WorldWideScience

Sample records for selectivity voltage-dependent gating

  1. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  2. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  3. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  4. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  5. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  6. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  7. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  8. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  9. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  10. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  11. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

    Science.gov (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

    2017-05-01

    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  12. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  13. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  15. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  16. Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

    Science.gov (United States)

    Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

    2012-02-14

    Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

  17. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  18. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  19. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  20. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  1. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  2. Voltage-Gated Potassium Channels: A Structural Examination of Selectivity and Gating

    Science.gov (United States)

    Kim, Dorothy M.; Nimigean, Crina M.

    2016-01-01

    Voltage-gated potassium channels play a fundamental role in the generation and propagation of the action potential. The discovery of these channels began with predictions made by early pioneers, and has culminated in their extensive functional and structural characterization by electrophysiological, spectroscopic, and crystallographic studies. With the aid of a variety of crystal structures of these channels, a highly detailed picture emerges of how the voltage-sensing domain reports changes in the membrane electric field and couples this to conformational changes in the activation gate. In addition, high-resolution structural and functional studies of K+ channel pores, such as KcsA and MthK, offer a comprehensive picture on how selectivity is achieved in K+ channels. Here, we illustrate the remarkable features of voltage-gated potassium channels and explain the mechanisms used by these machines with experimental data. PMID:27141052

  3. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  4. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  5. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  6. Determination of prospective displacement-based gate threshold for respiratory-gated radiation delivery from retrospective phase-based gate threshold selected at 4D CT simulation

    International Nuclear Information System (INIS)

    Vedam, S.; Archambault, L.; Starkschall, G.; Mohan, R.; Beddar, S.

    2007-01-01

    Four-dimensional (4D) computed tomography (CT) imaging has found increasing importance in the localization of tumor and surrounding normal structures throughout the respiratory cycle. Based on such tumor motion information, it is possible to identify the appropriate phase interval for respiratory gated treatment planning and delivery. Such a gating phase interval is determined retrospectively based on tumor motion from internal tumor displacement. However, respiratory-gated treatment is delivered prospectively based on motion determined predominantly from an external monitor. Therefore, the simulation gate threshold determined from the retrospective phase interval selected for gating at 4D CT simulation may not correspond to the delivery gate threshold that is determined from the prospective external monitor displacement at treatment delivery. The purpose of the present work is to establish a relationship between the thresholds for respiratory gating determined at CT simulation and treatment delivery, respectively. One hundred fifty external respiratory motion traces, from 90 patients, with and without audio-visual biofeedback, are analyzed. Two respiratory phase intervals, 40%-60% and 30%-70%, are chosen for respiratory gating from the 4D CT-derived tumor motion trajectory. From residual tumor displacements within each such gating phase interval, a simulation gate threshold is defined based on (a) the average and (b) the maximum respiratory displacement within the phase interval. The duty cycle for prospective gated delivery is estimated from the proportion of external monitor displacement data points within both the selected phase interval and the simulation gate threshold. The delivery gate threshold is then determined iteratively to match the above determined duty cycle. The magnitude of the difference between such gate thresholds determined at simulation and treatment delivery is quantified in each case. Phantom motion tests yielded coincidence of simulation

  7. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  8. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  9. Selective porous gates made from colloidal silica nanoparticles

    Directory of Open Access Journals (Sweden)

    Roberto Nisticò

    2015-11-01

    Full Text Available Highly selective porous films were prepared by spin-coating deposition of colloidal silica nanoparticles on an appropriate macroporous substrate. Silica nanoparticles very homogenous in size were obtained by sol–gel reaction of a metal oxide silica precursor, tetraethyl orthosilicate (TEOS, and using polystyrene-block-poly(ethylene oxide (PS-b-PEO copolymers as soft-templating agents. Nanoparticles synthesis was carried out in a mixed solvent system. After spin-coating onto a macroporous silicon nitride support, silica nanoparticles were calcined under controlled conditions. An organized nanoporous layer was obtained characterized by a depth filter-like structure with internal porosity due to interparticle voids. Permeability and size-selectivity were studied by monitoring the diffusion of probe molecules under standard conditions and under the application of an external stimulus (i.e., electric field. Promising results were obtained, suggesting possible applications of these nanoporous films as selective gates for controlled transport of chemical species in solution.

  10. Creativity and sensory gating indexed by the P50: selective versus leaky sensory gating in divergent thinkers and creative achievers.

    Science.gov (United States)

    Zabelina, Darya L; O'Leary, Daniel; Pornpattananangkul, Narun; Nusslock, Robin; Beeman, Mark

    2015-03-01

    Creativity has previously been linked with atypical attention, but it is not clear what aspects of attention, or what types of creativity are associated. Here we investigated specific neural markers of a very early form of attention, namely sensory gating, indexed by the P50 ERP, and how it relates to two measures of creativity: divergent thinking and real-world creative achievement. Data from 84 participants revealed that divergent thinking (assessed with the Torrance Test of Creative Thinking) was associated with selective sensory gating, whereas real-world creative achievement was associated with "leaky" sensory gating, both in zero-order correlations and when controlling for academic test scores in a regression. Thus both creativity measures related to sensory gating, but in opposite directions. Additionally, divergent thinking and real-world creative achievement did not interact in predicting P50 sensory gating, suggesting that these two creativity measures orthogonally relate to P50 sensory gating. Finally, the ERP effect was specific to the P50 - neither divergent thinking nor creative achievement were related to later components, such as the N100 and P200. Overall results suggest that leaky sensory gating may help people integrate ideas that are outside of focus of attention, leading to creativity in the real world; whereas divergent thinking, measured by divergent thinking tests which emphasize numerous responses within a limited time, may require selective sensory processing more than previously thought. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  12. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  13. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  14. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  15. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  16. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  17. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  18. Design of a spin-wave majority gate employing mode selection

    Energy Technology Data Exchange (ETDEWEB)

    Klingler, S., E-mail: klingler@physik.uni-kl.de; Pirro, P.; Brächer, T.; Leven, B.; Hillebrands, B.; Chumak, A. V. [Fachbereich Physik and Landesforschungszentrum OPTIMAS, Technische Universität Kaiserslautern, 67663 Kaiserslautern (Germany)

    2014-10-13

    The design of a microstructured, fully functional spin-wave majority gate is presented and studied using micromagnetic simulations. This all-magnon logic gate consists of three-input waveguides, a spin-wave combiner, and an output waveguide. In order to ensure the functionality of the device, the output waveguide is designed to perform spin-wave mode selection. We demonstrate that the gate evaluates the majority of the input signals coded into the spin-wave phase. Moreover, the all-magnon data processing device is used to perform logic AND-, OR-, NAND-, and NOR- operations.

  19. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  20. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  1. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  2. Selective darkening of degenerate transitions for implementing quantum controlled-NOT gates

    NARCIS (Netherlands)

    De Groot, P.C.; Ashhab, S.; Lupascu, A.; DiCarlo, L.; Nori, F.; Harmans, C.J.P.M.; Mooij, J.E.

    2012-01-01

    We present a theoretical analysis of the selective darkening method for implementing quantum controlled-NOT (CNOT) gates. This method, which we have recently proposed and demonstrated, consists of driving two transversely coupled quantum bits (qubits) with a driving field that is resonant with one

  3. Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

    2012-01-01

    The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

  4. Controlling Working Memory Operations by Selective Gating: The Roles of Oscillations and Synchrony

    Science.gov (United States)

    Dipoppa, Mario; Szwed, Marcin; Gutkin, Boris S.

    2016-01-01

    Working memory (WM) is a primary cognitive function that corresponds to the ability to update, stably maintain, and manipulate short-term memory (ST M) rapidly to perform ongoing cognitive tasks. A prevalent neural substrate of WM coding is persistent neural activity, the property of neurons to remain active after having been activated by a transient sensory stimulus. This persistent activity allows for online maintenance of memory as well as its active manipulation necessary for task performance. WM is tightly capacity limited. Therefore, selective gating of sensory and internally generated information is crucial for WM function. While the exact neural substrate of selective gating remains unclear, increasing evidence suggests that it might be controlled by modulating ongoing oscillatory brain activity. Here, we review experiments and models that linked selective gating, persistent activity, and brain oscillations, putting them in the more general mechanistic context of WM. We do so by defining several operations necessary for successful WM function and then discussing how such operations may be carried out by mechanisms suggested by computational models. We specifically show how oscillatory mechanisms may provide a rapid and flexible active gating mechanism for WM operations. PMID:28154616

  5. Liquid-based gating mechanism with tunable multiphase selectivity and antifouling behaviour.

    Science.gov (United States)

    Hou, Xu; Hu, Yuhang; Grinthal, Alison; Khan, Mughees; Aizenberg, Joanna

    2015-03-05

    Living organisms make extensive use of micro- and nanometre-sized pores as gatekeepers for controlling the movement of fluids, vapours and solids between complex environments. The ability of such pores to coordinate multiphase transport, in a highly selective and subtly triggered fashion and without clogging, has inspired interest in synthetic gated pores for applications ranging from fluid processing to 3D printing and lab-on-chip systems. But although specific gating and transport behaviours have been realized by precisely tailoring pore surface chemistries and pore geometries, a single system capable of controlling complex, selective multiphase transport has remained a distant prospect, and fouling is nearly inevitable. Here we introduce a gating mechanism that uses a capillary-stabilized liquid as a reversible, reconfigurable gate that fills and seals pores in the closed state, and creates a non-fouling, liquid-lined pore in the open state. Theoretical modelling and experiments demonstrate that for each transport substance, the gating threshold-the pressure needed to open the pores-can be rationally tuned over a wide pressure range. This enables us to realize in one system differential response profiles for a variety of liquids and gases, even letting liquids flow through the pore while preventing gas from escaping. These capabilities allow us to dynamically modulate gas-liquid sorting in a microfluidic flow and to separate a three-phase air-water-oil mixture, with the liquid lining ensuring sustained antifouling behaviour. Because the liquid gating strategy enables efficient long-term operation and can be applied to a variety of pore structures and membrane materials, and to micro- as well as macroscale fluid systems, we expect it to prove useful in a wide range of applications.

  6. Liquid-based gating mechanism with tunable multiphase selectivity and antifouling behaviour

    Energy Technology Data Exchange (ETDEWEB)

    Hou, X; Hu, YH; Grinthal, A; Khan, M; Aizenberg, J

    2015-03-04

    Living organisms make extensive use of micro- and nanometre-sized pores as gatekeepers for controlling the movement of fluids, vapours and solids between complex environments. The ability of such pores to coordinate multiphase transport, in a highly selective and subtly triggered fashion and without clogging, has inspired interest in synthetic gated pores for applications ranging from fluid processing to 3D printing and lab-on-chip systems(1-10). But although specific gating and transport behaviours have been realized by precisely tailoring pore surface chemistries and pore geometries(6,11-17), a single system capable of controlling complex, selective multiphase transport has remained a distant prospect, and fouling is nearly inevitable(11,12). Here we introduce a gating mechanism that uses a capillary-stabilized liquid as a reversible, reconfigurable gate that fills and seals pores in the closed state, and creates a non-fouling, liquid-lined pore in the open state. Theoretical modelling and experiments demonstrate that for each transport substance, the gating threshold-the pressure needed to open the pores-can be rationally tuned over a wide pressure range. This enables us to realize in one system differential response profiles for a variety of liquids and gases, even letting liquids flow through the pore while preventing gas from escaping. These capabilities allow us to dynamically modulate gas-liquid sorting in a microfluidic flow and to separate a three-phase air-water-oil mixture, with the liquid lining ensuring sustained antifouling behaviour. Because the liquid gating strategy enables efficient long-term operation and can be applied to a variety of pore structures and membrane materials, and to micro- as well as macroscale fluid systems, we expect it to prove useful in a wide range of applications.

  7. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  8. Selected area growth integrated wavelength converter based on PD-EAM optical logic gate

    International Nuclear Information System (INIS)

    Niu Bin; Zhou Daibing; Zhang Can; Liang Song; Lu Dan; Zhao Lingjuan; Wang Wei; Qiu Jifang; Wu Jian

    2014-01-01

    A selected area growth wavelength converter based on a PD-EAM optical logic gate for WDM application is presented, integrating an EML transmitter and a SOA-PD receiver. The design, fabrication, and DC characters were analyzed. A 2 Gb/s NRZ signal based on the C-band wavelength converted to 1555 nm with the highest extinction ratio of 7 dB was achieved and wavelength converted eye diagrams with eyes opened were presented. (semiconductor devices)

  9. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  10. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  11. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  12. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  13. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  14. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  15. Time gating for energy selection and scatter rejection: High-energy pulsed neutron imaging at LANSCE

    Science.gov (United States)

    Swift, Alicia; Schirato, Richard; McKigney, Edward; Hunter, James; Temple, Brian

    2015-09-01

    The Los Alamos Neutron Science Center (LANSCE) is a linear accelerator in Los Alamos, New Mexico that accelerates a proton beam to 800 MeV, which then produces spallation neutron beams. Flight path FP15R uses a tungsten target to generate neutrons of energy ranging from several hundred keV to ~600 MeV. The beam structure has micropulses of sub-ns width and period of 1.784 ns, and macropulses of 625 μs width and frequency of either 50 Hz or 100 Hz. This corresponds to 347 micropulses per macropulse, or 1.74 x 104 micropulses per second when operating at 50 Hz. Using a very fast, cooled ICCD camera (Princeton Instruments PI-Max 4), gated images of various objects were obtained on FP15R in January 2015. Objects imaged included blocks of lead and borated polyethylene; a tungsten sphere; and a tungsten, polyethylene, and steel cylinder. Images were obtained in 36 min or less, with some in as little as 6 min. This is novel because the gate widths (some as narrow as 10 ns) were selected to reject scatter and other signal not of interest (e.g. the gamma flash that precedes the neutron pulse), which has not been demonstrated at energies above 14 MeV. This proof-of-principle experiment shows that time gating is possible above 14MeV and is useful for selecting neutron energy and reducing scatter, thus forming clearer images. Future work (simulation and experimental) is being undertaken to improve camera shielding and system design and to precisely determine optical properties of the imaging system.

  16. Spectroscopic and TDDFT investigation on highly selective fluorogenic chemosensor and construction of molecular logic gates

    Energy Technology Data Exchange (ETDEWEB)

    Basheer, Sabeel M [Department of Chemistry, National Institute of Technology, Tiruchirappalli 620 015 (India); Kumar, Saravana Loganathan Ashok [Department of Chemistry, GRT Institute of Engineering Technology, Tiruttani (India); Kumar, Moorthy Saravana [Research and PG Department of Chemistry, Saraswathi Narayanan College, Madurai 625022 (India); Sreekanth, Anandaram, E-mail: sreekanth@nitt.edu [Department of Chemistry, National Institute of Technology, Tiruchirappalli 620 015 (India)

    2017-03-01

    1,5-Bis(2-fluorene)thiocarbohydrazone (FBTC) was designed and synthesized for selective sensing of fluoride and copper ions. The binding constants of FBTC towards fluoride and copper ions have been calculated using the Benesi-Hildebrand equation, and FBTC has more binding affinity towards copper ion than fluoride ion. The {sup 1}H NMR and {sup 13}C NMR titration studies strongly support the deprotonation was taken from the N–H protons followed by the formation of hydrogen bond via N–H{sup …}F. To understand the fluoride ion sensing mechanism, theoretical investigation had been carried out using the density functional theory and time-dependent density functional theory. The theoretical data well reproduced the experimental results. The deprotonation process has a moderate transition barrier (481.55 kcal/mol). The calculated ΔE and ΔG values (− 253.92 and − 192.41 kcal/mol respectively) suggest the feasibility of sensing process. The potential energy curves give the optimized structures of FBTC-F complex in the ground state and excited state, which states the proton transition occurs at the excited state. The excited state proton transition mechanism was further confirmed with natural bond orbital analysis. The reversibility of the sensor was monitored by the alternate addition of F{sup −} and Cu{sup 2+} ions, which was explained with “Read-Erase-Write-Read” behaviour. The multi-ion detection of sensor used to construct the molecular logic gate, such as AND, OR, NOR and INHIBITION logic gates. - Highlight: • Synthesis and characterised the thiosemicarbohydrazone derivative • Experimental evolution of selective fluoride and copper sensing via both colorimetric and spectroscopic studies • The proposed sensing mechanism of fluoride and copper ion were further confirmed with DFT and TD-DFT investigation • Receptor was turned as molecular switches and molecular logic gates.

  17. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  18. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  19. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  20. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  1. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  2. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  3. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  4. Jointly Feature Learning and Selection for Robust Tracking via a Gating Mechanism.

    Directory of Open Access Journals (Sweden)

    Bineng Zhong

    Full Text Available To achieve effective visual tracking, a robust feature representation composed of two separate components (i.e., feature learning and selection for an object is one of the key issues. Typically, a common assumption used in visual tracking is that the raw video sequences are clear, while real-world data is with significant noise and irrelevant patterns. Consequently, the learned features may be not all relevant and noisy. To address this problem, we propose a novel visual tracking method via a point-wise gated convolutional deep network (CPGDN that jointly performs the feature learning and feature selection in a unified framework. The proposed method performs dynamic feature selection on raw features through a gating mechanism. Therefore, the proposed method can adaptively focus on the task-relevant patterns (i.e., a target object, while ignoring the task-irrelevant patterns (i.e., the surrounding background of a target object. Specifically, inspired by transfer learning, we firstly pre-train an object appearance model offline to learn generic image features and then transfer rich feature hierarchies from an offline pre-trained CPGDN into online tracking. In online tracking, the pre-trained CPGDN model is fine-tuned to adapt to the tracking specific objects. Finally, to alleviate the tracker drifting problem, inspired by an observation that a visual target should be an object rather than not, we combine an edge box-based object proposal method to further improve the tracking accuracy. Extensive evaluation on the widely used CVPR2013 tracking benchmark validates the robustness and effectiveness of the proposed method.

  5. Lysine and the Na+/K+ Selectivity in Mammalian Voltage-Gated Sodium Channels.

    Science.gov (United States)

    Li, Yang; Liu, Huihui; Xia, Mengdie; Gong, Haipeng

    2016-01-01

    Voltage-gated sodium (Nav) channels are critical in the generation and transmission of neuronal signals in mammals. The crystal structures of several prokaryotic Nav channels determined in recent years inspire the mechanistic studies on their selection upon the permeable cations (especially between Na+ and K+ ions), a property that is proposed to be mainly determined by residues in the selectivity filter. However, the mechanism of cation selection in mammalian Nav channels lacks direct explanation at atomic level due to the difference in amino acid sequences between mammalian and prokaryotic Nav homologues, especially at the constriction site where the DEKA motif has been identified to determine the Na+/K+ selectivity in mammalian Nav channels but is completely absent in the prokaryotic counterparts. Among the DEKA residues, Lys is of the most importance since its mutation to Arg abolishes the Na+/K+ selectivity. In this work, we modeled the pore domain of mammalian Nav channels by mutating the four residues at the constriction site of a prokaryotic Nav channel (NavRh) to DEKA, and then mechanistically investigated the contribution of Lys in cation selection using molecular dynamics simulations. The DERA mutant was generated as a comparison to understand the loss of ion selectivity caused by the K-to-R mutation. Simulations and free energy calculations on the mutants indicate that Lys facilitates Na+/K+ selection by electrostatically repelling the cation to a highly Na+-selective location sandwiched by the carboxylate groups of Asp and Glu at the constriction site. In contrast, the electrostatic repulsion is substantially weakened when Lys is mutated to Arg, because of two intrinsic properties of the Arg side chain: the planar geometric design and the sparse charge distribution of the guanidine group.

  6. Lysine and the Na+/K+ Selectivity in Mammalian Voltage-Gated Sodium Channels.

    Directory of Open Access Journals (Sweden)

    Yang Li

    Full Text Available Voltage-gated sodium (Nav channels are critical in the generation and transmission of neuronal signals in mammals. The crystal structures of several prokaryotic Nav channels determined in recent years inspire the mechanistic studies on their selection upon the permeable cations (especially between Na+ and K+ ions, a property that is proposed to be mainly determined by residues in the selectivity filter. However, the mechanism of cation selection in mammalian Nav channels lacks direct explanation at atomic level due to the difference in amino acid sequences between mammalian and prokaryotic Nav homologues, especially at the constriction site where the DEKA motif has been identified to determine the Na+/K+ selectivity in mammalian Nav channels but is completely absent in the prokaryotic counterparts. Among the DEKA residues, Lys is of the most importance since its mutation to Arg abolishes the Na+/K+ selectivity. In this work, we modeled the pore domain of mammalian Nav channels by mutating the four residues at the constriction site of a prokaryotic Nav channel (NavRh to DEKA, and then mechanistically investigated the contribution of Lys in cation selection using molecular dynamics simulations. The DERA mutant was generated as a comparison to understand the loss of ion selectivity caused by the K-to-R mutation. Simulations and free energy calculations on the mutants indicate that Lys facilitates Na+/K+ selection by electrostatically repelling the cation to a highly Na+-selective location sandwiched by the carboxylate groups of Asp and Glu at the constriction site. In contrast, the electrostatic repulsion is substantially weakened when Lys is mutated to Arg, because of two intrinsic properties of the Arg side chain: the planar geometric design and the sparse charge distribution of the guanidine group.

  7. Non-Selective Lexical Access in Late Arabic-English Bilinguals: Evidence from Gating.

    Science.gov (United States)

    Boudelaa, Sami

    2018-02-07

    Previous research suggests that late bilinguals who speak typologically distant languages are the least likely to show evidence of non-selective lexical access processes. This study puts this claim to test by using the gating task to determine whether words beginning with speech sounds that are phonetically similar in Arabic and English (e.g., [b,d,m,n]) give rise to selective or non-selective lexical access processes in late Arabic-English bilinguals. The results show that an acoustic-phonetic input (e.g., [bæ]) that is consistent with words in Arabic (e.g., [bædrun] "moon") and English (e.g., [bæd] "bad") activates lexical representations in both languages of the bilingual. This non-selective activation holds equally well for mixed lists with words from both Arabic and English and blocked lists consisting only of Arabic or English words. These results suggest that non-selective lexical access processes are the default mechanism even in late bilinguals of typologically distant languages.

  8. The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

    Science.gov (United States)

    Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

    2013-03-01

    The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

  9. Selection and evaluation of an ultra high vacuum gate valve for Isabelle beam line vacuum system

    International Nuclear Information System (INIS)

    Foerster, C.L.; McCafferty, D.

    1980-01-01

    A minimum of eighty-four (84) Ultra High Vacuum Gate Valves will be utilized in ISABELLE to protect proton beam lines from catastrophic vacuum failure and to provide sector isolation for maintenance requirements. The valve to be selected must function at less than 1 x 10 -11 Torr pressure and be bakeable to 300 0 C in its open or closed position. In the open position, the valve must have an RF shield to make the beam line walls appear continuous. Several proposed designs were built and evaluated. The evaluation consisted mainly of leak testing, life tests, thermal cycling, mass spectrometer analysis, and 10 -12 Torr operation. Problems with initial design and fabrication were resolved. Special requirements for design and construction were developed. This paper describes the tests on two final prototypes which appear to be the best candidates for ISABELLE operation

  10. A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.

    Science.gov (United States)

    Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas

    2016-02-25

    Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  12. Mechanisms for plasma etching of HfO{sub 2} gate stacks with Si selectivity and photoresist trimming

    Energy Technology Data Exchange (ETDEWEB)

    Shoeb, Juline; Kushner, Mark J. [Department of Electrical and Computer Engineering, Iowa State University, Ames, Iowa 50011 (United States); Department of Electrical Engineering and Computer Science, University of Michigan, Ann Arbor, Michigan 48109-2122 (United States)

    2009-11-15

    To minimize leakage currents resulting from the thinning of the insulator in the gate stack of field effect transistors, high-dielectric constant (high-k) metal oxides, and HfO{sub 2} in particular, are being implemented as a replacement for SiO{sub 2}. To speed the rate of processing, it is desirable to etch the gate stack (e.g., metal gate, antireflection layers, and dielectric) in a single process while having selectivity to the underlying Si. Plasma etching using Ar/BCl{sub 3}/Cl{sub 2} mixtures effectively etches HfO{sub 2} while having good selectivity to Si. In this article, results from integrated reactor and feature scale modeling of gate-stack etching in Ar/BCl{sub 3}/Cl{sub 2} plasmas, preceded by photoresist trimming in Ar/O{sub 2} plasmas, are discussed. It was found that BCl{sub n} species react with HfO{sub 2}, which under ion impact, form volatile etch products such as B{sub m}OCl{sub n} and HfCl{sub n}. Selectivity to Si is achieved by creating Si-B bonding as a precursor to the deposition of a BCl{sub n} polymer which slows the etch rate relative to HfO{sub 2}. The low ion energies required to achieve this selectivity then challenge one to obtain highly anisotropic profiles in the metal gate portion of the stack. Validation was performed with data from literature. The effect of bias voltage and key reactant probabilities on etch rate, selectivity, and profile are discussed.

  13. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  14. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  15. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  16. An Adaptable Neuromorphic Model of Orientation Selectivity Based On Floating Gate Dynamics

    Directory of Open Access Journals (Sweden)

    Priti eGupta

    2014-04-01

    Full Text Available The biggest challenge that the neuromorphic community faces today is to build systems that can be considered truly cognitive. Adaptation and self-organization are the two basic principles that underlie any cognitive function that the brain performs. If we can replicate this behavior in hardware, we move a step closer to our goal of having cognitive neuromorphic systems. Adaptive feature selectivity is a mechanism by which nature optimizes resources so as to have greater acuity for more abundant features. Developing neuromorphic feature maps can help design generic machines that can emulate this adaptive behavior. Most neuromorphic models that have attempted to build self-organizing systems, follow the approach of modeling abstract theoretical frameworks in hardware. While this is good from a modeling and analysis perspective, it may not lead to the most efficient hardware. On the other hand, exploiting hardware dynamics to build adaptive systems rather than forcing the hardware to behave like mathematical equations, seems to be a more robust methodology when it comes to developing actual hardware for real world applications. In this paper we use a novel time-staggered Winner Take All circuit, that exploits the adaptation dynamics of floating gate transistors, to model an adaptive cortical cell that demonstrates Orientation Selectivity, a well-known biological phenomenon observed in the visual cortex. The cell performs competitive learning, refining its weights in response to input patterns resembling different oriented bars, becoming selective to a particular oriented pattern. Different analysis performed on the cell such as orientation tuning, application of abnormal inputs, response to spatial frequency and periodic patterns reveal close similarity between our cell and its biological counterpart. Embedded in a RC grid, these cells interact diffusively exhibiting cluster formation, making way for adaptively building orientation selective maps

  17. Ion Selectivity Mechanism in a Bacterial Pentameric Ligand-Gated Ion Channel

    International Nuclear Information System (INIS)

    Wang, Hailong; Cheng, Xiaolin

    2011-01-01

    The proton-gated ion channel from Gloeobacter violaceus (GLIC) is a prokaryotic homolog of the eukaryotic nicotinic acetylcholine receptor (nAChR) that responds to the binding of neurotransmitter acetylcholine and mediates fast signal transmission. Recent emergence of a high resolution crystal structure of GLIC captured in a potentially open state allowed detailed, atomic-level insight into ion conduction and selectivity mechanisms in these channels. Herein, we have examined the barriers to ion conduction and origins of ion selectivity in the GLIC channel by the construction of potential of mean force (PMF) profiles for sodium and chloride ions inside the transmembrane region. Our calculations reveal that the GLIC channel is open for a sodium ion to transport, but presents a ∼10 kcal/mol free energy barrier for a chloride ion, which arises primarily from the unfavorable interactions with a ring of negatively charged glutamate residues (E-2) at the intracellular end and a ring of hydrophobic residues (I9) in the middle of the transmembrane domain. Our collective findings further suggest that the charge selection mechanism can, to a large extent, be attributed to the narrow intracellular end and a ring of glutamate residues in this position their strong negative electrostatics and ability to bind cations. By contrast, E19 at the extracellular entrance only plays a minor role in ion selectivity of GLIC. In addition to electrostatics, both ion hydration and protein dynamics are found to be crucial for ion conduction as well, which explains why a chloride ion experiences a much greater barrier than a sodium ion in the hydrophobic region of the pore.

  18. A Cu2+-selective fluorescent chemosensor based on BODIPY with two pyridine ligands and logic gate

    Science.gov (United States)

    Huang, Liuqian; Zhang, Jing; Yu, Xiaoxiu; Ma, Yifan; Huang, Tianjiao; Shen, Xi; Qiu, Huayu; He, Xingxing; Yin, Shouchun

    2015-06-01

    A novel near-infrared fluorescent chemosensor based on BODIPY (Py-1) has been synthesized and characterized. Py-1 displays high selectivity and sensitivity for sensing Cu2+ over other metal ions in acetonitrile. Upon addition of Cu2+ ions, the maximum absorption band of Py-1 in CH3CN displays a red shift from 603 to 608 nm, which results in a visual color change from pink to blue. When Py-1 is excited at 600 nm in the presence of Cu2+, the fluorescent emission intensity of Py-1 at 617 nm is quenched over 86%. Notably, the complex of Py-1-Cu2+ can be restored with the introduction of EDTA or S2-. Consequently, an IMPLICATION logic gate at molecular level operating in fluorescence mode with Cu2+ and S2- as chemical inputs can be constructed. Finally, based on the reversible and reproducible system, a nanoscale sequential memory unit displaying "Writing-Reading-Erasing-Reading" functions can be integrated.

  19. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  20. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  1. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  2. Identification of an HV 1 voltage-gated proton channel in insects.

    Science.gov (United States)

    Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris

    2016-04-01

    The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

  3. Thermosensitive gating effect and selective gas adsorption in a porous coordination nanocage

    NARCIS (Netherlands)

    Zhao, D.; Yuan, D.; Krishna, R.; van Baten, J.M.; Zhou, H.C.

    2010-01-01

    A porous coordination nanocage functionalized with 24 triisopropylsilyl groups exhibits a remarkable thermosensitive gate opening phenomenon and demonstrates a molecular sieving effect at a certain temperature range, which can be used for gas separation purposes.

  4. Meroterpenoid Chrodrimanins Are Selective and Potent Blockers of Insect GABA-Gated Chloride Channels.

    Directory of Open Access Journals (Sweden)

    Yan Xu

    Full Text Available Meroterpenoid chrodrimanins, produced from Talaromyces sp. YO-2, are known to paralyze silkworm (Bombyx mori larvae, but their target is unknown. We have investigated the actions of chrodrimanin B on ligand-gated ion channels of silkworm larval neurons using patch-clamp electrophysiology. Chrodrimanin B had no effect on membrane currents when tested alone at 1 μM. However, it completely blocked the γ-aminobutyric acid (GABA-induced current and showed less pronounced actions on acetylcholine- and L-glutamate-induced currents, when delivered at 1 μM for 1 min prior to co-application with transmitter GABA. Thus, chrodrimanins were also tested on a wild-type isoform of the B. mori GABA receptor (GABAR RDL using two-electrode voltage-clamp electrophysiology. Chrodrimanin B attenuated the peak current amplitude of the GABA response of RDL with an IC50 of 1.66 nM. The order of the GABAR-blocking potency of chrodrimanins B > D > A was in accordance with their reported insecticidal potency. Chrodrimanin B had no open channel blocking action when tested at 3 nM on the GABA response of RDL. Co-application with 3 nM chrodrimanin B shifted the GABA concentration response curve to a higher concentration and further increase of chrodrimanin B concentration to 10 nM; it reduced maximum current amplitude of the GABA response, pointing to a high-affinity competitive action and a lower affinity non-competitive action. The A282S;T286V double mutation of RDL, which impairs the actions of fipronil, hardly affected the blocking action of chrodrimanin B, indicating a binding site of chrodrimanin B distinct from that of fipronil. Chrodrimanin B showed approximately 1,000-fold lower blocking action on human α1β2γ2 GABAR compared to RDL and thus is a selective blocker of insect GABARs.

  5. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  6. Fabrication of GaAs nanowire devices with self-aligning W-gate electrodes using selective-area MOVPE

    International Nuclear Information System (INIS)

    Ooike, N.; Motohisa, J.; Fukui, T.

    2004-01-01

    We propose and demonstrate a novel self-aligning process for fabricating the tungsten (W) gate electrode of GaAs nanowire FETs by using selective-area metalorganic vapor phase epitaxy (SA-MOVPE) where SiO 2 /W composite films are used to mask the substrates. First, to study the growth process and its dependence on mask materials, GaAs wire structures were grown on masked substrates partially covered with a single W layer or SiO 2 /W composite films. We found that lateral growth over the masked regions could be suppressed when a wire along the [110] direction and a SiO 2 /W composite mask were used. Using this composite mask, we fabricated GaAs narrow channel FETs using W as a Schottky gate electrode, and we were able to observe FET characteristics at room temperature

  7. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  8. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  9. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  10. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  11. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  12. AN EVALUATION OF POINT AND DENSITY FORECASTS FOR SELECTED EU FARM GATE MILK PRICES

    Directory of Open Access Journals (Sweden)

    Dennis Bergmann

    2018-01-01

    Full Text Available Fundamental changes to the common agricultural policy (CAP have led to greater market orientation which in turn has resulted in sharply increased variability of EU farm gate milk prices and thus farmers’ income. In this market environment reliable forecasts of farm gate milk prices are extremely important as farmers can make improved decisions with regards to cash flow management and budget preparation. In addition these forecasts may be used in setting fixed priced contracts between dairy farmers and processors thus providing certainty and reducing risk. In this study both point and density forecasts from various time series models for farm gate milk prices in Germany, Ireland and for an average EU price series are evaluated using a rolling window framework. Additionally forecasts of the individual models are combined using different combination schemes. The results of the out of sample evaluation show that ARIMA type models perform well on short forecast horizons (1 to 3 month while the structural time series approach performs well on longer forecast horizons (12 month. Finally combining individual forecasts of different models significantly improves the forecast performance for all forecast horizons.

  13. Wedge gate valves selecting essentials in pipeline systems designing based on permissible operation parameters

    Science.gov (United States)

    Zakirnichnaya, M. M.; Kulsharipov, I. M.

    2017-10-01

    Wedge gate valves are widely used at the fuel and energy complex enterprises. The pipeline valves manufacturers indicate the safe operation resource according to the current regulatory and technical documentation. In this case, the resource value of the valve body strength calculation results is taken into consideration as the main structural part. However, it was determined that the wedge gate valves fail before the assigned resource due to the occurrence of conditions under which the wedge breaks in the hooks and, accordingly, the sealing integrity is not ensured. In this regard, it became necessary to assess the conditions under which the resource should be assigned not only to the valve body, but also to take into account the wedge durability. For this purpose, wedge resource calculations were made using the example of ZKL2 250-25 and ZKL2 300-25 valves using the ABAQUS software package FE-SAFE module under the technological parameters influence on the basis of their stressstrain state calculation results. Operating conditions, under which the wedge resource value is lower than the one set by the manufacturer, were determined. A technique for limiting the operating parameters for ensuring the wedge durability during the wedge gate valve assigned resource is proposed.

  14. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  15. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  16. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  17. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  18. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  20. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  1. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  2. Selection for narrow gate of emergence results in correlated sex-specific changes in life history of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Vishwanath Varma

    2014-06-01

    Full Text Available Since the ability to time rhythmic behaviours in accordance with cyclic environments is likely to confer adaptive advantage to organisms, the underlying clocks are believed to be selected for stability in timekeeping over evolutionary time scales. Here we report the results of a study aimed at assessing fitness consequences of a long-term laboratory selection for tighter circadian organisation using fruit fly Drosophila melanogaster populations. We selected flies emerging in a narrow window of 1 h in the morning for several generations and assayed their life history traits such as pre-adult development time, survivorship, adult lifespan and lifetime fecundity. We chose flies emerging during the selection window (in the morning and another window (in the evening to represent adaptive and non-adaptive phenotypes, respectively, and examined the correlation of emergence time with adult fitness traits. Adult lifespan of males from the selected populations does not differ from the controls, whereas females from the selected populations have significantly shorter lifespan and produce more eggs during their mid-life compared to the controls. Although there is no difference in the lifespan of males of the selected populations, whether they emerge in morning or evening window, morning emerging females live slightly shorter and lay more eggs during the mid-life stage compared to those emerging in the evening. Interestingly, such a time of emergence dependent difference in fitness is not seen in flies from the control populations. These results, therefore, suggest reduced lifespan and enhanced mid-life reproductive output in females selected for narrow gate of emergence, and a sex-dependent genetic correlation between the timing of emergence and key fitness traits in these populations.

  3. Influence of gating phase selection on the image quality of coronary arteries in multidetector row computed tomography

    International Nuclear Information System (INIS)

    Laskowska, K.; Marzec, M.; Serafin, Z.; Nawrocka, E.; Lasek, W.; WWisniewska-Szmyt, J.; Kubica, J.

    2005-01-01

    Motion artifacts caused by cardiac movement disturb the imaging of coronary arteries with multidetector-row spiral computed tomography. The aim of this study was to determine the phase of the heart rate which provides the best quality of coronary artery imaging in retrospective ECG-gated CT. Although 75% is usually the best reconstruction phase, the optimal phase should be established individually for the patient, artery, segment, and type of tomograph for the best imaging quality. Forty-five cardiac CT angiograms of 26 patients were retrospectively evaluated. The examinations were performed with a 4-detector-row tomograph. ECG-gated retrospective reconstructions were relatively delayed at 0%, 12.5%, 25%, 37.5%, 50%, 62.5%, 75%, and 87.5% of the cardiac cycle. Selected coronary arteries of the highest diagnostic quality were estimated in the eight phases of the cardiac cycle. Only arteries of very high image quality were selected for analysis: left coronary artery trunks (44 cases, incl. 37 stented), anterior interventricular branches (36, incl. 3 stented), circumflex branches (16), right coronary rtery branches (23), and posterior interventricular branches (4). The reconstruction phase had a statistically significant impact on the quality of imaging (p < 0.0003). Depending on the case, optimal imaging was noted in various phases, except in the 12.5 % phase. The 75% phase appeared to be the best of all those examined (p < 0.05), both in the group of arteries without stents (p < 0.0006) and in those stented (p < 0.05). In some cases of repeated examinations the best phases differed within the same patient. (author)

  4. Extended-gate field-effect transistor (EG-FET) with molecularly imprinted polymer (MIP) film for selective inosine determination.

    Science.gov (United States)

    Iskierko, Zofia; Sosnowska, Marta; Sharma, Piyush Sindhu; Benincori, Tiziana; D'Souza, Francis; Kaminska, Izabela; Fronc, Krzysztof; Noworyta, Krzysztof

    2015-12-15

    A novel recognition unit of chemical sensor for selective determination of the inosine, renal disfunction biomarker, was devised and prepared. For that purpose, inosine-templated molecularly imprinted polymer (MIP) film was deposited on an extended-gate field-effect transistor (EG-FET) signal transducing unit. The MIP film was prepared by electrochemical polymerization of bis(bithiophene) derivatives bearing cytosine and boronic acid substituents, in the presence of the inosine template and a thiophene cross-linker. After MIP film deposition, the template was removed, and was confirmed by UV-visible spectroscopy. Subsequently, the film composition was characterized by spectroscopic techniques, and its morphology and thickness were determined by AFM. The finally MIP film-coated extended-gate field-effect transistor (EG-FET) was used for signal transduction. This combination is not widely studied in the literature, despite the fact that it allows for facile integration of electrodeposited MIP film with FET transducer. The linear dynamic concentration range of the chemosensor was 0.5-50 μM with inosine detectability of 0.62 μM. The obtained detectability compares well to the levels of the inosine in body fluids which are in the range 0-2.9 µM for patients with diagnosed diabetic nephropathy, gout or hyperuricemia, and can reach 25 µM in certain cases. The imprinting factor for inosine, determined from piezomicrogravimetric experiments with use of the MIP film-coated quartz crystal resonator, was found to be 5.5. Higher selectivity for inosine with respect to common interferents was also achieved with the present molecularly engineered sensing element. The obtained analytical parameters of the devised chemosensor allow for its use for practical sample measurements. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Gating of a pH-sensitive K(2P potassium channel by an electrostatic effect of basic sensor residues on the selectivity filter.

    Directory of Open Access Journals (Sweden)

    Leandro Zúñiga

    2011-01-01

    Full Text Available K(+ channels share common selectivity characteristics but exhibit a wide diversity in how they are gated open. Leak K(2P K(+ channels TASK-2, TALK-1 and TALK-2 are gated open by extracellular alkalinization. The mechanism for this alkalinization-dependent gating has been proposed to be the neutralization of the side chain of a single arginine (lysine in TALK-2 residue near the pore of TASK-2, which occurs with the unusual pK(a of 8.0. We now corroborate this hypothesis by transplanting the TASK-2 extracellular pH (pH(o sensor in the background of a pH(o-insensitive TASK-3 channel, which leads to the restitution of pH(o-gating. Using a concatenated channel approach, we also demonstrate that for TASK-2 to open, pH(o sensors must be neutralized in each of the two subunits forming these dimeric channels with no apparent cross-talk between the sensors. These results are consistent with adaptive biasing force analysis of K(+ permeation using a model selectivity filter in wild-type and mutated channels. The underlying free-energy profiles confirm that either a doubly or a singly charged pH(o sensor is sufficient to abolish ion flow. Atomic detail of the associated mechanism reveals that, rather than a collapse of the pore, as proposed for other K(2P channels gated at the selectivity filter, an increased height of the energetic barriers for ion translocation accounts for channel blockade at acid pH(o. Our data, therefore, strongly suggest that a cycle of protonation/deprotonation of pH(o-sensing arginine 224 side chain gates the TASK-2 channel by electrostatically tuning the conformational stability of its selectivity filter.

  6. Gating of a pH-sensitive K(2P) potassium channel by an electrostatic effect of basic sensor residues on the selectivity filter.

    Science.gov (United States)

    Zúñiga, Leandro; Márquez, Valeria; González-Nilo, Fernando D; Chipot, Christophe; Cid, L Pablo; Sepúlveda, Francisco V; Niemeyer, María Isabel

    2011-01-25

    K(+) channels share common selectivity characteristics but exhibit a wide diversity in how they are gated open. Leak K(2P) K(+) channels TASK-2, TALK-1 and TALK-2 are gated open by extracellular alkalinization. The mechanism for this alkalinization-dependent gating has been proposed to be the neutralization of the side chain of a single arginine (lysine in TALK-2) residue near the pore of TASK-2, which occurs with the unusual pK(a) of 8.0. We now corroborate this hypothesis by transplanting the TASK-2 extracellular pH (pH(o)) sensor in the background of a pH(o)-insensitive TASK-3 channel, which leads to the restitution of pH(o)-gating. Using a concatenated channel approach, we also demonstrate that for TASK-2 to open, pH(o) sensors must be neutralized in each of the two subunits forming these dimeric channels with no apparent cross-talk between the sensors. These results are consistent with adaptive biasing force analysis of K(+) permeation using a model selectivity filter in wild-type and mutated channels. The underlying free-energy profiles confirm that either a doubly or a singly charged pH(o) sensor is sufficient to abolish ion flow. Atomic detail of the associated mechanism reveals that, rather than a collapse of the pore, as proposed for other K(2P) channels gated at the selectivity filter, an increased height of the energetic barriers for ion translocation accounts for channel blockade at acid pH(o). Our data, therefore, strongly suggest that a cycle of protonation/deprotonation of pH(o)-sensing arginine 224 side chain gates the TASK-2 channel by electrostatically tuning the conformational stability of its selectivity filter.

  7. Mechanosensitive gating of Kv channels.

    Directory of Open Access Journals (Sweden)

    Catherine E Morris

    Full Text Available K-selective voltage-gated channels (Kv are multi-conformation bilayer-embedded proteins whose mechanosensitive (MS Popen(V implies that at least one conformational transition requires the restructuring of the channel-bilayer interface. Unlike Morris and colleagues, who attributed MS-Kv responses to a cooperative V-dependent closed-closed expansion↔compaction transition near the open state, Mackinnon and colleagues invoke expansion during a V-independent closed↔open transition. With increasing membrane tension, they suggest, the closed↔open equilibrium constant, L, can increase >100-fold, thereby taking steady-state Popen from 0→1; "exquisite sensitivity to small…mechanical perturbations", they state, makes a Kv "as much a mechanosensitive…as…a voltage-dependent channel". Devised to explain successive gK(V curves in excised patches where tension spontaneously increased until lysis, their L-based model falters in part because of an overlooked IK feature; with recovery from slow inactivation factored in, their g(V datasets are fully explained by the earlier model (a MS V-dependent closed-closed transition, invariant L≥4. An L-based MS-Kv predicts neither known Kv time courses nor the distinctive MS responses of Kv-ILT. It predicts Kv densities (hence gating charge per V-sensor several-fold different from established values. If opening depended on elevated tension (L-based model, standard gK(V operation would be compromised by animal cells' membrane flaccidity. A MS V-dependent transition is, by contrast, unproblematic on all counts. Since these issues bear directly on recent findings that mechanically-modulated Kv channels subtly tune pain-related excitability in peripheral mechanoreceptor neurons we undertook excitability modeling (evoked action potentials. Kvs with MS V-dependent closed-closed transitions produce nuanced mechanically-modulated excitability whereas an L-based MS-Kv yields extreme, possibly excessive

  8. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  9. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  10. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  11. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  12. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  13. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  14. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  15. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  16. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  17. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  18. A Cu²⁺-selective fluorescent chemosensor based on BODIPY with two pyridine ligands and logic gate.

    Science.gov (United States)

    Huang, Liuqian; Zhang, Jing; Yu, Xiaoxiu; Ma, Yifan; Huang, Tianjiao; Shen, Xi; Qiu, Huayu; He, Xingxing; Yin, Shouchun

    2015-06-15

    A novel near-infrared fluorescent chemosensor based on BODIPY (Py-1) has been synthesized and characterized. Py-1 displays high selectivity and sensitivity for sensing Cu(2+) over other metal ions in acetonitrile. Upon addition of Cu(2+) ions, the maximum absorption band of Py-1 in CH3CN displays a red shift from 603 to 608 nm, which results in a visual color change from pink to blue. When Py-1 is excited at 600 nm in the presence of Cu(2+), the fluorescent emission intensity of Py-1 at 617 nm is quenched over 86%. Notably, the complex of Py-1-Cu(2+) can be restored with the introduction of EDTA or S(2-). Consequently, an IMPLICATION logic gate at molecular level operating in fluorescence mode with Cu(2+) and S(2-) as chemical inputs can be constructed. Finally, based on the reversible and reproducible system, a nanoscale sequential memory unit displaying "Writing-Reading-Erasing-Reading" functions can be integrated. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

    Science.gov (United States)

    Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

    2013-09-01

    Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

  20. Voltage-Gated Proton Channels: Molecular Biology, Physiology, and Pathophysiology of the HV Family

    Science.gov (United States)

    2013-01-01

    Voltage-gated proton channels (HV) are unique, in part because the ion they conduct is unique. HV channels are perfectly selective for protons and have a very small unitary conductance, both arguably manifestations of the extremely low H+ concentration in physiological solutions. They open with membrane depolarization, but their voltage dependence is strongly regulated by the pH gradient across the membrane (ΔpH), with the result that in most species they normally conduct only outward current. The HV channel protein is strikingly similar to the voltage-sensing domain (VSD, the first four membrane-spanning segments) of voltage-gated K+ and Na+ channels. In higher species, HV channels exist as dimers in which each protomer has its own conduction pathway, yet gating is cooperative. HV channels are phylogenetically diverse, distributed from humans to unicellular marine life, and perhaps even plants. Correspondingly, HV functions vary widely as well, from promoting calcification in coccolithophores and triggering bioluminescent flashes in dinoflagellates to facilitating killing bacteria, airway pH regulation, basophil histamine release, sperm maturation, and B lymphocyte responses in humans. Recent evidence that hHV1 may exacerbate breast cancer metastasis and cerebral damage from ischemic stroke highlights the rapidly expanding recognition of the clinical importance of hHV1. PMID:23589829

  1. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  2. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  3. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  4. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  5. Optimized ONO thickness for multi-level and 2-bit/cell operation for wrapped-select-gate (WSG) SONOS memory

    International Nuclear Information System (INIS)

    Wu, Woei-Cherng; Chao, Tien-Sheng; Yang, Tsung-Yu; Peng, Wu-Chin; Yang, Wen-Luh; Chen, Jian-Hao; Ma, Ming Wen; Lai, Chao-Sung; Lee, Chien-Hsing; Hsieh, Tsung-Min; Liou, Jhyy Cheng; Chen, Tzu Ping; Chen, Chien Hung; Lin, Chih Hung; Chen, Hwi Huang; Ko, Joe

    2008-01-01

    In this paper, highly reliable wrapped-select-gate (WSG) silicon–oxide–nitride–oxide–silicon (SONOS) memory cells with multi-level and 2-bit/cell operation have been successfully demonstrated. The source-side injection mechanism for WSG-SONOS memory with different ONO thickness was thoroughly investigated. The different programming efficiencies of the WSG-SONOS memory under different ONO thicknesses are explained by the lateral electrical field extracted from the simulation results. Furthermore, multi-level storage is easily obtained, and good V TH distribution presented, for the WSG-SONOS memory with optimized ONO thickness. High program/erase speed (10 µs/5 ms) and low programming current (3.5 µA) are used to achieve the multi-level operation with tolerable gate and drain disturbance, negligible second-bit effect, excellent data retention and good endurance performance

  6. Linear gate

    International Nuclear Information System (INIS)

    Suwono.

    1978-01-01

    A linear gate providing a variable gate duration from 0,40μsec to 4μsec was developed. The electronic circuity consists of a linear circuit and an enable circuit. The input signal can be either unipolar or bipolar. If the input signal is bipolar, the negative portion will be filtered. The operation of the linear gate is controlled by the application of a positive enable pulse. (author)

  7. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  8. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  9. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  10. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  11. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  13. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Gate-last TiN/HfO2 band edge effective work functions using low-temperature anneals and selective cladding to control interface composition

    KAUST Repository

    Hinkle, C. L.

    2012-04-09

    Silicon N-metal-oxide-semiconductor (NMOS) and P-metal-oxide-semiconductor (PMOS) band edge effective work functions and the correspondingly low threshold voltages (Vt) are demonstrated using standard fab materials and processes in a gate-last scheme employing low-temperature anneals and selective cladding layers. Al diffusion from the cladding to the TiN/HfO2interface during forming gas anneal together with low O concentration in the TiN enables low NMOS Vt. The use of non-migrating W cladding along with experimentally detected N-induced dipoles, produced by increased oxygen in the TiN, facilitates low PMOS Vt.

  15. Gate-last TiN/HfO2 band edge effective work functions using low-temperature anneals and selective cladding to control interface composition

    KAUST Repository

    Hinkle, C. L.; Galatage, R. V.; Chapman, R. A.; Vogel, E. M.; Alshareef, Husam N.; Freeman, C.; Christensen, M.; Wimmer, E.; Niimi, H.; Li-Fatou, A.; Shaw, J. B.; Chambers, J. J.

    2012-01-01

    Silicon N-metal-oxide-semiconductor (NMOS) and P-metal-oxide-semiconductor (PMOS) band edge effective work functions and the correspondingly low threshold voltages (Vt) are demonstrated using standard fab materials and processes in a gate-last scheme employing low-temperature anneals and selective cladding layers. Al diffusion from the cladding to the TiN/HfO2interface during forming gas anneal together with low O concentration in the TiN enables low NMOS Vt. The use of non-migrating W cladding along with experimentally detected N-induced dipoles, produced by increased oxygen in the TiN, facilitates low PMOS Vt.

  16. Effects of electrolyte gating on photoluminescence spectra of large-area WSe2monolayer films

    KAUST Repository

    Matsuki, Keiichiro; Pu, Jiang; Kozawa, Daichi; Matsuda, Kazunari; Li, Lain-Jong; Takenobu, Taishi

    2016-01-01

    We fabricated electric double-layer transistors comprising large-area WSe2 monolayers and investigated the effects of electrolyte gating on their photoluminescence (PL) spectra. Using the efficient gating effects of electric double layers, we succeeded in the application of a large electric field (>107Vcm%1) and the accumulation of high carrier density (>1013cm%2). As a result, we observed PL spectra based on both positively and negatively charged excitons and their gate-voltage-dependent redshifts, suggesting the effects of both an electric field and charge accumulation. © 2016 The Japan Society of Applied Physics.

  17. Effects of electrolyte gating on photoluminescence spectra of large-area WSe2monolayer films

    KAUST Repository

    Matsuki, Keiichiro

    2016-05-24

    We fabricated electric double-layer transistors comprising large-area WSe2 monolayers and investigated the effects of electrolyte gating on their photoluminescence (PL) spectra. Using the efficient gating effects of electric double layers, we succeeded in the application of a large electric field (>107Vcm%1) and the accumulation of high carrier density (>1013cm%2). As a result, we observed PL spectra based on both positively and negatively charged excitons and their gate-voltage-dependent redshifts, suggesting the effects of both an electric field and charge accumulation. © 2016 The Japan Society of Applied Physics.

  18. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  19. Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-01

    Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

  20. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  1. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  2. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  3. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  4. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  5. Use of ECG-gated computed tomography, echocardiography and selective angiography in five dogs with pulmonic stenosis and one dog with pulmonic stenosis and aberrant coronary arteries.

    Science.gov (United States)

    Laborda-Vidal, P; Pedro, B; Baker, M; Gelzer, A R; Dukes-McEwan, J; Maddox, T W

    2016-12-01

    Pulmonic stenosis (PS) is the most common congenital cardiac disease in dogs. Boxers and English bulldogs are among the most commonly affected breeds and also commonly associated with an aberrant coronary artery (CA). If an aberrant CA is suspected and balloon valvuloplasty indicated, an intra-operative angiography is recommended prior to the procedure. ECG-gated computed tomography (CT) can be used to screen for CA anomalies in a quick and minimally-invasive way (preventing side effects associated with selective catheter angiography) and allowing early planning of the procedure. The aim of this case series was to report CT findings associated with PS diagnosed by echocardiography. Our database was retrospectively searched for cases of dogs with PS diagnosed by echocardiography, where an ECG-gated CT was performed. A total of six cases were retrieved: all were diagnosed with severe PS. Four dogs had concurrent congenital defects: two dogs had a patent ductus arteriosus, one dog had a ventricular septal defect and an overriding aorta, one dog had an aberrant CA. Detailed CT findings of all cases were reported, including one case of a patent ductus arteriosus and an overriding aorta not identified by transthoracic echocardiography. In addition, an abnormal single left coronary ostium, with a pre-pulmonic right CA was described. In conclusion, despite echocardiography remaining the gold standard for diagnosis and assessment of PS, ECG-gated-CT angiography is a complementary diagnostic method that may provide additional relevant information, shorten surgery/anaesthesia time and reduce the amount of radiation to which the clinician is subjected. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  7. Stapled Voltage-Gated Calcium Channel (CaV) α-Interaction Domain (AID) Peptides Act As Selective Protein-Protein Interaction Inhibitors of CaV Function.

    Science.gov (United States)

    Findeisen, Felix; Campiglio, Marta; Jo, Hyunil; Abderemane-Ali, Fayal; Rumpf, Christine H; Pope, Lianne; Rossen, Nathan D; Flucher, Bernhard E; DeGrado, William F; Minor, Daniel L

    2017-06-21

    For many voltage-gated ion channels (VGICs), creation of a properly functioning ion channel requires the formation of specific protein-protein interactions between the transmembrane pore-forming subunits and cystoplasmic accessory subunits. Despite the importance of such protein-protein interactions in VGIC function and assembly, their potential as sites for VGIC modulator development has been largely overlooked. Here, we develop meta-xylyl (m-xylyl) stapled peptides that target a prototypic VGIC high affinity protein-protein interaction, the interaction between the voltage-gated calcium channel (Ca V ) pore-forming subunit α-interaction domain (AID) and cytoplasmic β-subunit (Ca V β). We show using circular dichroism spectroscopy, X-ray crystallography, and isothermal titration calorimetry that the m-xylyl staples enhance AID helix formation are structurally compatible with native-like AID:Ca V β interactions and reduce the entropic penalty associated with AID binding to Ca V β. Importantly, electrophysiological studies reveal that stapled AID peptides act as effective inhibitors of the Ca V α 1 :Ca V β interaction that modulate Ca V function in an Ca V β isoform-selective manner. Together, our studies provide a proof-of-concept demonstration of the use of protein-protein interaction inhibitors to control VGIC function and point to strategies for improved AID-based Ca V modulator design.

  8. The electrically silent Kv6.4 subunit confers hyperpolarized gating charge movement in Kv2.1/Kv6.4 heterotetrameric channels.

    Directory of Open Access Journals (Sweden)

    Elke Bocksteins

    Full Text Available The voltage-gated K(+ (Kv channel subunit Kv6.4 does not form functional homotetrameric channels but co-assembles with Kv2.1 to form functional Kv2.1/Kv6.4 heterotetrameric channels. Compared to Kv2.1 homotetramers, Kv6.4 exerts a ~40 mV hyperpolarizing shift in the voltage-dependence of Kv2.1/Kv6.4 channel inactivation, without a significant effect on activation gating. However, the underlying mechanism of this Kv6.4-induced modulation of Kv2.1 channel inactivation, and whether the Kv6.4 subunit participates in the voltage-dependent gating of heterotetrameric channels is not well understood. Here we report distinct gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels, compared to Kv2.1 homotetramers, as revealed by gating current recordings from mammalian cells expressing these channels. The gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels displayed an extra component around the physiological K(+ equilibrium potential, characterized by a second sigmoidal relationship of the voltage-dependence of gating charge movement. This distinct gating charge displacement reflects movement of the Kv6.4 voltage-sensing domain and has a voltage-dependency that matches the hyperpolarizing shift in Kv2.1/Kv6.4 channel inactivation. These results provide a mechanistic basis for the modulation of Kv2.1 channel inactivation gating kinetics by silent Kv6.4 subunits.

  9. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  10. A novel optical gating method for laser gated imaging

    Science.gov (United States)

    Ginat, Ran; Schneider, Ron; Zohar, Eyal; Nesher, Ofer

    2013-06-01

    For the past 15 years, Elbit Systems is developing time-resolved active laser-gated imaging (LGI) systems for various applications. Traditional LGI systems are based on high sensitive gated sensors, synchronized to pulsed laser sources. Elbit propriety multi-pulse per frame method, which is being implemented in LGI systems, improves significantly the imaging quality. A significant characteristic of the LGI is its ability to penetrate a disturbing media, such as rain, haze and some fog types. Current LGI systems are based on image intensifier (II) sensors, limiting the system in spectral response, image quality, reliability and cost. A novel propriety optical gating module was developed in Elbit, untying the dependency of LGI system on II. The optical gating module is not bounded to the radiance wavelength and positioned between the system optics and the sensor. This optical gating method supports the use of conventional solid state sensors. By selecting the appropriate solid state sensor, the new LGI systems can operate at any desired wavelength. In this paper we present the new gating method characteristics, performance and its advantages over the II gating method. The use of the gated imaging systems is described in a variety of applications, including results from latest field experiments.

  11. On photonic controlled phase gates

    International Nuclear Information System (INIS)

    Kieling, K; Eisert, J; O'Brien, J L

    2010-01-01

    As primitives for entanglement generation, controlled phase gates have a central role in quantum computing. Especially in ideas realizing instances of quantum computation in linear optical gate arrays, a closer look can be rewarding. In such architectures, all effective nonlinearities are induced by measurements. Hence the probability of success is a crucial parameter of such quantum gates. In this paper, we discuss this question for controlled phase gates that implement an arbitrary phase with one and two control qubits. Within the class of post-selected gates in dual-rail encoding with vacuum ancillas, we identify the optimal success probabilities. We construct networks that allow for implementation using current experimental capabilities in detail. The methods employed here appear specifically useful with the advent of integrated linear optical circuits, providing stable interferometers on monolithic structures.

  12. Modeling of the Channel Thickness Influence on Electrical Characteristics and Series Resistance in Gate-Recessed Nanoscale SOI MOSFETs

    Directory of Open Access Journals (Sweden)

    A. Karsenty

    2013-01-01

    Full Text Available Ultrathin body (UTB and nanoscale body (NSB SOI-MOSFET devices, sharing a similar W/L but with a channel thickness of 46 nm and lower than 5 nm, respectively, were fabricated using a selectivegate-recessed” process on the same silicon wafer. Their current-voltage characteristics measured at room temperature were found to be surprisingly different by several orders of magnitude. We analyzed this result by considering the severe mobility degradation and the influence of a huge series resistance and found that the last one seems more coherent. Then the electrical characteristics of the NSB can be analytically derived by integrating a gate voltage-dependent drain source series resistance. In this paper, the influence of the channel thickness on the series resistance is reported for the first time. This influence is integrated to the analytical model in order to describe the trends of the saturation current with the channel thickness. This modeling approach may be useful to interpret anomalous electrical behavior of other nanodevices in which series resistance and/or mobility degradation is of a great concern.

  13. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  14. The selective alpha7 nicotinic acetylcholine receptor agonist PNU-282987 [N-[(3R)-1-Azabicyclo[2.2.2]oct-3-yl]-4-chlorobenzamide hydrochloride] enhances GABAergic synaptic activity in brain slices and restores auditory gating deficits in anesthetized rats.

    Science.gov (United States)

    Hajós, M; Hurst, R S; Hoffmann, W E; Krause, M; Wall, T M; Higdon, N R; Groppi, V E

    2005-03-01

    Schizophrenic patients are thought to have an impaired ability to process sensory information. This deficit leads to disrupted auditory gating measured electrophysiologically as a reduced suppression of the second of paired auditoryevoked responses (P50) and is proposed to be associated with decreased function and/or expression of the homomeric alpha7 nicotinic acetylcholine receptor (nAChR). Here, we provide evidence that N-[(3R)-1-azabicyclo[2.2.2]oct-3-yl]-4-chlorobenzamide hydrochloride (PNU-282987), a novel selective agonist of the alpha7 nAChR, evoked whole-cell currents from cultured rat hippocampal neurons that were sensitive to the selective alpha7 nAChR antagonist methyllycaconitine (MLA) and enhanced GABAergic synaptic activity when applied to hippocampal slices. Amphetamine-induced sensory gating deficit, determined by auditory-evoked potentials in hippocampal CA3 region, was restored by systemic administration of PNU-282987 in chloral hydrate-anesthetized rats. Auditory gating of rat reticular thalamic neurons was also disrupted by amphetamine; however, PNU-282987 normalized gating deficit only in a subset of tested neurons (6 of 11). Furthermore, PNU-282987 improved the inherent hippocampal gating deficit occurring in a subpopulation of anesthetized rats, and enhanced amphetamine-induced hippocampal oscillation. We propose that the alpha7 nAChR agonist PNU-282987, via modulating/enhancing hippocampal GABAergic neurotransmission, improves auditory gating and enhances hippocampal oscillatory activity. These results provide further support for the concept that drugs that selectively activate alpha7 nAChRs may offer a novel, potential pharmacotherapy in treatment of schizophrenia.

  15. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  16. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  17. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  18. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  19. Mechanism underlying selective regulation of G protein-gated inwardly rectifying potassium channels by the psychostimulant-sensitive sorting nexin 27

    Science.gov (United States)

    Balana, Bartosz; Maslennikov, Innokentiy; Kwiatkowski, Witek; Stern, Kalyn M.; Bahima, Laia; Choe, Senyon; Slesinger, Paul A.

    2011-01-01

    G protein-gated inwardly rectifying potassium (GIRK) channels are important gatekeepers of neuronal excitability. The surface expression of neuronal GIRK channels is regulated by the psychostimulant-sensitive sorting nexin 27 (SNX27) protein through a class I (-X-Ser/Thr-X-Φ, where X is any residue and Φ is a hydrophobic amino acid) PDZ-binding interaction. The G protein-insensitive inward rectifier channel (IRK1) contains the same class I PDZ-binding motif but associates with a different synaptic PDZ protein, postsynaptic density protein 95 (PSD95). The mechanism by which SNX27 and PSD95 discriminate these channels was previously unclear. Using high-resolution structures coupled with biochemical and functional analyses, we identified key amino acids upstream of the channel's canonical PDZ-binding motif that associate electrostatically with a unique structural pocket in the SNX27-PDZ domain. Changing specific charged residues in the channel's carboxyl terminus or in the PDZ domain converts the selective association and functional regulation by SNX27. Elucidation of this unique interaction site between ion channels and PDZ-containing proteins could provide a therapeutic target for treating brain diseases. PMID:21422294

  20. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  2. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  3. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  4. Respiratory gating and multi field technique radiotherapy for esophageal cancer

    International Nuclear Information System (INIS)

    Ohta, Atsushi; Kaidu, Motoki; Tanabe, Satoshi

    2017-01-01

    To investigate the effects of a respiratory gating and multi field technique on the dose-volume histogram (DVH) in radiotherapy for esophageal cancer. Twenty patients who underwent four-dimensional computed tomography for esophageal cancer were included. We retrospectively created the four treatment plans for each patient, with or without the respiratory gating and multi field technique: No gating-2-field, No gating-4-field, Gating-2-field, and Gating-4-field plans. We compared the DVH parameters of the lung and heart in the No gating-2-field plan with the other three plans.Result In the comparison of the parameters in the No gating-2-field plan, there are significant differences in the Lung V 5Gy , V 20Gy , mean dose with all three plans and the Heart V 25Gy -V 40Gy with Gating-2-field plan, V 35Gy , V 40Gy , mean dose with No Gating-4-field plan and V 30Gy -V 40Gy , and mean dose with Gating-4-field plan. The lung parameters were smaller in the Gating-2-field plan and larger in the No gating-4-field and Gating-4-field plans. The heart parameters were all larger in the No gating-2-field plan. The lung parameters were reduced by the respiratory gating technique and increased by the multi field technique. The heart parameters were reduced by both techniques. It is important to select the optimal technique according to the risk of complications. (author)

  5. Phenotype selection reveals coevolution of muscle glycogen and protein and PTEN as a gate keeper for the accretion of muscle mass in adult female mice.

    Directory of Open Access Journals (Sweden)

    Mandy Sawitzky

    Full Text Available We have investigated molecular mechanisms for muscle mass accretion in a non-inbred mouse model (DU6P mice characterized by extreme muscle mass. This extreme muscle mass was developed during 138 generations of phenotype selection for high protein content. Due to the repeated trait selection a complex setting of different mechanisms was expected to be enriched during the selection experiment. In muscle from 29-week female DU6P mice we have identified robust increases of protein kinase B activation (AKT, Ser-473, up to 2-fold if compared to 11- and 54-week DU6P mice or controls. While a number of accepted effectors of AKT activation, including IGF-I, IGF-II, insulin/IGF-receptor, myostatin or integrin-linked kinase (ILK, were not correlated with this increase, phosphatase and tensin homologue deleted on chromosome 10 (PTEN was down-regulated in 29-week female DU6P mice. In addition, higher levels of PTEN phosphorylation were found identifying a second mechanism of PTEN inhibition. Inhibition of PTEN and activation of AKT correlated with specific activation of p70S6 kinase and ribosomal protein S6, reduced phosphorylation of eukaryotic initiation factor 2α (eIF2α and higher rates of protein synthesis in 29-week female DU6P mice. On the other hand, AKT activation also translated into specific inactivation of glycogen synthase kinase 3ß (GSK3ß and an increase of muscular glycogen. In muscles from 29-week female DU6P mice a significant increase of protein/DNA was identified, which was not due to a reduction of protein breakdown or to specific increases of translation initiation. Instead our data support the conclusion that a higher rate of protein translation is contributing to the higher muscle mass in mid-aged female DU6P mice. Our results further reveal coevolution of high protein and high glycogen content during the selection experiment and identify PTEN as gate keeper for muscle mass in mid-aged female DU6P mice.

  6. Combined two-photon excitation and d → f energy-transfer in Ir/lanthanide dyads with time-gated selection from a two-component emission spectrum.

    Science.gov (United States)

    Edkins, Robert M; Sykes, Daniel; Beeby, Andrew; Ward, Michael D

    2012-10-14

    In a pair of Ir/Eu and Ir/Tb dyads, two-photon excitation of the Ir-phenylpyridine chromophore at 780 nm is followed by partial d → f energy-transfer to give a combination of short-lived Ir-based (blue) and long-lived lanthanide-based (red or green) emission; these components can be selected separately by time-gated detection.

  7. CMOS gate array characterization procedures

    Science.gov (United States)

    Spratt, James P.

    1993-09-01

    Present procedures are inadequate for characterizing the radiation hardness of gate array product lines prior to personalization because the selection of circuits to be used, from among all those available in the manufacturer's circuit library, is usually uncontrolled. (Some circuits are fundamentally more radiation resistant than others.) In such cases, differences in hardness can result between different designs of the same logic function. Hardness also varies because many gate arrays feature large custom-designed megacells (e.g., microprocessors and random access memories-MicroP's and RAM's). As a result, different product lines cannot be compared equally. A characterization strategy is needed, along with standardized test vehicle(s), methodology, and conditions, so that users can make informed judgments on which gate arrays are best suited for their needs. The program described developed preferred procedures for the radiation characterization of gate arrays, including a gate array evaluation test vehicle, featuring a canary circuit, designed to define the speed versus hardness envelope of the gate array. A multiplier was chosen for this role, and a baseline multiplier architecture is suggested that could be incorporated into an existing standard evaluation circuit chip.

  8. Molecular analysis of the sea anemone toxin Av3 reveals selectivity to insects and demonstrates the heterogeneity of receptor site-3 on voltage-gated Na+ channels.

    Science.gov (United States)

    Moran, Yehu; Kahn, Roy; Cohen, Lior; Gur, Maya; Karbat, Izhar; Gordon, Dalia; Gurevitz, Michael

    2007-08-15

    Av3 is a short peptide toxin from the sea anemone Anemonia viridis shown to be active on crustaceans and inactive on mammals. It inhibits inactivation of Na(v)s (voltage-gated Na+ channels) like the structurally dissimilar scorpion alpha-toxins and type I sea anemone toxins that bind to receptor site-3. To examine the potency and mode of interaction of Av3 with insect Na(v)s, we established a system for its expression, mutagenized it throughout, and analysed it in toxicity, binding and electrophysiological assays. The recombinant Av3 was found to be highly toxic to blowfly larvae (ED50=2.65+/-0.46 pmol/100 mg), to compete well with the site-3 toxin LqhalphaIT (from the scorpion Leiurus quinquestriatus) on binding to cockroach neuronal membranes (K(i)=21.4+/-7.1 nM), and to inhibit the inactivation of Drosophila melanogaster channel, DmNa(v)1, but not that of mammalian Na(v)s expressed in Xenopus oocytes. Moreover, like other site-3 toxins, the activity of Av3 was synergically enhanced by ligands of receptor site-4 (e.g. scorpion beta-toxins). The bioactive surface of Av3 was found to consist mainly of aromatic residues and did not resemble any of the bioactive surfaces of other site-3 toxins. These analyses have portrayed a toxin that might interact with receptor site-3 in a different fashion compared with other ligands of this site. This assumption was corroborated by a D1701R mutation in DmNa(v)1, which has been shown to abolish the activity of all other site-3 ligands, except Av3. All in all, the present study provides further evidence for the heterogeneity of receptor site-3, and raises Av3 as a unique model for design of selective anti-insect compounds.

  9. Non-enhanced 3D MR angiography of the lower extremity using ECG-gated TSE imaging with non-selective refocusing pulses. Initial experience

    International Nuclear Information System (INIS)

    Lanzman, R.S.; Blondin, D.; Orzechowski, D.; Scherer, A.; Moedder, U.; Kroepil, P.; Godehardt, E.

    2010-01-01

    Purpose: To evaluate non-enhanced 3D MR angiography using turbo spin echo (TSE) imaging with non-selective refocusing pulses (NATIVE SPACE MRA) for the visualization of the arteries of the lower extremity. Materials and Methods: Three-station imaging (iliac arteries, femoral arteries, arteries of the lower leg) was performed in 8 healthy volunteers and 3 patients with peripheral artery disease (PAD) using a 1.5 T MR scanner. In 8 healthy volunteers, 4 different acquisition schemes were performed with the following imaging parameters: S 1: acquisition with every heartbeat (RR = 1), spoiler gradient of 25 % (SG = 25 %); S 2: RR = 1, SG = 0 %; S 3: RR = 2, SG = 25 %; S 4: RR = 2, SG = 0 %. The subjective image quality on a 4-point-scale (4 = excellent to 1 = not diagnostic) and relative SNR were assessed. In 3 patients with peripheral artery disease (PAD), SPACE MRA was performed for assessment of stenosis. Results: The mean subjective image quality was significantly lower for the iliac arteries compared to the femoral arteries and arteries of the lower leg (p < 0.0001). The subjective image quality for acquisition scheme S 1 was significantly lower than the image quality for S 3 and S 4 for the iliac arteries (p < 0.01), while the subjective image quality for acquisition scheme S 2 was significantly lower than S 3 and S 4 for the femoral arteries and the arteries of the lower leg (p < 0.01). The relative SNR was significantly higher for acquisition schemes S 3 and S 4 as compared to S 1 and S 2 (p < 0.0001) for all regions. SPACE MRA disclosed 7 significant stenoses in 3 PAD patients. Conclusion: ECG-gated SPACE MRA is a promising imaging technique for non-enhanced assessment of the arteries of the lower extremity. (orig.)

  10. Cognitive mechanisms associated with auditory sensory gating

    Science.gov (United States)

    Jones, L.A.; Hills, P.J.; Dick, K.M.; Jones, S.P.; Bright, P.

    2016-01-01

    Sensory gating is a neurophysiological measure of inhibition that is characterised by a reduction in the P50 event-related potential to a repeated identical stimulus. The objective of this work was to determine the cognitive mechanisms that relate to the neurological phenomenon of auditory sensory gating. Sixty participants underwent a battery of 10 cognitive tasks, including qualitatively different measures of attentional inhibition, working memory, and fluid intelligence. Participants additionally completed a paired-stimulus paradigm as a measure of auditory sensory gating. A correlational analysis revealed that several tasks correlated significantly with sensory gating. However once fluid intelligence and working memory were accounted for, only a measure of latent inhibition and accuracy scores on the continuous performance task showed significant sensitivity to sensory gating. We conclude that sensory gating reflects the identification of goal-irrelevant information at the encoding (input) stage and the subsequent ability to selectively attend to goal-relevant information based on that previous identification. PMID:26716891

  11. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  12. The mechanism of fast-gate opening in ClC-0.

    Science.gov (United States)

    Engh, Anita M; Faraldo-Gómez, José D; Maduke, Merritt

    2007-10-01

    ClC-0 is a chloride channel whose gating is sensitive to both voltage and chloride. Based on analysis of gating kinetics using single-channel recordings, a five-state model was proposed to describe the dependence of ClC-0 fast-gate opening on voltage and external chloride (Chen, T.-Y., and C. Miller. 1996. J. Gen. Physiol. 108:237-250). We aimed to use this five-state model as a starting point for understanding the structural changes that occur during gating. Using macroscopic patch recordings, we were able to reproduce the effects of voltage and chloride that were reported by Chen and Miller and to fit our opening rate constant data to the five-state model. Upon further analysis of both our data and those of Chen and Miller, we learned that in contrast to their conclusions, (a) the features in the data are not adequate to rule out a simpler four-state model, and (b) the chloride-binding step is voltage dependent. In order to be able to evaluate the effects of mutants on gating (described in the companion paper, see Engh et al. on p. 351 of this issue), we developed a method for determining the error on gating model parameters, and evaluated the sources of this error. To begin to mesh the kinetic model(s) with the known CLC structures, a model of ClC-0 was generated computationally based on the X-ray crystal structure of the prokaryotic homolog ClC-ec1. Analysis of pore electrostatics in this homology model suggests that at least two of the conclusions derived from the gating kinetics analysis are consistent with the known CLC structures: (1) chloride binding is necessary for channel opening, and (2) chloride binding to any of the three known chloride-binding sites must be voltage dependent.

  13. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  15. A step by step selection method for the location and the size of a waste-to-energy facility targeting the maximum output energy and minimization of gate fee.

    Science.gov (United States)

    Kyriakis, Efstathios; Psomopoulos, Constantinos; Kokkotis, Panagiotis; Bourtsalas, Athanasios; Themelis, Nikolaos

    2017-06-23

    This study attempts the development of an algorithm in order to present a step by step selection method for the location and the size of a waste-to-energy facility targeting the maximum output energy, also considering the basic obstacle which is in many cases, the gate fee. Various parameters identified and evaluated in order to formulate the proposed decision making method in the form of an algorithm. The principle simulation input is the amount of municipal solid wastes (MSW) available for incineration and along with its net calorific value are the most important factors for the feasibility of the plant. Moreover, the research is focused both on the parameters that could increase the energy production and those that affect the R1 energy efficiency factor. Estimation of the final gate fee is achieved through the economic analysis of the entire project by investigating both expenses and revenues which are expected according to the selected site and outputs of the facility. In this point, a number of commonly revenue methods were included in the algorithm. The developed algorithm has been validated using three case studies in Greece-Athens, Thessaloniki, and Central Greece, where the cities of Larisa and Volos have been selected for the application of the proposed decision making tool. These case studies were selected based on a previous publication made by two of the authors, in which these areas where examined. Results reveal that the development of a «solid» methodological approach in selecting the site and the size of waste-to-energy (WtE) facility can be feasible. However, the maximization of the energy efficiency factor R1 requires high utilization factors while the minimization of the final gate fee requires high R1 and high metals recovery from the bottom ash as well as economic exploitation of recovered raw materials if any.

  16. New gate opening hours

    CERN Multimedia

    GS Department

    2009-01-01

    Please note the new opening hours of the gates as well as the intersites tunnel from the 19 May 2009: GATE A 7h - 19h GATE B 24h/24 GATE C 7h - 9h\t17h - 19h GATE D 8h - 12h\t13h - 16h GATE E 7h - 9h\t17h - 19h Prévessin 24h/24 The intersites tunnel will be opened from 7h30 to 18h non stop. GS-SEM Group Infrastructure and General Services Department

  17. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  18. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  19. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  20. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  1. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  2. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  3. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  4. An L319F mutation in transmembrane region 3 (TM3) selectively reduces sensitivity to okaramine B of the Bombyx mori l-glutamate-gated chloride channel.

    Science.gov (United States)

    Furutani, Shogo; Okuhara, Daiki; Hashimoto, Anju; Ihara, Makoto; Kai, Kenji; Hayashi, Hideo; Sattelle, David B; Matsuda, Kazuhiko

    2017-10-01

    Okaramines produced by Penicillium simplicissimum AK-40 activate l-glutamate-gated chloride channels (GluCls) and thus paralyze insects. However, the okaramine binding site on insect GluCls is poorly understood. Sequence alignment shows that the equivalent of residue Leucine319 of the okaramine B sensitive Bombyx mori (B. mori) GluCl is a phenylalanine in the okaramine B insensitive B. mori γ-aminobutyric acid-gated chloride channel of the same species. This residue is located in the third transmembrane (TM3) region, a location which in a nematode GluCl is close to the ivermectin binding site. The B. mori GluCl containing the L319F mutation retained its sensitivity to l-glutamate, but responses to ivermectin were reduced and those to okaramine B were completely blocked.

  5. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  6. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  7. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

    Science.gov (United States)

    Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

    2012-06-06

    Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  8. Double-disc gate valve

    International Nuclear Information System (INIS)

    Wheatley, S.J.

    1979-01-01

    The invention relates to an improvement in a conventional double-disc gate valve having a vertically movable gate assembly including a wedge, spreaders slidably engaged therewith, a valve disc carried by the spreaders. When the gate assembly is lowered to a selected point in the valve casing, the valve discs are moved transversely outward to close inlet and outlet ports in the casing. The valve includes hold-down means for guiding the disc-and-spreader assemblies as they are moved transversely outward and inward. If such valves are operated at relatively high differential pressures, they sometimes jam during opening. Such jamming has been a problem for many years in gate valves used in gaseous diffusion plants for the separation of uranium isotopes. The invention is based on the finding that the above-mentioned jamming results when the outlet disc tilts about its horizontal axis in a certain way during opening of the valve. In accordance with the invention, tilting of the outlet disc is maintained at a tolerable value by providing the disc with a rigid downwardly extending member and by providing the casing with a stop for limiting inward arcuate movement of the member to a preselected value during opening of the valve

  9. Linear gate with prescaled window

    Energy Technology Data Exchange (ETDEWEB)

    Koch, J; Bissem, H H; Krause, H; Scobel, W [Hamburg Univ. (Germany, F.R.). 1. Inst. fuer Experimentalphysik

    1978-07-15

    An electronic circuit is described that combines the features of a linear gate, a single channel analyzer and a prescaler. It allows selection of a pulse height region between two adjustable thresholds and scales the intensity of the spectrum within this window down by a factor 2sup(N) (0<=N<=9), whereas the complementary part of the spectrum is transmitted without being affected.

  10. Self-gated fat-suppressed cardiac cine MRI.

    Science.gov (United States)

    Ingle, R Reeve; Santos, Juan M; Overall, William R; McConnell, Michael V; Hu, Bob S; Nishimura, Dwight G

    2015-05-01

    To develop a self-gated alternating repetition time balanced steady-state free precession (ATR-SSFP) pulse sequence for fat-suppressed cardiac cine imaging. Cardiac gating is computed retrospectively using acquired magnetic resonance self-gating data, enabling cine imaging without the need for electrocardiogram (ECG) gating. Modification of the slice-select rephasing gradients of an ATR-SSFP sequence enables the acquisition of a one-dimensional self-gating readout during the unused short repetition time (TR). Self-gating readouts are acquired during every TR of segmented, breath-held cardiac scans. A template-matching algorithm is designed to compute cardiac trigger points from the self-gating signals, and these trigger points are used for retrospective cine reconstruction. The proposed approach is compared with ECG-gated ATR-SSFP and balanced steady-state free precession in 10 volunteers and five patients. The difference of ECG and self-gating trigger times has a variability of 13 ± 11 ms (mean ± SD). Qualitative reviewer scoring and ranking indicate no statistically significant differences (P > 0.05) between self-gated and ECG-gated ATR-SSFP images. Quantitative blood-myocardial border sharpness is not significantly different among self-gated ATR-SSFP ( 0.61±0.15 mm -1), ECG-gated ATR-SSFP ( 0.61±0.15 mm -1), or conventional ECG-gated balanced steady-state free precession cine MRI ( 0.59±0.15 mm -1). The proposed self-gated ATR-SSFP sequence enables fat-suppressed cardiac cine imaging at 1.5 T without the need for ECG gating and without decreasing the imaging efficiency of ATR-SSFP. © 2014 Wiley Periodicals, Inc.

  11. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    Science.gov (United States)

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Quantum gate decomposition algorithms.

    Energy Technology Data Exchange (ETDEWEB)

    Slepoy, Alexander

    2006-07-01

    Quantum computing algorithms can be conveniently expressed in a format of a quantum logical circuits. Such circuits consist of sequential coupled operations, termed ''quantum gates'', or quantum analogs of bits called qubits. We review a recently proposed method [1] for constructing general ''quantum gates'' operating on an qubits, as composed of a sequence of generic elementary ''gates''.

  13. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  14. Dextromethorphan inhibition of voltage-gated proton currents in BV2 microglial cells.

    Science.gov (United States)

    Song, Jin-Ho; Yeh, Jay Z

    2012-05-10

    Dextromethorphan, an antitussive drug, has a neuroprotective property as evidenced by its inhibition of microglial production of pro-inflammatory cytokines and reactive oxygen species. The microglial activation requires NADPH oxidase activity, which is sustained by voltage-gated proton channels in microglia as they dissipate an intracellular acid buildup. In the present study, we examined the effect of dextromethorphan on proton currents in microglial BV2 cells. Dextromethorphan reversibly inhibited proton currents with an IC(50) value of 51.7 μM at an intracellular/extracellular pH gradient of 5.5/7.3. Dextromethorphan did not change the reversal potential or the voltage dependence of the gating. Dextrorphan and 3-hydroxymorphinan, major metabolites of dextromethorphan, and dextromethorphan methiodide were ineffective in inhibiting proton currents. The results indicate that dextromethorphan inhibition of proton currents would suppress NADPH oxidase activity and, eventually, microglial activation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  15. Molecular mechanism of voltage sensing in voltage-gated proton channels

    Science.gov (United States)

    Rebolledo, Santiago; Perez, Marta E.

    2013-01-01

    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  16. Signatures of Mechanosensitive Gating.

    Science.gov (United States)

    Morris, Richard G

    2017-01-10

    The question of how mechanically gated membrane channels open and close is notoriously difficult to address, especially if the protein structure is not available. This perspective highlights the relevance of micropipette-aspirated single-particle tracking-used to obtain a channel's diffusion coefficient, D, as a function of applied membrane tension, σ-as an indirect assay for determining functional behavior in mechanosensitive channels. While ensuring that the protein remains integral to the membrane, such methods can be used to identify not only the gating mechanism of a protein, but also associated physical moduli, such as torsional and dilational rigidity, which correspond to the protein's effective shape change. As an example, three distinct D-versus-σ "signatures" are calculated, corresponding to gating by dilation, gating by tilt, and gating by a combination of both dilation and tilt. Both advantages and disadvantages of the approach are discussed. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. A chemosensor showing discriminating fluorescent response for highly selective and nanomolar detection of Cu²⁺ and Zn²⁺ and its application in molecular logic gate.

    Science.gov (United States)

    Fegade, Umesh A; Sahoo, Suban K; Singh, Amanpreet; Singh, Narinder; Attarde, Sanjay B; Kuwar, Anil S

    2015-05-04

    A fluorescent based receptor (4Z)-4-(4-diethylamino)-2-hydroxybenzylidene amino)-1,2dihydro-1,5-dimethyl-2-phenylpyrazol-3-one (receptor 3) was developed for the highly selective and sensitive detection of Cu(2+) and Zn(2+) in semi-aqueous system. The fluorescence of receptor 3 was enhanced and quenched, respectively, with the addition of Zn(2+) and Cu(2+) ions over other surveyed cations. The receptor formed host-guest complexes in 1:1 stoichiometry with the detection limit of 5 nM and 15 nM for Cu(2+) and Zn(2+) ions, respectively. Further, we have effectively utilized the two metal ions (Cu(2+) and Zn(2+)) as chemical inputs for the manufacture of INHIBIT type logic gate at molecular level using the fluorescence responses of receptor 3 at 450 nm. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Species selective resistance of cardiac muscle voltage gated sodium channels: characterization of brevetoxin and ciguatoxin binding sites in rats and fish.

    Science.gov (United States)

    Dechraoui, Marie-Yasmine Bottein; Wacksman, Jeremy J; Ramsdell, John S

    2006-11-01

    Brevetoxins (PbTxs) and ciguatoxins (CTXs) are two suites of dinoflagellate derived marine polyether neurotoxins that target the voltage gated sodium channel (VGSC). PbTxs are commonly responsible for massive fish kills and unusual mortalities in marine mammals. CTXs, more often noted for human intoxication, are suspected causes of fish and marine mammal intoxication, although this has never been reported in the field. VGSCs, present in the membrane of all excitable cells including those found in skeletal muscle, nervous and heart tissues, are found as isoforms with differential expression within species and tissues. To investigate the tissue and species susceptibility to these biotoxins, we determined the relative affinity of PbTx-2 and -3 and P-CTX-1 to native VGSCs in the brain, heart, and skeletal muscle of rat and the marine teleost fish Centropristis striata by competitive binding in the presence of [(3)H]PbTx-3. No differences between rat and fish were observed in the binding of PbTxs and CTX to either brain or skeletal muscle. However, [(3)H]PbTx-3 showed substantial lower affinity to rat heart tissue while in the fish it bound with the same affinity to heart than to brain or skeletal muscle. These new insights into PbTxs and CTXs binding in fish and mammalian excitable tissues indicate a species related resistance of heart VGSC in the rat; yet, with comparable sensitivity between the species for brain and skeletal muscle.

  19. Optical XOR gate

    Science.gov (United States)

    Vawter, G. Allen

    2013-11-12

    An optical XOR gate is formed as a photonic integrated circuit (PIC) from two sets of optical waveguide devices on a substrate, with each set of the optical waveguide devices including an electroabsorption modulator electrically connected in series with a waveguide photodetector. The optical XOR gate utilizes two digital optical inputs to generate an XOR function digital optical output. The optical XOR gate can be formed from III-V compound semiconductor layers which are epitaxially deposited on a III-V compound semiconductor substrate, and operates at a wavelength in the range of 0.8-2.0 .mu.m.

  20. VKCDB: Voltage-gated potassium channel database

    Directory of Open Access Journals (Sweden)

    Gallin Warren J

    2004-01-01

    Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.

  1. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  2. Gate-Tunable Spin Exchange Interactions and Inversion of Magnetoresistance in Single Ferromagnetic ZnO Nanowires.

    Science.gov (United States)

    Modepalli, Vijayakumar; Jin, Mi-Jin; Park, Jungmin; Jo, Junhyeon; Kim, Ji-Hyun; Baik, Jeong Min; Seo, Changwon; Kim, Jeongyong; Yoo, Jung-Woo

    2016-04-26

    Electrical control of ferromagnetism in semiconductor nanostructures offers the promise of nonvolatile functionality in future semiconductor spintronics. Here, we demonstrate a dramatic gate-induced change of ferromagnetism in ZnO nanowire (NW) field-effect transistors (FETs). Ferromagnetism in our ZnO NWs arose from oxygen vacancies, which constitute deep levels hosting unpaired electron spins. The magnetic transition temperature of the studied ZnO NWs was estimated to be well above room temperature. The in situ UV confocal photoluminescence (PL) study confirmed oxygen vacancy mediated ferromagnetism in the studied ZnO NW FET devices. Both the estimated carrier concentration and temperature-dependent conductivity reveal the studied ZnO NWs are at the crossover of the metal-insulator transition. In particular, gate-induced modulation of the carrier concentration in the ZnO NW FET significantly alters carrier-mediated exchange interactions, which causes even inversion of magnetoresistance (MR) from negative to positive values. Upon sweeping the gate bias from -40 to +50 V, the MRs estimated at 2 K and 2 T were changed from -11.3% to +4.1%. Detailed analysis on the gate-dependent MR behavior clearly showed enhanced spin splitting energy with increasing carrier concentration. Gate-voltage-dependent PL spectra of an individual NW device confirmed the localization of oxygen vacancy-induced spins, indicating that gate-tunable indirect exchange coupling between localized magnetic moments played an important role in the remarkable change of the MR.

  3. Characteristics of dual-gate thin-film transistors for applications in digital radiology

    International Nuclear Information System (INIS)

    Waechter, D.; Huang, Z.; Zhao, W.; Blevis, I.; Rowlands, J.A.

    1996-01-01

    A large-area flat-panel detector for digital radiology is being developed. The detector uses an array of dual-gate thin-film transistors (TFTs) to read out X-ray-generated charge produced in an amorphous selenium (a-Se) layer. The TFTs use CdSe as the semiconductor and use the bottom gate for row selection. The top gate can be divided into a 'deliberate' gate, covering most of the channel length, and small 'parasitic' gates that consist of: overlap of source or drain metal over the top-gate oxide; and gap regions in the metal that are covered only by the a-Se. In this paper we present the properties of dual-gate TFTs and examine the effect of both the deliberate and parasitic gates on the detector operation. Various options for controlling the top-gate potential are analyzed and discussed. (author)

  4. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  5. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  6. SU-E-T-350: Verification of Gating Performance of a New Elekta Gating Solution: Response Kit and Catalyst System

    Energy Technology Data Exchange (ETDEWEB)

    Xie, X; Cao, D; Housley, D; Mehta, V; Shepard, D [Swedish Cancer Institute, Seattle, WA (United States)

    2014-06-01

    Purpose: In this work, we have tested the performance of new respiratory gating solutions for Elekta linacs. These solutions include the Response gating and the C-RAD Catalyst surface mapping system.Verification measurements have been performed for a series of clinical cases. We also examined the beam on latency of the system and its impact on delivery efficiency. Methods: To verify the benefits of tighter gating windows, a Quasar Respiratory Motion Platform was used. Its vertical-motion plate acted as a respiration surrogate and was tracked by the Catalyst system to generate gating signals. A MatriXX ion-chamber array was mounted on its longitudinal-moving platform. Clinical plans are delivered to a stationary and moving Matrix array at 100%, 50% and 30% gating windows and gamma scores were calculated comparing moving delivery results to the stationary result. It is important to note that as one moves to tighter gating windows, the delivery efficiency will be impacted by the linac's beam-on latency. Using a specialized software package, we generated beam-on signals of lengths of 1000ms, 600ms, 450ms, 400ms, 350ms and 300ms. As the gating windows get tighter, one can expect to reach a point where the dose rate will fall to nearly zero, indicating that the gating window is close to beam-on latency. A clinically useful gating window needs to be significantly longer than the latency for the linac. Results: As expected, the use of tighter gating windows improved delivery accuracy. However, a lower limit of the gating window, largely defined by linac beam-on latency, exists at around 300ms. Conclusion: The Response gating kit, combined with the C-RAD Catalyst, provides an effective solution for respiratorygated treatment delivery. Careful patient selection, gating window design, even visual/audio coaching may be necessary to ensure both delivery quality and efficiency. This research project is funded by Elekta.

  7. Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.

    Science.gov (United States)

    Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L

    2016-02-25

    Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

    Science.gov (United States)

    Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

    2018-01-01

    Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use

  9. Amplifying genetic logic gates.

    Science.gov (United States)

    Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

    2013-05-03

    Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

  10. Cardiac gated ventilation

    International Nuclear Information System (INIS)

    Hanson, C.W. III; Hoffman, E.A.

    1995-01-01

    There are several theoretic advantages to synchronizing positive pressure breaths with the cardiac cycle, including the potential for improving distribution of pulmonary and myocardial blood flow and enhancing cardiac output. The authors evaluated the effects of synchronizing respiration to the cardiac cycle using a programmable ventilator and electron beam CT (EBCT) scanning. The hearts of anesthetized dogs were imaged during cardiac gated respiration with a 50 msec scan aperture. Multi slice, short axis, dynamic image data sets spanning the apex to base of the left ventricle were evaluated to determine the volume of the left ventricular chamber at end-diastole and end-systole during apnea, systolic and diastolic cardiac gating. The authors observed an increase in cardiac output of up to 30% with inspiration gated to the systolic phase of the cardiac cycle in a non-failing model of the heart

  11. Visualization of neonatal coronary arteries on multidetector row CT: ECG-gated versus non-ECG-gated technique

    International Nuclear Information System (INIS)

    Tsai, I.C.; Lee, Tain; Chen, Min-Chi; Fu, Yun-Ching; Jan, Sheng-Lin; Wang, Chung-Chi; Chang, Yen

    2007-01-01

    Multidetector CT (MDCT) seems to be a promising tool for detection of neonatal coronary arteries, but whether the ECG-gated or non-ECG-gated technique should be used has not been established. To compare the detection rate and image quality of neonatal coronary arteries on MDCT using ECG-gated and non-ECG-gated techniques. Twelve neonates with complex congenital heart disease were included. The CT scan was acquired using an ECG-gated technique, and the most quiescent phase of the RR interval was selected to represent the ECG-gated images. The raw data were then reconstructed without the ECG signal to obtain non-ECG-gated images. The detection rate and image quality of nine coronary artery segments in the two sets of images were then compared. A two-tailed paired t test was used with P values <0.05 considered as statistically significant. In all coronary segments the ECG-gated technique had a better detection rate and produced images of better quality. The difference between the two techniques ranged from 25% in the left main coronary artery to 100% in the distal right coronary artery. For neonates referred for MDCT, if evaluation of coronary artery anatomy is important for the clinical management or surgical planning, the ECG-gated technique should be used because it can reliably detect the coronary arteries. (orig.)

  12. Design of selective 8-methylquinolinol based ratiometric Fe{sup 2+} and Fe{sup 3+}/H{sub 2}PO{sub 4}{sup −} fluorescent chemosensor mimicking NOR and IMPLICATION logic gates

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Gurjaspreet, E-mail: gjpsingh@pu.ac.in; Singh, Jandeep; Singh, Jasbhinder; Mangat, Satinderpal Singh

    2015-09-15

    This report describes an on–off module of a fluorescent probe for selectively sensing of Fe(II) and Fe(III) ions by a single chemosensor with unique output optical response and is being reported for the first time. The probe 8-methylquinolinyl-1,2,3-triazolyl silatrane (QTS) was efficiently developed using click silylation route, followed by transetherification of silane. Moreover, the color change in probe QTS by response of this colorimetric sensor can be visualized by naked eye. The anti-quenching response for quenched QTS–Fe{sup 3+} fluorescence spectra by addition of H{sub 2}PO{sub 4}{sup −} ions in the MeOH/H{sub 2}O solvent system results into reversion of fluorescence maximum. These fluctuations in spectral response, under electronic behavior, can be viewed to mimic as NOR and IMPLICATION logic gate. - Highlights: • The probe 8-methylquinolinyl-1,2,3-triazolyl silatrane (QTS) was efficiently developed by using click silylation route. • The fluorescence emission response of sensor QTS towards Fe{sup 3+} ions show 'turn-on' mode, with red shift of 79 nm. • UV–vis spectra illustrate increase in absorption maxima on sensing of both ionic species.

  13. Voltage-sensing domain mode shift is coupled to the activation gate by the N-terminal tail of hERG channels.

    Science.gov (United States)

    Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P

    2012-09-01

    Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.

  14. Gate valve performance prediction

    International Nuclear Information System (INIS)

    Harrison, D.H.; Damerell, P.S.; Wang, J.K.; Kalsi, M.S.; Wolfe, K.J.

    1994-01-01

    The Electric Power Research Institute is carrying out a program to improve the performance prediction methods for motor-operated valves. As part of this program, an analytical method to predict the stem thrust required to stroke a gate valve has been developed and has been assessed against data from gate valve tests. The method accounts for the loads applied to the disc by fluid flow and for the detailed mechanical interaction of the stem, disc, guides, and seats. To support development of the method, two separate-effects test programs were carried out. One test program determined friction coefficients for contacts between gate valve parts by using material specimens in controlled environments. The other test program investigated the interaction of the stem, disc, guides, and seat using a special fixture with full-sized gate valve parts. The method has been assessed against flow-loop and in-plant test data. These tests include valve sizes from 3 to 18 in. and cover a considerable range of flow, temperature, and differential pressure. Stem thrust predictions for the method bound measured results. In some cases, the bounding predictions are substantially higher than the stem loads required for valve operation, as a result of the bounding nature of the friction coefficients in the method

  15. Stanford, Duke, Rice,... and Gates?

    Science.gov (United States)

    Carey, Kevin

    2009-01-01

    This article presents an open letter to Bill Gates. In his letter, the author suggests that Bill Gates should build a brand-new university, a great 21st-century institution of higher learning. This university will be unlike anything the world has ever seen. He asks Bill Gates not to stop helping existing colleges create the higher-education system…

  16. Cleaning Challenges of High-κ/Metal Gate Structures

    KAUST Repository

    Hussain, Muhammad Mustafa; Shamiryan, Denis G.; Paraschiv, Vasile; Sano, Kenichi; Reinhardt, Karen A.

    2010-01-01

    High-κ/metal gates are used as transistors for advanced logic applications to improve speed and eliminate electrical issues associated with polySi and SiO2 gates. Various integration schemes are possible and will be discussed, such as dual gate, gate-first, and gate-last, both of which require specialized cleaning and etching steps. Specific areas of discussion will include cleaning and conditioning of the silicon surface, forming a high-quality chemical oxide, removal of the high-κ dielectric with selectivity to the SiO2 layer, cleaning and residue removal after etching, and prevention of galvanic corrosion during cleaning. © 2011 Scrivener Publishing LLC. All rights reserved.

  17. Cleaning Challenges of High-κ/Metal Gate Structures

    KAUST Repository

    Hussain, Muhammad Mustafa

    2010-12-20

    High-κ/metal gates are used as transistors for advanced logic applications to improve speed and eliminate electrical issues associated with polySi and SiO2 gates. Various integration schemes are possible and will be discussed, such as dual gate, gate-first, and gate-last, both of which require specialized cleaning and etching steps. Specific areas of discussion will include cleaning and conditioning of the silicon surface, forming a high-quality chemical oxide, removal of the high-κ dielectric with selectivity to the SiO2 layer, cleaning and residue removal after etching, and prevention of galvanic corrosion during cleaning. © 2011 Scrivener Publishing LLC. All rights reserved.

  18. Hybrid Toffoli gate on photons and quantum spins.

    Science.gov (United States)

    Luo, Ming-Xing; Ma, Song-Ya; Chen, Xiu-Bo; Wang, Xiaojun

    2015-11-16

    Quantum computation offers potential advantages in solving a number of interesting and difficult problems. Several controlled logic gates, the elemental building blocks of quantum computer, have been realized with various physical systems. A general technique was recently proposed that significantly reduces the realization complexity of multiple-control logic gates by harnessing multi-level information carriers. We present implementations of a key quantum circuit: the three-qubit Toffoli gate. By exploring the optical selection rules of one-sided optical microcavities, a Toffoli gate may be realized on all combinations of photon and quantum spins in the QD-cavity. The three general controlled-NOT gates are involved using an auxiliary photon with two degrees of freedom. Our results show that photons and quantum spins may be used alternatively in quantum information processing.

  19. Double optical gating

    Science.gov (United States)

    Gilbertson, Steve

    The observation and control of dynamics in atomic and molecular targets requires the use of laser pulses with duration less than the characteristic timescale of the process which is to be manipulated. For electron dynamics, this time scale is on the order of attoseconds where 1 attosecond = 10 -18 seconds. In order to generate pulses on this time scale, different gating methods have been proposed. The idea is to extract or "gate" a single pulse from an attosecond pulse train and switch off all the other pulses. While previous methods have had some success, they are very difficult to implement and so far very few labs have access to these unique light sources. The purpose of this work is to introduce a new method, called double optical gating (DOG), and to demonstrate its effectiveness at generating high contrast single isolated attosecond pulses from multi-cycle lasers. First, the method is described in detail and is investigated in the spectral domain. The resulting attosecond pulses produced are then temporally characterized through attosecond streaking. A second method of gating, called generalized double optical gating (GDOG), is also introduced. This method allows attosecond pulse generation directly from a carrier-envelope phase un-stabilized laser system for the first time. Next the methods of DOG and GDOG are implemented in attosecond applications like high flux pulses and extreme broadband spectrum generation. Finally, the attosecond pulses themselves are used in experiments. First, an attosecond/femtosecond cross correlation is used for characterization of spatial and temporal properties of femtosecond pulses. Then, an attosecond pump, femtosecond probe experiment is conducted to observe and control electron dynamics in helium for the first time.

  20. Dysfunctional Hyperpolarization-Activated Cyclic Nucleotide-gated Ion Channels in Cardiac Diseases

    Directory of Open Access Journals (Sweden)

    Xiaoqi Zhao

    Full Text Available Abstract Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are reverse voltage-dependent, and their activation depends on the hyperpolarization of the membrane and may be directly or indirectly regulated by the cyclic adenosine monophosphate (cAMP or other signal-transduction cascades. The distribution, quantity and activation states of HCN channels differ in tissues throughout the body. Evidence exhibits that HCN channels play critical roles in the generation and conduction of the electrical impulse and the physiopathological process of some cardiac diseases. They may constitute promising drug targets in the treatment of these cardiac diseases. Pharmacological treatment targeting HCN channels is of benefit to these cardiac conditions.

  1. Gating system design for the space device case using T-Flex CAD

    Directory of Open Access Journals (Sweden)

    Ayusheev Munkhe-Zul

    2017-01-01

    Full Text Available The judicious selection of gating system for the consumable pattern takes a lot of time, labour and other significant resources. The modern design technologies provide quick and effective ways for gating system calculation and casting process simulation. Gating system modeling allows estimating different kinds of defects which can occur at the developing stage of casting process. Moreover, it is possible to modify the whole gating system configuration if some parameters are changed. Analyzing these data and modifying the gating system characteristics high quality of castings can be achieved.

  2. Noise Gating Solar Images

    Science.gov (United States)

    DeForest, Craig; Seaton, Daniel B.; Darnell, John A.

    2017-08-01

    I present and demonstrate a new, general purpose post-processing technique, "3D noise gating", that can reduce image noise by an order of magnitude or more without effective loss of spatial or temporal resolution in typical solar applications.Nearly all scientific images are, ultimately, limited by noise. Noise can be direct Poisson "shot noise" from photon counting effects, or introduced by other means such as detector read noise. Noise is typically represented as a random variable (perhaps with location- or image-dependent characteristics) that is sampled once per pixel or once per resolution element of an image sequence. Noise limits many aspects of image analysis, including photometry, spatiotemporal resolution, feature identification, morphology extraction, and background modeling and separation.Identifying and separating noise from image signal is difficult. The common practice of blurring in space and/or time works because most image "signal" is concentrated in the low Fourier components of an image, while noise is evenly distributed. Blurring in space and/or time attenuates the high spatial and temporal frequencies, reducing noise at the expense of also attenuating image detail. Noise-gating exploits the same property -- "coherence" -- that we use to identify features in images, to separate image features from noise.Processing image sequences through 3-D noise gating results in spectacular (more than 10x) improvements in signal-to-noise ratio, while not blurring bright, resolved features in either space or time. This improves most types of image analysis, including feature identification, time sequence extraction, absolute and relative photometry (including differential emission measure analysis), feature tracking, computer vision, correlation tracking, background modeling, cross-scale analysis, visual display/presentation, and image compression.I will introduce noise gating, describe the method, and show examples from several instruments (including SDO

  3. Expression and distribution of voltage-gated ion channels in ferret sinoatrial node.

    Science.gov (United States)

    Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C

    2010-10-01

    Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.

  4. Photocontrol of Voltage-Gated Ion Channel Activity by Azobenzene Trimethylammonium Bromide in Neonatal Rat Cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Sheyda R Frolova

    Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.

  5. A quantum Fredkin gate

    Science.gov (United States)

    Patel, Raj B.; Ho, Joseph; Ferreyrol, Franck; Ralph, Timothy C.; Pryde, Geoff J.

    2016-01-01

    Minimizing the resources required to build logic gates into useful processing circuits is key to realizing quantum computers. Although the salient features of a quantum computer have been shown in proof-of-principle experiments, difficulties in scaling quantum systems have made more complex operations intractable. This is exemplified in the classical Fredkin (controlled-SWAP) gate for which, despite theoretical proposals, no quantum analog has been realized. By adding control to the SWAP unitary, we use photonic qubit logic to demonstrate the first quantum Fredkin gate, which promises many applications in quantum information and measurement. We implement example algorithms and generate the highest-fidelity three-photon Greenberger-Horne-Zeilinger states to date. The technique we use allows one to add a control operation to a black-box unitary, something that is impossible in the standard circuit model. Our experiment represents the first use of this technique to control a two-qubit operation and paves the way for larger controlled circuits to be realized efficiently. PMID:27051868

  6. A quantum Fredkin gate.

    Science.gov (United States)

    Patel, Raj B; Ho, Joseph; Ferreyrol, Franck; Ralph, Timothy C; Pryde, Geoff J

    2016-03-01

    Minimizing the resources required to build logic gates into useful processing circuits is key to realizing quantum computers. Although the salient features of a quantum computer have been shown in proof-of-principle experiments, difficulties in scaling quantum systems have made more complex operations intractable. This is exemplified in the classical Fredkin (controlled-SWAP) gate for which, despite theoretical proposals, no quantum analog has been realized. By adding control to the SWAP unitary, we use photonic qubit logic to demonstrate the first quantum Fredkin gate, which promises many applications in quantum information and measurement. We implement example algorithms and generate the highest-fidelity three-photon Greenberger-Horne-Zeilinger states to date. The technique we use allows one to add a control operation to a black-box unitary, something that is impossible in the standard circuit model. Our experiment represents the first use of this technique to control a two-qubit operation and paves the way for larger controlled circuits to be realized efficiently.

  7. MO-FG-CAMPUS-JeP2-01: 4D-MRI with 3D Radial Sampling and Self-Gating-Based K-Space Sorting: Image Quality Improvement by Slab-Selective Excitation

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Z; Pang, J; Tuli, R; Fraass, B; Fan, Z [Cedars Sinai Medical Center, Los Angeles, CA (United States); Yang, W [Cedars-Sinai Medical Center, Los Angeles, CA (United States); Bi, X [Siemens Healthcare, Los Angeles, CA (United States); Hakimian, B [Cedars Sinai Medical Center, Los Angeles CA (United States); Li, D [Cedars Sinai Medical Center, Los Angeles, California (United States)

    2016-06-15

    Purpose: A recent 4D MRI technique based on 3D radial sampling and self-gating-based K-space sorting has shown promising results in characterizing respiratory motion. However due to continuous acquisition and potentially drastic k-space undersampling resultant images could suffer from low blood-to-tissue contrast and streaking artifacts. In this study 3D radial sampling with slab-selective excitation (SS) was proposed in attempt to enhance blood-to-tissue contrast by exploiting the in-flow effect and to suppress the excess signal from the peripheral structures particularly in the superior-inferior direction. The feasibility of improving image quality by using this approach was investigated through a comparison with the previously developed non-selective excitation (NS) approach. Methods: Two excitation approaches SS and NS were compared in 5 cancer patients (1 lung 1 liver 2 pancreas and 1 esophagus) at 3Tesla. Image artifact was assessed in all patients on a 4-point scale (0: poor; 3: excellent). Signal-tonoise ratio (SNR) of the blood vessel (aorta) at the center of field-of-view and its nearby tissue were measured in 3 of the 5 patients (1 liver 2 pancreas) and blood-to-tissue contrast-to-noise ratio (CNR) were then determined. Results: Compared with NS the image quality of SS was visually improved with overall higher signal in all patients (2.6±0.55 vs. 3.4±0.55). SS showed an approximately 2-fold increase of SNR in the blood (aorta: 16.39±1.95 vs. 32.19±7.93) and slight increase in the surrounding tissue (liver/pancreas: 16.91±1.82 vs. 22.31±3.03). As a result the blood-totissue CNR was dramatically higher in the SS method (1.20±1.20 vs. 9.87±6.67). Conclusion: The proposed 3D radial sampling with slabselective excitation allows for reduced image artifact and improved blood SNR and blood-to-tissue CNR. The success of this technique could potentially benefit patients with cancerous tumors that have invaded the surrounding blood vessels where radiation

  8. MO-FG-CAMPUS-JeP2-01: 4D-MRI with 3D Radial Sampling and Self-Gating-Based K-Space Sorting: Image Quality Improvement by Slab-Selective Excitation

    International Nuclear Information System (INIS)

    Deng, Z; Pang, J; Tuli, R; Fraass, B; Fan, Z; Yang, W; Bi, X; Hakimian, B; Li, D

    2016-01-01

    Purpose: A recent 4D MRI technique based on 3D radial sampling and self-gating-based K-space sorting has shown promising results in characterizing respiratory motion. However due to continuous acquisition and potentially drastic k-space undersampling resultant images could suffer from low blood-to-tissue contrast and streaking artifacts. In this study 3D radial sampling with slab-selective excitation (SS) was proposed in attempt to enhance blood-to-tissue contrast by exploiting the in-flow effect and to suppress the excess signal from the peripheral structures particularly in the superior-inferior direction. The feasibility of improving image quality by using this approach was investigated through a comparison with the previously developed non-selective excitation (NS) approach. Methods: Two excitation approaches SS and NS were compared in 5 cancer patients (1 lung 1 liver 2 pancreas and 1 esophagus) at 3Tesla. Image artifact was assessed in all patients on a 4-point scale (0: poor; 3: excellent). Signal-tonoise ratio (SNR) of the blood vessel (aorta) at the center of field-of-view and its nearby tissue were measured in 3 of the 5 patients (1 liver 2 pancreas) and blood-to-tissue contrast-to-noise ratio (CNR) were then determined. Results: Compared with NS the image quality of SS was visually improved with overall higher signal in all patients (2.6±0.55 vs. 3.4±0.55). SS showed an approximately 2-fold increase of SNR in the blood (aorta: 16.39±1.95 vs. 32.19±7.93) and slight increase in the surrounding tissue (liver/pancreas: 16.91±1.82 vs. 22.31±3.03). As a result the blood-totissue CNR was dramatically higher in the SS method (1.20±1.20 vs. 9.87±6.67). Conclusion: The proposed 3D radial sampling with slabselective excitation allows for reduced image artifact and improved blood SNR and blood-to-tissue CNR. The success of this technique could potentially benefit patients with cancerous tumors that have invaded the surrounding blood vessels where radiation

  9. Multiple Independent Gate FETs: How Many Gates Do We Need?

    OpenAIRE

    Amarù, Luca; Hills, Gage; Gaillardon, Pierre-Emmanuel; Mitra, Subhasish; De Micheli, Giovanni

    2015-01-01

    Multiple Independent Gate Field Effect Transistors (MIGFETs) are expected to push FET technology further into the semiconductor roadmap. In a MIGFET, supplementary gates either provide (i) enhanced conduction properties or (ii) more intelligent switching functions. In general, each additional gate also introduces a side implementation cost. To enable more efficient digital systems, MIGFETs must leverage their expressive power to realize complex logic circuits with few physical resources. Rese...

  10. 100-nm gate lithography for double-gate transistors

    Science.gov (United States)

    Krasnoperova, Azalia A.; Zhang, Ying; Babich, Inna V.; Treichler, John; Yoon, Jung H.; Guarini, Kathryn; Solomon, Paul M.

    2001-09-01

    The double gate field effect transistor (FET) is an exploratory device that promises certain performance advantages compared to traditional CMOS FETs. It can be scaled down further than the traditional devices because of the greater electrostatic control by the gates on the channel (about twice as short a channel length for the same gate oxide thickness), has steeper sub-threshold slope and about double the current for the same width. This paper presents lithographic results for double gate FET's developed at IBM's T. J. Watson Research Center. The device is built on bonded wafers with top and bottom gates self-aligned to each other. The channel is sandwiched between the top and bottom polysilicon gates and the gate length is defined using DUV lithography. An alternating phase shift mask was used to pattern gates with critical dimensions of 75 nm, 100 nm and 125 nm in photoresist. 50 nm gates in photoresist have also been patterned by 20% over-exposure of nominal 100 nm lines. No trim mask was needed because of a specific way the device was laid out. UV110 photoresist from Shipley on AR-3 antireflective layer were used. Process windows, developed and etched patterns are presented.

  11. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  12. Expert Oracle GoldenGate

    CERN Document Server

    Prusinski, Ben; Chung, Richard

    2011-01-01

    Expert Oracle GoldenGate is a hands-on guide to creating and managing complex data replication environments using the latest in database replication technology from Oracle. GoldenGate is the future in replication technology from Oracle, and aims to be best-of-breed. GoldenGate supports homogeneous replication between Oracle databases. It supports heterogeneous replication involving other brands such as Microsoft SQL Server and IBM DB2 Universal Server. GoldenGate is high-speed, bidirectional, highly-parallelized, and makes only a light impact on the performance of databases involved in replica

  13. Decision Support Model for Optimal Management of Coastal Gate

    Science.gov (United States)

    Ditthakit, Pakorn; Chittaladakorn, Suwatana

    2010-05-01

    The coastal areas are intensely settled by human beings owing to their fertility of natural resources. However, at present those areas are facing with water scarcity problems: inadequate water and poor water quality as a result of saltwater intrusion and inappropriate land-use management. To solve these problems, several measures have been exploited. The coastal gate construction is a structural measure widely performed in several countries. This manner requires the plan for suitably operating coastal gates. Coastal gate operation is a complicated task and usually concerns with the management of multiple purposes, which are generally conflicted one another. This paper delineates the methodology and used theories for developing decision support modeling for coastal gate operation scheduling. The developed model was based on coupling simulation and optimization model. The weighting optimization technique based on Differential Evolution (DE) was selected herein for solving multiple objective problems. The hydrodynamic and water quality models were repeatedly invoked during searching the optimal gate operations. In addition, two forecasting models:- Auto Regressive model (AR model) and Harmonic Analysis model (HA model) were applied for forecasting water levels and tide levels, respectively. To demonstrate the applicability of the developed model, it was applied to plan the operations for hypothetical system of Pak Phanang coastal gate system, located in Nakhon Si Thammarat province, southern part of Thailand. It was found that the proposed model could satisfyingly assist decision-makers for operating coastal gates under various environmental, ecological and hydraulic conditions.

  14. Bubble gate for in-plane flow control.

    Science.gov (United States)

    Oskooei, Ali; Abolhasani, Milad; Günther, Axel

    2013-07-07

    We introduce a miniature gate valve as a readily implementable strategy for actively controlling the flow of liquids on-chip, within a footprint of less than one square millimetre. Bubble gates provide for simple, consistent and scalable control of liquid flow in microchannel networks, are compatible with different bulk microfabrication processes and substrate materials, and require neither electrodes nor moving parts. A bubble gate consists of two microchannel sections: a liquid-filled channel and a gas channel that intercepts the liquid channel to form a T-junction. The open or closed state of a bubble gate is determined by selecting between two distinct gas pressure levels: the lower level corresponds to the "open" state while the higher level corresponds to the "closed" state. During closure, a gas bubble penetrates from the gas channel into the liquid, flanked by a column of equidistantly spaced micropillars on each side, until the flow of liquid is completely obstructed. We fabricated bubble gates using single-layer soft lithographic and bulk silicon micromachining procedures and evaluated their performance with a combination of theory and experimentation. We assessed the dynamic behaviour during more than 300 open-and-close cycles and report the operating pressure envelope for different bubble gate configurations and for the working fluids: de-ionized water, ethanol and a biological buffer. We obtained excellent agreement between the experimentally determined bubble gate operational envelope and a theoretical prediction based on static wetting behaviour. We report case studies that serve to illustrate the utility of bubble gates for liquid sampling in single and multi-layer microfluidic devices. Scalability of our strategy was demonstrated by simultaneously addressing 128 bubble gates.

  15. Four-frame gated optical imager with 120-ps resolution

    International Nuclear Information System (INIS)

    Young, P.E.; Hares, J.D.; Kilkenny, J.D.; Phillion, D.W.; Campbell, E.M.

    1988-04-01

    In this paper we describe the operation and applications of a framing camera capable of four separate two-dimensional images with each frame having a 120-ps gate width. Fast gating of a single frame is accomplished by using a wafer image intensifier tube in which the cathode is capacitively coupled to an external electrode placed outside of the photocathode of the tube. This electrode is then pulsed relative to the microchannel plate by a narrow (120 ps), high-voltage pulse. Multiple frames are obtained by using multiple gated tubes which share a single bias supply and pulser with relative gate times selected by the cable lengths between the tubes and the pulser. A beamsplitter system has been constructed which produces a separate image for each tube from a single scene. Applications of the framing camera to inertial confinement fusion experiments are discussed

  16. Penn State DOE GATE Program

    Energy Technology Data Exchange (ETDEWEB)

    Anstrom, Joel

    2012-08-31

    The Graduate Automotive Technology Education (GATE) Program at The Pennsylvania State University (Penn State) was established in October 1998 pursuant to an award from the U.S. Department of Energy (U.S. DOE). The focus area of the Penn State GATE Program is advanced energy storage systems for electric and hybrid vehicles.

  17. Piezoconductivity of gated suspended graphene

    NARCIS (Netherlands)

    Medvedyeva, M.V.; Blanter, Y.M.

    2011-01-01

    We investigate the conductivity of graphene sheet deformed over a gate. The effect of the deformation on the conductivity is twofold: The lattice distortion can be represented as pseudovector potential in the Dirac equation formalism, whereas the gate causes inhomogeneous density redistribution. We

  18. GATE: Improving the computational efficiency

    International Nuclear Information System (INIS)

    Staelens, S.; De Beenhouwer, J.; Kruecker, D.; Maigne, L.; Rannou, F.; Ferrer, L.; D'Asseler, Y.; Buvat, I.; Lemahieu, I.

    2006-01-01

    GATE is a software dedicated to Monte Carlo simulations in Single Photon Emission Computed Tomography (SPECT) and Positron Emission Tomography (PET). An important disadvantage of those simulations is the fundamental burden of computation time. This manuscript describes three different techniques in order to improve the efficiency of those simulations. Firstly, the implementation of variance reduction techniques (VRTs), more specifically the incorporation of geometrical importance sampling, is discussed. After this, the newly designed cluster version of the GATE software is described. The experiments have shown that GATE simulations scale very well on a cluster of homogeneous computers. Finally, an elaboration on the deployment of GATE on the Enabling Grids for E-Science in Europe (EGEE) grid will conclude the description of efficiency enhancement efforts. The three aforementioned methods improve the efficiency of GATE to a large extent and make realistic patient-specific overnight Monte Carlo simulations achievable

  19. Impact of window size of extracranial stereotactic treatments Gating with respiratory synchronization; Analisis de las correcciones interfraccion en el posicionamiento de los pacientes mediante IGRT

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez Rubio, P.; Castro Tejero, P.; Medrano Prado, J. C.

    2011-07-01

    The choice of the gating window is to find a compromise between the duration of the treatment session and the accuracy and precision in the administration. This paper analyzes the dosimetric impact depending on the selected gating window.

  20. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Gated equilibrium bloodpool scintigraphy

    International Nuclear Information System (INIS)

    Reinders Folmer, S.C.C.

    1981-01-01

    This thesis deals with the clinical applications of gated equilibrium bloodpool scintigraphy, performed with either a gamma camera or a portable detector system, the nuclear stethoscope. The main goal has been to define the value and limitations of noninvasive measurements of left ventricular ejection fraction as a parameter of cardiac performance in various disease states, both for diagnostic purposes as well as during follow-up after medical or surgical intervention. Secondly, it was attempted to extend the use of the equilibrium bloodpool techniques beyond the calculation of ejection fraction alone by considering the feasibility to determine ventricular volumes and by including the possibility of quantifying valvular regurgitation. In both cases, it has been tried to broaden the perspective of the observations by comparing them with results of other, invasive and non-invasive, procedures, in particular cardiac catheterization, M-mode echocardiography and myocardial perfusion scintigraphy. (Auth.)

  2. Crystalline silicotitanate gate review analysis

    International Nuclear Information System (INIS)

    Schlahta, S.N.; Carreon, R.; Gentilucci, J.A.

    1997-11-01

    Crystalline silicotitanate (CST) is an ion-exchange method for removing radioactive cesium from tank waste to allow the separation of the waste into high- and low-level fractions. The CST, originally developed Sandia National Laboratories personnel in association with Union Oil Products Corporation, has both a high affinity and selectivity for sorbing cesium-137 from highly alkaline or acidic solutions. For several years now, the U.S. Department of Energy has funded work to investigate applying CST to large-scale removal of cesium-137 from radioactive tank wastes. In January 1997, an expert panel sponsored by the Tanks Focus Area met to review the current state of the technology and to determine whether it was ready for routine use. The review also sought to identify any technical issues that must be resolved or additional CST development that must occur before full implementation by end-users. The CST Gate Review Group concluded that sufficient work has been done to close developmental work on CST and turn the remaining site-specific tasks over to the users. This report documents the review group''s findings, issues, concerns, and recommendations as well as responses from the Tanks Focus Area expert staff to specific pretreatment and immobilization issues

  3. Photon-gated spin transistor

    OpenAIRE

    Li, Fan; Song, Cheng; Cui, Bin; Peng, Jingjing; Gu, Youdi; Wang, Guangyue; Pan, Feng

    2017-01-01

    Spin-polarized field-effect transistor (spin-FET), where a dielectric layer is generally employed for the electrical gating as the traditional FET, stands out as a seminal spintronic device under the miniaturization trend of electronics. It would be fundamentally transformative if optical gating was used for spin-FET. We report a new type of spin-polarized field-effect transistor (spin-FET) with optical gating, which is fabricated by partial exposure of the (La,Sr)MnO3 channel to light-emitti...

  4. Rapidly reconfigurable all-optical universal logic gate

    Science.gov (United States)

    Goddard, Lynford L.; Bond, Tiziana C.; Kallman, Jeffrey S.

    2010-09-07

    A new reconfigurable cascadable all-optical on-chip device is presented. The gate operates by combining the Vernier effect with a novel effect, the gain-index lever, to help shift the dominant lasing mode from a mode where the laser light is output at one facet to a mode where it is output at the other facet. Since the laser remains above threshold, the speed of the gate for logic operations as well as for reprogramming the function of the gate is primarily limited to the small signal optical modulation speed of the laser, which can be on the order of up to about tens of GHz. The gate can be rapidly and repeatedly reprogrammed to perform any of the basic digital logic operations by using an appropriate analog optical or electrical signal at the gate selection port. Other all-optical functionality includes wavelength conversion, signal duplication, threshold switching, analog to digital conversion, digital to analog conversion, signal routing, and environment sensing. Since each gate can perform different operations, the functionality of such a cascaded circuit grows exponentially.

  5. Isotropic gates and large gamma detector arrays versus angular distributions

    International Nuclear Information System (INIS)

    Iacob, V.E.; Duchene, G.

    1997-01-01

    Angular information extracted from in-beam γ ray measurements are of great importance for γ ray multipolarity and nuclear spin assignments. In our days large Ge detector arrays became available allowing the measurements of extremely weak γ rays in almost 4π sr solid angle (e.g., EUROGAM detector array). Given the high detector efficiency it is common for the mean suppressed coincidence multiplicity to reach values as high as 4 to 6. Thus, it is possible to gate on particular γ rays in order to enhance the relative statistics of a definite reaction channel and/or a definite decaying path in the level scheme of the selected residual nucleus. As compared to angular correlations, the conditioned angular distribution spectra exhibit larger statistics because in the latter the gate-setting γ ray may be observed by all the detectors in the array, relaxing somehow the geometrical restrictions of the angular correlations. Since the in-beam γ ray emission is anisotropic one could inquire that gate setting as mentioned above, based on anisotropic γ ray which would perturb the angular distributions in the unfolded events. As our work proved, there is no reason to worry about this if the energy gate runs over the whole solid angle in an ideal 4π sr detector, i.e., if the gate is isotropic. In real quasi 4π sr detector arrays the corresponding quasi isotropic gate preserves the angular properties of the unfolded data, too. However extraction of precise angular distribution coefficient especially a 4 , requires the consideration of the deviation of the quasi isotropic gate relative to the (ideal) isotropic gate

  6. Reversible logic gates on Physarum Polycephalum

    International Nuclear Information System (INIS)

    Schumann, Andrew

    2015-01-01

    In this paper, we consider possibilities how to implement asynchronous sequential logic gates and quantum-style reversible logic gates on Physarum polycephalum motions. We show that in asynchronous sequential logic gates we can erase information because of uncertainty in the direction of plasmodium propagation. Therefore quantum-style reversible logic gates are more preferable for designing logic circuits on Physarum polycephalum

  7. Demonstration of a Quantum Nondemolition Sum Gate

    DEFF Research Database (Denmark)

    Yoshikawa, J.; Miwa, Y.; Huck, Alexander

    2008-01-01

    The sum gate is the canonical two-mode gate for universal quantum computation based on continuous quantum variables. It represents the natural analogue to a qubit C-NOT gate. In addition, the continuous-variable gate describes a quantum nondemolition (QND) interaction between the quadrature...

  8. Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide.

    Science.gov (United States)

    Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício

    2015-02-01

    This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Deep Gate Recurrent Neural Network

    Science.gov (United States)

    2016-11-22

    and Fred Cummins. Learning to forget: Continual prediction with lstm . Neural computation, 12(10):2451–2471, 2000. Alex Graves. Generating sequences...DSGU) and Simple Gated Unit (SGU), which are structures for learning long-term dependencies. Compared to traditional Long Short-Term Memory ( LSTM ) and...Gated Recurrent Unit (GRU), both structures require fewer parameters and less computation time in sequence classification tasks. Unlike GRU and LSTM

  10. Bill Gates vil redde Folkeskolen

    DEFF Research Database (Denmark)

    Fejerskov, Adam Moe

    2014-01-01

    Det amerikanske uddannelsessystem bliver for tiden udsat for hård kritik, ledt an af Microsoft stifteren Bill Gates. Gates har indtil videre brugt 3 mia. kroner på at skabe opbakning til tiltag som præstationslønning af lærere og strømlining af pensum på tværs af alle skoler i landet...

  11. Latest design of gate valves

    Energy Technology Data Exchange (ETDEWEB)

    Kurzhofer, U.; Stolte, J.; Weyand, M.

    1996-12-01

    Babcock Sempell, one of the most important valve manufacturers in Europe, has delivered valves for the nuclear power industry since the beginning of the peaceful application of nuclear power in the 1960s. The latest innovation by Babcock Sempell is a gate valve that meets all recent technical requirements of the nuclear power technology. At the moment in the United States, Germany, Sweden, and many other countries, motor-operated gate and globe valves are judged very critically. Besides the absolute control of the so-called {open_quotes}trip failure,{close_quotes} the integrity of all valve parts submitted to operational forces must be maintained. In case of failure of the limit and torque switches, all valve designs have been tested with respect to the quality of guidance of the gate. The guidances (i.e., guides) shall avoid a tilting of the gate during the closing procedure. The gate valve newly designed by Babcock Sempell fulfills all these characteristic criteria. In addition, the valve has cobalt-free seat hardfacing, the suitability of which has been proven by friction tests as well as full-scale blowdown tests at the GAP of Siemens in Karlstein, West Germany. Babcock Sempell was to deliver more than 30 gate valves of this type for 5 Swedish nuclear power stations by autumn 1995. In the presentation, the author will report on the testing performed, qualifications, and sizing criteria which led to the new technical design.

  12. Image-guided adaptive gating of lung cancer radiotherapy: a computer simulation study

    Energy Technology Data Exchange (ETDEWEB)

    Aristophanous, Michalis; Rottmann, Joerg; Park, Sang-June; Berbeco, Ross I [Department of Radiation Oncology, Brigham and Women' s Hospital, Dana Farber Cancer Institute and Harvard Medical School, Boston, MA (United States); Nishioka, Seiko [Department of Radiology, NTT Hospital, Sapporo (Japan); Shirato, Hiroki, E-mail: maristophanous@lroc.harvard.ed [Department of Radiation Medicine, Hokkaido University School of Medicine, Sapporo (Japan)

    2010-08-07

    The purpose of this study is to investigate the effect that image-guided adaptation of the gating window during treatment could have on the residual tumor motion, by simulating different gated radiotherapy techniques. There are three separate components of this simulation: (1) the 'Hokkaido Data', which are previously measured 3D data of lung tumor motion tracks and the corresponding 1D respiratory signals obtained during the entire ungated radiotherapy treatments of eight patients, (2) the respiratory gating protocol at our institution and the imaging performed under that protocol and (3) the actual simulation in which the Hokkaido Data are used to select tumor position information that could have been collected based on the imaging performed under our gating protocol. We simulated treatments with a fixed gating window and a gating window that is updated during treatment. The patient data were divided into different fractions, each with continuous acquisitions longer than 2 min. In accordance to the imaging performed under our gating protocol, we assume that we have tumor position information for the first 15 s of treatment, obtained from kV fluoroscopy, and for the rest of the fractions the tumor position is only available during the beam-on time from MV imaging. The gating window was set according to the information obtained from the first 15 s such that the residual motion was less than 3 mm. For the fixed gating window technique the gate remained the same for the entire treatment, while for the adaptive technique the range of the tumor motion during beam-on time was measured and used to adapt the gating window to keep the residual motion below 3 mm. The algorithm used to adapt the gating window is described. The residual tumor motion inside the gating window was reduced on average by 24% for the patients with regular breathing patterns and the difference was statistically significant (p-value = 0.01). The magnitude of the residual tumor motion

  13. Non-enhanced ECG-gated respiratory-triggered 3-D steady-state free-precession MR angiography with slab-selective inversion: initial experience in visualisation of renal arteries in free-breathing children without renal artery abnormality

    International Nuclear Information System (INIS)

    Klee, Dirk; Lanzman, Rotem Shlomo; Blondin, Dirk; Antoch, Gerald; Schaper, Joerg; Schmitt, Peter; Oh, Jun; Salgin, Burak; Mayatepek, Ertan

    2012-01-01

    ECG-gated non-enhanced balanced steady-state free precession (bSSFP) MR angiography requires neither breath-holding nor administration of contrast material. To investigate the image quality of free-breathing ECG-gated non-enhanced bSSFP MR angiography of renal arteries in children. Fourteen boys and seven girls (mean age, 9.7 years; range, 7 weeks-17 years) with no history of renovascular disease were included. MRI was performed at 1.5 T. Subjective image quality of axial and coronal maximum-intensity-projection reconstructions of four segments (I, aorta and renal artery ostium; II, main renal artery; III, segmental branches; IV, intrarenal vessels) was evaluated using a 4-point scale (4 = excellent, 3 = good, 2 = acceptable, 1 = non-diagnostic). Image quality was excellent for segments I (mean ± SD, 3.9 ± 0.3) and II (4.0 ± 0.1), good for segment III (3.4 ± 0.9) and acceptable for segment IV (2.3 ± 1.1). Mean image quality did not differ between sedated and non-sedated children. bSSFP MR angiography enables visualisation of renal arteries in children. (orig.)

  14. Chaotic logic gate: A new approach in set and design by genetic algorithm

    International Nuclear Information System (INIS)

    Beyki, Mahmood; Yaghoobi, Mahdi

    2015-01-01

    How to reconfigure a logic gate is an attractive subject for different applications. Chaotic systems can yield a wide variety of patterns and here we use this feature to produce a logic gate. This feature forms the basis for designing a dynamical computing device that can be rapidly reconfigured to become any wanted logical operator. This logic gate that can reconfigure to any logical operator when placed in its chaotic state is called chaotic logic gate. The reconfiguration realize by setting the parameter values of chaotic logic gate. In this paper we present mechanisms about how to produce a logic gate based on the logistic map in its chaotic state and genetic algorithm is used to set the parameter values. We use three well-known selection methods used in genetic algorithm: tournament selection, Roulette wheel selection and random selection. The results show the tournament selection method is the best method for set the parameter values. Further, genetic algorithm is a powerful tool to set the parameter values of chaotic logic gate

  15. LRRK2 regulates voltage-gated calcium channel function.

    Directory of Open Access Journals (Sweden)

    Cade eBedford

    2016-05-01

    Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how

  16. Reduction of skin effect losses in double-level-T-gate structure

    Energy Technology Data Exchange (ETDEWEB)

    Mikulics, M., E-mail: m.mikulics@fz-juelich.de; Hardtdegen, H.; Arango, Y. C.; Adam, R.; Fox, A.; Grützmacher, D. [Peter Grünberg Institute (PGI-9), Forschungszentrum Jülich, D-52425 Jülich (Germany); Jülich-Aachen Research Alliance, JARA, Fundamentals of Future Information Technology, D-52425 Jülich (Germany); Gregušová, D.; Novák, J. [Institute of Electrical Engineering, Slovak Academy of Sciences, SK-84104 Bratislava (Slovakia); Stanček, S. [Department of Nuclear Physic and Technique, Slovak University of Technology, SK-81219 Bratislava (Slovakia); Kordoš, P. [Institute of Electronics and Photonics, Slovak University of Technology, SK-81219 Bratislava (Slovakia); Sofer, Z. [Department of Inorganic Chemistry, Institute of Chemical Technology, Technická 5, Prague 6 (Czech Republic); Juul, L.; Marso, M. [Faculté des Sciences, de la Technologie et de la Communication, Université du Luxembourg, L-1359 Luxembourg (Luxembourg)

    2014-12-08

    We developed a T-gate technology based on selective wet etching yielding 200 nm wide T-gate structures used for fabrication of High Electron Mobility Transistors (HEMT). Major advantages of our process are the use of only standard photolithographic process and the ability to generate T-gate stacks. A HEMT fabricated on AlGaN/GaN/sapphire with gate length L{sub g} = 200 nm and double-stacked T-gates exhibits 60 GHz cutoff frequency showing ten-fold improvement compared to 6 GHz for the same device with 2 μm gate length. HEMTs with a double-level-T-gate (DLTG) structure exhibit up to 35% improvement of f{sub max} value compared to a single T-gate device. This indicates a significant reduction of skin effect losses in DLTG structure compared to its standard T-gate counterpart. These results agree with the theoretical predictions.

  17. Identification of the gate regions in the primary structure of the secretin pIV.

    Science.gov (United States)

    Spagnuolo, Julian; Opalka, Natacha; Wen, Wesley X; Gagic, Dragana; Chabaud, Elodie; Bellini, Pierdomenico; Bennett, Matthew D; Norris, Gillian E; Darst, Seth A; Russel, Marjorie; Rakonjac, Jasna

    2010-04-01

    Secretins are a family of large bacterial outer membrane channels that serve as exit ports for folded proteins, filamentous phage and surface structures. Despite the large size of their substrates, secretins do not compromise the barrier function of the outer membrane, implying a gating mechanism. The region in the primary structure that forms the putative gate has not previously been determined for any secretin. To identify residues involved in gating the pIV secretin of filamentous bacteriophage f1, we used random mutagenesis of the gene followed by positive selection for mutants with compromised barrier function ('leaky' mutants). We identified mutations in 34 residues, 30 of which were clustered into two regions located in the centre of the conserved C-terminal secretin family domain: GATE1 (that spanned 39 residues) and GATE2 (that spanned 14 residues). An internal deletion constructed in the GATE2 region resulted in a severely leaky phenotype. Three of the four remaining mutations are located in the region that encodes the N-terminal, periplasmic portion of pIV and could be involved in triggering gate opening. Two missense mutations in the 24-residue region that separates GATE1 and GATE2 were also constructed. These mutant proteins were unstable, defective in multimerization and non-functional.

  18. New opening hours of the gates

    CERN Multimedia

    GS Department

    2009-01-01

    Please note the new opening hours of the gates as well as the intersites tunnel from the 19 May 2009: GATE A 7h - 19h GATE B 24h/24 GATE C 7h - 9h\t17h - 19h GATE D 8h - 12h\t13h - 16h GATE E 7h - 9h\t17h - 19h Prévessin 24h/24 The intersites tunnel will be opened from 7h30 to 18h non stop. GS-SEM Group Infrastructure and General Services Department

  19. Logic-Gate Functions in Chemomechanical Materials.

    Science.gov (United States)

    Schneider, Hans-Jörg

    2017-09-06

    Chemomechanical polymers that change their shape or volume on stimulation by multiple external chemical signals, particularly on the basis of selective molecular recognition, are discussed. Several examples illustrate how such materials, usually in the form of hydrogels, can be used for the design of chemically triggered valves or artificial muscles and applied, for example, in self-healing materials or drug delivery. The most attractive feature of such materials is that they can combine sensor and actuator within single units, from nano- to macrosize. Simultaneous action of a cofactor allows selective response in the sense of AND logic gates by, for example, amino acids and peptides, which without the presence of a second effector do not induce any changes. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. A Grand Challenge for CMOS Scaling: Alternate Gate Dielectrics

    Science.gov (United States)

    Wallace, Robert M.

    2001-03-01

    Many materials systems are currently under consideration as potential replacements for SiO2 as the gate dielectric material for sub-0.13 um complementary metal oxide semiconductor (CMOS) technology. The prospect of replacing SiO2 is a formidable task because the alternate gate dielectric must provide many properties that are, at a minimum, comparable to those of SiO2 yet with a much higher permittivity. A systematic examination of the required performance of gate dielectrics suggests that the key properties to consider in the selection an alternative gate dielectric candidate are (a) permittivity, band gap and band alignment to silicon, (b) thermodynamic stability, (c) film morphology, (d) interface quality, (e) compatibility with the current or expected materials to be used in processing for CMOS devices, (f) process compatibility, and (g) reliability. Many dielectrics appear favorable in some of these areas, but very few materials are promising with respect to all of these guidelines. We will review the performance requirements for materials associated with CMOS scaling, the challenges associated with these requirements, and the state-of-the-art in current research for alternate gate dielectrics. The requirements for process integration compatibility are remarkably demanding, and any serious candidates will emerge only through continued, intensive investigation.

  1. Respiratory gating in cardiac PET

    DEFF Research Database (Denmark)

    Lassen, Martin Lyngby; Rasmussen, Thomas; Christensen, Thomas E

    2017-01-01

    BACKGROUND: Respiratory motion due to breathing during cardiac positron emission tomography (PET) results in spatial blurring and erroneous tracer quantification. Respiratory gating might represent a solution by dividing the PET coincidence dataset into smaller respiratory phase subsets. The aim...... of our study was to compare the resulting imaging quality by the use of a time-based respiratory gating system in two groups administered either adenosine or dipyridamole as the pharmacological stress agent. METHODS AND RESULTS: Forty-eight patients were randomized to adenosine or dipyridamole cardiac...... stress (82)RB-PET. Respiratory rates and depths were measured by a respiratory gating system in addition to registering actual respiratory rates. Patients undergoing adenosine stress showed a decrease in measured respiratory rate from initial to later scan phase measurements [12.4 (±5.7) vs 5.6 (±4...

  2. Robustness of holonomic quantum gates

    International Nuclear Information System (INIS)

    Solinas, P.; Zanardi, P.; Zanghi, N.

    2005-01-01

    Full text: If the driving field fluctuates during the quantum evolution this produces errors in the applied operator. The holonomic (and geometrical) quantum gates are believed to be robust against some kind of noise. Because of the geometrical dependence of the holonomic operators can be robust against this kind of noise; in fact if the fluctuations are fast enough they cancel out leaving the final operator unchanged. I present the numerical studies of holonomic quantum gates subject to this parametric noise, the fidelity of the noise and ideal evolution is calculated for different noise correlation times. The holonomic quantum gates seem robust not only for fast fluctuating fields but also for slow fluctuating fields. These results can be explained as due to the geometrical feature of the holonomic operator: for fast fluctuating fields the fluctuations are canceled out, for slow fluctuating fields the fluctuations do not perturb the loop in the parameter space. (author)

  3. The ladder-shaped polyether toxin gambierol anchors the gating machinery of Kv3.1 channels in the resting state

    Science.gov (United States)

    Kopljar, Ivan; Labro, Alain J.; de Block, Tessa; Rainier, Jon D.; Tytgat, Jan

    2013-01-01

    Voltage-gated potassium (Kv) and sodium (Nav) channels are key determinants of cellular excitability and serve as targets of neurotoxins. Most marine ciguatoxins potentiate Nav channels and cause ciguatera seafood poisoning. Several ciguatoxins have also been shown to affect Kv channels, and we showed previously that the ladder-shaped polyether toxin gambierol is a potent Kv channel inhibitor. Most likely, gambierol acts via a lipid-exposed binding site, located outside the K+ permeation pathway. However, the mechanism by which gambierol inhibits Kv channels remained unknown. Using gating and ionic current analysis to investigate how gambierol affected S6 gate opening and voltage-sensing domain (VSD) movements, we show that the resting (closed) channel conformation forms the high-affinity state for gambierol. The voltage dependence of activation was shifted by >120 mV in the depolarizing direction, precluding channel opening in the physiological voltage range. The (early) transitions between the resting and the open state were monitored with gating currents, and provided evidence that strong depolarizations allowed VSD movement up to the activated-not-open state. However, for transition to the fully open (ion-conducting) state, the toxin first needed to dissociate. These dissociation kinetics were markedly accelerated in the activated-not-open state, presumably because this state displayed a much lower affinity for gambierol. A tetrameric concatemer with only one high-affinity binding site still displayed high toxin sensitivity, suggesting that interaction with a single binding site prevented the concerted step required for channel opening. We propose a mechanism whereby gambierol anchors the channel’s gating machinery in the resting state, requiring more work from the VSD to open the channel. This mechanism is quite different from the action of classical gating modifier peptides (e.g., hanatoxin). Therefore, polyether toxins open new opportunities in structure

  4. Dynamic gating window for compensation of baseline shift in respiratory-gated radiation therapy

    International Nuclear Information System (INIS)

    Pepin, Eric W.; Wu Huanmei; Shirato, Hiroki

    2011-01-01

    Purpose: To analyze and evaluate the necessity and use of dynamic gating techniques for compensation of baseline shift during respiratory-gated radiation therapy of lung tumors. Methods: Motion tracking data from 30 lung tumors over 592 treatment fractions were analyzed for baseline shift. The finite state model (FSM) was used to identify the end-of-exhale (EOE) breathing phase throughout each treatment fraction. Using duty cycle as an evaluation metric, several methods of end-of-exhale dynamic gating were compared: An a posteriori ideal gating window, a predictive trend-line-based gating window, and a predictive weighted point-based gating window. These methods were evaluated for each of several gating window types: Superior/inferior (SI) gating, anterior/posterior beam, lateral beam, and 3D gating. Results: In the absence of dynamic gating techniques, SI gating gave a 39.6% duty cycle. The ideal SI gating window yielded a 41.5% duty cycle. The weight-based method of dynamic SI gating yielded a duty cycle of 36.2%. The trend-line-based method yielded a duty cycle of 34.0%. Conclusions: Dynamic gating was not broadly beneficial due to a breakdown of the FSM's ability to identify the EOE phase. When the EOE phase was well defined, dynamic gating showed an improvement over static-window gating.

  5. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

    International Nuclear Information System (INIS)

    Du Yuzhe; Song Weizhong; Groome, James R.; Nomura, Yoshiko; Luo Ningguang; Dong Ke

    2010-01-01

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.

  6. Travels with Gates - July 2010

    Science.gov (United States)

    New Sanctions SEOUL, South Korea, July 21, 2010 - Secretary of State Hillary Rodham Clinton, in Seoul - Secretary of State Hillary Rodham Clinton and Defense Secretary Robert M. Gates reaffirmed the U.S zone along with Secretary of State Hillary Rodham Clinton and their South Korean counterparts to

  7. Bill Gates eyes healthcare market.

    Science.gov (United States)

    Dunbar, C

    1995-02-01

    The entrepreneurial spirit is still top in Bill Gates' mind as he look toward healthcare and other growth industries. Microsoft's CEO has not intention of going the way of other large technology companies that became obsolete before they could compete today.

  8. Dry dock gate stability modelling

    Science.gov (United States)

    Oktoberty; Widiyanto; Sasono, E. J.; Pramono, S.; Wandono, A. T.

    2018-03-01

    The development of marine transportation needs in Indonesia increasingly opens national shipyard business opportunities to provide shipbuilding services to the shipbuilding vessels. That emphasizes the stability of prime. The ship's decking door becomes an integral part of the efficient place and the specification of the use of the asset of its operational ease. This study aims to test the stability of Dry Dock gate with the length of 35.4 meters using Maxsurf and Hydromax in analyzing the calculation were in its assessment using interval per 500 mm length so that it can get detail data toward longitudinal and transverse such as studying Ship planning in general. The test result shows dry dock gate meets IMO standard with ballast construction containing 54% and 68% and using fix ballast can produce GMt 1,924 m, tide height 11,357m. The GMt value indicates dry dick gate can be stable and firmly erect at the base of the mouth dry dock. When empty ballast produces GMt 0.996 which means dry dock date is stable, but can easily be torn down. The condition can be used during dry dock gate treatment.

  9. Cellular hyper-excitability caused by mutations that alter the activation process of voltage-gated sodium channels

    Directory of Open Access Journals (Sweden)

    Mohamed-Yassine eAMAROUCH

    2015-02-01

    Full Text Available Voltage-gated sodium channels (Nav are widely expressed as macro-molecular complexes in both excitable and non-excitable tissues. In excitable tissues, the upstroke of the action potential is the result of the passage of a large and rapid influx of sodium ions through these channels. NaV dysfunction has been associated with an increasingly wide range of neurological, muscular and cardiac disorders. The purpose of this review is to summarize the recently identified sodium channel mutations that are linked to hyper-excitability phenotypes and associated with the alteration of the activation process of voltage gated sodium channels. Indeed, several clinical manifestations that demonstrate an alteration of tissue excitability were recently shown to be strongly associated with the presence of mutations that affect the activation process of the voltage-gated sodium channels. These emerging genotype-phenotype correlations have expanded the clinical spectrum of sodium channelopathies to include disorders which feature a hyper-excitability phenotype that may or may not be associated with a cardiomyopathy. The p.I141V mutation in SCN4A and SCN5A, as well as its homologous p.I136V mutation in SCN9A, are interesting examples of mutations that have been linked to inherited hyperexcitability myotonia, exercise-induced polymorphic ventricular arrhythmias and erythromelalgia, respectively. Regardless of which sodium channel isoform is investigated, the substitution of the isoleucine to valine in the locus 141 induces similar modifications in the biophysical properties of the voltage-gated sodium channels by shifting the voltage-dependence of steady state activation towards more negative potentials.

  10. Assessing self-reported use of new psychoactive substances: The impact of gate questions.

    Science.gov (United States)

    Palamar, Joseph J; Acosta, Patricia; Calderón, Fermín Fernández; Sherman, Scott; Cleland, Charles M

    2017-09-01

    New psychoactive substances (NPS) continue to emerge; however, few surveys of substance use ask about NPS use. Research is needed to determine how to most effectively query use of NPS and other uncommon drugs. To determine whether prevalence of self-reported lifetime and past-year use differs depending on whether or not queries about NPS use are preceded by "gate questions." Gate questions utilize skip-logic, such that only a "yes" response to the use of specific drug class is followed by more extensive queries of drug use in that drug class. We surveyed 1,048 nightclub and dance festival attendees (42.6% female) entering randomly selected venues in New York City in 2016. Participants were randomized to gate vs. no gate question before each drug category. Analyses focus on eight categories classifying 145 compounds: NBOMe, 2C, DOx, "bath salts" (synthetic cathinones), other stimulants, tryptamines, dissociatives, and non-phenethylamine psychedelics. Participants, however, were asked about specific "bath salts" regardless of their response to the gate question to test reliability. We examined whether prevalence of use of each category differed by gate condition and whether gate effects were moderated by participant demographics. Prevalence of use of DOx, other stimulants, and non-phenethylamine psychedelics was higher without a gate question. Gate effects for other stimulants and non-phenethylamine psychedelics were larger among white participants and those attending parties less frequently. Almost one in ten (9.3%) participants reporting no "bath salt" use via the gate question later reported use of a "bath salt" such as mephedrone, methedrone, or methylone. Omitting gate questions may improve accuracy of data collected via self-report.

  11. Factors influencing resident's decision to reside in gated and guarded community

    Science.gov (United States)

    Shamsudin, Zarina; Shamsudin, Shafiza; Zainal, Rozlin

    2017-10-01

    Gated communities are residential areas developed with restricted access with strictly controlled entrances and surrounded by a close perimeter of wall or fences. Developers, conscious of the need to fulfill the requirement of living in modern and sophisticated lifestyle and gated properties become the trend and mushroomed over the past decade. Nowadays, it is obvious that gated and guarded communities become almost a dominant feature of Malaysia housing development projects. The focus of this paper is to identify the factors contribute resident's decision to reside in gated and guarded community and to study social interaction among gated communities' residents. 150 questionnaires were distributed to the residents of selected gated and guarded community area in order to achieve the objectives and analyzed by using Statistical Package for Social Science (SPSS) and descriptive analysis. The result was tabulated and presented in charts and graphs for a clear and better understanding. The five main factors contribute to resident decision to reside in gated communities were identified and ranked; there are privacy, security, location, lifestyle and prestige. Besides, the residents are feeling neutral towards the facilities and services provided in their gated and guarded residential area. A comprehensive improvement towards the facilities and services is needed to reach higher satisfaction from the residents.

  12. Dosimetric evaluation of the interplay effect in respiratory-gated RapidArc radiation therapy

    International Nuclear Information System (INIS)

    Riley, Craig; Yang, Yong; Li, Tianfang; Zhang, Yongqian; Heron, Dwight E.; Huq, M. Saiful

    2014-01-01

    Purpose: Volumetric modulated arc therapy (VMAT) with gating capability has had increasing adoption in many clinics in the United States. In this new technique, dose rate, gantry rotation speed, and the leaf motion speed of multileaf collimators (MLCs) are modulated dynamically during gated beam delivery to achieve highly conformal dose coverage of the target and normal tissue sparing. Compared with the traditional gated intensity-modulated radiation therapy technique, this complicated beam delivery technique may result in larger dose errors due to the intrafraction tumor motion. The purpose of this work is to evaluate the dosimetric influence of the interplay effect for the respiration-gated VMAT technique (RapidArc, Varian Medical Systems, Palo Alto, CA). Our work consisted of two parts: (1) Investigate the interplay effect for different target residual errors during gated RapidArc delivery using a one-dimensional moving phantom capable of producing stable sinusoidal movement; (2) Evaluate the dosimetric influence in ten clinical patients’ treatment plans using a moving phantom driven with a patient-specific respiratory curve. Methods: For the first part of this study, four plans were created with a spherical target for varying residual motion of 0.25, 0.5, 0.75, and 1.0 cm. Appropriate gating windows were applied for each. The dosimetric effect was evaluated using EDR2 film by comparing the gated delivery with static delivery. For the second part of the project, ten gated lung stereotactic body radiotherapy cases were selected and reoptimized to be delivered by the gated RapidArc technique. These plans were delivered to a phantom, and again the gated treatments were compared to static deliveries by the same methods. Results: For regular sinusoidal motion, the dose delivered to the target was not substantially affected by the gating windows when evaluated with the gamma statistics, suggesting the interplay effect has a small role in respiratory-gated Rapid

  13. Dosimetric evaluation of the interplay effect in respiratory-gated RapidArc radiation therapy.

    Science.gov (United States)

    Riley, Craig; Yang, Yong; Li, Tianfang; Zhang, Yongqian; Heron, Dwight E; Huq, M Saiful

    2014-01-01

    Volumetric modulated arc therapy (VMAT) with gating capability has had increasing adoption in many clinics in the United States. In this new technique, dose rate, gantry rotation speed, and the leaf motion speed of multileaf collimators (MLCs) are modulated dynamically during gated beam delivery to achieve highly conformal dose coverage of the target and normal tissue sparing. Compared with the traditional gated intensity-modulated radiation therapy technique, this complicated beam delivery technique may result in larger dose errors due to the intrafraction tumor motion. The purpose of this work is to evaluate the dosimetric influence of the interplay effect for the respiration-gated VMAT technique (RapidArc, Varian Medical Systems, Palo Alto, CA). Our work consisted of two parts: (1) Investigate the interplay effect for different target residual errors during gated RapidArc delivery using a one-dimensional moving phantom capable of producing stable sinusoidal movement; (2) Evaluate the dosimetric influence in ten clinical patients' treatment plans using a moving phantom driven with a patient-specific respiratory curve. For the first part of this study, four plans were created with a spherical target for varying residual motion of 0.25, 0.5, 0.75, and 1.0 cm. Appropriate gating windows were applied for each. The dosimetric effect was evaluated using EDR2 film by comparing the gated delivery with static delivery. For the second part of the project, ten gated lung stereotactic body radiotherapy cases were selected and reoptimized to be delivered by the gated RapidArc technique. These plans were delivered to a phantom, and again the gated treatments were compared to static deliveries by the same methods. For regular sinusoidal motion, the dose delivered to the target was not substantially affected by the gating windows when evaluated with the gamma statistics, suggesting the interplay effect has a small role in respiratory-gated RapidArc therapy. Varied results were

  14. Mechanism of Estradiol-Induced Block of Voltage-Gated K+ Currents in Rat Medial Preoptic Neurons

    Science.gov (United States)

    Druzin, Michael; Malinina, Evgenya; Grimsholm, Ola; Johansson, Staffan

    2011-01-01

    The present study was conducted to characterize possible rapid effects of 17-β-estradiol on voltage-gated K+ channels in preoptic neurons and, in particular, to identify the mechanisms by which 17-β-estradiol affects the K+ channels. Whole-cell currents from dissociated rat preoptic neurons were studied by perforated-patch recording. 17-β-estradiol rapidly (within seconds) and reversibly reduced the K+ currents, showing an EC50 value of 9.7 µM. The effect was slightly voltage dependent, but independent of external Ca2+, and not sensitive to an estrogen-receptor blocker. Although 17-α-estradiol also significantly reduced the K+ currents, membrane-impermeant forms of estradiol did not reduce the K+ currents and other estrogens, testosterone and cholesterol were considerably less effective. The reduction induced by estradiol was overlapping with that of the KV-2-channel blocker r-stromatoxin-1. The time course of K+ current in 17-β-estradiol, with a time-dependent inhibition and a slight dependence on external K+, suggested an open-channel block mechanism. The properties of block were predicted from a computational model where 17-β-estradiol binds to open K+ channels. It was concluded that 17-β-estradiol rapidly reduces voltage-gated K+ currents in a way consistent with an open-channel block mechanism. This suggests a new mechanism for steroid action on ion channels. PMID:21625454

  15. Potentiation of glycine-gated NR1/NR3A NMDA receptors relieves Ca2+-dependent outward rectification

    Directory of Open Access Journals (Sweden)

    Christian Madry

    2010-03-01

    Full Text Available Glycine has diverse functions within the mammalian central nervous system. It inhibits postsynaptic neurons via strychnine-sensitive glycine receptors (GlyRs and enhances neuronal excitation through co-activation of N-methyl-D-aspartate (NMDA receptors. Classical Ca2+-permeable NMDA receptors are composed of glycine-binding NR1 and glutamate-binding NR2 subunits, and hence require both glutamate and glycine for efficient activation. In contrast, recombinant receptors composed of NR1 and the glycine binding NR3A and/or NR3B subunits lack glutamate binding sites and can be activated by glycine alone. Therefore these receptors are also named excitatory glycine receptors. Co-application of antagonists of the NR1 glycine-binding site or of the divalent cation Zn2+ markedly enhances the glycine responses of these receptors. To gain further insight into the properties of these glycine-gated NMDA receptors, we investigated their current-voltage (I-V dependence. Whole-cell current-voltage relations of glycine currents recorded from NR1/NR3B and NR1/NR3A/NR3B expressing oocytes were found to be linear under our recording conditions. In contrast, NR1/NR3A receptors displayed a strong outwardly rectifying I-V relation. Interestingly, the voltage-dependent inward current block was abolished in the presence of NR1 antagonists, Zn2+ or a combination of both. Further analysis revealed that Ca2+ (1.8 mM present in our recording solutions was responsible for the voltage-dependent inhibition of ion flux through NR1/NR3A receptors. Since physiological concentrations of the divalent cation Mg2+ did not affect the I-V dependence, our data suggest that relief of the voltage-dependent Ca2+ block of NR1/NR3A receptors by Zn2+ may be important for the regulation of excitatory glycinergic transmission, according to the Mg2+-block of conventional NR1/NR2 NMDA receptors.

  16. H2O2 augments cytosolic calcium in nucleus tractus solitarii neurons via multiple voltage-gated calcium channels.

    Science.gov (United States)

    Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D

    2017-05-01

    Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.

  17. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  18. Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

    Science.gov (United States)

    Findeisen, Felix; Minor, Daniel L

    2009-03-01

    Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

  19. A Gate Hinge Controls the Epithelial Calcium Channel TRPV5

    OpenAIRE

    van der Wijst, Jenny; Leunissen, Elizabeth H.; Blanchard, Maxime G.; Venselaar, Hanka; Verkaart, Sjoerd; Paulsen, Candice E.; Bindels, Ren? J.; Hoenderop, Joost G.

    2017-01-01

    TRPV5 is unique within the large TRP channel family for displaying a high Ca2+ selectivity together with Ca2+-dependent inactivation. Our study aims to uncover novel insights into channel gating through in-depth structure-function analysis. We identify an exceptional tryptophan (W583) at the terminus of the intracellular pore that is unique for TRPV5 (and TRPV6). A combination of site-directed mutagenesis, biochemical and electrophysiological analysis, together with homology modeling, demonst...

  20. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains.

    Science.gov (United States)

    Cheng, Lan; Sanguinetti, Michael C

    2009-05-01

    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  1. Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity.

    Directory of Open Access Journals (Sweden)

    Céline M Bourdin

    Full Text Available Insect voltage-gated sodium (Nav channels are formed by a well-known pore-forming α-subunit encoded by para-like gene and ancillary subunits related to TipE from the mutation "temperature-induced-paralysis locus E." The role of these ancillary subunits in the modulation of biophysical and pharmacological properties of Na(+ currents are not enough documented. The unique neuronal ancillary subunit TipE-homologous protein 1 of Drosophila melanogaster (DmTEH1 strongly enhances the expression of insect Nav channels when heterologously expressed in Xenopus oocytes. Here we report the cloning and functional expression of two neuronal DmTEH1-homologs of the cockroach, Periplaneta americana, PaTEH1A and PaTEH1B, encoded by a single bicistronic gene. In PaTEH1B, the second exon encoding the last 11-amino-acid residues of PaTEH1A is shifted to 3'UTR by the retention of a 96-bp intron-containing coding-message, thus generating a new C-terminal end. We investigated the gating and pharmacological properties of the Drosophila Nav channel variant (DmNav1-1 co-expressed with DmTEH1, PaTEH1A, PaTEH1B or a truncated mutant PaTEH1Δ(270-280 in Xenopus oocytes. PaTEH1B caused a 2.2-fold current density decrease, concomitant with an equivalent α-subunit incorporation decrease in the plasma membrane, compared to PaTEH1A and PaTEH1Δ(270-280. PaTEH1B positively shifted the voltage-dependences of activation and slow inactivation of DmNav1-1 channels to more positive potentials compared to PaTEH1A, suggesting that the C-terminal end of both proteins may influence the function of the voltage-sensor and the pore of Nav channel. Interestingly, our findings showed that the sensitivity of DmNav1-1 channels to lidocaine and to the pyrazoline-type insecticide metabolite DCJW depends on associated TEH1-like subunits. In conclusion, our work demonstrates for the first time that density, gating and pharmacological properties of Nav channels expressed in Xenopus oocytes can be

  2. A high performance gate drive for large gate turn off thyristors

    Energy Technology Data Exchange (ETDEWEB)

    Szilagyi, C.P.

    1993-01-01

    Past approaches to gate turn-off (GTO) gating are application oriented, inefficient and dissipate power even when inactive. They allow the gate to avalanch, and do not reduce GTO turn-on and turn-off losses. A new approach is proposed which will allow modular construction and adaptability to large GTOs in the 50 amp to 2000 amp range. The proposed gate driver can be used in large voltage source and current source inverters and other power converters. The approach consists of a power metal-oxide-silicon field effect transistor (MOSFET) technology gating unit, with associated logic and supervisory circuits and an isolated flyback converter as the dc power source for the gating unit. The gate driver formed by the gating unit and the flyback converter is designed for 4000 V isolation. Control and supervisory signals are exchanged between the gate driver and the remote control system via fiber optics. The gating unit has programmable front-porch current amplitude and pulse-width, programmable closed-loop controlled back-porch current, and a turn-off switch capable of supplying negative gate current at demand as a function of peak controllable forward anode current. The GTO turn-on, turn-off and gate avalanch losses are reduced to a minimum. The gate driver itself has minimum operating losses. Analysis, design and practical realization are reported. 19 refs., 54 figs., 1 tab.

  3. A bistable electromagnetically actuated rotary gate microvalve

    International Nuclear Information System (INIS)

    Luharuka, Rajesh; Hesketh, Peter J

    2008-01-01

    Two types of rotary gate microvalves are developed for flow modulation in microfluidic systems. These microvalves have been tested for an open flow rate of up to 100 sccm and operate under a differential pressure of 6 psig with flow modulation of up to 100. The microvalve consists of a suspended gate that rotates in the plane of the chip to regulate flow through the orifice. The gate is suspended by a novel fully compliant in-plane rotary bistable micromechanism (IPRBM) that advantageously constrains the gate in all degrees of freedom except for in-plane rotational motion. Multiple inlet/outlet orifices provide flexibility of operating the microvalve in three different flow configurations. The rotary gate microvalve is switched with an external electromagnetic actuator. The suspended gate is made of a soft magnetic material and its electromagnetic actuation is based on the operating principle of a variable-reluctance stepper motor

  4. Experimental superposition of orders of quantum gates

    Science.gov (United States)

    Procopio, Lorenzo M.; Moqanaki, Amir; Araújo, Mateus; Costa, Fabio; Alonso Calafell, Irati; Dowd, Emma G.; Hamel, Deny R.; Rozema, Lee A.; Brukner, Časlav; Walther, Philip

    2015-01-01

    Quantum computers achieve a speed-up by placing quantum bits (qubits) in superpositions of different states. However, it has recently been appreciated that quantum mechanics also allows one to ‘superimpose different operations'. Furthermore, it has been shown that using a qubit to coherently control the gate order allows one to accomplish a task—determining if two gates commute or anti-commute—with fewer gate uses than any known quantum algorithm. Here we experimentally demonstrate this advantage, in a photonic context, using a second qubit to control the order in which two gates are applied to a first qubit. We create the required superposition of gate orders by using additional degrees of freedom of the photons encoding our qubits. The new resource we exploit can be interpreted as a superposition of causal orders, and could allow quantum algorithms to be implemented with an efficiency unlikely to be achieved on a fixed-gate-order quantum computer. PMID:26250107

  5. High speed gated x-ray imagers

    International Nuclear Information System (INIS)

    Kilkenny, J.D.; Bell, P.; Hanks, R.; Power, G.; Turner, R.E.; Wiedwald, J.

    1988-01-01

    Single and multi-frame gated x-ray images with time-resolution as fast as 150 psec are described. These systems are based on the gating of microchannel plates in a stripline configuration. The gating voltage comes from the avalanche breakdown of reverse biased p-n junction producing high power voltage pulses as short as 70 psec. Results from single and four frame x-ray cameras used on Nova are described. 8 refs., 9 figs

  6. Seven channel gated charge to time converter

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, R J; Waddoup, W D [Durham Univ. (UK)

    1977-11-01

    By using a hybrid integrated circuit seven independent gated charge to time converters have been constructed in a single width NIM module. Gate widths from < approximately 10 ns to approximately 300 ns are possible with a resolution of 0.25 pC, linearity is better than +-1 pC over 2.5 decades of input signal height. Together with a multichannel scaling system described in the following paper one has a very powerful multichannel gated ADC system.

  7. Gating-ML: XML-based gating descriptions in flow cytometry.

    Science.gov (United States)

    Spidlen, Josef; Leif, Robert C; Moore, Wayne; Roederer, Mario; Brinkman, Ryan R

    2008-12-01

    The lack of software interoperability with respect to gating due to lack of a standardized mechanism for data exchange has traditionally been a bottleneck, preventing reproducibility of flow cytometry (FCM) data analysis and the usage of multiple analytical tools. To facilitate interoperability among FCM data analysis tools, members of the International Society for the Advancement of Cytometry (ISAC) Data Standards Task Force (DSTF) have developed an XML-based mechanism to formally describe gates (Gating-ML). Gating-ML, an open specification for encoding gating, data transformations and compensation, has been adopted by the ISAC DSTF as a Candidate Recommendation. Gating-ML can facilitate exchange of gating descriptions the same way that FCS facilitated for exchange of raw FCM data. Its adoption will open new collaborative opportunities as well as possibilities for advanced analyses and methods development. The ISAC DSTF is satisfied that the standard addresses the requirements for a gating exchange standard.

  8. Optimization of Ecg Gating in Quantitative Femoral Angiography

    International Nuclear Information System (INIS)

    Nilsson, S.; Berglund, I.; Erikson, U.; Johansson, J.; Walldius, G.

    2003-01-01

    Purpose: To determine which phase of the heart cycle would yield the highest reproducibility in measuring atherosclerosis-related variables such as arterial lumen volume and edge roughness. Material and Methods: 35 patients with hypercholesterolemia underwent select ive femoral angiography, repeated four times at 10-min intervals. The angiographies were performed with Ecg-gated exposures. In angiographies 1 and 2 the delay from R-wave maximum to each exposure was 0.1 s, in angiographies 3 and 4 the delay was 0.1, 0.3, 0.5 or 0.7 s or the exposures were performed 1/s without Ecg gating. Arterial lumen volume and edge roughness were measured in a 20-cm segment of the superficial femoral artery using a computer-based densitometric method. Measurement reproducibility was determined by comparing angiographies 1-2 and angiographies 3-4. Results: When measuring arterial lumen volume and edge roughness of a 20-cm segment of the femoral artery, reproducibility was not dependent on Ecg gating. In measuring single arterial diameters and cross-sectional areas, the reproducibility was better when exposures were made 0.1 s after the R-wave maximum than when using other settings of the Ecg gating device or without Ecg gating. Conclusion: The influence of pulsatile flow upon quantitative measurement in femoral angiograms seems to be the smallest possible in early systole, as can be demonstrated when measuring single diameters and cross-sectional areas. In variables based on integration over longer segments, measurement reproducibility seems to be independent of phase

  9. Optimization of Ecg Gating in Quantitative Femoral Angiography

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson, S.; Berglund, I.; Erikson, U. [Univ. Hospital, Uppsala (Sweden). Dept. of Oncology, Radiology and Clinical Immunology; Johansson, J.; Walldius, G. [Karolinska Hospital, Stockholm (Sweden). King Gustav V Research Inst.

    2003-09-01

    Purpose: To determine which phase of the heart cycle would yield the highest reproducibility in measuring atherosclerosis-related variables such as arterial lumen volume and edge roughness. Material and Methods: 35 patients with hypercholesterolemia underwent select ive femoral angiography, repeated four times at 10-min intervals. The angiographies were performed with Ecg-gated exposures. In angiographies 1 and 2 the delay from R-wave maximum to each exposure was 0.1 s, in angiographies 3 and 4 the delay was 0.1, 0.3, 0.5 or 0.7 s or the exposures were performed 1/s without Ecg gating. Arterial lumen volume and edge roughness were measured in a 20-cm segment of the superficial femoral artery using a computer-based densitometric method. Measurement reproducibility was determined by comparing angiographies 1-2 and angiographies 3-4. Results: When measuring arterial lumen volume and edge roughness of a 20-cm segment of the femoral artery, reproducibility was not dependent on Ecg gating. In measuring single arterial diameters and cross-sectional areas, the reproducibility was better when exposures were made 0.1 s after the R-wave maximum than when using other settings of the Ecg gating device or without Ecg gating. Conclusion: The influence of pulsatile flow upon quantitative measurement in femoral angiograms seems to be the smallest possible in early systole, as can be demonstrated when measuring single diameters and cross-sectional areas. In variables based on integration over longer segments, measurement reproducibility seems to be independent of phase.

  10. Mechanism of electromechanical coupling in voltage-gated potassium channels

    Directory of Open Access Journals (Sweden)

    Rikard eBlunck

    2012-09-01

    Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels

  11. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking*

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-01-01

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. PMID:26453302

  12. Benchmarking gate-based quantum computers

    Science.gov (United States)

    Michielsen, Kristel; Nocon, Madita; Willsch, Dennis; Jin, Fengping; Lippert, Thomas; De Raedt, Hans

    2017-11-01

    With the advent of public access to small gate-based quantum processors, it becomes necessary to develop a benchmarking methodology such that independent researchers can validate the operation of these processors. We explore the usefulness of a number of simple quantum circuits as benchmarks for gate-based quantum computing devices and show that circuits performing identity operations are very simple, scalable and sensitive to gate errors and are therefore very well suited for this task. We illustrate the procedure by presenting benchmark results for the IBM Quantum Experience, a cloud-based platform for gate-based quantum computing.

  13. Electrocardiographic gating in positron emission computed tomography

    International Nuclear Information System (INIS)

    Hoffman, E.J.; Phelps, M.E.; Wisenberg, G.; Schelbert, H.R.; Kuhl, D.E.

    1979-01-01

    Electrocardiographic (ECG) synchronized multiple gated data acquisition was employed with positron emission computed tomography (ECT) to obtain images of myocardial blood pool and myocardium. The feasibility and requirements of multiple gated data acquisition in positron ECT were investigated for 13NH3, ( 18 F)-2-fluoro-2-D-deoxyglucose, and ( 11 C)-carboxyhemoglobin. Examples are shown in which image detail is enhanced and image interpretation is facilitated when ECG gating is employed in the data collection. Analysis of count rate data from a series of volunteers indicates that multiple, statistically adequate images can be obtained under a multiple gated data collection format without an increase in administered dose

  14. Liquid–Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing

    KAUST Repository

    Zhang, Yu

    2017-10-17

    Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid–liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the “sensing channel” can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.

  15. Liquid-Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing.

    Science.gov (United States)

    Zhang, Yu; Li, Jun; Li, Rui; Sbircea, Dan-Tiberiu; Giovannitti, Alexander; Xu, Junling; Xu, Huihua; Zhou, Guodong; Bian, Liming; McCulloch, Iain; Zhao, Ni

    2017-11-08

    Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid-liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the "sensing channel" can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.

  16. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  17. Gate current for p+-poly PMOS devices under gate injection conditions

    NARCIS (Netherlands)

    Hof, A.J.; Holleman, J.; Woerlee, P.H.

    2001-01-01

    In current CMOS processing both n+-poly and p+-poly gates are used. The I-V –relationship and reliability of n+-poly devices are widely studied and well understood. Gate currents and reliability for p+-poly PMOS devices under gate injection conditions are not well understood. In this paper, the

  18. Boolean gates on actin filaments

    International Nuclear Information System (INIS)

    Siccardi, Stefano; Tuszynski, Jack A.; Adamatzky, Andrew

    2016-01-01

    Actin is a globular protein which forms long polar filaments in the eukaryotic cytoskeleton. Actin networks play a key role in cell mechanics and cell motility. They have also been implicated in information transmission and processing, memory and learning in neuronal cells. The actin filaments have been shown to support propagation of voltage pulses. Here we apply a coupled nonlinear transmission line model of actin filaments to study interactions between voltage pulses. To represent digital information we assign a logical TRUTH value to the presence of a voltage pulse in a given location of the actin filament, and FALSE to the pulse's absence, so that information flows along the filament with pulse transmission. When two pulses, representing Boolean values of input variables, interact, then they can facilitate or inhibit further propagation of each other. We explore this phenomenon to construct Boolean logical gates and a one-bit half-adder with interacting voltage pulses. We discuss implications of these findings on cellular process and technological applications. - Highlights: • We simulate interaction between voltage pulses using on actin filaments. • We use a coupled nonlinear transmission line model. • We design Boolean logical gates via interactions between the voltage pulses. • We construct one-bit half-adder with interacting voltage pulses.

  19. Boolean gates on actin filaments

    Energy Technology Data Exchange (ETDEWEB)

    Siccardi, Stefano, E-mail: ssiccardi@2ssas.it [The Unconventional Computing Centre, University of the West of England, Bristol (United Kingdom); Tuszynski, Jack A., E-mail: jackt@ualberta.ca [Department of Oncology, University of Alberta, Edmonton, Alberta (Canada); Adamatzky, Andrew, E-mail: andrew.adamatzky@uwe.ac.uk [The Unconventional Computing Centre, University of the West of England, Bristol (United Kingdom)

    2016-01-08

    Actin is a globular protein which forms long polar filaments in the eukaryotic cytoskeleton. Actin networks play a key role in cell mechanics and cell motility. They have also been implicated in information transmission and processing, memory and learning in neuronal cells. The actin filaments have been shown to support propagation of voltage pulses. Here we apply a coupled nonlinear transmission line model of actin filaments to study interactions between voltage pulses. To represent digital information we assign a logical TRUTH value to the presence of a voltage pulse in a given location of the actin filament, and FALSE to the pulse's absence, so that information flows along the filament with pulse transmission. When two pulses, representing Boolean values of input variables, interact, then they can facilitate or inhibit further propagation of each other. We explore this phenomenon to construct Boolean logical gates and a one-bit half-adder with interacting voltage pulses. We discuss implications of these findings on cellular process and technological applications. - Highlights: • We simulate interaction between voltage pulses using on actin filaments. • We use a coupled nonlinear transmission line model. • We design Boolean logical gates via interactions between the voltage pulses. • We construct one-bit half-adder with interacting voltage pulses.

  20. Insights into operation of planar tri-gate tunnel field effect transistor for dynamic memory application

    Science.gov (United States)

    Navlakha, Nupur; Kranti, Abhinav

    2017-07-01

    Insights into device physics and operation through the control of energy barriers are presented for a planar tri-gate Tunnel Field Effect Transistor (TFET) based dynamic memory. The architecture consists of a double gate (G1) at the source side and a single gate (G2) at the drain end of the silicon film. Dual gates (G1) effectively enhance the tunneling based read mechanism through the enhanced coupling and improved electrostatic control over the channel. The single gate (G2) controls the holes in the potential barrier induced through the proper selection of bias and workfunction. The results indicate that the planar tri-gate achieves optimum performance evaluated in terms of two composite metrics (M1 and M2), namely, product of (i) Sense Margin (SM) and Retention Time (RT) i.e., M1 = SM × RT and (ii) Sense Margin and Current Ratio (CR) i.e., M2 = SM × CR. The regulation of barriers created by the gates (G1 and G2) through the optimal use of device parameters leads to better performance metrics, with significant improvement at scaled lengths as compared to other tunneling based dynamic memory architectures. The investigation shows that lengths of G1, G2 and lateral spacing can be scaled down to 25 nm, 50 nm, and 30 nm, respectively, while achieving reasonable values for (M1, M2). The work demonstrates a systematic approach to showcase the advancement in TFET based Dynamic Random Access Memory (DRAM) through the use of planar tri-gate topology at a lower bias value. The concept, design, and operation of planar tri-gate architecture provide valuable viewpoints for TFET based DRAM.

  1. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  2. Implementation of a three-qubit refined Deutsch-Jozsa algorithm using SFG quantum logic gates

    International Nuclear Information System (INIS)

    Duce, A Del; Savory, S; Bayvel, P

    2006-01-01

    In this paper we present a quantum logic circuit which can be used for the experimental demonstration of a three-qubit solid state quantum computer based on a recent proposal of optically driven quantum logic gates. In these gates, the entanglement of randomly placed electron spin qubits is manipulated by optical excitation of control electrons. The circuit we describe solves the Deutsch problem with an improved algorithm called the refined Deutsch-Jozsa algorithm. We show that it is possible to select optical pulses that solve the Deutsch problem correctly, and do so without losing quantum information to the control electrons, even though the gate parameters vary substantially from one gate to another

  3. Implementation of a three-qubit refined Deutsch-Jozsa algorithm using SFG quantum logic gates

    Energy Technology Data Exchange (ETDEWEB)

    Duce, A Del; Savory, S; Bayvel, P [Department of Electronic and Electrical Engineering, University College London, Torrington Place, London WC1E 7JE (United Kingdom)

    2006-05-31

    In this paper we present a quantum logic circuit which can be used for the experimental demonstration of a three-qubit solid state quantum computer based on a recent proposal of optically driven quantum logic gates. In these gates, the entanglement of randomly placed electron spin qubits is manipulated by optical excitation of control electrons. The circuit we describe solves the Deutsch problem with an improved algorithm called the refined Deutsch-Jozsa algorithm. We show that it is possible to select optical pulses that solve the Deutsch problem correctly, and do so without losing quantum information to the control electrons, even though the gate parameters vary substantially from one gate to another.

  4. Implementation of a three-qubit refined Deutsch Jozsa algorithm using SFG quantum logic gates

    Science.gov (United States)

    DelDuce, A.; Savory, S.; Bayvel, P.

    2006-05-01

    In this paper we present a quantum logic circuit which can be used for the experimental demonstration of a three-qubit solid state quantum computer based on a recent proposal of optically driven quantum logic gates. In these gates, the entanglement of randomly placed electron spin qubits is manipulated by optical excitation of control electrons. The circuit we describe solves the Deutsch problem with an improved algorithm called the refined Deutsch-Jozsa algorithm. We show that it is possible to select optical pulses that solve the Deutsch problem correctly, and do so without losing quantum information to the control electrons, even though the gate parameters vary substantially from one gate to another.

  5. A gate drive circuit for gate-turn-off (GTO) devices in series stack

    International Nuclear Information System (INIS)

    Despe, O.

    1999-01-01

    A gate-turn-off (GTO) switch is under development at the Advanced Photon Source as a replacement for a thyratron switch in high power pulsed application. The high voltage in the application requires multiple GTOs connected in series. One component that is critical to the success of GTO operation is the gate drive circuit. The gate drive circuit has to provide fast high-current pulses to the GTO gate for fast turn-on and turn-off. It also has to be able to operate while floating at high voltage. This paper describes a gate drive circuit that meets these requirements

  6. Transparently wrap-gated semiconductor nanowire arrays for studies of gate-controlled photoluminescence

    Energy Technology Data Exchange (ETDEWEB)

    Nylund, Gustav; Storm, Kristian; Torstensson, Henrik; Wallentin, Jesper; Borgström, Magnus T.; Hessman, Dan; Samuelson, Lars [Solid State Physics, Nanometer Structure Consortium, Lund University, Box 118, S-221 00 Lund (Sweden)

    2013-12-04

    We present a technique to measure gate-controlled photoluminescence (PL) on arrays of semiconductor nanowire (NW) capacitors using a transparent film of Indium-Tin-Oxide (ITO) wrapping around the nanowires as the gate electrode. By tuning the wrap-gate voltage, it is possible to increase the PL peak intensity of an array of undoped InP NWs by more than an order of magnitude. The fine structure of the PL spectrum reveals three subpeaks whose relative peak intensities change with gate voltage. We interpret this as gate-controlled state-filling of luminescing quantum dot segments formed by zincblende stacking faults in the mainly wurtzite NW crystal structure.

  7. Protected gates for topological quantum field theories

    International Nuclear Information System (INIS)

    Beverland, Michael E.; Pastawski, Fernando; Preskill, John; Buerschaper, Oliver; Koenig, Robert; Sijher, Sumit

    2016-01-01

    We study restrictions on locality-preserving unitary logical gates for topological quantum codes in two spatial dimensions. A locality-preserving operation is one which maps local operators to local operators — for example, a constant-depth quantum circuit of geometrically local gates, or evolution for a constant time governed by a geometrically local bounded-strength Hamiltonian. Locality-preserving logical gates of topological codes are intrinsically fault tolerant because spatially localized errors remain localized, and hence sufficiently dilute errors remain correctable. By invoking general properties of two-dimensional topological field theories, we find that the locality-preserving logical gates are severely limited for codes which admit non-abelian anyons, in particular, there are no locality-preserving logical gates on the torus or the sphere with M punctures if the braiding of anyons is computationally universal. Furthermore, for Ising anyons on the M-punctured sphere, locality-preserving gates must be elements of the logical Pauli group. We derive these results by relating logical gates of a topological code to automorphisms of the Verlinde algebra of the corresponding anyon model, and by requiring the logical gates to be compatible with basis changes in the logical Hilbert space arising from local F-moves and the mapping class group

  8. Gates Auto Door Car With Lights Modulated

    OpenAIRE

    Lina Carolina; Luyung Dinani, Skom, MMSi

    2002-01-01

    In scientific writing wi ll be explained about automatic gates with modulated headlights, where to find the car lights were adjusted by the relative frequency darker because of this background that the author alleviate human task in performing daily activities by using an automatic gate with the car lights modulated.

  9. Automatically closing swing gate closure assembly

    Science.gov (United States)

    Chang, Shih-Chih; Schuck, William J.; Gilmore, Richard F.

    1988-01-01

    A swing gate closure assembly for nuclear reactor tipoff assembly wherein the swing gate is cammed open by a fuel element or spacer but is reliably closed at a desired closing rate primarily by hydraulic forces in the absence of a fuel charge.

  10. Efficient experimental design of high-fidelity three-qubit quantum gates via genetic programming

    Science.gov (United States)

    Devra, Amit; Prabhu, Prithviraj; Singh, Harpreet; Arvind; Dorai, Kavita

    2018-03-01

    We have designed efficient quantum circuits for the three-qubit Toffoli (controlled-controlled-NOT) and the Fredkin (controlled-SWAP) gate, optimized via genetic programming methods. The gates thus obtained were experimentally implemented on a three-qubit NMR quantum information processor, with a high fidelity. Toffoli and Fredkin gates in conjunction with the single-qubit Hadamard gates form a universal gate set for quantum computing and are an essential component of several quantum algorithms. Genetic algorithms are stochastic search algorithms based on the logic of natural selection and biological genetics and have been widely used for quantum information processing applications. We devised a new selection mechanism within the genetic algorithm framework to select individuals from a population. We call this mechanism the "Luck-Choose" mechanism and were able to achieve faster convergence to a solution using this mechanism, as compared to existing selection mechanisms. The optimization was performed under the constraint that the experimentally implemented pulses are of short duration and can be implemented with high fidelity. We demonstrate the advantage of our pulse sequences by comparing our results with existing experimental schemes and other numerical optimization methods.

  11. Multi-gated field emitters for a micro-column

    International Nuclear Information System (INIS)

    Mimura, Hidenori; Kioke, Akifumi; Aoki, Toru; Neo, Yoichiro; Yoshida, Tomoya; Nagao, Masayoshi

    2011-01-01

    We have developed a multi-gated field emitter (FE) such as a quadruple-gated FE with a three-stacked electrode lens and a quintuple-gated FE with a four-stacked electrode lens. Both the FEs can focus the electron beam. However, the quintuple-gated FE has a stronger electron convergence than the quadruple-gated FE, and a beam crossover is clearly observed for the quintuple-gated FE.

  12. Respiratory trace feature analysis for the prediction of respiratory-gated PET quantification

    Science.gov (United States)

    Wang, Shouyi; Bowen, Stephen R.; Chaovalitwongse, W. Art; Sandison, George A.; Grabowski, Thomas J.; Kinahan, Paul E.

    2014-02-01

    The benefits of respiratory gating in quantitative PET/CT vary tremendously between individual patients. Respiratory pattern is among many patient-specific characteristics that are thought to play an important role in gating-induced imaging improvements. However, the quantitative relationship between patient-specific characteristics of respiratory pattern and improvements in quantitative accuracy from respiratory-gated PET/CT has not been well established. If such a relationship could be estimated, then patient-specific respiratory patterns could be used to prospectively select appropriate motion compensation during image acquisition on a per-patient basis. This study was undertaken to develop a novel statistical model that predicts quantitative changes in PET/CT imaging due to respiratory gating. Free-breathing static FDG-PET images without gating and respiratory-gated FDG-PET images were collected from 22 lung and liver cancer patients on a PET/CT scanner. PET imaging quality was quantified with peak standardized uptake value (SUVpeak) over lesions of interest. Relative differences in SUVpeak between static and gated PET images were calculated to indicate quantitative imaging changes due to gating. A comprehensive multidimensional extraction of the morphological and statistical characteristics of respiratory patterns was conducted, resulting in 16 features that characterize representative patterns of a single respiratory trace. The six most informative features were subsequently extracted using a stepwise feature selection approach. The multiple-regression model was trained and tested based on a leave-one-subject-out cross-validation. The predicted quantitative improvements in PET imaging achieved an accuracy higher than 90% using a criterion with a dynamic error-tolerance range for SUVpeak values. The results of this study suggest that our prediction framework could be applied to determine which patients would likely benefit from respiratory motion compensation

  13. Respiratory trace feature analysis for the prediction of respiratory-gated PET quantification

    International Nuclear Information System (INIS)

    Wang, Shouyi; Chaovalitwongse, W Art; Bowen, Stephen R; Kinahan, Paul E; Sandison, George A; Grabowski, Thomas J

    2014-01-01

    The benefits of respiratory gating in quantitative PET/CT vary tremendously between individual patients. Respiratory pattern is among many patient-specific characteristics that are thought to play an important role in gating-induced imaging improvements. However, the quantitative relationship between patient-specific characteristics of respiratory pattern and improvements in quantitative accuracy from respiratory-gated PET/CT has not been well established. If such a relationship could be estimated, then patient-specific respiratory patterns could be used to prospectively select appropriate motion compensation during image acquisition on a per-patient basis. This study was undertaken to develop a novel statistical model that predicts quantitative changes in PET/CT imaging due to respiratory gating. Free-breathing static FDG-PET images without gating and respiratory-gated FDG-PET images were collected from 22 lung and liver cancer patients on a PET/CT scanner. PET imaging quality was quantified with peak standardized uptake value (SUV peak ) over lesions of interest. Relative differences in SUV peak between static and gated PET images were calculated to indicate quantitative imaging changes due to gating. A comprehensive multidimensional extraction of the morphological and statistical characteristics of respiratory patterns was conducted, resulting in 16 features that characterize representative patterns of a single respiratory trace. The six most informative features were subsequently extracted using a stepwise feature selection approach. The multiple-regression model was trained and tested based on a leave-one-subject-out cross-validation. The predicted quantitative improvements in PET imaging achieved an accuracy higher than 90% using a criterion with a dynamic error-tolerance range for SUV peak values. The results of this study suggest that our prediction framework could be applied to determine which patients would likely benefit from respiratory motion

  14. Dual-Gate p-GaN Gate High Electron Mobility Transistors for Steep Subthreshold Slope.

    Science.gov (United States)

    Bae, Jong-Ho; Lee, Jong-Ho

    2016-05-01

    A steep subthreshold slope characteristic is achieved through p-GaN gate HEMT with dual-gate structure. Obtained subthreshold slope is less than 120 μV/dec. Based on the measured and simulated data obtained from single-gate device, breakdown of parasitic floating-base bipolar transistor and floating gate charged with holes are responsible to increase abruptly in drain current. In the dual-gate device, on-current degrades with high temperature but subthreshold slope is not changed. To observe the switching speed of dual-gate device and transient response of drain current are measured. According to the transient responses of drain current, switching speed of the dual-gate device is about 10(-5) sec.

  15. Top-gate pentacene-based organic field-effect transistor with amorphous rubrene gate insulator

    Science.gov (United States)

    Hiroki, Mizuha; Maeda, Yasutaka; Ohmi, Shun-ichiro

    2018-02-01

    The scaling of organic field-effect transistors (OFETs) is necessary for high-density integration and for this, OFETs with a top-gate configuration are required. There have been several reports of damageless lithography processes for organic semiconductor or insulator layers. However, it is still difficult to fabricate scaled OFETs with a top-gate configuration. In this study, the lift-off process and the device characteristics of the OFETs with a top-gate configuration utilizing an amorphous (α) rubrene gate insulator were investigated. We have confirmed that α-rubrene shows an insulating property, and its extracted linear mobility was 2.5 × 10-2 cm2/(V·s). The gate length and width were 10 and 60 µm, respectively. From these results, the OFET with a top-gate configuration utilizing an α-rubrene gate insulator is promising for the high-density integration of scaled OFETs.

  16. Precise linear gating circuit on integrated microcircuits

    Energy Technology Data Exchange (ETDEWEB)

    Butskii, V.V.; Vetokhin, S.S.; Reznikov, I.V.

    Precise linear gating circuit on four microcircuits is described. A basic flowsheet of the gating circuit is given. The gating circuit consists of two input differential cascades total load of which is two current followers possessing low input and high output resistances. Follower outlets are connected to high ohmic dynamic load formed with a current source which permits to get high amplification (>1000) at one cascade. Nonlinearity amounts to <0.1% in the range of input signal amplitudes of -10-+10 V. Front duration for an output signal with 10 V amplitude amounts to 100 ns. Attenuation of input signal with a closed gating circuit is 60 db. The gating circuits described is used in the device intended for processing of scintillation sensor signals.

  17. Materials Fundamentals of Gate Dielectrics

    CERN Document Server

    Demkov, Alexander A

    2006-01-01

    This book presents materials fundamentals of novel gate dielectrics that are being introduced into semiconductor manufacturing to ensure the continuous scalling of the CMOS devices. This is a very fast evolving field of research so we choose to focus on the basic understanding of the structure, thermodunamics, and electronic properties of these materials that determine their performance in device applications. Most of these materials are transition metal oxides. Ironically, the d-orbitals responsible for the high dielectric constant cause sever integration difficulties thus intrinsically limiting high-k dielectrics. Though new in the electronics industry many of these materials are wel known in the field of ceramics, and we describe this unique connection. The complexity of the structure-property relations in TM oxides makes the use of the state of the art first-principles calculations necessary. Several chapters give a detailed description of the modern theory of polarization, and heterojunction band discont...

  18. Measurement of time delay for a prospectively gated CT simulator.

    Science.gov (United States)

    Goharian, M; Khan, R F H

    2010-04-01

    For the management of mobile tumors, respiratory gating is the ideal option, both during imaging and during therapy. The major advantage of respiratory gating during imaging is that it is possible to create a single artifact-free CT data-set during a selected phase of the patient's breathing cycle. The purpose of the present work is to present a simple technique to measure the time delay during acquisition of a prospectively gated CT. The time delay of a Philips Brilliance BigBore (Philips Medical Systems, Madison, WI) scanner attached to a Varian Real-Time Position Management (RPM) system (Varian Medical Systems, Palo Alto, CA) was measured. Two methods were used to measure the CT time delay: using a motion phantom and using a recorded data file from the RPM system. In the first technique, a rotating wheel phantom was altered by placing two plastic balls on its axis and rim, respectively. For a desired gate, the relative positions of the balls were measured from the acquired CT data and converted into corresponding phases. Phase difference was calculated between the measured phases and the desired phases. Using period of motion, the phase difference was converted into time delay. The Varian RPM system provides an external breathing signal; it also records transistor-transistor logic (TTL) 'X-Ray ON' status signal from the CT scanner in a text file. The TTL 'X-Ray ON' indicates the start of CT image acquisition. Thus, knowledge of the start time of CT acquisition, combined with the real-time phase and amplitude data from the external respiratory signal, provides time-stamping of all images in an axial CT scan. The TTL signal with time-stamp was used to calculate when (during the breathing cycle) a slice was recorded. Using the two approaches, the time delay between the prospective gating signal and CT simulator has been determined to be 367 +/- 40 ms. The delay requires corrections both at image acquisition and while setting gates for the treatment delivery

  19. Measurement of time delay for a prospectively gated CT simulator

    Directory of Open Access Journals (Sweden)

    Goharian M

    2010-01-01

    Full Text Available For the management of mobile tumors, respiratory gating is the ideal option, both during imaging and during therapy. The major advantage of respiratory gating during imaging is that it is possible to create a single artifact-free CT data-set during a selected phase of the patient′s breathing cycle. The purpose of the present work is to present a simple technique to measure the time delay during acquisition of a prospectively gated CT. The time delay of a Philips Brilliance BigBore™ (Philips Medical Systems, Madison, WI scanner attached to a Varian Real-Time Position Management™ (RPM system (Varian Medical Systems, Palo Alto, CA was measured. Two methods were used to measure the CT time delay: using a motion phantom and using a recorded data file from the RPM system. In the first technique, a rotating wheel phantom was altered by placing two plastic balls on its axis and rim, respectively. For a desired gate, the relative positions of the balls were measured from the acquired CT data and converted into corresponding phases. Phase difference was calculated between the measured phases and the desired phases. Using period of motion, the phase difference was converted into time delay. The Varian RPM system provides an external breathing signal; it also records transistor-transistor logic (TTL ′X-Ray ON′ status signal from the CT scanner in a text file. The TTL ′X-Ray ON′ indicates the start of CT image acquisition. Thus, knowledge of the start time of CT acquisition, combined with the real-time phase and amplitude data from the external respiratory signal, provides time-stamping of all images in an axial CT scan. The TTL signal with time-stamp was used to calculate when (during the breathing cycle a slice was recorded. Using the two approaches, the time delay between the prospective gating signal and CT simulator has been determined to be 367 ± 40 ms. The delay requires corrections both at image acquisition and while setting gates for

  20. Measurement of time delay for a prospectively gated CT simulator

    International Nuclear Information System (INIS)

    Goharian, M.; Khan, R.F.H.

    2010-01-01

    For the management of mobile tumors, respiratory gating is the ideal option, both during imaging and during therapy. The major advantage of respiratory gating during imaging is that it is possible to create a single artifact-free CT data-set during a selected phase of the patient's breathing cycle. The purpose of the present work is to present a simple technique to measure the time delay during acquisition of a prospectively gated CT. The time delay of a Philips Brilliance BigBore (Philips Medical Systems, Madison, WI) scanner attached to a Varian Real-Time Position Management (RPM) system (Varian Medical Systems, Palo Alto, CA) was measured. Two methods were used to measure the CT time delay: using a motion phantom and using a recorded data file from the RPM system. In the first technique, a rotating wheel phantom was altered by placing two plastic balls on its axis and rim, respectively. For a desired gate, the relative positions of the balls were measured from the acquired CT data and converted into corresponding phases. Phase difference was calculated between the measured phases and the desired phases. Using period of motion, the phase difference was converted into time delay. The Varian RPM system provides an external breathing signal; it also records transistor-transistor logic (TTL) 'X-Ray ON' status signal from the CT scanner in a text file. The TTL 'X-Ray ON' indicates the start of CT image acquisition. Thus, knowledge of the start time of CT acquisition, combined with the real-time phase and amplitude data from the external respiratory signal, provides time-stamping of all images in an axial CT scan. The TTL signal with time-stamp was used to calculate when (during the breathing cycle) a slice was recorded. Using the two approaches, the time delay between the prospective gating signal and CT simulator has been determined to be 367 ± 40 ms. The delay requires corrections both at image acquisition and while setting gates for the treatment delivery

  1. Sterol Regulation of Voltage-Gated K+ Channels.

    Science.gov (United States)

    Balajthy, Andras; Hajdu, Peter; Panyi, Gyorgy; Varga, Zoltan

    2017-01-01

    Cholesterol is an essential lipid building block of the cellular plasma membrane. In addition to its structural role, it regulates the fluidity and raft structure of the membrane and influences the course of numerous membrane-linked signaling pathways and the function of transmembrane proteins, including ion channels. This is supported by a vast body of scientific data, which demonstrates the modulation of ion channels with a great variety of ion selectivity, gating, and tissue distribution by changes in membrane cholesterol. Here, we review what is currently known about the modulation of voltage-gated K + (Kv) channels by changes in membrane cholesterol content, considering raft association of the channels, the roles of cholesterol recognition sites, and those of adaptor proteins in cholesterol-Kv channel interactions. We specifically focus on Kv1.3, the dominant K + channel of human T cells. Effects of cholesterol depletion and enrichment and 7-dehydrocholesterol enrichment on Kv1.3 gating are discussed in the context of the immunological synapse and the comparison of the in vitro effects of sterol modifications on Kv1.3 function with ex vivo effects on cells from hypercholesterolemic and Smith-Lemli-Opitz patients. © 2017 Elsevier Inc. All rights reserved.

  2. Chloride channels as tools for developing selective insecticides.

    Science.gov (United States)

    Bloomquist, Jeffrey R

    2003-12-01

    Ligand-gated chloride channels underlie inhibition in excitable membranes and are proven target sites for insecticides. The gamma-aminobutyric acid (GABA(1)) receptor/chloride ionophore complex is the primary site of action for a number of currently used insecticides, such as lindane, endosulfan, and fipronil. These compounds act as antagonists by stabilizing nonconducting conformations of the chloride channel. Blockage of the GABA-gated chloride channel reduces neuronal inhibition, which leads to hyperexcitation of the central nervous system, convulsions, and death. We recently investigated the mode of action of the silphinenes, plant-derived natural compounds that structurally resemble picrotoxinin. These materials antagonize the action of GABA on insect neurons and block GABA-mediated chloride uptake into mouse brain synaptoneurosomes in a noncompetitive manner. In mammals, avermectins have a blocking action on the GABA-gated chloride channel consistent with a coarse tremor, whereas at longer times and higher concentrations, activation of the channel suppresses neuronal activity. Invertebrates display ataxia, paralysis, and death as the predominant signs of poisoning, with a glutamate-gated chloride channel playing a major role. Additional target sites for the avermectins or other chloride channel-directed compounds might include receptors gated by histamine, serotonin, or acetylcholine.The voltage-sensitive chloride channels form another large gene family of chloride channels. Voltage-dependent chloride channels are involved in a number of physiological processes including: maintenance of electrical excitability, chloride ion secretion and resorption, intravesicular acidification, and cell volume regulation. A subset of these channels is affected by convulsants and insecticides in mammals, although the role they play in acute lethality in insects is unclear. Given the wide range of functions that they mediate, these channels are also potential targets for

  3. SEMICONDUCTOR DEVICES: Structural and electrical characteristics of lanthanum oxide gate dielectric film on GaAs pHEMT technology

    Science.gov (United States)

    Chia-Song, Wu; Hsing-Chung, Liu

    2009-11-01

    This paper investigates the feasibility of using a lanthanum oxide thin film (La2O3) with a high dielectric constant as a gate dielectric on GaAs pHEMTs to reduce gate leakage current and improve the gate to drain breakdown voltage relative to the conventional GaAs pHEMT. An E/D mode pHEMT in a single chip was realized by selecting the appropriate La2O3 thickness. The thin La2O3 film was characterized: its chemical composition and crystalline structure were determined by X-ray photoelectron spectroscopy and X-ray diffraction, respectively. La2O3 exhibited good thermal stability after post-deposition annealing at 200, 400 and 600 °C because of its high binding-energy (835.6 eV). Experimental results clearly demonstrated that the La2O3 thin film was thermally stable. The DC and RF characteristics of Pt/La2O3/Ti/Au gate and conventional Pt/Ti/Au gate pHEMTs were examined. The measurements indicated that the transistor with the Pt/La2O3/Ti/Au gate had a higher breakdown voltage and lower gate leakage current. Accordingly, the La2O3 thin film is a potential high-k material for use as a gate dielectric to improve electrical performance and the thermal effect in high-power applications.

  4. Getting started with FortiGate

    CERN Document Server

    Fabbri, Rosato

    2013-01-01

    This book is a step-by-step tutorial that will teach you everything you need to know about the deployment and management of FortiGate, including high availability, complex routing, various kinds of VPN working, user authentication, security rules and controls on applications, and mail and Internet access.This book is intended for network administrators, security managers, and IT pros. It is a great starting point if you have to administer or configure a FortiGate unit, especially if you have no previous experience. For people that have never managed a FortiGate unit, the book helpfully walks t

  5. Optimizing the Gating System for Steel Castings

    Directory of Open Access Journals (Sweden)

    Jan Jezierski

    2018-04-01

    Full Text Available The article presents the attempt to optimize a gating system to produce cast steel castings. It is based on John Campbell’s theory and presents the original results of computer modelling of typical and optimized gating systems for cast steel castings. The current state-of-the-art in cast steel casting foundry was compared with several proposals of optimization. The aim was to find a compromise between the best, theoretically proven gating system version, and a version that would be affordable in industrial conditions. The results show that it is possible to achieve a uniform and slow pouring process even for heavy castings to preserve their internal quality.

  6. Gate A: changes to opening hours

    CERN Multimedia

    2015-01-01

    Due to maintenance work, the opening hours of Gate A (near Reception) will be modified between Monday, 13 and Friday, 17 April 2015.   During this period, the gate will be open to vehicles between 7 a.m. and 9.30 a.m., then between 4.30 p.m. and 7 p.m. It will be completely closed to traffic between 9.30 a.m. and 4.30 p.m. Pedestrians and cyclists may continue to use the gate. We apologise for any inconvenience and thank you for your understanding.

  7. Calibration of submerged multi-sluice gates

    Directory of Open Access Journals (Sweden)

    Mohamed F. Sauida

    2014-09-01

    The main objective of this work is to study experimentally and verify empirically the different parameters affecting the discharge through submerged multiple sluice gates (i.e., the expansion ratios, gates operational management, etc.. Using multiple regression analysis of the experimental results, a general equation for discharge coefficient is developed. The results show, that the increase in the expansion ratio and the asymmetric operation of gates, give higher values for the discharge coefficient. The obtained predictions of the discharge coefficient using the developed equations are compared to the experimental data. The present developed equations showed good consistency and high accuracy.

  8. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  9. Contact effects analyzed by a parameter extraction method based on a single bottom-gate/top-contact organic thin-film transistor

    Science.gov (United States)

    Takagaki, Shunsuke; Yamada, Hirofumi; Noda, Kei

    2018-03-01

    Contact effects in organic thin-film transistors (OTFTs) were examined by using our previously proposed parameter extraction method from the electrical characteristics of a single staggered-type device. Gate-voltage-dependent contact resistance and channel mobility in the linear regime were evaluated for bottom-gate/top-contact (BGTC) pentacene TFTs with active layers of different thicknesses, and for pentacene TFTs with contact-doped layers prepared by coevaporation of pentacene and tetrafluorotetracyanoquinodimethane (F4TCNQ). The extracted parameters suggested that the influence of the contact resistance becomes more prominent with the larger active-layer thickness, and that contact-doping experiments give rise to a drastic decrease in the contact resistance and a concurrent considerable improvement in the channel mobility. Additionally, the estimated energy distributions of trap density in the transistor channel probably reflect the trap filling with charge carriers injected into the channel regions. The analysis results in this study confirm the effectiveness of our proposed method, with which we can investigate contact effects and circumvent the influences of characteristic variations in OTFT fabrication.

  10. Performance projections and design optimization of planar double gate SOI MOSFETs for logic technology applications

    International Nuclear Information System (INIS)

    Kranti, Abhinav; Hao Ying; Armstrong, G Alastair

    2008-01-01

    In this paper, by investigating the influence of source/drain extension region engineering (also known as gate–source/drain underlap) in nanoscale planar double gate (DG) SOI MOSFETs, we offer new insights into the design of future nanoscale gate-underlap DG devices to achieve ITRS projections for high performance (HP), low standby power (LSTP) and low operating power (LOP) logic technologies. The impact of high-κ gate dielectric, silicon film thickness, together with parameters associated with the lateral source/drain doping profile, is investigated in detail. The results show that spacer width along with lateral straggle can not only effectively control short-channel effects, thus presenting low off-current in a gate underlap device, but can also be optimized to achieve lower intrinsic delay and higher on–off current ratio (I on /I off ). Based on the investigation of on-current (I on ), off-current (I off ), I on /I off , intrinsic delay (τ), energy delay product and static power dissipation, we present design guidelines to select key device parameters to achieve ITRS projections. Using nominal gate lengths for different technologies, as recommended from ITRS specification, optimally designed gate-underlap DG MOSFETs with a spacer-to-straggle (s/σ) ratio of 2.3 for HP/LOP and 3.2 for LSTP logic technologies will meet ITRS projection. However, a relatively narrow range of lateral straggle lying between 7 to 8 nm is recommended. A sensitivity analysis of intrinsic delay, on-current and off-current to important parameters allows a comparative analysis of the various design options and shows that gate workfunction appears to be the most crucial parameter in the design of DG devices for all three technologies. The impact of back gate misalignment on I on , I off and τ is also investigated for optimized underlap devices

  11. Social gating of sensory information during ongoing communication.

    Science.gov (United States)

    Anders, Silke; Heussen, Yana; Sprenger, Andreas; Haynes, John-Dylan; Ethofer, Thomas

    2015-01-01

    Social context plays an important role in human communication. Depending on the nature of the source, the same communication signal might be processed in fundamentally different ways. However, the selective modulation (or "gating") of the flow of neural information during communication is not fully understood. Here, we use multivoxel pattern analysis (MVPA) and multivoxel connectivity analysis (MVCA), a novel technique that allows to analyse context-dependent changes of the strength interregional coupling between ensembles of voxels, to examine how the human brain differentially gates content-specific sensory information during ongoing perception of communication signals. In a simulated electronic communication experiment, participants received two alternative text messages during fMRI ("happy" or "sad") which they believed had been sent either by their real-life friend outside the scanner or by a computer. A region in the dorsal medial prefrontal cortex (dmPFC) selectively increased its functional coupling with sensory-content encoding regions in the visual cortex when a text message was perceived as being sent by the participant's friend, and decreased its functional coupling with these regions when a text message was perceived as being sent by the computer. Furthermore, the strength of neural encoding of content-specific information of text messages in the dmPFC was modulated by the social tie between the participant and her friend: the more of her spare time a participant reported to spend with her friend the stronger was the neural encoding. This suggests that the human brain selectively gates sensory information into the relevant network for processing the mental states of others, depending on the source of the communication signal. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Ultrasonic vocalizations, predictability and sensorimotor gating in the rat.

    Science.gov (United States)

    Webber, Emily S; Mankin, David E; McGraw, Justin J; Beckwith, Travis J; Cromwell, Howard C

    2013-09-15

    Prepulse inhibition (PPI) is a measure of sensorimotor gating in diverse groups of animals including humans. Emotional states can influence PPI in humans both in typical subjects and in individuals with mental illness. Little is known about emotional regulation during PPI in rodents. We used ultrasonic vocalization recording to monitor emotional states in rats during PPI testing. We altered the predictability of the PPI trials to examine any alterations in gating and emotional regulation. We also examined PPI in animals selectively bred for high or low levels of 50kHz USV emission. Rats emitted high levels of 22kHz calls consistently throughout the PPI session. USVs were sensitive to prepulses during the PPI session similar to startle. USV rate was sensitive to predictability among the different levels tested and across repeated experiences. Startle and inhibition of startle were not affected by predictability in a similar manner. No significant differences for PPI or startle were found related to the different levels of predictability; however, there was a reduction in USV signals and an enhancement of PPI after repeated exposure. Animals selectively bred to emit high levels of USVs emitted significantly higher levels of USVs during the PPI session and a reduced ASR compared to the low and random selective lines. Overall, the results support the idea that PPI tests in rodents induce high levels of negative affect and that manipulating emotional styles of the animals alters the negative impact of the gating session as well as the intensity of the startle response. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. 2010 ARRA Lidar: Golden Gate (CA)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Golden Gate LiDAR Project is a cooperative project sponsored by the US Geological Survey (USGS) and San Francisco State University (SFSU) that has resulted in...

  14. Synthesizing biomolecule-based Boolean logic gates.

    Science.gov (United States)

    Miyamoto, Takafumi; Razavi, Shiva; DeRose, Robert; Inoue, Takanari

    2013-02-15

    One fascinating recent avenue of study in the field of synthetic biology is the creation of biomolecule-based computers. The main components of a computing device consist of an arithmetic logic unit, the control unit, memory, and the input and output devices. Boolean logic gates are at the core of the operational machinery of these parts, and hence to make biocomputers a reality, biomolecular logic gates become a necessity. Indeed, with the advent of more sophisticated biological tools, both nucleic acid- and protein-based logic systems have been generated. These devices function in the context of either test tubes or living cells and yield highly specific outputs given a set of inputs. In this review, we discuss various types of biomolecular logic gates that have been synthesized, with particular emphasis on recent developments that promise increased complexity of logic gate circuitry, improved computational speed, and potential clinical applications.

  15. Extending Double Optical Gating to the Midinfrared

    Science.gov (United States)

    Gorman, Timothy; Camper, Antoine; Agostini, Pierre; Dimauro, Louis

    2015-05-01

    In the past decade there has been great interest in creating broadband isolated attosecond pulses (IAPs). Primarily these IAPs have been generated using Ti:Sapphire 800nm short pulses, namely through spatiotemporal gating with the attosecond lighthouse technique, amplitude gating, polarization gating, and double optical gating (DOG). Here we present theoretical calculations and experimental investigations into extending DOG to using a 2 μm driving wavelength, the benefits of which include extended harmonic cutoff and longer input driving pulse durations. It is proposed that broadband IAPs with cutoffs extending up to 250 eV can be generated in Argon by using >30 fs pulses from the passively-CEP stabilized 2 μm idler out of an optical parametric amplifier combined with a collinear DOG experimental setup.

  16. Golden Gate and Pt. Reyes Acoustic Detections

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset contains detections of acoustic tagged fish from two general locations: Golden Gate (east and west line) and Pt. Reyes. Several Vemco 69khz acoustic...

  17. Synthesizing Biomolecule-based Boolean Logic Gates

    Science.gov (United States)

    Miyamoto, Takafumi; Razavi, Shiva; DeRose, Robert; Inoue, Takanari

    2012-01-01

    One fascinating recent avenue of study in the field of synthetic biology is the creation of biomolecule-based computers. The main components of a computing device consist of an arithmetic logic unit, the control unit, memory, and the input and output devices. Boolean logic gates are at the core of the operational machinery of these parts, hence to make biocomputers a reality, biomolecular logic gates become a necessity. Indeed, with the advent of more sophisticated biological tools, both nucleic acid- and protein-based logic systems have been generated. These devices function in the context of either test tubes or living cells and yield highly specific outputs given a set of inputs. In this review, we discuss various types of biomolecular logic gates that have been synthesized, with particular emphasis on recent developments that promise increased complexity of logic gate circuitry, improved computational speed, and potential clinical applications. PMID:23526588

  18. Active gated imaging in driver assistance system

    Science.gov (United States)

    Grauer, Yoav

    2014-04-01

    In this paper, we shall present the active gated imaging system (AGIS) in relation to the automotive field. AGIS is based on a fast-gated camera and pulsed illuminator, synchronized in the time domain to record images of a certain range of interest. A dedicated gated CMOS imager sensor and near infra-red (NIR) pulsed laser illuminator, is presented in this paper to provide active gated technology. In recent years, we have developed these key components and learned the system parameters, which are most beneficial to nighttime (in all weather conditions) driving in terms of field of view, illumination profile, resolution, and processing power. We shall present our approach of a camera-based advanced driver assistance systems (ADAS) named BrightEye™, which makes use of the AGIS technology in the automotive field.

  19. Distributed Idea Screening in Stage–gate Development Processes

    DEFF Research Database (Denmark)

    Onarheim, Balder; Christensen, Bo T.

    2012-01-01

    This paper investigates the gate screening of ideas in engineering design, by examination of the validity of employee voting schemes and biases associated with such voting. After conducting an employee-driven innovation project at a major producer of disposable medical equipment, 99 ideas had...... to be screened for further development. Inspired by the concept of ‘wisdom of the crowd’, all ideas were individually rated by a broad selection of employees, and the ratings were used to investigate two biases in employee voting: visual complexity and endowment effect/ownership of ideas. The visual complexity...

  20. Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation.

    Science.gov (United States)

    Minor, Daniel L; Findeisen, Felix

    2010-01-01

    Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

  1. The gating cycle of a K+ channel at atomic resolution

    Energy Technology Data Exchange (ETDEWEB)

    Cuello, Luis G. [Center for Membrane Protein Research, Department of Cell Physiology and Molecular Biophysics, Texas Tech University Health Sciences Center, Lubbock, United States; Cortes, D. Marien [Center for Membrane Protein Research, Department of Cell Physiology and Molecular Biophysics, Texas Tech University Health Sciences Center, Lubbock, United States; Perozo, Eduardo [Department of Biochemistry and Molecular Biology, The University of Chicago, Chicago, United States

    2017-11-22

    C-type inactivation in potassium channels helps fine-tune long-term channel activity through conformational changes at the selectivity filter. Here, through the use of cross-linked constitutively open constructs, we determined the structures of KcsA’s mutants that stabilize the selectivity filter in its conductive (E71A, at 2.25 Å) and deep C-type inactivated (Y82A at 2.4 Å) conformations. These structural snapshots represent KcsA’s transient open-conductive (O/O) and the stable open deep C-type inactivated states (O/I), respectively. The present structures provide an unprecedented view of the selectivity filter backbone in its collapsed deep C-type inactivated conformation, highlighting the close interactions with structural waters and the local allosteric interactions that couple activation and inactivation gating. Together with the structures associated with the closed-inactivated state (C/I) and in the well-known closed conductive state (C/O), this work recapitulates, at atomic resolution, the key conformational changes of a potassium channel pore domain as it progresses along its gating cycle.

  2. Dual-gated volumetric modulated arc therapy

    International Nuclear Information System (INIS)

    Fahimian, Benjamin; Wu, Junqing; Wu, Huanmei; Geneser, Sarah; Xing, Lei

    2014-01-01

    Gated Volumetric Modulated Arc Therapy (VMAT) is an emerging radiation therapy modality for treatment of tumors affected by respiratory motion. However, gating significantly prolongs the treatment time, as delivery is only activated during a single respiratory phase. To enhance the efficiency of gated VMAT delivery, a novel dual-gated VMAT (DG-VMAT) technique, in which delivery is executed at both exhale and inhale phases in a given arc rotation, is developed and experimentally evaluated. Arc delivery at two phases is realized by sequentially interleaving control points consisting of MUs, MLC sequences, and angles of VMAT plans generated at the exhale and inhale phases. Dual-gated delivery is initiated when a respiration gating signal enters the exhale window; when the exhale delivery concludes, the beam turns off and the gantry rolls back to the starting position for the inhale window. The process is then repeated until both inhale and exhale arcs are fully delivered. DG-VMAT plan delivery accuracy was assessed using a pinpoint chamber and diode array phantom undergoing programmed motion. DG-VMAT delivery was experimentally implemented through custom XML scripting in Varian’s TrueBeam™ STx Developer Mode. Relative to single gated delivery at exhale, the treatment time was improved by 95.5% for a sinusoidal breathing pattern. The pinpoint chamber dose measurement agreed with the calculated dose within 0.7%. For the DG-VMAT delivery, 97.5% of the diode array measurements passed the 3%/3 mm gamma criterion. The feasibility of DG-VMAT delivery scheme has been experimentally demonstrated for the first time. By leveraging the stability and natural pauses that occur at end-inspiration and end-exhalation, DG-VMAT provides a practical method for enhancing gated delivery efficiency by up to a factor of two

  3. An Integrated Gate Turnaround Management Concept Leveraging Big Data Analytics for NAS Performance Improvements

    Science.gov (United States)

    Chung, William W.; Ingram, Carla D.; Ahlquist, Douglas Kurt; Chachad, Girish H.

    2016-01-01

    "Gate Turnaround" plays a key role in the National Air Space (NAS) gate-to-gate performance by receiving aircraft when they reach their destination airport, and delivering aircraft into the NAS upon departing from the gate and subsequent takeoff. The time spent at the gate in meeting the planned departure time is influenced by many factors and often with considerable uncertainties. Uncertainties such as weather, early or late arrivals, disembarking and boarding passengers, unloading/reloading cargo, aircraft logistics/maintenance services and ground handling, traffic in ramp and movement areas for taxi-in and taxi-out, and departure queue management for takeoff are likely encountered on the daily basis. The Integrated Gate Turnaround Management (IGTM) concept is leveraging relevant historical data to support optimization of the gate operations, which include arrival, at the gate, departure based on constraints (e.g., available gates at the arrival, ground crew and equipment for the gate turnaround, and over capacity demand upon departure), and collaborative decision-making. The IGTM concept provides effective information services and decision tools to the stakeholders, such as airline dispatchers, gate agents, airport operators, ramp controllers, and air traffic control (ATC) traffic managers and ground controllers to mitigate uncertainties arising from both nominal and off-nominal airport gate operations. IGTM will provide NAS stakeholders customized decision making tools through a User Interface (UI) by leveraging historical data (Big Data), net-enabled Air Traffic Management (ATM) live data, and analytics according to dependencies among NAS parameters for the stakeholders to manage and optimize the NAS performance in the gate turnaround domain. The application will give stakeholders predictable results based on the past and current NAS performance according to selected decision trees through the UI. The predictable results are generated based on analysis of the

  4. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  5. Neuropsychiatry at the Courtroom Gates: Selective Entry or Anything Goes?

    Science.gov (United States)

    Brakel; Gonzalez; Cavanaugh

    1996-07-01

    That the influx of technology into our lives will include its entry into law and legal proceedings is a foregone conclusion. "Progress" of this kind can be slowed or regulated, perhaps, but it cannot be stopped. The proposed use of positron emission tomography (PET) scan-derived data on brain functioning in a criminal insanity case is merely one of the latest efforts to put biotechnology to forensic use. How the court reacts to this particular admissibility proposition-in or out?-may serve as a useful example of how the larger battle is fought. Trial judges are the gatekeepers in our legal system. They make the initial decision as to whether a piece of controversial evidence, scientific or otherwise, may go to the jury. Trial judges are under pressure to admit innovative factual evidence or theory from several sources, among which trial attorneys, the purveyors and practitioners of the new techniques, and the law itself (as personified by the "progressive" rulings of appellate judges or legislators) are the more obvious. The 1975 Federal Rules of Evidence exemplify the success of this sort of pressure. Pertaining to the admissibility of evidence generally and of scientific evidence in particular, the Federal Rules are clearly more liberal in intent and effect than was the doctrine that preceeded them: the 1923 Frye rule, which required "general acceptance" of the proffered new technology or theory. In the recent case of Daubert v. Merrell Dow Pharmaceuticals, however, the U.S. Supreme Court has let it be known that standards of reliability continue to be in force for scientific evidence submitted under the Federal Rules and that gatekeeping remains an important function of the trial judge. Nonetheless, a "sleeper" rule permitting experts to support the opinions they offer in court with reasonable clarifying information opens the evidentiary door a bit wider than the restrictions of Daubert might suggest. In the case at hand, this rule led to a preliminary decision that PET scan data concerning the defendant could come in, despite the lack of a scientifically established connection between such data and the criminal behavior at issue. This particular result is probably a bad one. Does that mean PET scan evidence in the courts is an example of general forensic misuse of neurotechnology? Are the new admissibility rules hopelessly out of whack? There is no need for such broadsides. The better conclusion is that neuropsychiatrists should continue to work together with lawyers and lawmakers to ensure, as much as possible, the appropriate application of this technology to legal proceedings.

  6. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  7. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  8. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  9. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  10. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  11. Respiratory gating in positron emission tomography: A quantitative comparison of different gating schemes

    International Nuclear Information System (INIS)

    Dawood, Mohammad; Buether, Florian; Lang, Norbert; Schober, Otmar; Schaefers, Klaus P

    2007-01-01

    Respiratory gating is used for reducing the effects of breathing motion in a wide range of applications from radiotherapy treatment to diagnostical imaging. Different methods are feasible for respiratory gating. In this study seven gating methods were developed and tested on positron emission tomography (PET) listmode data. The results of seven patient studies were compared quantitatively with respect to motion and noise. (1) Equal and (2) variable time-based gating methods use only the time information of the breathing cycle to define respiratory gates. (3) Equal and (4) variable amplitude-based gating approaches utilize the amplitude of the respiratory signal. (5) Cycle-based amplitude gating is a combination of time and amplitude-based techniques. A baseline correction was applied to methods (3) and (4) resulting in two new approaches: Baseline corrected (6) equal and (7) variable amplitude-based gating. Listmode PET data from seven patients were acquired together with a respiratory signal. Images were reconstructed applying the seven gating methods. Two parameters were used to quantify the results: Motion was measured as the displacement of the heart due to respiration and noise was defined as the standard deviation of pixel intensities in a background region. The amplitude-based approaches (3) and (4) were superior to the time-based methods (1) and (2). The improvement in capturing the motion was more than 30% (up to 130%) in all subjects. The variable time (2) and amplitude (4) methods had a more uniform noise distribution among all respiratory gates compared to equal time (1) and amplitude (3) methods. Baseline correction did not improve the results. Out of seven different respiratory gating approaches, the variable amplitude method (4) captures the respiratory motion best while keeping a constant noise level among all respiratory phases

  12. Analytical drain current formulation for gate dielectric engineered dual material gate-gate all around-tunneling field effect transistor

    Science.gov (United States)

    Madan, Jaya; Gupta, R. S.; Chaujar, Rishu

    2015-09-01

    In this work, an analytical drain current model for gate dielectric engineered (hetero dielectric)-dual material gate-gate all around tunnel field effect transistor (HD-DMG-GAA-TFET) has been developed. Parabolic approximation has been used to solve the two-dimensional (2D) Poisson equation with appropriate boundary conditions and continuity equations to evaluate analytical expressions for surface potential, electric field, tunneling barrier width and drain current. Further, the analog performance of the device is studied for three high-k dielectrics (Si3N4, HfO2, and ZrO2), and it has been investigated that the problem of lower ION, can be overcome by using the hetero-gate architecture. Moreover, the impact of scaling the gate oxide thickness and bias variations has also been studied. The HD-DMG-GAA-TFET shows an enhanced ION of the order of 10-4 A. The effectiveness of the proposed model is validated by comparing it with ATLAS device simulations.

  13. Statistical analysis of target motion in gated lung stereotactic body radiation therapy

    International Nuclear Information System (INIS)

    Zhao Bo; Yang Yong; Li Tianfang; Li Xiang; Heron, Dwight E; Huq, M Saiful

    2011-01-01

    An external surrogate-based respiratory gating technique is a useful method to reduce target margins for the treatment of a moving lung tumor. The success of this technique relies on a good correlation between the motion of the external markers and the internal tumor as well as the repeatability of the respiratory motion. In gated lung stereotactic body radiation therapy (SBRT), the treatment time for each fraction could exceed 30 min due to large fractional dose. Tumor motion may experience pattern changes such as baseline shift during such extended treatment time. The purpose of this study is to analyze tumor motion traces in actual treatment situations and to evaluate the effect of the target baseline shift in gated lung SBRT treatment. Real-time motion data for both the external markers and tumors from 51 lung SBRT treatments with Cyberknife Synchrony technology were analyzed in this study. The treatment time is typically greater than 30 min. The baseline shift was calculated with a rolling average window equivalent to ∼20 s and subtracted from that at the beginning. The magnitude of the baseline shift and its relationship with treatment time were investigated. Phase gating simulation was retrospectively performed on 12 carefully selected treatments with respiratory amplitude larger than 5 mm and regular phases. A customized gating window was defined for each individual treatment. It was found that the baseline shifts are specific to each patient and each fraction. Statistical analysis revealed that more than 69% treatments exhibited increased baseline shifts with the lapse of treatment time. The magnitude of the baseline shift could reach 5.3 mm during a 30 min treatment. Gating simulation showed that tumor excursion was caused mainly by the uncertainties in phase gating simulation and baseline shift, the latter being the primary factor. With a 5 mm gating window, 2 out of 12 treatments in the study group showed significant tumor excursion. Baseline shifts

  14. Intrinsic respiratory gating in small-animal CT

    International Nuclear Information System (INIS)

    Bartling, Soenke H.; Dinkel, Julien; Kauczor, Hans-Ulrich; Stiller, Wolfram; Semmler, Wolfhard; Grasruck, Michael; Madisch, Ijad; Gupta, Rajiv; Kiessling, Fabian

    2008-01-01

    Gating in small-animal CT imaging can compensate artefacts caused by physiological motion during scanning. However, all published gating approaches for small animals rely on additional hardware to derive the gating signals. In contrast, in this study a novel method of intrinsic respiratory gating of rodents was developed and tested for mice (n=5), rats (n=5) and rabbits (n=2) in a flat-panel cone-beam CT system. In a consensus read image quality was compared with that of non-gated and retrospective extrinsically gated scans performed using a pneumatic cushion. In comparison to non-gated images, image quality improved significantly using intrinsic and extrinsic gating. Delineation of diaphragm and lung structure improved in all animals. Image quality of intrinsically gated CT was judged to be equivalent to extrinsically gated ones. Additionally 4D datasets were calculated using both gating methods. Values for expiratory, inspiratory and tidal lung volumes determined with the two gating methods were comparable and correlated well with values known from the literature. We could show that intrinsic respiratory gating in rodents makes additional gating hardware and preparatory efforts superfluous. This method improves image quality and allows derivation of functional data. Therefore it bears the potential to find wide applications in small-animal CT imaging. (orig.)

  15. Sliding-gate valve for use with abrasive materials

    Science.gov (United States)

    Ayers, Jr., William J.; Carter, Charles R.; Griffith, Richard A.; Loomis, Richard B.; Notestein, John E.

    1985-01-01

    The invention is a flow and pressure-sealing valve for use with abrasive solids. The valve embodies special features which provide for long, reliable operating lifetimes in solids-handling service. The valve includes upper and lower transversely slidable gates, contained in separate chambers. The upper gate provides a solids-flow control function, whereas the lower gate provides a pressure-sealing function. The lower gate is supported by means for (a) lifting that gate into sealing engagement with its seat when the gate is in its open and closed positions and (b) lowering the gate out of contact with its seat to permit abrasion-free transit of the gate between its open and closed positions. When closed, the upper gate isolates the lower gate from the solids. Because of this shielding action, the sealing surface of the lower gate is not exposed to solids during transit or when it is being lifted or lowered. The chamber containing the lower gate normally is pressurized slightly, and a sweep gas is directed inwardly across the lower-gate sealing surface during the vertical translation of the gate.

  16. Metric Structure of the Space of Two-Qubit Gates, Perfect Entanglers and Quantum Control

    Directory of Open Access Journals (Sweden)

    Paul Watts

    2013-05-01

    Full Text Available We derive expressions for the invariant length element and measure for the simple compact Lie group SU(4 in a coordinate system particularly suitable for treating entanglement in quantum information processing. Using this metric, we compute the invariant volume of the space of two-qubit perfect entanglers. We find that this volume corresponds to more than 84% of the total invariant volume of the space of two-qubit gates. This same metric is also used to determine the effective target sizes that selected gates will present in any quantum-control procedure designed to implement them.

  17. Proposal for quantum gates in permanently coupled antiferromagnetic spin rings without need of local fields.

    Science.gov (United States)

    Troiani, Filippo; Affronte, Marco; Carretta, Stefano; Santini, Paolo; Amoretti, Giuseppe

    2005-05-20

    We propose a scheme for the implementation of quantum gates which is based on the qubit encoding in antiferromagnetic molecular rings. We show that a proper engineering of the intercluster link would result in an effective coupling that vanishes as far as the system is kept in the computational space, while it is turned on by a selective excitation of specific auxiliary states. These are also shown to allow the performing of single-qubit and two-qubit gates without an individual addressing of the rings by means of local magnetic fields.

  18. Bidirectional shifts of TRPM8 channel gating by temperature and chemical agents modulate the cold sensitivity of mammalian thermoreceptors.

    Science.gov (United States)

    Mälkiä, Annika; Madrid, Rodolfo; Meseguer, Victor; de la Peña, Elvira; Valero, María; Belmonte, Carlos; Viana, Félix

    2007-05-15

    TRPM8, a member of the melastatin subfamily of transient receptor potential (TRP) cation channels, is activated by voltage, low temperatures and cooling compounds. These properties and its restricted expression to small sensory neurons have made it the ion channel with the most advocated role in cold transduction. Recent work suggests that activation of TRPM8 by cold and menthol takes place through shifts in its voltage-activation curve, which cause the channel to open at physiological membrane potentials. By contrast, little is known about the actions of inhibitors on the function of TRPM8. We investigated the chemical and thermal modulation of TRPM8 in transfected HEK293 cells and in cold-sensitive primary sensory neurons. We show that cold-evoked TRPM8 responses are effectively suppressed by inhibitor compounds SKF96365, 4-(3-chloro-pyridin-2-yl)-piperazine-1-carboxylic acid (4-tert-butyl-phenyl)-amide (BCTC) and 1,10-phenanthroline. These antagonists exert their effect by shifting the voltage dependence of TRPM8 activation towards more positive potentials. An opposite shift towards more negative potentials is achieved by the agonist menthol. Functionally, the bidirectional shift in channel gating translates into a change in the apparent temperature threshold of TRPM8-expressing cells. Accordingly, in the presence of the antagonist compounds, the apparent response-threshold temperature of TRPM8 is displaced towards colder temperatures, whereas menthol sensitizes the response, shifting the threshold in the opposite direction. Co-application of agonists and antagonists produces predictable cancellation of these effects, suggesting the convergence on a common molecular process. The potential for half maximal activation of TRPM8 activation by cold was approximately 140 mV more negative in native channels compared to recombinant channels, with a much higher open probability at negative membrane potentials in the former. In functional terms, this difference translates

  19. The pollution of the 'iron gate' reservoir

    International Nuclear Information System (INIS)

    Babic-Mladenovic, M.; Varga, S; Popovic, L.; Damjanovic, M.

    2002-01-01

    The paper presents the characteristics of the Iron Gate I (the Djerdap) Water Power and Navigational System, one of the largest in Europe (completed in 1972 by joint efforts of Yugoslavia and Romania). In this paper the attention is devoted to review of the sediment monitoring program and impacts of reservoir sedimentation, as well as to the investigations of water and sediment quality. Special consideration is paid to the issue of sediment pollution research needs. Namely, the hot spot of the 'Iron Gate' sedimentation represents a scarcely known pollution of sediment deposits. The present pollution probably is considerable, since the 'Iron Gate' reservoir drains about 577000 km 2 , with over 80 million inhabitants, and developed municipal and industrial infrastructure. Therefore, in the thirty-year reservoir life various types of sediment-bound pollutants entered and deposited within it. Especially severe incidents happened during 1999 (as a result of NATO bombing campaign) and 2000 (two accidental pollutions in the Tisza river catchment). The study of the 'Iron Gate' reservoir pollution should be prepared in order to enlighten the present state of reservoir sedimentation and pollution. The main objectives of the study are to enhance the government and public awareness of the present environmental state of the 'Iron Gate' reservoir and to serve as a baseline for all future actions. (author)

  20. Instantons in Self-Organizing Logic Gates

    Science.gov (United States)

    Bearden, Sean R. B.; Manukian, Haik; Traversa, Fabio L.; Di Ventra, Massimiliano

    2018-03-01

    Self-organizing logic is a recently suggested framework that allows the solution of Boolean truth tables "in reverse"; i.e., it is able to satisfy the logical proposition of gates regardless to which terminal(s) the truth value is assigned ("terminal-agnostic logic"). It can be realized if time nonlocality (memory) is present. A practical realization of self-organizing logic gates (SOLGs) can be done by combining circuit elements with and without memory. By employing one such realization, we show, numerically, that SOLGs exploit elementary instantons to reach equilibrium points. Instantons are classical trajectories of the nonlinear equations of motion describing SOLGs and connect topologically distinct critical points in the phase space. By linear analysis at those points, we show that these instantons connect the initial critical point of the dynamics, with at least one unstable direction, directly to the final fixed point. We also show that the memory content of these gates affects only the relaxation time to reach the logically consistent solution. Finally, we demonstrate, by solving the corresponding stochastic differential equations, that, since instantons connect critical points, noise and perturbations may change the instanton trajectory in the phase space but not the initial and final critical points. Therefore, even for extremely large noise levels, the gates self-organize to the correct solution. Our work provides a physical understanding of, and can serve as an inspiration for, models of bidirectional logic gates that are emerging as important tools in physics-inspired, unconventional computing.

  1. Role of ATP binding and hydrolysis in the gating of the cystic fibrosis transmembrane conductance regulator

    Directory of Open Access Journals (Sweden)

    Taras Gout

    2012-01-01

    Full Text Available The CFTR gene is unique within the ATP-binding cassette (ABC protein family, predominantly of transporters, by coding a chloride channel. The gating mechanism of ABC proteins has been characterized by the ATP Switch model in terms cycles of dimer formation and dissociation linked to ATP binding and hydrolysis, respectively. It would be of interest to assess the extent that Cystic Fibrosis Transmembrane Conductance Regulator (CFTR, a functional channel, fits the ATP Switch model for ABC transporters. Additional transporter mechanisms, namely those of Pgp and HlyB, are discussed for perspective. Literature search of databases selected key references in comparing and contrasting the gating mechanism. CFTR is a functional chloride channel facilitating transmembrane anion flow down electrochemical gradients. A dysfunctional CFTR protein results in cystic fibrosis, a fatal pleiotropic disease currently managed symptomatically. Understanding the gating mechanism will help target drug development aimed at alleviating and curing the disease.

  2. Gating Systems for Sizeable Castings from Al Alloys Cast into Ceramic Moulds

    Directory of Open Access Journals (Sweden)

    I. Stachovec

    2012-04-01

    Full Text Available In contrast to casting to conventional non-reusable “sand” moulds, for which calculating technique for an optimum design of the gating system is comparatively well-developed, a trial-and-error method is applied mostly for casting to ceramic shell moulds made by the investment casting technology. A technologist selects from gating systems of several types (that are standardized by the foundry mostly on the basis of experience. However, this approach is not sustainable with ever growing demands on quality of castings and also the economy of their fabrication as well as with new types of complex sizeable castings introduced to the production gradually (by new customers from the aircraft industry above all any more. The simulation software may be used as a possible tool for making the process of optimising gating systems more effective.

  3. Bridging the Divide between Manual Gating and Bioinformatics with the Bioconductor Package flowFlowJo

    Directory of Open Access Journals (Sweden)

    John J. Gosink

    2009-01-01

    Full Text Available In flow cytometry, different cell types are usually selected or “gated” by a series of 1- or 2-dimensional geometric subsets of the measurements made on each cell. This is easily accomplished in commercial flow cytometry packages but it is difficult to work computationally with the results of this process. The ability to retrieve the results and work with both them and the raw data is critical; our experience points to the importance of bioinformatics tools that will allow us to examine gating robustness, combine manual and automated gating, and perform exploratory data analysis. To provide this capability, we have developed a Bioconductor package called flowFlowJo that can import gates defined by the commercial package FlowJo and work with them in a manner consistent with the other flow packages in Bioconductor. We present this package and illustrate some of the ways in which it can be used.

  4. Control of Target Molecular Recognition in a Small Pore Space with Biomolecule-Recognition Gating Membrane.

    Science.gov (United States)

    Okuyama, Hiroto; Oshiba, Yuhei; Ohashi, Hidenori; Yamaguchi, Takeo

    2018-05-01

    A biomolecule-recognition gating membrane, which introduces thermosensitive graft polymer including molecular recognition receptor into porous membrane substrate, can close its pores by recognizing target biomolecule. The present study reports strategies for improving both versatility and sensitivity of the gating membrane. First, the membrane is fabricated by introducing the receptor via a selectively reactive click reaction improving the versatility. Second, the sensitivity of the membrane is enhanced via an active delivering method of the target molecules into the pores. In the method, the tiny signal of the target biomolecule is amplified as obvious pressure change. Furthermore, this offers 15 times higher sensitivity compared to the previously reported passive delivering method (membrane immersion to sample solution) with significantly shorter recognition time. The improvement will aid in applying the gating membrane to membrane sensors in medical fields. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Voltage-Gated Sodium Channels: Evolutionary History and Distinctive Sequence Features.

    Science.gov (United States)

    Kasimova, M A; Granata, D; Carnevale, V

    2016-01-01

    Voltage-gated sodium channels (Nav) are responsible for the rising phase of the action potential. Their role in electrical signal transmission is so relevant that their emergence is believed to be one of the crucial factors enabling development of nervous system. The presence of voltage-gated sodium-selective channels in bacteria (BacNav) has raised questions concerning the evolutionary history of the ones in animals. Here we review some of the milestones in the field of Nav phylogenetic analysis and discuss some of the most important sequence features that distinguish these channels from voltage-gated potassium channels and transient receptor potential channels. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Fluorescence-tracking of activation gating in human ERG channels reveals rapid S4 movement and slow pore opening.

    Directory of Open Access Journals (Sweden)

    Zeineb Es-Salah-Lamoureux

    2010-05-01

    Full Text Available hERG channels are physiologically important ion channels which mediate cardiac repolarization as a result of their unusual gating properties. These are very slow activation compared with other mammalian voltage-gated potassium channels, and extremely rapid inactivation. The mechanism of slow activation is not well understood and is investigated here using fluorescence as a direct measure of S4 movement and pore opening.Tetramethylrhodamine-5-maleimide (TMRM fluorescence at E519 has been used to track S4 voltage sensor movement, and channel opening and closing in hERG channels. Endogenous cysteines (C445 and C449 in the S1-S2 linker bound TMRM, which caused a 10 mV hyperpolarization of the V((1/2 of activation to -27.5+/-2.0 mV, and showed voltage-dependent fluorescence signals. Substitution of S1-S2 linker cysteines with valines allowed unobstructed recording of S3-S4 linker E519C and L520C emission signals. Depolarization of E519C channels caused rapid initial fluorescence quenching, fit with a double Boltzmann relationship, F-V(ON, with V((1/2 (,1 = -37.8+/-1.7 mV, and V((1/2 (,2 = 43.5+/-7.9 mV. The first phase, V((1/2 (,1, was approximately 20 mV negative to the conductance-voltage relationship measured from ionic tail currents (G-V((1/2 = -18.3+/-1.2 mV, and relatively unchanged in a non-inactivating E519C:S620T mutant (V((1/2 = -34.4+/-1.5 mV, suggesting the fast initial fluorescence quenching tracked S4 voltage sensor movement. The second phase of rapid quenching was absent in the S620T mutant. The E519C fluorescence upon repolarization (V((1/2 = -20.6+/-1.2, k = 11.4 mV and L520C quenching during depolarization (V((1/2 = -26.8+/-1.0, k = 13.3 mV matched the respective voltage dependencies of hERG ionic tails, and deactivation time constants from -40 to -110 mV, suggesting they detected pore-S4 rearrangements related to ionic current flow during pore opening and closing.THE DATA INDICATE: 1 that rapid environmental changes occur at the

  7. Voltage-gated sodium channels as targets for pyrethroid insecticides.

    Science.gov (United States)

    Field, Linda M; Emyr Davies, T G; O'Reilly, Andrias O; Williamson, Martin S; Wallace, B A

    2017-10-01

    The pyrethroid insecticides are a very successful group of compounds that have been used extensively for the control of arthropod pests of agricultural crops and vectors of animal and human disease. Unfortunately, this has led to the development of resistance to the compounds in many species. The mode of action of pyrethroids is known to be via interactions with the voltage-gated sodium channel. Understanding how binding to the channel is affected by amino acid substitutions that give rise to resistance has helped to elucidate the mode of action of the compounds and the molecular basis of their selectivity for insects vs mammals and between insects and other arthropods. Modelling of the channel/pyrethroid interactions, coupled with the ability to express mutant channels in oocytes and study function, has led to knowledge of both how the channels function and potentially how to design novel insecticides with greater species selectivity.

  8. Gas-controlled dynamic vacuum insulation with gas gate

    Science.gov (United States)

    Benson, D.K.; Potter, T.F.

    1994-06-07

    Disclosed is a dynamic vacuum insulation comprising sidewalls enclosing an evacuated chamber and gas control means for releasing hydrogen gas into a chamber to increase gas molecule conduction of heat across the chamber and retrieving hydrogen gas from the chamber. The gas control means includes a metal hydride that absorbs and retains hydrogen gas at cooler temperatures and releases hydrogen gas at hotter temperatures; a hydride heating means for selectively heating the metal hydride to temperatures high enough to release hydrogen gas from the metal hydride; and gate means positioned between the metal hydride and the chamber for selectively allowing hydrogen to flow or not to flow between said metal hydride and said chamber. 25 figs.

  9. High-κ gate dielectrics: Current status and materials properties considerations

    Science.gov (United States)

    Wilk, G. D.; Wallace, R. M.; Anthony, J. M.

    2001-05-01

    Many materials systems are currently under consideration as potential replacements for SiO2 as the gate dielectric material for sub-0.1 μm complementary metal-oxide-semiconductor (CMOS) technology. A systematic consideration of the required properties of gate dielectrics indicates that the key guidelines for selecting an alternative gate dielectric are (a) permittivity, band gap, and band alignment to silicon, (b) thermodynamic stability, (c) film morphology, (d) interface quality, (e) compatibility with the current or expected materials to be used in processing for CMOS devices, (f) process compatibility, and (g) reliability. Many dielectrics appear favorable in some of these areas, but very few materials are promising with respect to all of these guidelines. A review of current work and literature in the area of alternate gate dielectrics is given. Based on reported results and fundamental considerations, the pseudobinary materials systems offer large flexibility and show the most promise toward successful integration into the expected processing conditions for future CMOS technologies, especially due to their tendency to form at interfaces with Si (e.g. silicates). These pseudobinary systems also thereby enable the use of other high-κ materials by serving as an interfacial high-κ layer. While work is ongoing, much research is still required, as it is clear that any material which is to replace SiO2 as the gate dielectric faces a formidable challenge. The requirements for process integration compatibility are remarkably demanding, and any serious candidates will emerge only through continued, intensive investigation.

  10. Respiratory gating during stereotactic body radiotherapy for lung cancer reduces tumor position variability.

    Science.gov (United States)

    Saito, Tetsuo; Matsuyama, Tomohiko; Toya, Ryo; Fukugawa, Yoshiyuki; Toyofuku, Takamasa; Semba, Akiko; Oya, Natsuo

    2014-01-01

    We evaluated the effects of respiratory gating on treatment accuracy in lung cancer patients undergoing lung stereotactic body radiotherapy by using electronic portal imaging device (EPID) images. Our study population consisted of 30 lung cancer patients treated with stereotactic body radiotherapy (48 Gy/4 fractions/4 to 9 days). Of these, 14 were treated with- (group A) and 16 without gating (group B); typically the patients whose tumors showed three-dimensional respiratory motion ≧5 mm were selected for gating. Tumor respiratory motion was estimated using four-dimensional computed tomography images acquired during treatment simulation. Tumor position variability during all treatment sessions was assessed by measuring the standard deviation (SD) and range of tumor displacement on EPID images. The two groups were compared for tumor respiratory motion and position variability using the Mann-Whitney U test. The median three-dimensional tumor motion during simulation was greater in group A than group B (9 mm, range 3-30 mm vs. 2 mm, range 0-4 mm; psimulation, tumor position variability in the EPID images was low and comparable to patients treated without gating. This demonstrates the benefit of respiratory gating.

  11. Improved performance of nanoscale junctionless tunnel field-effect transistor based on gate engineering approach

    Science.gov (United States)

    Molaei Imen Abadi, Rouzbeh; Sedigh Ziabari, Seyed Ali

    2016-11-01

    In this paper, a first qualitative study on the performance characteristics of dual-work function gate junctionless TFET (DWG-JLTFET) on the basis of energy band profile modulation is investigated. A dual-work function gate technique is used in a JLTFET in order to create a downward band bending on the source side similar to PNPN structure. Compared with the single-work function gate junctionless TFET (SWG-JLTFET), the numerical simulation results demonstrated that the DWG-JLTFET simultaneously optimizes the ON-state current, the OFF-state leakage current, and the threshold voltage and also improves average subthreshold slope. It is illustrated that if appropriate work functions are selected for the gate materials on the source side and the drain side, the JLTFET exhibits a considerably improved performance. Furthermore, the optimization design of the tunnel gate length ( L Tun) for the proposed DWG-JLTFET is studied. All the simulations are done in Silvaco TCAD for a channel length of 20 nm using the nonlocal band-to-band tunneling (BTBT) model.

  12. Gate engineered heterostructure junctionless TFET with Gaussian doping profile for ambipolar suppression and electrical performance improvement

    Science.gov (United States)

    Aghandeh, Hadi; Sedigh Ziabari, Seyed Ali

    2017-11-01

    This study investigates a junctionless tunnel field-effect transistor with a dual material gate and a heterostructure channel/source interface (DMG-H-JLTFET). We find that using the heterostructure interface improves device behavior by reducing the tunneling barrier width at the channel/source interface. Simultaneously, the dual material gate structure decreases ambipolar current by increasing the tunneling barrier width at the drain/channel interface. The performance of the device is analyzed based on the energy band diagram at on, off, and ambipolar states. Numerical simulations demonstrate improvements in ION, IOFF, ION/IOFF, subthreshold slope (SS), transconductance and cut-off frequency and suppressed ambipolar behavior. Next, the workfunction optimization of dual material gate is studied. It is found that if appropriate workfunctions are selected for tunnel and auxiliary gates, the JLTFET exhibits considerably improved performance. We then study the influence of Gaussian doping distribution at the drain and the channel on the ambipolar performance of the device and find that a Gaussian doping profile and a dual material gate structure remarkably reduce ambipolar current. Gaussian doped DMG-H-JLTFET, also exhibits enhanced IOFF, ION/IOFF, SS and a low threshold voltage without degrading IOFF.

  13. Systolically gated 3D phase contrast MRA of mesenteric arteries in suspected mesenteric ischemia

    Energy Technology Data Exchange (ETDEWEB)

    Wasser, M.N.; Schultze Kool, L.J.; Roos, A. de [Leiden Univ. Hospital (Netherlands)] [and others

    1996-03-01

    Our goal was to assess the value of MRA for detecting stenoses in the celiac (CA) and superior mesenteric (SMA) arteries in patients suspected of having chronic mesenteric ischemia, using an optimized systolically gated 3D phase contrast technique. In an initial study in 24 patients who underwent conventional angiography of the abdominal vessels for different clinical indications, a 3D phase contrast MRA technique (3D-PCA) was evaluated and optimized to image the CAs and SMAs. Subsequently, a prospective study was performed to assess the value of systolically gated 3D-PCA in evaluation of the mesenteric arteries in 10 patients with signs and symptoms of chronic mesenteric ischemia. Intraarterial digital subtraction angiography and surgical findings were used as the reference standard. In the initial study, systolic gating appeared to be essential in imaging the SMA on 3D-PCA. In 10 patients suspected of mesenteric ischemia, systolically gated 3D-PCA identified significant proximal disease in the two mesenteric vessels in 4 patients. These patients underwent successful reconstruction of their stenotic vessels. Cardiac-gated MRA may become a useful tool in selection of patients suspected of having mesenteric ischemia who may benefit from surgery. 16 refs., 6 figs., 4 tabs.

  14. Active gated imaging for automotive safety applications

    Science.gov (United States)

    Grauer, Yoav; Sonn, Ezri

    2015-03-01

    The paper presents the Active Gated Imaging System (AGIS), in relation to the automotive field. AGIS is based on a fast gated-camera equipped with a unique Gated-CMOS sensor, and a pulsed Illuminator, synchronized in the time domain to record images of a certain range of interest which are then processed by computer vision real-time algorithms. In recent years we have learned the system parameters which are most beneficial to night-time driving in terms of; field of view, illumination profile, resolution and processing power. AGIS provides also day-time imaging with additional capabilities, which enhances computer vision safety applications. AGIS provides an excellent candidate for camera-based Advanced Driver Assistance Systems (ADAS) and the path for autonomous driving, in the future, based on its outstanding low/high light-level, harsh weather conditions capabilities and 3D potential growth capabilities.

  15. Four-gate transistor analog multiplier circuit

    Science.gov (United States)

    Mojarradi, Mohammad M. (Inventor); Blalock, Benjamin (Inventor); Cristoloveanu, Sorin (Inventor); Chen, Suheng (Inventor); Akarvardar, Kerem (Inventor)

    2011-01-01

    A differential output analog multiplier circuit utilizing four G.sup.4-FETs, each source connected to a current source. The four G.sup.4-FETs may be grouped into two pairs of two G.sup.4-FETs each, where one pair has its drains connected to a load, and the other par has its drains connected to another load. The differential output voltage is taken at the two loads. In one embodiment, for each G.sup.4-FET, the first and second junction gates are each connected together, where a first input voltage is applied to the front gates of each pair, and a second input voltage is applied to the first junction gates of each pair. Other embodiments are described and claimed.

  16. ISAC's Gating-ML 2.0 data exchange standard for gating description.

    Science.gov (United States)

    Spidlen, Josef; Moore, Wayne; Brinkman, Ryan R

    2015-07-01

    The lack of software interoperability with respect to gating has traditionally been a bottleneck preventing the use of multiple analytical tools and reproducibility of flow cytometry data analysis by independent parties. To address this issue, ISAC developed Gating-ML, a computer file format to encode and interchange gates. Gating-ML 1.5 was adopted and published as an ISAC Candidate Recommendation in 2008. Feedback during the probationary period from implementors, including major commercial software companies, instrument vendors, and the wider community, has led to a streamlined Gating-ML 2.0. Gating-ML has been significantly simplified and therefore easier to support by software tools. To aid developers, free, open source reference implementations, compliance tests, and detailed examples are provided to stimulate further commercial adoption. ISAC has approved Gating-ML as a standard ready for deployment in the public domain and encourages its support within the community as it is at a mature stage of development having undergone extensive review and testing, under both theoretical and practical conditions. © 2015 International Society for Advancement of Cytometry.

  17. SEMICONDUCTOR TECHNOLOGY: TaN wet etch for application in dual-metal-gate integration technology

    Science.gov (United States)

    Yongliang, Li; Qiuxia, Xu

    2009-12-01

    Wet-etch etchants and the TaN film method for dual-metal-gate integration are investigated. Both HF/HN O3/H2O and NH4OH/H2O2 solutions can etch TaN effectively, but poor selectivity to the gate dielectric for the HF/HNO3/H2O solution due to HF being included in HF/HNO3/H2O, and the fact that TaN is difficult to etch in the NH4OH/H2O2 solution at the first stage due to the thin TaOxNy layer on the TaN surface, mean that they are difficult to individually apply to dual-metal-gate integration. A two-step wet etching strategy using the HF/HNO3/H2O solution first and the NH4OH/H2O2 solution later can fully remove thin TaN film with a photo-resist mask and has high selectivity to the HfSiON dielectric film underneath. High-k dielectric film surfaces are smooth after wet etching of the TaN metal gate and MOSCAPs show well-behaved C-V and Jg-Vg characteristics, which all prove that the wet etching of TaN has little impact on electrical performance and can be applied to dual-metal-gate integration technology for removing the first TaN metal gate in the PMOS region.

  18. The optimum choice of gate width for neutron coincidence counting

    Energy Technology Data Exchange (ETDEWEB)

    Croft, S., E-mail: crofts@ornl.gov [Safeguards and Security Technology (SST), Global Nuclear Security Technology Divisions, PO Box 2008, Building 5700, MS-6166, Oak Ridge, TN 37831-6166 (United States); Henzlova, D.; Favalli, A.; Hauck, D.K.; Santi, P.A. [Safeguards Science and Technology Group (NEN-1), Nuclear Engineering and Nonproliferation Division, MS-E540, Los Alamos, NM 87545 (United States)

    2014-11-11

    In the measurement field of international nuclear safeguards, passive neutron coincidence counting is used to quantify the spontaneous fission rate of certain special nuclear materials. The shift register autocorrelation analysis method is the most commonly used approach. However, the Feynman-Y technique, which is more commonly applied in reactor noise analysis, provides an alternative means to extract the correlation information from a pulse train. In this work we consider how to select the optimum gate width for each of these two time-correlation analysis techniques. The optimum is considered to be that which gives the lowest fractional precision on the net doublets rate. Our theoretical approach is approximate but is instructional in terms of revealing the key functional dependence. We show that in both cases the same performance figure of merit applies so that common design criteria apply to the neutron detector head. Our prediction is that near optimal results, suitable for most practical applications, can be obtained from both techniques using a common gate width setting. The estimated precision is also comparable in the two cases. The theoretical expressions are tested experimentally using {sup 252}Cf spontaneous fission sources measured in two thermal well counters representative of the type in common use by international inspectorates. Fast accidental sampling was the favored method of acquiring the Feynman-Y data. Our experimental study confirmed the basic functional dependences predicted although experimental results when available are preferred. With an appropriate gate setting Feynman-Y analysis provides an alternative to shift register analysis for safeguards applications which is opening up new avenues of data collection and data reduction to explore.

  19. Respiratory gated radiotherapy-pretreatment patient specific quality assurance

    Directory of Open Access Journals (Sweden)

    Rajesh Thiyagarajan

    2016-01-01

    Full Text Available Organ motions during inter-fraction and intra-fraction radiotherapy introduce errors in dose delivery, irradiating excess of normal tissue, and missing target volume. Lung and heart involuntary motions cause above inaccuracies and gated dose delivery try to overcome above effects. Present work attempts a novel method to verify dynamic dose delivery using a four-dimensional (4D phantom. Three patients with mobile target are coached to maintain regular and reproducible breathing pattern. Appropriate intensity projection image set generated from 4D-computed tomography (4D-CT is used for target delineation. Intensity modulated radiotherapy plans were generated on selected phase using CT simulator (Siemens AG, Germany in conjunction with "Real-time position management" (Varian, USA to acquire 4D-CT images. Verification plans were generated for both ion chamber and Gafchromic (EBT film image sets. Gated verification plans were delivered on the phantom moving with patient respiratory pattern. We developed a MATLAB-based software to generate maximum intensity projection, minimum intensity projections, and average intensity projections, also a program to convert patient breathing pattern to phantom compatible format. Dynamic thorax quality assurance (QA phantom (Computerized Imaging Reference Systems type is used to perform the patient specific QA, which holds an ion chamber and film to measure delivered radiation intensity. Exposed EBT films are analyzed and compared with treatment planning system calculated dose. The ion chamber measured dose shows good agreement with planned dose within ± 0.5% (0.203 ± 0.57%. Gamma value evaluated from EBT film shows passing rates 92–99% (96.63 ± 3.84% for 3% dose and 3 mm distance criteria. Respiratory gated treatment delivery accuracy is found to be within clinically acceptable level.

  20. Evaluation of respiratory pattern during respiratory-gated radiotherapy

    International Nuclear Information System (INIS)

    Dobashi, Suguru; Mori, Shinichiro

    2014-01-01

    The respiratory cycle is not strictly regular, and generally varies in amplitude and period from one cycle to the next. We evaluated the characteristics of respiratory patterns acquired during respiratory gating treatment in more than 300 patients. A total 331 patients treated with respiratory-gated carbon-ion beam therapy were selected from a group of patients with thoracic and abdominal conditions. Respiratory data were acquired for a total of 3,171 fractions using an external respiratory sensing monitor and evaluated for respiratory cycle, duty cycle, magnitude of baseline drift, and intrafractional/interfractional peak inhalation/exhalation positional variation. Results for the treated anatomical sites and patient positioning were compared. Mean ± SD respiratory cycle averaged over all patients was 4.1 ± 1.3 s. Mean ± SD duty cycle averaged over all patients was 36.5 ± 7.3 %. Two types of baseline drift were seen, the first decremental and the second incremental. For respiratory peak variation, the mean intrafractional variation in peak-inhalation position relative to the amplitude in the first respiratory cycle (15.5 ± 9.3 %) was significantly larger than that in exhalation (7.5 ± 4.6 %). Interfractional variations in inhalation (17.2 ± 18.5 %) were also significantly greater than those in exhalation (9.4 ± 10.0 %). Statistically significant differences were observed between patients in the supine position and those in the prone position in mean respiratory cycle, duty cycle, and intra-/interfractional variations. We quantified the characteristics of the respiratory curve based on a large number of respiratory data obtained during treatment. These results might be useful in improving the accuracy of respiratory-gated treatment.

  1. Quality verification for respiratory gated proton therapy

    International Nuclear Information System (INIS)

    Kim, Eun Sook; Jang, Yo Jong; Park, Ji Yeon; Kang, Dong Yun; Yeom, Doo Seok

    2013-01-01

    To verify accuracy of respiratory gated proton therapy by measuring and analyzing proton beam delivered when respiratory gated proton therapy is being performed in our institute. The plan data of 3 patients who took respiratory gated proton therapy were used to deliver proton beam from proton therapy system. The manufactured moving phantom was used to apply respiratory gating system to reproduce proton beam which was partially irradiated. The key characteristics of proton beam, range, spreat-out Bragg peak (SOBP) and output factor were measured 5 times and the same categories were measured in the continuous proton beam which was not performed with respiratory gating system. Multi-layer ionization chamber was used to measure range and SOBP, and Scanditronix Wellhofer and farmer chamber was used to measure output factor. The average ranges of 3 patients (A, B, C), who had taken respiratory gated proton therapy or not, were (A) 7.226, 7.230, (B) 12.216, 12.220 and (C) 19.918, 19.920 g/cm 2 and average SOBP were (A) 4.950, 4.940, (B) 6.496, 6.512 and (C) 8.486, 8.490 g/cm 2 . And average output factor were (A) 0.985, 0.984 (B) 1.026, 1.027 and (C) 1.138, 1.136 cGy/MU. The differences of average range were -0.004, -0.004, -0.002 g/cm 2 , that of SOBP were 0.010, -0.016, -0.004 g/cm 2 and that of output factor were 0.001, -0.001, 0.002 cGy/MU. It is observed that the range, SOBP and output factor of proton beam delivered when respiratory gated proton therapy is being performed have the same beam quality with no significant difference compared to the proton beam which was continuously irradiated. Therefore, this study verified the quality of proton beam delivered when respiratory gated proton therapy and confirmed the accuracy of proton therapy using this

  2. Round Gating for Low Energy Block Ciphers

    DEFF Research Database (Denmark)

    Banik, Subhadeep; Bogdanov, Andrey; Regazzoni, Francesco

    2016-01-01

    design techniques for implementing block ciphers in a low energy fashion. We concentrate on round based implementation and we discuss how gating, applied at round level can affect and improve the energy consumption of the most common lightweight block cipher currently used in the internet of things....... Additionally, we discuss how to needed gating wave can be generated. Experimental results show that our technique is able to reduce the energy consumption in most block ciphers by over 60% while incurring only a minimal overhead in hardware....

  3. Defense.gov Special Report: Travels with Gates - October 2010

    Science.gov (United States)

    - Secretary of State Hillary Rodham Clinton and Defense Secretary Robert M. Gates expressed support for the Travels Top Story Clinton, Gates Voice Support For Afghan Reconciliation BRUSSELS, Belgium, Oct. 14, 2010

  4. Gate errors in solid-state quantum-computer architectures

    International Nuclear Information System (INIS)

    Hu Xuedong; Das Sarma, S.

    2002-01-01

    We theoretically consider possible errors in solid-state quantum computation due to the interplay of the complex solid-state environment and gate imperfections. In particular, we study two examples of gate operations in the opposite ends of the gate speed spectrum, an adiabatic gate operation in electron-spin-based quantum dot quantum computation and a sudden gate operation in Cooper-pair-box superconducting quantum computation. We evaluate quantitatively the nonadiabatic operation of a two-qubit gate in a two-electron double quantum dot. We also analyze the nonsudden pulse gate in a Cooper-pair-box-based quantum-computer model. In both cases our numerical results show strong influences of the higher excited states of the system on the gate operation, clearly demonstrating the importance of a detailed understanding of the relevant Hilbert-space structure on the quantum-computer operations

  5. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking.

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-12-18

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Tunable pulse-shaping with gated graphene nanoribbons

    DEFF Research Database (Denmark)

    Prokopeva, Ludmila; Emani, Naresh K.; Boltasseva, Alexandra

    2014-01-01

    We propose a pulse-shaper made of gated graphene nanoribbons. Simulations demonstrate tunable control over the shapes of transmitted and reflected pulses using the gating bias. Initial fabrication and characterization of graphene elements is also discussed.......We propose a pulse-shaper made of gated graphene nanoribbons. Simulations demonstrate tunable control over the shapes of transmitted and reflected pulses using the gating bias. Initial fabrication and characterization of graphene elements is also discussed....

  7. Adult forebrain NMDA receptors gate social motivation and social memory.

    Science.gov (United States)

    Jacobs, Stephanie; Tsien, Joe Z

    2017-02-01

    Motivation to engage in social interaction is critical to ensure normal social behaviors, whereas dysregulation in social motivation can contribute to psychiatric diseases such as schizophrenia, autism, social anxiety disorders and post-traumatic stress disorder (PTSD). While dopamine is well known to regulate motivation, its downstream targets are poorly understood. Given the fact that the dopamine 1 (D1) receptors are often physically coupled with the NMDA receptors, we hypothesize that the NMDA receptor activity in the adult forebrain principal neurons are crucial not only for learning and memory, but also for the proper gating of social motivation. Here, we tested this hypothesis by examining sociability and social memory in inducible forebrain-specific NR1 knockout mice. These mice are ideal for exploring the role of the NR1 subunit in social behavior because the NR1 subunit can be selectively knocked out after the critical developmental period, in which NR1 is required for normal development. We found that the inducible deletion of the NMDA receptors prior to behavioral assays impaired, not only object and social recognition memory tests, but also resulted in profound deficits in social motivation. Mice with ablated NR1 subunits in the forebrain demonstrated significant decreases in sociability compared to their wild type counterparts. These results suggest that in addition to its crucial role in learning and memory, the NMDA receptors in the adult forebrain principal neurons gate social motivation, independent of neuronal development. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. r-Universal reversible logic gates

    International Nuclear Information System (INIS)

    Vos, A de; Storme, L

    2004-01-01

    Reversible logic plays a fundamental role both in ultra-low power electronics and in quantum computing. It is therefore important to know which reversible logic gates can be used as building block for the reversible implementation of an arbitrary boolean function and which cannot

  9. Gate protective device for SOS array

    Science.gov (United States)

    Meyer, J. E., Jr.; Scott, J. H.

    1972-01-01

    Protective gate device consisting of alternating heavily doped n(+) and p(+) diffusions eliminates breakdown voltages in silicon oxide on sapphire arrays caused by electrostatic discharge from person or equipment. Diffusions are easily produced during normal double epitaxial processing. Devices with nine layers had 27-volt breakdown.

  10. Phase analysis in gated blood pool tomography

    International Nuclear Information System (INIS)

    Nakajima, Kenichi; Bunko, Hisashi; Tada, Akira; Taki, Junichi; Nanbu, Ichiro

    1984-01-01

    Phase analysis of gated blood pool study has been applied to detect the site of accessory conduction pathway (ACP) in the Wolff-Parkinson-White (WPW) syndrome; however, there was a limitation to detect the precise location of ACP by phase analysis alone. In this study, we applied phase analysis to gated blood pool tomography using seven pin hole tomography (7PT) and gated emission computed tomography (GECT) in 21 patients with WPW syndrome and 3 normal subjects. In 17 patients, the sites of ACPs were confirmed by epicardial mapping and the result of the surgical division of ACP. In 7PT, the site of ACP grossly agreed to the abnormal initial phase in phase image in 5 out of 6 patients with left cardiac type. In GECT, phase images were generated in short axial, vertical and horizontal long axial sections. In 8 out of 9 patients, the site of ACP was correctly identified by phase images, and in a patient who had two ACPs, initial phase corresponded to one of the two locations. Phase analysis of gated blood pool tomography has advantages for avoiding overlap of blood pools and for estimating three-dimensional propagation of the contraction, and can be a good adjunctive method in patients with WPW syndrome. (author)

  11. Comparison of gate capacitance extraction methodologies

    NARCIS (Netherlands)

    Kazmi, S.N.R.; Schmitz, Jurriaan

    2008-01-01

    In recent years, many new capacitance-voltage measurement approaches have been presented in literature. New approaches became necessary with the rapidly increasing gate current density in newer CMOS generations. Here we present a simulation platform using Silvaco software, to describe the full chain

  12. Disrupted sensory gating in pathological gambling.

    Science.gov (United States)

    Stojanov, Wendy; Karayanidis, Frini; Johnston, Patrick; Bailey, Andrew; Carr, Vaughan; Schall, Ulrich

    2003-08-15

    Some neurochemical evidence as well as recent studies on molecular genetics suggest that pathologic gambling may be related to dysregulated dopamine neurotransmission. The current study examined sensory (motor) gating in pathologic gamblers as a putative measure of endogenous brain dopamine activity with prepulse inhibition of the acoustic startle eye-blink response and the auditory P300 event-related potential. Seventeen pathologic gamblers and 21 age- and gender-matched healthy control subjects were assessed. Both prepulse inhibition measures were recorded under passive listening and two-tone prepulse discrimination conditions. Compared to the control group, pathologic gamblers exhibited disrupted sensory (motor) gating on all measures of prepulse inhibition. Sensory motor gating deficits of eye-blink responses were most profound at 120-millisecond prepulse lead intervals in the passive listening task and at 240-millisecond prepulse lead intervals in the two-tone prepulse discrimination task. Sensory gating of P300 was also impaired in pathologic gamblers, particularly at 500-millisecond lead intervals, when performing the discrimination task on the prepulse. In the context of preclinical studies on the disruptive effects of dopamine agonists on prepulse inhibition, our findings suggest increased endogenous brain dopamine activity in pathologic gambling in line with previous neurobiological findings.

  13. Corner Office Interview: Gates Foundation's Deborah Jacobs

    Science.gov (United States)

    Miller, Rebecca

    2010-01-01

    U.S. libraries gave the world a top talent when Deborah Jacobs left her transformational role as City Librarian of Seattle in 2008 to head the Bill & Melinda Gates Foundation's Global Libraries program, the international sibling to the U.S. Libraries program. The initiative fosters national-scale projects with grantees in transitioning countries…

  14. Quantum gates via relativistic remote control

    Energy Technology Data Exchange (ETDEWEB)

    Martín-Martínez, Eduardo, E-mail: emartinm@uwaterloo.ca [Institute for Quantum Computing, University of Waterloo, Waterloo, Ontario, N2L 3G1 (Canada); Dept. Applied Math., University of Waterloo, Ontario, N2L 3G1 (Canada); Perimeter Institute for Theoretical Physics, Waterloo, Ontario N2L 2Y5 (Canada); Sutherland, Chris [Institute for Quantum Computing, University of Waterloo, Waterloo, Ontario, N2L 3G1 (Canada)

    2014-12-12

    We harness relativistic effects to gain quantum control on a stationary qubit in an optical cavity by controlling the non-inertial motion of a different probe atom. Furthermore, we show that by considering relativistic trajectories of the probe, we enhance the efficiency of the quantum control. We explore the possible use of these relativistic techniques to build 1-qubit quantum gates.

  15. State memory in solution gated epitaxial graphene

    Science.gov (United States)

    Butko, A. V.; Butko, V. Y.; Lebedev, S. P.; Lebedev, A. A.; Davydov, V. Y.; Smirnov, A. N.; Eliseyev, I. A.; Dunaevskiy, M. S.; Kumzerov, Y. A.

    2018-06-01

    We studied electrical transport in transistors fabricated on a surface of high quality epitaxial graphene with density of defects as low as 5·1010 cm-2 and observed quasistatic hysteresis with a time constant in a scale of hours. This constant is in a few orders of magnitude greater than the constant previously reported in CVD graphene. The hysteresis observed here can be described as a shift of ∼+2V of the Dirac point measured during a gate voltage increase from the position of the Dirac point measured during a gate voltage decrease. This hysteresis can be characterized as a nonvolatile quasistatic state memory effect in which the state of the gated graphene is determined by its initial state prior to entering the hysteretic region. Due to this effect the difference in resistance of the gated graphene measured in the hysteretic region at the same applied voltages can be as high as 70%. The observed effect can be explained by assuming that charge carriers in graphene and oppositely charged molecular ions from the solution form quasistable interfacial complexes at the graphene interface. These complexes likely preserve the initial state by preventing charge carriers in graphene from discharging in the hysteretic region.

  16. An electronically controlled automatic security access gate

    Directory of Open Access Journals (Sweden)

    Jonathan A. ENOKELA

    2014-11-01

    Full Text Available The security challenges being encountered in many places require electronic means of controlling access to communities, recreational centres, offices, and homes. The electronically controlled automated security access gate being proposed in this work helps to prevent an unwanted access to controlled environments. This is achieved mainly through the use of a Radio Frequency (RF transmitter-receiver pair. In the design a microcontroller is programmed to decode a given sequence of keys that is entered on a keypad and commands a transmitter module to send out this code as signal at a given radio frequency. Upon reception of this RF signal by the receiver module, another microcontroller activates a driver circuitry to operate the gate automatically. The codes for the microcontrollers were written in C language and were debugged and compiled using the KEIL Micro vision 4 integrated development environment. The resultant Hex files were programmed into the memories of the microcontrollers with the aid of a universal programmer. Software simulation was carried out using the Proteus Virtual System Modeling (VSM version 7.7. A scaled-down prototype of the system was built and tested. The electronically controlled automated security access gate can be useful in providing security for homes, organizations, and automobile terminals. The four-character password required to operate the gate gives the system an increased level of security. Due to its standalone nature of operation the system is cheaper to maintain in comparison with a manually operated type.

  17. Modeling small-signal response of GaN-based metal-insulator-semiconductor high electron mobility transistor gate stack in spill-over regime: Effect of barrier resistance and interface states

    International Nuclear Information System (INIS)

    Capriotti, M.; Fleury, C.; Oposich, M.; Bethge, O.; Strasser, G.; Pogany, D.; Lagger, P.; Ostermaier, C.

    2015-01-01

    We provide theoretical and simulation analysis of the small signal response of SiO 2 /AlGaN/GaN metal insulator semiconductor (MIS) capacitors from depletion to spill over region, where the AlGaN/SiO 2 interface is accumulated with free electrons. A lumped element model of the gate stack, including the response of traps at the III-N/dielectric interface, is proposed and represented in terms of equivalent parallel capacitance, C p , and conductance, G p . C p -voltage and G p -voltage dependences are modelled taking into account bias dependent AlGaN barrier dynamic resistance R br and the effective channel resistance. In particular, in the spill-over region, the drop of C p with the frequency increase can be explained even without taking into account the response of interface traps, solely by considering the intrinsic response of the gate stack (i.e., no trap effects) and the decrease of R br with the applied forward bias. Furthermore, we show the limitations of the conductance method for the evaluation of the density of interface traps, D it , from the G p /ω vs. angular frequency ω curves. A peak in G p /ω vs. ω occurs even without traps, merely due to the intrinsic frequency response of gate stack. Moreover, the amplitude of the G p /ω vs. ω peak saturates at high D it , which can lead to underestimation of D it . Understanding the complex interplay between the intrinsic gate stack response and the effect of interface traps is relevant for the development of normally on and normally off MIS high electron mobility transistors with stable threshold voltage

  18. Structure of a prokaryotic sodium channel pore reveals essential gating elements and an outer ion binding site common to eukaryotic channels.

    Science.gov (United States)

    Shaya, David; Findeisen, Felix; Abderemane-Ali, Fayal; Arrigoni, Cristina; Wong, Stephanie; Nurva, Shailika Reddy; Loussouarn, Gildas; Minor, Daniel L

    2014-01-23

    Voltage-gated sodium channels (NaVs) are central elements of cellular excitation. Notwithstanding advances from recent bacterial NaV (BacNaV) structures, key questions about gating and ion selectivity remain. Here, we present a closed conformation of NaVAe1p, a pore-only BacNaV derived from NaVAe1, a BacNaV from the arsenite oxidizer Alkalilimnicola ehrlichei found in Mono Lake, California, that provides insight into both fundamental properties. The structure reveals a pore domain in which the pore-lining S6 helix connects to a helical cytoplasmic tail. Electrophysiological studies of full-length BacNaVs show that two elements defined by the NaVAe1p structure, an S6 activation gate position and the cytoplasmic tail "neck", are central to BacNaV gating. The structure also reveals the selectivity filter ion entry site, termed the "outer ion" site. Comparison with mammalian voltage-gated calcium channel (CaV) selectivity filters, together with functional studies, shows that this site forms a previously unknown determinant of CaV high-affinity calcium binding. Our findings underscore commonalities between BacNaVs and eukaryotic voltage-gated channels and provide a framework for understanding gating and ion permeation in this superfamily. © 2013. Published by Elsevier Ltd. All rights reserved.

  19. High-fidelity gates in quantum dot spin qubits.

    Science.gov (United States)

    Koh, Teck Seng; Coppersmith, S N; Friesen, Mark

    2013-12-03

    Several logical qubits and quantum gates have been proposed for semiconductor quantum dots controlled by voltages applied to top gates. The different schemes can be difficult to compare meaningfully. Here we develop a theoretical framework to evaluate disparate qubit-gating schemes on an equal footing. We apply the procedure to two types of double-dot qubits: the singlet-triplet and the semiconducting quantum dot hybrid qubit. We investigate three quantum gates that flip the qubit state: a DC pulsed gate, an AC gate based on logical qubit resonance, and a gate-like process known as stimulated Raman adiabatic passage. These gates are all mediated by an exchange interaction that is controlled experimentally using the interdot tunnel coupling g and the detuning [Symbol: see text], which sets the energy difference between the dots. Our procedure has two steps. First, we optimize the gate fidelity (f) for fixed g as a function of the other control parameters; this yields an f(opt)(g) that is universal for different types of gates. Next, we identify physical constraints on the control parameters; this yields an upper bound f(max) that is specific to the qubit-gate combination. We show that similar gate fidelities (~99:5%) should be attainable for singlet-triplet qubits in isotopically purified Si, and for hybrid qubits in natural Si. Considerably lower fidelities are obtained for GaAs devices, due to the fluctuating magnetic fields ΔB produced by nuclear spins.

  20. Gate Engineering in SOI LDMOS for Device Reliability

    Directory of Open Access Journals (Sweden)

    Aanand

    2016-01-01

    Full Text Available A linearly graded doping drift region with step gate structure, used for improvement of reduced surface field (RESURF SOI LDMOS transistor performance has been simulated with 0.35µm technology in this paper. The proposed device has one poly gate and double metal gate arranged in a stepped manner, from channel to drift region. The first gate uses n+ poly (near source where as other two gates of aluminium. The first gate with thin gate oxide has good control over the channel charge. The third gate with thick gate oxide at drift region reduce gate to drain capacitance. The arrangement of second and third gates in a stepped manner in drift region spreads the electric field uniformly. Using two dimensional device simulations, the proposed SOI LDMOS is compared with conventional structure and the extended metal structure. We demonstrate that the proposed device exhibits significant enhancement in linearity, breakdown voltage, on-resistance and HCI. Double metal gate reduces the impact ionization area which helps to improve the Hot Carrier Injection effect..

  1. Normal p50 gating in unmedicated schizophrenia outpatients

    DEFF Research Database (Denmark)

    Arnfred, Sidse M; Chen, Andrew C.N.; Glenthøj, Birte Y

    2003-01-01

    The hypothesis of a sensory gating defect in schizophrenia has been supported by studies demonstrating deficient auditory P50 gating in patients. P50 gating is the relative attenuation of P50 amplitude in the auditory evoked potential following the second auditory stimulus of a stimulus pair....

  2. Optical Co-Incidence Gate | Srinivasulu | African Journal of Science ...

    African Journals Online (AJOL)

    The paper explains Optical co-incidence gate, realized using Unijunction transistors (UJT), Light emitting diodes (LED) and Photo-resistors (LDR), which works on 1.8Vdc instead of 3Vdc. The power dissipation of the designed gate is only 3 mW. This optical gate finds application in the field of Mechatronics, Instrumentation ...

  3. High frequency MOSFET gate drivers technologies and applications

    CERN Document Server

    Zhang, Zhiliang

    2017-01-01

    This book describes high frequency power MOSFET gate driver technologies, including gate drivers for GaN HEMTs, which have great potential in the next generation of switching power converters. Gate drivers serve as a critical role between control and power devices.

  4. Online junction temperature measurement using peak gate current

    DEFF Research Database (Denmark)

    Baker, Nick; Munk-Nielsen, Stig; Iannuzzo, Francesco

    2015-01-01

    A new method for junction temperature measurement of MOS-gated power semiconductor switches is presented. The measurement method involves detecting the peak voltage over the external gate resistor of an IGBT or MOSFET during turn-on. This voltage is directly proportional to the peak gate current...

  5. Low band-to-band tunnelling and gate tunnelling current in novel nanoscale double-gate architecture: simulations and investigation

    Energy Technology Data Exchange (ETDEWEB)

    Datta, Deepanjan [Department of Electrical and Computer Engineering, Purdue University, West Lafayette, IN 47906 (United States); Ganguly, Samiran [Department of Electronics Engineering, Indian School of Mines, Dhanbad-826004 (India); Dasgupta, S [Department of Electronics and Computer Engineering, Indian Institute of Technology, Roorkee-247667 (India)

    2007-05-30

    Large band-to-band tunnelling (BTBT) and gate leakage current can limit scalability of nanoscale devices. In this paper, we have proposed a novel nanoscale parallel connected heteromaterial double gate (PCHEM-DG) architecture with triple metal gate which significantly suppress BTBT leakage, making it efficient for low power design in the sub-10 nm regime. We have also proposed a triple gate device with p{sup +} poly-n{sup +} poly-p{sup +} poly gate which has substantially low gate leakage over symmetric DG MOSFET. Simulations are performed using a 2D Poisson-Schroedinger simulator and verified with a 2D device simulator ATLAS. We conclude that, due to intrinsic body doping, negligible gate leakage, suppressed BTBT over symmetric DG devices, metal gate (MG) PCHEM-DG MOSFET is efficient for low power circuit design in the nanometre regime.

  6. Low band-to-band tunnelling and gate tunnelling current in novel nanoscale double-gate architecture: simulations and investigation

    International Nuclear Information System (INIS)

    Datta, Deepanjan; Ganguly, Samiran; Dasgupta, S

    2007-01-01

    Large band-to-band tunnelling (BTBT) and gate leakage current can limit scalability of nanoscale devices. In this paper, we have proposed a novel nanoscale parallel connected heteromaterial double gate (PCHEM-DG) architecture with triple metal gate which significantly suppress BTBT leakage, making it efficient for low power design in the sub-10 nm regime. We have also proposed a triple gate device with p + poly-n + poly-p + poly gate which has substantially low gate leakage over symmetric DG MOSFET. Simulations are performed using a 2D Poisson-Schroedinger simulator and verified with a 2D device simulator ATLAS. We conclude that, due to intrinsic body doping, negligible gate leakage, suppressed BTBT over symmetric DG devices, metal gate (MG) PCHEM-DG MOSFET is efficient for low power circuit design in the nanometre regime

  7. Angle-independent measure of motion for image-based gating in 3D coronary angiography

    International Nuclear Information System (INIS)

    Lehmann, Glen C.; Holdsworth, David W.; Drangova, Maria

    2006-01-01

    compared to an ECG-based gating strategy in a porcine model. The image-based gating strategy selected 61 projection images, compared to 45 selected by the ECG-gating strategy. Qualitative comparison revealed that although both the SIC-based and ECG-gated reconstructions decreased motion artifact compared to reconstruction with no gating, the SIC-based gating technique increased the conspicuity of smaller vessels when compared to ECG gating in maximum intensity projections of the reconstructions and increased the sharpness of a vessel cross section in multi-planar reformats of the reconstruction

  8. Tuning the allosteric regulation of artificial muscarinic and dopaminergic ligand-gated potassium channels by protein engineering of G protein-coupled receptors

    Science.gov (United States)

    Moreau, Christophe J.; Revilloud, Jean; Caro, Lydia N.; Dupuis, Julien P.; Trouchet, Amandine; Estrada-Mondragón, Argel; Nieścierowicz, Katarzyna; Sapay, Nicolas; Crouzy, Serge; Vivaudou, Michel

    2017-01-01

    Ligand-gated ion channels enable intercellular transmission of action potential through synapses by transducing biochemical messengers into electrical signal. We designed artificial ligand-gated ion channels by coupling G protein-coupled receptors to the Kir6.2 potassium channel. These artificial channels called ion channel-coupled receptors offer complementary properties to natural channels by extending the repertoire of ligands to those recognized by the fused receptors, by generating more sustained signals and by conferring potassium selectivity. The first artificial channels based on the muscarinic M2 and the dopaminergic D2L receptors were opened and closed by acetylcholine and dopamine, respectively. We find here that this opposite regulation of the gating is linked to the length of the receptor C-termini, and that C-terminus engineering can precisely control the extent and direction of ligand gating. These findings establish the design rules to produce customized ligand-gated channels for synthetic biology applications. PMID:28145461

  9. Time-Gated Raman Spectroscopy for Quantitative Determination of Solid-State Forms of Fluorescent Pharmaceuticals.

    Science.gov (United States)

    Lipiäinen, Tiina; Pessi, Jenni; Movahedi, Parisa; Koivistoinen, Juha; Kurki, Lauri; Tenhunen, Mari; Yliruusi, Jouko; Juppo, Anne M; Heikkonen, Jukka; Pahikkala, Tapio; Strachan, Clare J

    2018-04-03

    Raman spectroscopy is widely used for quantitative pharmaceutical analysis, but a common obstacle to its use is sample fluorescence masking the Raman signal. Time-gating provides an instrument-based method for rejecting fluorescence through temporal resolution of the spectral signal and allows Raman spectra of fluorescent materials to be obtained. An additional practical advantage is that analysis is possible in ambient lighting. This study assesses the efficacy of time-gated Raman spectroscopy for the quantitative measurement of fluorescent pharmaceuticals. Time-gated Raman spectroscopy with a 128 × (2) × 4 CMOS SPAD detector was applied for quantitative analysis of ternary mixtures of solid-state forms of the model drug, piroxicam (PRX). Partial least-squares (PLS) regression allowed quantification, with Raman-active time domain selection (based on visual inspection) improving performance. Model performance was further improved by using kernel-based regularized least-squares (RLS) regression with greedy feature selection in which the data use in both the Raman shift and time dimensions was statistically optimized. Overall, time-gated Raman spectroscopy, especially with optimized data analysis in both the spectral and time dimensions, shows potential for sensitive and relatively routine quantitative analysis of photoluminescent pharmaceuticals during drug development and manufacturing.

  10. COHERENTLY DEDISPERSED GATED IMAGING OF MILLISECOND PULSARS

    International Nuclear Information System (INIS)

    Roy, Jayanta; Bhattacharyya, Bhaswati

    2013-01-01

    Motivated by the need for rapid localization of newly discovered faint millisecond pulsars (MSPs), we have developed a coherently dedispersed gating correlator. This gating correlator accounts for the orbital motions of MSPs in binaries while folding the visibilities with a best-fit topocentric rotational model derived from a periodicity search in a simultaneously generated beamformer output. Unique applications of the gating correlator for sensitive interferometric studies of MSPs are illustrated using the Giant Metrewave Radio Telescope (GMRT) interferometric array. We could unambiguously localize five newly discovered Fermi MSPs in the on-off gated image plane with an accuracy of ±1''. Immediate knowledge of such a precise position enables the use of sensitive coherent beams of array telescopes for follow-up timing observations which substantially reduces the use of telescope time (∼20× for the GMRT). In addition, a precise a priori astrometric position reduces the effect of large covariances in the timing fit (with discovery position, pulsar period derivative, and an unknown binary model), which in-turn accelerates the convergence to the initial timing model. For example, while fitting with the precise a priori position (±1''), the timing model converges in about 100 days, accounting for the effect of covariance between the position and pulsar period derivative. Moreover, such accurate positions allow for rapid identification of pulsar counterparts at other wave bands. We also report a new methodology of in-beam phase calibration using the on-off gated image of the target pulsar, which provides optimal sensitivity of the coherent array removing possible temporal and spacial decoherences.

  11. COHERENTLY DEDISPERSED GATED IMAGING OF MILLISECOND PULSARS

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Jayanta; Bhattacharyya, Bhaswati [National Centre for Radio Astrophysics, Pune 411007 (India)

    2013-03-10

    Motivated by the need for rapid localization of newly discovered faint millisecond pulsars (MSPs), we have developed a coherently dedispersed gating correlator. This gating correlator accounts for the orbital motions of MSPs in binaries while folding the visibilities with a best-fit topocentric rotational model derived from a periodicity search in a simultaneously generated beamformer output. Unique applications of the gating correlator for sensitive interferometric studies of MSPs are illustrated using the Giant Metrewave Radio Telescope (GMRT) interferometric array. We could unambiguously localize five newly discovered Fermi MSPs in the on-off gated image plane with an accuracy of {+-}1''. Immediate knowledge of such a precise position enables the use of sensitive coherent beams of array telescopes for follow-up timing observations which substantially reduces the use of telescope time ({approx}20 Multiplication-Sign for the GMRT). In addition, a precise a priori astrometric position reduces the effect of large covariances in the timing fit (with discovery position, pulsar period derivative, and an unknown binary model), which in-turn accelerates the convergence to the initial timing model. For example, while fitting with the precise a priori position ({+-}1''), the timing model converges in about 100 days, accounting for the effect of covariance between the position and pulsar period derivative. Moreover, such accurate positions allow for rapid identification of pulsar counterparts at other wave bands. We also report a new methodology of in-beam phase calibration using the on-off gated image of the target pulsar, which provides optimal sensitivity of the coherent array removing possible temporal and spacial decoherences.

  12. Dosimetry applications in GATE Monte Carlo toolkit.

    Science.gov (United States)

    Papadimitroulas, Panagiotis

    2017-09-01

    Monte Carlo (MC) simulations are a well-established method for studying physical processes in medical physics. The purpose of this review is to present GATE dosimetry applications on diagnostic and therapeutic simulated protocols. There is a significant need for accurate quantification of the absorbed dose in several specific applications such as preclinical and pediatric studies. GATE is an open-source MC toolkit for simulating imaging, radiotherapy (RT) and dosimetry applications in a user-friendly environment, which is well validated and widely accepted by the scientific community. In RT applications, during treatment planning, it is essential to accurately assess the deposited energy and the absorbed dose per tissue/organ of interest, as well as the local statistical uncertainty. Several types of realistic dosimetric applications are described including: molecular imaging, radio-immunotherapy, radiotherapy and brachytherapy. GATE has been efficiently used in several applications, such as Dose Point Kernels, S-values, Brachytherapy parameters, and has been compared against various MC codes which are considered as standard tools for decades. Furthermore, the presented studies show reliable modeling of particle beams when comparing experimental with simulated data. Examples of different dosimetric protocols are reported for individualized dosimetry and simulations combining imaging and therapy dose monitoring, with the use of modern computational phantoms. Personalization of medical protocols can be achieved by combining GATE MC simulations with anthropomorphic computational models and clinical anatomical data. This is a review study, covering several dosimetric applications of GATE, and the different tools used for modeling realistic clinical acquisitions with accurate dose assessment. Copyright © 2017 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  13. Sensing small neurotransmitter-enzyme interaction with nanoporous gated ion-sensitive field effect transistors.

    Science.gov (United States)

    Kisner, Alexandre; Stockmann, Regina; Jansen, Michael; Yegin, Ugur; Offenhäusser, Andreas; Kubota, Lauro Tatsuo; Mourzina, Yulia

    2012-01-15

    Ion-sensitive field effect transistors with gates having a high density of nanopores were fabricated and employed to sense the neurotransmitter dopamine with high selectivity and detectability at micromolar range. The nanoporous structure of the gates was produced by applying a relatively simple anodizing process, which yielded a porous alumina layer with pores exhibiting a mean diameter ranging from 20 to 35 nm. Gate-source voltages of the transistors demonstrated a pH-dependence that was linear over a wide range and could be understood as changes in surface charges during protonation and deprotonation. The large surface area provided by the pores allowed the physical immobilization of tyrosinase, which is an enzyme that oxidizes dopamine, on the gates of the transistors, and thus, changes the acid-base behavior on their surfaces. Concentration-dependent dopamine interacting with immobilized tyrosinase showed a linear dependence into a physiological range of interest for dopamine concentration in the changes of gate-source voltages. In comparison with previous approaches, a response time relatively fast for detecting dopamine was obtained. Additionally, selectivity assays for other neurotransmitters that are abundantly found in the brain were examined. These results demonstrate that the nanoporous structure of ion-sensitive field effect transistors can easily be used to immobilize specific enzyme that can readily and selectively detect small neurotransmitter molecule based on its acid-base interaction with the receptor. Therefore, it could serve as a technology platform for molecular studies of neurotransmitter-enzyme binding and drugs screening. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Low-power DRAM-compatible Replacement Gate High-k/Metal Gate Stacks

    Science.gov (United States)

    Ritzenthaler, R.; Schram, T.; Bury, E.; Spessot, A.; Caillat, C.; Srividya, V.; Sebaai, F.; Mitard, J.; Ragnarsson, L.-Å.; Groeseneken, G.; Horiguchi, N.; Fazan, P.; Thean, A.

    2013-06-01

    In this work, the possibility of integration of High-k/Metal Gate (HKMG), Replacement Metal Gate (RMG) gate stacks for low power DRAM compatible transistors is studied. First, it is shown that RMG gate stacks used for Logic applications need to be seriously reconsidered, because of the additional anneal(s) needed in a DRAM process. New solutions are therefore developed. A PMOS stack HfO2/TiN with TiN deposited in three times combined with Work Function metal oxidations is demonstrated, featuring a very good Work Function of 4.95 eV. On the other hand, the NMOS side is shown to be a thornier problem to solve: a new solution based on the use of oxidized Ta as a diffusion barrier is proposed, and a HfO2/TiN/TaOX/TiAl/TiN/TiN gate stack featuring an aggressive Work Function of 4.35 eV (allowing a Work Function separation of 600 mV between NMOS and PMOS) is demonstrated. This work paves the way toward the integration of gate-last options for DRAM periphery transistors.

  15. Accuracy and Consistency of Respiratory Gating in Abdominal Cancer Patients

    International Nuclear Information System (INIS)

    Ge, Jiajia; Santanam, Lakshmi; Yang, Deshan; Parikh, Parag J.

    2013-01-01

    Purpose: To evaluate respiratory gating accuracy and intrafractional consistency for abdominal cancer patients treated with respiratory gated treatment on a regular linear accelerator system. Methods and Materials: Twelve abdominal patients implanted with fiducials were treated with amplitude-based respiratory-gated radiation therapy. On the basis of daily orthogonal fluoroscopy, the operator readjusted the couch position and gating window such that the fiducial was within a setup margin (fiducial-planning target volume [f-PTV]) when RPM indicated “beam-ON.” Fifty-five pre- and post-treatment fluoroscopic movie pairs with synchronized respiratory gating signal were recorded. Fiducial motion traces were extracted from the fluoroscopic movies using a template matching algorithm and correlated with f-PTV by registering the digitally reconstructed radiographs with the fluoroscopic movies. Treatment was determined to be “accurate” if 50% of the fiducial area stayed within f-PTV while beam-ON. For movie pairs that lost gating accuracy, a MATLAB program was used to assess whether the gating window was optimized, the external-internal correlation (EIC) changed, or the patient moved between movies. A series of safety margins from 0.5 mm to 3 mm was added to f-PTV for reassessing gating accuracy. Results: A decrease in gating accuracy was observed in 44% of movie pairs from daily fluoroscopic movies of 12 abdominal patients. Three main causes for inaccurate gating were identified as change of global EIC over time (∼43%), suboptimal gating setup (∼37%), and imperfect EIC within movie (∼13%). Conclusions: Inconsistent respiratory gating accuracy may occur within 1 treatment session even with a daily adjusted gating window. To improve or maintain gating accuracy during treatment, we suggest using at least a 2.5-mm safety margin to account for gating and setup uncertainties

  16. Ant Colony Algorithm and Simulation for Robust Airport Gate Assignment

    Directory of Open Access Journals (Sweden)

    Hui Zhao

    2014-01-01

    Full Text Available Airport gate assignment is core task for airport ground operations. Due to the fact that the departure and arrival time of flights may be influenced by many random factors, the airport gate assignment scheme may encounter gate conflict and many other problems. This paper aims at finding a robust solution for airport gate assignment problem. A mixed integer model is proposed to formulate the problem, and colony algorithm is designed to solve this model. Simulation result shows that, in consideration of robustness, the ability of antidisturbance for airport gate assignment scheme has much improved.

  17. Exchange gate on the qudit space and Fock space

    International Nuclear Information System (INIS)

    Fujii, Kazuyuki

    2003-01-01

    We construct an exchange gate with small elementary gates on the space of qudits, which consist of three controlled shift gates and three 'reverse' gates. This is a natural extension of the qubit case. We also consider a similar situation in Fock space, but in this case we find some differences. However, we can construct the exchange gate by making use of a generalized coherent operator based on the Lie algebra su(2), which is a well-known method in quantum optics. We also make a brief comment on 'imperfect clones'

  18. Edge-on gating effect in molecular wires.

    Science.gov (United States)

    Lo, Wai-Yip; Bi, Wuguo; Li, Lianwei; Jung, In Hwan; Yu, Luping

    2015-02-11

    This work demonstrates edge-on chemical gating effect in molecular wires utilizing the pyridinoparacyclophane (PC) moiety as the gate. Different substituents with varied electronic demands are attached to the gate to simulate the effect of varying gating voltages similar to that in field-effect transistor (FET). It was observed that the orbital energy level and charge carrier's tunneling barriers can be tuned by changing the gating group from strong electron acceptors to strong electron donors. The single molecule conductance and current-voltage characteristics of this molecular system are truly similar to those expected for an actual single molecular transistor.

  19. Characterization of a Common-Gate Amplifier Using Ferroelectric Transistors

    Science.gov (United States)

    Hunt, Mitchell; Sayyah, Rana; MacLeod, Todd C.; Ho, Fat D.

    2011-01-01

    In this paper, the empirical data collected through experiments performed using a FeFET in the common-gate amplifier circuit is presented. The FeFET common-gate amplifier was characterized by varying all parameters in the circuit, such as load resistance, biasing of the transistor, and input voltages. Due to the polarization of the ferroelectric layer, the particular behavior of the FeFET common-gate amplifier presents interesting results. Furthermore, the differences between a FeFET common-gate amplifier and a MOSFET common-gate amplifier are examined.

  20. Unimolecular Logic Gate with Classical Input by Single Gold Atoms.

    Science.gov (United States)

    Skidin, Dmitry; Faizy, Omid; Krüger, Justus; Eisenhut, Frank; Jancarik, Andrej; Nguyen, Khanh-Hung; Cuniberti, Gianaurelio; Gourdon, Andre; Moresco, Francesca; Joachim, Christian

    2018-02-27

    By a combination of solution and on-surface chemistry, we synthesized an asymmetric starphene molecule with two long anthracenyl input branches and a short naphthyl output branch on the Au(111) surface. Starting from this molecule, we could demonstrate the working principle of a single molecule NAND logic gate by selectively contacting single gold atoms by atomic manipulation to the longer branches of the molecule. The logical input "1" ("0") is defined by the interaction (noninteraction) of a gold atom with one of the input branches. The output is measured by scanning tunneling spectroscopy following the shift in energy of the electronic tunneling resonances at the end of the short branch of the molecule.

  1. Ballistic transport of graphene pnp junctions with embedded local gates

    International Nuclear Information System (INIS)

    Nam, Seung-Geol; Ki, Dong-Keun; Kim, Youngwook; Kim, Jun Sung; Lee, Hu-Jong; Park, Jong Wan

    2011-01-01

    We fabricated graphene pnp devices, by embedding pre-defined local gates in an oxidized surface layer of a silicon substrate. With neither deposition of dielectric material on the graphene nor electron-beam irradiation, we obtained high-quality graphene pnp devices without degradation of the carrier mobility even in the local-gate region. The corresponding increased mean free path leads to the observation of ballistic and phase-coherent transport across a local gate 130 nm wide, which is about an order of magnitude wider than reported previously. Furthermore, in our scheme, we demonstrated independent control of the carrier density in the local-gate region, with a conductance map very much distinct from those of top-gated devices. This was caused by the electric field arising from the global back gate being strongly screened by the embedded local gate. Our scheme allows the realization of ideal multipolar graphene junctions with ballistic carrier transport.

  2. Synthesis of multivalued quantum logic circuits by elementary gates

    Science.gov (United States)

    Di, Yao-Min; Wei, Hai-Rui

    2013-01-01

    We propose the generalized controlled X (gcx) gate as the two-qudit elementary gate, and based on Cartan decomposition, we also give the one-qudit elementary gates. Then we discuss the physical implementation of these elementary gates and show that it is feasible with current technology. With these elementary gates many important qudit quantum gates can be synthesized conveniently. We provide efficient methods for the synthesis of various kinds of controlled qudit gates and greatly simplify the synthesis of existing generic multi-valued quantum circuits. Moreover, we generalize the quantum Shannon decomposition (QSD), the most powerful technique for the synthesis of generic qubit circuits, to the qudit case. A comparison of ququart (d=4) circuits and qubit circuits reveals that using ququart circuits may have an advantage over the qubit circuits in the synthesis of quantum circuits.

  3. Double-gated spectral snapshots for biomolecular fluorescence

    International Nuclear Information System (INIS)

    Nakamura, Ryosuke; Hamada, Norio; Ichida, Hideki; Tokunaga, Fumio; Kanematsu, Yasuo

    2007-01-01

    A versatile method to take femtosecond spectral snapshots of fluorescence has been developed based on a double gating technique in the combination of an optical Kerr gate and an image intensifier as an electrically driven gate set in front of a charge-coupled device detector. The application of a conventional optical-Kerr-gate method is limited to molecules with the short fluorescence lifetime up to a few hundred picoseconds, because long-lifetime fluorescence itself behaves as a source of the background signal due to insufficiency of the extinction ratio of polarizers employed for the Kerr gate. By using the image intensifier with the gate time of 200 ps, we have successfully suppressed the background signal and overcome the application limit of optical-Kerr-gate method. The system performance has been demonstrated by measuring time-resolved fluorescence spectra for laser dye solution and the riboflavin solution as a typical sample of biomolecule

  4. Aptamer-Gated Nanoparticles for Smart Drug Delivery

    Directory of Open Access Journals (Sweden)

    Huseyin Avni Oktem

    2011-08-01

    Full Text Available Aptamers are functional nucleic acid sequences which can bind specific targets. An artificial combinatorial methodology can identify aptamer sequences for any target molecule, from ions to whole cells. Drug delivery systems seek to increase efficacy and reduce side-effects by concentrating the therapeutic agents at specific disease sites in the body. This is generally achieved by specific targeting of inactivated drug molecules. Aptamers which can bind to various cancer cell types selectively and with high affinity have been exploited in a variety of drug delivery systems for therapeutic purposes. Recent progress in selection of cell-specific aptamers has provided new opportunities in targeted drug delivery. Especially functionalization of nanoparticles with such aptamers has drawn major attention in the biosensor and biomedical areas. Moreover, nucleic acids are recognized as an attractive building materials in nanomachines because of their unique molecular recognition properties and structural features. A active controlled delivery of drugs once targeted to a disease site is a major research challenge. Stimuli-responsive gating is one way of achieving controlled release of nanoparticle cargoes. Recent reports incorporate the structural properties of aptamers in controlled release systems of drug delivering nanoparticles. In this review, the strategies for using functional nucleic acids in creating smart drug delivery devices will be explained. The main focus will be on aptamer-incorporated nanoparticle systems for drug delivery purposes in order to assess the future potential of aptamers in the therapeutic area. Special emphasis will be given to the very recent progress in controlled drug release based on molecular gating achieved with aptamers.

  5. Rapid gated Thallium-201 perfusion SPECT - clinically feasible?

    International Nuclear Information System (INIS)

    Wadhwa, S.S.; Mansberg, R.; Fernandes, V.B.; Wilkinson, D.; Abatti, D.

    1998-01-01

    Full text: Standard dose energy window optimised Thallium-201 (Tl-201) SPECT has about half the counts of a standard dose from Technetium-99m Sestamibi (Tc99m-Mibi) gated perfusion SPECT. This study investigates the clinical feasibility of rapid energy window optimised Tl-201 gated perfusion SPECT (gated-TI) and compares quantitative left ventricular ejection fraction (LVEF) and visually assessed image quality for wall motion and thickening to analogous values obtained from Tc99m-Mibi gated perfusion SPECT (gated - mibi). Methods: We studied 60 patients with a rest gated Tl-201 SPECT (100 MBq, 77KeV peak, 34% window, 20 sec/projection) followed by a post stress gated Sestamibi SPECT (1GBq, 140KeV, 20% window, 20 sec/projection) separate dual isotope protocol. LVEF quantitation was performed using commercially available software (SPECTEF, General Electric). Visual grading of image quality for wall thickening and motion was performed using a three-point scale (excellent, good and poor). Results: LVEF for gated Tl-201 SPECT was 59.6 ± 12.0% (Mean ± SD). LVEF for gated Sestamibi SPECT was 60.4 ±11.4% (Mean ± SD). These were not significantly different (P=0.27, T-Test). There was good correlation (r=0.9) between gated-TI and gated-mibi LVEF values. The quality of gated-Tl images was ranked as excellent, good and poor in 12, 50 and 38% of the patients respectively. Image quality was better in gated-mibi SPECT, with ratings of 12, 62 and 26% respectively. Conclusion: Rapid gated Thallium-201 acquisition with energy window optimisation can be effectively performed on majority of patients and offers the opportunity to assess not only myocardial perfusion and function, as with Technetium based agents, but also viability using a single day one isotope protocol

  6. Fast, high-fidelity, all-optical and dynamically-controlled polarization gate using room-temperature atomic vapor

    Energy Technology Data Exchange (ETDEWEB)

    Li, Runbing [National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan 430071 (China); Center for Cold Atom Physics, Chinese Academy of Sciences, Wuhan 430071 (China); Zhu, Chengjie [National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); School of Physics Science and Engineering, Tongji University, Shanghai 200092 (China); Deng, L.; Hagley, E. W. [National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States)

    2014-10-20

    We demonstrate a fast, all-optical polarization gate in a room-temperature atomic medium. Using a Polarization-Selective-Kerr-Phase-Shift (PSKPS) technique, we selectively write a π phase shift to one circularly-polarized component of a linearly-polarized input signal field. The output signal field maintains its original strength but acquires a 90° linear polarization rotation, demonstrating fast, high-fidelity, dynamically-controlled polarization gate operation. The intensity of the polarization-switching field used in this PKSPK-based polarization gate operation is only 2 mW/cm{sup 2}, which would be equivalent to 0.5 nW of light power (λ = 800 nm) confined in a typical commercial photonic hollow-core fiber. This development opens a realm of possibilities for potential future extremely low light level telecommunication and information processing systems.

  7. Dynamic load effects on gate valve operability

    International Nuclear Information System (INIS)

    Steele, R. Jr.; MacDonald, P.E.; Arendts, J.G.

    1986-01-01

    The Idaho National Engineering Laboratory (INEL) participated in an internationally sponsored seismic research program conducted at the decommissioned Heissdampfreaktor (HDR) located in the Federal Republic of Germany. An existing piping system was modified by installation of an 8-in., naturally aged, motor-operated gate valve from a US nuclear power plant and a piping support system of US design. Six other piping support systems of varying flexibility from stiff to flexible were also installed at various times during the tests. Additional valve loadings included internal hydraulic loads and, during one block of tests, elevated temperature. The operability and integrity of the aged gate valve and the dynamic response of the various piping support system were measured during 25 representative seismic events

  8. Gate Control Coefficient Effect on CNFET Characteristic

    International Nuclear Information System (INIS)

    Sanudin, Rahmat; Ma'Radzi, Ahmad Alabqari; Nayan, Nafarizal

    2009-01-01

    The development of carbon nanotube field-effect transistor (CNFET) as alternative to existing transistor technology has long been published and discussed. The emergence of this device offers new material and structure in building a transistor. This paper intends to do an analysis of gate control coefficient effect on CNFET performance. The analysis is based on simulation study of current-voltage (I-V) characteristic of ballistic CNFET. The simulation study used the MOSFET-like CNFET mathematical model to establish the device output characteristic. Based on the analysis of simulation result, it is found that the gate control coefficient contributes to a significant effect on the performance of CNFET. The result also shown the parameter could help to improve the device performance in terms of its output and response as well. Nevertheless, the characteristic of the carbon nanotube that acts as the channel is totally important in determining the performance of the transistor as a whole.

  9. Floating Gate CMOS Dosimeter With Frequency Output

    Science.gov (United States)

    Garcia-Moreno, E.; Isern, E.; Roca, M.; Picos, R.; Font, J.; Cesari, J.; Pineda, A.

    2012-04-01

    This paper presents a gamma radiation dosimeter based on a floating gate sensor. The sensor is coupled with a signal processing circuitry, which furnishes a square wave output signal, the frequency of which depends on the total dose. Like any other floating gate dosimeter, it exhibits zero bias operation and reprogramming capabilities. The dosimeter has been designed in a standard 0.6 m CMOS technology. The whole dosimeter occupies a silicon area of 450 m250 m. The initial sensitivity to a radiation dose is Hz/rad, and to temperature and supply voltage is kHz/°C and 0.067 kHz/mV, respectively. The lowest detectable dose is less than 1 rad.

  10. Water-gel for gating graphene transistors.

    Science.gov (United States)

    Kim, Beom Joon; Um, Soong Ho; Song, Woo Chul; Kim, Yong Ho; Kang, Moon Sung; Cho, Jeong Ho

    2014-05-14

    Water, the primary electrolyte in biology, attracts significant interest as an electrolyte-type dielectric material for transistors compatible with biological systems. Unfortunately, the fluidic nature and low ionic conductivity of water prevents its practical usage in such applications. Here, we describe the development of a solid state, megahertz-operating, water-based gate dielectric system for operating graphene transistors. The new electrolyte systems were prepared by dissolving metal-substituted DNA polyelectrolytes into water. The addition of these biocompatible polyelectrolytes induced hydrogelation to provide solid-state integrity to the system. They also enhanced the ionic conductivities of the electrolytes, which in turn led to the quick formation of an electric double layer at the graphene/electrolyte interface that is beneficial for modulating currents in graphene transistors at high frequencies. At the optimized conditions, the Na-DNA water-gel-gated flexible transistors and inverters were operated at frequencies above 1 MHz and 100 kHz, respectively.

  11. SWNT array resonant gate MOS transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arun, A; Salet, P; Ionescu, A M [NanoLab, Ecole Polytechnique Federale de Lausanne, CH-1015, Lausanne (Switzerland); Campidelli, S; Filoramo, A; Derycke, V; Goffman, M F, E-mail: marcelo.goffman@cea.fr [Laboratoire d' Electronique Moleculaire, SPEC (CNRS URA 2454), IRAMIS, CEA, Gif-sur-Yvette (France)

    2011-02-04

    We show that thin horizontal arrays of single wall carbon nanotubes (SWNTs) suspended above the channel of silicon MOSFETs can be used as vibrating gate electrodes. This new class of nano-electromechanical system (NEMS) combines the unique mechanical and electronic properties of SWNTs with an integrated silicon-based motion detection. Its electrical response exhibits a clear signature of the mechanical resonance of SWNT arrays (120-150 MHz) showing that these thin horizontal arrays behave as a cohesive, rigid and elastic body membrane with a Young's modulus in the order of 1-10 GPa and ultra-low mass. The resonant frequency can be tuned by the gate voltage and its dependence is well understood within the continuum mechanics framework.

  12. SWNT array resonant gate MOS transistor.

    Science.gov (United States)

    Arun, A; Campidelli, S; Filoramo, A; Derycke, V; Salet, P; Ionescu, A M; Goffman, M F

    2011-02-04

    We show that thin horizontal arrays of single wall carbon nanotubes (SWNTs) suspended above the channel of silicon MOSFETs can be used as vibrating gate electrodes. This new class of nano-electromechanical system (NEMS) combines the unique mechanical and electronic properties of SWNTs with an integrated silicon-based motion detection. Its electrical response exhibits a clear signature of the mechanical resonance of SWNT arrays (120-150 MHz) showing that these thin horizontal arrays behave as a cohesive, rigid and elastic body membrane with a Young's modulus in the order of 1-10 GPa and ultra-low mass. The resonant frequency can be tuned by the gate voltage and its dependence is well understood within the continuum mechanics framework.

  13. SWNT array resonant gate MOS transistor

    International Nuclear Information System (INIS)

    Arun, A; Salet, P; Ionescu, A M; Campidelli, S; Filoramo, A; Derycke, V; Goffman, M F

    2011-01-01

    We show that thin horizontal arrays of single wall carbon nanotubes (SWNTs) suspended above the channel of silicon MOSFETs can be used as vibrating gate electrodes. This new class of nano-electromechanical system (NEMS) combines the unique mechanical and electronic properties of SWNTs with an integrated silicon-based motion detection. Its electrical response exhibits a clear signature of the mechanical resonance of SWNT arrays (120-150 MHz) showing that these thin horizontal arrays behave as a cohesive, rigid and elastic body membrane with a Young's modulus in the order of 1-10 GPa and ultra-low mass. The resonant frequency can be tuned by the gate voltage and its dependence is well understood within the continuum mechanics framework.

  14. GATE V6: a major enhancement of the GATE simulation platform enabling modelling of CT and radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Jan, S; Becheva, E [DSV/I2BM/SHFJ, Commissariat a l' Energie Atomique, Orsay (France); Benoit, D; Rehfeld, N; Stute, S; Buvat, I [IMNC-UMR 8165 CNRS-Paris 7 and Paris 11 Universities, 15 rue Georges Clemenceau, 91406 Orsay Cedex (France); Carlier, T [INSERM U892-Cancer Research Center, University of Nantes, Nantes (France); Cassol, F; Morel, C [Centre de physique des particules de Marseille, CNRS-IN2P3 and Universite de la Mediterranee, Aix-Marseille II, 163, avenue de Luminy, 13288 Marseille Cedex 09 (France); Descourt, P; Visvikis, D [INSERM, U650, Laboratoire du Traitement de l' Information Medicale (LaTIM), CHU Morvan, Brest (France); Frisson, T; Grevillot, L; Guigues, L; Sarrut, D; Zahra, N [Universite de Lyon, CREATIS, CNRS UMR5220, Inserm U630, INSA-Lyon, Universite Lyon 1, Centre Leon Berard (France); Maigne, L; Perrot, Y [Laboratoire de Physique Corpusculaire, 24 Avenue des Landais, 63177 Aubiere Cedex (France); Schaart, D R [Delft University of Technology, Radiation Detection and Medical Imaging, Mekelweg 15, 2629 JB Delft (Netherlands); Pietrzyk, U, E-mail: buvat@imnc.in2p3.fr [Reseach Center Juelich, Institute of Neurosciences and Medicine and Department of Physics, University of Wuppertal (Germany)

    2011-02-21

    GATE (Geant4 Application for Emission Tomography) is a Monte Carlo simulation platform developed by the OpenGATE collaboration since 2001 and first publicly released in 2004. Dedicated to the modelling of planar scintigraphy, single photon emission computed tomography (SPECT) and positron emission tomography (PET) acquisitions, this platform is widely used to assist PET and SPECT research. A recent extension of this platform, released by the OpenGATE collaboration as GATE V6, now also enables modelling of x-ray computed tomography and radiation therapy experiments. This paper presents an overview of the main additions and improvements implemented in GATE since the publication of the initial GATE paper (Jan et al 2004 Phys. Med. Biol. 49 4543-61). This includes new models available in GATE to simulate optical and hadronic processes, novelties in modelling tracer, organ or detector motion, new options for speeding up GATE simulations, examples illustrating the use of GATE V6 in radiotherapy applications and CT simulations, and preliminary results regarding the validation of GATE V6 for radiation therapy applications. Upon completion of extensive validation studies, GATE is expected to become a valuable tool for simulations involving both radiotherapy and imaging.

  15. Respiration Induced Heart Motion and Indications of Gated Delivery for Left-Sided Breast Irradiation

    International Nuclear Information System (INIS)

    Qi, X. Sharon; Hu, Angela; Wang Kai; Newman, Francis; Crosby, Marcus; Hu Bin; White, Julia; Li, X. Allen

    2012-01-01

    Purpose: To investigate respiration-induced heart motion for left-sided breast irradiation using a four-dimensional computed tomography (4DCT) technique and to determine novel indications to assess heart motion and identify breast patients who may benefit from a gated treatment. Methods and Materials: Images of 4DCT acquired during free breathing for 20 left-sided breast cancer patients, who underwent whole breast irradiation with or without regional nodal irradiation, were analyzed retrospectively. Dose distributions were reconstructed in the phases of 0%, 20%, and 50%. The intrafractional heart displacement was measured in three selected transverse CT slices using D LAD (the distance from left ascending aorta to a fixed line [connecting middle point of sternum and the body] drawn on each slice) and maximum heart depth (MHD, the distance of the forefront of the heart to the line). Linear regression analysis was used to correlate these indices with mean heart dose and heart dose volume at different breathing phases. Results: Respiration-induced heart displacement resulted in observable variations in dose delivered to the heart. During a normal free-breathing cycle, heart-induced motion D LAD and MHD changed up to 9 and 11 mm respectively, resulting in up to 38% and 39% increases of mean doses and V 25.2 for the heart. MHD and D LAD were positively correlated with mean heart dose and heart dose volume. Respiratory-adapted gated treatment may better spare heart and ipsilateral-lung compared with the conventional non-gated plan in a subset of patients with large D LAD or MHD variations. Conclusion: Proposed indices offer novel assessment of heart displacement based on 4DCT images. MHD and D LAD can be used independently or jointly as selection criteria for respiratory gating procedure before treatment planning. Patients with great intrafractional MHD variations or tumor(s) close to the diaphragm may particularly benefit from the gated treatment.

  16. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain.

    Science.gov (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R

    2016-09-01

    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  17. Probabilistic implementation of Hadamard and unitary gates

    International Nuclear Information System (INIS)

    Song Wei; Yang Ming; Cao Zhuoliang

    2004-01-01

    We show that the Hadamard and unitary gates could be implemented by a unitary evolution together with a measurement for any unknown state chosen from a set A={ vertical bar Ψi>, vertical bar Ψ-bar i>} (i=1,2) if and only if vertical bar Ψ1>, vertical bar Ψ2>, vertical bar Ψ-bar 1>, vertical bar Ψ-bar 2> are linearly independent. We also derive the best transformation efficiencies

  18. Robust gates for holonomic quantum computation

    International Nuclear Information System (INIS)

    Florio, Giuseppe; Pascazio, Saverio; Facchi, Paolo; Fazio, Rosario; Giovannetti, Vittorio

    2006-01-01

    Non-Abelian geometric phases are attracting increasing interest because of possible experimental application in quantum computation. We study the effects of the environment (modeled as an ensemble of harmonic oscillators) on a holonomic transformation and write the corresponding master equation. The solution is analytically and numerically investigated and the behavior of the fidelity analyzed: fidelity revivals are observed and an optimal finite operation time is determined at which the gate is most robust against noise

  19. Gated Detection Measurements of Phosphorescence Lifetimes

    Directory of Open Access Journals (Sweden)

    Yordan Kostov

    2004-10-01

    Full Text Available A low-cost, gated system for measurements of phosphorescence lifetimes is presented. An extensive description of the system operating principles and metrological characteristics is given. Remarkably, the system operates without optical filtering of the LED excitation source. A description of a practical system is also given and its performance is discussed. Because the device effectively suppresses high-level background fluorescence and scattered light, it is expected to find wide-spread application in bioprocess, environmental and biomedical fields.

  20. Molecular sensors and molecular logic gates

    International Nuclear Information System (INIS)

    Georgiev, N.; Bojinov, V.

    2013-01-01

    Full text: The rapid grow of nanotechnology field extended the concept of a macroscopic device to the molecular level. Because of this reason the design and synthesis of (supra)-molecular species capable of mimicking the functions of macroscopic devices are currently of great interest. Molecular devices operate via electronic and/or nuclear rearrangements and, like macroscopic devices, need energy to operate and communicate between their elements. The energy needed to make a device work can be supplied as chemical energy, electrical energy, or light. Luminescence is one of the most useful techniques to monitor the operation of molecular-level devices. This fact determinates the synthesis of novel fluorescence compounds as a considerable and inseparable part of nanoscience development. Further miniaturization of semiconductors in electronic field reaches their limit. Therefore the design and construction of molecular systems capable of performing complex logic functions is of great scientific interest now. In semiconductor devices the logic gates work using binary logic, where the signals are encoded as 0 and 1 (low and high current). This process is executable on molecular level by several ways, but the most common are based on the optical properties of the molecule switches encoding the low and high concentrations of the input guest molecules and the output fluorescent intensities with binary 0 and 1 respectively. The first proposal to execute logic operations at the molecular level was made in 1988, but the field developed only five years later when the analogy between molecular switches and logic gates was experimentally demonstrated by de Silva. There are seven basic logic gates: AND, OR, XOR, NOT, NAND, NOR and XNOR and all of them were achieved by molecules, the fluorescence switching as well. key words: fluorescence, molecular sensors, molecular logic gates

  1. Modeling Electrolytically Top-Gated Graphene

    Directory of Open Access Journals (Sweden)

    Mišković ZL

    2010-01-01

    Full Text Available Abstract We investigate doping of a single-layer graphene in the presence of electrolytic top gating. The interfacial phenomenon is modeled using a modified Poisson–Boltzmann equation for an aqueous solution of simple salt. We demonstrate both the sensitivity of graphene’s doping levels to the salt concentration and the importance of quantum capacitance that arises due to the smallness of the Debye screening length in the electrolyte.

  2. Re-opening of Gate C

    CERN Multimedia

    TS-FM Group

    2006-01-01

    From 3rd April to 1st December 2006, Gate C (Satigny) will be open to pedestrians and vehicles (except delivery vehicles) from Monday to Friday, excluding official holidays, between 8.00 a.m. and 9.00 a.m. for those entering the site and between 5.00 p.m. and 6.00 p.m. for those leaving the site. TS-FM Group Reception and Access Control Service

  3. Re-opening of Gate C

    CERN Multimedia

    2006-01-01

    From 3rd April to 1st December 2006, Gate C (Satigny) will be open to pedestrians and vehicles (except delivery vehicles) from Mondays to Fridays, excluding official holidays, between 8.00 a.m. and 9.00 a.m. for those entering the site and between 5.00 p.m. and 6.00 p.m. for those leaving the site. TS-FM Group Reception and Access Control Service

  4. Sensorimotor gating deficits in multiple system atrophy

    DEFF Research Database (Denmark)

    Zoetmulder, Marielle; Biernat, Heidi Bryde; Nikolic, Miki

    2014-01-01

    Prepulse inhibition (PPI) of the auditory blink reflex is a measure of sensorimotor gating, which reflects an organism's ability to filter out irrelevant sensory information. PPI has never been studied in patients with multiple system atrophy (MSA), although sensorimotor deficits are frequently a...... associated with synucleinopathies. We investigated whether alterations in PPI were more pronounced in MSA compared with Parkinson's disease (PD), idiopathic rapid eye movement sleep behavior disorder (iRBD) and healthy controls....

  5. Cluster computing software for GATE simulations

    International Nuclear Information System (INIS)

    Beenhouwer, Jan de; Staelens, Steven; Kruecker, Dirk; Ferrer, Ludovic; D'Asseler, Yves; Lemahieu, Ignace; Rannou, Fernando R.

    2007-01-01

    Geometry and tracking (GEANT4) is a Monte Carlo package designed for high energy physics experiments. It is used as the basis layer for Monte Carlo simulations of nuclear medicine acquisition systems in GEANT4 Application for Tomographic Emission (GATE). GATE allows the user to realistically model experiments using accurate physics models and time synchronization for detector movement through a script language contained in a macro file. The downside of this high accuracy is long computation time. This paper describes a platform independent computing approach for running GATE simulations on a cluster of computers in order to reduce the overall simulation time. Our software automatically creates fully resolved, nonparametrized macros accompanied with an on-the-fly generated cluster specific submit file used to launch the simulations. The scalability of GATE simulations on a cluster is investigated for two imaging modalities, positron emission tomography (PET) and single photon emission computed tomography (SPECT). Due to a higher sensitivity, PET simulations are characterized by relatively high data output rates that create rather large output files. SPECT simulations, on the other hand, have lower data output rates but require a long collimator setup time. Both of these characteristics hamper scalability as a function of the number of CPUs. The scalability of PET simulations is improved here by the development of a fast output merger. The scalability of SPECT simulations is improved by greatly reducing the collimator setup time. Accordingly, these two new developments result in higher scalability for both PET and SPECT simulations and reduce the computation time to more practical values

  6. Patient training in respiratory-gated radiotherapy

    International Nuclear Information System (INIS)

    Kini, Vijay R.; Vedam, Subrahmanya S.; Keall, Paul J.; Patil, Sumukh; Chen, Clayton; Mohan, Radhe

    2003-01-01

    Respiratory gating is used to counter the effects of organ motion during radiotherapy for chest tumors. The effects of variations in patient breathing patterns during a single treatment and from day to day are unknown. We evaluated the feasibility of using patient training tools and their effect on the breathing cycle regularity and reproducibility during respiratory-gated radiotherapy. To monitor respiratory patterns, we used a component of a commercially available respiratory-gated radiotherapy system (Real Time Position Management (RPM) System, Varian Oncology Systems, Palo Alto, CA 94304). This passive marker video tracking system consists of reflective markers placed on the patient's chest or abdomen, which are detected by a wall-mounted video camera. Software installed on a PC interfaced to this camera detects the marker motion digitally and records it. The marker position as a function of time serves as the motion signal that may be used to trigger imaging or treatment. The training tools used were audio prompting and visual feedback, with free breathing as a control. The audio prompting method used instructions to 'breathe in' or 'breathe out' at periodic intervals deduced from patients' own breathing patterns. In the visual feedback method, patients were shown a real-time trace of their abdominal wall motion due to breathing. Using this, they were asked to maintain a constant amplitude of motion. Motion traces of the abdominal wall were recorded for each patient for various maneuvers. Free breathing showed a variable amplitude and frequency. Audio prompting resulted in a reproducible frequency; however, the variability and the magnitude of amplitude increased. Visual feedback gave a better control over the amplitude but showed minor variations in frequency. We concluded that training improves the reproducibility of amplitude and frequency of patient breathing cycles. This may increase the accuracy of respiratory-gated radiation therapy

  7. Thermodynamic coupling between activation and inactivation gating in potassium channels revealed by free energy molecular dynamics simulations.

    Science.gov (United States)

    Pan, Albert C; Cuello, Luis G; Perozo, Eduardo; Roux, Benoît

    2011-12-01

    The amount of ionic current flowing through K(+) channels is determined by the interplay between two separate time-dependent processes: activation and inactivation gating. Activation is concerned with the stimulus-dependent opening of the main intracellular gate, whereas inactivation is a spontaneous conformational transition of the selectivity filter toward a nonconductive state occurring on a variety of timescales. A recent analysis of multiple x-ray structures of open and partially open KcsA channels revealed the mechanism by which movements of the inner activation gate, formed by the inner helices from the four subunits of the pore domain, bias the conformational changes at the selectivity filter toward a nonconductive inactivated state. This analysis highlighted the important role of Phe103, a residue located along the inner helix, near the hinge position associated with the opening of the intracellular gate. In the present study, we use free energy perturbation molecular dynamics simulations (FEP/MD) to quantitatively elucidate the thermodynamic basis for the coupling between the intracellular gate and the selectivity filter. The results of the FEP/MD calculations are in good agreement with experiments, and further analysis of the repulsive, van der Waals dispersive, and electrostatic free energy contributions reveals that the energetic basis underlying the absence of inactivation in the F103A mutation in KcsA is the absence of the unfavorable steric interaction occurring with the large Ile100 side chain in a neighboring subunit when the intracellular gate is open and the selectivity filter is in a conductive conformation. Macroscopic current analysis shows that the I100A mutant indeed relieves inactivation in KcsA, but to a lesser extent than the F103A mutant.

  8. Engineering integrated photonics for heralded quantum gates.

    Science.gov (United States)

    Meany, Thomas; Biggerstaff, Devon N; Broome, Matthew A; Fedrizzi, Alessandro; Delanty, Michael; Steel, M J; Gilchrist, Alexei; Marshall, Graham D; White, Andrew G; Withford, Michael J

    2016-06-10

    Scaling up linear-optics quantum computing will require multi-photon gates which are compact, phase-stable, exhibit excellent quantum interference, and have success heralded by the detection of ancillary photons. We investigate the design, fabrication and characterisation of the optimal known gate scheme which meets these requirements: the Knill controlled-Z gate, implemented in integrated laser-written waveguide arrays. We show device performance to be less sensitive to phase variations in the circuit than to small deviations in the coupler reflectivity, which are expected given the tolerance values of the fabrication method. The mode fidelity is also shown to be less sensitive to reflectivity and phase errors than the process fidelity. Our best device achieves a fidelity of 0.931 ± 0.001 with the ideal 4 × 4 unitary circuit and a process fidelity of 0.680 ± 0.005 with the ideal computational-basis process.

  9. Three-channel gated nanosecond integrator

    International Nuclear Information System (INIS)

    Tsirkel', B.I.; Martsinovskij, A.M.

    1981-01-01

    Structure and principle of operation of three-channel gated integrator for investigating the shape of periodical electric and optical signals at high background noise level are described. The integrator consists of an integrating circuit itself for each channel and a circuit of gating pulse formation. If the noise level doesn't exceed the signal, the value of storage capacity can be equal to 22 nF. The value of storage capacity must be increased in the case of a worse signal-to-noise ratio. The gating pulse formation circuit includes a comparator, a sawtooth voltage generator and a reference voltage generator. An integrator flowsheet is given. The time resolution of the system is about 50 ns, time sweep amounts to 5-2000 μs, electric signal sensitivity is about 70 μV. The pulse signal shape recording is performed with manual or automated time sweep at two-coordinate potentiometer. The light signal detection is made on the base of photomultiplier pulse counting rate record by the dynamic capacitor method, sensitivity limit amounts to about 1 pulse/s

  10. Engineering integrated photonics for heralded quantum gates

    Science.gov (United States)

    Meany, Thomas; Biggerstaff, Devon N.; Broome, Matthew A.; Fedrizzi, Alessandro; Delanty, Michael; Steel, M. J.; Gilchrist, Alexei; Marshall, Graham D.; White, Andrew G.; Withford, Michael J.

    2016-06-01

    Scaling up linear-optics quantum computing will require multi-photon gates which are compact, phase-stable, exhibit excellent quantum interference, and have success heralded by the detection of ancillary photons. We investigate the design, fabrication and characterisation of the optimal known gate scheme which meets these requirements: the Knill controlled-Z gate, implemented in integrated laser-written waveguide arrays. We show device performance to be less sensitive to phase variations in the circuit than to small deviations in the coupler reflectivity, which are expected given the tolerance values of the fabrication method. The mode fidelity is also shown to be less sensitive to reflectivity and phase errors than the process fidelity. Our best device achieves a fidelity of 0.931 ± 0.001 with the ideal 4 × 4 unitary circuit and a process fidelity of 0.680 ± 0.005 with the ideal computational-basis process.

  11. Towards Self-Clocked Gated OCDMA Receiver

    Science.gov (United States)

    Idris, S.; Osadola, T.; Glesk, I.

    2013-02-01

    A novel incoherent OCDMA receiver with incorporated all-optical clock recovery for self-synchronization of a time gate for the multi access interferences (MAI) suppression and minimizing the effect of data time jitter in incoherent OCDMA system was successfully developed and demonstrated. The solution was implemented and tested in a multiuser environment in an out of the laboratory OCDMA testbed with two-dimensional wavelength-hopping time-spreading coding scheme and OC-48 (2.5 Gbp/s) data rate. The self-clocked all-optical time gate uses SOA-based fibre ring laser optical clock, recovered all-optically from the received OCDMA traffic to control its switching window for cleaning the autocorrelation peak from the surrounding MAI. A wider eye opening was achieved when the all-optically recovered clock from received data was used for synchronization if compared to a static approach with the RF clock being generated by a RF synthesizer. Clean eye diagram was also achieved when recovered clock is used to drive time gating.

  12. Opening of the New Gate E (Reminder)

    CERN Multimedia

    Relations with the Host States Service

    2004-01-01

    Since 1 November 2004, members of the CERN personnel holding a legitimation document issued by the Swiss Federal Department of Foreign Affairs may use Gate E ("Charles de Gaulle Gate"), located at the West end of the Meyrin Site, from Monday to Friday, except on official CERN holidays, from 7.30 a.m. to 9.30 a.m. to enter the site and from 4.30 p.m. to 6.30 p.m. to leave the site. All persons using Gate E must automatically present for inspection by the Guard on duty: either their azure B-type CERN access card (the letter B precedes the identification number printed on the card); or, during a transitional period lasting until 17 December 2004, their blue C-type CERN access card (the letter C precedes the identification number printed on the card) and their legitimation document issued by the Swiss Federal Department of Foreign Affairs («Carte de légitimation» or «Attestation de fonctions»). The new azure B-type CERN access card is issued, where appropria...

  13. Direct Structural Identification of Gas Induced Gate-Opening Coupled with Commensurate Adsorption in a Microporous Metal-Organic Framework.

    Science.gov (United States)

    Banerjee, Debasis; Wang, Hao; Plonka, Anna M; Emge, Thomas J; Parise, John B; Li, Jing

    2016-08-08

    Gate-opening is a unique and interesting phenomenon commonly observed in flexible porous frameworks, where the pore characteristics and/or crystal structures change in response to external stimuli such as adding or removing guest molecules. For gate-opening that is induced by gas adsorption, the pore-opening pressure often varies for different adsorbate molecules and, thus, can be applied to selectively separate a gas mixture. The detailed understanding of this phenomenon is of fundamental importance to the design of industrially applicable gas-selective sorbents, which remains under investigated due to the lack of direct structural evidence for such systems. We report a mechanistic study of gas-induced gate-opening process of a microporous metal-organic framework, [Mn(ina)2 ] (ina=isonicotinate) associated with commensurate adsorption, by a combination of several analytical techniques including single crystal X-ray diffraction, in situ powder X-ray diffraction coupled with differential scanning calorimetry (XRD-DSC), and gas adsorption-desorption methods. Our study reveals that the pronounced and reversible gate opening/closing phenomena observed in [Mn(ina)2 ] are coupled with a structural transition that involves rotation of the organic linker molecules as a result of interaction of the framework with adsorbed gas molecules including carbon dioxide and propane. The onset pressure to open the gate correlates with the extent of such interaction. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Developing a gate-array capability at a research and development laboratory

    Science.gov (United States)

    Balch, J. W.; Current, K. W.; Magnuson, W. G., Jr.; Pocha, M. D.

    1983-03-01

    Experiences in developing a gate array capability for low volume applications in a research and development (R and D) laboratory are described. By purchasing unfinished wafers and doing the customization steps in-house. Turnaround time was shortened to as little as one week and the direct costs reduced to as low as $5K per design. Designs generally require fast turnaround (a few weeks to a few months) and very low volumes (1 to 25). Design costs must be kept at a minimum. After reviewing available commercial gate array design and fabrication services, it was determined that objectives would best be met by using existing internal integrated circuit fabrication facilities, the COMPUTERVISION interactive graphics layout system, and extensive computational capabilities. The reasons and the approach taken for; selection for a particular gate array wafer, adapting a particular logic simulation program, and how layout aids were enhanced are discussed. Testing of the customized chips is described. The content, schedule, and results of the internal gate array course recently completed are discussed. Finally, problem areas and near term plans are presented.

  15. Biomolecule-recognition gating membrane using biomolecular cross-linking and polymer phase transition.

    Science.gov (United States)

    Kuroki, Hidenori; Ito, Taichi; Ohashi, Hidenori; Tamaki, Takanori; Yamaguchi, Takeo

    2011-12-15

    We present for the first time a biomolecule-recognition gating system that responds to small signals of biomolecules by the cooperation of biorecognition cross-linking and polymer phase transition in nanosized pores. The biomolecule-recognition gating membrane immobilizes the stimuli-responsive polymer, including the biomolecule-recognition receptor, onto the pore surface of a porous membrane. The pore state (open/closed) of this gating membrane depends on the formation of specific biorecognition cross-linking in the pores: a specific biomolecule having multibinding sites can be recognized by several receptors and acts as the cross-linker of the grafted polymer, whereas a nonspecific molecule cannot. The pore state can be distinguished by a volume phase transition of the grafted polymer. In the present study, the principle of the proposed system is demonstrated using poly(N-isopropylacrylamide) as the stimuli-responsive polymer and avidin-biotin as a multibindable biomolecule-specific receptor. As a result of the selective response to the specific biomolecule, a clear permeability change of an order of magnitude was achieved. The principle is versatile and can be applied to many combinations of multibindable analyte-specific receptors, including antibody-antigen and lectin-sugar analogues. The new gating system can find wide application in the bioanalytical field and aid the design of novel biodevices.

  16. Bottom-Up Tri-gate Transistors and Submicrosecond Photodetectors from Guided CdS Nanowalls.

    Science.gov (United States)

    Xu, Jinyou; Oksenberg, Eitan; Popovitz-Biro, Ronit; Rechav, Katya; Joselevich, Ernesto

    2017-11-08

    Tri-gate transistors offer better performance than planar transistors by exerting additional gate control over a channel from two lateral sides of semiconductor nanowalls (or "fins"). Here we report the bottom-up assembly of aligned CdS nanowalls by a simultaneous combination of horizontal catalytic vapor-liquid-solid growth and vertical facet-selective noncatalytic vapor-solid growth and their parallel integration into tri-gate transistors and photodetectors at wafer scale (cm 2 ) without postgrowth transfer or alignment steps. These tri-gate transistors act as enhancement-mode transistors with an on/off current ratio on the order of 10 8 , 4 orders of magnitude higher than the best results ever reported for planar enhancement-mode CdS transistors. The response time of the photodetector is reduced to the submicrosecond level, 1 order of magnitude shorter than the best results ever reported for photodetectors made of bottom-up semiconductor nanostructures. Guided semiconductor nanowalls open new opportunities for high-performance 3D nanodevices assembled from the bottom up.

  17. SO-limited mobility in a germanium inversion channel with non-ideal metal gate

    International Nuclear Information System (INIS)

    Shah, Raheel; De Souza, M.M.

    2008-01-01

    Germanium is an attractive candidate for ultra fast CMOS technology due to its potential for doubling electron mobility and quadrupling hole mobility in comparison to silicon. To maintain the requirements of the International Technology Roadmap for Semiconductors (ITRS), high-κ insulators and metal gates will be required in conjunction with Ge technology. Key issues which will have to be addressed in achieving Ge technology are: trap free insulators, assessment of appropriate crystallographic orientations and the selection of gate metals for the best mobility. In this work mobilities are evaluated for Ge-nMOSFET with two metal gates (Al and TiN) and high-κ (HfO 2 ) insulator. Scattering with bulk phonons, surface roughness and high-κ phonons are taken into account. It is predicted that Al as the gate material on Ge {100} substrate performs 50% better than Ge {111} orientation at a sheet concentration of 1 x 10 13 cm -2 . Surface roughness is likely to be the most damaging mobility degradation mechanism at high fields for Ge {111}

  18. The cooperative voltage sensor motion that gates a potassium channel.

    Science.gov (United States)

    Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud

    2005-01-01

    The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close.

  19. Probing Dense Sprays with Gated, Picosecond, Digital Particle Field Holography

    Directory of Open Access Journals (Sweden)

    James Trolinger

    2011-12-01

    Full Text Available This paper describes work that demonstrated the feasibility of producing a gated digital holography system that is capable of producing high-resolution images of three-dimensional particle and structure details deep within dense particle fields of a spray. We developed a gated picosecond digital holocamera, using optical Kerr cell gating, to demonstrate features of gated digital holography that make it an exceptional candidate for this application. The Kerr cell gate shuttered the camera after the initial burst of ballistic and snake photons had been recorded, suppressing longer path, multiple scattered illumination. By starting with a CW laser without gating and then incorporating a picosecond laser and an optical Kerr gate, we were able to assess the imaging quality of the gated holograms, and determine improvement gained by gating. We produced high quality images of 50–200 μm diameter particles, hairs and USAF resolution charts from digital holograms recorded through turbid media where more than 98% of the light was scattered from the field. The system can gate pulses as short as 3 mm in pathlength (10 ps, enabling image-improving features of the system. The experiments lead us to the conclusion that this method has an excellent capability as a diagnostics tool in dense spray combustion research.

  20. The hitchhiker’s guide to the voltage-gated sodium channel galaxy

    Science.gov (United States)

    2016-01-01

    Eukaryotic voltage-gated sodium (Nav) channels contribute to the rising phase of action potentials and served as an early muse for biophysicists laying the foundation for our current understanding of electrical signaling. Given their central role in electrical excitability, it is not surprising that (a) inherited mutations in genes encoding for Nav channels and their accessory subunits have been linked to excitability disorders in brain, muscle, and heart; and (b) Nav channels are targeted by various drugs and naturally occurring toxins. Although the overall architecture and behavior of these channels are likely to be similar to the more well-studied voltage-gated potassium channels, eukaryotic Nav channels lack structural and functional symmetry, a notable difference that has implications for gating and selectivity. Activation of voltage-sensing modules of the first three domains in Nav channels is sufficient to open the channel pore, whereas movement of the domain IV voltage sensor is correlated with inactivation. Also, structure–function studies of eukaryotic Nav channels show that a set of amino acids in the selectivity filter, referred to as DEKA locus, is essential for Na+ selectivity. Structures of prokaryotic Nav channels have also shed new light on mechanisms of drug block. These structures exhibit lateral fenestrations that are large enough to allow drugs or lipophilic molecules to gain access into the inner vestibule, suggesting that this might be the passage for drug entry into a closed channel. In this Review, we will synthesize our current understanding of Nav channel gating mechanisms, ion selectivity and permeation, and modulation by therapeutics and toxins in light of the new structures of the prokaryotic Nav channels that, for the time being, serve as structural models of their eukaryotic counterparts. PMID:26712848

  1. GATED SPECT TO EVALUATE LEFT VENTRICULAR MYOCARDIAL PERFUSION, FUNCTION AND DYSSYNCHRONY FOR RESYNCHRONIZATION THERAPY

    Directory of Open Access Journals (Sweden)

    E.N. Ostroumov

    2009-01-01

    Full Text Available The study included 15 consecutive patients with heart failure and substantial LV dyssynchrony undergoing CRT. Clinical and phase analysis of gated myocardial perfusion SPECT assessed at baseline, after 2–3 days and after 3–4 months of CRT. The results demonstrated inversely relationship between the response to CRT and the nonviable myocardium. Evaluation of myocardial viability is necessary to considered in the selection process for CRT.

  2. SU-E-T-403: Evaluation of the Beam Performance of a Varian TrueBeam Linear Accelerator Under External Device-Based Gated Delivery Conditions

    International Nuclear Information System (INIS)

    Kobulnicky, K; Pawlak, D; Purwar, A

    2015-01-01

    Purpose: To examine the beam performance of a Varian TrueBeam linear accelerator under external device-based gated delivery conditions. Methods: Six gating cycles were used to evaluate the gating performance of a standard production TrueBeam system that was not specially tuned in any way. The system was equipped with a factory installed external gating interface (EXGI). An in-house EXGI tester box was used to simulate the input gating signals. The gating cycles were selected based on long beam-on and short beam-off times, short beam-on and long beam-off times, or equal beam on and off times to check linac performance. The beam latencies were measured as the time difference between the logic high gating signal and the first or last target pulses with an oscilloscope. Tissue-Phantom Ratio, beam flatness, and dose distributions from 5 different plans were measured using the 6 different gating durations and the un-gated irradiation. A PTW 729 2-D array was used to compare 5 plans versus the un-gated delivery with a 1%/1mm gamma index passing criteria. Results: The beam latencies of the linac were based off of 20 samples for beam-on and beam-off, for each gating cycle. The average beam-on delays were measured to be between 57 and 66msec, with a maximum of 88 msec. The beam off latencies averaged between 19 and 26msec, with a maximum of 48 msec. TPR20,10 measurements showed beam energy stability within 0.5% of the un-gated delivery. Beam flatness was better than 2.5% for all gated cycles. All but two deliveries, the open field with 4 seconds on, 1 second off, and a five field IMRT plan with 0.5 seconds on, 2.5 seconds off, had >90% passing rate. Conclusion: TrueBeam demonstrates excellent beam stability with minimal beam latencies under external device-based gated operations. Dosimetric measurements show minimal variation in beam energy, flatness, and plan delivery. Authors are employees of Varian Medical Systems, Inc

  3. SU-E-T-403: Evaluation of the Beam Performance of a Varian TrueBeam Linear Accelerator Under External Device-Based Gated Delivery Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Kobulnicky, K; Pawlak, D; Purwar, A [Varian Medical Systems, Inc., Palo Alto, CA (United States)

    2015-06-15

    Purpose: To examine the beam performance of a Varian TrueBeam linear accelerator under external device-based gated delivery conditions. Methods: Six gating cycles were used to evaluate the gating performance of a standard production TrueBeam system that was not specially tuned in any way. The system was equipped with a factory installed external gating interface (EXGI). An in-house EXGI tester box was used to simulate the input gating signals. The gating cycles were selected based on long beam-on and short beam-off times, short beam-on and long beam-off times, or equal beam on and off times to check linac performance. The beam latencies were measured as the time difference between the logic high gating signal and the first or last target pulses with an oscilloscope. Tissue-Phantom Ratio, beam flatness, and dose distributions from 5 different plans were measured using the 6 different gating durations and the un-gated irradiation. A PTW 729 2-D array was used to compare 5 plans versus the un-gated delivery with a 1%/1mm gamma index passing criteria. Results: The beam latencies of the linac were based off of 20 samples for beam-on and beam-off, for each gating cycle. The average beam-on delays were measured to be between 57 and 66msec, with a maximum of 88 msec. The beam off latencies averaged between 19 and 26msec, with a maximum of 48 msec. TPR20,10 measurements showed beam energy stability within 0.5% of the un-gated delivery. Beam flatness was better than 2.5% for all gated cycles. All but two deliveries, the open field with 4 seconds on, 1 second off, and a five field IMRT plan with 0.5 seconds on, 2.5 seconds off, had >90% passing rate. Conclusion: TrueBeam demonstrates excellent beam stability with minimal beam latencies under external device-based gated operations. Dosimetric measurements show minimal variation in beam energy, flatness, and plan delivery. Authors are employees of Varian Medical Systems, Inc.

  4. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel.

    Science.gov (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen

    2018-02-01

    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na + /K + -ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K + -battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  5. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel

    Science.gov (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen

    2018-02-01

    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na+/K+-ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K+-battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  6. Analysis of gate underlap channel double gate MOS transistor for electrical detection of bio-molecules

    Science.gov (United States)

    Ajay; Narang, Rakhi; Saxena, Manoj; Gupta, Mridula

    2015-12-01

    In this paper, an analytical model for gate drain underlap channel Double-Gate Metal-Oxide-Semiconductor Field-Effect Transistor (DG-MOSFET) for label free electrical detection of biomolecules has been proposed. The conformal mapping technique has been used to derive the expressions for surface potential, lateral electric field, energy bands (i.e. conduction and valence band) and threshold voltage (Vth). Subsequently a full drain current model to analyze the sensitivity of the biosensor has been developed. The shift in the threshold voltage and drain current (after the biomolecules interaction with the gate underlap channel region of the MOS transistor) has been used as a sensing metric. All the characteristic trends have been verified through ATLAS (SILVACO) device simulation results.

  7. Gate tunneling current and quantum capacitance in metal-oxide-semiconductor devices with graphene gate electrodes

    Science.gov (United States)

    An, Yanbin; Shekhawat, Aniruddh; Behnam, Ashkan; Pop, Eric; Ural, Ant

    2016-11-01

    Metal-oxide-semiconductor (MOS) devices with graphene as the metal gate electrode, silicon dioxide with thicknesses ranging from 5 to 20 nm as the dielectric, and p-type silicon as the semiconductor are fabricated and characterized. It is found that Fowler-Nordheim (F-N) tunneling dominates the gate tunneling current in these devices for oxide thicknesses of 10 nm and larger, whereas for devices with 5 nm oxide, direct tunneling starts to play a role in determining the total gate current. Furthermore, the temperature dependences of the F-N tunneling current for the 10 nm devices are characterized in the temperature range 77-300 K. The F-N coefficients and the effective tunneling barrier height are extracted as a function of temperature. It is found that the effective barrier height decreases with increasing temperature, which is in agreement with the results previously reported for conventional MOS devices with polysilicon or metal gate electrodes. In addition, high frequency capacitance-voltage measurements of these MOS devices are performed, which depict a local capacitance minimum under accumulation for thin oxides. By analyzing the data using numerical calculations based on the modified density of states of graphene in the presence of charged impurities, it is shown that this local minimum is due to the contribution of the quantum capacitance of graphene. Finally, the workfunction of the graphene gate electrode is extracted by determining the flat-band voltage as a function of oxide thickness. These results show that graphene is a promising candidate as the gate electrode in metal-oxide-semiconductor devices.

  8. Reconfigurable chaotic logic gates based on novel chaotic circuit

    International Nuclear Information System (INIS)

    Behnia, S.; Pazhotan, Z.; Ezzati, N.; Akhshani, A.

    2014-01-01

    Highlights: • A novel method for implementing logic gates based on chaotic maps is introduced. • The logic gates can be implemented without any changes in the threshold voltage. • The chaos-based logic gates may serve as basic components of future computing devices. - Abstract: The logical operations are one of the key issues in today’s computer architecture. Nowadays, there is a great interest in developing alternative ways to get the logic operations by chaos computing. In this paper, a novel implementation method of reconfigurable logic gates based on one-parameter families of chaotic maps is introduced. The special behavior of these chaotic maps can be utilized to provide same threshold voltage for all logic gates. However, there is a wide interval for choosing a control parameter for all reconfigurable logic gates. Furthermore, an experimental implementation of this nonlinear system is presented to demonstrate the robustness of computing capability of chaotic circuits

  9. ECG-gating in non-cardiac digital subtraction angiography

    International Nuclear Information System (INIS)

    Gattoni, F.; Baldini, V.; Cairo, F.

    1987-01-01

    This paper reports the results of the ECG-gating in non-cardiac digital subtraction angiography (DSA). One hundred and fifteen patients underwent DSA (126 examinations); ECG-gating was applied in 66/126 examinations: images recorded at 70% of R wave were subtracted. Artifacts produced by vascular movements were evaluated in all patients: only 40 examinations, carried out whithout ECG-gating, showed vascular artifacts. The major advantage of the ECG-gated DSA is the more efficent subtraction because of the better images superimposition: therefore, ECG-gating can be clinically helpful. On the contrary, it could be a problem in arrhytmic or bradycardic patients. ECG-gating is helpful in DSA imaging of the thoracic and abdominal aorta and of the cervical and renal arteries. In the examinations of peripheral vessels of the limbs it is not so efficent as in the trunk or in the neck

  10. Emergency Gate Vibration of the Pipe-Turbine Model

    Directory of Open Access Journals (Sweden)

    Andrej Predin

    2000-01-01

    Full Text Available The vibration behavior of an emergency gate situated on a horizontal-shaft Kaplan turbine is studied. The analysis and transfer of the dynamic movements of the gate are quite complex. In particular the behavior is examined of the emergency gate for the case when the power unit is disconnected from the system or there is a breakdown of the guide vane system at the moment when the maximal head and capacity are achieved. Experimental-numerical methods both in the time domain and in the frequency domain are employed. Natural vibrations characterize a first zone, corresponding to relatively small gate openings. As the gate opening increases, the vibration behavior of the gate becomes increasingly dependent on the swirl pulsations in the draft tube of the turbine. Finally, the data transfer from the model to the prototype by use of the dynamic similitude law is discussed.

  11. Gate replacement at the Upper Lake Falls development

    International Nuclear Information System (INIS)

    Chen, C.T.; Locke, A.E.; Brown, E.R.

    1998-01-01

    Nova Scotia Power's integrated approach to dam safety was discussed. One of the two intake gates at Unit 1 of the Upper Falls Power Plant on the Mersey River was replaced in 1997 as part of the Utility's upgrading program. In the event of governor failure or turbine runaway, the new roller gate will allow operators to close the original sliding gate first under a more-or-less balanced head condition, and then to close the new roller gate under a full-flow condition. The planning, design and construction of the new roller gate is described. One of the two head gates of Unit 2 at the same station will be replaced in a similar fashion in the fall of 1998. 4 refs., 7 figs

  12. Double gated-integrator for shaping nuclear radiation detector signals

    International Nuclear Information System (INIS)

    Gal, J.

    2001-01-01

    A new shaper, the double gated-integrator, for shaping nuclear radiation detector signals is investigated both theoretically and experimentally. The double gated-integrator consists of a pre-filter and two cascaded gated integrators. Two kinds of pre-filters were considered: a rectangular one and an exponential one. The results of the theoretical calculation show that the best figure of demerit for the double gated-integrator with exponential pre-filter is 1.016. This means that its noise to signal ratio is only 1.6% worse than that it is for infinite cusp shaping. The practical realization of the exponential pre-filter and that of the double gated integrator, both in analogue and in digital way, is very simple. Therefore, the double gated-integrator with exponential pre-filter could be a promising solution for shaping nuclear radiation detector signals

  13. An allosteric gating model recapitulates the biophysical properties of IK,L expressed in mouse vestibular type I hair cells.

    Science.gov (United States)

    Spaiardi, Paolo; Tavazzani, Elisa; Manca, Marco; Milesi, Veronica; Russo, Giancarlo; Prigioni, Ivo; Marcotti, Walter; Magistretti, Jacopo; Masetto, Sergio

    2017-11-01

    Vestibular type I and type II hair cells and their afferent fibres send information to the brain regarding the position and movement of the head. The characteristic feature of type I hair cells is the expression of a low-voltage-activated outward rectifying K + current, I K,L , whose biophysical properties and molecular identity are still largely unknown. In vitro, the afferent nerve calyx surrounding type I hair cells causes unstable intercellular K + concentrations, altering the biophysical properties of I K,L . We found that in the absence of the calyx, I K,L in type I hair cells exhibited unique biophysical activation properties, which were faithfully reproduced by an allosteric channel gating scheme. These results form the basis for a molecular and pharmacological identification of I K,L . Type I and type II hair cells are the sensory receptors of the mammalian vestibular epithelia. Type I hair cells are characterized by their basolateral membrane being enveloped in a single large afferent nerve terminal, named the calyx, and by the expression of a low-voltage-activated outward rectifying K + current, I K,L . The biophysical properties and molecular profile of I K,L are still largely unknown. By using the patch-clamp whole-cell technique, we examined the voltage- and time-dependent properties of I K,L in type I hair cells of the mouse semicircular canal. We found that the biophysical properties of I K,L were affected by an unstable K + equilibrium potential (V eq K + ). Both the outward and inward K + currents shifted V eq K + consistent with K + accumulation or depletion, respectively, in the extracellular space, which we attributed to a residual calyx attached to the basolateral membrane of the hair cells. We therefore optimized the hair cell dissociation protocol in order to isolate mature type I hair cells without their calyx. In these cells, the uncontaminated I K,L showed a half-activation at -79.6 mV and a steep voltage dependence (2.8 mV). I K,L also

  14. Preliminary observations of gate valve flow interruption tests, Phase 2

    International Nuclear Information System (INIS)

    Steele, R. Jr.; DeWall, K.G.

    1990-01-01

    This paper presents preliminary observations from the US Nuclear Regulatory Commission/Idaho National Engineering Laboratory Flexible Wedge Gate Valve Qualification and Flow Interruption Test Program, Phase 2. The program investigated the ability of selected boiling water reactor (BWR) process line valves to perform their containment isolation function at high energy pipe break conditions and other more normal flow conditions. The fluid and valve operating responses were measured to provide information concerning valve and operator performance at various valve loadings so that the information could be used to assess typical nuclear industry motor operator sizing equations. Six valves were tested, three 6-in. isolation valves representative of those used in reactor water cleanup systems in BWRs and three 10-in. isolation valves representative of those used in BWR high pressure coolant injection (HPCI) steam lines. The concern with these normally open isolation valves is whether they will close in the event of a downstream pipe break outside of containment. The results of this testing will provide part of the technical insights for NRC efforts regarding Generic Issue 87 (GI-87), Failure of the HPCI Steam Line Without Isolation, which includes concerns about the uncertainties in gate valve motor operator sizing and torque switch settings for these BWR containment isolation valves. As of this writing, the Phase 2 test program has just been completed. Preliminary observations made in the field confirmed most of the results from the Phase 1 test program. All six valves closing in high energy water, high energy steam, and high pressure cold water require more force to close than would be calculated using the typical variables in the standard industry motor operator sizing equations

  15. Transcending binary logic by gating three coupled quantum dots.

    Science.gov (United States)

    Klein, Michael; Rogge, S; Remacle, F; Levine, R D

    2007-09-01

    Physical considerations supported by numerical solution of the quantum dynamics including electron repulsion show that three weakly coupled quantum dots can robustly execute a complete set of logic gates for computing using three valued inputs and outputs. Input is coded as gating (up, unchanged, or down) of the terminal dots. A nanosecond time scale switching of the gate voltage requires careful numerical propagation of the dynamics. Readout is the charge (0, 1, or 2 electrons) on the central dot.

  16. Quantum logic gates based on ballistic transport in graphene

    Energy Technology Data Exchange (ETDEWEB)

    Dragoman, Daniela [Faculty of Physics, University of Bucharest, P.O. Box MG-11, 077125 Bucharest (Romania); Academy of Romanian Scientists, Splaiul Independentei 54, 050094 Bucharest (Romania); Dragoman, Mircea, E-mail: mircea.dragoman@imt.ro [National Institute for Research and Development in Microtechnology (IMT), P.O. Box 38-160, 023573 Bucharest (Romania)

    2016-03-07

    The paper presents various configurations for the implementation of graphene-based Hadamard, C-phase, controlled-NOT, and Toffoli gates working at room temperature. These logic gates, essential for any quantum computing algorithm, involve ballistic graphene devices for qubit generation and processing and can be fabricated using existing nanolithographical techniques. All quantum gate configurations are based on the very large mean-free-paths of carriers in graphene at room temperature.

  17. Gate-keeper module for TANSY-KM5

    International Nuclear Information System (INIS)

    Rydz, R.; Norberg, L.; Urholm, L.; Grosshoeg, G.

    1991-01-01

    The purpose of the Gate-keeper is the control of the RDCs, the ADCs, and the constant fraction discriminator. The Gate-keeper synchronizes the units and ensures that the data taking is clean and not intermixed with other events. There are six Gate-Keepers in the system, one for each proton detector. All input circuits are designed to accept TTL as well as negative NIM signals. The output is 50 ohm TTL or negative NIM as defined by internal jumpers

  18. Dual-gated cardiac PET-clinical feasibility study

    Energy Technology Data Exchange (ETDEWEB)

    Teraes, Mika; Kokki, Tommi; Noponen, Tommi; Hoppela, Erika; Sipilae, Hannu T.; Knuuti, Juhani [Turku PET Centre, PO BOX 52, Turku (Finland); Durand-Schaefer, Nicolas [General Electric Medical Systems, Buc (France); Pietilae, Mikko [Turku University Hospital, Department of Internal Medicine, Turku (Finland); Kiss, Jan [Turku University Hospital, Department of Surgery, Turku (Finland)

    2010-03-15

    Both respiratory and cardiac motions reduce image quality in myocardial imaging. For accurate imaging of small structures such as vulnerable coronary plaques, simultaneous cardiac and respiratory gating is warranted. This study tests the feasibility of a recently developed robust method for cardiac-respiratory gating. List-mode data with triggers from respiratory and cardiac cycles are rearranged into dual-gated segments and reconstructed with standard algorithms of a commercial PET/CT scanner. Cardiac gates were defined as three fixed phases and one variable diastolic phase. Chest motion was measured with a respiratory gating device and post-processed to determine gates. Preservation of quantification in dual-gated images was tested with an IEC whole-body phantom. Minipig and human studies were performed to evaluate the feasibility of the method. In minipig studies, a coronary catheter with radioactive tip was guided in coronary artery for in vivo and ex vivo acquisitions. Dual gating in humans with suspected cardiac disorders was performed using 18-F-FDG as a tracer. The method was found feasible for in vivo imaging and the radioactive catheter tip was better resolved in gated images. In human studies, the dual gating was found feasible and easy for clinical routine. Maximal movement of myocardial surface in cranio-caudal direction was over 20 mm. The shape of myocardium was clearly different between the gates and papillary muscles become more visible in diastolic images. The first clinical experiences using robust cardiac-respiratory dual gating are encouraging. Further testing in larger clinical populations using tracers designed especially for plaque imaging is warranted. (orig.)

  19. Dual-gated cardiac PET-clinical feasibility study

    International Nuclear Information System (INIS)

    Teraes, Mika; Kokki, Tommi; Noponen, Tommi; Hoppela, Erika; Sipilae, Hannu T.; Knuuti, Juhani; Durand-Schaefer, Nicolas; Pietilae, Mikko; Kiss, Jan

    2010-01-01

    Both respiratory and cardiac motions reduce image quality in myocardial imaging. For accurate imaging of small structures such as vulnerable coronary plaques, simultaneous cardiac and respiratory gating is warranted. This study tests the feasibility of a recently developed robust method for cardiac-respiratory gating. List-mode data with triggers from respiratory and cardiac cycles are rearranged into dual-gated segments and reconstructed with standard algorithms of a commercial PET/CT scanner. Cardiac gates were defined as three fixed phases and one variable diastolic phase. Chest motion was measured with a respiratory gating device and post-processed to determine gates. Preservation of quantification in dual-gated images was tested with an IEC whole-body phantom. Minipig and human studies were performed to evaluate the feasibility of the method. In minipig studies, a coronary catheter with radioactive tip was guided in coronary artery for in vivo and ex vivo acquisitions. Dual gating in humans with suspected cardiac disorders was performed using 18-F-FDG as a tracer. The method was found feasible for in vivo imaging and the radioactive catheter tip was better resolved in gated images. In human studies, the dual gating was found feasible and easy for clinical routine. Maximal movement of myocardial surface in cranio-caudal direction was over 20 mm. The shape of myocardium was clearly different between the gates and papillary muscles become more visible in diastolic images. The first clinical experiences using robust cardiac-respiratory dual gating are encouraging. Further testing in larger clinical populations using tracers designed especially for plaque imaging is warranted. (orig.)

  20. Nonassociative learning as gated neural integrator and differentiator in stimulus-response pathways

    Directory of Open Access Journals (Sweden)

    Young Daniel L

    2006-08-01

    Full Text Available Abstract Nonassociative learning is a basic neuroadaptive behavior exhibited across animal phyla and sensory modalities but its role in brain intelligence is unclear. Current literature on habituation and sensitization, the classic "dual process" of nonassociative learning, gives highly incongruous accounts between varying experimental paradigms. Here we propose a general theory of nonassociative learning featuring four base modes: habituation/primary sensitization in primary stimulus-response pathways, and desensitization/secondary sensitization in secondary stimulus-response pathways. Primary and secondary modes of nonassociative learning are distinguished by corresponding activity-dependent recall, or nonassociative gating, of neurotransmission memory. From the perspective of brain computation, nonassociative learning is a form of integral-differential calculus whereas nonassociative gating is a form of Boolean logic operator – both dynamically transforming the stimulus-response relationship. From the perspective of sensory integration, nonassociative gating provides temporal filtering whereas nonassociative learning affords low-pass, high-pass or band-pass/band-stop frequency filtering – effectively creating an intelligent sensory firewall that screens all stimuli for attention and resultant internal model adaptation and reaction. This unified framework ties together many salient characteristics of nonassociative learning and nonassociative gating and suggests a common kernel that correlates with a wide variety of sensorimotor integration behaviors such as central resetting and self-organization of sensory inputs, fail-safe sensorimotor compensation, integral-differential and gated modulation of sensorimotor feedbacks, alarm reaction, novelty detection and selective attention, as well as a variety of mental and neurological disorders such as sensorimotor instability, attention deficit hyperactivity, sensory defensiveness, autism

  1. High-performance colorimeter with an electronic bubble gate for use in miniaturized continuous-flow analyzers.

    Science.gov (United States)

    Neeley, W E; Wardlaw, S C; Yates, T; Hollingsworth, W G; Swinnen, M E

    1976-02-01

    We describe a high-performance colorimeter with an electronic bubble gate for use with miniaturized continuous-flow analyzers. The colorimeter has a flow-through cuvette with optically flat quartz windows that allows a bubbled stream to pass freely without any breakup or retention of bubbles. The fluid volume in the light path is only 1.8 mul. The electronic bubble gate selectively removes that portion of the photodector signal produced by the air bubbles passing through the flow cell and allows that portion of the signal attributable to the fluid segment to pass to the recorder. The colorimeter is easy to use, rugged, inexpensive, and requires minimal adjustments.

  2. Quantum design rules for single molecule logic gates.

    Science.gov (United States)

    Renaud, N; Hliwa, M; Joachim, C

    2011-08-28

    Recent publications have demonstrated how to implement a NOR logic gate with a single molecule using its interaction with two surface atoms as logical inputs [W. Soe et al., ACS Nano, 2011, 5, 1436]. We demonstrate here how this NOR logic gate belongs to the general family of quantum logic gates where the Boolean truth table results from a full control of the quantum trajectory of the electron transfer process through the molecule by very local and classical inputs practiced on the molecule. A new molecule OR gate is proposed for the logical inputs to be also single metal atoms, one per logical input.

  3. Deterministic nonlinear phase gates induced by a single qubit

    Science.gov (United States)

    Park, Kimin; Marek, Petr; Filip, Radim

    2018-05-01

    We propose deterministic realizations of nonlinear phase gates by repeating a finite sequence of non-commuting Rabi interactions between a harmonic oscillator and only a single two-level ancillary qubit. We show explicitly that the key nonclassical features of the ideal cubic phase gate and the quartic phase gate are generated in the harmonic oscillator faithfully by our method. We numerically analyzed the performance of our scheme under realistic imperfections of the oscillator and the two-level system. The methodology is extended further to higher-order nonlinear phase gates. This theoretical proposal completes the set of operations required for continuous-variable quantum computation.

  4. Electrochemical Single-Molecule Transistors with Optimized Gate Coupling

    DEFF Research Database (Denmark)

    Osorio, Henrry M.; Catarelli, Samantha; Cea, Pilar

    2015-01-01

    Electrochemical gating at the single molecule level of viologen molecular bridges in ionic liquids is examined. Contrary to previous data recorded in aqueous electrolytes, a clear and sharp peak in the single molecule conductance versus electrochemical potential data is obtained in ionic liquids....... These data are rationalized in terms of a two-step electrochemical model for charge transport across the redox bridge. In this model the gate coupling in the ionic liquid is found to be fully effective with a modeled gate coupling parameter, ξ, of unity. This compares to a much lower gate coupling parameter...

  5. Heavy-ion-induced, gate-rupture in power MOSFETs

    International Nuclear Information System (INIS)

    Fischer, T.A.

    1987-01-01

    A new, heavy-ion-induced, burnout mechanism has been experimentally observed in power metal-oxide-semiconductor field-effect transistors (MOSFETs). This mechanism occurs when a heavy, charged particle passes through the gate oxide region of n- or p-channel devices having sufficient gate-to-source or gate-to-drain bias. The gate-rupture leads to significant permanent degradation of the device. A proposed failure mechanism is discussed and experimentally verified. In addition, the absolute immunity of p-channel devices to heavy-ion-induced, semiconductor burnout is demonstrated and discussed along with new, non-destructive, burnout testing methods

  6. Gambierol, a toxin produced by the dinoflagellate Gambierdiscus toxicus, is a potent blocker of voltage-gated potassium channels☆

    Science.gov (United States)

    Cuypers, Eva; Abdel-Mottaleb, Yousra; Kopljar, Ivan; Rainier, Jon D.; Raes, Adam L.; Snyders, Dirk J.; Tytgat, Jan

    2008-01-01

    In this study, we pharmacologically characterized gambierol, a marine polycyclic ether toxin which is produced by the dinoflagellate Gambierdiscus toxicus. Besides several other polycyclic ether toxins like ciguatoxins, this scarcely studied toxin is one of the compounds that may be responsible for ciguatera fish poisoning (CFP). Unfortunately, the biological target(s) that underlies CFP is still partly unknown. Today, ciguatoxins are described to specifically activate voltage-gated sodium channels by interacting with their receptor site 5. But some dispute about the role of gambierol in the CFP story shows up: some describe voltage-gated sodium channels as the target, while others pinpoint voltage-gated potassium channels as targets. Since gambierol was never tested on isolated ion channels before, it was subjected in this work to extensive screening on a panel of 17 ion channels: nine cloned voltage-gated ion channels (mammalian Nav1.1–Nav1.8 and insect Para) and eight cloned voltage-gated potassium channels (mammalian Kv1.1–Kv1.6, hERG and insect ShakerIR) expressed in Xenopus laevis oocytes using two-electrode voltage-clamp technique. All tested sodium channel subtypes are insensitive to gambierol concentrations up to 10 μM. In contrast, Kv1.2 is the most sensitive voltage-gated potassium channel subtype with almost full block (>97%) and an half maximal inhibitory concentration (IC50) of 34.5 nM. To the best of our knowledge, this is the first study where the selectivity of gambierol is tested on isolated voltage-gated ion channels. Therefore, these results lead to a better understanding of gambierol and its possible role in CFP and they may also be useful in the development of more effective treatments. PMID:18313714

  7. Pharmacology of the Nav1.1 domain IV voltage sensor reveals coupling between inactivation gating processes.

    Science.gov (United States)

    Osteen, Jeremiah D; Sampson, Kevin; Iyer, Vivek; Julius, David; Bosmans, Frank

    2017-06-27

    The Na v 1.1 voltage-gated sodium channel is a critical contributor to excitability in the brain, where pathological loss of function leads to such disorders as epilepsy, Alzheimer's disease, and autism. This voltage-gated sodium (Na v ) channel subtype also plays an important role in mechanical pain signaling by primary afferent somatosensory neurons. Therefore, pharmacologic modulation of Na v 1.1 represents a potential strategy for treating excitability disorders of the brain and periphery. Inactivation is a complex aspect of Na v channel gating and consists of fast and slow components, each of which may involve a contribution from one or more voltage-sensing domains. Here, we exploit the Hm1a spider toxin, a Na v 1.1-selective modulator, to better understand the relationship between these temporally distinct modes of inactivation and ask whether they can be distinguished pharmacologically. We show that Hm1a inhibits the gating movement of the domain IV voltage sensor (VSDIV), hindering both fast and slow inactivation and leading to an increase in Na v 1.1 availability during high-frequency stimulation. In contrast, ICA-121431, a small-molecule Na v 1.1 inhibitor, accelerates a subsequent VSDIV gating transition to accelerate entry into the slow inactivated state, resulting in use-dependent block. Further evidence for functional coupling between fast and slow inactivation is provided by a Na v 1.1 mutant in which fast inactivation removal has complex effects on slow inactivation. Taken together, our data substantiate the key role of VSDIV in Na v channel fast and slow inactivation and demonstrate that these gating processes are sequential and coupled through VSDIV. These findings provide insight into a pharmacophore on VSDIV through which modulation of inactivation gating can inhibit or facilitate Na v 1.1 function.

  8. Universal programmable logic gate and routing method

    Science.gov (United States)

    Fijany, Amir (Inventor); Vatan, Farrokh (Inventor); Akarvardar, Kerem (Inventor); Blalock, Benjamin (Inventor); Chen, Suheng (Inventor); Cristoloveanu, Sorin (Inventor); Kolawa, Elzbieta (Inventor); Mojarradi, Mohammad M. (Inventor); Toomarian, Nikzad (Inventor)

    2009-01-01

    An universal and programmable logic gate based on G.sup.4-FET technology is disclosed, leading to the design of more efficient logic circuits. A new full adder design based on the G.sup.4-FET is also presented. The G.sup.4-FET can also function as a unique router device offering coplanar crossing of signal paths that are isolated and perpendicular to one another. This has the potential of overcoming major limitations in VLSI design where complex interconnection schemes have become increasingly problematic.

  9. Gated cardiac blood pool studies in arrhythmias

    International Nuclear Information System (INIS)

    Itti, R.; Casset, D.; Philippe, L.; Cosnay, P.; Fauchier, J.P.

    1988-01-01

    Biventricular phase analysis a gated blood pool studies may help to solve two fundamental questions raised by patients suffering from arrhythmias: localization of an electrical cardiac activation abnormality by means of contraction mapping and assesment of an underlying organic disease using the phase histograms and their standard deviations. Three groups of patients have been evaluated to demonstrate the usefulness of radioisotopic techniques in arrhythmias: 36 patients with a Wolff-Parkinson-White syndrom, 27 patients studied during a ventricular tachycardia attack and 32 patients suspected of arrhythmogenic ventricular dysplasia. Correlations with invasive electrophysiologic studies are presented and the diagnostic and therapeutic implications of these results are discussed [fr

  10. Temporary new opening hours for Gate C

    CERN Multimedia

    GS Department

    2010-01-01

    Please note the new temporary opening hours for the gate C as from 22 September 2010 until 29 October 2010 (working days): Morning: between 7:00 a.m. and 9:00 a.m. Lunch: between 12:00 and 2:00 p.m. Evening: between 5:00 pm and 7:00 p.m. Traffic flow will be permitted in both directions during this period. Please minimize your speed accordingly and respect all road signs. GS-SEM Group General Infrastructure Services Department

  11. Gated cardiac blood pool studies in arrhythmias

    Energy Technology Data Exchange (ETDEWEB)

    Itti, R.; Casset, D.; Philippe, L.; Cosnay, P.; Fauchier, J.P.

    1988-01-01

    Biventricular phase analysis a gated blood pool studies may help to solve two fundamental questions raised by patients suffering from arrhythmias: localization of an electrical cardiac activation abnormality by means of contraction mapping and assesment of an underlying organic disease using the phase histograms and their standard deviations. Three groups of patients have been evaluated to demonstrate the usefulness of radioisotopic techniques in arrhythmias: 36 patients with a Wolff-Parkinson-White syndrom, 27 patients studied during a ventricular tachycardia attack and 32 patients suspected of arrhythmogenic ventricular dysplasia. Correlations with invasive electrophysiologic studies are presented and the diagnostic and therapeutic implications of these results are discussed.

  12. Nano-CMOS gate dielectric engineering

    CERN Document Server

    Wong, Hei

    2011-01-01

    According to Moore's Law, not only does the number of transistors in an integrated circuit double every two years, but transistor size also decreases at a predictable rate. At the rate we are going, the downsizing of CMOS transistors will reach the deca-nanometer scale by 2020. Accordingly, the gate dielectric thickness will be shrunk to less than half-nanometer oxide equivalent thickness (EOT) to maintain proper operation of the transistors, leaving high-k materials as the only viable solution for such small-scale EOT. This comprehensive, up-to-date text covering the physics, materials, devic

  13. Block QCA Fault-Tolerant Logic Gates

    Science.gov (United States)

    Firjany, Amir; Toomarian, Nikzad; Modarres, Katayoon

    2003-01-01

    Suitably patterned arrays (blocks) of quantum-dot cellular automata (QCA) have been proposed as fault-tolerant universal logic gates. These block QCA gates could be used to realize the potential of QCA for further miniaturization, reduction of power consumption, increase in switching speed, and increased degree of integration of very-large-scale integrated (VLSI) electronic circuits. The limitations of conventional VLSI circuitry, the basic principle of operation of QCA, and the potential advantages of QCA-based VLSI circuitry were described in several NASA Tech Briefs articles, namely Implementing Permutation Matrices by Use of Quantum Dots (NPO-20801), Vol. 25, No. 10 (October 2001), page 42; Compact Interconnection Networks Based on Quantum Dots (NPO-20855) Vol. 27, No. 1 (January 2003), page 32; Bit-Serial Adder Based on Quantum Dots (NPO-20869), Vol. 27, No. 1 (January 2003), page 35; and Hybrid VLSI/QCA Architecture for Computing FFTs (NPO-20923), which follows this article. To recapitulate the principle of operation (greatly oversimplified because of the limitation on space available for this article): A quantum-dot cellular automata contains four quantum dots positioned at or between the corners of a square cell. The cell contains two extra mobile electrons that can tunnel (in the quantummechanical sense) between neighboring dots within the cell. The Coulomb repulsion between the two electrons tends to make them occupy antipodal dots in the cell. For an isolated cell, there are two energetically equivalent arrangements (denoted polarization states) of the extra electrons. The cell polarization is used to encode binary information. Because the polarization of a nonisolated cell depends on Coulomb-repulsion interactions with neighboring cells, universal logic gates and binary wires could be constructed, in principle, by arraying QCA of suitable design in suitable patterns. Heretofore, researchers have recognized two major obstacles to realization of QCA

  14. Error-Transparent Quantum Gates for Small Logical Qubit Architectures

    Science.gov (United States)

    Kapit, Eliot

    2018-02-01

    One of the largest obstacles to building a quantum computer is gate error, where the physical evolution of the state of a qubit or group of qubits during a gate operation does not match the intended unitary transformation. Gate error stems from a combination of control errors and random single qubit errors from interaction with the environment. While great strides have been made in mitigating control errors, intrinsic qubit error remains a serious problem that limits gate fidelity in modern qubit architectures. Simultaneously, recent developments of small error-corrected logical qubit devices promise significant increases in logical state lifetime, but translating those improvements into increases in gate fidelity is a complex challenge. In this Letter, we construct protocols for gates on and between small logical qubit devices which inherit the parent device's tolerance to single qubit errors which occur at any time before or during the gate. We consider two such devices, a passive implementation of the three-qubit bit flip code, and the author's own [E. Kapit, Phys. Rev. Lett. 116, 150501 (2016), 10.1103/PhysRevLett.116.150501] very small logical qubit (VSLQ) design, and propose error-tolerant gate sets for both. The effective logical gate error rate in these models displays superlinear error reduction with linear increases in single qubit lifetime, proving that passive error correction is capable of increasing gate fidelity. Using a standard phenomenological noise model for superconducting qubits, we demonstrate a realistic, universal one- and two-qubit gate set for the VSLQ, with error rates an order of magnitude lower than those for same-duration operations on single qubits or pairs of qubits. These developments further suggest that incorporating small logical qubits into a measurement based code could substantially improve code performance.

  15. Diminished auditory sensory gating during active auditory verbal hallucinations.

    Science.gov (United States)

    Thoma, Robert J; Meier, Andrew; Houck, Jon; Clark, Vincent P; Lewine, Jeffrey D; Turner, Jessica; Calhoun, Vince; Stephen, Julia

    2017-10-01

    Auditory sensory gating, assessed in a paired-click paradigm, indicates the extent to which incoming stimuli are filtered, or "gated", in auditory cortex. Gating is typically computed as the ratio of the peak amplitude of the event related potential (ERP) to a second click (S2) divided by the peak amplitude of the ERP to a first click (S1). Higher gating ratios are purportedly indicative of incomplete suppression of S2 and considered to represent sensory processing dysfunction. In schizophrenia, hallucination severity is positively correlated with gating ratios, and it was hypothesized that a failure of sensory control processes early in auditory sensation (gating) may represent a larger system failure within the auditory data stream; resulting in auditory verbal hallucinations (AVH). EEG data were collected while patients (N=12) with treatment-resistant AVH pressed a button to indicate the beginning (AVH-on) and end (AVH-off) of each AVH during a paired click protocol. For each participant, separate gating ratios were computed for the P50, N100, and P200 components for each of the AVH-off and AVH-on states. AVH trait severity was assessed using the Psychotic Symptoms Rating Scales AVH Total score (PSYRATS). The results of a mixed model ANOVA revealed an overall effect for AVH state, such that gating ratios were significantly higher during the AVH-on state than during AVH-off for all three components. PSYRATS score was significantly and negatively correlated with N100 gating ratio only in the AVH-off state. These findings link onset of AVH with a failure of an empirically-defined auditory inhibition system, auditory sensory gating, and pave the way for a sensory gating model of AVH. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Gate-first integration of tunable work function metal gates of different thicknesses into high-k metal gates CMOS FinFETs for multi- VTh engineering

    KAUST Repository

    Hussain, Muhammad Mustafa

    2010-03-01

    Gate-first integration of tunable work function metal gates of different thicknesses (320 nm) into high-k/metal gates CMOS FinFETs was demonstrated to achieve multiple threshold voltages (VTh) for 32-nm technology and beyond logic, memory, input/output, and system-on-a-chip applications. The fabricated devices showed excellent short-channel effect immunity (drain-induced barrier lowering ∼ 40 mV/V), nearly symmetric VTh, low T inv(∼ 1.4 nm), and high Ion(∼780μAμm) for N/PMOS without any intentional strain enhancement. © 2006 IEEE.

  17. Gate-first integration of tunable work function metal gates of different thicknesses into high-k metal gates CMOS FinFETs for multi- VTh engineering

    KAUST Repository

    Hussain, Muhammad Mustafa; Smith, Casey Eben; Harris, Harlan Rusty; Young, Chadwin; Tseng, Hsinghuang; Jammy, Rajarao

    2010-01-01

    Gate-first integration of tunable work function metal gates of different thicknesses (320 nm) into high-k/metal gates CMOS FinFETs was demonstrated to achieve multiple threshold voltages (VTh) for 32-nm technology and beyond logic, memory, input/output, and system-on-a-chip applications. The fabricated devices showed excellent short-channel effect immunity (drain-induced barrier lowering ∼ 40 mV/V), nearly symmetric VTh, low T inv(∼ 1.4 nm), and high Ion(∼780μAμm) for N/PMOS without any intentional strain enhancement. © 2006 IEEE.

  18. New Role of P/Q-type Voltage-gated Calcium Channels

    DEFF Research Database (Denmark)

    Hansen, Pernille B L

    2015-01-01

    Voltage-gated calcium channels are important for the depolarization-evoked contraction of vascular smooth muscle cells (SMCs), with L-type channels being the classical channel involved in this mechanism. However, it has been demonstrated that the CaV2.1 subunit, which encodes a neuronal isoform...... of the voltage-gated calcium channels (P/Q-type), is also expressed and contributes functionally to contraction of renal blood vessels in both mice and humans. Furthermore, preglomerular vascular SMCs and aortic SMCs coexpress L-, P-, and Q-type calcium channels within the same cell. Calcium channel blockers...... are widely used as pharmacological treatments. However, calcium channel antagonists vary in their selectivity for the various ca