report 1999. April 1999 - March 2000

International Nuclear Information System (INIS)

2000-01-01

The KUR (Kyoto-University Reactor) was operated 1,462 hours though some troubles happened at control rods in the fiscal year of 1999. In the same time, we accepted 6,082 man-day researchers for their experiments and scientific meeting at KURRI (Kyoto-University Research Reactor Institute). Two international symposia supported by KURRI on the neutron radiography and on the environmental plutonium were also held in the year. Kyoto University Critical Assembly (KUCA) was celebrated for its 25th anniversary on 10th March 2000. During 25 years 1,652 students came from outside to take the educational program of KUCA, which was open to all Japanese university graduate courses. The progress report compiles one-page briefings of research activities by authors on following 10 categories: 1) Slow Neutron Physics and Neutron Scattering (22 authors). 2) Nuclear Physics and Nuclear Data (12 authors). The 6 papers among them are on Project Research on Systematic Studies of Neutron Rich Nuclei by Using ISOL (Isotope Separator On-Line). 3) Reactor Physics and Reactor Engineering (9 authors). 4) Material Science and Radiation Effect (42 authors). Project Research on the Condensed Matter by Use of Nuclear Probe includes 10 papers, and Project Research on Material Irradiation Effect under Controlled Irradiation Fields includes 10 papers. 5) Geochemistry and Environmental Science (29 authors). The 4 papers among them are on Project Research on Ultra-Low-Level Environmental Radio-Nuclide Analysis. 6) Life-Science and Medical Science (18 authors). Project Research on Non-Equilibrium Radical Process in Biological Molecule System includes 5 papers, and Project Research on Biological Effects of Intermediate Energy Neutron of the KUR Facility on the Mammalian Cells includes 3 papers. 7) Neutron Capture Therapy (26 authors). 8) Neutron Radiography and Radiation Application (4 authors). 9) TRU and Nuclear Chemistry (14 authors). The 9 papers among them are on Project Research on Nuclear and

Progress report 1999-2000; Rapport d'activite 1999-2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

This document presents the activities of the CENBG for the 1999 and 2000 years. The activities are arranged into 7 topics: 1) astro-particles, 2) high spins and big deformations, 3) fundamental interactions, 4) exotic nuclei, 5) the down end of the nuclear fuel cycle and ADS (accelerator driven system), 6) theoretical physics and 7) at the interface between physics and biology. Among a lot of achievements relevant to INIS we can note: -) the investigation of 2 new modes of decay: the bound internal conversion and the Pauli forbidden bound internal conversion, -) the progress made on the Nemo-3 experiment whose purpose is the possibility of detecting the neutrinoless double beta decay from the kinematics specificities of the 2 electrons released, -) the first observation of the doubly-magic nucleus Ni{sup 48}, -) the beta delayed proton and gamma -ray spectroscopy of Mg{sup 21} and Si{sup 25} nuclei, -) the identification of the fundamental state of Li{sup 10}, -) the measurement of the masses of nuclei close to N = Z line in the region A = 80, -) the measurement of the beta decay of Ga{sup 62} (T = 116 ms), and concerning ADS technology: -) the neutron capture cross-section of Th{sup 232} has been measured in the energy range from 60 keV to 2 MeV, -) the determination of neutron induced fission cross-section of Pa{sup 233} in the fast neutron energy range from 0.5 to 10 MeV, and -) the measurement of isotopic distributions for all residual elements from Ti to Pb produced in the reaction 1 A.GeV Pb{sup 208} on proton. (A.C.)

Highlights Eurosites insights; highlights on image, implementation, interpretation and integration of Natura 2000 in European perspective; United Kingdom, Sweden, Spain, France and Hungary

NARCIS (Netherlands)

Neven, M.G.G.; Kistenkas, F.H.

2005-01-01

Highlighting the main report Eurosites Insights this comparative study analyses Natura 2000 nature conservation (EU Birds- and Habitats Directives) alongside the key issues of image, implementation, interpretation and integration. Having quick scanned the EU25, five member states have been selected

European Communities (Drinking water) Regulations, 2000

International Nuclear Information System (INIS)

2000-12-01

These Regulations were adopted as Statutory Instrument No. 439 of 2000 on 18 December 2000 and come in to operation on 1 January 2004. The regulations give effect to provisions of EU Council Directive 98/83/EC on the quality of water intended for human consumption.. They prescribe quality standards to be applied in relation to certain supplies of drinking water. S.I. 439 of 2000 stipulates that the radiation dose arising from one year's consumption of drinking water should not exceed 0.1 mSv. It further stipulates that the dose calculation should include contributions from all natural and artificial radionuclides with the exception of tritium, potassium-40, radon and radon decay products

Prospects for SIMPLE 2000: a large-mass, low-background superheated droplet detector for WIMP searches

International Nuclear Information System (INIS)

Collar, J.I.; Girard, T.A.; Miley, H.S.; Waysand, G.

2000-01-01

The Superheated Instrument for Massive Particle searches (SIMPLE 2000) will consist of an array of 8-16 large active mass (approx. 15 g) superheated droplet detectors (SDDs) to be installed in the new underground laboratory of Rustrel-Pays d'Apt. Several factors make the use of SDDs an attractive approach for the detection of weakly interacting massive particles (WIMPs), namely their intrinsic insensitivity to minimally ionizing particles, high fluorine content, low cost and operation at near ambient pressure and temperature. We comment here on the fabrication, calibration and already-competitive first limits from prototype SDDs for SIMPLE, as well as on the expected immediate increase in sensitivity of the programme, which aims at an exposure of > 25 kg day during 2000. The ability of modest-mass fluorine-rich detectors to investigate regions of neutralino parameter space beyond the reach of the most ambitious cryogenic projects is pointed out. (author)

Prospects for SIMPLE 2000: a large-mass, low-background superheated droplet detector for WIMP searches

International Nuclear Information System (INIS)

Collar, J I; Puibasset, J; Girard, T A; Limagne, D; Miley, H S; Waysand, G

2000-01-01

The Superheated Instrument for Massive Particle searches (SIMPLE 2000) will consist of an array of 8-16 large active mass (≅15 g) superheated droplet detectors (SDDs) to be installed in the new underground laboratory of Rustrel-Pays d'Apt. Several factors make the use of SDDs an attractive approach for the detection of weakly interacting massive particles (WIMPs), namely their intrinsic insensitivity to minimally ionizing particles, high fluorine content, low cost and operation at near ambient pressure and temperature. We comment here on the fabrication, calibration and already-competitive first limits from prototype SDDs for SIMPLE, as well as on the expected immediate increase in sensitivity of the programme, which aims at an exposure of > 25 kg day during 2000. The ability of modest-mass fluorine-rich detectors to investigate regions of neutralino parameter space beyond the reach of the most ambitious cryogenic projects is pointed out

NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0033 ref|YP_001510423.1| hypothetical protein Franean1_6173 [Frankia s...p. EAN1pec] gb|ABW15517.1| hypothetical protein Franean1_6173 [Frankia sp. EAN1pec] YP_001510423.1 0.097 29% ...

NCBI nr-aa BLAST: CBRC-GACU-09-0004 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0004 ref|XP_747491.1| K+ homeostasis protein Kha1, putative [Aspergill...us fumigatus Af293] gb|EAL85453.1| K+ homeostasis protein Kha1, putative [Aspergillus fumigatus Af293] XP_747491.1 0.53 28% ...

NCBI nr-aa BLAST: CBRC-RMAC-09-0031 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RMAC-09-0031 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 0.0 97% ...

NCBI nr-aa BLAST: CBRC-TGUT-09-0014 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TGUT-09-0014 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 1e-144 67% ...

NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0017 ref|NP_001025549.1| potassium voltage-gated channel, shaker-relat...ed subfamily, member 3 [Gallus gallus] gb|AAP94028.1| shaker subfamily potassium channel Kv1.3 [Gallus gallus] NP_001025549.1 0.0 83% ...

NCBI nr-aa BLAST: CBRC-PABE-09-0037 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PABE-09-0037 ref|YP_890142.1| hypothetical protein MSMEG_5916 [Mycobacterium sme...gmatis str. MC2 155] gb|ABK71889.1| hypothetical protein MSMEG_5916 [Mycobacterium smegmatis str. MC2 155] YP_890142.1 0.033 36% ...

NCBI nr-aa BLAST: CBRC-GACU-09-0056 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0056 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 68% ...

Mortality trends from hypertension in Mexico by socioeconomic region and state, 2000-2008 Tendencias de mortalidad por hipertensión arterial por región socioeconómica y estado en México, 2000-2008

Directory of Open Access Journals (Sweden)

Juan Jesús Sánchez-Barriga

2012-08-01

Full Text Available OBJECTIVE: To determine mortality trends from hypertension in Mexico nationwide, by state, by socioeconomic region, and by sex and to establish an association between education, state of residence, and socioeconomic region with mortality from hypertension in 2000-2008. METHODS: Records of mortality associated with hypertension for 2000-2008 were obtained from the National Information System of the Secretariat of Health. This information is generated by the National Institute of Statistics, Geography and Informatics through death certificates issued throughout the country. International Classification of Diseases, 10th Revision, codes corresponding to the basic cause of death from hypertension were identified. Rates of mortality nationwide, by state, and by socioeconomic region were calculated. The strength of association (obtained by Poisson regression between states where individuals resided, socioeconomic regions, and education with mortality from hypertension was determined. The seven socioeconomic regions were elaborated by the National Institute of Statistics, Geography and Informatics and include the 31 states and Mexico City according to indicators that are related to well-being such as education, occupation, health, housing, and employment. RESULTS: Individuals who did not complete elementary school had a higher risk of dying from hypertension than people with more or no education [relative risk (RR 1.462, 95% confidence interval (CI 1.442-1.482]. Mexico City, Oaxaca, and region 7 had the strongest association with dying from hypertension [Mexico City: RR 2.6, CI 2.1-3.2 (2000 and RR 2.5, CI 2.1-3.1 (2005; Oaxaca: RR 2.4, CI2.0-3.0 (2006 and RR 2.7, CI2.3-3.3 (2008; region 7: RR 1.58, CI 1.45-1.72 (2000 and RR 1.25, CI 1.17-1.34 (2008]. CONCLUSIONS: Age-adjusted mortality rates per 100 000 inhabitants who died from hypertension increased from 15.7 to 18.5 between 2000 and 2008, taking the world population age distribution as standard

Year 2000 Tropical Cyclones of the World

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Year 2000 Tropical Cyclones of the World poster. During calendar year 2000, forty-five tropical cyclones with sustained surface winds of at least 64 knots were...

SAFARI 2000 PAI Estimates from Hemispherical Photography, Kalahari Transect

Data.gov (United States)

National Aeronautics and Space Administration — ABSTRACT: This data set was collected during February-March 2000 wet season and September 2000 dry season field campaigns of SAFARI 2000. Mongu in Zambia and...

Research and Development. Annual Report 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

This report discusses the research and development activities in which NVE has been involved in 2000. These activities fall into three categories: watercourse research, hydrological research and energy related research. The HYDRA research programme, which studied flooding and human intervention, is discussed in particular. The report includes a list of research and development reports that were published in 2000.

Undergraduate Education with the WIYN 0.9-m Telescope

Science.gov (United States)

Pilachowski, Catherine A.

2017-01-01

Several models have been explored at Indiana University Bloomington for undergraduate student engagement in astronomy using the WIYN 0.9-m telescope at Kitt Peak. These models include individual student research projects using the telescope, student observations as part of an observational techniques course for majors, and enrichment activities for non-science majors in general education courses. Where possible, we arrange for students to travel to the telescope. More often, we are able to use simple online tools such as Skype and VNC viewers to give students an authentic observing experience. Experiences with the telescope motivate students to learn basic content in astronomy, including the celestial sphere, the electromagnetic spectrum, telescopes and detectors, the variety of astronomical objects, date reduction processes, image analysis, and color image creation and appreciation. The WIYN 0.9-m telescope is an essential tool for our program at all levels of undergraduate education

SAFARI 2000 TOMS Tropospheric Ozone Data, Southern Africa Subset, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — Tropical Tropospheric Ozone (TTO) data from Earth Probe (EP) Total Ozone Mapping Spectrometer (TOMS) for the period of August 8-September 29, 2000 were processed and...

SAFARI 2000 PAI Estimates from Hemispherical Photography, Kalahari Transect

Data.gov (United States)

National Aeronautics and Space Administration — This data set was collected during February-March 2000 wet season and September 2000 dry season field campaigns of SAFARI 2000. Mongu in Zambia and Pandematenga (aka...

Global biofuel use, 1850-2000

Science.gov (United States)

Fernandes, Suneeta D.; Trautmann, Nina M.; Streets, David G.; Roden, Christoph A.; Bond, Tami C.

2007-06-01

This paper presents annual, country-level estimates of biofuel use for the period 1850-2000. We estimate that global biofuel consumption rose from about 1000 Tg in 1850 to 2460 Tg in 2000, an increase of 140%. In the late 19th century, biofuel consumption in North America was very high, ˜220-250 Tg/yr, because widespread land clearing supplied plentiful fuelwood. At that time biofuel use in Western Europe was lower, ˜180-200 Tg/yr. As fossil fuels became available, biofuel use in the developed world fell. Compensating changes in other parts of the world, however, caused global consumption to remain remarkably stable between 1850 and 1950 at ˜1200 ± 200 Tg/yr. It was only after World War II that biofuel use began to increase more rapidly in response to population growth in the developing world. Between 1950 and 2000, biofuel use in Africa, South Asia, and Southeast Asia grew by 170%, 160%, and 130%, respectively.

Annual Statistical Supplement, 2000

Data.gov (United States)

Social Security Administration — The Annual Statistical Supplement, 2000 includes the most comprehensive data available on the Social Security and Supplemental Security Income programs. More than...

Swiss energy statistics 2000; Schweizerische Gesamtenergiestatistik 2000/Statistique globale suisse de l'energie 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

This comprehensive report presents the Swiss Federal Office of Energy's statistics on energy production and consumption in Switzerland in 2000. Facts and figures are presented in tables and diagrams. First of all, a general overview of Swiss energy consumption is presented that includes details on the shares taken by the various energy carriers involved and their development during the period reviewed. The article also includes graphical representations of energy usage in various sectors such as households, trade and industry, transport and the services sector. Also, economic data on energy consumption is presented. A second chapter takes a look at energy flows from producers to consumers and presents an energy balance for Switzerland in the form of tables and an energy-flow diagram. The individual energy sources and the import, export and storage of energy carriers are discussed as is the conversion between various forms and categories of energy. Details on the consumption of energy, its growth over the years up to 2000 and energy use in various sectors are presented. Finally, the Swiss energy balance with reference to the use of renewable sources of energy such as solar energy, biomass, wastes and ambient heat is discussed and figures are presented on the contribution of renewables to heating and the generation of electrical power.

Annual report 2000

International Nuclear Information System (INIS)

2001-07-01

Article VI.J of the Agency's Statute requires the Board of Governors to submit 'an annual report to the General Conference concerning the affairs of the Agency and any projects approved by the Agency'. This report covers the period 1 January to 31 December 2000

Estimated number of adults with prediabetes in the US in 2000: opportunities for prevention.

Science.gov (United States)

Benjamin, Stephanie M; Valdez, Rodolfo; Geiss, Linda S; Rolka, Deborah B; Narayan, K M Venkat

2003-03-01

To estimate the percent and number of overweight adults in the U.S. with prediabetes who would be potential candidates for diabetes prevention as per the American Diabetes Association Position Statement (12). We analyzed data from the Third National Health and Nutrition Examination Survey (NHANES III; 1988-1994) and projected our estimates to the year 2000. We defined impaired glucose tolerance (IGT; 2-h glucose 140-199 mg/dl), impaired fasting glucose (IFG; fasting glucose 110-125 mg/dl), and prediabetes (IGT or IFG) per American Diabetes Association (ADA) criteria. The ADA recently recommended that all overweight people (BMI >or=25 kg/m(2)) who are >or=45 years of age with prediabetes could be potential candidates for diabetes prevention, as could prediabetic people aged >25 years with risk factors. In NHANES III, 2-h postload glucose concentrations were done only among subjects aged 40-74 years. Because we were interested in overweight people who had both the 2-h glucose and fasting glucose tests, we limited our estimates of IGT, IFG, and prediabetes to those aged 45-74 years. RESULTS-Overall, 17.1% of overweight adults aged 45-74 years had IGT, 11.9% had IFG, 22.6% had prediabetes, and 5.6% had both IGT and IFG. Based on those data, we estimated that in the year 2000, 9.1 million overweight adults aged 45-74 had IGT, 5.8 million had IFG, 11.9 million had prediabetes, and 3.0 million had IGT and IFG. Almost 12 million overweight individuals aged 45-74 years in the U.S. may benefit from diabetes prevention interventions. The number will be substantially higher if estimation is extended to individuals aged >75 and 25-44 years.

Effects of glucose and sucrose variants of the caries-promoting Diet 2000 on the feeding patterns and parotid glands of prematurely weaned rats.

Science.gov (United States)

Redman, Robert S

2015-03-01

The hypothesis of this study was that feeding glucose instead of sucrose in the cariogenic Diet 2000 to rats weaned at age 18 days would result in greater light/dark differences in feeding activity and secretion and storage of parotid salivary enzymes. Diet 2000 and a stock commercial diet (controls) were prepared in pelleted and powdered forms, as the increased mastication required by pellets has been shown to support circadian rhythms in rats. Food jars were weighed at lights on and just prior to lights off daily. Rats were euthanized at 25 days and their parotid glands removed, weighed, and analyzed for specific activities of the salivary enzymes α-amylase and deoxyribonuclease I. Light/dark differences in feeding activity were strong in the rats fed the pelleted stock diet and both powdered and pelleted glucose 2000 diets, moderate with the pelleted sucrose 2000 diet, and not significant with the powdered sucrose 2000 and stock diets. Light/dark differences in the parotid salivary enzymes were strong with the powdered glucose 2000 diet and the pelleted forms of the glucose and sucrose 2000 and stock diets, and not significant with the powdered stock and sucrose 2000 diets. Caries reportedly is higher in sucrose than glucose fed to rats in the standard powdered form of Diet 2000, mainly due to the colonizing advantage Streptococcus mutans gains with sucrose. These results suggest that additional factors are more feeding during lights on and less stimulation of parotid salivary secretion with the sucrose powder. Published by Elsevier Ltd.

Updated atmospheric speciated mercury emissions from iron and steel production in China during 2000–2015

Directory of Open Access Journals (Sweden)

Q. Wu

2017-09-01

Full Text Available Iron and steel production (ISP is one of the significant atmospheric Hg emission sources in China. Atmospheric mercury (Hg emissions from ISP during 2000–2015 were estimated by using a technology-based emission factor method. To support the application of this method, databases of Hg concentrations in raw materials, technology development trends, and Hg removal efficiencies of air pollution control devices (APCDs were constructed through national sampling and literature review. Hg input to ISP increased from 21.6 t in 2000 to 94.5 t in 2015. In the various types of raw materials, coking coal and iron concentrates contributed 35–46 and 25–32 % of the total Hg input. Atmospheric Hg emissions from ISP increased from 11.5 t in 2000 to 32.7 t in 2015 with a peak of 35.6 t in 2013. Pollution control promoted the increase in average Hg removal efficiency, from 47 % in 2000 to 65 % in 2015. During the study period, sinter/pellet plants and blast furnaces were the largest two emission processes. However, emissions from roasting plants and coke ovens cannot be ignored, which accounted for 22–34 % of ISP's emissions. Overall, Hg speciation shifted from 50/44/6 (gaseous elemental Hg (Hg0/gaseous oxidized Hg (HgII/particulate-bound Hg (Hgp in 2000 to 40/59/1 in 2015, which indicated a higher proportion of Hg deposition around the emission points. Future emissions of ISP were expected to decrease based on the comprehensive consideration crude-steel production, steel scrap utilization, energy saving, and pollution control measures.

NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0186 ref|ZP_01510169.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirm...ans PsJN] gb|EAV05032.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirmans PsJN] ZP_01510169.1 1.4 31% ...

NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0074 ref|XP_001558290.1| hypothetical protein BC1G_02954 [Botryotinia fuck...eliana B05.10] gb|EDN18805.1| hypothetical protein BC1G_02954 [Botryotinia fuckeliana B05.10] XP_001558290.1 2.7 34% ...

The growth in newspaper coverage of tobacco control in China, 2000-2010.

Science.gov (United States)

Gao, Junling; Chapman, Simon; Sun, Shaojing; Fu, Hua; Zheng, Pinpin

2012-03-07

Media coverage of tobacco-related issues can potentially shape individual beliefs, attitudes and behaviors about tobacco use. This study aims to describe news coverage of tobacco control related issues in Chinese newspapers from 2000 to 2010. All 1149 articles related to tobacco control were extracted from the Database of Chinese Important Newspapers and content analyzed for the period Jan 1, 2000 to Dec 31, 2010. The changing pattern of tobacco control topic, article type, viewpoint, and article origin, and their relationship were analysed. News coverage of tobacco control related issues increased significantly (p newspapers (χ2 = 24.09, p = 0.002) and article types (χ2 = 193.35, p newspapers had more coverage of the dangers of tobacco and on enforcing bans on tobacco-advertising. News stories centered around monitoring tobacco use and smoke free activity, while editorials focused on enforcing bans on tobacco-advertising, youth access and programs and campaigns. Letters to editors focused on the dangers of smoking, raising tax, and smoking cessation. More articles (50.4%) took an anti-tobacco position (compared with 10.5% which were pro-smoking), with the amount of negative coverage growing significantly across the decade. National articles tended to lean toward anti-tobacco, however, local articles tended mix of pro-tobacco and neutral/balance positions. Editorials seemed to be more anti-tobacco oriented, but letters to the editor tended to show a mix of anti-tobacco and pro-tobacco positions. Chinese newspapers are giving increasing attention to tobacco control, but coverage remains lower than in the USA and Australia. Health workers need to give higher priority to efforts to increase news coverage beyond the present concentration around World No Tobacco Day and to develop strategies for making tobacco control issues more newsworthy to both national and local news outlets.

Marketing program for R2000 in Ontario

International Nuclear Information System (INIS)

Killins, B.L.

1990-01-01

In the Ontario new housing market, Ontario Hydro's goal is to reduce the demand for electricity, increase the utility's visibility in this market, and increase customer satisfaction. Analyses have demonstrated that it costs less to construct new houses according to R-2000 insulation standards than to install new power production and transmission facilities. Research has also shown that R-2000 houses have better air quality and energy efficiency than ordinary houses. Nevertheless, most home builders have little enthusiasm for R-2000 houses; the strictness of airtightness standards, the slowness of certification, excessive paperwork, and a lack of promised marketing support are cited as the reasons for this. Ontario Hydro and builders' associations have signed a cooperative agreement for certifying new houses with the object of self-financing the program. The program intends to see construction of 1,000 R-2000 houses in 1990. To carry out this objective, some elements have been added to Ontario Hydro's marketing program in order to make potential customers aware of the advantages of the R-2000 house. Field staff will receive rigorous training in order to prepare them for helping the diverse types of builders. A mail campaign, focusing on areas not served by natural gas where significant numbers of new houses are being built, intends to bring home builders and buyers together. In February 1990, Ontario Hydro signed agreements with four major housing manufacturers to construct a significant proportion of the R-2000 housing stock

An ecological study of skin biopsies and skin cancer treatment procedures in the United States Medicare population, 2000 to 2015.

Science.gov (United States)

Wang, David M; Morgan, Frederick C; Besaw, Robert J; Schmults, Chrysalyne D

2018-01-01

Analyses of skin cancer procedures adjusted for population changes are needed. To describe trends in skin cancer-related biopsies and procedures in Medicare beneficiaries. An ecological study of Medicare claims for skin biopsies and skin cancer procedures in 2000 to 2015. Biopsies increased 142%, and skin cancer procedures increased 56%. Mohs micrographic surgery (MMS) utilization increased on the head/neck, hands/feet, and genitalia (increasing from 11% to 27% of all treatment procedures) but was low on the trunk/extremities (increasing from 1% to 4%). Adjusted for increased Medicare enrollment (+36%) between 2000 and 2015, the number of biopsies and MMS procedures performed per 1000 beneficiaries increased (from 56 to 99 and from 5 to 15, respectively), whereas the number of excisions and destructions changed minimally (from 18 to 16 and from 19 to 18, respectively). Growth in biopsies and MMS procedures slowed between each time period studied: 4.3 additional biopsies per year and 0.9 additional MMS procedures per year per 1000 beneficiaries between 2000 and 2007, 2.2 and 0.5 more between 2008 and 2011, and 0.5 and 0.3 more between 2012 and 2015, respectively. Medicare claims-level data do not provide patient-level or nonsurgical treatment information. The increased number of skin cancer procedures performed was largely the result of Medicare population growth over time. MMS utilization increased primarily on high- and medium-risk and functionally and cosmetically significant locations where tissue sparing and maximizing cure are critical. Copyright © 2017 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Urban and Rural Ozone Collect over Lusaka (Zambia, 15.5 S, 28 E) during SAFARI-2000 (September 2000)

Science.gov (United States)

Thompson, Anne M.; Witte, Jacquelyn C.; Freiman, M. Tai; Phalane, N. Agnes; Coetzee, Gert J. R.

2002-01-01

In early September, throughout south central Africa, seasonal clearing of dry vegetation and the production of charcoal for cooking leads to intense smoke haze and ozone formation. Ozone soundings made over Lusaka in early September 2000 recorded layers of high ozone (greater than 125 ppbv at 5 km) during two stagnant periods, broken by a frontal passage that reduced boundary layer ozone by 30%. During the 6-day measurement period, surface ozone concentrations ranged from 50-95 ppbv and integrated tropospheric ozone from the soundings was 39-54 Dobson Units (note 1.3 km elevation at the launch site). A stable layer of high ozone at 2-5 km was advected from rural burning regions in western Zambia and neighboring countries, making Lusaka a collection point for transboundary pollution. This is confirmed by trajectories that show ozone leaving Angola, Namibia, Botswana and South Africa before heading toward the Indian Ocean and returning to Lusaka via Mozambique and Zimbabwe. Ozone in the mixed layer at Lusaka is heavily influenced by local sources.

Closure Report for Corrective Action Unit 135: Areas 25 Underground Storage Tanks, Nevada Test Site, Nevada

Energy Technology Data Exchange (ETDEWEB)

D. H. Cox

2001-06-01

Corrective Action Unit (CAU) 135, Area 25 Underground Storage Tanks, was closed in accordance with the approved Corrective Action Plan (DOE/NV, 2000). CAU 135 consists of three Corrective Action Sites (CAS). Two of these CAS's were identified in the Corrective Action Investigation Data Quality Objective meeting as being improperly identified as underground storage tanks. CAS 25-02-03 identified as the Deluge Valve Pit was actually an underground electrical vault and CAS 25-02-10 identified as an Underground Storage Tank was actually a former above ground storage tank filled with demineralized water. Both of these CAS's are recommended for a no further action closure. CAS 25-02-01 the Underground Storage Tanks commonly referred to as the Engine Maintenance Assembly and Disassembly Waste Holdup Tanks and Vault was closed by decontaminating the vault structure and conducting a radiological verification survey to document compliance with the Nevada Test Site unrestricted use release criteria. The Area 25 Underground Storage Tanks, (CAS 25-02-01), referred to as the Engine Maintenance, Assembly, and Disassembly (E-MAD) Waste Holdup Tanks and Vault, were used to receive liquid waste from all of the radioactive and cell service area drains at the E-MAD Facility. Based on the results of the Corrective Action Investigation conducted in June 1999, discussed in ''The Corrective Action Investigation Plan for Corrective Action Unit 135: Area 25 Underground Storage Tanks, Nevada Test Site, Nevada'' (DOE/NV, 199a), one sample from the radiological survey of the concrete vault interior exceeded radionuclide preliminary action levels. The analytes from the sediment samples exceeded the preliminary action levels for polychlorinated biphenyls, Resource Conservation and Recovery Act metals, total petroleum hydrocarbons as diesel-range organics, and radionuclides. The CAU 135 closure activities consisted of scabbling radiological ''hot spots

A multi-element solid-phase extraction method for trace metals determination in environmental samples on Amberlite XAD-2000

International Nuclear Information System (INIS)

Bulut, Volkan Numan; Gundogdu, Ali; Duran, Celal; Senturk, Hasan Basri; Soylak, Mustafa; Elci, Latif; Tufekci, Mehmet

2007-01-01

A method for the preconcentration of some transition elements at trace level was proposed using a column filled with Amberlite XAD-2000 resin. Metal ions were adsorbed on XAD-2000 as their diethyldithiocarbamate chelates, then analytes retained on the resin were eluted by 1 mol L -1 nitric acid in acetone and determined by flame atomic absorption spectrometry (FAAS). The influences of some analytical parameters including pH of sample solution, ligand amount, the type, concentration and volume of elution solution, flow rates of the sample and eluent solutions, adsorption capacity of the resin and sample volume on the preconcentration efficiency have been investigated. The influences of some matrix elements were also examined. The detection limit (N = 20, 3 sigma) for Mn(II), Fe(II), Co(II), Cu(II), Cd(II), Zn(II), Pb(II) and Ni(II) were found as 0.20, 0.35, 0.25, 0.20, 0.20, 0.15, 0.45 and 0.25 μg L -1 , respectively. The validation of the procedure was carried out by analysis of certified reference materials. The proposed method was applied to natural waters and kale vegetable (Brassica oleracea var. acephala)

A multi-element solid-phase extraction method for trace metals determination in environmental samples on Amberlite XAD-2000

Energy Technology Data Exchange (ETDEWEB)

Bulut, Volkan Numan [Department of Chemistry, Giresun Faculty of Arts and Sciences, Karadeniz Technical University, 28049 Giresun (Turkey); Gundogdu, Ali [Department of Chemistry, Faculty of Arts and Sciences, Karadeniz Technical University, 61080 Trabzon (Turkey); Duran, Celal [Department of Chemistry, Faculty of Arts and Sciences, Karadeniz Technical University, 61080 Trabzon (Turkey); Senturk, Hasan Basri [Department of Chemistry, Faculty of Arts and Sciences, Karadeniz Technical University, 61080 Trabzon (Turkey); Soylak, Mustafa [Department of Chemistry, Faculty of Arts and Sciences, Erciyes University, 38039 Kayseri (Turkey)]. E-mail: msoylak@gmail.com; Elci, Latif [Department of Chemistry, Faculty of Arts and Sciences, Pamukkale University, 20020 Denizli (Turkey); Tufekci, Mehmet [Department of Chemistry, Faculty of Arts and Sciences, Karadeniz Technical University, 61080 Trabzon (Turkey)

2007-07-19

A method for the preconcentration of some transition elements at trace level was proposed using a column filled with Amberlite XAD-2000 resin. Metal ions were adsorbed on XAD-2000 as their diethyldithiocarbamate chelates, then analytes retained on the resin were eluted by 1 mol L{sup -1} nitric acid in acetone and determined by flame atomic absorption spectrometry (FAAS). The influences of some analytical parameters including pH of sample solution, ligand amount, the type, concentration and volume of elution solution, flow rates of the sample and eluent solutions, adsorption capacity of the resin and sample volume on the preconcentration efficiency have been investigated. The influences of some matrix elements were also examined. The detection limit (N = 20, 3 sigma) for Mn(II), Fe(II), Co(II), Cu(II), Cd(II), Zn(II), Pb(II) and Ni(II) were found as 0.20, 0.35, 0.25, 0.20, 0.20, 0.15, 0.45 and 0.25 {mu}g L{sup -1}, respectively. The validation of the procedure was carried out by analysis of certified reference materials. The proposed method was applied to natural waters and kale vegetable (Brassica oleracea var. acephala)

Chromosome 15q25 (CHRNA3-CHRNA5 variation impacts indirectly on lung cancer risk.

Directory of Open Access Journals (Sweden)

Yufei Wang

2011-04-01

Full Text Available Genetic variants at the 15q25 CHRNA5-CHRNA3 locus have been shown to influence lung cancer risk however there is controversy as to whether variants have a direct carcinogenic effect on lung cancer risk or impact indirectly through smoking behavior. We have performed a detailed analysis of the 15q25 risk variants rs12914385 and rs8042374 with smoking behavior and lung cancer risk in 4,343 lung cancer cases and 1,479 controls from the Genetic Lung Cancer Predisposition Study (GELCAPS. A strong association between rs12914385 and rs8042374, and lung cancer risk was shown, odds ratios (OR were 1.44, (95% confidence interval (CI: 1.29-1.62, P = 3.69×10(-10 and 1.35 (95% CI: 1.18-1.55, P = 9.99×10(-6 respectively. Each copy of risk alleles at rs12914385 and rs8042374 was associated with increased cigarette consumption of 1.0 and 0.9 cigarettes per day (CPD (P = 5.18×10(-5 and P = 5.65×10(-3. These genetically determined modest differences in smoking behavior can be shown to be sufficient to account for the 15q25 association with lung cancer risk. To further verify the indirect effect of 15q25 on the risk, we restricted our analysis of lung cancer risk to never-smokers and conducted a meta-analysis of previously published studies of lung cancer risk in never-smokers. Never-smoker studies published in English were ascertained from PubMed stipulating--lung cancer, risk, genome-wide association, candidate genes. Our study and five previously published studies provided data on 2,405 never-smoker lung cancer cases and 7,622 controls. In the pooled analysis no association has been found between the 15q25 variation and lung cancer risk (OR = 1.09, 95% CI: 0.94-1.28. This study affirms the 15q25 association with smoking and is consistent with an indirect link between genotype and lung cancer risk.

Tropospheric Carbon Monoxide Measurements from the Scanning High-resolution Interferometer Sounder on 7 September 2000 in Southern Africa during SAFARI 2000

Science.gov (United States)

McMillan, W. W.; McCourt, M. L.; Revercomb, H. E.; Knuteson, R. O.; Christian, T. J.; Doddridge, B. G.; Hobbs, P. V.; Lukovich, P. C.; Novelli, P. C.; Piketh, S. J.

2003-01-01

Retrieved tropospheric carbon monoxide (CO) column densities are presented for more than 9000 spectra obtained by the University of Wisconsin-Madison (UWis) Scanning High-Resolution Interferometer Sounder (SHIS) during a flight on the NASA ER-2 on 7 September 2000 as part of the Southern African Regional Science Initiative (SAFARI 2000) dry season field campaign. Enhancements in tropospheric column CO were detected in the vicinity of a controlled biomass burn in the Timbavati Game Reserve in northeastern South Africa and over the edge of the river of smoke in south central Mozambique. Relatively clean air was observed over the far southern coast of Mozambique. Quantitative comparisons are presented with in situ measurements from five different instruments flying on two other aircraft: the University of Washington Convair-580 (CV) and the South African Aerocommander JRB in the vicinity of the Timbavati fire. Measured tropospheric CO columns (extrapolated from 337 to 100 mb) of 2.1 x 10(exp 18) per square centimeter in background air and up to 1.5 x 10(exp 19) per square centimeter in the smoke plume agree well with SHIS retrieved tropospheric CO columns of (2.3 plus or minus 0.25) x 10(exp 18) per square centimeter over background air near the fire and (1.5 plus or minus 0.35) x 10(exp 19) per square centimeter over the smoke plume. Qualitative comparisons are presented with three other in situ CO profiles obtained by the South African JRA aircraft over Mozambique and northern South Africa showing the influence of the river of smoke.

2000 Scientific Report

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-04-01

The report summarises the status and main achievements of various programmes at the Belgian Nuclear Research Centre SCK-CEN in the year 2000. The report is structured along four main fields of activity: Radioactive Waste and Clean-up, Reactor Safety, the BR2 Reactor and Radiation Protection.

2000 Scientific Report

International Nuclear Information System (INIS)

2001-04-01

The report summarises the status and main achievements of various programmes at the Belgian Nuclear Research Centre SCK-CEN in the year 2000. The report is structured along four main fields of activity: Radioactive Waste and Clean-up, Reactor Safety, the BR2 Reactor and Radiation Protection

Safety measures to address the year 2000 issue at medical facilities which use radiation generators and radioactive materials

International Nuclear Information System (INIS)

1999-03-01

In resolution GC(42)/RES/11 on 'Measures to Address the Year 2000 (Y2K) Issue', adopted on 25 September 1998, the General Conference of the International Atomic Energy Agency (IAEA) - inter alia - urged Member States 'to share information with the Secretariat regarding diagnostic and corrective actions being planned or implemented by operating and regulatory organizations at their ... medical facilities which use radioactive materials to make those facilities Year 2000 ready', encouraged the Secretariat 'within existing resources to act as a clearing-house and central point of contact for Member States to exchange information regarding diagnostic and remediation actions being taken at ... medical facilities which use radioactive materials to make these facilities Year 2000 ready', urged the Secretariat 'to handle the information provided by Member States carefully' and requested the Director General to report to it at its next (1999) regular session on the implementation of that resolution. The IAEA Secretariat convened a group of consultants who met in Vienna from 14 to 18 December 1998 and produced this report. The consultants decided that the report should cover not just 'medical facilities which use radioactive materials' but also medical facilities which, while perhaps not using radioactive materials, use ionizing radiation produced by radiation generators such as accelerators. The reports issued together are: Achieving Year 2000 Readiness: Basic Processes; Safety Measures to Address the Year 2000 Issue at Medical Facilities Which Use Radiation Generators and Radioactive Materials; and Safety Measures to Address the Year 2000 Issue at Radioactive Waste Management Facilities. This report addresses means of dealing with the Y2K problem at medical facilities which use radiation generators and radioactive materials

The 14th European Immunology Meeting--EFIS 2000. 23-27 September 2000, Poznañ, Poland.

Science.gov (United States)

Wysocki, P J; Nawrocki, S; Mackiewicz, A

2001-01-01

The 14th European Immunology Meeting--EFIS 2000, held in Poznan, Poland on 23-27 September 2000, was the last major meeting of European immunologists in the second millennium. This conference was intended to summarise past achievements and to present future prospects in immunology. The philosophy of the scientific program was to fuse fundamental and clinical immunology and give a chance for basic scientists and clinicians to discuss mutual topics in a general view. There were eight state-of-art lectures, 12 'meet an expert' sessions, 20 plenary sessions and 46 workshops. More than 900 works were presented. Significant interest was focused on several aspects of cancer immunology and immunotherapy. EFIS 2000 was accompanied by six pre-congress satellite symposia held in various Polish cities. The topics were, 'Heat shock proteins: immune, stress response and apoptosis' (Gdansk), 'Infectious immunity and vaccines' (Kazimierz Dolny), 'Mononuclear phagocytes in basic and clinical immunology' (Cracow), 'Immunology of reproduction' (Poznan), 'Primary immunodeficiencies' (Warsaw) and 'Glycoimmunology' (Wroclaw).

The reduction of summer sulfate and switch from summer to winter PM2.5 concentration maxima in the U.S.

Data.gov (United States)

U.S. Environmental Protection Agency — These four files each contain 24-hour PM2.5 concentrations collected between 2000-2015. This dataset is associated with the following publication: Chan, E., B....

Important notice for Windows 2000 Service Pack 3 computers

CERN Multimedia

The NICE Team

2005-01-01

Microsoft is ending support for Windows 2000 Service Pack 3, which was introduced in 2002. As a consequence, computers running Windows 2000 Service Pack 3 (or older versions1)) must be updated. It is recommended that Windows 2000 computers be re-installed with Windows XP Service Pack 2 (see http://cern.ch/Win/Services/Installation/Diane). If this is not possible for compatibility reasons, Windows 2000 Service Pack 4 must be installed to ensure the computers continue to receive security patches (see http://cern.ch/Win/Docs/2000SP4). In the next few days, NICE 2000 computers requiring an update will receive a pop-up window with instructions. Users requiring help with the update can contact Helpdesk@cern.ch or call 78888. If your computer needs to be updated you are recommended to read the additional information available at http://cern.ch/Win/Docs/2000SP3. The NICE Team 1) To determine your Windows service pack version, use the ‘Start' button and select ‘Run'. In the new window that open...

Important notice for Windows 2000 Service Pack 3 computers

CERN Multimedia

The NICE Team

2005-01-01

Microsoft is ending support for Windows 2000 Service Pack 3, which was introduced in 2002. As a consequence, computers running Windows 2000 Service Pack 3 (or older versions1) ) must be updated. It is recommended that Windows 2000 computers be re-installed with Windows XP Service Pack 2 (see http://cern.ch/Win/Services/Installation/Diane). If this is not possible for compatibility reasons, Windows 2000 Service Pack 4 must be installed to ensure the computers continue to receive security patches (see http://cern.ch/Win/Docs/2000SP4). In the next few days, NICE 2000 computers requiring an update will receive a pop-up window with instructions. Users requiring help with the update can contact Helpdesk@cern.ch or call 78888. If your computer needs to be updated you are recommended to read the additional information available at http://cern.ch/Win/Docs/2000SP3. The NICE Team 1) To determine your Windows service pack version, use the ‘Start' button and select ‘Run'. In the new window that opens, type ‘wi...

Corrosion of Dental Au-Ag-Cu-Pd Alloys in 0.9 % Sodium Chloride Solution

International Nuclear Information System (INIS)

Chiba, Atsushi; Kusayanagi, Yukiharu

2005-01-01

Two Au-Ag-Cu-Pd dental casting alloys (Au:12% and 20%) used. The test solutions used 0.9 % NaCl solution (isotonic sodium chloride solution), 0.9 % NaCl solution containing 1 % lactic acid, and 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The surface of two samples in three sample solutions was not natural discoloration during one year. The alloy containing 12 % gold was easily alloyed and the composition was uniform comparing with the alloy containing 20 % gold. The rest potentials have not a little effect after three months. The kinds of metals could not definitely from the oxidation and reduction waves of metal on the cyclic voltammograms. The dissolutions of gold and palladium were 12 % Au sample in the 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The pH of solution had an affect on dissolution of copper, and sulfur ion had an affect on dissolution of silver. The copper dissolved amount from 20 % gold sample was about 26 times comparing with that of 12 % gold sample in the 0.9 % solution containing 1 % lactic acid. Corrosion products were silver chloride and copper chloride in NaCl solution, and silver sulfide and copper sulfide in NaCl solution containing Na 2 S

2000 Annual report; 2000 Informe anual

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-07-01

This annual report presents information of the main activities on the scope of radiation protection and nuclear safety of the Nuclear Regulatory Authority (NRA) of the Argentina during 2000. The following activities and developed topic in this report describe: the Argentine regulatory system; the evolution of the nuclear regulatory activities in the Argentina since the beginnings in the National Atomic Energy Commission (NAEC) of Argentina; the nuclear regulatory laws and standards; the safeguards and inspection of the nuclear facilities and nuclear power plants; the radiological emergency systems; the environmental monitoring; the institutional relations with national and international organizations; the biological and physics dosimetry; the training courses and meetings; the economic and human recourses.

NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0017 ref|NP_001079227.1| shaker-like potassium channel subunit Kv1.3B ...[Xenopus laevis] gb|AAK83378.1|AF395810_1 shaker-like potassium channel subunit Kv1.3B [Xenopus laevis] NP_001079227.1 0.0 86% ...

NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0033 ref|ZP_01901905.1| hypothetical protein RAZWK3B_08726 [Roseobacte...r sp. AzwK-3b] gb|EDM72321.1| hypothetical protein RAZWK3B_08726 [Roseobacter sp. AzwK-3b] ZP_01901905.1 0.13 31% ...

The National Shipbuilding Research Program. Development of a Quick TBT Analytical Method

Science.gov (United States)

2000-08-16

Development of a Quick TBT Analytical Method 09/25/2000 Page 3 of 38 Executive Summary Concern about the toxic effect of tributyltin have caused the...Antifouling Paints on the Environment Tributyl tin ( TBT ) has been shown to be highly toxic to certain aquatic organisms at concentrations measured in the...paints, developed in the 1960s, contains the organotin tributyltin ( TBT ), which has been proven to cause deformations in oysters and sex changes in

Doktoritööd : [2000

Index Scriptorium Estoniae

2000-01-01

6. okt. 2000 TPÜ-s ökoloogia doktorikraadi kaitsmisnõukogu koosolekul tuleb kaitsmisele Tiiu Alliksaare doktoritöö "Spatial and temporal variability of the distribution of spherical fly-ash particles in sediments in Estonia". 15. dets. 2000 kaitsevad Mart Kivimäe TPÜ kultuuriajaloo doktoritööde kaitsmisnõukogu koosolekul doktoritööd "Dialoogiline historism. Ajaloomõtlemise kolm strateegiat ja nende dialoogisuhted minevikuga saksa teaduskultuuri näitel (R. Kosselleck, J. Rüsen, E. Nolte)" ja Hannes Walter doktoritööd "Eesti teenetemärgid"

Aquatic Environment 2000

DEFF Research Database (Denmark)

Svendsen, L. M.; Bijl, L. van der; Boutrup, S.

The report summarizes the results of the Danish Aquatic Monitoring and Assessment Programme 1998-2003. Danish Environmental Protection Agency 2000: NOVA-2003. Programbeskrivelse for det nationale program for overvågning af vandmiljøet 1998-2003. 397 pp. - Redegørelse fra Miljøstyrelsen nr. 1 (in...

[Prevalence of viral hepatitis type C in blood donors in Peru].

Science.gov (United States)

Farfán, Gustavo; Cabezas, César

2003-01-01

In Peru there is limited information on the prevalence of HVC in the general population, for which reason we seek this information through blood donors in the different departments throughout the country. Information was gathered from the Blood Bank Programs of the Ministry of Health establishments between 2000 and 2001, on which basis prevalences and their distribution by departments were obtained. The average prevalence, nationwide, was in the year 2000, 0.25% for HVC (0.08-0.48), 0.95% for HbsAg, 4.25% for Anti-HBc. In 2001, it was 0.60% for HVC (0.18-1.33), 0.9% for HbsAg and 4.51% for anti HBc. During 2000, for HVC, the result was 0.28% in the Coast and Jungle area 0.20% in the Sierra (Andean area) and during 2001 it was 0.89% in the jungle, 0.6% in the Coast and 0.46% in the Sierra. HVC prevalence in blood donors in Peru is low, however, it is necessary to extend the studies in the general population.

JAERI TANDEM annual report 2000. April 1, 2000 - March 31, 2001

Energy Technology Data Exchange (ETDEWEB)

Takeuchi, Suehiro; Ikezoe, Hiroshi; Chiba, Satoshi; Nagame, Yuichiro; Sataka, Masao; Iwamoto, Akira [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment] (eds.)

2001-11-01

This annual report describes research activities which have been performed with the JAERI tandem accelerator and the Van de Graaff accelerator from April 1, 2000 to March 31, 2001. Summary reports of 46 papers, and lists of publication, personnel and cooperative research with universities are contained. (author)

Nuclear safety review for the year 2000

International Nuclear Information System (INIS)

2001-06-01

The nuclear safety review for the year 2000 reports on worldwide efforts to strengthen nuclear and radiation safety, including radioactive waste safety. It is in three parts: Part 1 describes those events in 2000 that have, or may have, significance for nuclear, radiation and waste safety worldwide. It includes developments such as new initiatives in international cooperation, events of safety significance and events that may be indicative of trends in safety; Part 2 describes some of the IAEA efforts to strengthen international co-operation in nuclear, radiation and waste safety during 2000. It covers legally binding international agreements, non-binding safety standards, and provisions for the application of safety standards. This is done in a very brief manner, because these issues are addressed in more detail in the Agency's Annual Report for 2000; Part 3 presents a brief look ahead to some issues that are likely to be prominent in the coming year(s). The topics covered were selected by the IAEA Secretariat on the basis of trends observed in recent years, account being taken of planned or expected future developments. A draft of the Nuclear Safety Review for the Year 2000 was presented to the March 2001 session of the IAEA Board of Governors. This final version has been prepared taking account of the discussion in the Board. In some places, information has been added to describe developments early in 2001 that were considered pertinent to the discussion of events during 2000. In such cases, a note containing the more recent information has been provided in the form of a footnote

U.S. EPA, Pesticide Product Label, , 09/25/1980

Science.gov (United States)

2011-04-21

... IR\\I'I-: ... ru...phi .... l .... alMppt .. "rl\\ ,,, r .. ''t •• ,h'p'·ndln!.: .. n .. 1/. ·,.I~,.T: ... 1J..1!IUI u ... ·"n haha\\;,r. ' .. ~ lin.· ... phid ... ~pidtor "it~ ... ( 1 ...

22 CFR 231.09 - No acceleration of Eligible Notes.

Science.gov (United States)

2010-04-01

... Section 231.09 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ARAB REPUBLIC OF EGYPT LOAN GUARANTEES ISSUED UNDER THE EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11... have the right to pay any amounts in respect of the Eligible Notes other than in accordance with the...

NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 gb|EAW85442.1| progestin and adipoQ receptor family member IV, is...oform CRA_b [Homo sapiens] gb|EAW85444.1| progestin and adipoQ receptor family member IV, isoform CRA_b [Homo sapiens] EAW85442.1 3e-94 65% ...

Changes in Socio-Economic Inequality in Neonatal Mortality in Iran Between 1995-2000 and 2005-2010: An Oaxaca Decomposition Analysis

Directory of Open Access Journals (Sweden)

Mostafa Amini Rarani

2017-04-01

Full Text Available Background Exploring changes in health inequality and its determinants over time is of policy interest. Accordingly, this study aimed to decompose inequality in neonatal mortality into its contributing factors and then explore changes from 1995-2000 to 2005-2010 in Iran. Methods Required data were drawn from two Iran’s demographic and health survey (DHS conducted in 2000 and 2010. Normalized concentration index (CI was used to measure the magnitude of inequality in neonatal mortality. The contribution of various determinants to inequality was estimated by decomposing concentration indices in 1995-2000 and 2005-2010. Finally, changes in inequality were investigated using Oaxaca-type decomposition technique. Results Pro-rich inequality in neonatal mortality was declined by 16%, ie, the normalized CI dropped from -0.1490 in 1995-2000 to -0.1254 in 2005-2010. The largest contribution to inequality was attributable to mother’s education (32% and household’s economic status (49% in 1995-2000 and 2005-2010, respectively. Changes in mother’s educational level (121%, use of skilled birth attendants (79%, mother’s age at the delivery time (25-34 years old (54% and using modern contraceptive (29% were mainly accountable for the decrease in inequality in neonatal mortality. Conclusion Policy actions on improving households’ economic status and maternal education, especially in rural areas, may have led to the reduction in neonatal mortality inequality in Iran.

XRD and HRTEM characterization of mechanosynthesized Ti{sub 0.9}W{sub 0.1}C cermet

Energy Technology Data Exchange (ETDEWEB)

Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan 713103, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)

2013-12-25

Highlights: •Cubic Ti{sub 0.9}W{sub 0.1}C is formed after 50 min of milling of α-Ti, W and graphite powders. •Nanocrystalline Ti{sub 0.9}W{sub 0.1}C with particle size ∼11 nm is obtained after 8 h milling. •Average particle size of Ti{sub 0.9}W{sub 0.1}C from XRD analysis and HRTEM is very close. •Formation of Ti{sub 0.9}W{sub 0.1}C is hindered as compared with TiC. -- Abstract: Elemental powder mixture of titanium, tungsten and graphite is milled by high energy planetary ball mill at a fixed ball to powder mass ratio (BPMR) for different duration to produce nanosized particles of Ti{sub 0.9}W{sub 0.1}C hard metal. Microstructure characterization in terms of lattice imperfections and phase quantification of ball-milled samples has been done primarily by analyzing the XRD pattern and employing Rietveld method of structure and microstructure refinement. After 8 h of ball-milling full formation of Ti{sub 0.9}W{sub 0.1}C is noticed without any contamination of other phase or milling media. TEM study of 8 h ball-milled sample gives direct supportive evidence of structural and microstructural evaluation by XRD pattern analysis. A comparative study of microstructural changes between TiC and Ti{sub 0.9}W{sub 0.1}C helps to understand the effect of addition of W as solute in Ti–C metal matrix.

ESI-PR09, Manati, Puerto Rico 2000 (Environmental Sensitivity Index Map)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Environmental Sensitivity Index (ESI) maps are an integral component in oil-spill contingency planning and assessment. They serve as a source of information in the...

Partos cesáreos no Piauí: tendência e fatores associados no período 2000-2011

Directory of Open Access Journals (Sweden)

Alberto Madeiro

Full Text Available Resumo OBJETIVO: analisar a tendência da proporção de partos cesáreos e fatores associados no Piauí, Brasil, de 2000 a 2011. MÉTODOS: estudo de série temporal e transversal, com dados dos partos hospitalares de primíparas registrados no Sistema de Informações sobre Nascidos Vivos (Sinasc. RESULTADOS: a proporção de partos cesáreos aumentou de 34,4% em 2000 para 52,1% em 2011 (variação percentual anual +4,4; IC95% 3,6;5,1; mulheres brancas (RP=1,72; IC95% 1,63;1,86, com 40 anos ou mais de idade (RP=2,17; IC95% 2,09;2,28, com 12 anos ou mais de estudo (RP=1,86; IC95% 1,77;1,96, que realizaram sete ou mais consultas de pré-natal (RP=2,08; IC95% 1,97;2,18, residentes em municípios com mais de 300 mil habitantes (RP=1,68; IC95% 1,62;1,80 e com índice de desenvolvimento humano mais elevado (RP=1,61; IC95% 1,51;1,73 mostraram maiores proporções de partos cesáreos. CONCLUSÃO: a ocorrência de partos cesáreos foi elevada e mais frequente em mulheres de baixo risco obstétrico.

University of Washington Participation in SAFARI-2000

Science.gov (United States)

Hobbs, Peter V.

2005-01-01

This report presents a summary, of the participation in the 6-week field study in southern Africa. During the field study there were flown 119.02 research hours (31 research flights). In these flights the researchers obtained many unique data sets for evaluating the effects of biomass burning and other sources of particles and gases on the climate of southern Africa, and obtained simultaneous measurements with NASA ER-2 and Terra overflights. They also analyzed portions of the large data sets acquired in SAFARI-2000. They attended several SAFARI-2000 workshops, national and international conferences to present SAFARI-2000 results.

ISO 9001 2000 : the quality management process

CERN Document Server

Tricker, Ray

2006-01-01

With the publication of ISO 9001:2000, there is now a single quality management ?requirements? standard that is applicable to all organisations, products and services. ISO 9001:2000 is the only standard that can be used for the certification of a QMS and its generic requirements can be used by any organisation.ISO 9001:2000 applies to all types or organisations. It is the quality standard which specifies the requirements of quality management systems for use where organisations need to demonstrate their capability to provide products and services which meet both customer needs and relevant reg

Prospects for SIMPLE 2000 A large-mass, low-background Superheated Droplet Detector for WIMP searches

CERN Document Server

Collar, J I; Girard, T A; Limagne, D; Miley, H S; Waysand, G

2000-01-01

SIMPLE 2000 ({\\underline S}uperheated {\\underline I}nstrument for {\\underline M}assive {\\underline P}artic{\\underline {LE}} searches) will consist of an array of eight to sixteen large active mass ($\\sim15$ g) Superheated Droplet Detectors(SDDs) to be installed in the new underground laboratory of Rustrel-Pays d'Apt. Several factors make of SDDs an attractive approach for the detection of Weakly Interacting Massive Particles (WIMPs), namely their intrinsic insensitivity to minimum ionizing particles, high fluorine content, low cost and operation near ambient pressure and temperature. We comment here on the fabrication, calibration and already-competitive first limits from SIMPLE prototype SDDs, as well as on the expected immediate increase in sensitivity of the program, which aims at an exposure of $>$25 kg-day during the year 2000. The ability of modest-mass fluorine-rich detectors to explore regions of neutralino parameter space beyond the reach of the most ambitious cryogenic projects is pointed out.

A survey on hazardous materials accidents during road transport in China from 2000 to 2008

International Nuclear Information System (INIS)

Yang Jie; Li Fengying; Zhou Jingbo; Zhang Ling; Huang Lei; Bi Jun

2010-01-01

A study of 322 accidents that occurred during the road transport of hazardous materials (hazmat) in China from 2000 to 2008 was carried out. The results showed an increase in the frequency of accidents from 2000 to 2007 and a decline in 2008. More than 63% of the accidents occurred in the eastern coastal areas, 25.5% in the central inland areas, and only 10.9% in the western remote areas. The most frequent types of accident were releases (84.5%), followed by gas clouds (13.0%), fires (10.2%), no substance released due to timely measures (9.9%), and explosions (5.9%). The spatial distribution, the causes and consequences of the accidents related to the population (e.g., number of people killed, injured, evacuated, or poisoned), and environment elements were analyzed. Finally, conclusions are drawn concerning the need to improve certain safety measures in the road transport of hazmat in China.

Mortality trends from diabetes mellitus in the seven socioeconomic regions of Mexico, 2000-2007.

Science.gov (United States)

Sánchez-Barriga, Juan Jesús

2010-11-01

To determine trends in mortality from diabetes mellitus nationwide according to federative entity, socioeconomic region, and sex and to establish the association between education level, federation entity of residence, and socioeconomic region and mortality from diabetes in Mexico during the years 2000-2007. Records of mortality associated with diabetes for 2000-2007 were obtained from the National Information System of the Secretariat of Health. This information is generated by the National Institute of Statistics, Geography and Informatics through death certificates. Codes of International Classification of Diseases, 10th Revision, that correspond to the basic cause of death from diabetes mellitus were identified. Rates of mortality by federative entity and socioeconomic region were calculated, along with the strength of association (obtained by Poisson regression) between federative entity of residence, socioeconomic region, and education level and mortality from diabetes. The seven socioeconomic regions elaborated by the National Institute of Statistics, Geography and Informatics include the 32 federative entities according to indicators related to well-being such as education, occupation, health, housing, and employment. Individuals who did not complete elementary school had a higher risk of dying from diabetes (relative risk [RR] 2.104, 95% confidence interval [CI] 2.089-2.119). The federative entity and socioeconomic region with the strongest association with mortality from diabetes were Mexico City (RR 2.5, CI 2.33-2.68 for 2000; RR 2.06, CI 1.95-2.18 for 2007) and region 7 (RR 2.47, CI 2.36-2.57 for 2000; RR 2.05, CI 1.98-2.13 for 2007). Mortality rates increased from 77.9 to 89.2 per 100,000 inhabitants in the period 2000-2007. Women had higher mortality than men. Individuals who did not complete elementary school had a higher risk of dying from diabetes (RR 2.104, CI 2.089-2.119). Mexico City as federative entity and socioeconomic region 7 presented the

NOK's 1 MW solar chain - Standardised data for the period 1992 - 2000; 1-MW-Solarkette der NOK. Normierte Daten 1992 - 2000

Energy Technology Data Exchange (ETDEWEB)

Roth, S.

2002-07-01

This report for the Swiss Federal Office of Energy (SFOE) presents the results of detailed measurements and analyses made for the assessment of the long-term operational behaviour of grid-connected photovoltaic (PV) systems. The data from eight different PV installations with powers ranging from 2.5 to 100 kW{sub p}, mounted on roofs, facades and even on trackers, that were collected between 1992 and 2000 are presented. All energy and performance values are standardised to the guidelines of the European Solar Test Installation (ESTI) in Ispra, Italy. The report contains all detailed data for all the PV plant monitored within the framework of the 1 MW Solar Chain project. In order to secure continuity of the monitoring during the whole lifetimes of the installations, the author suggests the launching of a follow-up measurement project.

Incidence rates of enterovirus 71 infections in young children during a nationwide epidemic in Taiwan, 2008-09.

Directory of Open Access Journals (Sweden)

Min-Shi Lee

Full Text Available OBJECTIVE: Enterovirus 71 (EV71 is causing life-threatening outbreaks in tropical Asia. In Taiwan and other tropical Asian countries, although nationwide EV71 epidemics occur cyclically, age-specific incidence rates of EV71 infections that are critical to estimate disease burden and design vaccine trials are not clear. A nationwide EV71 epidemic occurred in 2008-09 in Taiwan, which provided a unique opportunity to estimate age-specific incidence rates of EV71 infections. STUDY DESIGN: We prospectively recruited 749 healthy neonates and conducted follow-ups from June 2006 to December 2009. Sera were obtained from participants at 0, 6, 12, 24, and 36 months of age for measuring EV71 neutralizing antibody titers. If the participants developed suspected enterovirus illnesses, throat swabs were collected for virus isolation. RESULTS: We detected 28 EV71 infections including 20 symptomatic and 8 asymptomatic infections. Age-specific incidence rates of EV71 infection increased from 1.71 per 100 person-years at 0-6 months of age to 4.09, 5.74, and 4.97 per 100 person-years at 7-12, 13-24, and 25-36 months of age, respectively. Cumulative incidence rate was 15.15 per 100 persons by 36 months of age, respectively. CONCLUSIONS: Risk of EV71 infections in Taiwan increased after 6 months of age during EV71 epidemics. The cumulative incidence rate was 15% by 36 months of age, and 29% of EV71 infections were asymptomatic in young children.

33 CFR 88.09 - Temporary exemption from light and shape requirements when operating under bridges.

Science.gov (United States)

2010-07-01

... and shape requirements when operating under bridges. 88.09 Section 88.09 Navigation and Navigable... Temporary exemption from light and shape requirements when operating under bridges. A vessel's navigation lights and shapes may be lowered if necessary to pass under a bridge. ...

Enhanced Performance of Mg0.1Zn0.9O UV Photodetectors Using Photoelectrochemical Treatment and Silica Nanospheres

Directory of Open Access Journals (Sweden)

Hsin-Ying Lee

2014-01-01

Full Text Available The Mg0.1Zn0.9O films were grown using atomic layer deposition (ALD system and applied to metal-semiconductor-metal ultraviolet photodetectors (MSM-UPDs as an active layer. To suppress the dangling bonds on the Mg0.1Zn0.9O surface, the photoelectrochemical (PEC treatment was used to passivate the Mg0.1Zn0.9O surface, which could reduce the dark current of the MSM-UPDs about one order. Beside, to increase more incident light into the Mg0.1Zn0.9O active layer of the MSM-UPDs, the 500-nm-diameter silica nanospheres were spin-coated on the Mg0.1Zn0.9O active layer to improve the antireflection capability at the wavelength of 340 nm. The reflectivity of the Mg0.1Zn0.9O films with silica nanospheres antireflection layer decreased about 7.0% in comparison with the Mg0.1Zn0.9O films without silica nanospheres. The photocurrent and UV-visible ratio of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were enhanced to 5.85 μA and 1.44×104, respectively, at the bias voltage of 5 V. Moreover, the noise equivalent power and the specific detectivity of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were decreased to 2.60×10-13 W and increased to 1.21×1012 cmHz1/2W−1, respectively, at the bias voltage of 5 V. According to the above mentions, the PEC treatment and silica nanospheres antireflection layer could effectively enhance the performance of Mg0.1Zn0.9O MSM-UPDs.

The year 2000 problem as seen by manufacturers; Das Jahr-2000-Problem in deutschen Kernkraftwerken. Aus der Sicht der Hersteller

Energy Technology Data Exchange (ETDEWEB)

Graf, A. [Siemens AG, Erlangen (Germany). Bereich KWU

1999-11-01

The Y2K problem has many facets due mainly to two reasons: The extremely wide use of microcomputers, and the complexity of automation in modern industrial plants. For the past two years, Siemens AG has been checking the Y2K conformity of its products. The result of these investigations is this: All automation equipment, almost without exception, is in conformity with the year 2000 requirements as it works without the date function causing the errors. A few occasional malfunctions were discovered in older computer-supported operating and monitoring stations and in process computer applications. However, malfunctions are not going to cause failures of the system but only make its use more difficult. (orig.) [German] Ursache des Jahr-2000-Problems ist die Unfaehigkeit gewisser aelterer Software, das Jahresdatum 2000 beim Uebergang der letzten beiden Ziffern von '99' auf '00' richtig zu verarbeiten. Potenziell betroffen sind alle Geraete und Systeme, die in irgendeiner Form Rechner oder Mikrorechner enthalten. Das Jahr-2000-Problem ist sehr vielschichtig. Dies resultiert im Wesentlichen aus zwei Gruenden: Der extrem weiten Verbreitung von Mikrorechnern und der Komplexitaet der Automatisierung moderner Industrieanlagen. Die Siemens AG ueberprueft seit zwei Jahren die 2000-Jahr-Konformitaet ihrer Produkte. Ergebnis der Untersuchungen ist: Automatisierungsgeraete sind fast ausnahmslos Jahr-2000 konform, da sie ohne die fehlerverursachenden Datumsfunktionen auskommen. Vereinzelte Fehlfunktionen wurden in aelteren rechnergestuetzten Bedien- und Beobachtungssystemen sowie in Prozessrechneranwendungen gefunden. Fehlfunktionen fuehren jedoch meist nicht zum Versagen des Systems, sondern erschweren nur dessen Nutzung. In den sicherheitsrelevanten Bereichen der Kernkraftwerke werden ausschliesslich die vom Jahr-2000-Problem nicht betroffenen Automatisierungsgeraete eingesetzt. (orig.)

SAFARI 2000 Aerosol Fatty Acid and Stable Isotope Data, Mongu, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — ABSTRACT: The Southern African Regional Science Initiative (SAFARI 2000) was conducted in part to investigate the impacts of the large-scale transport and deposition...

SAFARI 2000 Aerosol Fatty Acid and Stable Isotope Data, Mongu, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — The Southern African Regional Science Initiative (SAFARI 2000) was conducted in part to investigate the impacts of the large-scale transport and deposition of...

Proceedings Workshop on Generic Programming (WGP2000)

NARCIS (Netherlands)

Jeuring, J.T.

2000-01-01

This report contains the papers selected for presentation at the 2nd Workshop on Generic Programming (WGP2000), which was held on July 6, 2000 in Ponte de Lima, Portugal. Generic programming is about making programs more adaptable by making them more general. Generic programs often embody

12 CFR 7.2000 - Corporate governance procedures.

Science.gov (United States)

2010-01-01

... OPERATIONS Corporate Practices § 7.2000 Corporate governance procedures. (a) General. A national bank proposing to engage in a corporate governance procedure shall comply with applicable Federal banking... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Corporate governance procedures. 7.2000 Section...

Annual Site Environmental Report, 2000 (ASER)

Energy Technology Data Exchange (ETDEWEB)

Russak, Hillary M.

2001-11-20

This report provides information about environmental programs and compliance with environmental regulations during 2000 at the Stanford Linear Accelerator Center (SLAC). In addition, updates that may be of special interest, which occurred beyond 2000, are included. The most noteworthy information in this report is summarized in this section. This summary demonstrates the effective application of SLAC environmental management systems in meeting the site's Integrated Safety Management System (ISMS) goals.

ATLAS Monte Carlo tunes for MC09

CERN Document Server

The ATLAS collaboration

2010-01-01

This note describes the ATLAS tunes of underlying event and minimum bias description for the main Monte Carlo generators used in the MC09 production. For the main shower generators, pythia and herwig (with jimmy), the MRST LO* parton distribution functions (PDFs) were used for the first time in ATLAS. Special studies on the performance of these, conceptually new, PDFs for high pt physics processes at LHC energies are presented. In addition, a tune of jimmy for CTEQ6.6 is presented, for use with MC@NLO.

Cord blood 25(OH)-vitamin D deficiency and childhood asthma, allergy and eczema

DEFF Research Database (Denmark)

Chawes, Bo L; Bønnelykke, Klaus; Jensen, Pia F

2014-01-01

on Asthma in Childhood (COPSAC2000) at-risk mother-child cohort. Troublesome lung symptoms (TROLS), asthma, respiratory infections, allergic rhinitis, and eczema, at age 0-7 yrs were diagnosed exclusively by the COPSAC pediatricians strictly adhering to predefined algorithms. Objective assessments of lung......BACKGROUND: Epidemiological studies have suggested an association between maternal vitamin D dietary intake during pregnancy and risk of asthma and allergy in the offspring. However, prospective clinical studies on vitamin D measured in cord blood and development of clinical end-points are sparse....... OBJECTIVE: To investigate the interdependence of cord blood 25-hydroxyvitamin D (25(OH)-Vitamin D) level and investigator-diagnosed asthma- and allergy-related conditions during preschool-age. METHODS: Cord blood 25(OH)-Vitamin D level was measured in 257 children from the Copenhagen Prospective Studies...

Monitoring of radiation exposure. Annual report 2000

International Nuclear Information System (INIS)

Rantanen, E.

2001-03-01

At the end of 2000, there were 1,779 valid safety licenses in Finland for the use of radiation. In addition, there were 2,038 responsible parties for dental x-ray diagnostics. The registry Radiation and Nuclear Safety Authority (STUK) listed 13,754 radiation sources and 270 radionuclide laboratories. In the year 2000 360 inspections were made concerning the safety licences and 53 concerning dental x-ray diagnostics. The import of radioactive substances amounted to 175,836 GBq and export to 74,420 GBq. Short-lived radionuclides produced in Finland amounted to 55,527 GBq. In the year 2000 there were 10,846 workers monitored for radiation exposure at 1,171 work sites. Of these employees, 27% received an annual dose exceeding the recording level. The annual effective dose limit was not exceeded. The total dose recorded in the dose registry(sum of the individual dosemeter readings) was 6.5 Sv in 2000

“Mind the gap!” – How well does Natura 2000 cover species of European interest?

Directory of Open Access Journals (Sweden)

Bernd Gruber

2012-12-01

Full Text Available Setting aside protected areas is widely recognized as one of the most effective measures to prevent species from extinction. Accordingly, there has been a tremendous effort by governments worldwide to establish protected areas, resulting in over 100,000 sites, which are set aside, to achieve the 10% target proposed at the Fourth World Park Congress in 1992 in Caracas. The main effort of the European to achieve this target is the Natura 2000 network of protected areas, comprising over 25,000 sites representing 18 % of the area of the 27 Member States of the European Union. The designation of Natura 2000 sites was based on species and habitats listed in the Annexes of the Habitats and Birds Directive. The effectiveness of the selection process and the resulting Natura 2000 network has often been questioned as each country made its designations largely independently and in most cases without considering the theories of optimal reserve site selection. However, the effectiveness of the selection process and the Natura 2000 network has never been explicitly analysed at the European scale. Here we present such an analysis focusing on the representation of Annex II species of the Habitats Directive in the Natura 2000 network relative to a random allocation of species to sites. Our results show that the network is effective in covering target species and minimizing the number of gap species (i.e. species not represented in a single site of the Natura 2000 network. We demonstrate that the representation is uneven among species. Some species are overrepresented and many species are only represented in a low number of sites. We show that this is mainly due to differing patterns in species ranges, as wide-spread species are inevitably represented in many sites, but narrow ranged species are often covered only by a small number of sites in a particular area. Finally, we propose a representation index that detects species that are underrepresented and could be

PR Bibliography, 2000.

Science.gov (United States)

Hiebert, Ray E., Ed.

2000-01-01

This annotated bibliography presents an overview of journal articles and books on public relations that can be helpful to teachers and students as well as to practitioners and managers. Categories for this 2000 edition correspond to knowledge needed by public relations undergraduate majors, as determined in a study conducted by the 1999 Commission…

Update: outbreak of acute febrile illness among athletes participating in Eco-Challenge-Sabah 2000--Borneo, Malaysia, 2000.

Science.gov (United States)

2001-01-19

During September 7-11, 2000, CDC was notified by the Idaho Department of Health, the Los Angeles County Department of Health Services, and the GeoSentinel Global Surveillance Network of at least 20 cases of acute febrile illness in three countries; all ill patients had participated in the Eco-Challenge-Sabah 2000 multisport expedition race in Borneo, Malaysia, during August 21-September 3, 2000. Participants included athletes from 29 U.S. states and 26 countries. This report updates the ongoing investigation of this outbreak through December 2, which suggests that Leptospira were the cause of illness and that water from the Segama River was the primary source of infection. Participants in adventure sports and exotic tourism should be aware of potential exposure to unusual and emerging infectious agents.

Design, Build and Test of a Double Crystal Monochromator for Beamlines I09 and I23 at the Diamond Light Source

International Nuclear Information System (INIS)

Kelly, J; Lee, T; Alcock, S; Patel, H

2013-01-01

A high stability Double Crystal Monochromator has been developed at The Diamond Light Source for beamlines I09 and I23. The design specification was a cryogenic, fixed exit, energy scanning monochromator, operating over an energy range of 2.1 – 25 keV using a Si(111) crystal set. The novel design concepts are the direct drive, air bearing Bragg axis, low strain crystal mounts and the cooling scheme. The instrument exhibited superb stability and repeatability on the B16 Test Beamline. A 20 keV Si(555), 1.4 μrad rocking curve was demonstrated. The DCM showed good stability without any evidence of vibration or Bragg angle nonlinearity.

LEAP2000: tools for sustainable energy analysis

Energy Technology Data Exchange (ETDEWEB)

Heaps, C.; Lazarus, M.; Raskin, P. [SEU-Boston, Boston, MA (USA)

2000-09-01

LEAP2000 is a collaborative initiative, led by the Boston Center for the Stockholm Environment Institute, to create a new suite of analytical software and databases for integrated energy-environment analysis. The LEAP2000 software and the Technology and Environmental Database (TED) are described. 5 refs., 5 figs.

International nuclear power status 2000

International Nuclear Information System (INIS)

Lauritzen, B.; Majborn, B.; Nonboel, E.; Oelgaard, P.L.

2001-03-01

This report is the seventh in a series of annual reports on the international development of nuclear power with special emphasis on reactor safety. For 2000, the report contains: 1. General trends in the development of nuclear power. 2. Deposition of low-level radioactive waste. 3. Statistical information on nuclear power production (in 1999). 4. An overview of safety-relevant incidents in 2000. 5. The development in Sweden. 6. The development in Eastern Europe. 7. The development in the rest of the world. 8. Trends in the development of reactor types. 9. Trends in the development of the nuclear fuel cycle. (au)

Husky Energy Inc. : 2000 annual report

International Nuclear Information System (INIS)

2001-01-01

Financial information from Husky Energy Inc. was presented in this first annual report and a review of their 2000 operations was made available for the benefit of shareholders. Husky Energy is an integrated energy and energy-related company. With the acquisition of Renaissance Energy Ltd. in August 2000, Husky Energy became one of Canada's largest petroleum companies in terms of production and the value of its asset base. Upstream activities were focused in Western Canada, offshore Eastern Canada and in China. Sales and operating revenues in 2000 were $5,090 million, up 82 per cent from 1999. Strong commodity prices increased production volumes from new developments and acquisitions. The midstream business contributed to the profitability of the company. The acquisition of Renaissance Energy provided proved reserves of 390 million boe. The acquisition cost of reserves was about $6.50 per boe on a proved plus half-probable basis. Annual production volumes in 2000 averaged 176,800 boe per day, up considerably from 1999 due to the acquisition of the Valhalla and Wapiti properties in Western Canada. This report summarized the company's energy resource activities and presented an operations review as well as consolidated financial statements, and common share information. Revenue and expenditure statements were summarized by source. tabs., figs

SAFARI 2000 Leaf Area Measurements at the Mongu Tower Site, Zambia, 2000-2002

Data.gov (United States)

National Aeronautics and Space Administration — ABSTRACT: Data from the LAI-2000 instrument were processed to determine the leaf area index (LAI) at the EOS Validation Core Site in Kataba Local Forest,...

NCBI nr-aa BLAST: CBRC-OLAT-09-0016 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-OLAT-09-0016 sp|P43141|ADB4C_MELGA Beta-4C adrenergic receptor (Beta-4C adreno...ceptor) (Beta-4C adrenoreceptor) gb|AAA62151.1| beta-4C-adrenergic receptor gb|AAA62150.1| adrenergic beta-4c receptor P43141 1e-107 51% ...

Chemical, physical and profile oceanographic data collected aboard the CAPE HATTERAS in the Gulf of Mexico from 2010-09-04 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069059)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the CAPE HATTERAS in the Gulf of Mexico from 2010-09-04 to 2010-09-15 in response to the...

Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-04 to 2010-09-08 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069120)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-04 to 2010-09-08 in response to the...

Fisheries Disaster Survey, 2000

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Responses to selected questions from the Social and Economic Survey administered in spring and summer 2000 to recipients of the second round (Round II) of financial...

Fermi National Accelerator Laboratory Annual Program Review 2000

Energy Technology Data Exchange (ETDEWEB)

2000-03-01

This book is submitted as one written part of the 2000 Annual DOE High Energy Physics Program Review of Fermilab, scheduled March 22-24, 2000. In it are Director's Overview, some experimental highlights, discussions of several projects, and descriptions of the functions and activities of the four laboratory divisions. This book should be read in conjunction with the 2000 Fermilab Workbook and the review presentations (both in formal sessions and at the poster session).

Radiation safety and quality in diagnostic x-ray imaging 2000. Education course 24.-25.2.2000 and 10.-11.4.2000; Saetelyturvallisuus ja laatu roentgendiagnostiikassa 2000. Koulutuspaeivaet 24.-25.2.2000, 10.-11.4.2000

Energy Technology Data Exchange (ETDEWEB)

Servomaa, A.; Parviainen, T. [eds.

2000-02-01

The Medical Directive (97/43/Euratom), which regulates current activities in radiation protection with regard to medical radiology, has introduced new obligations for hospitals. Current topics are the development of radiation protection regulations and quality systems, education and training programmes, patient doses and clinical audits. The assessment of patient dose is one of the most important tasks required by the Directive. Hospitals are made responsible for assessing patient doses and then comparing the results against the national reference levels. The European Commission has financed research projects in order to develop methods for assessing patient doses and to establish reference levels. This report deals with the new radiation protection regulations, quality systems and the assessment of patient doses. The articles deal with the requirements set for radiation workers, quality systems implemented in hospitals, dose assessment methods and patient doses. (orig.)

Egwuatu et al., Afr., J. Infect. Dis. (2017) 11 (1): 18-25 http://dx.doi ...

African Journals Online (AJOL)

PROF ADEWUNMI

Dis. (2017) 11 (1): 18-25 http://dx.doi.org/10.21010/ajid.v11i1.3. 18. EFFECT OF ... resistant isolates of Escherichia coli in HIV-infected adult patients in Lagos. .... Institute for Medical Research (NIMR), Yaba both in Nigeria. ..... with HIV/AIDS in Africa 2000. http://www.unaids.org/publications/documents/care/general/ ...

Physical and profile oceanographic data collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-02 to 2010-09-06 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0084590)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Physical and profile oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-02 to 2010-09-06 in response to the Deepwater...

Synthesis and electrochemical properties of xLiMn0.9Fe0.1PO4·yLi3V2(PO4)3/C composite cathode materials for lithium–ion batteries

International Nuclear Information System (INIS)

Wu, Ling; Lu, JiaJia; Wei, Gui; Wang, Pengfei; Ding, Hao; Zheng, Junwei; Li, Xiaowei; Zhong, Shengkui

2014-01-01

Highlights: • xLiMn 0.9 Fe 0.1 PO4·yLi 3 V 2 (PO 4 ) 3 /C composites are prepared by a solid-state method. • The addition of Li 3 V 2 (PO 4 ) 3 can improve the properties of LiMn 0.9 Fe 0.1 PO 4 . • Mutual doping occurrs between the LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases. • 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical properties. - Abstract: The xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x:y=1:0, 9:1 5:1, 3:1, 1:1 and 0:1) cathode materials are synthesized by a ball–milling and post–calcination method. XRD results reveal that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites are composed of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases, and no impurities are detected. In LiMn 0.9 Fe 0.1 PO 4 –Li 3 V 2 (PO 4 ) 3 system, most of the manganese, iron and vanadium elements in the raw materials tend to form the two major phases, and only small amounts of V, Mn and Fe as dopants enter into the lattice of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 . Electrochemical tests show that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites exhibit much better performance than the single LiMn 0.9 Fe 0.1 PO 4 /C. Among the samples, 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical performance. The sample delivers the specific capacities of 158.1, 140.7 and 100.2 mAh g −1 at 0.05, 1 and 4 C rates in the potential range of 2.5–4.5 V, and exhibits very long and flat discharge plateau around 4.0 V up to 1 C rate. The sample also shows good cycling performance at various C–rates

Natura 2000 loob võrgustiku / Tiit Kändler

Index Scriptorium Estoniae

Kändler, Tiit, 1948-

2001-01-01

Natura 2000 on EL looduskaitsepoliitika keskne vahend. Tegemist on võrgustikuga, mille moodustavad liikmesriikide kõige väärtuslikumad loodusalad. 2001. aastal on Lihula Euroopa looduskaitsevõrgustiku Natura 2000 pealinn Eestis

Natura 2000 sai tuule tiibadesse Raplamaal / Ain Aivela

Index Scriptorium Estoniae

Aivela, Ain

2004-01-01

Natura 2000 idee jõudis Eestisse 2000. aastal, mil pilootprojekti raames ning Taani riigi rahalisel toel alustati Natura-võrgustiku eelvalikualade mahamärkimist Lääne- ja Raplamaal. Kommenteerinud Aleksei Lotman

Energetic situation. January 2000

International Nuclear Information System (INIS)

2000-03-01

This report makes a statement of the French energy consumption, demand, import and export in January 2000. Details are given separately for primary energy, solid mineral fuels, petroleum products, natural gas and electric power. (J.S.)

SAFARI 2000 JRA Aerocommander Trace Gas, Aerosol, and CCN Data, Dry Season 2000

Data.gov (United States)

National Aeronautics and Space Administration — As part of the 3rd Intensive Campaign of SAFARI 2000, the South African Weather Bureau Aerocommander, JRA, flew 19 missions, for a total of 28 separate flights...

Room temperature mechanosynthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C

Energy Technology Data Exchange (ETDEWEB)

Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan, 713103, West Bengal (India); Kar, T. [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700032, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India)

2016-02-01

This article reports the synthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C powder obtained by mechanical milling the mixture of Si, Al and graphite powders at room temperature under inert atmosphere. XRD patterns of ball-milled powders clearly reveal the nucleation of Si{sub 0.9}Al{sub 0.1}C phase after 5 h of milling and the stoichiometric cubic Si{sub 0.9}Al{sub 0.1}C is formed after 10 h of milling with crystallite size of ∼3 nm. Microstructure of ball-milled powders in terms of different lattice imperfections is characterized by employing both Rietveld's method of structure refinement using XRD data and high resolution transmission electron microscope (HRTEM). HRTEM micrographs of 10 h milled powder substantiate the formation of nanocrystalline Si{sub 0.9}Al{sub 0.1}C compound without any contamination and confirm the findings of Rietveld analysis using XRD data. - Highlights: • Cubic Si{sub 0.9}Al{sub 0.1}C is formed after 5 h of milling of Si, Al and graphite powders. • Nanocrystalline Si{sub 0.9}Al{sub 0.1}C with particle size ∼3 nm is obtained after 10 h milling. • Average particle size of Si{sub 0.9}Al{sub 0.1}C from XRD analysis and HRTEM is very close.

Annual Report 2000

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-07-01

The Institut Laue-Langevin (ILL) is an international research center using neutrons to probe the microscopic structure and dynamics of a broad range of materials. This annual report presents the ILL activities in 2000: the scientific highlights, the Millennium programme and the new developments, the workshops organized by the ILL, the experimental programme and the publications. (A.L.B.)

Annual Report 2000

International Nuclear Information System (INIS)

2000-01-01

The Institut Laue-Langevin (ILL) is an international research center using neutrons to probe the microscopic structure and dynamics of a broad range of materials. This annual report presents the ILL activities in 2000: the scientific highlights, the Millennium programme and the new developments, the workshops organized by the ILL, the experimental programme and the publications. (A.L.B.)

Charged-particle multiplicity measurement in proton-proton collisions at $\\sqrt{s}$ = 0.9 and 2.36 TeV with ALICE at LHC

CERN Document Server

Aamodt, K.; Abeysekara, U.; Abrahantes Quintana, A.; Abramyan, A.; Adamova, D.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, A.; Ahmad, N.; Ahn, S.U.; Akimoto, R.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Alfaro Molina, R.; Alici, A.; Avina, E.Almaraz; Alme, J.; Alt, T.; Altini, V.; Altinpinar, S.; Andrei, C.; Andronic, A.; Anelli, G.; Angelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antinori, S.; Antipin, K.; Antonczyk, D.; Antonioli, P.; Anzo, A.; Aphecetche, L.; Appelshauser, H.; Arcelli, S.; Arceo, R.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bablok, S.; Bach, M.; Badala, A.; Baek, Y.W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baldit, A.; Ban, J.; Barbera, R.; Barnafoldi, G.G.; Barnby, L.; Barret, V.; Bartke, J.; Barile, F.; Basile, M.; Basmanov, V.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Becker, B.; Belikov, I.; Bellwied, R.; Belmont-Moreno, E.; Belogianni, A.; Benhabib, L.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdermann, E.; Berdnikov, Y.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Bimbot, L.; Biolcati, E.; Blanc, A.; Blanco, F.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Bohm, J.; Boldizsar, L.; Bombara, M.; Bombonati, C.; Bondila, M.; Borel, H.; Borshchov, V.; Borisov, A.; Bortolin, C.; Bose, S.; Bosisio, L.; Bossu, F.; Botje, M.; Bottger, S.; Bourdaud, G.; Boyer, B.; Braun, M.; Braun-Munzinger, P.; Bravina, L.; Bregant, M.; Breitner, T.; Bruckner, G.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Buncic, P.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Camacho, E.; Camerini, P.; Campbell, M.; Canoa Roman, V.; Capitani, G.P.; Cara Romeo, G.; Carena, F.; Carena, W.; Carminati, F.; Casanova Diaz, A.; Caselle, M.; Castellanos, J.Castillo; Castillo Hernandez, J.F.; Catanescu, V.; Cattaruzza, E.; Cavicchioli, C.; Cerello, P.; Chambert, V.; Chang, B.; Chapeland, S.; Charpy, A.; Charvet, J.L.; Chattopadhyay, S.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Choi, K.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chuman, F.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Cobanoglu, O.; Coffin, J.P.; Coli, S.; Colla, A.; Conesa Balbastre, G.; Conesa del Valle, Z.; Conner, E.S.; Constantin, P.; Contin, G.; Contreras, J.G.; Corrales Morales, Y.; Cormier, T.M.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Cussonneau, J.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Das, S.; Dash, A.; Dash, S.; de Barros, G.O.V.; De Caro, A.; de Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gaspari, M.; de Groot, J.; De Gruttola, D.; de Haas, A.P.; De Marco, N.; De Pasquale, S.; De Remigis, R.; de Rooij, R.; de Vaux, G.; Delagrange, H.; Dellacasa, G.; Deloff, A.; Demanov, V.; Denes, E.; Deppman, A.; D'Erasmo, G.; Derkach, D.; Devaux, A.; Di Bari, D.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Dialinas, M.; Diaz, L.; Diaz, R.; Dietel, T.; Divia, R.; Djuvsland, O.; Dobretsov, V.; Dobrin, A.; Dobrowolski, T.; Donigus, B.; Dominguez, I.; Dordic, O.; Dubey, A.K.; Dubuisson, J.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, A.K.; Dutta Majumdar, M.R.; Elia, D.; Emschermann, D.; Enokizono, A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Evrard, S.; Eyyubova, G.; Fabjan, C.W.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fateev, O.; Fearick, R.; Fedunov, A.; Fehlker, D.; Fekete, V.; Felea, D.; Fenton-Olsen, B.; Feofilov, G.; Fernandez Tellez, A.; Ferreiro, E.G.; Ferretti, A.; Ferretti, R.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Fodor, Z.; Foertsch, S.; Foka, P.; Fokin, S.; Formenti, F.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Frolov, A.; Fuchs, U.; Furano, F.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gadrat, S.; Gagliardi, M.; Gago, A.; Gallio, M.; Ganoti, P.; Ganti, M.S.; Garabatos, C.; Garcia Trapaga, C.; Gebelein, J.; Gemme, R.; Germain, M.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Giraudo, G.; Giubellino, P.; Gladysz-Dziadus, E.; Glasow, R.; Glassel, P.; Glenn, A.; Gomez Jimenez, R.; Gonzalez Santos, H.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Gorbunov, Y.; Gotovac, S.; Gottschlag, H.; Grabski, V.; Grajcarek, R.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Gustafsson, H.A.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Hamblen, J.; Han, B.H.; Harris, J.W.; Hartig, M.; Harutyunyan, A.; Hasch, D.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heide, M.; Heinz, M.; Helstrup, H.; Herghelegiu, A.; Hernandez, C.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hiei, A.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Hu, S.; Huang, M.; Huber, S.; Humanic, T.J.; Hutter, D.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Innocenti, P.G.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, A.; Ivanov, M.; Ivanov, V.; Iwasaki, T.; Jacholkowski, A.; Jacobs, P.; Jancurova, L.; Jangal, S.; Janik, R.; Jena, C.; Jena, S.; Jirden, L.; Jones, G.T.; Jones, P.G.; Jovanovic, P.; Jung, H.; Jung, W.; Jusko, A.; Kaidalov, A.B.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kamal, A.; Kamermans, R.; Kanaki, K.; Kang, E.; Kang, J.H.; Kapitan, J.; Kaplin, V.; Kapusta, S.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kikola, D.; Kileng, B.; Kim, D.J.; Kim, D.S.; Kim, D.W.; Kim, H.N.; Kim, J.; Kim, J.H.; Kim, J.S.; Kim, M.; Kim, M.; Kim, S.H.; Kim, S.; Kim, Y.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Klovning, A.; Kluge, A.; Kniege, S.; Koch, K.; Kolevatov, R.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskih, A.; Kornas, E.; Kour, R.; Kowalski, M.; Kox, S.; Kozlov, K.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Kravcakova, A.; Krawutschke, T.; Krivda, M.; Krumbhorn, D.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kumar, L.; Kumar, N.; Kupczak, R.; Kurashvili, P.; Kurepin, A.; Kurepin, A.N.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kutouski, M.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; La Rocca, P.; Lackner, F.; Ladron de Guevara, P.; Lafage, V.; Lal, C.; Lara, C.; Larsen, D.T.; Laurenti, G.; Lazzeroni, C.; Le Bornec, Y.; Le Bris, N.; Lee, H.; Lee, K.S.; Lee, S.C.; Lefevre, F.; Lenhardt, M.; Leistam, L.; Lehnert, J.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Li, Y.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Listratenko, O.; Liu, L.; Loginov, V.; Lohn, S.; Lopez, X.; Lopez Noriega, M.; Lopez-Ramirez, R.; Lopez Torres, E.; Lovhoiden, G.; Lozea Feijo Soares, A.; Lu, S.; Lunardon, M.; Luparello, G.; Luquin, L.; Lutz, J.R.; Ma, K.; Ma, R.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Makhlyueva, I.; Mal'Kevich, D.; Malaev, M.; Malagalage, K.J.; Maldonado Cervantes, I.; Malek, M.; Malkiewicz, T.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Martashvili, I.; Martinengo, P.; Martinez Hernandez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Maruyama, Y.; Marzari Chiesa, A.; Masciocchi, S.; Masera, M.; Masetti, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mazza, G.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mendez Lorenzo, P.; Meoni, M.; Mercado Perez, J.; Mereu, P.; Miake, Y.; Michalon, A.; Miftakhov, N.; Milosevic, J.; Minafra, F.; Mischke, A.; Miskowiec, D.; Mitu, C.; Mizoguchi, K.; Mlynarz, J.; Mohanty, B.; Molnar, L.; Mondal, M.M.; Montano Zetina, L.; Monteno, M.; Montes, E.; Morando, M.; Moretto, S.; Morsch, A.; Moukhanova, T.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Munoz, J.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Navach, F.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nendaz, F.; Newby, J.; Nianine, A.; Nicassio, M.; Nielsen, B.S.; Nikolaev, S.; Nikolic, V.; Nikulin, S.; Nikulin, V.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyatha, A.; Nygaard, C.; Nyiri, A.; Nystrand, J.; Ochirov, A.; Odyniec, G.; Oeschler, H.; Oinonen, M.; Okada, K.; Okada, Y.; Oldenburg, M.; Oleniacz, J.; Oppedisano, C.; Orsini, F.; Ortiz Velasquez, A.; Ortona, G.; Oskamp, C.J.; Oskarsson, A.; Osmic, F.; Osterman, L.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Ovrebekk, G.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Panse, R.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Pastircak, B.; Pastore, C.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Pepato, A.; Pereira, H.; Peressounko, D.; Perez, C.; Perini, D.; Perrino, D.; Peryt, W.; Peschek, J.; Pesci, A.; Peskov, V.; Pestov, Y.; Peters, A.J.; Petracek, V.; Petridis, A.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Peyre, J.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Platt, R.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta Lerma, P.L.M.; Poggio, F.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Polozov, P.; Polyakov, V.; Pommeresch, B.; Pop, A.; Posa, F.; Pospisil, V.; Potukuchi, B.; Pouthas, J.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puddu, G.; Pujahari, P.; Pulvirenti, A.; Punin, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Ramirez Reyes, A.; Rammler, M.; Raniwala, R.; Raniwala, S.; Rasanen, S.S.; Rashevskaya, I.; Rath, S.; Read, K.F.; Real, J.S.; Redlich, K.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.P.; Reygers, K.; Ricaud, H.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rivetti, A.; Rodriguez Cahuantzi, M.; Roed, K.; Rohrich, D.; Roman Lopez, S.; Romita, R.; Ronchetti, F.; Rosinsky, P.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Rousseau, S.; Roy, C.; Roy, P.; Rubio-Montero, A.J.; Rui, R.; Rusanov, I.; Russo, G.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahoo, R.; Saini, J.; Saiz, P.; Sakata, D.; Salgado, C.A.; Salgueiro Domingues da Silva, R.; Salur, S.; Samanta, T.; Sambyal, S.; Samsonov, V.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Saturnini, P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schindler, H.; Schmidt, C.; Schmidt, H.R.; Schossmaier, K.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Segato, G.; Semenov, D.; Senyukov, S.; Seo, J.; Serci, S.; Serkin, L.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabratova, G.; Shahoyan, R.; Sharkov, G.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddi, E.; Siemiarczuk, T.; Silenzi, A.; Silvermyr, D.; Simili, E.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Snow, H.; Sogaard, C.; Soloviev, A.; Soltveit, H.K.; Soltz, R.; Sommer, W.; Son, C.W.; Son, H.; Song, M.; Soos, C.; Soramel, F.; Soyk, D.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Staley, F.; Stan, E.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Stenlund, E.; Steyn, G.; Stocco, D.; Stock, R.; Stolpovsky, P.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sumbera, M.; Susa, T.; Swoboda, D.; Symons, J.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Szuba, M.; Tadel, M.; Tagridis, C.; Takahara, A.; Takahashi, J.; Tanabe, R.; Takaki, D.J.Tapia; Taureg, H.; Tauro, A.; Tavlet, M.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thader, J.; Tieulent, R.; Tlusty, D.; Toia, A.; Tolyhy, T.; Torcato de Matos, C.; Torii, H.; Torralba, G.; Toscano, L.; Tosello, F.; Tournaire, A.; Traczyk, T.; Tribedy, P.; Troger, G.; Truesdale, D.; Trzaska, W.H.; Tsiledakis, G.; Tsilis, E.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Turvey, A.; Tveter, T.S.; Tydesjo, H.; Tywoniuk, K.; Ulery, J.; Ullaland, K.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vacchi, A.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van den Brink, A.; van der Kolk, N.; Vyvre, P.Vande; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasiliev, A.; Vassiliev, I.; Vasileiou, M.; Vechernin, V.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernet, R.; Verweij, M.; Vetlitskiy, I.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Viyogi, Y.P.; Vodopianov, A.; Voloshin, K.; Voloshin, S.; Volpe, G.; von Haller, B.; Vranic, D.; Vrlakova, J.; Vulpescu, B.; Wagner, B.; Wagner, V.; Wallet, L.; Wan, R.; Wang, D.; Wang, Y.; Watanabe, K.; Wen, Q.; Wessels, J.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilk, A.; Wilk, G.; Williams, M.C.S.; Willis, N.; Windelband, B.; Xu, C.; Yang, C.; Yang, H.; Yasnopolskiy, S.; Yermia, F.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I-K.; Yuan, X.; Yurevich, V.; Yushmanov, I.; Zabrodin, E.; Zagreev, B.; Zalite, A.; Zampolli, C.; Zanevsky, Yu.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zbroszczyk, H.; Zelnicek, P.; Zenin, A.; Zepeda, A.; Zgura, I.; Zhalov, M.; Zhang, X.; Zhou, D.; Zhou, S.; Zhu, J.; Zichichi, A.; Zinchenko, A.; Zinovjev, G.; Zoccarato, Y.; Zychacek, V.; Zynovyev, M.

2010-01-01

Charged-particle production was studied in proton-proton collisions collected at the LHC with the ALICE detector at centre-of-mass energies 0.9 TeV and 2.36 TeV in the pseudorapidity range |eta| < 1.4. In the central region (|eta| < 0.5), at 0.9 TeV, we measure charged-particle pseudorapidity density dNch/deta = 3.02 +- 0.01 (stat.) +0.08 -0.05 (syst.) for inelastic interactions, and dNch/deta = 3.58 +- 0.01 (stat.) +0.12 -0.12 (syst.) for non-single-diffractive interactions. At 2.36 TeV, we find dNch/deta = 3.77 +- 0.01 (stat.) +0.25 -0.12 (syst.) for inelastic, and dNch/deta = 4.43 +- 0.01 (stat.) +0.17 -0.12 (syst.) for non-single-diffractive collisions. The relative increase in charged-particle multiplicity from the lower to higher energy is 24.7% +- 0.5% (stat.) +5.7% -2.8% (syst.) for inelastic and 23.7% +- 0.5% (stat.) +4.6% -1.1% (syst.) for non-single-diffractive interactions. This increase is consistent with that reported by the CMS collaboration for non-single-diffractive events and larger th...

Phototrophic microvegetation of thermal springs in Karlovy Vary, Czech Republic

Czech Academy of Sciences Publication Activity Database

Kaštovský, J.; span class="emphasis">Komárek, Jiříspan>

2001-01-01

Roč. 123, - (2001), s. 107-120 ISSN 1438-9134. [International conference: Algae and extreme environments. Třeboň, 11.09.2000-16.09.2000] R&D Projects: GA AV ČR KSK6005114 Institutional research plan: CEZ:AV0Z6005908 Keywords : Cyanobacteria * algae * biodiversity * thermal springs * Karlovy Vary Spa * ecology * seasonality * anthropogenic factors * conservation Subject RIV: EF - Botanics Impact factor: 0.488, year: 2000

Natura2000 : information and communication on the designation and management of Natura2000 sites : main report 3: towards integrated management

NARCIS (Netherlands)

Kruk, R.W.; Blust, de G.; Apeldoorn, van R.C.; Bouwma, I.M.; Sier, A.R.J.

2010-01-01

Natura2000 : information and communication on the designation and management of Natura2000 sites. For all member states information will be collected describing the necessary management approaches, their legal framework, public consultation procedures as well as timing, structure and content of

OPG 2000 Sustainable development report

International Nuclear Information System (INIS)

2001-01-01

A major Ontario-based electricity generator, Ontario Power Generation Inc.'s main business focuses on the generation and sale of electricity to the Ontario wholesale market and interconnected markets in the surrounding provinces and states. By reducing the impact on the environment, by creating long-term shareholder value, and through community involvement, Ontario Power Generation Inc. is attempting to achieve sustainability. Shareholders are kept informed of the progress in meeting environmental, financial, and community and stakeholder goals every year by means of this report. The company's assets included five nuclear generating stations, six fossil-fuelled generating stations and 69 hydroelectric stations as of December 31, 2000, the end of the period covered by this report. Approximately 25,800 MW of total available capacity is available to local distribution companies and municipal utilities, large direct industrial customers, and Hydro One. The report begins with a discussion, between the Chief Executive Officer and the Vice-President of Sustainable Development, of the company's environmental goals. A brief section is devoted to the company's vision, followed by a section detailing the priorities. The company's performance is presented next, with a breakdown by sector, namely air, water, land. The topic of green power is presented, as well as a section on community. Value, including a brief discussion of the Auditor's review is then included. tabs., figs

Perovskite-based heterostructures integrating ferromagnetic-insulating La0.1Bi0.9MnO3

Science.gov (United States)

Gajek, M.; Bibes, M.; Barthélémy, A.; Varela, M.; Fontcuberta, J.

2005-05-01

We report on the growth of thin films and heterostructures of the ferromagnetic-insulating perovskite La0.1Bi0.9MnO3. We show that the La0.1Bi0.9MnO3 perovskite grows single phased, epitaxially, and with a single out-of-plane orientation either on SrTiO3 substrates or onto strained La2/3Sr1/3MnO3 and SrRuO3 ferromagnetic-metallic buffer layers. We discuss the magnetic properties of the La0.1Bi0.9MnO3 films and heterostructures in view of their possible potential as magnetoelectric or spin-dependent tunneling devices.

LMHC/TWRS year 2000 equipment project renovation and contingency plan

International Nuclear Information System (INIS)

ADAMS, M.R.

1999-01-01

A program has been completed to assess, renovate and document tank farm field equipment year 2000 compliance. A communication plan has also been prepared (see section 8.0). The objective of the program was to assure that no adverse effects occur in tank farm operations as a result of equipment malfunction due to the advent of year 2000. The purposes of this document are to: describe the process used to assess field equipment; document items found to be compliant; document items found to be non-compliant including options for making the equipment year 2000 functional and/or tolerant; describe location and management of field equipment year 2000 documentation; assess overall vulnerability of TWRS field equipment with regard to year 2000 problems and describe plans to communicate year 2000 equipment review results and corrective actions

Swiss electricity statistics 2000

International Nuclear Information System (INIS)

2001-01-01

This publication by the Association of Swiss Electricity Enterprises for the Swiss Federal Office of Energy (SFOE) provides statistical information on electricity production, trading and consumption in Switzerland in 2000. Apart from a general overview of the Swiss electricity supply that includes details on power generation, energy transfer with neighbouring countries and data on prices, average consumption and capital investment, the publication also includes graphical representations of electrical energy flows in and out of Switzerland. Tables of data give information on electricity production, import and export for the years 1950 to 2000, the data being supplied for each hydrological year and the summer and winter seasons respectively. The production of power in Switzerland is examined in detail. Details are given on the development of production capacities and the various means of production together with their respective shares of total production. Further tables and diagrams provide information on power production in various geographical regions and on the management of pumped storage hydro-electricity schemes. A further chapter deals in detail with the consumption of electricity, its growth between 1984 and 2000 and its use in various sectors. A fifth chapter examines electricity consumption, generation, import and export on single, typical days, presenting data in tables and diagrams. The next chapter examines energy transfer with foreign countries and the trading structures involved. The final two chapters cover new and future power generation capacities and the economic considerations involved in the supply of electricity

CSIR Technology Impact 2000

CSIR Research Space (South Africa)

CSIR

2000-01-01

Full Text Available This millennium issue of Technology Impact celebrates the CSIR's contributions during the transitional 1999/2000 year. It presents a rich canvas portrays technology solutions and information which have touched the lives of people both within...

Performance of HIV Prevention of Mother-To-Child Transmission Programs in Sub-Saharan Africa: Longitudinal Assessment of 64 Nevirapine-Based Programs Implemented in 25 Countries, 2000-2011.

Directory of Open Access Journals (Sweden)

Joël Ladner

Full Text Available To evaluate the performance and to identify predictive factors of performance in prevention of mother-to-child HIV transmission programs (PMTCT in sub-Saharan African countries.From 2000 to 2011, PMTCT programs included in the Viramune Donation Programme (VDP were prospectively followed. Each institution included in the VDP provided data on program implementation, type of management institution, number of PMTCT sites, key programs outputs (HIV counseling and testing, NVP regimens received by mothers and newborns. Nevirapine Coverage Ratio (NCR, defined as the number of women who should have received nevirapine (observed HIV prevalence x number of women in antenatal care, was used to measure performance. Included programs were followed every six months through progress reports.A total of 64 programs in 25 sub-Saharan African countries were included. The mean program follow-up was 48.0 months (SD = 24.5; 20,084,490 women attended in antenatal clinics were included. The overall mean NCR was 0.52 (SD = 0.25, with an increase from 0.37 to 0.57 between the first and last progress reports (p<.0001; NCR increased by 3.26% per year-program. Between the first and the last report, the number of women counseled and tested increased from 64.3% to 86.0% (p<.0001, the number of women post-counseled from 87.5% to 91.3% (p = 0.08. After mixed linear regression analysis, type of responsible institution, number of women attended in ANC, and program initiation in 2005-2006 were significant predictive factors associated with the NCR. The effect of the time period increased from earlier to later periods.A longitudinal assessment of large PMTCT programs shows that scaling-up of programs was increased in sub-Saharan African countries. The PMTCT coverage increased throughout the study period, especially after 2006. Performance may be better for programs with a small or medium number of women attended in ANC. Identification of factors that predict PMTCT program

Wind energy report Germany 1999/2000. Annual evaluation of WMEP; Windenergie Report Deutschland 1999/2000. Jahresauswertung des WMEP

Energy Technology Data Exchange (ETDEWEB)

Durstewitz, M.; Ensslin, C.; Hahn, B.; Hoppe-Klipper, M.; Rohrig, K. (comps.)

2001-07-01

The 1999/2000 issue of the annual evaluations of the scientific measurement and evaluation programme (WMEP) is the tenth regular publication of operational results from the wind turbines included in the ''250 MW Wind'' funding programme. Besides depicting the current state of the technology, a reflection on the long-term and successful development of this still young technology is offered. With the approval of a fourth project phase (2000 - 2004) it has been ensured that, also in coming years, particular attention can be paid to long-term behaviour in regard to reliability, life span and operational costs. (orig.) [German] Die vorliegende Jahresauswertung 1999/2000 des ''wissenschaftlichen mess- und evaluierungsprogramms'' (WMEP) stellt bereits die zehnte Ausgabe der regelmaessigen Veroeffentlichung von Betriebsergebnissen der Windenergieanlagen im Foerderprogramm ''250 MW Wind'' dar. Sie bietet damit neben der Darstellung des aktuellen Stands der Technik auch einen Rueckblick auf die langjaehrige und erfolgreiche Entwicklung dieser noch jungen Technologie. Mit dem Auftrag einer vierten Projektphase (zunaechst 2000 bis 2002) ist sichergestellt, dass auch in den kommenden Jahren besonders auf das Langzeitverhalten hinsichtlich Zuverlaessigkeit, Lebensdauer und Betriebskosten eingegangen werden kann. (orig.)

ITER council proceedings: 2000

International Nuclear Information System (INIS)

2001-01-01

No ITER Council Meetings were held during 2000. However, two ITER EDA Meetings were held, one in Tokyo, January 19-20, and one in Moscow, June 29-30. The parties participating in these meetings were those that partake in the extended ITER EDA, namely the EU, the Russian Federation, and Japan. This document contains, a/o, the records of these meetings, the list of attendees, the agenda, the ITER EDA Status Reports issued during these meetings, the TAC (Technical Advisory Committee) reports and recommendations, the MAC Reports and Advice (also for the July 1999 Meeting), the ITER-FEAT Outline Design Report, the TAC Reports and Recommendations both meetings), Site requirements and Site Design Assumptions, the Tentative Sequence of technical Activities 2000-2001, Report of the ITER SWG-P2 on Joint Implementation of ITER, EU/ITER Canada Proposal for New ITER Identification

NCBI nr-aa BLAST: CBRC-PABE-09-0018 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PABE-09-0018 ref|NP_005276.2| G protein-coupled receptor 7 [Homo sapiens] gb|AAH69117.1| Neuropeptides... B/W receptor 1 [Homo sapiens] gb|AAI07102.1| Neuropeptides B/W receptor 1 [Homo sap...iens] gb|EAW86722.1| neuropeptides B/W receptor 1 [Homo sapiens] NP_005276.2 0.0 100% ...

Imagery, laboratory analysis and sediment analysis oceanographic data collected aboard the GYRE in the Gulf of Mexico from 2010-09-13 to 2010-09-16 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0084568)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Imagery, laboratory analysis and sediment analysis oceanographic data were collected aboard the GYRE in the Gulf of Mexico from 2010-09-13 to 2010-09-16 in response...

Results of the 2000 census of wild reindeer on the Taimyr Peninsula

Directory of Open Access Journals (Sweden)

Leonid A. Kolpashchikov

2003-04-01

Full Text Available We conducted a census of wild reindeer (Rangifer tarandus on the Taimyr Peninsula during 21-25 July 2000. This was the eighteenth aerial population census of wild reindeer on the Taimyr since counts began in 1959. Prior to the census, we conducted reconnaissance flights to identify areas of reindeer concentration. After the reindeer became aggregated, we estimated group size both visually and by photographing the larger groups. Unusually hot and dry weather (temperatures of 25-30 °C and a high density of mosquitoes during the census likely forced the reindeer to group into unusually large concentrations. In late July most of the reindeer in the Taimyr population were distributed in two groupings that contained at least 450 000 animals, and one area that contained about 110 000. Smaller groups found during the census and the estimated 43 000 resident wild reindeer that were not counted during the census brought the total minimum population estimate to about 1 040 000. The maximum number of wild reindeer present could have been as high as about 1 100 000.

Trends of Non-Accidental, Cardiovascular, Stroke and Lung Cancer Mortality in Arkansas Are Associated with Ambient PM2.5 Reductions

Directory of Open Access Journals (Sweden)

Marie-Cecile G. Chalbot

2014-07-01

Full Text Available The cardiovascular and stroke mortality rates in Arkansas are among the highest in the USA. The annual trends of stroke and cardiovascular mortality are barely correlated to smoking cessation; while the prevalence of risk factors such as obesity; cholesterol and hypertension increased over the 1979–2007 period. The study determined the effect of chronic exposure to PM2.5 on non-accidental; cardiovascular; stroke and lung cancer mortality in Arkansas over the 2000–2010 period using the World Health Organization’s log-linear health impact model. County chronic exposures to PM2.5 were computed by averaging spatially-resolved gridded concentrations using PM2.5 observations. A spatial uniformity was observed for PM2.5 mass levels indicating that chronic exposures were comparable throughout the state. The reduction of PM2.5 mass levels by 3.0 μg/m3 between 2000 and 2010 explained a significant fraction of the declining mortality. The effect was more pronounced in southern and eastern rural Arkansas as compared to the rest of the state. This study provides evidence that the implementation of air pollution regulations has measurable effects on mortality even in regions with high prevalence of major risk factors such as obesity and smoking. These outcomes are noteworthy as efforts to modify the major risk factors require longer realization times.

Dynamics of cognitive disturbances in rats with acute cerebral ischemia on the background of introduction of 0.9 % solution NaCl

Directory of Open Access Journals (Sweden)

Андрій Ігорович Семененко

2015-06-01

Full Text Available For today there are no clear recommendations on infusion therapy at the disease and injuries of brain, and infusion preparations are commonly used empirically. Within the framework of the complex study of an influence of the different infusion remedies on brain at an experimental ischemia of brain, an aim of this work is to investigate how the 0,9 % solution of NaCl influences on the dynamics of cognitive functions and neurological status of the rats with an acute cerebral ischemia at the course medical introduction into an animal organism.Methods. Experiments were carried out on 60 white rats-males. An acute disturbance of cerebral blood circulation (ADCBC was modeled by means of the two-sided dressing of internal carotid arteries. The 0,9 % solution of NаСІ was injected intravenously in catheterized thigh vein 2,5 ml/kg 2 times/day (5 ml/kg for a day. The first introduction was carried out in 30 minutes after ADCBC and then every day in 12 hours during 7 days. The control groups consist of intact rats that received 0,9 % NаСІ and animals with a model ischemia without treatment.Neurological deficiency in animals was defined on the scale stroke-index McGrow C. P. The dynamics of position-finding activity was assessed in experiment “an open field”. An assessment of animal capacity to training and memorization of an aversive stimulus was studied in the test of conditioned response of passive avoidance. The results were processed using the program StatPlus 2009.Results. The study showed that bilateral carotid occlusion in rats without treatment is followed not only by the high animal lethality but also by the development of a hard neurological symptomatology and then by essential disturbance of mnestic functions in animals that survived during the recovery period of model insult (р<0,01.The study of lethality dynamics, neurological status, behavioral responses in rats with ADCBC on the model of bilateral carotid occlusion showed that the

Land-use trends related to Natura2000 sites in Denmark

DEFF Research Database (Denmark)

Levin, Gregor; Nainggolan, Doan; Frederiksen, Pia

2018-01-01

EU-member states are obliged to designate Natura2000 sites for habitat protection. Natura2000 sites comprise approximately 18 percent of the terrestrial area of the EU. On average, around 22 percent of Natura2000 sites are covered by agricultural land use, such as intensive cropland and more...... extensively managed land. Particularly in regions with high proportions of agricultural land use in Natura2000 sites, habitat protection is closely linked with the intensity of agricultural land use. Thus, it is important to understand dynamics between intensive and extensive land use. Denmark, where Natura......2000 sites comprise approximately 8 percent of the terrestrial area, is the EU member state with the highest proportion of agricultural land use in Natura2000 sites. The Habitat Directive (HD) was implemented in Denmark in 2003. This implied increased focus from authorities on extensification...

Energy situation. November 2000

International Nuclear Information System (INIS)

2000-12-01

This report makes a status of the French energy consumption, demand, import and export since January 1998 and up to November 2000. Details are given separately for primary energy, solid mineral fuels, petroleum products, natural gas and electric power. (J.S.)

Energy situation. September 2000

International Nuclear Information System (INIS)

2000-10-01

This report gives a status of the French energy consumption, demand, import and export since January 1998 and up to September 2000. Details are given separately for primary energy, solid mineral fuels, petroleum products, natural gas and electric power. (J.S.)

Energy situation. July 2000

International Nuclear Information System (INIS)

2000-08-01

This report makes a status of the French energy consumption, demand, import and export since January 1998 and up to July 2000. Details are given separately for primary energy, solid mineral fuels, petroleum products, natural gas and electric power. (J.S.)

Energy situation. May 2000

International Nuclear Information System (INIS)

2000-06-01

This report makes a statement of the French energy consumption, demand, import and export since January 1998 and up to May 2000. Details are given separately for primary energy, solid mineral fuels, petroleum products, natural gas and electric power. (J.S.)

Net Carbon Emissions from Deforestation in Bolivia during 1990-2000 and 2000-2010: Results from a Carbon Bookkeeping Model.

Science.gov (United States)

Andersen, Lykke E; Doyle, Anna Sophia; del Granado, Susana; Ledezma, Juan Carlos; Medinaceli, Agnes; Valdivia, Montserrat; Weinhold, Diana

2016-01-01

Accurate estimates of global carbon emissions are critical for understanding global warming. This paper estimates net carbon emissions from land use change in Bolivia during the periods 1990-2000 and 2000-2010 using a model that takes into account deforestation, forest degradation, forest regrowth, gradual carbon decomposition and accumulation, as well as heterogeneity in both above ground and below ground carbon contents at the 10 by 10 km grid level. The approach permits detailed maps of net emissions by region and type of land cover. We estimate that net CO2 emissions from land use change in Bolivia increased from about 65 million tons per year during 1990-2000 to about 93 million tons per year during 2000-2010, while CO2 emissions per capita and per unit of GDP have remained fairly stable over the sample period. If we allow for estimated biomass increases in mature forests, net CO2 emissions drop to close to zero. Finally, we find these results are robust to alternative methods of calculating emissions.

Progress report 1999-2000

International Nuclear Information System (INIS)

2000-01-01

This document presents the activities of the CENBG for the 1999 and 2000 years. The activities are arranged into 7 topics: 1) astro-particles, 2) high spins and big deformations, 3) fundamental interactions, 4) exotic nuclei, 5) the down end of the nuclear fuel cycle and ADS (accelerator driven system), 6) theoretical physics and 7) at the interface between physics and biology. Among a lot of achievements relevant to INIS we can note: -) the investigation of 2 new modes of decay: the bound internal conversion and the Pauli forbidden bound internal conversion, -) the progress made on the Nemo-3 experiment whose purpose is the possibility of detecting the neutrinoless double beta decay from the kinematics specificities of the 2 electrons released, -) the first observation of the doubly-magic nucleus Ni 48 , -) the beta delayed proton and gamma -ray spectroscopy of Mg 21 and Si 25 nuclei, -) the identification of the fundamental state of Li 10 , -) the measurement of the masses of nuclei close to N = Z line in the region A = 80, -) the measurement of the beta decay of Ga 62 (T = 116 ms), and concerning ADS technology: -) the neutron capture cross-section of Th 232 has been measured in the energy range from 60 keV to 2 MeV, -) the determination of neutron induced fission cross-section of Pa 233 in the fast neutron energy range from 0.5 to 10 MeV, and -) the measurement of isotopic distributions for all residual elements from Ti to Pb produced in the reaction 1 A.GeV Pb 208 on proton. (A.C.)

Solution of operational problems utilization of an EX-IRT-2000 heat exchanger

International Nuclear Information System (INIS)

Razak, Abdu

1986-01-01

The Bandung TRIGA Mark II Reactor has been successfully operated for 21 years, especially in low power operation or as neutron sources for various experiments. Most of the operating time, approximately 80% of routine operation, was dedicated for radio-isotope production. During routine operation for radio-isotope production, the reactor could not be operated at full power. The reactor was operated at 60% of the maximum power (1 MWth) due to the inability of the original heat exchanger to operate properly. The reason is that slack deposition was built-up on the secondary side of the heat exchanger. Therefore, it reduced the coefficient of heat transfer considerably. To solve the problems, a set of heat exchanger including the pump was installed In parallel with the original unit. The heat exchanger was an IRT-2000 Reactor Heat exchanger which was collected from the abandoned IRT-2000 Project. The heat exchanger has capacity of 1.25 MW. The new heat exchanger could reduced the outlet temperature of the primary coolant Into 42 deg. C. While the original-heat exchanger at the worst condition and at 600 kW of power reach outlet temperature 49 deg. C. The IRT Heat Exchanger is a counter flow heat exchanger. (author)

Solution of operational problems utilization of an EX-IRT-2000 heat exchanger

Energy Technology Data Exchange (ETDEWEB)

Razak, Abdu [Research Centre for Nuclear Techniques, National Atomic Energy Agency (Indonesia)

1986-07-01

The Bandung TRIGA Mark II Reactor has been successfully operated for 21 years, especially in low power operation or as neutron sources for various experiments. Most of the operating time, approximately 80% of routine operation, was dedicated for radio-isotope production. During routine operation for radio-isotope production, the reactor could not be operated at full power. The reactor was operated at 60% of the maximum power (1 MWth) due to the inability of the original heat exchanger to operate properly. The reason is that slack deposition was built-up on the secondary side of the heat exchanger. Therefore, it reduced the coefficient of heat transfer considerably. To solve the problems, a set of heat exchanger including the pump was installed In parallel with the original unit. The heat exchanger was an IRT-2000 Reactor Heat exchanger which was collected from the abandoned IRT-2000 Project. The heat exchanger has capacity of 1.25 MW. The new heat exchanger could reduced the outlet temperature of the primary coolant Into 42 deg. C. While the original-heat exchanger at the worst condition and at 600 kW of power reach outlet temperature 49 deg. C. The IRT Heat Exchanger is a counter flow heat exchanger. (author)

Determination of gold using clay modified carbon paste electrode

Czech Academy of Sciences Publication Activity Database

Navrátilová, Zuzana; Kula, Petr

2000-01-01

Roč. 367, č. 4 (2000), s. 369-372 ISSN 0937-0633. [ELACH 4 - Forum on Electroanalytical Methods. Warnemuende, 13.09.1999-19.09.1999] R&D Projects: GA AV ČR KSK1012601 Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.418, year: 2000

Cephradine as corrosion inhibitor for copper in 0.9% NaCl solution

Science.gov (United States)

Tasić, Žaklina Z.; Petrović Mihajlović, Marija B.; Radovanović, Milan B.; Simonović, Ana T.; Antonijević, Milan M.

2018-05-01

The effect of (6R,7R)-7-[[(2R)-2-amino-2-cyclohexa-1,4-dien-1-ylacetyl]amino]-3-methyl-8-oxo-5-thia-1-azobicyclo[4.2.0]oct-2-ene-2-carboxylic acid (cephradine) on corrosion behavior of copper in 0.9% NaCl solution was investigated. The electrochemical methods including the open circuit potential measurements, potentiodynamic polarization and electrochemical impedance spectroscopy measurements, scanning electron microscopy with energy dispersive X-ray spectroscopy and quantum chemical calculations were used for this investigation. According to the results obtained by potentiodynamic polarization, cephradine acts as mixed type inhibitor. Also, the results obtained by electrochemical impedance spectroscopy indicate that cephradine provides good copper protection in 0.9% NaCl solution. The inhibition efficiency of cephradine increases with increasing its concentration. The scanning electron microscopy with energy dispersive X-ray spectroscopy confirms that a protective layer is formed on the copper surface due to the adsorption of cephradine on the active sites on the copper surface. Adsorption of cephradine in 0.9% NaCl solution follows the Langmuir adsorption isotherm. Quantum chemical calculations are in agreement with results obtained by electrochemical measurements.

Description of deaths on Easter Island, 2000-2012 period.

Science.gov (United States)

Bravo, Eduardo Francisco; Saint-Pierre, Gustavo Enrique; Yaikin, Pabla Javiera; Meier, Martina Jose

2014-01-01

Easter Island is a small island of 180 km2, located 3,800 km from the Chilean coast and one of the most isolated inhabited places in the world. Since the mid-twentieth century, it has been undergoing an epidemiological transition in relation to the causes of death, from a predominance of infectious to non-communicable diseases (NCDs) such as cardiovascular ailments and cancer. The aim of this study is to describe the causes of death to Easter Island between 2000 and 2012, so the statistical records of Hanga Roa Hospital and death certificates were reviewed. The period under review of 13 years there was a total of 252 deaths, an average to 19.3 deaths per year. The most frequent causes of death found in the general population of Easter Island were cardiovascular diseases (25.4%), followed by neoplasms (23.4%), accidents (18.6%). Related to Rapa Nui people, cardiovascular and neoplastic diseases (both 26.7%) predominate, while in the population without belonging to the ethnic group the main causes were traumatic (25%) and cardiovascular (22.2%). Comparing the leading causes of death of Easter Island with mainland Chile, it can be seen how they resemble. Taking the island death profile, it is necessary to work on public health strategies aimed to this, considering that some of the causes are completely preventable.

Proceedings of the IRI task force activity 2000

International Nuclear Information System (INIS)

Radicella, Sandro M.

2001-05-01

This internal report of the International Center for Theoretical Physics (ICTP) contains presentations delivered during the International Reference Ionosphere Task Force Activity 2000 which took place at the Abdus Salam ICTP during July 2000. The 2000 Task Force Activity is the seventh successful encounter of specialists organized by the URSI-COSPAR IRI Working Group and the Aeronomy and Radiopropagation Laboratory of the ICTP of Trieste, Italy. The main topic of this task force activity was the modeling of the topside ionosphere and the development of strategies for modeling of ionospheric variability

Turundustegu 2000 : ego pani end maksma / Margo Kokerov

Index Scriptorium Estoniae

Kokerov, Margo, 1978-

2001-01-01

Marketingi Instituudi, Turunduskeskuse ja Emori korraldatud konkursist Eesti Turundustegu 2000. Ülevaade finaaltöödest - A. Le Coq'i turuosa kasv, Dynamo kõnepakett, Eesti väljapanek Expo 2000-1, Hiirte juust ja Ego järelmaksukaart

Large reductions in urban black carbon concentrations in the United States between 1965 and 2000

Science.gov (United States)

Kirchstetter, Thomas W.; Preble, Chelsea V.; Hadley, Odelle L.; Bond, Tami C.; Apte, Joshua S.

2017-02-01

Long-term pollutant concentration trends can be useful for evaluating air quality effects of emission controls and historical transitions in energy sources. We employed archival records of coefficient of haze (COH), a now-retired measure of light-absorbing particulate matter, to re-construct historical black carbon (BC) concentrations at urban locations in the United States (U.S.). The following relationship between COH and BC was determined by reinstating into service COH monitors beside aethalometers for two years in Vallejo and one year in San Jose, California: BC (μg m-3) = 6.7COH + 0.1, R2 = 0.9. Estimated BC concentrations in ten states stretching from the East to West Coast decreased markedly between 1965 and 1980: 5-fold in Illinois, Ohio, and Virginia, 4-fold in Missouri, and 2.5-fold in Pennsylvania. Over the period from the mid-1960s to the early 2000s, annual average BC concentrations in New Jersey and California decreased from 13 to 2 μg m-3 and 4 to 1 μg m-3, respectively, despite concurrent increases in fossil fuel consumption from 1.6 to 2.1 EJ (EJ = 1018 J) in New Jersey and 4.2 to 6.4 EJ in California. New Jersey's greater reliance on BC-producing heavy fuel oils and coal in the 1960s and early 1970s and subsequent transition to cleaner fuels explains why the decrease was larger in New Jersey than California. Patterns in seasonal and weekly BC concentrations and energy consumption trends together indicate that reducing wintertime emissions - namely substituting natural gas and electricity for heavy fuel oil in the residential sector - and decreasing emissions from diesel vehicles contributed to lower ambient BC concentrations. Over the period of study, declining concentrations of BC, a potent and short-lived climate warming pollutant, contrast increasing fossil fuel carbon dioxide (CO2) emissions in the U.S. Declining BC emissions may have had the benefit of mitigating some atmospheric warming driven by increased CO2 emissions with

Mortality trends from diabetes mellitus in the seven socioeconomic regions of Mexico, 2000-2007 Tendencias de la mortalidad por diabetes mellitus en las siete regiones socioeconómicas de México, 2000-2007

Directory of Open Access Journals (Sweden)

Juan Jesús Sánchez-Barriga

2010-11-01

Full Text Available OBJECTIVE: To determine trends in mortality from diabetes mellitus nationwide according to federative entity, socioeconomic region, and sex and to establish the association between education level, federation entity of residence, and socioeconomic region and mortality from diabetes in Mexico during the years 2000-2007. METHODS: Records of mortality associated with diabetes for 2000-2007 were obtained from the National Information System of the Secretariat of Health. This information is generated by the National Institute of Statistics, Geography and Informatics through death certificates. Codes of International Classification of Diseases, 10th Revision, that correspond to the basic cause of death from diabetes mellitus were identified. Rates of mortality by federative entity and socioeconomic region were calculated, along with the strength of association (obtained by Poisson regression between federative entity of residence, socioeconomic region, and education level and mortality from diabetes. The seven socioeconomic regions elaborated by the National Institute of Statistics, Geography and Informatics include the 32 federative entities according to indicators related to well-being such as education, occupation, health, housing, and employment. RESULTS: Individuals who did not complete elementary school had a higher risk of dying from diabetes (relative risk [RR] 2.104, 95% confidence interval [CI] 2.089-2.119. The federative entity and socioeconomic region with the strongest association with mortality from diabetes were Mexico City (RR 2.5, CI 2.33-2.68 for 2000; RR 2.06, CI 1.95-2.18 for 2007 and region 7 (RR 2.47, CI 2.36-2.57 for 2000; RR 2.05, CI 1.98-2.13 for 2007. CONCLUSIONS: Mortality rates increased from 77.9 to 89.2 per 100 000 inhabitants in the period 2000-2007. Women had higher mortality than men. Individuals who did not complete elementary school had a higher risk of dying from diabetes (RR 2.104, CI 2.089-2.119. Mexico City as

LEGO Koncern 2000 - 2003 - en årsagsanalyse

OpenAIRE

Rosenberg, Morten; Özbudak, Devrim; Møller, Mads; Herneth, Daniel

2006-01-01

Denne rapport omhandler LEGO Koncernens økonomiske krise i årene 2000-2003. Vores videnskabsteoretiske er Kritisk realisme og vi bruger i projektet; en regnskabsanalyse, komparativ rapport og en PEST-analyse Denne rapport omhandler LEGO Koncernens økonomiske krise i årene 2000-2003. Vores videnskabsteoretiske er Kritisk realisme og vi bruger i projektet; en regnskabsanalyse, komparativ rapport og en PEST-analyse

Magnetismo 2000

Science.gov (United States)

Cardús, J. O.; Curto, J. J.; Sanclement, E.; Torta, J. M.

This CD-ROM presents the digital version of the Boletin del Observatorio del Ebro Magnetismo. It contains data obtained in the Magnetic Station of the Ebre Observatory during the year 2000. The structure of the CD-ROM consists of one directory numbered with the year of the measurement. There, it could be found the bulletin as printable sheets (Year.pdf) generate with Adobe Acrobat and data files in plain ASCII text (Year.wdc) readable with any text editor. These data files were compiled according to the data exchange format recommended by the IAGA-2002.

Tribology in 2000 and beyond

International Nuclear Information System (INIS)

Prashad, H.

1999-01-01

The proceeding of Second International Conference on Industrial Tribology with a theme of Tribology in 2000 and beyond offers a platform to focus the achievements of tribology by 2000 and the future advancement of this discipline in the 21st Century. The conference dealt with the use of synthetic, environment friendly, multigrade lubricants, friction modifiers, increased wear resistant surface treatment, use of magnetic bearings and optimum energy saving bearing design to enhance the performance of the equipment. The papers included in this proceeding is of interest to industries like steel, petroleum, engineering, power generation as well as for academic institutions and research laboratories from India and abroad. Papers relevant to INIS are indexed separately

Migration towards Windows 2000/XP

International Nuclear Information System (INIS)

Gal, J.

2004-01-01

The article deals with interesting technical solutions used in the project 'Migration towards Windows 2000/XP', which was introduced by the company AITEN, Plc for companies SE Plc, SEPS Plc and TEKO, Plc in the period 2002 and 2003. The contents of the project was migration of about 100 servers and more than 4 000 PC to the Windows 2000 and XP environs. The result of the project is a unified and documented system in the field of file, print and small application servers and PC. It has enabled to increase the system reliability and availability, to decrease the total costs for administration and operation and to establish the steady environs for users of the applications. (author)

Nuclear power: Year 2000

International Nuclear Information System (INIS)

Siegel, J.R.

1984-01-01

This paper offers a contrary view on the future of nuclear power in the U.S. Contrarian, in that it argues that it is quite possible that the installed U.S. nuclear capacity in the year 2000 will be in the range of 250GWe. This projection is based on the longer view - a 20-30 year picture - of the price trends of the fuels commercially available to make electricity. And on the belief that other projections of nuclear capacity for the year 2000, while generally acknowledging the need to add significant amounts of new electricity capacity, are essentially discounting nuclear power. And thus, are ignoring fundamental economics. The logic for the projected 250 GWe follows: The demand for electricity is continuing to grow, albeit at a slower rate than that experienced prior to 1973; The excess generating capacity in the construction pipeline, which developed during the 1970s as economic growth rates came in at half the projections made in 1973, has been worked off; in fact, the pendulum has swung past the mid-point; U.S. utilities need to order an additional 200-350 GWe of capacity for service between 1992 and 2000; The real capital costs of plants, particularly nuclear plants, ordered in the 1980s will be less than that being completed today, as this new plant will be completed on a more expedient basis for reliability reasons, and built in an improved financial climate for utilities; Owing primarily to more favorable economics, but also to environmental considerations, at least half of new generating capacity will be nuclear

An Adaptive B-Spline Method for Low-order Image Reconstruction Problems - Final Report - 09/24/1997 - 09/24/2000

Energy Technology Data Exchange (ETDEWEB)

Li, Xin; Miller, Eric L.; Rappaport, Carey; Silevich, Michael

2000-04-11

A common problem in signal processing is to estimate the structure of an object from noisy measurements linearly related to the desired image. These problems are broadly known as inverse problems. A key feature which complicates the solution to such problems is their ill-posedness. That is, small perturbations in the data arising e.g. from noise can and do lead to severe, non-physical artifacts in the recovered image. The process of stabilizing these problems is known as regularization of which Tikhonov regularization is one of the most common. While this approach leads to a simple linear least squares problem to solve for generating the reconstruction, it has the unfortunate side effect of producing smooth images thereby obscuring important features such as edges. Therefore, over the past decade there has been much work in the development of edge-preserving regularizers. This technique leads to image estimates in which the important features are retained, but computationally the y require the solution of a nonlinear least squares problem, a daunting task in many practical multi-dimensional applications. In this thesis we explore low-order models for reducing the complexity of the re-construction process. Specifically, B-Splines are used to approximate the object. If a ''proper'' collection B-Splines are chosen that the object can be efficiently represented using a few basis functions, the dimensionality of the underlying problem will be significantly decreased. Consequently, an optimum distribution of splines needs to be determined. Here, an adaptive refining and pruning algorithm is developed to solve the problem. The refining part is based on curvature information, in which the intuition is that a relatively dense set of fine scale basis elements should cluster near regions of high curvature while a spares collection of basis vectors are required to adequately represent the object over spatially smooth areas. The pruning part is a greedy search algorithm to find and delete redundant knots based on the estimation of a weight associated with each basis vector. The overall algorithm iterates by inserting and deleting knots and end up with much fewer knots than pixels to represent the object, while the estimation error is within a certain tolerance. Thus, an efficient reconstruction can be obtained which significantly reduces the complexity of the problem. In this thesis, the adaptive B-Spline method is applied to a cross-well tomography problem. The problem comes from the application of finding underground pollution plumes. Cross-well tomography method is applied by placing arrays of electromagnetic transmitters and receivers along the boundaries of the interested region. By utilizing inverse scattering method, a linear inverse model is set up and furthermore the adaptive B-Spline method described above is applied. The simulation results show that the B-Spline method reduces the dimensional complexity by 90%, compared with that o f a pixel-based method, and decreases time complexity by 50% without significantly degrading the estimation.

Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069110)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in...

Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-03 to 2010-09-07 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069108)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-03 to 2010-09-07 in...

Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-15 to 2010-09-22 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069079)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-15 to 2010-09-22 in...

Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-23 to 2010-09-28 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069080)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-23 to 2010-09-28 in...

Reported child sexual abuse in Bahrain: 2000-2009.

Science.gov (United States)

Al-Mahroos, Fadheela; Al-Amer, Eshraq

2011-01-01

Child sexual abuse (CSA) is a common problem with severe short and long-term consequences to the abused child, the family and to society. The aim of this study was to evaluate the extent of CSA, and demographic and other characteristics of the abused and their families. Retrospective and descriptive study based on a review of medical records of CSA cases from 2000-2009 at Sulmaniya Medical Complex, the main secondary and tertiary medical care facility in Bahrain. The review included demographic data, child and family characteristics, manifestations and interventions. The 440 children diagnosed with CSA had a mean age of 8 years (range, 9 months to 17 years); 222 were males (50.5%) and 218 were females (49.5%). There was a steady increase in cases from 31 per year in 2000 to 77 cases in 2009. Children disclosed abuse in 26% of cases, while health sector professionals recognized 53% of the cases. Genital touching and fondling (62.5%) were the most common form of CSA, followed by sodomy in 39%. Gonorrhea was documented in 2% of the cases and pregnancy in 4% of the females. The illiteracy rate among the fathers and mothers was 9% and 12%, respectively, which is higher than the rate among the adult general population. Children came from all socio-economic classes. There was referral to police in 56%, public prosecution in 31% of the cases, but only 8% reached the court. During ten years there has been a 2.5% increase in reported cases of CSA. Improving the skill of professionals in identifying CSA indicators and a mandatory reporting law might be needed to improve the rate of recognition and referral of CSA cases. Further general population-based surveys are needed to determine more accurately the scope of CSA and the risk and protective factors in the family and community.

Activity report 2000

International Nuclear Information System (INIS)

2001-01-01

This document draws out an overview of the actions carried out by the Andra (the French national agency of radioactive wastes) during the year 2000 in the framework of its three main missions: the warranty of radioactivity confinement, the scientific research on radioactive waste management and the development of the public information in this domain. The management report of the agency is given in appendix. (J.S.)

2000-2006 National Wood Energy Programme. 2000-2005 Activities Report

International Nuclear Information System (INIS)

2006-01-01

component in developing wood energy. In this context, wood energy will be a key part of the fight against climate change and the development of renewable sources of energy. This report presents: 1 - the Wood Energy issues, advantages and key figures, and the evaluation of resources; 2 - The 2000-2006 Programme: objectives (domestic heating, industrial heating systems, urban, public and tertiary heating), operation (ADEME programme leadership (2000-2005), partnerships and State Region planning contracts, the funding system for Wood Energy projects (2000-2005, modified in November 2004 and the other financial instruments (FOGIME/FIDEME); 3 - 2000-2005 Assessment: results by sector (domestic wood-fired heating, industrial, public and tertiary sectors); supply development and structuring (supply systems and regional diversity, growth in suppliers, supply structuring, emergence of new players in the market, biomass resources and forestry work, developing the use of wood chips, the impact of collecting slash); Information and communication (leadership and promotion, publications supported by ADEME); Appendixes: fuels and energy content, detailed report, studies funded by ADEME; ADEME's presentation; 2005 R and D projects

Wind energy in Canada: an action plan to 2000

International Nuclear Information System (INIS)

1996-02-01

The role of the CanWEA (Canadian Wind Energy Association) is to promote the development and application of wind energy technology, products and services. CanWEA has established targets with regard to the future development of wind energy. Present targets include (1) the installation of 500 MW of wind generated electric capacity by the year 2000, and at least 5,000 MW by the year 2010, (2) the installation or export of 15,000 wind powered water pumping systems by the year 2000, (3) the installation of 2,500 micro-wind systems by the year 2000, and (4) the development of a Canadian wind energy industry which generates $200 million in annual sales by the year 2000

76 FR 41501 - Notice of Intent To Award Affordable Care Act (ACA) Funding, EH09-907

Science.gov (United States)

2011-07-14

... network expansion and enhancement. Funding is appropriated under the Affordable Care Act (Pub. L. 111-148... Intent To Award Affordable Care Act (ACA) Funding, EH09-907 AGENCY: Centers for Disease Control and... in their FY 2011 applications submitted under funding opportunity EH09-907, ``National Environmental...

PROCEEDINGS OF RIKEN BNL RESEARCH CENTER WORKSHOP ON RHIC SPIN PHYSICS III AND IV, POLARIZED PARTONS AT HIGH Q2 REGION, AUGUST 3, 2000 AT BNL, OCTOBER 14, 2000 AT KYOTO UNIVERSITY.

Energy Technology Data Exchange (ETDEWEB)

BUNCE, G.; VIGDOR, S.

2001-03-15

International workshop on II Polarized Partons at High Q2 region 11 was held at the Yukawa Institute for Theoretical Physics, Kyoto University, Kyoto, Japan on October 13-14, 2000, as a satellite of the international conference ''SPIN 2000'' (Osaka, Japan, October 16-21,2000). This workshop was supported by RIKEN (The Institute of Physical and Chemical Research) and by Yukawa Institute. The scientific program was focused on the upcoming polarized collider RHIC. The workshop was also an annual meeting of RHIC Spin Collaboration (RSC). The number of participants was 55, including 28 foreign visitors and 8 foreign-resident Japanese participants, reflecting the international nature of the RHIC spin program. At the workshop there were 25 oral presentations in four sessions, (1) RHIC Spin Commissioning, (2) Polarized Partons, Present and Future, (3) New Ideas on Polarization Phenomena, (4) Strategy for the Coming Spin Running. In (1) the successful polarized proton commissioning and the readiness of the accelerator for the physics program impressed us. In (2) and (3) active discussions were made on the new structure function to be firstly measured at RHIC, and several new theoretical ideas were presented. In session (4) we have established a plan for the beam time requirement toward the first collision of polarized protons. These proceedings include the transparencies presented at the workshop. The discussion on ''Strategy for the Coming Spin Running'' was summarized by the chairman of the session, S. Vigdor and G. Bunce.

Meningen over abortus in West-Europa, 1981-2000

NARCIS (Netherlands)

Need, Ariana; Ultee, Wouter; Levels, Mark; Tienen, Marike van

2008-01-01

Summary Abortion attitudes in Western Europe, 1981-2000 This article answers descriptive and explanatory questions about abortion attitudes in Western Europe between 1981 and 2000. It explains country differences and trends in these attitudes with abortion laws of states, with the norms that prevail

CORINE Land Cover 2000 (IandCLC2000)

International Nuclear Information System (INIS)

Novacek, J.

2005-01-01

Remote Sensing for the Earth is one of the method for obtaining of information about objects of the Earth surface. Satellite snapshots were basic source of information for this project. Slovak Environmental Agency was the coordinator of this project to the Slovak Republic and co-research organisation was Geographic Institute, Slovak Academy of Sciences. Interpretation of satellite snapshots enabled to obtain information about position and area of natural ranges of 44 classes of landscape cover of Europe, from which in the Slovakia occurs 31 classes. Resulting thematic layers of landscape cover of the Slovakia during the years 1990 and 2000 are significant for analysis of trends, reasons and implications of nature and social processes which proceeds in the time and place of given territory

A 0.9-V 12-bit 40-MSPS Pipeline ADC for Wireless Receivers

Science.gov (United States)

Ito, Tomohiko; Itakura, Tetsuro

A 0.9-V 12-bit 40-MSPS pipeline ADC with I/Q amplifier sharing technique is presented for wireless receivers. To achieve high linearity even at 0.9-V supply, the clock signals to sampling switches are boosted over 0.9V in conversion stages. The clock-boosting circuit for lifting these clocks is shared between I-ch ADC and Q-ch ADC, reducing the area penalty. Low supply voltage narrows the available output range of the operational amplifier. A pseudo-differential (PD) amplifier with two-gain-stage common-mode feedback (CMFB) is proposed in views of its wide output range and power efficiency. This ADC is fabricated in 90-nm CMOS technology. At 40MS/s, the measured SNDR is 59.3dB and the corresponding effective number of bits (ENOB) is 9.6. Until Nyquist frequency, the ENOB is kept over 9.3. The ADC dissipates 17.3mW/ch, whose performances are suitable for ADCs for mobile wireless systems such as WLAN/WiMAX.

The Presidential Sweepstakes 2000.

Science.gov (United States)

Doyle, Denis P.

2000-01-01

In the 2000 presidential campaigns, both Vice-President Al Gore and Texas Governor George W. Bush want to enlarge the federal role in education. In separate essays, Bush and Gore explain their plans to invest more federal dollars in improving poor children's educational progress and opportunities. (MLH)

LD in AD 2000.

Science.gov (United States)

Smith, Bert Kruger

The author discusses potential problems and benefits for learning disabled (LD) students in the year 2000. Considered are developments in three areas: human engineering (such as the role of amniocentesis in prevention of disabilities), education (including new audiovisual technology and a restructuring of secondary education), and human…

The positive impact of general vitamin D food fortification policy on vitamin D status in a representative adult Finnish population: evidence from an 11-y follow-up based on standardized 25-hydroxyvitamin D data.

Science.gov (United States)

Jääskeläinen, Tuija; Itkonen, Suvi T; Lundqvist, Annamari; Erkkola, Maijaliisa; Koskela, Tapani; Lakkala, Kaisa; Dowling, Kirsten G; Hull, George Lj; Kröger, Heikki; Karppinen, Jaro; Kyllönen, Eero; Härkänen, Tommi; Cashman, Kevin D; Männistö, Satu; Lamberg-Allardt, Christel

2017-06-01

Background: A systematic vitamin D fortification of fluid milk products and fat spreads was started in 2003 in Finland to improve vitamin D status. Objective: We investigated the effects of the vitamin D fortification policy on vitamin D status in Finland between 2000 and 2011. Design: Serum 25-hydroxyvitamin D [S-25(OH)D] concentrations of a nationally representative sample comprising 6134 and 4051 adults aged ≥30 y from the Health 2000 and Health 2011 surveys, respectively, were standardized according to the Vitamin D Standardization Program with the use of liquid chromatography-tandem mass spectrometry. Linear and logistic regression models were used to assess the change in S-25(OH)D concentrations. Results: Between 2000 and 2011, the mean S-25(OH)D increased from 48 nmol/L (95% CI: 47, 48 nmol/L) to 65 nmol/L (95% CI: 65, 66 nmol/L) ( P vitamin D supplement users increased from 11% to 41% ( P 50 nmol/L in 2011. Conclusions: The vitamin D status of the Finnish adult population has improved considerably during the time period studied. The increase is mainly explained by food fortification, especially of fluid milk products, and augmented vitamin D supplement use. Other factors, such as the difference in the ultraviolet radiation index between 2000 and 2011, may partly explain the results. When consuming vitamin D sources based on the nutritional recommendations, vitamin D status is sufficient [S-25(OH)D ≥50 nmol/L], and supplementation is generally not needed. © 2017 American Society for Nutrition.

Awareness of cancer susceptibility genetic testing: the 2000, 2005, and 2010 National Health Interview Surveys.

Science.gov (United States)

Mai, Phuong L; Vadaparampil, Susan Thomas; Breen, Nancy; McNeel, Timothy S; Wideroff, Louise; Graubard, Barry I

2014-05-01

Genetic testing for several cancer susceptibility syndromes is clinically available; however, existing data suggest limited population awareness of such tests. To examine awareness regarding cancer genetic testing in the U.S. population aged ≥25 years in the 2000, 2005, and 2010 National Health Interview Surveys. The weighted percentages of respondents aware of cancer genetic tests, and percent changes from 2000-2005 and 2005-2010, overall and by demographic, family history, and healthcare factors were calculated. Interactions were used to evaluate the patterns of change in awareness between 2005 and 2010 among subgroups within each factor. To evaluate associations with awareness in 2005 and 2010, percentages were adjusted for covariates using multiple logistic regression. The analysis was performed in 2012. Awareness decreased from 44.4% to 41.5% (pAwareness increased between 2005 and 2010 in most subgroups, particularly among individuals in the South (pinteraction=0.03) or with a usual place of care (pinteraction=0.01). In 2005 and 2010, awareness was positively associated with personal or family cancer history and high perceived cancer risk, and inversely associated with racial/ethnic minorities, age 25-39 or ≥60 years, male gender, lower education and income levels, public or no health insurance, and no provider contact in 12 months. Despite improvement from 2005 to 2010, ≤50% of the U.S. adult population was aware of cancer genetic testing in 2010. Notably, disparities persist for racial/ethnic minorities and individuals with limited health care access or income. Published by Elsevier Inc.

Das Neue Difraktometer ARES für die Analyse von Eigensannungen

Czech Academy of Sciences Publication Activity Database

Staron, P.; Ruhnau, H. U.; Mamotti, M.; Mikula, Pavol; Kampmann, R.

276/278, - (2000), s. 158-159 ISSN 0921-4526. [ECNS`99. Budapest, 01.09.1999-04.09.1999] R&D Projects: GA ČR GV202/97/K038; GA AV ČR KSK1048601 Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 0.893, year: 2000

Elliptic flow of .eta. and ă.sub.o mesons in heavy-ion collisions at 2 A GeV

Czech Academy of Sciences Publication Activity Database

Taranenko, Arkadij; Kugler, Andrej; Marín, A.; Díaz, J.; Averbeck, R.; Doppenschmidt, A.; Hlaváč, S.; Holzmann, R.; Lefévre, F.; Schubert, A.; Simon, R. S.; Charbonnier, Y.; Martínez, G.; Schutz, Y.; Marqués, F. M.; Appenheimer, H.; Berg, F. D.; Metag, V.; Novotny, R.; Stroher, H.; Weiss, J.; Wolf, A. R.; Wolf, H.; Löhner, H.; Ostendorf, R. W.; Vogt, P.; Wilschut, H. W.; Baiborodin, Dmitri; Pleskač, Radek; Tlustý, Pavel; Wagner, Vladimír

2000-01-01

Roč. 50, - (2000), s. 139-166 ISSN 0011-4626. [TAPS Workshop /5./ "Electromagnetic and Mesonic Probes of Nuclear Matter". Prague, 04.09.1999-08.09.1999] Institutional research plan: CEZ:AV0Z1048901 Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 0.298, year: 2000

Swisswoodhouse -a building for the 2000-Watt Society; Swisswoodhouse - ein Gebaeude fuer die 2000-Watt-Gesellschaft - Synthesebericht

Energy Technology Data Exchange (ETDEWEB)

Menz, T.; Wallbaum, H.; Hardziewski, R.; Graf, S.; Trachsel-Gerber, N.; Koschenz, M.; Guentert, P.

2009-05-15

This report deals with a building conceived to meet the requirements of the Swiss '2000-Watt Society' concept. The aims of the project are discussed which feature the demonstration of a forward-looking architectural layout, comfortable and healthy living, environmentally compatible and low resource consumption, standardisation and cost reduction. The report contains seven sections: Basics of the '2000-Watt Society' concept, optimisation of the whole building system, investor-orientated rating, use-oriented monitoring system, the development of the building, standardised building technology and, finally, a description of this pilot project.

2008-09 National Rivers and Streams Assessment Fish Tissue Data Dictionary

Science.gov (United States)

The Office of Science and Technology (OST) is providing the fish tissue results from the 2008-09 National Rivers and Streams Assessment (NRSA). This document includes the “data dictionary” for Mercury, Selenium, PBDEs, PCBs, Pesticides and PFCs.

Globex Resources Ltd. : annual report 2000

International Nuclear Information System (INIS)

2001-01-01

Financial information from Globex Resources Ltd. was presented and a review of their 2000 operations was made available for the benefit of shareholders. The company's core oil and gas business activities include exploration, development and production of crude oil and natural gas in Western Canada. The company plans to continue to increase its reserves and production base in Canada through exploration and development drilling and through strategic acquisitions. Globex is also planning a high impact project in Atlantic Canada, in New Brunswick for the medium- to long-term. In 2000, revenues more than doubled and cash flow tripled to $4.1 million. Earnings also increased nearly 8 times to $2.4 million. Net asset value per share also doubled and production increased by 16 per cent to 713 boe/day. In 2000, Globex Resources acquired 5 per cent of Corridor Resources Inc. This report summarized the company's energy resource activities and presented an operations review as well as consolidated financial statements, and common share information. Revenue and expenditure statements were summarized by source. tabs., figs

EAMJ Prognosis 09.indd

African Journals Online (AJOL)

2010-02-02

Feb 2, 2010 ... Background: In spite of many advances in the management of diabetes in the last 25 years ... definitions and consent obtained either from self or guardian. .... were responsible for enhancing water loss on the .... oral intake.

MANAGEMENT BOARD MEETING OF 25 MAY 2000

CERN Multimedia

2000-01-01

For informationOfficial Status of TIS as a CERN DivisionThe Management Board took note that the official title of the TIS Commission, led by Dr H. Schönbacher, was the Technical Inspection and Safety Division.Preparation of TREF's meeting on 31 MayJ. van der Boon, leader of the Human Resources Division, reported that the main items on the agenda of TREF's next meeting on 31 May would be the presentation and discussion of an initial Management proposal on the career structure and the examination of a second report on the results of the data collection enquiry for the five-yearly review, covering salary movements in the reference organisations and details of the latter's' career structures and advancement systems. The Management's first proposal on the career structure took account of a first, general discussion on the subject at the Forum's last meeting on 30 March, based on three working papers submitted by the Management, the Staff Association and the United Kingdom delegation, respectively, as well...

Joint Force Quarterly. Number 25, Summer 2000

Science.gov (United States)

2000-09-01

and Staff College Brig Gen Richard B. Bundy, USAF ■ The Joint Staff VADM Arthur K. Cebrowski, USN ■ Naval War College MG Reginal G. Clemmons , USA...1930s, General Maurice Gamelin, established the high command as the sole arbiter of doctrine early in his tenure. From that point, all articles, books

Changing epidemiology of methicillin-resistant Staphylococcus aureus in Iceland from 2000 to 2008: a challenge to current guidelines

DEFF Research Database (Denmark)

Holzknecht, B.J.; Hardardottir, H.; Haraldsson, Gustav Helgi

2010-01-01

, and screening for the Panton-Valentine leukocidin (PVL) gene. Two hundred twenty-six infected (60%) or colonized (40%) individuals were detected (annual incidence 2.5 to 16/100,000). From 2000 to 2003, two health care-associated outbreaks dominated (spa types t037 and t2802), which were successfully controlled...... with extensive infection control measures. After 2004, an increasing number of community-associated (CA) cases without relation to the health care system occurred. A great variety of clones (40 PFGE types and 49 spa types) were found, reflecting an influx of MRSA from abroad. The USA300 and Southwest Pacific...... and microbiological data of all MRSA patients from the years 2000 to 2008 were collected prospectively. Isolates were characterized by pulsed-field gel electrophoresis (PFGE), sequencing of the repeat region of the Staphylococcus protein A gene (spa typing), staphylococcal cassette chromosome mec (SCCmec) typing...

Secular changes in intakes of foods among New Zealand adults from 1997 to 2008/09.

Science.gov (United States)

Smith, Claire; Gray, Andrew R; Mainvil, Louise A; Fleming, Elizabeth A; Parnell, Winsome R

2015-12-01

To examine changes in the food choices of New Zealand (NZ) adults, between the 1997 National Nutrition Survey (NNS97) and the 2008/09 NZ Adult Nutrition Survey (2008/09 NZANS). The 2008/09 NZANS and the NNS97 were cross-sectional surveys of NZ adults (aged 15 years and over). Dietary intake data were collected using a computer-based 24 h diet recall. Logistic regression models were used to examine changes over time in the percentage reporting each food group, with survey year, sex and age group (19-30 years, 31-50 years, 51-70 years, ≥71 years) as the variables. NZ households. Adults aged 19 years and over (NNS97, n 4339; 2008/09 NZANS, n 3995). In the 2008/09 NZANS compared with NNS97, males and females were less likely to report consuming bread, potatoes, beef, vegetables, breakfast cereal, milk, cheese, butter, pies, biscuits, cakes and puddings, and sugar/confectionery (all Psnacks and snack bars (e.g., crisps, extruded snacks, muesli bars; P=0.007) and pasta and pasta dishes (P=0.017). Although food choices were associated with sex and age group, there were few differential changes between the surveys by sex or age group. For all age groups there was a shift in the percentage who reported consuming the traditional NZ foods, namely bread, beef, potatoes and vegetables, towards more rice and rice dishes. Declines in the consumption of butter, pies, biscuits, cakes and puddings are congruent with current dietary guidelines.

Response of CR-39 to 0.9–2.5 MeV protons for KOH and NaOH etching solutions

Energy Technology Data Exchange (ETDEWEB)

Bahrami, F. [Department of Medical Radiation Engineering, Shiraz University, Shiraz (Iran, Islamic Republic of); Mianji, F., E-mail: fmianji@aeoi.org.ir [Nuclear Science & Technology Research Institute, Tehran (Iran, Islamic Republic of); Iran Nuclear Regulatory Authority, Tehran (Iran, Islamic Republic of); Faghihi, R. [Department of Medical Radiation Engineering, Shiraz University, Shiraz (Iran, Islamic Republic of); Taheri, M. [Iran Nuclear Regulatory Authority, Tehran (Iran, Islamic Republic of); Ansarinejad, A. [Nuclear Science & Technology Research Institute, Tehran (Iran, Islamic Republic of)

2016-03-21

In some circumstances passive detecting methods are the only or preferable measuring approaches. For instance, defining particles' energy profile inside the objects being irradiated with heavy ions and measuring fluence of neutrons or heavy particles in space missions are the cases covered by these methods. In this paper the ability of polyallyl diglycol carbonate (PADC) track detector (commercially known as CR-39) for passive spectrometry of proton particles is studied. Furthermore, the effect of KOH and NaOH as commonly used chemical etching solutions on the response of the detector is investigated. The experiments were carried out with protons in the energy range of 0.94–2.5 MeV generated by a Van de Graaff accelerator. Then, the exposed track dosimeters were etched in the two aforementioned etchants through similar procedure with the same normality of 6.25 N and the same temperature of 85 °C. Formation of the tracks was precisely investigated and the track diameters were recorded following every etching step for each solution using a multistage etching process. The results showed that the proposed method can be efficiently used for the spectrometry of protons over a wider dynamic range and with a reasonable accuracy. Moreover, NaOH and KOH outperformed each other over different regions of the proton energy range. The detection efficiency of both etchants was approximately 100%.

Patrones de cambio de coberturas y usos del suelo en la región costa norte de Nayarit (1973-2000

Directory of Open Access Journals (Sweden)

César Alejandro Berlanga Robles

2010-09-01

Full Text Available Se clasificaron imágenes satelitales Landsat de los años 1973, 1990 y 2000 y posteriormente se realizó una comparación post-clasificatoria, con información digital complementaria, para analizar los cambios ocurridos en la cobertura vegetal y los usos del suelo de la región costa del norte de Nayarit (RCNN. Se produjeron mapas temáticos con nueve clases de cobertura y usos del terreno, con exactitudes totales > 85% y estimadores del coeficiente Kappa de 0.85 a 0.99 para las matrices de error espectral, en tanto que para el caso de las matrices de error real las exactitudes totales y Kappa fueron superiores al 87 y 0.85%, respectivamente. El análisis de las matrices de detección de cambio (1973-1990, 1990-2000 y 1973-2000 indica que el porcentaje general de cambio en el área en estudio fue próximo al 25% entre periodos y del 30% para el periodo completo (1973- 2000. En todos los casos existió una marcada tendencia al incremento de la superficie dedicada a las actividades humanas (agricultura, granjas camaronícolas y uso urbano y una disminución de las superficies con coberturas naturales como los bosques y los manglares.

Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0074853)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in...

Chemical and physical oceanographic profile data collected from CTD casts aboard the Wes Bordelon in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the Deepwater Horizon oil spill event (NODC Accession 0069085)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Wes Bordelon in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...

Chemical and physical oceanographic profile data collected from CTD casts aboard the BUNNY BORDELON in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the Deepwater Horizon oil spill event (NODC Accession 0069117)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the BUNNY BORDELON in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...

Chemical and physical oceanographic profile data collected from CTD casts aboard the Rachel Bordelon in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the Deepwater Horizon oil spill event (NODC Accession 0069078)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Rachel Bordelon in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the...

Dossier 'thermal regulation 2000'. Reconciling building and environment; Dossier RT 2000. Reconcilier batiment et environnement

Energy Technology Data Exchange (ETDEWEB)

Grumel, N.

2001-04-01

The works that led to the setup of the new French thermal regulation (TR 2000) for buildings started in 1997 and were carried out by the general direction of urbanism, accommodation and construction (DGUHC) of the ministry of equipment, transport and accommodation, by the agency of environment and energy mastery (Ademe) and by the scientific and technical committee of building trade. The different steps of buildings construction have been reviewed with specialists, industrialists, energy suppliers, design offices, federation of companies and other professional organisms, in order to reduce the energy consumption of buildings and their impact on the environment. The new regulation is based on the determination of the 'C coefficient', the conventional energy consumption coefficient, and of reference values for the six steps of the elaboration of a construction project. The TR 2000 will be enforced in June 1, 2001. Today, the air conditioning is not concerned by the TR 2000, but will be included in 2003. This dossier presents the different aspects of the new thermal regulation. (J.S.)

Enhanced acquired antibodies to a chimeric Plasmodium falciparum antigen; UB05-09 is associated with protective immunity against malaria.

Science.gov (United States)

Dinga, J N; Gamua, S D; Titanji, V P K

2017-08-01

It has been shown that covalently linking two antigens could enhance the immunogenicity of the chimeric construct. To prioritize such a chimera for malaria vaccine development, it is necessary to demonstrate that naturally acquired antibodies against the chimera are associated with protection from malaria. Here, we probe the ability of a chimeric construct of UB05 and UB09 antigens (UB05-09) to better differentiate between acquired immune protection and susceptibility to malaria. In a cross-sectional study, recombinant UB05-09 chimera and the constituent antigens were used to probe for specific antibodies in the plasma from children and adults resident in a malaria-endemic zone, using the enzyme-linked immunosorbent assay (ELISA). Anti-UB05-09 antibody levels doubled that of its constituent antigens, UB09 and UB05, and this correlated with protection against malaria. The presence of enhanced UB05-09-specific antibody correlated with the absence of fever and parasitaemia, which are the main symptoms of malaria infection. The chimera is more effective in detecting and distinguishing acquired protective immunity against malaria than any of its constituents taken alone. Online B-cell epitope prediction tools confirmed the presence of B-cell epitopes in the study antigens. UB05-09 chimera is a marker of protective immunity against malaria that needs to be studied further. © 2017 John Wiley & Sons Ltd.

Chemical and physical oceanographic profile data collected from CTD casts aboard the JACK FITZ in the Gulf of Mexico from 2010-09-04 to 2010-09-12 in response to the Deepwater Horizon oil spill event (NODC Accession 0069075)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the JACK FITZ in the Gulf of Mexico from 2010-09-04 to 2010-09-12 in response to the Deepwater...

Global Mangrove Forests Distribution, 2000

Data.gov (United States)

National Aeronautics and Space Administration — The Global Mangrove Forests Distribution, 2000 data set is a compilation of the extent of mangroves forests from the Global Land Survey and the Landsat archive with...

Land-use trends related to Natura2000 sites in Denmark

DEFF Research Database (Denmark)

Levin, Gregor; Nainggolan, Doan; Frederiksen, Pia

2018-01-01

EU-member states are obliged to designate Natura2000 sites for habitat protection. Natura2000 sites comprise approximately 18 percent of the terrestrial area of the EU. On average, around 22 percent of Natura2000 sites are covered by agricultural land use, such as intensive cropland and more...... and change in area of extensive land use for two periods: From 2000 to 2003, before the implementation of the HD and from 2003 to 2013, after its implementation. In order to control for the influences of biophysical constraints on agricultural intensity, we included information on slopes and peat soil...... extensively managed land. Particularly in regions with high proportions of agricultural land use in Natura2000 sites, habitat protection is closely linked with the intensity of agricultural land use. Thus, it is important to understand dynamics between intensive and extensive land use. Denmark, where Natura...

High School Longitudinal Study of 2009 (HSLS:09): Base-Year Data File Documentation. NCES 2011-328

Science.gov (United States)

Ingels, Steven J.; Pratt, Daniel J.; Herget, Deborah R.; Burns, Laura J.; Dever, Jill A.; Ottem, Randolph; Rogers, James E.; Jin, Ying; Leinwand, Steve

2011-01-01

The High School Longitudinal Study of 2009 (HSLS:09) is the fifth in a series of National Center for Education Statistics (NCES) secondary longitudinal studies. The core research questions for HSLS:09 explore secondary to postsecondary transition plans and the evolution of those plans; the paths into and out of science, technology, engineering,…

The Division III Financial Aid Reporting Process: Findings and Review Results, 2005-06 through 2008-09

Science.gov (United States)

National Collegiate Athletic Association (NJ1), 2009

2009-01-01

This report marks the completion of the 2008-09 reporting cycle and the fourth year of the Division III Financial Aid Reporting Program. The report examines findings for all reporting institutions from each of the four reporting cycles, and details the outcomes of the Division III Financial Aid Committee's 2008-09 review process. Four calculations…

Global Estimated Net Migration Grids by Decade: 1970-2000

Data.gov (United States)

National Aeronautics and Space Administration — The Global Estimated Net Migration by Decade: 1970-2000 data set provides estimates of net migration over the three decades from 1970 to 2000. Because of the lack of...

Periphyton ecology of glacial and snowmelt streams, Ny-Alesund, Svalbard: presence of mineral particles in water and their erosive activity

Czech Academy of Sciences Publication Activity Database

Kubečková, Klára; Elster, Josef; Kanda, H.

2001-01-01

Roč. 123, - (2001), s. 141-172 ISSN 1438-9134. [International conference: Algae and extreme environments. Třeboň, 11.09.2000-16.09.2000] R&D Projects: GA AV ČR KSK6005114; GA AV ČR IAA6005002 Institutional research plan: CEZ:AV0Z6005908; CEZ:MSM 123100004 Keywords : Periphyton * species diversity and productivity * the Arctic * glacial snowmelt streams * physical disturbances erosive discharge * water turbidity Subject RIV: EA - Cell Biology Impact factor: 0.488, year: 2000

46 CFR 25.25-1 - Application.

Science.gov (United States)

2010-10-01

... 46 Shipping 1 2010-10-01 2010-10-01 false Application. 25.25-1 Section 25.25-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY UNINSPECTED VESSELS REQUIREMENTS Life Preservers and Other Lifesaving Equipment § 25.25-1 Application. This subpart applies to each vessel to which this part applies...