WorldWideScience

Sample records for selected transgenic lines

  1. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Science.gov (United States)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  2. FLAX OIL FROM TRANSGENIC LINUM USITATISSIMUM SELECTIVELY INHIBITS IN VITRO PROLIFERATION OF HUMAN CANCER CELL LINES.

    Science.gov (United States)

    Gebarowski, Tomasz; Gebczak, Katarzyna; Wiatrak, Benita; Kulma, Anna; Pelc, Katarzyna; Czuj, Tadeusz; Szopa, Jan; Gasiorowski, Kazimierz

    2017-03-01

    Emulsions made of oils from transgenic flaxseeds significantly decreased in vitro proliferation of six tested human cancer cell lines in 48-h cultures, as assessed with the standard sulforhodamine assay. However, the emulsions also increased proliferation rate of normal human dermal fibroblasts and, to a lower extend, of keratinocytes. Both inhibition of in vitro proliferation of human cancer cell lines and stimulation of proliferation of normal dermal fibroblasts and keratinocytes were especially strong with the emulsion type B and with emulsion type M. Oils from seeds of transgenic flax type B and M should be considered as valuable adjunct to standard cytostatic therapy of human cancers and also could be applied to improve the treatment of skin lesions in wound healing.

  3. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  4. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

  5. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Science.gov (United States)

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  6. Establishment and characterization of CAG/EGFP transgenic rabbit line.

    Science.gov (United States)

    Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

    2007-02-01

    Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

  7. Development of putative transgenic lines of cassava variety H-226 ...

    African Journals Online (AJOL)

    CMD) caused by the Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV). An attempt was done to develop transgenic cassava lines resistant to SLCMV through RNAi vector targeting a conserved 440 bp of 5' end ...

  8. Adaptability and stability of transgenic soybean lines and cultivars in ...

    African Journals Online (AJOL)

    Subsequently, genotypic adaptability and stability were evaluated by the methods of Eberhart and Russel (1966), Lin and Binns modified by Carneiro, Annicchiarico and Centroid. All methods presented partial coherence on classifying the best genotypes and allowed the identification of the transgenic lines L1 and L4, and ...

  9. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  10. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene

    DEFF Research Database (Denmark)

    Efrat, S; Linde, S; Kofod, Hans

    1988-01-01

    Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....

  11. Case Study: Polycystic Livers in a Transgenic Mouse Line

    Energy Technology Data Exchange (ETDEWEB)

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  12. Effective selection of transgenic papaya plants with the PMI/Man selection system.

    Science.gov (United States)

    Zhu, Yun J; Agbayani, Ricelle; McCafferty, Heather; Albert, Henrik H; Moore, Paul H

    2005-09-01

    The selectable marker gene phospho-mannose isomerase (pmi), which encodes the enzyme phospho-mannose isomerase (PMI) to enable selection of transformed cell lines on media containing mannose (Man), was evaluated for genetic transformation of papaya (Carica papaya L.). We found that papaya embryogenic calli have little or no PMI activity and cannot utilize Man as a carbon source; however, when calli were transformed with a pmi gene, the PMI activity was greatly increased and they could utilize Man as efficiently as sucrose. Plants regenerated from selected callus lines also exhibited PMI activity but at a lower specific activity level. Our transformation efficiency with Man selection was higher than that reported using antibiotic selection or with a visual marker. For papaya, the PMI/Man selection system for producing transgenic plants is a highly efficient addition to previously published methods for selection and may facilitate the stacking of multiple transgenes of interest. Additionally, since the PMI/Man selection system does not involve antibiotic or herbicide resistance genes, its use might reduce environmental concerns about the potential flow of those genes into related plant populations.

  13. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    Directory of Open Access Journals (Sweden)

    Luhua Zhang

    Full Text Available Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.. To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer, and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  14. GENETIC TRANSFORMATION AND ANALYSIS OF WHEAT TRANSGENIC CELL LINES BY IRAP-PCR

    Directory of Open Access Journals (Sweden)

    Bavol A. V.

    2013-12-01

    Full Text Available The transgenic wheat cell lines were obtained via biolistic transformation of the callus cultures initiated from the 3-day-old sterile seedling shoot apexes. The pAHC25 vector construction used for 14- and 28-day-old callus cultures transformation carried the selective phosphinothricin-N-acetyltransferase (bar gene and reporter ?-glucuronidase gene. The cell line selection was carried out on the media with phosphinothricin by means of graduated cell selection. The transgenic status of the obtained forms was proved by PCR-analysis. The presence of new relatively high molecular (more than 1 000 bp amplicons were found out for three transformed lines by means of IRAP PCRanalysis with the primers coding for long termainal repeats sequences of SIRE 1 retrotransposon. This fact may prove transposition of this mobile genetic element. The new DNA fragments were detected for three of the seven analyzed lines but for the control callus. It is possible to assume at induction of SIRE 1 transposition bis probably caused by the genomic stress of foreign DNA inserting or associated with the transformation process (mechanical wounding, cultivation on selective media.

  15. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  16. Simplified methodology for large scale isolation of homozygous transgenic lines of lettuce

    Directory of Open Access Journals (Sweden)

    Flavia S. Darqui

    2018-01-01

    Conclusions: This protocol allows a simplified scaling-up of the production of multiple homozygous transgenic progeny lines in the early generations avoiding expensive and time-consuming molecular assays.

  17. Stability of transgene expression, field performance and recombination breeding of transformed barley lines

    DEFF Research Database (Denmark)

    Horvath, H.; Jensen, L.G.; Wong, O.T.

    2001-01-01

    in homozygous transgenic T-3 plants, and these remained constant over a 3-year period. In micro-malting experiments, the heat-stable enzyme reached levels of up to 1.4 mug.mg(-1) protein and survived kiln drying at levels of 70-100%. In the field trials of 1997 and 1998 the transgenic lines had a reduced 1000...... lines yielded approximately 6 t.ha(-1) and Golden Promise 7.7 t.ha(-1). Cross-breeding was carried out to transfer the transgene into a more suitable genetic background. Crosses of the semi-dwarf ari-e mutant Golden Promise gave rise to the four morphological phenotypes nutans, high erect, erect...... transformants were observed in some F-4 lines homozygous for the morphological phenotypes and for the transgene. In the case of a homozygous nutans line, the transgenic plants had a higher 1000-grain weight than those lacking the transgene. Like mutants providing useful output traits, transgenic plants...

  18. Investigating the application of a nitroreductase-expressing transgenic zebrafish line for high-throughput toxicity testing

    Directory of Open Access Journals (Sweden)

    Anna C. Chlebowski

    Full Text Available Nitroreductase enzymes are responsible for the reduction of nitro functional groups to amino functional groups, and are found in a range of animal models, zebrafish (Danio rerio excluded. Transgenic zebrafish models have been developed for tissue-specific cell ablation, which use nitroreductase to ablate specific tissues or cell types following exposure to the non-toxic pro-drug metronidazole (MTZ. When metabolized by nitroreductase, MTZ produces a potent cytotoxin, which specifically ablates the tissue in which metabolism occurs. Uses, beyond tissue-specific cell ablation, are possible for the hepatocyte-specific Tg(l-fabp:CFP-NTRs891 zebrafish line, including investigations of the role of nitroreductase in the toxicity of nitrated compounds. The hepatic ablation characteristics of this transgenic line were explored, in order to expand its potential uses. Embryos were exposed at 48, 72, or 96 h post fertilization (hpf to a range of MTZ concentrations, and the ablation profiles were compared. Ablation occurred at a 10-fold lower concentration than previously reported. Embryos were exposed to a selection of other compounds, with and without MTZ, in order to investigate alternative uses for this transgenic line. Test compounds were selected based on: their ability to undergo nitroreduction, known importance of hepatic metabolism to toxicity, and known pharmaceutical hepatotoxins. Selected compounds included nitrated polycyclic aromatic hydrocarbons (nitro-PAHs, the PAHs retene and benzo[a]pyrene, and the pharmaceuticals acetaminophen and flutamide. The results suggest a range of potential roles of the liver in the toxicity of these compounds, and highlight the additional uses of this transgenic model in toxicity testing. Keywords: Zebrafish, Transgenic, Nitroreductase, Nitrated polycyclic aromatic hydrocarbon, Tissue ablation, Pharmaceuticals

  19. Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

    Science.gov (United States)

    Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

    2011-01-01

    Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

  20. Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis

    International Nuclear Information System (INIS)

    Klein, C.B.; Rossman, T.G.

    1990-01-01

    The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT - Chinese hamster V79 cells. Several gpt - cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt - occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and β-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus

  1. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  2. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

    2005-01-01

    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  3. Generation of doubled haploid transgenic wheat lines by microspore transformation.

    Directory of Open Access Journals (Sweden)

    Rhoda A T Brew-Appiah

    Full Text Available Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i pretreatment of immature spikes with CuSO4 solution (500 mg/L at 4°C for 10 days; (ii electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v elimination of AGL-1 cells after co-cultivation with timentin (200-400 mg/L.

  4. Minimization over randomly selected lines

    Directory of Open Access Journals (Sweden)

    Ismet Sahin

    2013-07-01

    Full Text Available This paper presents a population-based evolutionary optimization method for minimizing a given cost function. The mutation operator of this method selects randomly oriented lines in the cost function domain, constructs quadratic functions interpolating the cost function at three different points over each line, and uses extrema of the quadratics as mutated points. The crossover operator modifies each mutated point based on components of two points in population, instead of one point as is usually performed in other evolutionary algorithms. The stopping criterion of this method depends on the number of almost degenerate quadratics. We demonstrate that the proposed method with these mutation and crossover operations achieves faster and more robust convergence than the well-known Differential Evolution and Particle Swarm algorithms.

  5. Line selection in celestial masers

    International Nuclear Information System (INIS)

    Middleton, M.S.

    1978-09-01

    The primary themes of this work concern the applicability of the Cook (1975) filter mechanism to line selection in hydroxyl masers, and the question of whether interstellar hydroxyl, water, and silicon monoxide masers are saturated. Whether the Cook filter is operative in celestial masers has not thus far been decided, even though it has been shown that such an effect might be occurring. The theory in its present form does not account for line broadening, nor have its consequences with regard to microwave maser emission from excited states of hydroxyl been explored. Both these topics are discussed and the findings are compared with the observations of NGC 6334A, a source which is interesting because of the strong evidence for Zeeman splitting which can be seen in some of its observed spectra. The question of whether interstellar masers are saturated has been much discussed, but a simple method for determining the state of saturation of observed masers does not exist. In particular, the importance of background radiation and of different cloud geometries on the state of saturation of interstellar masers up to now has not been fully appreciated. Both these topics are discussed. (author)

  6. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    Science.gov (United States)

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  7. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    International Nuclear Information System (INIS)

    Wang Tiegu; Huang Qunce; Feng Weisen

    2007-01-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning

  8. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Science.gov (United States)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen

    2007-10-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  9. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Energy Technology Data Exchange (ETDEWEB)

    Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)

    2007-10-15

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  10. Characterization of gastric adenocarcinoma cell lines established from CEA424/SV40 T antigen-transgenic mice with or without a human CEA transgene

    International Nuclear Information System (INIS)

    Nöckel, Jessica; Engel, Natasja K van den; Winter, Hauke; Hatz, Rudolf A; Zimmermann, Wolfgang; Kammerer, Robert

    2006-01-01

    Gastric carcinoma is one of the most frequent cancers worldwide. Patients with gastric cancer at an advanced disease stage have a poor prognosis, due to the limited efficacy of available therapies. Therefore, the development of new therapies, like immunotherapy for the treatment of gastric cancer is of utmost importance. Since the usability of existing preclinical models for the evaluation of immunotherapies for gastric adenocarcinomas is limited, the goal of the present study was to establish murine in vivo models which allow the stepwise improvement of immunotherapies for gastric cancer. Since no murine gastric adenocarcinoma cell lines are available we established four cell lines (424GC, mGC3, mGC5, mGC8) from spontaneously developing tumors of CEA424/SV40 T antigen (CEA424/Tag) mice and three cell lines derived from double-transgenic offsprings of CEA424/Tag mice mated with human carcinoembryonic antigen (CEA)-transgenic (CEA424/Tag-CEA) mice (mGC2 CEA , mGC4 CEA , mGC11 CEA ). CEA424/Tag is a transgenic C57BL/6 mouse strain harboring the Tag under the control of a -424/-8 bp CEA gene promoter which leads to the development of invasive adenocarcinoma in the glandular stomach. Tumor cell lines established from CEA424/Tag-CEA mice express the well defined tumor antigen CEA under the control of its natural regulatory elements. The epithelial origin of the tumor cells was proven by morphological criteria including the presence of mucin within the cells and the expression of the cell adhesion molecules EpCAM and CEACAM1. All cell lines consistently express the transgenes CEA and/or Tag and MHC class I molecules leading to their susceptibility to lysis by Tag-specific CTL in vitro. Despite the presentation of CTL-epitopes derived from the transgene products the tumor cell lines were tumorigenic when grafted into C57BL/6, CEA424/Tag or CEA424/Tag-CEA-transgenic hosts and no significant differences in tumor take and tumor growth were observed in the different hosts

  11. Preliminarily study on the maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on gastropods

    Science.gov (United States)

    Zhu, Tingbing; Zhang, Lihong; Zhang, Tanglin; Wang, Yaping; Hu, Wei; Olsen, Rolf Eric; Zhu, Zuoyan

    2017-10-01

    The present study preliminarily examined the differences in maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on four gastropods species (Bellamya aeruginosa, Radix auricularia, Parafossarulus sinensis and Alocinma longicornis) under laboratory conditions. In the maximum handling size trial, five fish from each age group (1-year-old and 2-year-old) and each genotype (transgenic and non-transgenic) of common carp were individually allowed to feed on B. aeruginosa with wide shell height range. The results showed that maximum handling size increased linearly with fish length, and there was no significant difference in maximum handling size between the two genotypes. In the size selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on three size groups of B. aeruginosa. The results show that the two genotypes of C. carpio favored the small-sized group over the large-sized group. In the species selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on thin-shelled B. aeruginosa and thick-shelled R. auricularia, and five pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on two gastropods species (P. sinensis and A. longicornis) with similar size and shell strength. The results showed that both genotypes preferred thin-shelled Radix auricularia rather than thick-shelled B. aeruginosa, but there were no significant difference in selectivity between the two genotypes when fed on P. sinensis and A. longicornis. The present study indicates that transgenic and non-transgenic C. carpio show similar selectivity of predation on the size- and species-limited gastropods. While this information may be useful for assessing the environmental risk of transgenic carp, it does not necessarily demonstrate that transgenic common carp might

  12. Inheritance and effectiveness of two transgenes determining PVY resistance in progeny from crossing independently transformed tobacco lines.

    Science.gov (United States)

    Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa

    2017-05-01

    Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.

  13. Lines of Descent Under Selection

    Science.gov (United States)

    Baake, Ellen; Wakolbinger, Anton

    2017-11-01

    We review recent progress on ancestral processes related to mutation-selection models, both in the deterministic and the stochastic setting. We mainly rely on two concepts, namely, the killed ancestral selection graph and the pruned lookdown ancestral selection graph. The killed ancestral selection graph gives a representation of the type of a random individual from a stationary population, based upon the individual's potential ancestry back until the mutations that define the individual's type. The pruned lookdown ancestral selection graph allows one to trace the ancestry of individuals from a stationary distribution back into the distant past, thus leading to the stationary distribution of ancestral types. We illustrate the results by applying them to a prototype model for the error threshold phenomenon.

  14. Establishment of a pig fibroblast-derived cell line for locus-directed transgene expression in cell cultures and blastocysts

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Li, Juan; Moldt, Brian

    2011-01-01

    We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon-based do......We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon...

  15. Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

    Directory of Open Access Journals (Sweden)

    Sachin Kajla

    Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

  16. Transgenic Xenopus laevis Line for In Vivo Labeling of Nephrons within the Kidney

    Directory of Open Access Journals (Sweden)

    Mark E. Corkins

    2018-04-01

    Full Text Available Xenopus laevis embryos are an established model for studying kidney development. The nephron structure and genetic pathways that regulate nephrogenesis are conserved between Xenopus and humans, allowing for the study of human disease-causing genes. Xenopus embryos are also amenable to large-scale screening, but studies of kidney disease-related genes have been impeded because assessment of kidney development has largely been limited to examining fixed embryos. To overcome this problem, we have generated a transgenic line that labels the kidney. We characterize this cdh17:eGFP line, showing green fluorescent protein (GFP expression in the pronephric and mesonephric kidneys and colocalization with known kidney markers. We also demonstrate the feasibility of live imaging of embryonic kidney development and the use of cdh17:eGFP as a kidney marker for secretion assays. Additionally, we develop a new methodology to isolate and identify kidney cells for primary culture. We also use morpholino knockdown of essential kidney development genes to establish that GFP expression enables observation of phenotypes, previously only described in fixed embryos. Taken together, this transgenic line will enable primary kidney cell culture and live imaging of pronephric and mesonephric kidney development. It will also provide a simple means for high-throughput screening of putative human kidney disease-causing genes.

  17. Transgenic mice produced by retroviral transduction of male germ-line stem cells

    OpenAIRE

    Nagano, Makoto; Brinster, Clayton J.; Orwig, Kyle E.; Ryu, Buom-Yong; Avarbock, Mary R.; Brinster, Ralph L.

    2001-01-01

    Male germ-line stem cells are the only cell type in postnatal mammals that have the capability to self-renew and to contribute genes to the next generation. Genetic modification of these cells would provide an opportunity to study the biology of their complex self-renewal and differentiation processes, as well as enable the generation of transgenic animals in a wide range of species. Although retroviral vectors have been used as an efficient method to introduce genes into a variety of cell ty...

  18. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  19. A human beta cell line with drug inducible excision of immortalizing transgenes

    Science.gov (United States)

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  20. A comparative study on pathological features of transgenic rat lines expressing either three or four repeat misfolded tau.

    Science.gov (United States)

    Valachova, Bernadeta; Brezovakova, Veronika; Bugos, Ondrej; Jadhav, Santosh; Smolek, Tomas; Novak, Petr; Zilka, Norbert

    2018-08-01

    Human tauopathies represent a heterogeneous group of neurodegenerative disorders characterized by distinct clinical features, typical histopathological structures, and defined ratio(s) of three-repeat and four-repeat tau isoforms within pathological aggregates. How the optional microtubule-binding repeat of tau influences this differentiation of pathologies is understudied. We have previously generated and characterized transgenic rodent models expressing human truncated tau aa151-391 with either three (SHR24) or four microtubule-binding repeats (SHR72). Here, we compare the behavioral and neuropathological hallmarks of these two transgenic lines using a battery of tests for sensorimotor, cognitive, and neurological functions over the age range of 3.5-15 months. Progression of sensorimotor and neurological deficits was similar in both transgenic lines; however, the lifespan of transgenic line SHR72 expressing truncated four-repeat tau was markedly shorter than SHR24. Moreover, the expression of three or four-repeat tau induced distinct neurofibrillary pathology in these lines. Transgenic lines displayed different distribution of tau pathology and different type of neurofibrillary tangles. Our results suggest that three- and four-repeat isoforms of tau may display different modes of action in the diseased brain. © 2018 Wiley Periodicals, Inc.

  1. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    Science.gov (United States)

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Effect of transgenic Bacillus thuringiensis rice lines on mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae).

    Science.gov (United States)

    Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun

    2008-02-01

    Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.

  3. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

    Directory of Open Access Journals (Sweden)

    Hee-Jong Woo

    Full Text Available Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

  4. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

    Science.gov (United States)

    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk

    2015-01-01

    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

  5. Monitoring changes in anthocyanin and steroid alkaloid glycoside content in lines of transgenic potato plants using liquid chromatography/mass spectrometry.

    Science.gov (United States)

    Stobiecki, Maciej; Matysiak-Kata, Iwona; Frański, Rafał; Skała, Jacek; Szopa, Jan

    2003-03-01

    Transgenic potato plants overexpressing and repressing enzymes of flavonoids biosynthesis were created and analyzed. The selected plants clearly showed the expected changes in anthocyanins synthesis level. Overexpression of a DNA encoding dihydroflavonol 4-reductase (DFR) in sense orientation resulted in an increase in tuber anthocyanins, a 4-fold increase in petunidin and pelargonidin derivatives. A significant decrease in anthocyanin level was observed when the plant was transformed with a corresponding antisense construct. The transformation of potato plants was also accompanied by significant changes in steroid alkaloid glycosides (SAG) level in transgenic potato tuber. The changes in SAGs content was not dependent on flavonoid composition in transgenic potato. However, in an extreme situation where the highest (DFR11) or the lowest (DFRa3) anthocyanin level was detected the positive correlation with steroid alkaloid content was clearly visible. It is suggested that the changes in SAGs content resulted from chromatin stressed upon transformation. A liquid chromatography/mass spectrometry (LC/MS) system with electrospray ionization was applied for profiling qualitative and quantitative changes of steroid alkaloid glycosides in tubers of twelve lines of transgenic potato plants. Except alpha-chaconine and alpha-solanine, in the extracts from dried tuber skin alpha-solamargine and alpha-solasonine, triglycosides of solasonine, were identified in minor amounts, triglycosides of solanidine dehydrodimers were also recognized.

  6. Application of a high-speed breeding technology to apple (Malus × domestica) based on transgenic early flowering plants and marker-assisted selection.

    Science.gov (United States)

    Flachowsky, Henryk; Le Roux, Pierre-Marie; Peil, Andreas; Patocchi, Andrea; Richter, Klaus; Hanke, Magda-Viola

    2011-10-01

    Breeding of apple (Malus × domestica) remains a slow process because of protracted generation cycles. Shortening the juvenile phase to achieve the introgression of traits from wild species into prebreeding material within a reasonable time frame is a great challenge. In this study, we evaluated early flowering transgenic apple lines overexpressing the BpMADS4 gene of silver birch with regard to tree morphology in glasshouse conditions. Based on the results obtained, line T1190 was selected for further analysis and application to fast breeding. The DNA sequences flanking the T-DNA were isolated and the T-DNA integration site was mapped on linkage group 4. The inheritance and correctness of the T-DNA integration were confirmed after meiosis. A crossbred breeding programme was initiated by crossing T1190 with the fire blight-resistant wild species Malus fusca. Transgenic early flowering F(1) seedlings were selected and backcrossed with 'Regia' and 98/6-10 in order to introgress the apple scab Rvi2, Rvi4 and powdery mildew Pl-1, Pl-2 resistance genes and the fire blight resistance quantitative trait locus FB-F7 present in 'Regia'. Three transgenic BC'1 seedlings pyramiding Rvi2, Rvi4 and FB-F7, as well as three other BC'1 seedlings combining Pl-1 and Pl-2, were identified. Thus, the first transgenic early flowering-based apple breeding programme combined with marker-assisted selection was established. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  7. Lactation Defect in a Widely Used MMTV-Cre Transgenic Line of Mice

    Science.gov (United States)

    Yuan, Taichang; Wang, Yongping; Pao, Lily; Anderson, Steve M.; Gu, Haihua

    2011-01-01

    Background MMTV-Cre mouse lines have played important roles in our understanding about the functions of numerous genes in mouse mammary epithelial cells during mammary gland development and tumorigenesis. However, numerous studies have not included MMTV-Cre mice as controls, and many investigators have not indicated which of the different MMTV-Cre founder lines were used in their studies. Here, we describe a lactation defect that severely limits the use of one of the most commonly used MMTV-Cre founder lines. Methodology/Principal Findings To explore the role of protein tyrosine phosphatase Shp1 in mammary gland development, mice bearing the floxed Shp1 gene were crossed with MMTV-Cre mice and mammary gland development was examined by histological and biochemical techniques, while lactation competency was assessed by monitoring pup growth. Surprisingly, both the Shp1fl/+;MMTV-Cre and MMTV-Cre female mice displayed a severe lactation defect when compared to the Shp1 fl/+ control mice. Histological and biochemical analyses reveal that female mice expressing the MMTV-Cre transgene, either alone or in combination with floxed genes, exhibit defects in lobuloalveolar expansion, presence of large cytoplasmic lipid droplets in luminal alveolar epithelial cells postpartum, and precocious induction of involution. Using a PCR-based genotyping method, the three different founder lines can be distinguished, and we determined that the MMTV-Cre line A, the most widely used MMTV-Cre founder line, exhibits a profound lactation defect that limits its use in studies on mammary gland development. Conclusions/Significance The identification of a lactation defect in the MMTV-Cre line A mice indicates that investigators must use MMTV-Cre alone mice as control in studies that utilize Cre recombinase to excise genes of interest from mammary epithelial cells. Our results also suggest that previous results obtained in studies using the MMTV-Cre line A line should be re-evaluated if the

  8. A cytochrome P450 monooxygenase commonly used for negative selection in transgenic plants causes growth anomalies by disrupting brassinosteroid signaling

    Directory of Open Access Journals (Sweden)

    Manivasagam Sindhu

    2011-04-01

    Full Text Available Abstract Background Cytochrome P450 monooxygenases form a large superfamily of enzymes that catalyze diverse reactions. The P450SU1 gene from the soil bacteria Streptomyces griseolus encodes CYP105A1 which acts on various substrates including sulfonylurea herbicides, vitamin D, coumarins, and based on the work presented here, brassinosteroids. P450SU1 is used as a negative-selection marker in plants because CYP105A1 converts the relatively benign sulfonyl urea pro-herbicide R7402 into a highly phytotoxic product. Consistent with its use for negative selection, transgenic Arabidopsis plants were generated with P450SU1 situated between recognition sequences for FLP recombinase from yeast to select for recombinase-mediated excision. However, unexpected and prominent developmental aberrations resembling those described for mutants defective in brassinosteroid signaling were observed in many of the lines. Results The phenotypes of the most affected lines included severe stunting, leaf curling, darkened leaves characteristic of anthocyanin accumulation, delayed transition to flowering, low pollen and seed yields, and delayed senescence. Phenotype severity correlated with P450SU1 transcript abundance, but not with transcript abundance of other experimental genes, strongly implicating CYP105A1 as responsible for the defects. Germination and seedling growth of transgenic and control lines in the presence and absence of 24-epibrassinolide indicated that CYP105A1 disrupts brassinosteroid signaling, most likely by inactivating brassinosteroids. Conclusions Despite prior use of this gene as a genetic tool, deleterious growth in the absence of R7402 has not been elaborated. We show that this gene can cause aberrant growth by disrupting brassinosteroid signaling and affecting homeostasis.

  9. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  10. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  11. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  12. Zebrafish transgenic line huORFZ is an effective living bioindicator for detecting environmental toxicants.

    Directory of Open Access Journals (Sweden)

    Hung-Chieh Lee

    Full Text Available Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50, huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+, cadmium (Cd2+ and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants.

  13. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    Science.gov (United States)

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen

    2014-01-01

    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  14. Immune selection of tumor cells in TCR β-chain transgenic mice.

    Science.gov (United States)

    Silaeva, Yulia Yu; Grinenko, Tatyana S; Vagida, Murad S; Kalinina, Anastasia A; Khromykh, Ludmila M; Kazansky, Dmitry B

    2014-10-01

    The concept of immunological surveillance implies that immunogenic variants of tumor cells arising in the organism can be recognized by the immune system. Tumor progression is provided by somatic evolution of tumor cells under the pressure of the immune system. The loss of MHC Class I molecules on the surface of tumor cells is one of the most known outcomes of immune selection. This study developed a model of immune selection based on the immune response of TCR 1d1 single β-chain transgenic B10.D2(R101) (K(d)I(d)D(b)) mice to allogeneic EL4 (H-2(b)) thymoma cells. In wild-type B10.D2(R101) mice, immunization with EL4 cells induced a vigorous CTL response targeted to the H-2K(b) molecule and results in full rejection of the tumor cells. In contrast, transgenic mice developed a compromised proliferative response in mixed-lymphocyte response assays and were unable to reject transplanted allogeneic EL4 cells. During the immune response to EL4 cells, CD8(+) T-lymphocytes with endogenous β-chains accumulated predominantly in the spleen of transgenic mice and only a small part of the T-lymphocytes expressing transgenic β-chains became CD8(+)CD44(+)CD62L(-) effectors. Then, instead of a full elimination of tumor cells as in wild-type mice, a reproducible prolonged equilibrium phase and subsequent escape was observed in transgenic mice that resulted in death of 90% of the mice in 40-60 days after grafting. Prolonged exposure of tumor cells to the pressure of the immune system in transgenic mice in vivo resulted in a stable loss of H-2K(b) molecules on the EL4 cell surface. Genetic manipulation of the T-lymphocyte repertoire was sufficient to reproduce the classic pattern of interactions between tumor cells and the immune system, usually observed in reliable syngeneic models of anti-tumor immunity. This newly-developed model could be used in further studies of immunoregulatory circuits common for transplantational and anti-tumor immune responses.

  15. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.

    Science.gov (United States)

    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro

    2016-07-01

    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

    Science.gov (United States)

    Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

    2013-09-01

    An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

  17. Role of the durum wheat dehydrin in the function of proteases conferring salinity tolerance in Arabidopsis thaliana transgenic lines.

    Science.gov (United States)

    Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal

    2016-04-01

    Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

    OpenAIRE

    Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.; Nettelbeck, Dirk M.

    2010-01-01

    Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show t...

  19. Two types of Tet-On transgenic lines for doxycycline-inducible gene expression in zebrafish rod photoreceptors and a gateway-based tet-on toolkit.

    Directory of Open Access Journals (Sweden)

    Leah J Campbell

    Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.

  20. Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice

    International Nuclear Information System (INIS)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros

    2009-01-01

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  1. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    Energy Technology Data Exchange (ETDEWEB)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)

    2009-06-26

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  2. T-DNA integration patterns in transgenic maize lines mediated by ...

    African Journals Online (AJOL)

    Jane

    2011-10-03

    Oct 3, 2011 ... locus can have profound effects on the level and stability of transgene ..... Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J, ... Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,. Li PH, Lisch ...

  3. N. plumbaginifolia zeaxanthin epoxidase transgenic lines have unaltered baseline ABA accumulations in roots and xylem sap, but contrasting sensitivities of ABA accumulation to water deficit.

    Science.gov (United States)

    Borel, C; Audran, C; Frey, A; Marion-Poll, A; Tardieu, F; Simonneau, T

    2001-03-01

    A series of transgenic lines of Nicotiana plumbaginifolia with modified expression of zeaxanthin epoxidase gene (ZEP) provided contrasting ABA accumulation in roots and xylem sap. For mild water stress, concentration of ABA in the xylem sap ([ABA](xylem)) was clearly lower in plants underexpressing ZEP mRNA (complemented mutants and antisense transgenic lines) than in wild-type. In well-watered conditions, all lines presented similar [ABA](xylem) and similar ABA accumulation rates in detached roots. Plants could, therefore, be grown under normal light intensities and evaporative demand. Both ZEP mRNA abundance and ABA accumulation rate in roots increased with water deficit in all transgenic lines, except in complemented aba2-s1 mutants in which the ZEP gene was controlled by a constitutive promoter which does not respond to water deficit. These lines presented no change in root ABA content either with time or dehydration. The increase in ZEP mRNA abundance in roots with decreasing RWC was more pronounced in detached roots than in whole plants, suggesting a difference in mechanism. In all transgenic lines, a linear relationship was observed between predawn leaf water potential and [ABA](xylem), which could be reproduced in several experiments in the greenhouse and in the growth chamber. It is therefore possible to represent the effect of the transformation by a single parameter, thereby allowing the use of a quantitative approach to assist understanding of the behaviour of transgenic lines.

  4. Promoter, transgene, and cell line effects in the transfection of mammalian cells using PDMAEMA-based nano-stars

    Directory of Open Access Journals (Sweden)

    Alexander Raup

    2016-09-01

    Full Text Available Non-viral transfection protocols are typically optimized using standard cells and reporter proteins, potentially underestimating cellular or transgene effects. Here such effects were studied for two human (Jurkat, HEK-293 and two rodent (CHO-K1, L929 cell lines and three fluorescent reporter proteins. Expression of the enhanced green fluorescent protein (EGFP was studied under the control of the human elongation factor 1 alpha promoter and three viral promoters (SV40, SV40/enhancer, CMV, that of ZsYellow1 (yellow fluorescence and mCherry (red fluorescence for the CMV promoter. Results varied with the cell line, in particular for the Jurkat cells. Pair-wise co-transfection of the CMV controlled transgenes resulted in a significant fraction of monochromatic cells (EGFP for EGFP/YFP and EGFP/RFP co-transfections, YFP in case of YFP/RFP co-transfections. Only Jurkat cells were almost incapable of expressing YFP. Dilution of the plasmid DNA with a non-expressed plasmid showed cell line dependent effects on transfection efficiency and/or expression levels.

  5. Cry1Ac Protein expression in tissues of potato (solanumtuberosum spp. andigena) transgenic lines var. Diacol Capiro

    International Nuclear Information System (INIS)

    Vanegas Araujo, Pablo Andres; Blanco Martinez, Jennifer Teresa; Chaparro Giraldo, Alejandro

    2010-01-01

    The potato plant is the fourth most important crop in the world. In Colombia around 2.8 million tons are produced annually economically supporting 90000 families. In the country, the major economic impact in the crop is caused by Tecia solanivora that originates loses up to 100% in the tuber production. The genetic plant breeding related to the introduction of Cry genes which codify insecticidal crystal proteins is an alternative for reducing the insect attack in commercial crops. In this work, the insertion, transcription and expression of Cry1Ac gen was characterized in different tissues and three development stages of two transgenic lines of Solanum tuberosum variety Diacol Capiro that were previously transformed by Agrobacterium tumefaciens method. The characterization was realized by PCR, RT-PCR and ELISA techniques. The gen insertion and transcription was confirmed using primers for Cry1Ac gen that amplified a specific band of 766 bp. The protein expression levels were higher than 45 µg/g and were not significantly different between the analyzed lines or the three development stages. Furthermore, taking into account some relevant phenotypic features, no significant differences were found between transgenic lines and controls. The results suggest that monitoring and biosecurity assays are necessary with this vegetal material because their high level expression inside all the tissues analyzed that could affect non-targeted insects.

  6. Transgene inheritances and genetic similarities of near isogenic lines of genetically modified common beans Herança de transgenes e similaridade genética de linhagens quase isogênicas de feijoeiro-comum geneticamente modificado

    Directory of Open Access Journals (Sweden)

    Patrícia Valle Pinheiro

    2009-09-01

    Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an

  7. Line profile variations in selected Seyfert galaxies

    International Nuclear Information System (INIS)

    Kollatschny, W; Zetzl, M; Ulbrich, K

    2010-01-01

    Continua as well as the broad emission lines in Seyfert 1 galaxies vary in different galaxies with different amplitudes on typical timescales of days to years. We present the results of two independent variability campaigns taken with the Hobby-Eberly Telescope. We studied in detail the integrated line and continuum variations in the optical spectra of the narrow-line Seyfert galaxy Mrk 110 and the very broad-line Seyfert galaxy Mrk 926. The broad-line emitting region in Mrk 110 has radii of four to 33 light-days as a function of the ionization degree of the emission lines. The line-profile variations are matched by Keplerian disk models with some accretion disk wind. The broad-line region in Mrk 926 is very small showing an extension of two to three light-days only. We could detect a structure in the rms line-profiles as well as in the response of the line profile segments of Mrk 926 indicating the BLR is structured.

  8. Selective WGA uptake in the hippocampus from the locus coeruleus of DBH-WGA transgenic mice

    Directory of Open Access Journals (Sweden)

    Susan G eWalling

    2012-05-01

    Full Text Available We generated transgenic mice in which a transsynaptic tracer, wheat germ agglutinin (WGA, was specifically expressed in the locus coeruleus neurons under the control of the dopamine-β-hydroxylase gene promoter. WGA protein was produced in more than 95% of the tyrosine hydroxylase-positive locus coeruleus neurons sampled. Transynaptic transfer of WGA was most evident in CA3 neurons of the hippocampus, but appeared absent in CA1 neurons. Faint but significant WGA immunoreactivity was observed surrounding the nuclei of dentate granule cells. Putative hilar mossy cells, identified by the presence of calretinin in the ventral hippocampus, appeared uniformly positive for transynaptically transferred WGA protein. GAD67-positive interneurons in the hilar and CA3 regions tended to be WGA-positive, although a subset of them did not show WGA co-localization. The same mixed WGA uptake profile was apparent when examining co-localization with parvalbumin. The selective uptake of WGA by dentate granule cells, mossy cells and CA3 pyramidal neurons is consistent with evidence for a large proportion of conventional synapses adjacent to locus coeruleus axonal varicosities in these regions. The lack of WGA uptake in the CA1 region and its relatively sparse innervation by dopamine-β-hydroxylase-positive fibers suggest that a majority of the tyrosine hydroxylase-positive classical synapses revealed by electron microscopy in that region may be producing dopamine. The overall pattern of WGA uptake in these transgenic mice suggests a selective role for the granule cell-mossy cell-CA3 network in processing novelty or the salient environmental contingency changes signaled by locus coeruleus activity.

  9. Comparison of the rhizosphere bacterial communities of Zigongdongdou soybean and a high-methionine transgenic line of this cultivar.

    Directory of Open Access Journals (Sweden)

    Jingang Liang

    Full Text Available Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91 that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars.

  10. Establishment of a transgenic zebrafish line for superficial skin ablation and functional validation of apoptosis modulators in vivo.

    Directory of Open Access Journals (Sweden)

    Chi-Fang Chen

    Full Text Available BACKGROUND: Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. METHODOLOGY/PRINCIPAL FINDINGS: This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR(cy17 (killer line, which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR(+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR(+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR(+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR(+ fluorescent signaling. CONCLUSION/SIGNIFICANCE: The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and

  11. Cre/lox system to develop selectable marker free transgenic tobacco plants conferring resistance against sap sucking homopteran insect.

    Science.gov (United States)

    Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain A; Schuermann, David; Hohn, Barbara; Sarmah, Bidyut K; Das, Sampa

    2008-10-01

    A binary expression vector was constructed containing the insecticidal gene Allium sativum leaf agglutinin (ASAL), and a selectable nptII marker gene cassette, flanked by lox sites. Similarly, another binary vector was developed with the chimeric cre gene construct. Transformed tobacco plants were generated with these two independent vectors. Each of the T(0) lox plants was crossed with T(0) Cre plants. PCR analyses followed by the sequencing of the target T-DNA part of the hybrid T(1) plants demonstrated the excision of the nptII gene in highly precised manner in certain percentage of the T(1) hybrid lines. The frequency of such marker gene excision was calculated to be 19.2% in the hybrids. Marker free plants were able to express ASAL efficiently and reduce the survivability of Myzus persiceae, the deadly pest of tobacco significantly, compared to the control tobacco plants. Results of PCR and Southern blot analyses of some of the T(2) plants detected the absence of cre as well as nptII genes. Thus, the crossing strategy involving Cre/lox system for the excision of marker genes appears to be very effective and easy to execute. Documentation of such marker excision phenomenon in the transgenic plants expressing the important insecticidal protein for the first time has a great significance from agricultural and biotechnological points of view.

  12. Characterization of selection effects on broiler lines using DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    GS Schmidt

    2003-05-01

    Full Text Available The objective of this study was to evaluate the effect of selection for body weight on the genetic variability and diversity in broiler lines. Two paternal broiler lines (LL and LLc were used. LL line was selected for 12 generations for growth and carcass and reproduction characteristics. The LLc line was established from LL line in 1985 and mated at random. Blood samples from six chickens per line were collected and used for molecular analysis. Also, a DNA pool was made for each line to compare effects between lines. Data were analyzed considering the collected information on the presence or absence of DNA bands. Band sharing scores were calculated using the DICE coefficient. The pattern of the 21 most representative bands was used. DNA fingerprinting (DFP showed 90.48 % of polymorphism bands for both lines. Difference between lines was not due to the presence or absence of bands, but to the frequency of such bands in each genotype. Considering that both lines had the same genetic background, changes on band frequency were probably due to selection. Selection for body weight had an effect on the band frequency as evaluated by DFP, and for this reason this technique could be used as a tool in the selection process. Results also suggest that bands 4, 5 and 19 were linked to body weight traits, and bands 9, 10, 12, 13 and 21 were linked to reproductive traits such as egg production.

  13. Pest control and resistance management through release of insects carrying a male-selecting transgene.

    Science.gov (United States)

    Harvey-Samuel, Tim; Morrison, Neil I; Walker, Adam S; Marubbi, Thea; Yao, Ju; Collins, Hilda L; Gorman, Kevin; Davies, T G Emyr; Alphey, Nina; Warner, Simon; Shelton, Anthony M; Alphey, Luke

    2015-07-16

    Development and evaluation of new insect pest management tools is critical for overcoming over-reliance upon, and growing resistance to, synthetic, biological and plant-expressed insecticides. For transgenic crops expressing insecticidal proteins from the bacterium Bacillus thuringiensis ('Bt crops') emergence of resistance is slowed by maintaining a proportion of the crop as non-Bt varieties, which produce pest insects unselected for resistance. While this strategy has been largely successful, multiple cases of Bt resistance have now been reported. One new approach to pest management is the use of genetically engineered insects to suppress populations of their own species. Models suggest that released insects carrying male-selecting (MS) transgenes would be effective agents of direct, species-specific pest management by preventing survival of female progeny, and simultaneously provide an alternative insecticide resistance management strategy by introgression of susceptibility alleles into target populations. We developed a MS strain of the diamondback moth, Plutella xylostella, a serious global pest of crucifers. MS-strain larvae are reared as normal with dietary tetracycline, but, when reared without tetracycline or on host plants, only males will survive to adulthood. We used this strain in glasshouse-cages to study the effect of MS male P. xylostella releases on target pest population size and spread of Bt resistance in these populations. Introductions of MS-engineered P. xylostella males into wild-type populations led to rapid pest population decline, and then elimination. In separate experiments on broccoli plants, relatively low-level releases of MS males in combination with broccoli expressing Cry1Ac (Bt broccoli) suppressed population growth and delayed the spread of Bt resistance. Higher rates of MS male releases in the absence of Bt broccoli were also able to suppress P. xylostella populations, whereas either low-level MS male releases or Bt broccoli

  14. Selecting physician leaders for clinical service lines: critical success factors.

    Science.gov (United States)

    Epstein, Andrew L; Bard, Marc A

    2008-03-01

    Clinical service lines and interdisciplinary centers have emerged as important strategic programs within academic health centers (AHCs). Effective physician leadership is significant to their success, but how these leaders are chosen has not been well studied. The authors conducted a study to identify current models for selecting the physician leaders of clinical service lines, determine critical success factors, and learn how the search process affected service line performance. In 2003 and 2004, the authors interviewed clinical and executive personnel involved in 14 programs to establish, or consider establishing, heart or cancer service lines, at 13 AHCs. The responses were coded to identify and analyze trends and themes. The key findings of the survey were (1) the goals and expectations that AHCs set for their service line leaders vary greatly, depending on both the strategic purpose of the service line in the AHC and the service line's stage of development, (2) the matrix organizational structure employed by most AHCs limits the leader's authority over necessary resources, and calls forth a variety of compensating strategies if the service line is to succeed, (3) the AHCs studied used relatively informal processes to identify, evaluate, and select service line leaders, and (4) the leader's job is vitally shaped by the AHC's strategic, structural, and political context, and selection criteria should be determined accordingly. Institutions should be explicit about the strategic purpose and stage of development of their clinical service lines and be clear about their expectations and requirements in hiring service line leaders.

  15. A transgenic mouse line for molecular genetic analysis of excitatory glutamatergic neurons

    DEFF Research Database (Denmark)

    Borgius, Lotta; Restrepo, C. Ernesto; Leao, Richardson N.

    2010-01-01

    Excitatory glutamatergic neurons are part of most of the neuronal circuits in the mammalian nervous system. We have used BAC-technology to generate a BAC-Vglut2::Cre mouse line where Cre expression is driven by the vesicular glutamate transporter 2 (Vglut2) promotor. This BAC-Vglut2::Cre mouse line...... showed specific expression of Cre in Vglut2 positive cells in the spinal cord with no ectopic expression in GABAergic or glycinergic neurons. This mouse line also showed specific Cre expression in Vglut2 positive structures in the brain such as thalamus, hypothalamus, superior colliculi, inferior...... colliculi and deep cerebellar nuclei together with nuclei in the midbrain and hindbrain. Cre-mediated recombination was restricted to Cre expressing cells in the spinal cord and brain and occurred as early as E 12.5. Known Vglut2 positive neurons showed normal electrophysiological properties in the BAC...

  16. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry.

    Directory of Open Access Journals (Sweden)

    Keiko Ikeda

    Full Text Available The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG and the pre-Bötzinger complex group (preBötC. The pFRG partially overlaps in the retrotrapezoid nucleus (RTN, which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems.

  17. Selective Iterative Waterfilling for Digital Subscriber Lines

    Directory of Open Access Journals (Sweden)

    Xu Yang

    2007-01-01

    Full Text Available This paper presents a high-performance, low-complexity, quasi-distributed dynamic spectrum management (DSM algorithm suitable for DSL systems. We analytically demonstrate that the rate degradation of the distributed iterative waterfilling (IW algorithm in near-far scenarios is caused by the insufficient utilization of all available frequency and power resources due to its nature of noncooperative game theoretic formulation. Inspired by this observation, we propose the selective IW (SIW algorithm that can considerably alleviate the performance degradation of IW by applying IW selectively to different groups of users over different frequency bands so that all the available resources can be fully utilized. For users, the proposed SIW algorithm needs at most times the complexity of the IW algorithm, and is much simpler than the centralized optimal spectrum balancing (OSB, while it can offer a rate performance much better than that of the IW and close to the maximum possible rate region computed by the OSB in realistic near-far DSL scenarios. Furthermore, its predominantly distributed structure makes it suitable for DSL implementation.

  18. A primary study of high performance transgenic rice through maize UBI-1 promoter fusing selective maker gene

    International Nuclear Information System (INIS)

    Shen, J.; Cai, P.; Qing, F.

    2012-01-01

    Based on the expression vector pBI121, we successfully constructed a plant over-expression vector of Hspa4 gene fusing with selective maker gene (hygromycin-resistance gene) driven by the Ubi-1 promoter (pBI121-Ubi-Hpt-Hspa4, p121UHH). The plant expression vectors p121UHH and pCAMBIA1301-Ubi-Hspa4 (p1301UH) were transformed into the rice callus, mediated by Agrobacterium tumefaciens. We screened 17 p121UHH-positive transgenic plants and 15 p1301UH-positive transgenic plants by the hygromycin-resistance gene. The pick-up rate of the resistance callus was 51.7% and 42.5%, respectively, and the rate of regeneration for the resistance callus was 51.2% and 49.1%, respectively. The result of polymerase chain reaction (P CR) identification indicated that the pick-up rate of positive transgenic plants was 51.7% and 42.5% and the total transformation efficiency was 16.5% and 6.2%, and the former was 2.66 time s of the later. The results of the experiment indicate that the possibility of the appearance of false positive results in the fusing of a plant over-expression vector with a selective maker gene is much less. (author)

  19. Murine transgenic embryonic stem cell lines for the investigation of sinoatrial node-related molecular pathways

    Directory of Open Access Journals (Sweden)

    Stefanie Schmitteckert

    2017-12-01

    Full Text Available The elucidation of molecular mechanisms that restrict the potential of pluripotent stem cells and promote cardiac lineage differentiation is of crucial relevance, since embryonic stem cells (ESCs hold great potential for cell based heart therapies. The homeodomain transcription factor Shox2 is essential for the development and proper function of the native cardiac pacemaker, the sinoatrial node. This prompted us to develop a cardiac differentiation model using ESC lines isolated from blastocysts of Shox2-deficient mice. The established cell model provides a fundamental basis for the investigation of molecular pathways under physiological and pathophysiological conditions for evaluating novel therapeutic approaches.

  20. An α-smooth muscle actin (acta2/αsma zebrafish transgenic line marking vascular mural cells and visceral smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Thomas R Whitesell

    Full Text Available Mural cells of the vascular system include vascular smooth muscle cells (SMCs and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma, which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.

  1. Aproach study of freedom to operate for transgenic line rice in Colombia

    Directory of Open Access Journals (Sweden)

    Alejandro Chaparro Giraldo

    2016-01-01

    Full Text Available The development of a genetically modified variety (GM is a scientific and legal challenge, by genetic engineering techniques used and the intellectual property rights (IPR involved. Approximate analysis of freedom of operation for a GM line derived from a Colombian rice variety, express an optimized version of the cry1Ac gene; in order to pursue their commercial release in Colombia was made. To do this, a deconstruction of innovation, which potentially protectable elements DPI on which patent searches and patent applications were made in the national and international context, databases were determined public access was performed. 59 patents and patent applications were found in the international arena. The Superintendency of Industry and Trade of Colombia (SIC three applications for patents that may affect the freedom of operation for this innovation were found. It is concluded that the higher the possibility of developing a GM rice line expressing cry1Ac gene without affecting the interest of third parties , as long as it is done in the country to commercialize.

  2. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  3. Transgenic Mouse Lines Subdivide External Segment of the Globus Pallidus (GPe) Neurons and Reveal Distinct GPe Output Pathways

    Science.gov (United States)

    Mastro, Kevin J.; Bouchard, Rachel S.; Holt, Hiromi A. K.

    2014-01-01

    Cell-type diversity in the brain enables the assembly of complex neural circuits, whose organization and patterns of activity give rise to brain function. However, the identification of distinct neuronal populations within a given brain region is often complicated by a lack of objective criteria to distinguish one neuronal population from another. In the external segment of the globus pallidus (GPe), neuronal populations have been defined using molecular, anatomical, and electrophysiological criteria, but these classification schemes are often not generalizable across preparations and lack consistency even within the same preparation. Here, we present a novel use of existing transgenic mouse lines, Lim homeobox 6 (Lhx6)–Cre and parvalbumin (PV)–Cre, to define genetically distinct cell populations in the GPe that differ molecularly, anatomically, and electrophysiologically. Lhx6–GPe neurons, which do not express PV, are concentrated in the medial portion of the GPe. They have lower spontaneous firing rates, narrower dynamic ranges, and make stronger projections to the striatum and substantia nigra pars compacta compared with PV–GPe neurons. In contrast, PV–GPe neurons are more concentrated in the lateral portions of the GPe. They have narrower action potentials, deeper afterhyperpolarizations, and make stronger projections to the subthalamic nucleus and parafascicular nucleus of the thalamus. These electrophysiological and anatomical differences suggest that Lhx6–GPe and PV–GPe neurons participate in different circuits with the potential to contribute to different aspects of motor function and dysfunction in disease. PMID:24501350

  4. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

    Science.gov (United States)

    Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

    2015-10-29

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier

  5. Effects of seed mixture sowing with transgenic Bt rice and its parental line on the population dynamics of target stemborers and leafrollers, and non-target planthoppers.

    Science.gov (United States)

    Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun

    2018-01-24

    The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  6. Performance of selected eastern oyster lines across northeastern US estuaries

    Science.gov (United States)

    Eastern oyster production derived from aquaculture has expanded, but growth potential is constrained by losses to disease. Breeding programs supporting industry in the Northeast have targeted resistance to three diseases: MSX, Dermo, and ROD. Selected lines should possess some level of resistance a...

  7. ptxD gene in combination with phosphite serves as a highly effective selection system to generate transgenic cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Pandeya, Devendra; Campbell, LeAnne M; Nunes, Eugenia; Lopez-Arredondo, Damar L; Janga, Madhusudhana R; Herrera-Estrella, Luis; Rathore, Keerti S

    2017-12-01

    This report demonstrates the usefulness of ptxD/phosphite as a selection system that not only provides a highly efficient and simple means to generate transgenic cotton plants, but also helps address many of the concerns related to the use of antibiotic and herbicide resistance genes in the production of transgenic crops. Two of the most popular dominant selectable marker systems for plant transformation are based on either antibiotic or herbicide resistance genes. Due to concerns regarding their safety and in order to stack multiple traits in a single plant, there is a need for alternative selectable marker genes. The ptxD gene, derived from Pseudomonas stutzeri WM88, that confers to cells the ability to convert phosphite (Phi) into orthophosphate (Pi) offers an alternative selectable marker gene as demonstrated for tobacco and maize. Here, we show that the ptxD gene in combination with a protocol based on selection medium containing Phi, as the sole source of phosphorus (P), can serve as an effective and efficient system to select for transformed cells and generate transgenic cotton plants. Fluorescence microscopy examination of the cultures under selection and molecular analyses on the regenerated plants demonstrate the efficacy of the system in recovering cotton transformants following Agrobacterium-mediated transformation. Under the ptxD/Phi selection, an average of 3.43 transgenic events per 100 infected explants were recovered as opposed to only 0.41% recovery when bar/phosphinothricin (PPT) selection was used. The event recovery rates for nptII/kanamycin and hpt/hygromycin systems were 2.88 and 2.47%, respectively. Molecular analysis on regenerated events showed a selection efficiency of ~ 97% under the ptxD/Phi system. Thus, ptxD/Phi has proven to be a very efficient, positive selection system for the generation of transgenic cotton plants with equal or higher transformation efficiencies compared to the commonly used, negative selection systems.

  8. Selective Transgenic Expression of Mutant Ubiquitin in Purkinje Cell Stripes in the Cerebellum.

    Science.gov (United States)

    Verheijen, Bert M; Gentier, Romina J G; Hermes, Denise J H P; van Leeuwen, Fred W; Hopkins, David A

    2017-06-01

    The ubiquitin-proteasome system (UPS) is one of the major mechanisms for protein breakdown in cells, targeting proteins for degradation by enzymatically conjugating them to ubiquitin molecules. Intracellular accumulation of ubiquitin-B +1 (UBB +1 ), a frameshift mutant of ubiquitin-B, is indicative of a dysfunctional UPS and has been implicated in several disorders, including neurodegenerative disease. UBB +1 -expressing transgenic mice display widespread labeling for UBB +1 in brain and exhibit behavioral deficits. Here, we show that UBB +1 is specifically expressed in a subset of parasagittal stripes of Purkinje cells in the cerebellar cortex of a UBB +1 -expressing mouse model. This expression pattern is reminiscent of that of the constitutively expressed Purkinje cell antigen HSP25, a small heat shock protein with neuroprotective properties.

  9. Generation and phenotypic analysis of a transgenic line of rabbits secreting active recombinant human erythropoietin in the milk

    Czech Academy of Sciences Publication Activity Database

    Mikuš, Tomáš; Poplštein, M.; Sedláková, J.; Landa, Vladimír; Jeníková, Gabriela; Trefil, P.; Lidický, J.; Malý, Petr

    2004-01-01

    Roč. 13, č. 5 (2004), s. 487-498 ISSN 0962-8819 R&D Projects: GA ČR GA304/03/0090 Institutional research plan: CEZ:AV0Z5052915 Keywords : erythropoietin, mammary gland, transgenic rabbit Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.107, year: 2004

  10. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Margarita Chumarina

    2017-03-01

    Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.

  11. Selective attention in vision: recognition memory for superimposed line drawings.

    Science.gov (United States)

    Goldstein, E B; Fink, S I

    1981-10-01

    These experiments show that observers can selectively attend to one of two stationary superimposed pictures. If superimposed line drawings are presented to observers who are told to attend to one line drawing in the pair and to ignore the other line drawing in the pair, then a subsequent recognition test in which the pictures are presently singly, the attended picture in each pair is recognized much more frequently than the unattended picture in each pair. This selective recognition occurs both with large (11 degrees-22 degrees) displays in which observers are free to make eye movements during a 3-sec exposure and with small (1 degree) displays in which observers are instructed to fixate steadily on a point during a 1-sec exposure. The results of the steady fixation experiments show that in the absence of eye movements, attention to one of two superimposed stimuli can cause an observer to remember the attended image and not to remember the other, clearly visible, unattended image in a superimposed pair.

  12. Generation of mRx-Cre Transgenic Mouse Line for Efficient Conditional Gene Deletion in Early Retinal Progenitors

    Czech Academy of Sciences Publication Activity Database

    Klímová, Lucie; Láchová, Jitka; Machoň, Ondřej; Sedláček, Radislav; Kozmik, Zbyněk

    2013-01-01

    Roč. 8, č. 5 (2013), e63029 E-ISSN 1932-6203 R&D Projects: GA ČR GAP305/11/2198; GA MŠk(CZ) LK11214; GA MŠk(CZ) LM2011032; GA ČR GAP305/10/2143; GA MŠk ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : eye development * lens * retina * transgenic mice Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  13. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  14. Generation of Pet1210-Cre Transgenic Mouse Line Reveals Non-Serotonergic Expression Domains of Pet1 Both in CNS and Periphery

    Science.gov (United States)

    Pelosi, Barbara; Migliarini, Sara; Pacini, Giulia; Pratelli, Marta; Pasqualetti, Massimo

    2014-01-01

    Neurons producing serotonin (5-hydroxytryptamine, 5-HT) constitute one of the most widely distributed neuronal networks in the mammalian central nervous system (CNS) and exhibit a profuse innervation throughout the CNS already at early stages of development. Serotonergic neuron specification is controlled by a combination of secreted molecules and transcription factors such as Shh, Fgf4/8, Nkx2.2, Lmx1b and Pet1. In the mouse, Pet1 mRNA expression appears between 10 and 11 days post coitum (dpc) in serotonergic post-mitotic precursors and persists in serotonergic neurons up to adulthood, where it promotes the expression of genes defining the mature serotonergic phenotype such as tryptophan hydroxylase 2 (Tph2) and serotonin transporter (SERT). Hence, the generation of genetic tools based on Pet1 specific expression represents a valuable approach to study the development and function of the serotonergic system. Here, we report the generation of a Pet1210-Cre transgenic mouse line in which the Cre recombinase is expressed under the control of a 210 kb fragment from the Pet1 genetic locus to ensure a reliable and faithful control of somatic recombination in Pet1 cell lineage. Besides Cre-mediated recombination accurately occurred in the serotonergic system as expected and according to previous studies, Pet1210-Cre transgenic mouse line allowed us to identify novel, so far uncharacterized, Pet1 expression domains. Indeed, we showed that in the raphe Pet1 is expressed also in a non-serotonergic neuronal population intermingled with Tph2-expressing cells and mostly localized in the B8 and B9 nuclei. Moreover, we detected Cre-mediated recombination also in the developing pancreas and in the ureteric bud derivatives of the kidney, where it reflected a specific Pet1 expression. Thus, Pet1210-Cre transgenic mouse line faithfully drives Cre-mediated recombination in all Pet1 expression domains representing a valuable tool to genetically manipulate serotonergic and non

  15. New line selected from irradiated cuttings of sweet potato

    International Nuclear Information System (INIS)

    Lu Shuyun; Wu Chongguang; Li Weiji; Feng Qihuan

    1992-01-01

    Some clonal lines of resistance to black rot were obtained from M 1 V 3 of Xu-18 variety. Through some regional tests, provincial yield trial and production test, the mutant line Nong-Da 601 (12-11-8) as spring sweet potato showed a better yield than the control, the dry matter content of Nong-Da 601 was also better than that of control, further more, the resistance to black rot of mutant selected in M 1 V 3 could be passed onto their progeny. The analysis of esterase isozyme showed zymogram variation between Nong-Da 601 and Xu-18. From the observation of the root tip cells, the chromosome bridge appeared obviously after irradiation, but the frequency of chromosome aberration in M 1 V 6 was decreased almost to the level of control (Xu-18). It seems that the changes of disease resistance from susceptible to resistant by irradiation was not due to chromosome aberration but due to gene mutation

  16. Early environmental planning: A process for power line corridor selection

    International Nuclear Information System (INIS)

    Haagenstad, T.; Bare, C.M.

    1998-01-01

    Los Alamos National Laboratory (LANL) conducted an environmental planning study in the fall of 1997 to help determine the best alternative for upgrading the Laboratory's electrical power system. Alternatives considered included an on-site power generation facility and two corridors for a 10-mile-long 115-kV power line. This planning process was conducted prior to the formal National Environmental Policy Act (NEPA) review. The goals were to help select the best proposed action, to recommend modifications and mitigation measures for each alternative for a more environmentally sound project, and to avoid potential delays once the formal Department of Energy review process began. Significant constraints existed from a planning perspective, including operational issues such as existing outdoor high explosives testing areas, as well as environmental issues including threatened and endangered species habitats, multiple archeological sites, contaminated areas, and aesthetics. The study had to be completed within 45 days to meet project schedule needs. The process resulted in a number of important recommendations. While the construction and operation of the on-site power generation facility could have minimal environmental impacts, the need for a new air quality permit would create severe cost and schedule constraints for the project. From an environmental perspective, construction and operation of a power line within either corridor was concluded to be a viable alternative. However, impacts with either corridor would have to be reduced through specific recommended alignment modifications and mitigation measures

  17. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events.

    Science.gov (United States)

    Santos-Amaya, Oscar F; Rodrigues, João V C; Souza, Thadeu C; Tavares, Clébson S; Campos, Silverio O; Guedes, Raul N C; Pereira, Eliseu J G

    2015-12-17

    Transgenic crop "pyramids" producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the "pyramid" resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field.

  18. Application Of Database Program in selecting Sorghum (Sorghum bicolor L) Mutant Lines

    International Nuclear Information System (INIS)

    H, Soeranto

    2000-01-01

    Computer database software namely MSTAT and paradox have been exercised in the field of mutation breeding especially in the process of selecting plant mutant lines of sorghum. In MSTAT, selecting mutant lines can be done by activating the SELECTION function and then followed by entering mathematical formulas for the selection criterion. Another alternative is by defining the desired selection intensity to the analysis results of subprogram SORT. Including the selected plant mutant lines in BRSERIES program, it will make their progenies be easier to be traced in subsequent generations. In paradox, an application program for selecting mutant lines can be made by combining facilities of Table, form and report. Selecting mutant lines with defined selection criterion can easily be done through filtering data. As a relation database, paradox ensures that the application program for selecting mutant lines and progeny trachings, can be made easier, efficient and interactive

  19. Selection and agronomic evaluation of induced mutant lines of sesame

    International Nuclear Information System (INIS)

    Hoballah, A.A.

    2001-01-01

    Station yield trial: Three high yielding mutants (8, 48, and EFM92) with better and stable performance were developed in our breeding programme and submitted for registration to the Agricultural Research Center (ARC), Egyptian Ministry of Agriculture and Land Reclamation. Multi-location yield trials indicated that mutant line EFM92 ranked first in all locations; significant yield increases recorded for it ranged from 14.7 to 74.0% over the check variety. Moreover, it was 15-20 days earlier than the check and/or other mutants. Mutant lines 8 and 48 produced higher seed yields than the check at two different locations. These mutants can probably be grown and produce more yield than the check variety at the low yielding environments. Seed quality assay: During 1996 and 1997, 15 promising lines of sesame including mutants and hybrid populations as well as the local variety were evaluated for seed protein, oil content and fatty acid composition. The protein content varied from 20.6 to 26.7%; hybrid population EXM90 gave the highest value. About 85% of the total fatty acids in the oil are unsaturated (oleic and linoleic) and 15% saturated, mainly palmitic and stearic. Linoleic acid ranged from 41.8 to 47.9%. Mutant lines 6, 9, and EFM92, which gave high oil content (54-55.5%) together with high linoleic acid values (45.2-47.8%), are recommended for breeding for seed oil quality. Heterosis, combining ability and type of gene action in sesame: A half diallel set of crosses involving seven parents was used to study heterosis and combining ability in the F 1 generation as well as the nature of gene action controlling seed yield and its contributing traits in both F 1 and F 2 in order to identify the most efficient breeding methods leading to rapid genetic improvement. The expressions of heterosis varied with the crosses and characters investigated. The maximal significant positive useful heterosis was observed for branches/plant (52.9%) followed by seed yield/plant (38

  20. Transgenic expression of an unedited mitochondrial orfB gene product from wild abortive (WA) cytoplasm of rice (Oryza sativa L.) generates male sterility in fertile rice lines.

    Science.gov (United States)

    Chakraborty, Anirban; Mitra, Joy; Bhattacharyya, Jagannath; Pradhan, Subrata; Sikdar, Narattam; Das, Srirupa; Chakraborty, Saikat; Kumar, Sachin; Lakhanpaul, Suman; Sen, Soumitra K

    2015-06-01

    Over-expression of the unedited mitochondrial orfB gene product generates male sterility in fertile indica rice lines in a dose-dependent manner. Cytoplasmic male sterility (CMS) and nuclear-controlled fertility restoration are widespread developmental features in plant reproductive systems. In self-pollinated crop plants, these processes often provide useful tools to exploit hybrid vigour. The wild abortive CMS has been employed in the majority of the "three-line" hybrid rice production since 1970s. In the present study, we provide experimental evidence for a positive functional relationship between the 1.1-kb unedited orfB gene transcript, and its translated product in the mitochondria with male sterility. The generation of the 1.1-kb unedited orfB gene transcripts increased during flowering, resulting in low ATP synthase activity in sterile plants. Following insertion of the unedited orfB gene into the genome of male-fertile plants, the plants became male sterile in a dose-dependent manner with concomitant reduction of ATPase activity of F1F0-ATP synthase (complex V). Fertility of the transgenic lines and normal activity of ATP synthase were restored by down-regulation of the unedited orfB gene expression through RNAi-mediated silencing. The genetic elements deciphered in this study could further be tested for their use in hybrid rice development.

  1. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  2. Acetylcholinesterase (AChE) gene modification in transgenic animals: functional consequences of selected exon and regulatory region deletion.

    Science.gov (United States)

    Camp, Shelley; Zhang, Limin; Marquez, Michael; de la Torre, Brian; Long, Jeffery M; Bucht, Goran; Taylor, Palmer

    2005-12-15

    AChE is an alternatively spliced gene. Exons 2, 3 and 4 are invariantly spliced, and this sequence is responsible for catalytic function. The 3' alternatively spliced exons, 5 and 6, are responsible for AChE disposition in tissue [J. Massoulie, The origin of the molecular diversity and functional anchoring of cholinesterases. Neurosignals 11 (3) (2002) 130-143; Y. Li, S. Camp, P. Taylor, Tissue-specific expression and alternative mRNA processing of the mammalian acetylcholinesterase gene. J. Biol. Chem. 268 (8) (1993) 5790-5797]. The splice to exon 5 produces the GPI anchored form of AChE found in the hematopoietic system, whereas the splice to exon 6 produces a sequence that binds to the structural subunits PRiMA and ColQ, producing AChE expression in brain and muscle. A third alternative RNA species is present that is not spliced at the 3' end; the intron 3' of exon 4 is used as coding sequence and produces the read-through, unanchored form of AChE. In order to further understand the role of alternative splicing in the expression of the AChE gene, we have used homologous recombination in stem cells to produce gene specific deletions in mice. Alternatively and together exon 5 and exon 6 were deleted. A cassette containing the neomycin gene flanked by loxP sites was used to replace the exon(s) of interest. Tissue analysis of mice with exon 5 deleted and the neomycin cassette retained showed very low levels of AChE expression, far less than would have been anticipated. Only the read-through species of the enzyme was produced; clearly the inclusion of the selection cassette disrupted splicing of exon 4 to exon 6. The selection cassette was then deleted in exon 5, exon 6 and exons 5 + 6 deleted mice by breeding to Ella-cre transgenic mice. AChE expression in serum, brain and muscle has been analyzed. Another AChE gene targeted mouse strain involving a region in the first intron, found to be critical for AChE expression in muscle cells [S. Camp, L. Zhang, M. Marquez, B

  3. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Science.gov (United States)

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  4. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Directory of Open Access Journals (Sweden)

    Shanshan Dong

    Full Text Available Pollen-mediated gene flow (PMGF is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  5. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

  6. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    Science.gov (United States)

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  7. Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

    International Nuclear Information System (INIS)

    Robab, U.E.; )

    2014-01-01

    The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

  8. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  9. Development of transgenic wheat (Triticum aestivum L.) expressing avidin gene conferring resistance to stored product insects.

    Science.gov (United States)

    Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed

    2015-07-22

    Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.

  10. Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

    African Journals Online (AJOL)

    Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

  11. Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

  12. Establishment and characterization of murine small cell lung carcinoma cell lines derived from HPV-16 E6/E7 transgenic mice.

    Science.gov (United States)

    Carraresi, Laura; Martinelli, Rosanna; Vannoni, Alessandro; Riccio, Massimo; Dembic, Maja; Tripodi, Sergio; Cintorino, Marcella; Santi, Spartaco; Bigliardi, Elisa; Carmellini, Mario; Rossini, Mara

    2006-01-08

    We have established two murine cell lines derived from Small Cell Lung Carcinomas (SCLCs) developed by HPV-E6/E7 transgenic mice. These cells named PPAP-9 and PPAP-10 were isolated from mice bearing tumors, 9 and 10 months old, respectively. The cells, 5 microm in diameter, express HPV oncoproteins and sustain tumor formation after subcutaneous injection in syngenic mice. A detailed analysis indicated the epithelial origin and the neuroendocrine differentiation of these cells. We showed by confocal immunofluorescence the expression of the epithelial marker cytokeratin 5, whose gene promoter was used to direct the expression of HPV E6/E. Cells express several neuroendocrine markers such as CGRP, MAP-2, Ash1, CgrA, Scg2. The neuroendocrine differentiation of these cells was further confirmed by electron microscopy demonstrating neuropeptides secreting granules in their cytoplasm. Furthermore, in agreement with the altered expression observed in the majority of human SCLC we showed in these cells the absence of both p53 and pRB and a dramatic reduction in the expression of Caveolin-1.

  13. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  14. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    Science.gov (United States)

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

  15. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    Science.gov (United States)

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  16. Selective loss of mouse embryos due to the expression of transgenic major histocompatibility class I molecules early in embryogenesis.

    Science.gov (United States)

    Aït-Azzouzene, D; Langkopf, A; Cohen, J; Bleux, C; Gendron, M C; Kanellopoulos-Langevin, C

    1998-05-01

    Among the numerous hypotheses proposed to explain the absence of fetal rejection by the mother in mammals, it has been suggested that regulation of expression of the polymorphic major histocompatibility complex (MHC) at the fetal-maternal interface plays a major role. In addition to a lack of MHC gene expression in the placenta throughout gestation, the absence of polymorphic MHC molecules on the early embryo, as well as their low level of expression after midgestation, could contribute to this important biologic phenomenon. In order to test this hypothesis, we have produced transgenic mice able to express polymorphic MHC class I molecules early in embryogenesis. We have placed the MHC class la gene H-2Kb under the control of a housekeeping gene promoter, the hydroxy-methyl-glutaryl coenzyme A reductase (HMG) gene minimal promoter. This construct has been tested for functionality after transfection into mouse fibroblast L cells. The analysis of three founder transgenic mice and their progeny suggested that fetoplacental units that could express the H-2Kb heavy chains are unable to survive in utero beyond midgestation. We have shown further that a much higher resorption rate, on days 11 to 13 of embryonic development, is observed among transgenic embryos developing from eggs microinjected at the one-cell stage with the pHMG-Kb construct than in control embryos. This lethality is not due to immune phenomena, since it is observed in histocompatible combinations between mother and fetus. These results are discussed in the context of what is currently known about the regulation of MHC expression at the fetal-maternal interface and in various transgenic mouse models.

  17. Selective Attention in Vision: Recognition Memory for Superimposed Line Drawings.

    Science.gov (United States)

    Goldstein, E. Bruce; Fink, Susan I.

    1981-01-01

    Four experiments show that observers can selectively attend to one of two stationary superimposed pictures. Selective recognition occurred with large displays in which observers were free to make eye movements during a 3-sec exposure and with small displays in which observers were instructed to fixate steadily on a point. (Author/RD)

  18. Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

    Science.gov (United States)

    Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

    1999-01-01

    Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

  19. The selection and implementation of hidden line algorithms

    International Nuclear Information System (INIS)

    Schneider, A.

    1983-06-01

    One of the most challenging problems in the field of computer graphics is the elimination of hidden lines in images of nontransparent bodies. In the real world the nontransparent material hinders the light ray coming from hidden regions to the observer. In the computer based image formation process there is no automatic visibility regulation of this kind. So many lines are created which result in a poor quality of the spacial representation. Therefore a three-dimensional representation on the screen is only meaningfull if the hidden lines are eliminated. For this process many algorithms have been developed in the past. A common feature of these codes is the large amount of computer time needed. In the first generation of algorithms, which are commonly used today, the bodies are modeled by plane polygons. More recently, however, also algorithms are in use, which are able to treat curved surfaces without discretisation by plane surfaces. In this paper the first group of algorithms is reviewed, and the most important codes are described. The experience obtained during the implementation of two algorithms is presented. (orig.) [de

  20. Selection and characterizations of radiation-induced salinity-tolerant lines in rice

    International Nuclear Information System (INIS)

    Lee, I.S.; Kim, D.S.; Lee, S.J.; Song, H.S.; Lim, Y.P.; Lee, Y.I.

    2003-01-01

    NaCl tolerant cell lines were selected from irradiated callus, which were generated from seed cultures. M 1 -regenerates were obtained from the salt-tolerant callus cultured on the auxin-free medium for 30 days. Some regenerants were more tolerant than the parent variety (Dongjinbyeo) on a medium containing 0.75 % NaCl. Seeds (M 3 5,000 lines) derived from M 2 lines were grown to the 3 leaf stage. M 3 lines were soaked with a 0.75 % salt solution for 3 weeks and 350 salt-tolerant genotypes were selected. Among the M 3 350 lines, forty tolerant lines were selected from a saline field (10~14 mS) near the sea coast. Of the forty lines, two lines (18-1 and 50-1) showed more improved plant height, panicle length, tillering number, spikelet number and yield than those of the original variety. Thirty primers were screened and two RAPD markers were identified, which appeared in both the salt-tolerant lines (18-1 and 50-1). From DNA-hybridization experiments, it appeared that the fragment arose from the middle-repetitive copy sequences. The transcript involved in the marker showed a higher expression in the salt-tolerant lines than the sensitive lines. The salt-tolerant lines would be useful as a resource for salt-tolerant breeding. (author)

  1. Effect of selected insecticides on SF9 insect cell line

    International Nuclear Information System (INIS)

    Saleh, M.; Rahmo, A.; Hajjar, J.

    2013-01-01

    The toxic effect of three insecticides: dimethoate (organophosphate insecticide), acetamiprid (neonicotinoid insecticide) and deltamethrin (pyrethroid insecticide) were evaluated in vitro on cultured Sf9 cell line. Cell growth inhibition was measured by the 3- (4,5- dimethylthiazol - 2-yl) - 2,5 - diphenyl tetrazolium bromide (MTT) assay. Regression Analysis was used to estimate the 20% inhibition of cells growth (IC 20). The IC 20 values obtained for deltamethrin, acetamipridand dimethoate were: 46.8, 61.6 and 68.9 μM, respectively. The proportion of phagocytic cells was positively correlated with the applied concentrations of the insecticides. (author)

  2. Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.

    Science.gov (United States)

    Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E

    2016-01-01

    The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants.

  3. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    Science.gov (United States)

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  4. Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

    Science.gov (United States)

    Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

    2003-06-01

    The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

  5. Integrated configurable equipment selection and line balancing for mass production with serial-parallel machining systems

    Science.gov (United States)

    Battaïa, Olga; Dolgui, Alexandre; Guschinsky, Nikolai; Levin, Genrikh

    2014-10-01

    Solving equipment selection and line balancing problems together allows better line configurations to be reached and avoids local optimal solutions. This article considers jointly these two decision problems for mass production lines with serial-parallel workplaces. This study was motivated by the design of production lines based on machines with rotary or mobile tables. Nevertheless, the results are more general and can be applied to assembly and production lines with similar structures. The designers' objectives and the constraints are studied in order to suggest a relevant mathematical model and an efficient optimization approach to solve it. A real case study is used to validate the model and the developed approach.

  6. The Relationship between Insect Resistance and Tree Age of Transgenic Triploid Populus tomentosa Plants.

    Science.gov (United States)

    Ren, Yachao; Zhang, Jun; Wang, Guiying; Liu, Xiaojie; Li, Li; Wang, Jinmao; Yang, Minsheng

    2018-01-01

    To explore the stability of insect resistance during the development of transgenic insect-resistant trees, this study investigated how insect resistance changes as transgenic trees age. We selected 19 transgenic insect-resistant triploid Populus tomentosa lines as plant material. The presence of exogenous genes and Cry1Ac protein expression were verified using polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) analyses. The toxicity for Clostera anachoreta and Lymantria dispar was evaluated by feeding fresh leaves to first instar larvae after the trees were planted in the field for 2 years and after the sixth year. Results of PCR showed that the exogenous genes had a long-term presence in the poplar genome. ELISA analyses showed significant differences existed on the 6-year-old transgenic lines. The insect-feeding experiment demonstrated significant differences in the mortality rates of C. anachoreta and L. dispar among different transgenic lines. The average corrected mortality rates of C. anachoreta and L. dispar ranged from 5.6-98.7% to 35.4-7.2% respectively. The larval mortality rates differed significantly between the lines at different ages. Up to 52.6% of 1-year-old transgenic lines and 42.1% of 2-year-old transgenic lines caused C. anachoreta larval mortality rates to exceed 80%, whereas only 26.3% of the 6-year-old transgenic lines. The mortality rates of L. dispar exhibited the same trend: 89.5% of 1-year-old transgenic lines and 84.2% of 2-year-old transgenic lines caused L. dispar larval mortality rates to exceed 80%; this number decreased to 63.2% for the 6-year-old plants. The proportion of 6-year-old trees with over 80% larval mortality rates was clearly lower than that of the younger trees. The death distribution of C. anachoreta in different developmental stages also showed the larvae that fed on the leaves of 1-year-old trees were killed mostly during L 1 and L 2 stages, whereas the proportion of larvae that died in L 3

  7. The front line health worker: selection, training, and performance.

    Science.gov (United States)

    Ronaghy, H A; Najarzadeh, E; Schwartz, T A; Russel, S S; Solter, S; Zeighami, B

    1976-03-01

    Iranian villagers with basic literacy were recruited, selected, trained, and deployed as Village Health Workers (VHWs) to rural areas of Iran. VHW clinical visit records and activities logs were analyzed to determine levels and nature of effort achieved in the field. Within six months of deployment, the number of patient visits to VHW treatment services constituted 53% of the target population. Within ten months of deployment, the number of family planning acceptors rose from 8% to 21% of the population at risk. Improvements to water supplies have been effected in 50% of target villages. Sanitary improvements have been made to 35% of the houses and 88% of toilets in those villages. Demographic characteristics, class rank, and place of residence of VHWs appear unassociated with village differences in levels of achievement. However, availability of material resources and actual time spent by VHWs on the job may be factors influencing the differences in outcome between villages.

  8. Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

    Science.gov (United States)

    Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

    2016-10-01

    An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

  9. Comparison of degrees of maturity of rabbit lines selected for different traits

    Directory of Open Access Journals (Sweden)

    M. Pascual

    2015-09-01

    Full Text Available The aim of this work was to study whether commercial nucleus lines of rabbits selected for different traits, and experimental lines having commercial purposes, have the same degree of maturity when compared at the same slaughter age. The study was carried out with 17897 rabbits from Universitat Politècnica de València. Rabbits came from the maternal lines A (3902 rabbits; 44th generation, V (4238 rabbits; 39th generation and LP (6115 rabbits; 9th generation, selected for litter size at weaning; the paternal line R (2023 rabbits; 25th generation, selected for growth rate between 28 and 63 days of age; the maternal line OR (586 rabbits; 11th generation selected for ovulation rate; and the lines High (503 rabbits; 5th generation and Low (530 rabbits; 5thgeneration lines, from a divergent selection for high and low intramuscular fat, respectively. Rabbits were weighted at 28 (W28 and 63 (W63 days of age. Rabbit does (42, 25, 39, 94, 14, 32 and 22 from lines A, V, R, LP, OR, High and Low, respectively were weighed between 30 and 80 wk of age to determine adult weight (AW. Line R had higher W28 and W63, growth rate between 28 and 63 d of age and AW than lines A, V and LP (5802 g vs. 4410, 4222, and 4391 g for AW, respectively. No relevant differences between lines in degrees of maturity at 28 and 63 d of age and time to reach 40% of degree of maturity (percentage of weight compared to AW were found between lines A, V, R and LP, but the degree of maturity at 2000 g and the time taken to reach that weight were lower in line R (34.7% and 55.2 d than in lines A (45.5% and 71.1 d, V (47.4% and 69.6 d, and LP (45.8% and 68.0 d. No relevant differences were found between lines OR, High and Low in the traits analysed. A robustness analysis showed that results can be extrapolated to other commercial lines and other slaughter weights. In conclusion, comparison of lines at similar slaughter age could be considered a valid approach for comparisons at the same

  10. Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

    Science.gov (United States)

    Pons, Elsa; Peris, Josep E; Peña, Leandro

    2012-07-15

    The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

  11. Genetically heterogeneous and selected lines of rats: behavioral and reproductive comparison.

    Science.gov (United States)

    Satinder, K P

    1980-03-01

    Avoidance learning, open-field, and reproductive behaviors of a genetically heterogeneous stock (derived from a four-way cross of selected lines) were compared with the corresponding behaviors of the parental lines. The heterogeneous stock showed heterosis on the body development, fertility rate, litter size at birth and at weaning, and directional dominance on the avoidance learning and open-field measures.

  12. Pentobarbital Sleep Time in Mouse Lines Selected for Resistance and Susceptibility to Fescue Toxicosis

    OpenAIRE

    Arthur, Kimberly Ann

    2002-01-01

    In previous work with mouse lines selected for resistance (R) and susceptibility (S) to fescue toxicosis, R mice had higher activities of Phase II liver enzymes glutathione S-transferase and uridine diphosphate glucuronosyl-transferase than S mice. Objectives of this study were: 1. to determine whether selection for toxicosis response had also caused divergence between lines in hepatic Phase I enzyme activity (as assessed by sleep time following sodium pentobarbital anesthesia), 2. to determi...

  13. Standing genetic variation as a major contributor to adaptation in the Virginia chicken lines selection experiment.

    Science.gov (United States)

    Sheng, Zheya; Pettersson, Mats E; Honaker, Christa F; Siegel, Paul B; Carlborg, Örjan

    2015-10-01

    Artificial selection provides a powerful approach to study the genetics of adaptation. Using selective-sweep mapping, it is possible to identify genomic regions where allele-frequencies have diverged during selection. To avoid false positive signatures of selection, it is necessary to show that a sweep affects a selected trait before it can be considered adaptive. Here, we confirm candidate, genome-wide distributed selective sweeps originating from the standing genetic variation in a long-term selection experiment on high and low body weight of chickens. Using an intercross between the two divergent chicken lines, 16 adaptive selective sweeps were confirmed based on their association with the body weight at 56 days of age. Although individual additive effects were small, the fixation for alternative alleles across the loci contributed at least 40 % of the phenotypic difference for the selected trait between these lines. The sweeps contributed about half of the additive genetic variance present within and between the lines after 40 generations of selection, corresponding to a considerable portion of the additive genetic variance of the base population. Long-term, single-trait, bi-directional selection in the Virginia chicken lines has resulted in a gradual response to selection for extreme phenotypes without a drastic reduction in the genetic variation. We find that fixation of several standing genetic variants across a highly polygenic genetic architecture made a considerable contribution to long-term selection response. This provides new fundamental insights into the dynamics of standing genetic variation during long-term selection and adaptation.

  14. Triggered Firing and Atrial Fibrillation in Transgenic Mice With Selective Atrial Fibrosis Induced by Overexpression of TGF-β1

    Science.gov (United States)

    Choi, Eue-Keun; Chang, Po-Cheng; Lee, Young-Soo; Lin, Shien-Fong; Zhu, Wuqiang; Maruyama, Mitsunori; Fishbein, Michael C.; Chen, Zhenhui; der Lohe, Michael Rubart-von; Field, Loren J.; Chen, Peng-Sheng

    2013-01-01

    Background Calcium transient triggered firing (CTTF) is induced by large intracellular calcium (Cai) transient and short action potential duration (APD). We hypothesized that CTTF underlies the mechanisms of early afterdepolarization (EAD) and spontaneous recurrent atrial fibrillation (AF) in transgenic (Tx) mice with overexpression of transforming growth factor β1 (TGF-β1). Methods and Results MHC-TGFcys33ser Tx mice develop atrial fibrosis because of elevated levels of TGF-β1. We studied membrane potential and Cai transients of isolated superfused atria from Tx and wild-type (Wt) littermates. Short APD and persistently elevated Cai transients promoted spontaneous repetitive EADs, triggered activity and spontaneous AF after cessation of burst pacing in Tx but not Wt atria (39% vs. 0%, P=0.008). We were able to map optically 4 episodes of spontaneous AF re-initiation. All first and second beats of spontaneous AF originated from the right atrium (4/4, 100%), which is more severely fibrotic than the left atrium. Ryanodine and thapsigargin inhibited spontaneous re-initiation of AF in all 7 Tx atria tested. Western blotting showed no significant changes of calsequestrin or sarco/endoplasmic reticulum Ca2+-ATPase 2a. Conclusions Spontaneous AF may occur in the Tx atrium because of CTTF, characterized by APD shortening, prolonged Cai transient, EAD and triggered activity. Inhibition of Ca2+ release from the sarcoplasmic reticulum suppressed spontaneous AF. Our results indicate that CTTF is an important arrhythmogenic mechanism in TGF-β1 Tx atria. PMID:22447020

  15. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    International Nuclear Information System (INIS)

    Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.

    2016-01-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  16. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    Energy Technology Data Exchange (ETDEWEB)

    Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others

    2016-10-15

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  17. Immunological characteristics and response to lipopolysaccharide of mouse lines selectively bred with natural and acquired immunities.

    Science.gov (United States)

    Narahara, Hiroki; Sakai, Eri; Katayama, Masafumi; Ohtomo, Yukiko; Yamamoto, Kanako; Takemoto, Miki; Aso, Hisashi; Ohwada, Shyuichi; Mohri, Yasuaki; Nishimori, Katsuhiko; Isogai, Emiko; Yamaguchi, Takahiro; Fukuda, Tomokazu

    2012-05-01

    Genetic improvement of resistance to infectious diseases is a challenging goal in animal breeding. Infection resistance involves multiple immunological characteristics, including natural and acquired immunity. In the present study, we developed an experimental model based on genetic selection, to improve immunological phenotypes. We selectively established three mouse lines based on phagocytic activity, antibody production and the combination of these two phenotypes. We analyzed the immunological characteristics of these lines using a lipopolysaccharide (LPS), which is one of the main components of Gram-negative bacteria. An intense immunological reaction was induced in each of the three mouse lines. Severe loss of body weight and liver damage were observed, and a high level of cytokine messenger RNA was detected in the liver tissue. The mouse line established using a combination of the two selection standards showed unique characteristics relative to the mouse lines selected on the basis of a single phenotype. Our results indicate that genetic selection and breeding is effective, even for immunological phenotypes with a relatively low heritability. Thus, it may be possible to improve resistance to infectious diseases by means of genetic selection. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  18. Accumulation of nickel in transgenic tobacco

    Science.gov (United States)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  19. Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploid embryo complementation

    Directory of Open Access Journals (Sweden)

    Zhao Roong

    2001-12-01

    Full Text Available Abstract Background Transgenic mice have been used extensively to analyze gene function. Unfortunately, traditional transgenic procedures have only limited use in analyzing alleles that cause lethality because lines of founder mice cannot be established. This is frustrating given that such alleles often reveal crucial aspects of gene function. For this reason techniques that facilitate the generation of embryos expressing such alleles would be of enormous benefit. Although the transient generation of transgenic embryos has allowed limited analysis of lethal alleles, it is expensive, time consuming and technically challenging. Moreover a fundamental limitation with this approach is that each embryo generated is unique and transgene expression is highly variable due to the integration of different transgene copy numbers at random genomic sites. Results Here we describe an alternative method that allows the generation of clonal mouse embryos harboring a single-copy transgene at a defined genomic location. This was facilitated through the production of Hprt negative embryonic stem cells that allow the derivation of embryos by tetraploid embryo complementation. We show that targeting transgenes to the hprt locus in these ES cells by homologous recombination can be efficiently selected by growth in HAT medium. Moreover, embryos derived solely from targeted ES cells containing a single copy LacZ transgene under the control of the α-myosin heavy chain promoter exhibited the expected cardiac specific expression pattern. Conclusion Our results demonstrate that tetraploid embryo complementation by F3 hprt negative ES cells facilitates the generation of transgenic mouse embryos containing a single copy gene at a defined genomic locus. This approach is simple, extremely efficient and bypasses any requirement to generate chimeric mice. Moreover embryos generated by this procedure are clonal in that they are all derived from a single ES cell lines. This

  20. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  1. Modulations of the processing of line discontinuities under selective attention conditions?

    Science.gov (United States)

    Giersch, Anne; Fahle, Manfred

    2002-01-01

    We examined whether the processing of discontinuities involved in figure-ground segmentation, like line ends, can be modulated under selective attention conditions. Subjects decided whether a gap in collinear or parallel lines was located to the right or left. Two stimuli were displayed in immediate succession. When the gaps were on the same side, reaction times (RTs) for the second stimulus increased when collinear lines followed parallel lines, or the reverse, but only when the two stimuli shared the same orientation and location. The effect did not depend on the global form of the stimuli or on the relative orientation of the gaps. A frame drawn around collinear elements affected the results, suggesting a crucial role of the "amodal" orthogonal lines produced when line ends are aligned. Including several gaps in the first stimulus also eliminated RT variations. By contrast, RT variations remained stable across several experimental blocks and were significant for interstimulus intervals from 50 to 600 msec between the two stimuli. These results are interpreted in terms of a modulation of the processing of line ends or the production of amodal lines, arising when attention is selectively drawn to a gap.

  2. A Novel Fault Line Selection Method Based on Improved Oscillator System of Power Distribution Network

    Directory of Open Access Journals (Sweden)

    Xiaowei Wang

    2014-01-01

    Full Text Available A novel method of fault line selection based on IOS is presented. Firstly, the IOS is established by using math model, which adopted TZSC signal to replace built-in signal of duffing chaotic oscillator by selecting appropriate parameters. Then, each line’s TZSC decomposed by db10 wavelet packet to get CFB with the maximum energy principle, and CFB was solved by IOS. Finally, maximum chaotic distance and average chaotic distance on the phase trajectory are used to judge fault line. Simulation results show that the proposed method can accurately judge fault line and healthy line in strong noisy background. Besides, the nondetection zones of proposed method are elaborated.

  3. Characterization of seasonal reproduction in Virginia Tech Selection Line, St. Croix, and Suffolk ewes

    OpenAIRE

    Jordan, Katherine Mead

    2008-01-01

    This dissertation research contained three studies. The first two studies were conducted to investigate the ability of ewes to rebreed while lactating during seasonal anestrus. Breeds studied included the Virginia Tech Out-of-season (OOS) Line, which is a wool line genetically selected to lamb in the fall, and the St. Croix, a hair breed of tropical origin thought to be lowly seasonal. When January-lambing ewes were exposed to rams while lactating in April, significantly more OOS than St. ...

  4. Frequency Selective Properties of Coaxial Transmission Lines Loaded with Combined Artificial Inclusions

    Directory of Open Access Journals (Sweden)

    Francisco Falcone

    2014-01-01

    Full Text Available The properties of a modified coaxial transmission line by periodic inclusions will be discussed. The introduction of split ring resonators, conductor stubs, air gaps, and combination of these gives rise to new frequency selective properties, such as stopband or passband behavior, observable in planar as well as volumetric metamaterial structures. These results envisage new potential applications and implementation of devices in coaxial transmission line technology.

  5. Method of selecting optimum cross arm lengths for a 750 kV transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Aleksandrov, G N; Olorokov, V P

    1965-01-01

    A method is presented, based on both technical and economic considerations, for selecting cross arm lengths for intermediate poles of power transmission lines according to the effects of internal overvoltage, methods from probability theory and mathematical statistics employed. The problem of optimum pole size is considered in terms of the effect of internal overvoltages for a prescribed maximum level of 2.1 PU currently used in the USSR for the design of 750 kV lines.

  6. Implications of selection in common bean lines in contrasting environments concerning nitrogen levels

    Directory of Open Access Journals (Sweden)

    Isabela Volpi Furtini

    2014-10-01

    Full Text Available Grain productivities of 100 bean lines were evaluated in the presence and absence of nitrogen fertilizer in order to identify those with high nitrogen use efficiency (NUE and to determine the correlated response observed in a stressed environment following selection in a non-stressed environment. The genetic and phenotypic characteristics of the lines, as well as the response index to applied nitrogen, were determined. The average grain productivities at both locations were 39.5% higher in the presence of nitrogen fertilizer, with 8.3 kg of grain being produced per kg of nitrogen applied. NUE varied greatly between lines. Lines BP-16, CVII-85-11, BP-24, Ouro Negro and MA-IV-15-203 were the most efficient and responsive. The results showed that it is possible to select bean lines in stressed and non-stressed environments. It was inferred that common bean lines for environments with low nitrogen availability should preferably be selected under nitrogen stress.

  7. Selection of common bean lines with high grain yield and high grain calcium and iron concentrations

    Directory of Open Access Journals (Sweden)

    Nerinéia Dalfollo Ribeiro

    2014-02-01

    Full Text Available Genetic improvement of common bean nutritional quality has advantages in marketing and can contribute to society as a food source. The objective of this study was to evaluate the genetic variability for grain yield, calcium and iron concentrations in grains of inbred common bean lines obtained by different breeding methods. For this, 136 F7 inbred lines were obtained using the Pedigree method and 136 F7 inbred lines were obtained using the Single-Seed Descent (SSD method. The lines showed genetic variability for grain yield, and concentrations of calcium and iron independently of the method of advancing segregating populations. The Pedigree method allows obtaining a greater number of lines with high grain yield. Selection using the SSD method allows the identification of a larger number of lines with high concentrations of calcium and iron in grains. Weak negative correlations were found between grain yield and calcium concentration (r = -0.0994 and grain yield and iron concentration (r = -0.3926. Several lines show genetic superiority for grain yield and concentrations of calcium and iron in grains and their selection can result in new common bean cultivars with high nutritional quality.

  8. Analysis of severe feather pecking behavior in a high feather pecking selection line

    DEFF Research Database (Denmark)

    Labouriau, R; Kjaer, J B; Abreu, G C G

    2009-01-01

    Even though feather pecking (FP) in laying hens has been extensively studied, a good solution to prevent chickens from this behavior under commercial circumstances has not been found. Selection against FP behavior is possible, but for a more effective selection across different populations......, it is necessary to characterize the genetic mechanism associated with this behavior. In this study, we use a high FP selection line, which has been selected for 8 generations. We present evidence of the presence of a major dominant allele affecting the FP behavior by using an argument based on the presence...

  9. Transgenic Parasites Stably Expressing Full-Length Plasmodium falciparum Circumsporozoite Protein as a Model for Vaccine Down-Selection in Mice Using Sterile Protection as an Endpoint

    Science.gov (United States)

    Porter, Michael D.; Nicki, Jennifer; Pool, Christopher D.; DeBot, Margot; Illam, Ratish M.; Brando, Clara; Bozick, Brooke; De La Vega, Patricia; Angra, Divya; Spaccapelo, Roberta; Crisanti, Andrea; Murphy, Jittawadee R.; Bennett, Jason W.; Schwenk, Robert J.; Ockenhouse, Christian F.

    2013-01-01

    Circumsporozoite protein (CSP) of Plasmodium falciparum is a protective human malaria vaccine candidate. There is an urgent need for models that can rapidly down-select novel CSP-based vaccine candidates. In the present study, the mouse-mosquito transmission cycle of a transgenic Plasmodium berghei malaria parasite stably expressing a functional full-length P. falciparum CSP was optimized to consistently produce infective sporozoites for protection studies. A minimal sporozoite challenge dose was established, and protection was defined as the absence of blood-stage parasites 14 days after intravenous challenge. The specificity of protection was confirmed by vaccinating mice with multiple CSP constructs of differing lengths and compositions. Constructs that induced high NANP repeat-specific antibody titers in enzyme-linked immunosorbent assays were protective, and the degree of protection was dependent on the antigen dose. There was a positive correlation between antibody avidity and protection. The antibodies in the protected mice recognized the native CSP on the parasites and showed sporozoite invasion inhibitory activity. Passive transfer of anti-CSP antibodies into naive mice also induced protection. Thus, we have demonstrated the utility of a mouse efficacy model to down-select human CSP-based vaccine formulations. PMID:23536694

  10. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Science.gov (United States)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  11. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  12. Automated high-content assay for compounds selectively toxic to Trypanosoma cruzi in a myoblastic cell line.

    Directory of Open Access Journals (Sweden)

    Julio Alonso-Padilla

    2015-01-01

    Full Text Available Chagas disease, caused by the protozoan parasite Trypanosoma cruzi, represents a very important public health problem in Latin America where it is endemic. Although mostly asymptomatic at its initial stage, after the disease becomes chronic, about a third of the infected patients progress to a potentially fatal outcome due to severe damage of heart and gut tissues. There is an urgent need for new drugs against Chagas disease since there are only two drugs available, benznidazole and nifurtimox, and both show toxic side effects and variable efficacy against the chronic stage of the disease.Genetically engineered parasitic strains are used for high throughput screening (HTS of large chemical collections in the search for new anti-parasitic compounds. These assays, although successful, are limited to reporter transgenic parasites and do not cover the wide T. cruzi genetic background. With the aim to contribute to the early drug discovery process against Chagas disease we have developed an automated image-based 384-well plate HTS assay for T. cruzi amastigote replication in a rat myoblast host cell line. An image analysis script was designed to inform on three outputs: total number of host cells, ratio of T. cruzi amastigotes per cell and percentage of infected cells, which respectively provides one host cell toxicity and two T. cruzi toxicity readouts. The assay was statistically robust (Z´ values >0.6 and was validated against a series of known anti-trypanosomatid drugs.We have established a highly reproducible, high content HTS assay for screening of chemical compounds against T. cruzi infection of myoblasts that is amenable for use with any T. cruzi strain capable of in vitro infection. Our visual assay informs on both anti-parasitic and host cell toxicity readouts in a single experiment, allowing the direct identification of compounds selectively targeted to the parasite.

  13. Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack

    Directory of Open Access Journals (Sweden)

    Hensel Goetz

    2012-09-01

    Full Text Available Abstract Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT and a synthetic green fluorescent protein gene (gfp. Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants.

  14. Selection and evaluation of soybean lines derived from gamma irradiation for rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    In 1979, seeds of 11 soybean cultivars were gamma irradiated with 15 and 30 krad. Treated and control seeds of each cultivar were planted in the rainy season. In the rainy season of 1980, M 3 populations were screened for rust resistance in Nong Hoi Valley and Mae Joe Experiment Station, both in Chiang Main province. The IWGSR rust rating system was used. Based upon the slow growth of rust on soybean plants, 6 and 115 plants were selected from 2,802 control plants and from 28,824 treated plants, respectively. Selected lines were evaluated in Nong Hoi Valley in the rainy season of 1981. Sixteen selections with average good seed yield per plant and low percentage of shrivelled seeds were obtained. Among them, two lines, namely G8586/Line number 81-1-072 and S.J. 4/Line number 81-1-037 gave the higher average seed yield per plant than other lines. They are at present in a preliminary yield trial in Chiang Mai. Chiang Mai. (author)

  15. Antiproliferative Effects of Selected Chemotherapeutics in Human Ovarian Cancer Cell Line A2780

    Directory of Open Access Journals (Sweden)

    Kateřina Caltová

    2012-01-01

    Full Text Available The aim of our study was to determine the effect of selected cytostatics on a human ovarian cancer cell line A2780 as a model system for ovarian cancer treatment. This cell line is considered cisplatin-sensitive. Panel of tested cytostatics included cisplatin, paclitaxel, carboplatin, gemcitabine, topotecan and etoposide. These cytostatics have a different mechanism of action. To evaluate cytotoxic potential of the tested compounds, the methods measuring various toxicological endpoints were employed including morphological studies, MTT assay, dynamic monitoring of cell proliferation with xCELLigence, cell cycle analysis, caspase 3 activity and expression of proteins involved in cell cycle regulation and cell death. The A270 cell line showed different sensitivity towards the selected cytostatics, the highest cytotoxic effect was associated with paclitaxel and topotecan.

  16. Product-line selection and pricing with remanufacturing under availability constraints

    Science.gov (United States)

    Aras, Necati; Esenduran, G.÷k.‡e.; Altinel, I. Kuban

    2004-12-01

    Product line selection and pricing are two crucial decisions for the profitability of a manufacturing firm. Remanufacturing, on the other hand, may be a profitable strategy that captures the remaining value in used products. In this paper we develop a mixed-integer nonlinear programming model form the perspective of an original equipment manufacturer (OEM). The objective of the OEM is to select products to manufacture and remanufacture among a set of given alternatives and simultaneously determine their prices so as to maximize its profit. It is assumed that the probability a customer selects a product is proportional to its utility and inversely proportional to its price. The utility of a product is an increasing function of its perceived quality. In our base model, products are discriminated by their unit production costs and utilities. We also analyze a case where remanufacturing is limited by the available quantity of collected remanufacturable products. We show that the resulting problem is decomposed into the pricing and product line selection subproblems. Pricing problem is solved by a variant of the simplex search procedure which can also handle constraints, while complete enumeration and a genetic algorithm are used for the solution of the product line selection problem. A number of experiments are carried out to identify conditions under which it is economically viable for the firm to sell remanufactured products. We also determine the optimal utility and unit production cost values of a remanufactured product, which maximizes the total profit of the OEM.

  17. Plant biotechnology: transgenic crops.

    Science.gov (United States)

    Shewry, Peter R; Jones, Huw D; Halford, Nigel G

    2008-01-01

    Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

  18. Slim by design: serving healthy foods first in buffet lines improves overall meal selection.

    Science.gov (United States)

    Wansink, Brian; Hanks, Andrew S

    2013-01-01

    Each day, tens of millions of restaurant goers, conference attendees, college students, military personnel, and school children serve themselves at buffets--many being all-you-can-eat buffets. Knowing how the food order at a buffet triggers what a person selects could be useful in guiding diners to make healthier selections. The breakfast food selections of 124 health conference attendees were tallied at two separate seven-item buffet lines (which included cheesy eggs, potatoes, bacon, cinnamon rolls, low-fat granola, low-fat yogurt, and fruit). The food order between the two lines was reversed (least healthy to most healthy, and vise-versa). Participants were randomly assigned to choose their meal from one line or the other, and researchers recorded what participants selected. With buffet foods, the first ones seen are the ones most selected. Over 75% of diners selected the first food they saw, and the first three foods a person encountered in the buffet comprised 66% of all the foods they took. Serving the less healthy foods first led diners to take 31% more total food items (pselection of healthier foods was less common. Three words summarize these results: First foods most. What ends up on a buffet diner's plate is dramatically determined by the presentation order of food. Rearranging food order from healthiest to least healthy can nudge unknowing or even resistant diners toward a healthier meal, helping make them slim by design. Health-conscious diners, can proactively start at the healthier end of the line, and this same basic principle of "first foods most" may be relevant in other contexts - such as when serving or passing food at family dinners.

  19. Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

    Science.gov (United States)

    Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

    2013-11-01

    Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

  20. Efficient transformation and regeneration of transgenic cassava using the neomycin phosphotransferase gene as aminoglycoside resistance marker gene.

    Science.gov (United States)

    Niklaus, Michael; Gruissem, Wilhelm; Vanderschuren, Hervé

    2011-01-01

    Cassava is one of the most important crops in the tropics. Its industrial use for starch and biofuel production is also increasing its importance for agricultural production in tropical countries. In the last decade cassava biotechnology has emerged as a valuable alternative to the breeding constraints of this highly heterozygous crop for improved trait development of cassava germplasm. Cassava transformation remains difficult and time-consuming because of limitations in selecting transgenic tissues and regeneration of transgenic plantlets. We have recently reported an efficient and robust cassava transformation protocol using the hygromycin phosphotransferase II (hptII) gene as selection marker and the aminoglycoside hygromycin at optimal concentrations to maximize the regeneration of transgenic plantlets. In the present work, we expanded the transformation protocol to the use of the neomycin phosphotransferase II (nptII) gene as selection marker. Several aminoglycosides compatible with the use of nptII were tested and optimal concentrations for cassava transformation were determined. Given its efficiency equivalent to hptII as selection marker with the described protocol, the use of nptII opens new possibilities to engineer transgenic cassava lines with multiple T-DNA insertions and to produce transgenic cassava with a resistance marker gene that is already deregulated in several commercial transgenic crops.

  1. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  2. Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

    Science.gov (United States)

    Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

    2016-06-15

    Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

  3. O-naphthoquinone isolated from Capraria biflora L. induces selective cytotoxicity in tumor cell lines.

    Science.gov (United States)

    de S Wisintainer, G G N; Scola, G; Moura, S; Lemos, T L G; Pessoa, C; de Moraes, M O; Souza, L G S; Roesch-Ely, M; Henriques, J A P

    2015-12-21

    Biflorin is an o-naphthoquinone isolated from the roots of the plant Capraria biflora L. (Scrophulariaceae). In this study, the cytotoxic effects of biflorin were verified, and late apoptosis was detected in various cancer cell lines by in situ analysis. The cytotoxicity was further evaluated exclusively for 48 h of treatment in different tumor and non-tumor cell lines (Hep-2, HeLa, HT-29, A-375, and A-549, and HEK-293, respectively). The results indicated that biflorin induced selective cytotoxicity in tumor cells. HeLa cells were more susceptible to biflorin, followed by HT-29, A-549, A-375, and Hep-2 at all concentrations (range 5-50 μg/mL), and the highest half-maximal inhibitory concentration IC50 (56.01 ± 1.17 μg/mL) was observed in HEK-293 cells. Late apoptotic/necrotic events, observed by in situ immunostaining with Annexin V, varied with each cell line; an increase in late apoptotic events was observed corresponding to the increase in biflorin dosage. Hep-2 cells showed a greater percentage of late apoptotic events among the tumor cell lines when treated with higher concentrations of biflorin (69.63 ± 2.28%). The non-tumor HEK-293 line showed greater resistance to late apoptotic events, as well as a lower level of cytotoxicity (77.69 ± 6.68%) than the tested tumor lines. The data presented indicate that biflorin showed an important, possibly selective, cytotoxicity against tumor cell lines, thereby revealing a promising novel substance with potential anticancer activity for tumor therapy.

  4. Transgenic plants: from first successes to future applications.

    Science.gov (United States)

    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

    2013-01-01

    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

  5. Slim by design: serving healthy foods first in buffet lines improves overall meal selection.

    Directory of Open Access Journals (Sweden)

    Brian Wansink

    Full Text Available OBJECTIVE: Each day, tens of millions of restaurant goers, conference attendees, college students, military personnel, and school children serve themselves at buffets--many being all-you-can-eat buffets. Knowing how the food order at a buffet triggers what a person selects could be useful in guiding diners to make healthier selections. METHOD: The breakfast food selections of 124 health conference attendees were tallied at two separate seven-item buffet lines (which included cheesy eggs, potatoes, bacon, cinnamon rolls, low-fat granola, low-fat yogurt, and fruit. The food order between the two lines was reversed (least healthy to most healthy, and vise-versa. Participants were randomly assigned to choose their meal from one line or the other, and researchers recorded what participants selected. RESULTS: With buffet foods, the first ones seen are the ones most selected. Over 75% of diners selected the first food they saw, and the first three foods a person encountered in the buffet comprised 66% of all the foods they took. Serving the less healthy foods first led diners to take 31% more total food items (p<0.001. Indeed, diners in this line more frequently chose less healthy foods in combinations, such as cheesy eggs and bacon (r = 0.47; p<0.001 or cheesy eggs and fried potatoes (r= 0.37; p<0.001. This co-selection of healthier foods was less common. CONCLUSIONS: Three words summarize these results: First foods most. What ends up on a buffet diner's plate is dramatically determined by the presentation order of food. Rearranging food order from healthiest to least healthy can nudge unknowing or even resistant diners toward a healthier meal, helping make them slim by design. Health-conscious diners, can proactively start at the healthier end of the line, and this same basic principle of "first foods most" may be relevant in other contexts - such as when serving or passing food at family dinners.

  6. Characterization of Agronomy, Grain Physicochemical Quality, and Nutritional Property of High-Lysine 35R Transgenic Rice with Simultaneous Modification of Lysine Biosynthesis and Catabolism.

    Science.gov (United States)

    Yang, Qingqing; Wu, Hongyu; Li, Qianfeng; Duan, Ruxu; Zhang, Changquan; Sun, Samuel Saiming; Liu, Qiaoquan

    2017-05-31

    Lysine is the first limiting essential amino acid in rice. We previously constructed a series of transgenic rice lines to enhance lysine biosynthesis (35S), down-regulate its catabolism (Ri), or simultaneously achieve both metabolic effects (35R). In this study, nine transgenic lines, three from each group, were selected for both field and animal feeding trials. The results showed that the transgene(s) caused no obvious effects on field performance and main agronomic traits. Mature seeds of transgenic line 35R-17 contained 48-60-fold more free lysine than in wild type and had slightly lower apparent amylose content and softer gel consistency. Moreover, a 35-day feeding experiment showed that the body weight gain, food efficiency, and protein efficiency ratio of rats fed the 35R-17 transgenic rice diet were improved when compared with those fed wild-type rice diet. These data will be useful for further evaluation and potential commercialization of 35R high-lysine transgenic rice.

  7. Chicken lines divergently selected for antibody responses to sheep red blood cells show line-specific differences in sensitivity to immunomodulation by diet. Part I: Humoral parameters

    NARCIS (Netherlands)

    Adriaansen-Tennekes, R.; Vries Reilingh, de G.; Nieuwland, M.G.B.; Parmentier, H.K.; Savelkoul, H.F.J.

    2009-01-01

    Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based

  8. Extracellular Secretion of Phytase from Transgenic Wheat Roots Allows Utilization of Phytate for Enhanced Phosphorus Uptake.

    Science.gov (United States)

    Mohsin, Samreen; Maqbool, Asma; Ashraf, Mehwish; Malik, Kauser Abdulla

    2017-08-01

    A significant portion of organic phosphorus comprises of phytates which are not available to wheat for uptake. Hence for enabling wheat to utilize organic phosphorus in form of phytate, transgenic wheat expressing phytase from Aspergillus japonicus under barley root-specific promoter was developed. Transgenic events were initially screened via selection media containing BASTA, followed by PCR and BASTA leaf paint assay after hardening. Out of 138 successfully regenerated T o events, only 12 had complete constructs and thus further analyzed. Positive T1 transgenic plants, grown in sand, exhibited 0.08-1.77, 0.02-0.67 and 0.44-2.14 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, after 4 weeks of phosphorus stress. Based on these results, T2 generation of four best transgenic events was further analyzed which showed up to 1.32, 56.89, and 15.40 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, while in case of real-time PCR, maximum fold increase of 19.8 in gene expression was observed. Transgenic lines showed 0.01-1.18 fold increase in phosphorus efficiency along with higher phosphorus content when supplied phytate or inorganic phosphorus than control plants. Thus, this transgenic wheat may aid in reducing fertilizer utilization and enhancing wheat yield.

  9. Genome characterization of the selected long- and short-sleep mouse lines.

    Science.gov (United States)

    Dowell, Robin; Odell, Aaron; Richmond, Phillip; Malmer, Daniel; Halper-Stromberg, Eitan; Bennett, Beth; Larson, Colin; Leach, Sonia; Radcliffe, Richard A

    2016-12-01

    The Inbred Long- and Short-Sleep (ILS, ISS) mouse lines were selected for differences in acute ethanol sensitivity using the loss of righting response (LORR) as the selection trait. The lines show an over tenfold difference in LORR and, along with a recombinant inbred panel derived from them (the LXS), have been widely used to dissect the genetic underpinnings of acute ethanol sensitivity. Here we have sequenced the genomes of the ILS and ISS to investigate the DNA variants that contribute to their sensitivity difference. We identified ~2.7 million high-confidence SNPs and small indels and ~7000 structural variants between the lines; variants were found to occur in 6382 annotated genes. Using a hidden Markov model, we were able to reconstruct the genome-wide ancestry patterns of the eight inbred progenitor strains from which the ILS and ISS were derived, and found that quantitative trait loci that have been mapped for LORR were slightly enriched for DNA variants. Finally, by mapping and quantifying RNA-seq reads from the ILS and ISS to their strain-specific genomes rather than to the reference genome, we found a substantial improvement in a differential expression analysis between the lines. This work will help in identifying and characterizing the DNA sequence variants that contribute to the difference in ethanol sensitivity between the ILS and ISS and will also aid in accurate quantification of RNA-seq data generated from the LXS RIs.

  10. Measurement of collisional self broadening of atomic resonance lines in selective reflection experiment

    International Nuclear Information System (INIS)

    Papoyan, A.V.

    1998-01-01

    A method is developed to measure directly the collisional self broadening rate for a dense atomic vapor from selective reflection spectra. Experimental realization for the atomic D 1 and D 2 resonance lines of Rb confirms a validity of the proposed technique. The deflection of experimentally measured values is not more than 20% from theoretically predicted ones in the atomic number density range of 7· 10 16 - 7· 10 17 cm - 3 . 10 refs

  11. [Progress in transgenic fish techniques and application].

    Science.gov (United States)

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  12. Cytotoxic Activity of Selected Iranian Traditional Medicinal Plants on Colon, Colorectal and Breast Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Leila Mohammad Taghizadeh Kashani

    2014-11-01

    Full Text Available Background: Many natural products from plants have been recognized to exert anticancer activity. In this study, ethanolic extracts of selected medicinal herbs from Iranian flora including Alyssum homolocarpum Fisch. (from seeds, Urtica dioica L. (from aerial parts, Cichorium intybus L. (from roots and Solanum nigrum L. (from fruits, were evaluated for their cytotoxic effect on different cell lines.Methods: Cytotoxic effect of these extracts was studied on three different cancer cell lines; colon carcinoma (HT-29, colorectal adenocarcinoma (Caco-2 and breast ductal carcinoma (T47D. In addition, Swiss mouse embryo fibroblasts (NIH 3T3 were used as normal nonmalignant cells. MTT assay (3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide was utilized for calculating the cytotoxicity of extracts on cell lines.Results: Results showed the potent cytotoxic activity of U. dioica ethanolic extract against T47D cell line with IC50 value of 46.14±4.55 µg/ml. Other extracts showed poor activity with IC50>100 µg/ml.Conclusions: Cytotoxic activity recorded in the present study revealed high potential antiproliferative activity of U. dioica ethanolic extract against T47D cell line. The real IC50 values of this extract may be considerably lower than the IC50 measured in our study if its pharmacological active compounds become pure. The results emphasize the importance of studies on U. dioica ethanolic extract to characterize potential components as cytotoxic natural medicines.

  13. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  14. MUC1 gene polymorphism in three Nelore lines selected for growth and its association with growth and carcass traits.

    Science.gov (United States)

    de Souza, Fabio Ricardo Pablos; Maione, Sandra; Sartore, Stefano; Soglia, Dominga; Spalenza, Veronica; Cauvin, Elsa; Martelli, Lucia Regina; Mercadante, Maria Eugênia Zerlotti; Sacchi, Paola; de Albuquerque, Lucia Galvão; Rasero, Roberto

    2012-02-01

    The objective of this study was to describe the VNTR polymorphism of the mucin 1 gene (MUC1) in three Nelore lines selected for yearling weight to determine whether allele and genotype frequencies of this polymorphism were affected by selection for growth. In addition, the effects of the polymorphism on growth and carcass traits were evaluated. Birth, weaning and yearling weights, rump height, Longissimus muscle area, backfat thickness, and rump fat thickness, were analyzed. A total of 295 Nelore heifers from the Beef Cattle Research Center, Instituto de Zootecnia de Sertãozinho, were used, including 41 of the control line, 102 of the selection line and 152 of the traditional. The selection and traditional lines comprise animals selected for higher yearling weight, whereas control line animals are selected for yearling weight close to the average. Five alleles were identified, with allele 1 being the most frequent in the three lines, especially in the lines selected for higher means for yearling weight. Heterozygosity was significantly higher in the control line. Association analyses showed significant effects of allele 1 on birth weight and weaning weight while the allele 3 exert significant effects on yearling weight and back fat thickness. Despite these findings, application of this marker to marker-assisted selection requires more consistent results based on the genotyping of a larger number of animals in order to increase the accuracy of the statistical analyses.

  15. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    Directory of Open Access Journals (Sweden)

    Liping Ke

    Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  16. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  17. Clustering Properties of Emission Line Selected Galaxies over the past 12.5 Gyrs

    Science.gov (United States)

    Khostovan, Ali Ahmad; Sobral, David; Mobasher, Bahram; Best, Philip N.; Smail, Ian; Matthee, Jorryt; Darvish, Behnam; Nayyeri, Hooshang; Hemmati, Shoubaneh; Stott, John P.

    2018-01-01

    In this talk, I will present my latest results on the clustering and dark matter halo (DMH) mass properties of ~7000 narrowband-selected [OIII] and [OII] emitters. I will briefly describe the past work that has been done with our samples (e.g., luminosity functions, evolution of equivalent widths) as motivation of using [OIII] and [OII] emitters to study clustering/halo properties. My talk will focus on our findings regarding the line luminosity and stellar mass dependencies with DMH mass. We find strongly increasing and redshift-independent trends between line luminosity and DMH mass with evidence for a shallower slope at the bright end consistent with halo masses of ~ 1012.5-13 M⊙. Similar, but weaker, trends between stellar mass and halo mass have also been found. We investigate the inter-dependencies of these trends on halo mass and find that the correlation with line luminosity is stronger than with stellar mass. This suggest that active galaxies may be connected with their host DMHs simply based on their emission line luminosity. If time permits, I will briefly present our most recent results using our sample of ~4000 Lyα emitters, where we find similar trends to that seen with the [OIII] and [OII] samples, as well as previous Hα measurements, which suggests galaxies selected based on emission lines may be tracing the same subpopulation of star forming galaxies. I will conclude my talk with an interpretation of this connection and suggest that the shallower slope seen for the brightest emitters is evidence for a transitional halo mass as suggested in models where quenching mechanisms truncate star formation activity and reduce the fraction of star forming galaxies with increasing halo mass.

  18. Effect of selection for productive traits in broiler maternal lines on embryo development

    Directory of Open Access Journals (Sweden)

    Schmidt GS

    2003-01-01

    Full Text Available This study used 300 females and 30 males with 36 weeks of age from the selected PP and control PPc maternal broiler lines. PP has been selected for heavy body weight (PC and high egg production for eight generations. Fertile eggs were collected and weighed individually for 4 periods of 5 consecutive days at two-week intervals. In each period, a total of 960 eggs/line were identified and separated in groups of 240 eggs, and stored for later incubation. Embryo weight (PE was evaluated at 9 (P9, 11 (P11, 13 (P13, 15 (P15, 17 (P17 and 21 (P21 days of incubation. The objective was to estimate the effect of selection on embryo development. Egg weight (PO was similar between the two lines. The differences in PE were significant from P15 on, resulting in 1.9g of difference in the chick weight, indicating correlated genetic changes in the embryo development, which can be credited to the selection for PC. Changes in PE while PO was kept unaltered modified the correlations between these two traits. Differences were significant from P13 on and estimated correlations for P21 were 0.72 and 0.70 for PP and PPc, respectively. Chick weight corresponded to 70.91% (PP and 68.48% (PPc of egg weight. The estimated increase in P21 that resulted from the increase of 1.0g in PO was 0.71 in PP and 0.68g in PPc.

  19. Furano diterpenes from Pterodon pubescens Benth with selective in vitro anticancer activity for prostate cell line

    International Nuclear Information System (INIS)

    Spindola, Humberto M.; Carvalho, Joao E. de; Ruiz, Ana Lucia T.G.; Rodrigues, Rodney A. F.; Denny, Carina; Sousa, Ilza M. de Oliveira; Foglio, Mary Ann; Tamashiro, Jorge Y.

    2009-01-01

    Activity guided fractionation of Pterodon pubescens Benth. methylene chloride-soluble fraction afforded novel 6α-acetoxi 7β-hydroxy-vouacapan 1 and four known diterpene furans 2, 3, 4, 5. The compounds were evaluated for in vitro cytotoxic activities against human normal cells and tumour cell lines UACC-62 (melanoma), MCF-7 (breast), NCI-H460 (lung, non-small cells), OVCAR-03 (ovarian), PC-3 (prostate), HT-29 (colon), 786-0 (renal), K562 (leukemia) and NCI-ADR/RES (ovarian expressing phenotype multiple drugs resistance). Results were expressed by three concentration dependent parameters GI 50 (concentration that produces 50% growth inhibition), TGI (concentration that produces total growth inhibition or cytostatic effect) and LC 50 (concentration that produces .50% growth, a cytotoxicity parameter). Also, in vitro cytotoxicity was evaluated against 3T3 cell line (mouse embryonic fibroblasts). Antiproliferative properties of compounds 1, 4 and 5 are herein reported for the first time. These compounds showed selectivity in a concentration-dependent way against human PC-3. Compound 1 demonstrated selectivity 26 fold more potent than the positive control, doxorubicin, for PC-3 (prostrate) cell line based on GI 50 values, causing cytostatic effect (TGI value) at a concentration fifteen times less than positive control. Moreover comparison of 50% lethal concentration (LC 50 value) with positive control (doxorubicin) suggested that compound 1 was less toxic. (author)

  20. LINES

    Directory of Open Access Journals (Sweden)

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  1. Background matters: Minor vibratory stimulation during motor skill acquisition selectively reduces off-line memory consolidation.

    Science.gov (United States)

    Korman, Maria; Herling, Zohar; Levy, Ishay; Egbarieh, Nebal; Engel-Yeger, Batya; Karni, Avi

    2017-04-01

    Although a ubiquitous situation, it is not clear how effective is a learning experience when task-irrelevant, sensory noise occurs in the background. Here, young adults were trained on the finger opposition sequence task, in a well-established training and testing protocol affording measures for online as well as off-line learning. During the training session, one group experienced a minor background vibratory stimulation to the trunk by the means of vibrating cushion, while the second group experienced recorded sound vibrations. A control group was trained with no extra sensory stimulation. Sensory stimulation during training had no effect on the online within-session gains, but dampened the expression of the off-line, consolidation phase, gains in the two sensory stimulation groups. These results suggest that background sensory stimulation can selectively modify off-line, procedural memory consolidation processes, despite well-preserved on-line learning. Classical studies have shown that neural plasticity in sensory systems is modulated by motor input. The current results extend this notion and suggest that some types of task-irrelevant sensory stimulation, concurrent with motor training, may constitute a 'gating' factor - modulating the triggering of long-term procedural memory consolidation processes. Thus, vibratory stimulation may be considered as a behavioral counterpart of pharmacological interventions that do not interfere with short term neural plasticity but block long-term plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. [Comparative study of microleakage by using different finished lines in selective laser melting metal crowns].

    Science.gov (United States)

    Peng, Yan; Zhong, Qun; Wu, Xue-Ying; Weng, Jia-Wei

    2016-12-01

    To evaluate microleakage of SLM Co -Cr alloy metal crown with two types finished line (chamfer and shoulder), compared with conventional fabrication of Co -Cr alloy metal crowns. Thirty healthy non-carious human molars were selected and randomly assigned to 3 groups, 10 in each. Teeth in group A and C received a chamfer finish line preparation, whereas teeth in group C received a shoulder finish line. Conventional Co -Cr alloy metal crowns were fabricated for group A when SLM metal crowns were made for group B and group C. Glass ionomer was applied for bonding. After 5000 thermocycles ranging from 5degrees centigrade to 55degrees centigrade,all the specimens were evaluated by dye penetration and then microleakage was examined under light microscope. The data were analyzed statistically with SPSS 20.0 software package. Microleakage in group A was significantly higher than the other two groups, group B and group C showed no significant difference in microleakage while microleakage in group B was higher than that in group C. Microleakage of SLM metal crowns was significantly less than that of conventional Co-Cr alloy metal crowns; chamfer finish line designs was recommended for SLM metal crowns in consideration of reducing microleakage and protecting tooth.

  3. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra.

    Directory of Open Access Journals (Sweden)

    Weidong Gao

    Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  4. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra).

    Science.gov (United States)

    Gao, Weidong; Bai, Shuang; Li, Qingmei; Gao, Caiqiu; Liu, Guifeng; Li, Guangde; Tan, Feili

    2013-01-01

    Late embryogenesis abundant (LEA) genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA) was transformed into Xiaohei poplar (Populussimonii × P. nigra) via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR) and ribonucleic acid (RNA) gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA) content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11) showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  5. Selection of refractory materials for acid tanks at the CSN continuous pickling line

    International Nuclear Information System (INIS)

    Silva, Sidiney Nascimento; Marques, Oscar Rosa; Bueno, Mauricio Chaves; Longo, Elson; Silva Pinheiro, Adriano da

    1997-01-01

    Aiming at the revamping of the CSN continuous pickling line 4 acid tanks, a Post Mortem study of the refractory lining was carried out. The collected samples were characterized through techniques such as chemical analysis, mercury porosimetry, X-ray diffraction and scanning electronic microscopy. Trying to reproduce the operational conditions closely, laboratorial simulations were carried out. Such simulations lead to the addition of some alterations on the test method proposed by ABNT. Primarily, the sulfuric acid was substituted by hydrochloric acid (30%), containing iron in solution (130g/l). As result, it was concluded that acid resistant refractories containing a smaller alumina and /or corundum and mullite concentrations, presenting a smaller open porosity and average pore diameter, have a better performance face to corrosion due to hydrochloric acid solution. In addition, abrasion wear resistance tests, according to the ASTM-G65-85 standard were carried out in order to select different materials to the acid tanks cells. (author)

  6. Selection and evaluation of an ultra high vacuum gate valve for Isabelle beam line vacuum system

    International Nuclear Information System (INIS)

    Foerster, C.L.; McCafferty, D.

    1980-01-01

    A minimum of eighty-four (84) Ultra High Vacuum Gate Valves will be utilized in ISABELLE to protect proton beam lines from catastrophic vacuum failure and to provide sector isolation for maintenance requirements. The valve to be selected must function at less than 1 x 10 -11 Torr pressure and be bakeable to 300 0 C in its open or closed position. In the open position, the valve must have an RF shield to make the beam line walls appear continuous. Several proposed designs were built and evaluated. The evaluation consisted mainly of leak testing, life tests, thermal cycling, mass spectrometer analysis, and 10 -12 Torr operation. Problems with initial design and fabrication were resolved. Special requirements for design and construction were developed. This paper describes the tests on two final prototypes which appear to be the best candidates for ISABELLE operation

  7. SELECTED PARAMETERS OF THE WORK OF SPEED LIMITER IN LINE STRAINING SYSTEM IN A FRICTIONAL LIFT

    Directory of Open Access Journals (Sweden)

    Paweł Lonkwic

    2014-03-01

    Full Text Available The article presents the analysis of selected work parameters of speed limiter in line straining system. We analyzed the effect of changing the geometrical conditions of the new solution for the speed limiter in line straining system upon the working conditions in frictional lift braking system. Within the conducted simulations of the work of the system, which is responsible for lift braking with a tension with spring, a test bed was prepared, which simulated the work of tension-rope-limiter system. The tests were performed in the conditions reflecting the work of a lifting appliance. Analyzing the results obtained through empirical calculations, we can conclude that there is a possibility of applying the spring to eliminate the weight.

  8. Durable field resistance to wheat yellow mosaic virus in transgenic wheat containing the antisense virus polymerase gene.

    Science.gov (United States)

    Chen, Ming; Sun, Liying; Wu, Hongya; Chen, Jiong; Ma, Youzhi; Zhang, Xiaoxiang; Du, Lipu; Cheng, Shunhe; Zhang, Boqiao; Ye, Xingguo; Pang, Junlan; Zhang, Xinmei; Li, Liancheng; Andika, Ida B; Chen, Jianping; Xu, Huijun

    2014-05-01

    Wheat yellow mosaic virus (WYMV) has spread rapidly and causes serious yield losses in the major wheat-growing areas in China. Because it is vectored by the fungus-like organism Polymyxa graminis that survives for long periods in soil, it is difficult to eliminate by conventional crop management or fungicides. There is also only limited resistance in commercial cultivars. In this research, fourteen independent transgenic events were obtained by co-transformation with the antisense NIb8 gene (the NIb replicase of WYMV) and a selectable gene bar. Four original transgenic lines (N12, N13, N14 and N15) and an offspring line (N12-1) showed high and durable resistance to WYMV in the field. Four resistant lines were shown to have segregated and only contain NIb8 (without bar) by PCR and herbicide resistance testing in the later generations. Line N12-1 showed broad-spectrum resistance to WYMV isolates from different sites in China. After growing in the infested soil, WYMV could not be detected by tissue printing and Western blot assays of transgenic wheat. The grain yield of transgenic wheat was about 10% greater than the wild-type susceptible control. Northern blot and small RNA deep sequencing analyses showed that there was no accumulation of small interfering RNAs targeting the NIb8 gene in transgenic wheat plants, suggesting that transgene RNA silencing, a common mechanism of virus-derived disease resistance, is not involved in the process of WYMV resistance. This durable and broad-spectrum resistance to WYMV in transgenic wheat will be useful for alleviating the damage caused by WYMV. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  9. A large sample of Kohonen-selected SDSS quasars with weak emission lines: selection effects and statistical properties

    Science.gov (United States)

    Meusinger, H.; Balafkan, N.

    2014-08-01

    Aims: A tiny fraction of the quasar population shows remarkably weak emission lines. Several hypotheses have been developed, but the weak line quasar (WLQ) phenomenon still remains puzzling. The aim of this study was to create a sizeable sample of WLQs and WLQ-like objects and to evaluate various properties of this sample. Methods: We performed a search for WLQs in the spectroscopic data from the Sloan Digital Sky Survey Data Release 7 based on Kohonen self-organising maps for nearly 105 quasar spectra. The final sample consists of 365 quasars in the redshift range z = 0.6 - 4.2 (z¯ = 1.50 ± 0.45) and includes in particular a subsample of 46 WLQs with equivalent widths WMg iiattention was paid to selection effects. Results: The WLQs have, on average, significantly higher luminosities, Eddington ratios, and accretion rates. About half of the excess comes from a selection bias, but an intrinsic excess remains probably caused primarily by higher accretion rates. The spectral energy distribution shows a bluer continuum at rest-frame wavelengths ≳1500 Å. The variability in the optical and UV is relatively low, even taking the variability-luminosity anti-correlation into account. The percentage of radio detected quasars and of core-dominant radio sources is significantly higher than for the control sample, whereas the mean radio-loudness is lower. Conclusions: The properties of our WLQ sample can be consistently understood assuming that it consists of a mix of quasars at the beginning of a stage of increased accretion activity and of beamed radio-quiet quasars. The higher luminosities and Eddington ratios in combination with a bluer spectral energy distribution can be explained by hotter continua, i.e. higher accretion rates. If quasar activity consists of subphases with different accretion rates, a change towards a higher rate is probably accompanied by an only slow development of the broad line region. The composite WLQ spectrum can be reasonably matched by the

  10. A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines

    International Nuclear Information System (INIS)

    Toki, Yasumichi; Sasaki, Katsunori; Tanaka, Hiroki; Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro; Torimoto, Yoshihiro; Ohtake, Takaaki; Kohgo, Yutaka

    2016-01-01

    Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.

  11. A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Toki, Yasumichi [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Sasaki, Katsunori, E-mail: k-sasaki@asahikawa-med.ac.jp [Department of Gastrointestinal Immunology and Regenerative Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Tanaka, Hiroki [Department of Legal Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Torimoto, Yoshihiro [Oncology Center, Asahikawa Medical University Hospital, Hokkaido 078-8510 (Japan); Ohtake, Takaaki; Kohgo, Yutaka [Department of Gastroenterology, International University of Health and Welfare Hospital, Tochigi 329-2763 (Japan)

    2016-08-05

    Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.

  12. Optimization of Sex Ratio in a Selection Plan for Palas Prolificacy Line

    Directory of Open Access Journals (Sweden)

    Răzvan Popa

    2011-05-01

    Full Text Available The aim of the paper work is to optimize the sex ratio in a selection plan, according to model developed by King (1961, which will be proposed to be applied for prolificacy improvement in Prolific Line Palas. The method used in this paper work is modeling, which exist in the most animal breeding scientifically papers. After the simulations, we observed that the most convenient variant was that which prefigure use of 13 rams on reproduction activity. This variant offer a genetic gain per generation by 0.47497 additive standard deviations.

  13. Protein and energy metabolism in two lines of chickens selected for growth on high or low protein diets

    DEFF Research Database (Denmark)

    Chwalibog, André; Eggum, B O; Sørensen, Peter

    1983-01-01

    Genetic adaptation was investigated in broilers selected for seven generations on a normal (A) or a low (B) protein diet. Protein and energy metabolism were studied in males from these selected lines fed on a diet of intermediate protein content. All selected birds retained more nitrogen than those...

  14. Spectral properties of X-ray selected narrow emission line galaxies

    Science.gov (United States)

    Romero-Colmenero, E.

    1998-03-01

    This thesis reports a study of the X-ray and optical properties of two samples of X-ray selected Narrow Emission Line Galaxies (NELGs), and their comparison with the properties of broad line Active Galactic Nuclei (AGN). One sample (18 NELGs) is drawn from the ROSAT International X-ray Optical Survey (RIXOS), the other (19 NELGs and 33 AGN) from the ROSAT UK Deep Survey. ROSAT multi-channel X-ray spectra have been extracted and fitted with power-law, bremsstrahlung and black body models for the brighter RIXOS sources. In most cases, power-law and bremsstrahlung models provide the best results. The average spectral energy index, alpha, of the RIXOS NELGs is 0.96 +/- 0.07, similar to that of AGN (alpha~1). For the fainter RIXOS NELGs, as well as for all the UK Deep Survey sources, counts in three spectral bands have been extracted and fitted with a power-law model, assuming the Galactic value for N_H. The brighter RIXOS sources demonstrated that the results obtained by these two different extraction and fitting procedures provide consistent results. Two average X-ray spectra, one for the NELGs and another for the AGN, were created from the UK Deep Survey sources. The power-law slope of the average NELG is alpha = 0.45 +/- 0.09, whilst that of the AGN is alpha = 0.96 +/- 0.03. ROSAT X-ray surveys have shown that the fractional surface density of NELGs increases with respect to AGN at faint fluxes (case for NELGs to be major contributors to the XRB at the fainter fluxes. The analysis of optical spectroscopy, obtained on La Palma and Hawaii, shows that NELGs form a very heterogeneous group, made up of a mixture of Seyfert 2, LINER and HII-region like galaxies. Seyfert 2 galaxies are found to possess in general the steepest X-ray slopes. Ways to explain this in the context of the unified model of AGN are discussed. The FWHM of some emission lines (Halpha, Hbeta, [NII]) in the NELGs appears to increase with steepening X-ray spectral slope. In the case of the Balmer lines

  15. Chicken lines divergently selected for antibody responses to sheep red blood cells show line-specific differences in sensitivity to immunomodulation by diet. Part I: Humoral parameters.

    Science.gov (United States)

    Adriaansen-Tennekes, R; de Vries Reilingh, G; Nieuwland, M G B; Parmentier, H K; Savelkoul, H F J

    2009-09-01

    Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based differential immune competence. The parental line of these hens was randomly bred as the control line and was used as well. Recently, we showed that these selection lines differ in their stress reactivity; the low line birds show a higher hypothalamic-pituitary-adrenal (HPA) axis reactivity. To examine maternal effects and neonatal nutritional exposure on nutrient sensitivity, we studied 2 subsequent generations. This also created the opportunity to examine egg production in these birds. The 3 lines were fed 2 different nutritionally complete layer feeds for a period of 22 wk in the first generation. The second generation was fed from hatch with the experimental diets. At several time intervals, parameters reflecting humoral immunity were determined such as specific antibody to Newcastle disease and infectious bursal disease vaccines; levels of natural antibodies binding lipopolysaccharide, lipoteichoic acid, and keyhole limpet hemocyanin; and classical and alternative complement activity. The most pronounced dietary-induced effects were found in the low line birds of the first generation: specific antibody titers to Newcastle disease vaccine were significantly elevated by 1 of the 2 diets. In the second generation, significant differences were found in lipoteichoic acid natural antibodies of the control and low line hens. At the end of the observation period of egg parameters, a significant difference in egg weight was found in birds of the high line. Our results suggest that nutritional differences have immunomodulatory effects on innate and adaptive humoral immune parameters in birds with high HPA axis reactivity and affect egg production in birds with low HPA axis reactivity.

  16. Characterization of Boerhavia diffusa L. mutant lines by RAPD and isozyme, selected for agronomically valuable traits

    International Nuclear Information System (INIS)

    Shukla, N.; Sangwan, N.S.; Misra, H.O.; Sangwan, R.S.

    2004-01-01

    Boerhavia diffusa is a medicinally important plant and finds extensive uses in traditional herbal drug preparations. For the development of improved varieties in terms of superior yield and quality of herb/root of B. diffusa, mutation breeding was attempted. Mutants generated by physical and chemical mutagenic treatments were screened for yield and quality parameters of the root/herb up to three consecutive generations. The selected-screened lines generated by physical and chemical mutagenic treatments on two selected genotypes I and II were molecularly analyzed using eight isozymes and eleven RAPD primers producing good amplification. Mutants from BD10 (selected genotype I) were distinct, while, in case of BD22 (selected genotype II), only one mutant BDMu7 was recorded distinct by isozyme analysis. The wild mutant (BDMu16, with maximum height and mouve coloured flower) was distinct in RAPD banding pattern. Isozymes differentiated the mutants from their respective controls, whereas RAPD differentiated the mutants and controls and also distinguished the mutants. The RAPD analysis was found to be better suited than isozymes for detecting genetic differences among controls and their mutants. However, both RAPD and isozyme analyses gave similar patterns of genetic relationships [it

  17. Aspects of Salt Tolerance in a NaCl-Selected Stable Cell Line of Citrus sinensis.

    Science.gov (United States)

    Ben-Hayyim, G; Kochba, J

    1983-07-01

    A NaCl-tolerant cell line which was selected from ovular callus of ;Shamouti' orange (Citrus sinensis L. Osbeck) proved to be a true cell line variant. This conclusion is based on the following observations. (a) Cells which have been removed from the selection pressure for at least four passages retain the same NaCl tolerance as do cells which are kept constantly on 0.2 molar NaCl. (b) Na(+) and Cl(-) uptake are considerably lower in salt-tolerant cells (R-10) than in salt-sensitive cells (L-5) at a given external NaCl concentration. (c) Growth of salt-tolerant cells is markedly suppressed upon replacement of NaCl by KCl, whereas the growth of salt-sensitive cells is only slightly affected. Accumulation of K(+) and Cl(-) accompanies the inhibition of growth. Experiments carried out with sodium and potassium sulfate suggest that the toxic effect is due to the accumulated Cl(-). (d) Removal of Ca(2+) from the growth medium severely inhibits the growth of salt-tolerant cells in the presence of NaCl, while it has a minor effect on growth of salt-sensitive cells in the presence of NaCl. (e) Electron micrographs show that the salt-tolerant cells have very big vacuoles when exposed to salt, while the size of the vacuoles of the salt-sensitive cells does not change.

  18. CLASH: EXTREME EMISSION-LINE GALAXIES AND THEIR IMPLICATION ON SELECTION OF HIGH-REDSHIFT GALAXIES

    International Nuclear Information System (INIS)

    Huang, Xingxing; Wang, Junxian; Shu, Xinwen; Zheng, Wei; Ford, Holland; Lemze, Doron; Moustakas, John; Van der Wel, Arjen; Zitrin, Adi; Frye, Brenda L.; Postman, Marc; Bradley, Larry; Coe, Dan; Bartelmann, Matthias; Benítez, Narciso; Broadhurst, Tom; Donahue, Megan; Infante, Leopoldo

    2015-01-01

    We utilize the Cluster Lensing And Supernova survey with Hubble observations of 25 clusters to search for extreme emission-line galaxies (EELGs). The selections are carried out in two central bands: F105W (Y 105 ) and F125W (J 125 ), as the flux of the central bands could be enhanced by the presence of [O III] λλ4959, 5007 at redshifts of ∼0.93-1.14 and 1.57-1.79, respectively. The multiband observations help to constrain the equivalent widths (EWs) of emission lines. Thanks to cluster lensing, we are able to identify 52 candidates down to an intrinsic limiting magnitude of 28.5 and to a rest-frame [O III] λλ4959, 5007 EW of ≅ 3700 Å. Our samples include a number of EELGs at lower luminosities that are missed in other surveys, and the extremely high EW can only be found in such faint galaxies. These EELGs can mimic a dropout feature similar to that of high-redshift galaxies and contaminate the color-color selection of high-redshift galaxies when the signal-to-noise ratio is limited or the band coverage is incomplete

  19. CLASH: EXTREME EMISSION-LINE GALAXIES AND THEIR IMPLICATION ON SELECTION OF HIGH-REDSHIFT GALAXIES

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xingxing; Wang, Junxian; Shu, Xinwen [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei, Anhui 230026 (China); Zheng, Wei; Ford, Holland; Lemze, Doron [Department of Physics and Astronomy, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 (United States); Moustakas, John [Department of Physics and Astronomy, Siena College, 515 Loudon Road, Loudonville, NY 12211 (United States); Van der Wel, Arjen [Max-Planck Institute for Astronomy, Königstuhl 17, D-69117, Heidelberg (Germany); Zitrin, Adi [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MS 249-17, Pasadena, CA 91125 (United States); Frye, Brenda L. [Steward Observatory/Department of Astronomy, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721-0065 (United States); Postman, Marc; Bradley, Larry; Coe, Dan [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21208 (United States); Bartelmann, Matthias [Leiden Observatory, Leiden University, P. O. Box 9513, 2300 RA Leiden (Netherlands); Benítez, Narciso [Instituto de Astrofísica de Andalucía (CSIC), C/Camino Bajo de Huétor 24, Granada E-18008 (Spain); Broadhurst, Tom [Department of Theoretical Physics, University of Basque Country UPV/EHU E-Bilbao (Spain); Donahue, Megan [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States); Infante, Leopoldo, E-mail: hxx@mail.ustc.edu.cn [Departamento de Astronoía y Astrofísica, Pontificia Universidad Católica de Chile, V. Mackenna 4860 Santiago 22 (Chile); and others

    2015-03-01

    We utilize the Cluster Lensing And Supernova survey with Hubble observations of 25 clusters to search for extreme emission-line galaxies (EELGs). The selections are carried out in two central bands: F105W (Y {sub 105}) and F125W (J {sub 125}), as the flux of the central bands could be enhanced by the presence of [O III] λλ4959, 5007 at redshifts of ∼0.93-1.14 and 1.57-1.79, respectively. The multiband observations help to constrain the equivalent widths (EWs) of emission lines. Thanks to cluster lensing, we are able to identify 52 candidates down to an intrinsic limiting magnitude of 28.5 and to a rest-frame [O III] λλ4959, 5007 EW of ≅ 3700 Å. Our samples include a number of EELGs at lower luminosities that are missed in other surveys, and the extremely high EW can only be found in such faint galaxies. These EELGs can mimic a dropout feature similar to that of high-redshift galaxies and contaminate the color-color selection of high-redshift galaxies when the signal-to-noise ratio is limited or the band coverage is incomplete.

  20. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2018-01-09

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  1. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  2. Field Trial and Molecular Characterization of RNAi-Transgenic Tomato Plants That Exhibit Resistance to Tomato Yellow Leaf Curl Geminivirus.

    Science.gov (United States)

    Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M

    2016-03-01

    RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.

  3. Comparative carcass and tissue nutrient composition of transgenic Yorkshire pigs expressing phytase in the saliva and conventional Yorkshire pigs.

    Science.gov (United States)

    Forsberg, C W; Meidinger, R G; Ajakaiye, A; Murray, D; Fan, M Z; Mandell, I B; Phillips, J P

    2014-10-01

    A transgenic line of Yorkshire (YK) pigs named the Cassie (CA) line was produced with a low copy number phytase transgene inserted in the genome. The transgenic line efficiently digests P, Ca, and other major minerals of plant dietary origin. The objectives of this study were to 1) compare carcass and tissue nutrient composition and meat quality traits for third generation hemizygous CA line market BW finisher pigs (n = 24) with age-matched conventional YK finisher pigs (n = 24) and 2) examine effects of outbreeding with high-index conventional YK boars on modifying carcass leanness from the third to sixth generations in CA line finisher boars (n = 73) and gilts (n = 103). Cassie boars (n = 12) and CA gilts (n = 12) were fed diets without supplemental P and comparable numbers of age-matched YK boars and gilts fed diets containing supplement P were raised throughout the finisher phase. The pigs were slaughtered and then fabricated into commercial pork primals before meat composition and quality evaluation. Proximate and major micronutrient composition was determined on tissues including fat, kidney, lean, liver, and skin. The main difference observed was greater (P = 0.033) crude fat content in CA boar carcasses and increased (P phytase action rather than to insertion of the transgene. However, from a meat composition perspective, transgenic expression of phytase in the CA line of YK pigs had little overall effect on meat composition. Outbreeding of high-index CA gilts with high-index commercial YK boars linearly reduced (P = 0.002) back fat thickness with a corresponding linear increase (P = 0.001) in lean yield in finisher CA gilts, although no change in these parameters was observed in CA finisher boars. The increase in lean yield in CA gilts by selective breeding without affecting the level of salivary phytase activity documents the value of conventional genetic selection in conjunction with genetic modification.

  4. Asymmetries in Chickens from Lines Selected and Relaxed for High or Low Antibody Titers to Sheep Red Blood Cells

    Directory of Open Access Journals (Sweden)

    Yunjie Tu

    2015-03-01

    Full Text Available Wattle length, width, and area were measured to classify bilateral asymmetries in four lines of chickens. The lines were the S26 generation of White Leghorns selected for high (HAS or low (LAS response to sheep red blood cells and sublines in which selection had been relaxed for three generations (high antibody relaxed [HAR] and low antibody relaxed [LAR]. Antibody titers (AB were greater for HAS than for HAR with both greater than for LAS and LAR which while different for males did not differ for females. The low antibody lines were heavier and reached sexual maturity at younger age than the high antibody lines. In general, wattle length, width, and area were greater in the low than high antibody lines. In 24 comparisons for bilaterality 18 exhibited fluctuating asymmetry and 6 exhibited directional asymmetry with 5 of the 6 being for wattle length. There was not a clear pattern for changes in degree of asymmetry when selection was relaxed for 3 generations. For females, the relative asymmetry (RA of wattle area was larger (p≤0.05 for HAR than for LAR and not different from the selected lines and relaxed lines. There were no differences among lines for RA of wattle length and width of females and wattle length, width, and area of males.

  5. The use of super-selective mesenteric embolisation as a first-line management of acute lower gastrointestinal bleeding

    Directory of Open Access Journals (Sweden)

    Bryan Soh, MBBS, BBiomedSci, PGDipSurgAnat

    2017-05-01

    Conclusion: Super-selective mesenteric embolisation is a viable, safe and effective first line management for localised LGIB. Our results overall compare favourably with the published experiences of other institutions. It is now accepted first-line practice at our institution to manage localised LGIB with embolisation.

  6. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  7. 9th Transgenic Technology Meeting (TT2010) in Berlin, Germany: a meeting report.

    Science.gov (United States)

    Saunders, Thomas L; Sobieszczuk, Peter

    2010-12-01

    The first Transgenic Technology (TT) Meeting was organized in 1999 by Johannes Wilbertz, Karolinska Institute, Stockholm, Sweden as a regional meeting. The TT Meetings continued in this way, constantly gathering additional practitioners of transgenic methodologies until the breakthrough in 2005 when the 6th TT Meeting in Barcelona, Spain, hosted by Lluis Montoliu (Centro Nacional de Biotecnologia, Madrid, Spain), generated the momentum to establish the International Society for Transgenic Technologies (ISTT). Since 2006, the ISTT has continued to promote the TT Meetings and provide its membership with a forum to discuss best practices and new methods in the field. The TT2010 Meeting was held at the Max Delbrück Center for Molecular Medicine (Berlin, Germany). Participation at the TT2010 Meeting exceeded the registration capacity and set a new attendance record. Session topics included methods for the generation of rat and mouse models of human disease, fundamental and advanced topics in rodent embryonic stem cells, and the newest transgenic technologies. Short presentations from selected abstracts were of especial interest. Roundtable discussions on transgenic facility establishment and cryoarchiving of mouse lines were favorably received. Students, technical staff, and professors participated in numerous discussions and came away with practical methods and new ideas for research.

  8. [Production of human proteins in the blood of transgenic animals

    NARCIS (Netherlands)

    Massoud, M.; Bischoff, Rainer; Dalemans, W.; Pointu, H.; Attal, J.; Schultz, H.; Clesse, D.; Stinnakre, M.G.; Pavirani, A.; Houdebine, L.M.

    1990-01-01

    The human alpha 1-antitrypsin gene has been microinjected into rabbit embryos. A line of transgenic rabbits has thus been established. Human alpha 1-antitrypsin was found in the blood of transgenic animals at the concentration of 1 mg/ml plasma. The human protein was active and separable from its

  9. Germline transgenic pigs by Sleeping Beauty transposition in porcine zygotes and targeted integration in the pig genome.

    Directory of Open Access Journals (Sweden)

    Wiebke Garrels

    Full Text Available Genetic engineering can expand the utility of pigs for modeling human diseases, and for developing advanced therapeutic approaches. However, the inefficient production of transgenic pigs represents a technological bottleneck. Here, we assessed the hyperactive Sleeping Beauty (SB100X transposon system for enzyme-catalyzed transgene integration into the embryonic porcine genome. The components of the transposon vector system were microinjected as circular plasmids into the cytoplasm of porcine zygotes, resulting in high frequencies of transgenic fetuses and piglets. The transgenic animals showed normal development and persistent reporter gene expression for >12 months. Molecular hallmarks of transposition were confirmed by analysis of 25 genomic insertion sites. We demonstrate germ-line transmission, segregation of individual transposons, and continued, copy number-dependent transgene expression in F1-offspring. In addition, we demonstrate target-selected gene insertion into transposon-tagged genomic loci by Cre-loxP-based cassette exchange in somatic cells followed by nuclear transfer. Transposase-catalyzed transgenesis in a large mammalian species expands the arsenal of transgenic technologies for use in domestic animals and will facilitate the development of large animal models for human diseases.

  10. Regional analysis assessment of landslide hazard and zoning map for transmission line route selection using GIS

    International Nuclear Information System (INIS)

    Baharuddin, I N Z; Omar, R C; Usman, F; Mejan, M A; Halim, M K Abd; Zainol, M A; Zulkarnain, M S

    2013-01-01

    The stability of ground as foundation for infrastructure development is always associated with geology and geomorphology aspects. Failure to carefully analyze these aspects may induce ground instability such subsidence and landslide which eventually can cause catastrophe to the infrastructure i.e. instability of transmission tower. However, in some cases such as the study area this is unavoidable. A GIS system for analysis of route was favoured to perform optimal route predictions based selection by incorporating multiple influence factors into its analysis by incorporating the Landslide Hazard Map (LHM) that was produced on basis of slope map, aspect map, land use map and geological map with the help of ArcGIS using weighted overlay method. Based on LHM it is safe to conclude that the proposed route for Ulu Jelai- Neggiri-Lebir-LILO transmission line has very low risk in term of landslides.

  11. Drug Treatment of Cancer Cell Lines: A Way to Select for Cancer Stem Cells?

    International Nuclear Information System (INIS)

    Chiodi, Ilaria; Belgiovine, Cristina; Donà, Francesca; Scovassi, A. Ivana; Mondello, Chiara

    2011-01-01

    Tumors are generally composed of different cell types. In recent years, it has been shown that in many types of cancers a subset of cells show peculiar characteristics, such as the ability to induce tumors when engrafted into host animals, self-renew and being immortal, and give rise to a differentiated progeny. These cells have been defined as cancer stem cells (CSCs) or tumor initiating cells. CSCs can be isolated both from tumor specimens and established cancer cell lines on the basis of their ability to exclude fluorescent dyes, express specific cell surface markers or grow in particular culture conditions. A key feature of CSCs is their resistance to chemotherapeutic agents, which could contribute to the remaining of residual cancer cells after therapeutic treatments. It has been shown that CSC-like cells can be isolated after drug treatment of cancer cell lines; in this review, we will describe the strategies so far applied to identify and isolate CSCs. Furthermore, we will discuss the possible use of these selected populations to investigate CSC biology and develop new anticancer drugs

  12. Selective cytotoxicity and modification activity of picornaviruses on transformed cell lines

    Directory of Open Access Journals (Sweden)

    Avagyan H. R.

    2011-10-01

    Full Text Available Aim. We do analyze of the dynamics of morphometabolic changes in transformed cells (of susceptoible lines demonstrating resistance to picrnaviral infection. Methods. The study was performed by application of cell culture technology and a complex of cytochemical and cytophotometric assays. Were used picornaviruses from various genu. Results. According to the results obtained, resistant to picornavirus infection cells of different susceptible lines have similar changes in the phenotype. They have decreased number of nucleoli and increased percentage of euploidy (and near euploid. In resistant cells of all cultures the reduction in amount of DNA and RNA both in nucleus and in cytoplasm was found. All these data correlated with the increased euploidy (and near euploid of the resistant population. All picornavirus resistant cells had a less transformed phenotype, and decreased proliferative activity. Decreased nucleolar status becomes apparent by reduction of all nucleolar indices. Conclusions. Picornaviruses on the susceptible cells produce 2 types of changes – selection and modification. Whatever the mechanism, it is specific for an individual virus, since no restrictions occur in case of infection caused by another picornavirus

  13. Selection of radioresistant cells by vitamin A deficiency in a small cell lung cancer cell line

    International Nuclear Information System (INIS)

    Terasaki, Takeo; Shimosato, Yukio; Wada, Makio; Yokota, Jun; Terada, Masaaki

    1990-01-01

    Radiation sensitivity of a human small cell lung cancer cell line, Lu-134-B cells, cultured in serum-supplemented medium and of cells transferred to and cultured in delipidized serum-supplemented (vitamin A-deficient) medium was studied. The cells cultured in serum-supplemented medium showed the phenotype of classic small cell lung cancer sensitive to radiation, while cells transferred to delipidized serum-supplemented medium showed partial squamous cell differentiation and became resistant to radiation. These results suggest that some small cell lung cancer cells in vitro change their morphology and radiosensitivity depending on the culture conditions. The change in radiosensitivity was reproducible, and was not reversible by culture of the radioresistant cells in delipidized serum-supplemented medium with addition of retinoic acid (vitamin A-sufficient medium) for two months, although squamous cells disappeared. Acquisition of radioresistancy was considered to occur as the result of clonal selective growth in delipidized medium of a minor cell population in the original cell culture, based on a study of chromosome number. It was also found that there was no association of myc-family oncogenes with the changes of radiosensitivity in this cell line. (author)

  14. WINDING METHOD SELECTION FOR TECHNICAL IMPLEMENTATION OF FIBER OPTIC COMMUNICATION LINE FOR HIGH-SPEED OBJECT

    Directory of Open Access Journals (Sweden)

    Vyacheslav A. Loparev

    2017-07-01

    Full Text Available The paper deals with fiber-optical cable winding methods for realization of fiber-optic communication line with high-speed object. We consider possible options of coils for optical cable winding providing mobility of one of the cable ends on an object. It is shown that the choice of a winding process is caused by the need of ensuring the minimum deformation of fiber-optical micro cable in case of separation from a winding body. It is revealed that the minimum tension value and its unevenness are observed when reeling from coils with a rocket form. Design ratios for determination of winding parameters are given. It is shown that reduction of tension unevenness reduces the jumps of internal tension and probability of break and emergence of optical signal local attenuation. Decrease in internal stresses occurs due to the absence of overlapping of the coils of the underlying layers with the overlying ones. To confirm the operability and the possibility of constructive implementation of the selected winding scheme, experiments were carried out to perform rocket and other types of winding with the use of a specially designed machine model. It is shown that the application of line rocket winding enables to achieve stability when reeling a cable during the movement and excludes breaks. Attenuation of optical signal decreases due to the increase in the bend minimum radius. This phenomenon is explained by reduction of the internal stresses causing optical signal attenuation in the place of cable separation from the coil.

  15. A chemically selective laser ion source for the on-line isotope separation

    International Nuclear Information System (INIS)

    Scheerer, F.

    1993-03-01

    In this thesis a laser ion source is presented. In a hot chamber the atoms of the elements to be studied are resonantly by light of pulsed dye lasers, which are pumped by pulsed copper-vapor lasers with extremely high pulse repetition rate (ν rep ∼ 10 kHz), stepwise excited and ionized. By the storage of the atoms in a hot chamber and the high pulse repetition rate of the copper-vapor lasers beyond the required high efficiency (ε ∼ 10%) can be reached. First preparing measurements were performed at the off-line separator at CERN with the rare earth elements ytterbium and thulium. Starting from the results of these measurements further tests of the laser ion source were performed at the on-line separator with in a thick tantalum target produced neutron-deficient ytterbium isotopes. Under application of a time-of-flight mass spectrometer in Mainz an efficient excitation scheme on the resonance ionization of tin was found. This excitation scheme is condition for an experiment at the GSI for the production of the extremely neutron-deficient, short-lived nucleus 102 Sn. In the summer 1993 is as first application of the newly developed laser ion source at the PSB-ISOLDE at CERN an astrophysically relevant experiment for the nuclear spectroscopy of the neutron-rich silver isotopes 124-129 Ag is planned. This experiment can because of the lacking selectivity of conventional ion sources only be performed by means of the here presented laser ion source. The laser ion source shall at the PSB-ISOLDE 1993 also be applied for the selective ionization of manganese. (orig./HSI) [de

  16. Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

    International Nuclear Information System (INIS)

    Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

    2005-01-01

    It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

  17. THE SEGREGATION PATTERN OF INSECT RESISTANCE GENES IN THE PROGENIES AND CROSSES OF TRANSGENIC ROJOLELE RICE

    Directory of Open Access Journals (Sweden)

    Satoto Satoto

    2016-10-01

    Full Text Available Successful application of genetic transformation technique, especially in developing rice variety resistant to brown plant hopper and stem borer, will depend on transgene being expressed and the gene inherited in a stable and predictable manner. This study aimed to analyse transgene segregation pattern of the progenies and the crosses of transgenic rice cv. Rojolele harboring cry1Ab and gna genes. The third generation (T2 of fivetransgenic Rojolele events containing gna and/or cry1Ab were evaluated for two generations to identify the homozygous lines and to study their inheritance. The homozygous lines were selected based on the result of PCR technique. The segregation patterns of gna and cry1Ab were studied in eight F2 populations derived from Rojolele x transgenic Rojolele homozygous for cry1Ab and or gna and their reciprocal crosses. Data  resulted from PCR of F2 population were analysed using a Chi Square test. The study obtained six homozygous lines for gna, namely A22- 1-32, A22-1-37, C72-1-9, F11-1-48, K21-1-39, K21-1-48, and two homozygous lines for cry1Ab, namely K21-1-39 and K21- 1-48. Both cry1Ab and gna transgenes had been inherited through selfing and crossing with their wild type as indicated from the F1 containing gna and cry1Ab as many as 48.4% and 47.4%, respectively. In six of the eight crosses, gna was inherited in a 3:1 ratio consistent with Mendelian inheritance of a single dominant locus, while in the remaining two crosses, gna was segregated in a 1:1 ratio. The presence of cry1Ab in F2 populations also showed a 3:1 segregation ratio in all crosses. In the F2 population derived from F1 plant containing cry1Ab and gna, both transgenes segregated in a 9:3:3:1 dihybrid segregation ratio. This study will add to the diversity of genetic sources for insect resistance and allow further use of these transgenic lines for pyramiding resistance to brown plant hopper and stem borer or  separately in rice breeding programs whenever

  18. Competitive performance of transgenic wheat resistant to powdery mildew.

    Directory of Open Access Journals (Sweden)

    Olena Kalinina

    Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

  19. Temperature dependency of cupular mechanics and hair cell frequency selectivity in the fish canal lateral line organ

    NARCIS (Netherlands)

    Wiersinga-Post, JEC; van Netten, SM

    2000-01-01

    The mechanical frequency selectivity of the cupula located in the supraorbital lateral line canal and the frequency selectivity of the hair cells driven by the cupula were measured simultaneously in vivo. Laser interferometry was used to measure cupular mechanics and extracellular receptor

  20. 49 CFR 542.2 - Procedures for selecting low theft light duty truck lines with a majority of major parts...

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 6 2010-10-01 2010-10-01 false Procedures for selecting low theft light duty... TRUCK LINES TO BE COVERED BY THE THEFT PREVENTION STANDARD § 542.2 Procedures for selecting low theft... a low theft rate have major parts interchangeable with a majority of the covered major parts of a...

  1. Laser-induced Breakdown spectroscopy quantitative analysis method via adaptive analytical line selection and relevance vector machine regression model

    International Nuclear Information System (INIS)

    Yang, Jianhong; Yi, Cancan; Xu, Jinwu; Ma, Xianghong

    2015-01-01

    A new LIBS quantitative analysis method based on analytical line adaptive selection and Relevance Vector Machine (RVM) regression model is proposed. First, a scheme of adaptively selecting analytical line is put forward in order to overcome the drawback of high dependency on a priori knowledge. The candidate analytical lines are automatically selected based on the built-in characteristics of spectral lines, such as spectral intensity, wavelength and width at half height. The analytical lines which will be used as input variables of regression model are determined adaptively according to the samples for both training and testing. Second, an LIBS quantitative analysis method based on RVM is presented. The intensities of analytical lines and the elemental concentrations of certified standard samples are used to train the RVM regression model. The predicted elemental concentration analysis results will be given with a form of confidence interval of probabilistic distribution, which is helpful for evaluating the uncertainness contained in the measured spectra. Chromium concentration analysis experiments of 23 certified standard high-alloy steel samples have been carried out. The multiple correlation coefficient of the prediction was up to 98.85%, and the average relative error of the prediction was 4.01%. The experiment results showed that the proposed LIBS quantitative analysis method achieved better prediction accuracy and better modeling robustness compared with the methods based on partial least squares regression, artificial neural network and standard support vector machine. - Highlights: • Both training and testing samples are considered for analytical lines selection. • The analytical lines are auto-selected based on the built-in characteristics of spectral lines. • The new method can achieve better prediction accuracy and modeling robustness. • Model predictions are given with confidence interval of probabilistic distribution

  2. Regulation of metabolism by dietary carbohydrates in two lines of rainbow trout divergently selected for muscle fat content.

    Science.gov (United States)

    Kamalam, Biju Sam; Medale, Françoise; Kaushik, Sadasivam; Polakof, Sergio; Skiba-Cassy, Sandrine; Panserat, Stephane

    2012-08-01

    Previous studies in two rainbow trout lines divergently selected for lean (L) or fat (F) muscle suggested that they differ in their ability to metabolise glucose. In this context, we investigated whether genetic selection for high muscle fat content led to a better capacity to metabolise dietary carbohydrates. Juvenile trout from the two lines were fed diets with or without gelatinised starch (17.1%) for 10 weeks, after which blood, liver, muscle and adipose tissues were sampled. Growth rate, feed efficiency and protein utilisation were lower in the F line than in the L line. In both lines, intake of carbohydrates was associated with a moderate post-prandial hyperglycaemia, a protein sparing effect, an enhancement of nutrient (TOR-S6) signalling cascade and a decrease of energy-sensing enzyme (AMPK). Gene expression of hepatic glycolytic enzymes was higher in the F line fed carbohydrates compared with the L line, but concurrently transcripts for the gluconeogenic enzymes was also higher in the F line, possibly impairing glucose homeostasis. However, the F line showed a higher gene expression of hepatic enzymes involved in lipogenesis and fatty acid bioconversion, in particular with an increased dietary carbohydrate intake. Enhanced lipogenic potential coupled with higher liver glycogen content in the F line suggests better glucose storage ability than the L line. Overall, the present study demonstrates the changes in hepatic intermediary metabolism resulting from genetic selection for high muscle fat content and dietary carbohydrate intake without, however, any interaction for an improved growth or glucose utilisation in the peripheral tissues.

  3. Genomic selection of crossing partners on basis of the expected mean and variance of their derived lines.

    Science.gov (United States)

    Osthushenrich, Tanja; Frisch, Matthias; Herzog, Eva

    2017-01-01

    In a line or a hybrid breeding program superior lines are selected from a breeding pool as parental lines for the next breeding cycle. From a cross of two parental lines, new lines are derived by single-seed descent (SSD) or doubled haploid (DH) technology. However, not all possible crosses between the parental lines can be carried out due to limited resources. Our objectives were to present formulas to characterize a cross by the mean and variance of the genotypic values of the lines derived from the cross, and to apply the formulas to predict means and variances of flowering time traits in recombinant inbred line families of a publicly available data set in maize. We derived formulas which are based on the expected linkage disequilibrium (LD) between two loci and which can be used for arbitrary mating systems. Results were worked out for SSD and DH lines derived from a cross after an arbitrary number of intermating generations. The means and variances were highly correlated with results obtained by the simulation software PopVar. Compared with these simulations, computation time for our closed formulas was about ten times faster. The means and variances for flowering time traits observed in the recombinant inbred line families of the investigated data set showed correlations of around 0.9 for the means and of 0.46 and 0.65 for the standard deviations with the estimated values. We conclude that our results provide a framework that can be exploited to increase the efficiency of hybrid and line breeding programs by extending genomic selection approaches to the selection of crossing partners.

  4. Genomic selection of crossing partners on basis of the expected mean and variance of their derived lines

    Science.gov (United States)

    Osthushenrich, Tanja; Frisch, Matthias

    2017-01-01

    In a line or a hybrid breeding program superior lines are selected from a breeding pool as parental lines for the next breeding cycle. From a cross of two parental lines, new lines are derived by single-seed descent (SSD) or doubled haploid (DH) technology. However, not all possible crosses between the parental lines can be carried out due to limited resources. Our objectives were to present formulas to characterize a cross by the mean and variance of the genotypic values of the lines derived from the cross, and to apply the formulas to predict means and variances of flowering time traits in recombinant inbred line families of a publicly available data set in maize. We derived formulas which are based on the expected linkage disequilibrium (LD) between two loci and which can be used for arbitrary mating systems. Results were worked out for SSD and DH lines derived from a cross after an arbitrary number of intermating generations. The means and variances were highly correlated with results obtained by the simulation software PopVar. Compared with these simulations, computation time for our closed formulas was about ten times faster. The means and variances for flowering time traits observed in the recombinant inbred line families of the investigated data set showed correlations of around 0.9 for the means and of 0.46 and 0.65 for the standard deviations with the estimated values. We conclude that our results provide a framework that can be exploited to increase the efficiency of hybrid and line breeding programs by extending genomic selection approaches to the selection of crossing partners. PMID:29200436

  5. Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

    DEFF Research Database (Denmark)

    Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

    2012-01-01

    Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

  6. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    Science.gov (United States)

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  7. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  8. A phenome database (NEAUHLFPD) designed and constructed for broiler lines divergently selected for abdominal fat content.

    Science.gov (United States)

    Li, Min; Dong, Xiang-yu; Liang, Hao; Leng, Li; Zhang, Hui; Wang, Shou-zhi; Li, Hui; Du, Zhi-Qiang

    2017-05-20

    Effective management and analysis of precisely recorded phenotypic traits are important components of the selection and breeding of superior livestocks. Over two decades, we divergently selected chicken lines for abdominal fat content at Northeast Agricultural University (Northeast Agricultural University High and Low Fat, NEAUHLF), and collected large volume of phenotypic data related to the investigation on molecular genetic basis of adipose tissue deposition in broilers. To effectively and systematically store, manage and analyze phenotypic data, we built the NEAUHLF Phenome Database (NEAUHLFPD). NEAUHLFPD included the following phenotypic records: pedigree (generations 1-19) and 29 phenotypes, such as body sizes and weights, carcass traits and their corresponding rates. The design and construction strategy of NEAUHLFPD were executed as follows: (1) Framework design. We used Apache as our web server, MySQL and Navicat as database management tools, and PHP as the HTML-embedded language to create dynamic interactive website. (2) Structural components. On the main interface, detailed introduction on the composition, function, and the index buttons of the basic structure of the database could be found. The functional modules of NEAUHLFPD had two main components: the first module referred to the physical storage space for phenotypic data, in which functional manipulation on data can be realized, such as data indexing, filtering, range-setting, searching, etc.; the second module related to the calculation of basic descriptive statistics, where data filtered from the database can be used for the computation of basic statistical parameters and the simultaneous conditional sorting. NEAUHLFPD could be used to effectively store and manage not only phenotypic, but also genotypic and genomics data, which can facilitate further investigation on the molecular genetic basis of chicken adipose tissue growth and development, and expedite the selection and breeding of broilers

  9. Selective expression of myosin IC Isoform A in mouse and human cell lines and mouse prostate cancer tissues.

    Directory of Open Access Journals (Sweden)

    Ivanna Ihnatovych

    Full Text Available Myosin IC is a single headed member of the myosin superfamily. We recently identified a novel isoform and showed that the MYOIC gene in mammalian cells encodes three isoforms (isoforms A, B, and C. Furthermore, we demonstrated that myosin IC isoform A but not isoform B exhibits a tissue specific expression pattern. In this study, we extended our analysis of myosin IC isoform expression patterns by analyzing the protein and mRNA expression in various mammalian cell lines and in various prostate specimens and tumor tissues from the transgenic mouse prostate (TRAMP model by immunoblotting, qRT-PCR, and by indirect immunohistochemical staining of paraffin embedded prostate specimen. Analysis of a panel of mammalian cell lines showed an increased mRNA and protein expression of specifically myosin IC isoform A in a panel of human and mouse prostate cancer cell lines but not in non-cancer prostate or other (non-prostate- cancer cell lines. Furthermore, we demonstrate that myosin IC isoform A expression is significantly increased in TRAMP mouse prostate samples with prostatic intraepithelial neoplasia (PIN lesions and in distant site metastases in lung and liver when compared to matched normal tissues. Our observations demonstrate specific changes in the expression of myosin IC isoform A that are concurrent with the occurrence of prostate cancer in the TRAMP mouse prostate cancer model that closely mimics clinical prostate cancer. These data suggest that elevated levels of myosin IC isoform A may be a potential marker for the detection of prostate cancer.

  10. A transgenic mouse model for trilateral retinoblastoma

    NARCIS (Netherlands)

    O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.

    1990-01-01

    We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically

  11. Selective removal of heavy metals from metal-bearing wastewater in a cascade line reactor.

    Science.gov (United States)

    Pavlović, Jelena; Stopić, Srećko; Friedrich, Bernd; Kamberović, Zeljko

    2007-11-01

    This paper is a part of the research work on 'Integrated treatment of industrial wastes towards prevention of regional water resources contamination - INTREAT' the project. It addresses the environmental pollution problems associated with solid and liquid waste/effluents produced by sulfide ore mining and metallurgical activities in the Copper Mining and Smelting Complex Bor (RTB-BOR), Serbia. However, since the minimum solubility for the different metals usually found in the polluted water occurs at different pH values and the hydroxide precipitates are amphoteric in nature, selective removal of mixed metals could be achieved as the multiple stage precipitation. For this reason, acid mine water had to be treated in multiple stages in a continuous precipitation system-cascade line reactor. All experiments were performed using synthetic metal-bearing effluent with chemical a composition similar to the effluent from open pit, Copper Mining and Smelting Complex Bor (RTB-BOR). That effluent is characterized by low pH (1.78) due to the content of sulfuric acid and heavy metals, such as Cu, Fe, Ni, Mn, Zn with concentrations of 76.680, 26.130, 0.113, 11.490, 1.020 mg/dm3, respectively. The cascade line reactor is equipped with the following components: for feeding of effluents, for injection of the precipitation agent, for pH measurements and control, and for removal of the process gases. The precipitation agent was 1M NaOH. In each of the three reactors, a changing of pH and temperature was observed. In order to verify. efficiency of heavy metals removal, chemical analyses of samples taken at different pH was done using AES-ICP. Consumption of NaOH in reactors was 370 cm3, 40 cm3 and 80 cm3, respectively. Total time of the experiment was 4 h including feeding of the first reactor. The time necessary to achieve the defined pH value was 25 min for the first reactor and 13 min for both second and third reactors. Taking into account the complete process in the cascade line

  12. Measurement-Based Transmission Line Parameter Estimation with Adaptive Data Selection Scheme

    DEFF Research Database (Denmark)

    Li, Changgang; Zhang, Yaping; Zhang, Hengxu

    2017-01-01

    Accurate parameters of transmission lines are critical for power system operation and control decision making. Transmission line parameter estimation based on measured data is an effective way to enhance the validity of the parameters. This paper proposes a multi-point transmission line parameter...

  13. The spatial intensity distribution of selected emission lines for Herbig-Haro 1 - Comparison between theory and observations

    International Nuclear Information System (INIS)

    Noriega-Crespo, A.; Bohm, K.H.; Raga, A.C.

    1989-01-01

    In this paper, it is shown that most of the spatial intensity distribution of 11 selected emission lines for Herbig-Haro 1 (including the forbidden S II emission lines at 6731 A and 4069 A, the forbidden O III line at 5007 A, and the forbidden O II line at 3727 A) can be explained by a bow shock with a shock velocity of about 150-200 km/sec at the stagnation point, and under the assumption that the gas entering the shock is fully preionized. The results are based on three spectrograms (with a total exposure time of 180 min) obtained consecutively. Specifically, the ratios of each of the forbidden lines to H-alpha were studied, which permitted a critical test of the model. The agreement between the theoretical predictions and the observations was found to be remarkable, considering the complex geometry that a bow shock could have. 38 refs

  14. Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

    Science.gov (United States)

    Nocarova, Eva; Fischer, Lukas

    2009-04-22

    Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

  15. Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

    International Nuclear Information System (INIS)

    Ahmad, R.; Hussain, J.

    2014-01-01

    Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

  16. Selective excitation of singly-ionized silver emission lines by Grimm glow discharge plasmas using several different plasma gases

    International Nuclear Information System (INIS)

    Wagatsuma, K.

    1996-01-01

    The relative intensities of silver emission lines from Grimm glow discharge plasmas were investigated in the wavelength range from 160 to 600 nm when using different plasma gases. It was characteristic of the plasma excitation that the spectral patterns were strongly dependent on the nature of the plasma gas employed. Intense emission lines of silver ion were observed when argon-helium mixed gases were employed as the plasma gas. Selective excitation of the ionic lines could be principally attributed to the charge transfer collisions between silver atoms and helium ions. (orig.)

  17. Development of technique on the induction and selection of in vitro mutant lines (Potato, Solanum tuberosum L.)

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Jang Ryoel; Lee, Yeong Il; Song, Hee Seop; Kim, Jae Seong; Sin, In Cheol; Lee, Sang Jae; Lee, Ki Un; Lim, Yong Taek [Korea Atomic Energy Res. Inst., Taejon (Korea, Republic of)

    1993-09-01

    For the development of the technique on the plant tissue culture and application of nuclear technique in the in vitro mutation breeding, present research laid emphasis on the development of techniques of potato tissue culture, and on the induction and selection of radiation mutation. Another culture for haploid induction, optimum radiation dosage for cybrid formation of potato and mutation induction from in vitro cultured microtuber and plantlets were investigated for modelling the technique on the induction and selection of in vitro mutant lines. Inheritance stability of the selected mutants were also studied in field condition. In vitro system of micropropagation and selection of mutation was summarized.

  18. Development of technique on the induction and selection of in vitro mutant lines (Potato, Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    Yoo, Jang Ryoel; Lee, Yeong Il; Song, Hee Seop; Kim, Jae Seong; Sin, In Cheol; Lee, Sang Jae; Lee, Ki Un; Lim, Yong Taek

    1993-09-01

    For the development of the technique on the plant tissue culture and application of nuclear technique in the in vitro mutation breeding, present research laid emphasis on the development of techniques of potato tissue culture, and on the induction and selection of radiation mutation. Another culture for haploid induction, optimum radiation dosage for cybrid formation of potato and mutation induction from in vitro cultured microtuber and plantlets were investigated for modelling the technique on the induction and selection of in vitro mutant lines. Inheritance stability of the selected mutants were also studied in field condition. In vitro system of micropropagation and selection of mutation was summarized

  19. Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru

    2016-10-01

    Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding.

  20. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  1. Selection of Novel Peptides Homing the 4T1 CELL Line: Exploring Alternative Targets for Triple Negative Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Vera L Silva

    Full Text Available The use of bacteriophages to select novel ligands has been widely explored for cancer therapy. Their application is most warranted in cancer subtypes lacking knowledge on how to target the cancer cells in question, such as the triple negative breast cancer, eventually leading to the development of alternative nanomedicines for cancer therapeutics. Therefore, the following study aimed to select and characterize novel peptides for a triple negative breast cancer murine mammary carcinoma cell line- 4T1. Using phage display, 7 and 12 amino acid random peptide libraries were screened against the 4T1 cell line. A total of four rounds, plus a counter-selection round using the 3T3 murine fibroblast cell line, was performed. The enriched selective peptides were characterized and their binding capacity towards 4T1 tissue samples was confirmed by immunofluorescence and flow cytometry analysis. The selected peptides (4T1pep1 -CPTASNTSC and 4T1pep2-EVQSSKFPAHVS were enriched over few rounds of selection and exhibited specific binding to the 4T1 cell line. Interestingly, affinity to the human MDA-MB-231 cell line was also observed for both peptides, promoting the translational application of these novel ligands between species. Additionally, bioinformatics analysis suggested that both peptides target human Mucin-16. This protein has been implicated in different types of cancer, as it is involved in many important cellular functions. This study strongly supports the need of finding alternative targeting systems for TNBC and the peptides herein selected exhibit promising future application as novel homing peptides for breast cancer therapy.

  2. Genome-wide characterization of genetic variants and putative regions under selection in meat and egg-type chicken lines.

    Science.gov (United States)

    Boschiero, Clarissa; Moreira, Gabriel Costa Monteiro; Gheyas, Almas Ara; Godoy, Thaís Fernanda; Gasparin, Gustavo; Mariani, Pilar Drummond Sampaio Corrêa; Paduan, Marcela; Cesar, Aline Silva Mello; Ledur, Mônica Corrêa; Coutinho, Luiz Lehmann

    2018-01-25

    Meat and egg-type chickens have been selected for several generations for different traits. Artificial and natural selection for different phenotypes can change frequency of genetic variants, leaving particular genomic footprints throghtout the genome. Thus, the aims of this study were to sequence 28 chickens from two Brazilian lines (meat and white egg-type) and use this information to characterize genome-wide genetic variations, identify putative regions under selection using Fst method, and find putative pathways under selection. A total of 13.93 million SNPs and 1.36 million INDELs were identified, with more variants detected from the broiler (meat-type) line. Although most were located in non-coding regions, we identified 7255 intolerant non-synonymous SNPs, 512 stopgain/loss SNPs, 1381 frameshift and 1094 non-frameshift INDELs that may alter protein functions. Genes harboring intolerant non-synonymous SNPs affected metabolic pathways related mainly to reproduction and endocrine systems in the white-egg layer line, and lipid metabolism and metabolic diseases in the broiler line. Fst analysis in sliding windows, using SNPs and INDELs separately, identified over 300 putative regions of selection overlapping with more than 250 genes. For the first time in chicken, INDEL variants were considered for selection signature analysis, showing high level of correlation in results between SNP and INDEL data. The putative regions of selection signatures revealed interesting candidate genes and pathways related to important phenotypic traits in chicken, such as lipid metabolism, growth, reproduction, and cardiac development. In this study, Fst method was applied to identify high confidence putative regions under selection, providing novel insights into selection footprints that can help elucidate the functional mechanisms underlying different phenotypic traits relevant to meat and egg-type chicken lines. In addition, we generated a large catalog of line-specific and common

  3. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  4. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  5. Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield.

    Science.gov (United States)

    Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

    2017-08-30

    RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3 , a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA- HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing ds HaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera . Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls.

  6. Intrathymic selection of NK1.1+α/β T cell antigen receptor (TCR)+ cells in transgenic mice bearing TCR specific for chicken ovalbumin and restricted to I-Ad

    OpenAIRE

    Iwabuchi, Chikako; Iwabuchi, Kazuya; Nakagawa, Ken-ichi; Takayanagi, Toshiaki; Nishihori, Hiroki; Tone, Saori; Ogasawara, Kazumasa; Good, Robert A.; Onoé, Kazunori

    1998-01-01

    Generation and negative selection of NK1.1+α/β T cell receptor (TCR)+ thymocytes were analyzed using TCR-transgenic (B10.D2 × DO10)F1 and (C57BL/6 × DO10)F1 mice and Rag-1−/−/DO10 mice, which had been established by breeding and backcrossing between Rag-1−/− and DO10 mice. Almost all T cells from these mice were shown to bear Vα13/Vβ8.2 that is specific for chicken ovalbumin (cOVA) and restricted to I-Ad. A normal proportion of the NK1.1+ Vα13/Vβ8.2+ thymocytes was generated in these mice. Ho...

  7. N-Linked Glycosylation is an Important Parameter for Optimal Selection of Cell Lines Producing Biopharmaceutical Human IgG

    NARCIS (Netherlands)

    van Berkel, Patrick H. C.; Gerritsen, Jolanda; Perdok, Gerrard; Valbjorn, Jesper; Vink, Tom; van de Winkel, Jan G. J.; Parren, Paul W. H. I.

    2009-01-01

    We studied the variations in N-linked glycosylation of human IgG molecules derived from 105 different stable cell lines each expressing one of the six different antibodies. Antibody expression was based on glutamine synthetase selection technology in suspension growing CHO-KISV cells. The glycans

  8. Development of technique on the induction and selection of in vitro mutant lines(Potato, Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    Hong, Joo Bong; Lee, Young Il; Song, Hee Sup; Kim, Jae Sung; Byun, Myung Woo; Lee, Young Keun; Shin, In Chul; Lee, Sang Jae; Lee, Ki Woon; Lim, Yong Taek

    1992-08-01

    The radiosensitivity and salt resistance on the single cell and callus of potato, mass production method of plantlet and microtuber of potato by in vitro culture and microtuber formation from the stem irradiated with radiation were investigated to obtain a optimum condition for selection of mutant cell line. (Author)

  9. 49 CFR Appendix C to Part 541 - Criteria for Selecting Light Duty Truck Lines Likely To Have High Theft Rates

    Science.gov (United States)

    2010-10-01

    ... Likely To Have High Theft Rates C Appendix C to Part 541 Transportation Other Regulations Relating to... MOTOR VEHICLE THEFT PREVENTION STANDARD Pt. 541, App. C Appendix C to Part 541—Criteria for Selecting Light Duty Truck Lines Likely To Have High Theft Rates Scope These criteria specify the factors the...

  10. Recombinant protein production from stable mammalian cell lines and pools.

    Science.gov (United States)

    Hacker, David L; Balasubramanian, Sowmya

    2016-06-01

    We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  12. Optimization of temperature-programmed GC separations. II. Off-line simplex optimization and column selection

    NARCIS (Netherlands)

    Snijders, H.M.J.; Janssen, J.G.M.; Cramers, C.A.M.G.; Sandra, P; Bertsch, W.; Sandra, P.; Devos, G.

    1996-01-01

    In this work a method is described which allows off-line optimization of temperature programmed GC separations. Recently, we described a new numerical method to predict off-line retention times and peak widths of a mixture containing components with known identities in capillary GC. In the present

  13. Selection of wheat lines with resistance to Fusarium graminearum by somaclonal variation

    International Nuclear Information System (INIS)

    Sun Guangzu

    1997-10-01

    The screening wheat new lines which have the resistance to Fusarium graminearum were completed by in vitro induced mutation and cell screening. Four new lines with resistance to Fusarium graminearum were obtained. The field inoculating determination in 1990∼1996 showed that their resistance was 1∼2 degree higher than that of parents, and there were variations in main agronomic traits between the new lines and their parents. Changes of the defensive enzymes (SOD, POD), sugar-protein on cell surface, and ultrastructure were investigated by using new lines and their parents under the action of toxin of Fusarium graminearum. The new lines under the action of toxin of Fusarium graminearum have the ability to increase the defensive enzyme activity and thickness of sugarprotein on cell surface and to reduce the damage of cell membrane system that would result in resistance increasing. (8 refs., 3 figs., 3 tabs.)

  14. Expression of a cystatin transgene in eggplant provides resistance to root-knot nematode, Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Pradeep Kumar Papolu

    2016-07-01

    Full Text Available Root-knot nematodes (RKN cause substantial yield decline in eggplant and sustainable management options to minimize crop damage due to nematodes are still limited. A number of genetic engineering strategies have been developed to disrupt the successful plant-nematode interactions. Among them, delivery of proteinase inhibitors from the plant to perturb nematode development and reproduction is arguably the most effective strategy. In the present study, transgenic eggplant expressing a modified rice cystatin (OC-IΔD86 gene under the control of the root-specific promoter, TUB-1, was generated to evaluate the genetically modified nematode resistance. Five putative transformants were selected through PCR and genomic Southern blot analysis. Expression of the cystatin transgene was confirmed in all the events using western blotting, ELISA and qPCR assay. Upon challenge inoculation, all the transgenic events exhibited a detrimental effect on RKN development and reproduction. The best transgenic line (a single copy event showed 78.3% inhibition in reproductive success of RKN. Our results suggest that cystatins can play an important role for improving nematode resistance in eggplant and their deployment in gene pyramiding strategies with other proteinase inhibitors could ultimately enhance crop yield.

  15. Transgenic rice expressing a codon-modified synthetic CP4-EPSPS confers tolerance to broad-spectrum herbicide, glyphosate.

    Science.gov (United States)

    Chhapekar, Sushil; Raghavendrarao, Sanagala; Pavan, Gadamchetty; Ramakrishna, Chopperla; Singh, Vivek Kumar; Phanindra, Mullapudi Lakshmi Venkata; Dhandapani, Gurusamy; Sreevathsa, Rohini; Ananda Kumar, Polumetla

    2015-05-01

    Highly tolerant herbicide-resistant transgenic rice was developed by expressing codon-modified synthetic CP4--EPSPS. The transformants could tolerate up to 1% commercial glyphosate and has the potential to be used for DSR (direct-seeded rice). Weed infestation is one of the major biotic stress factors that is responsible for yield loss in direct-seeded rice (DSR). Herbicide-resistant rice has potential to improve the efficiency of weed management under DSR. Hence, the popular indica rice cultivar IR64, was genetically modified using Agrobacterium-mediated transformation with a codon-optimized CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene, with N-terminal chloroplast targeting peptide from Petunia hybrida. Integration of the transgenes in the selected rice plants was confirmed by Southern hybridization and expression by Northern and herbicide tolerance assays. Transgenic plants showed EPSPS enzyme activity even at high concentrations of glyphosate, compared to untransformed control plants. T0, T1 and T2 lines were tested by herbicide bioassay and it was confirmed that the transgenic rice could tolerate up to 1% of commercial Roundup, which is five times more in dose used to kill weeds under field condition. All together, the transgenic rice plants developed in the present study could be used efficiently to overcome weed menace.

  16. Effective selection criteria for screening drought tolerant recombinant inbred lines of sunflower

    Directory of Open Access Journals (Sweden)

    Abdi Nishtman

    2013-01-01

    Full Text Available In this study, seventy two sunflower recombinant inbred lines were tested for their yielding ability under both water-stressed and well-watered states. The inbred lines were evaluated in a rectangular 8´9 lattice design with two replications in both well-watered and water-stressed conditions, separately. Eight drought tolerance indices including stability tolerance index (STI, mean productivity (MP, geometric mean productivity (GMP, harmonic mean (HM, stress susceptibility index (SSI, tolerance index (TOL, yield index (YI and yield stability index (YSI were calculated based on grain yield for every genotype. Results showed the highest values of mean productivity (MP index, geometric mean productivity (GMP, yield index (YI, harmonic mean (HM and stress tolerance index (STI indices for ‘C134a’ inbred line and least values of stress susceptibility index (SSI and tolerance (TOL for C61 inbred line. According to correlation of indices with yield performance under both drought stress and non-stress states and principle component analysis, indices including HM, MP, GMP and STI could properly distinguish drought tolerant sunflower inbred lines with high yield performance under both states. Cluster analysis of inbred lines using Ys, Yp and eight indices, categorized them into four groups including 19, 6, 26 and 19 inbred lines.

  17. [Selected enhancement of different order stokes lines of SRS by using fluorescence of mixed dye solution].

    Science.gov (United States)

    Zuo, Hao-yi; Gao, Jie; Yang, Jing-guo

    2007-03-01

    A new method to enhance the intensity of the different orders of Stokes lines of SRS by using mixed dye fluorescence is reported. The Stokes lines from the second-order to the fifth-order of CCl4 were enhanced by the fluorescence of mixed R6G and RB solutions in different proportions of 20:2, 20:13 and 20:40 (R6g:Rb), respectively. It is considered that the Stokes lines from the second-order to the fifth-order are near the fluorescence peaks of the three mixed solutions, and far from the absorption peaks of R6g and Rb, so the enhancement effect dominates the absorption effect; as a result, these stokes lines are enhanced. On the contrary, the first-order stokes line is near the absorption peak of RB and far from the fluorescence peaks of the mixed solutions, which leads to the weakening of this stokes line. It is also reported that the first-order, the second-order and the third-order Stokes lines of benzene were enhanced by the fluorescence of mixed solutions of R6g and DCM with of different proportions. The potential application of this method is forecasted.

  18. Cytokines Expression and Nitric Oxide Production under Induced Infection to Typhimurium in Chicken Lines Divergently Selected for Cutaneous Hypersensitivity

    Directory of Open Access Journals (Sweden)

    Rani Singh

    2012-07-01

    Full Text Available In the present study, the impact of Salmonella Typhimurium on cell-mediated immunity (CMI was investigated in 5 week-old immuno divergent broiler lines selected for the high and low response to phytohemagglutinin-P. The immune response was assessed in peripheral-blood mononuclear cells (PBMCs induced with Salmonella Typhimurium at different time intervals (0 h, 0.5 h, 2 h, 4 h, 6 h, 12 h and 24 h. The differential mRNA expression patterns of IFN-γ, IL-2 and iNOS were evaluated by quantitative real time PCR. In-vitro production of nitric oxide (NO was also estimated in the culture supernatant and correlated with iNOS mRNA expression. Present study showed higher production of NO in the high cell-mediated line (HCMI as compared to the low cell-mediated line (LCMI upon stimulation with Salmonella Typhimurium. Correspondingly, higher mRNA expression of iNOS and IFN-γ were observed in high response birds (HCMI; but IL-2 was down regulated in this line compared to the low response birds (LCMI. Significantly (p<0.05 higher expression of iNOS, IFN-γ and higher production of NO in high line indicated that the selection for PHA-P response might be employed for increasing the immune competence against Salmonella Typhimurium in chicken flocks.

  19. The Lyman Continuum Escape Fraction of Emission Line-selected z ∼ 2.5 Galaxies Is Less Than 15%

    Energy Technology Data Exchange (ETDEWEB)

    Rutkowski, Michael J.; Hayes, Matthew [Department of Astronomy, AlbaNova University Centre, Stockholm University, SE-10691 Stockholm (Sweden); Scarlata, Claudia; Mehta, Vihang [Minnesota Institute for Astrophysics, University of Minnesota, 116 Church Street SE, Minneapolis, MN 55455 (United States); Henry, Alaina; Hathi, Nimish; Koekemoer, Anton M. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Cohen, Seth; Windhorst, Rogier [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85281 (United States); Teplitz, Harry I. [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Haardt, Francesco [DiSAT, Università dellInsubria, via Valleggio 11, I-22100 Como (Italy); Siana, Brian [Department of Physics, University of California, Riverside, CA 92521 (United States)

    2017-06-01

    Recent work suggests that strong emission line, star-forming galaxies (SFGs) may be significant Lyman continuum leakers. We combine archival Hubble Space Telescope broadband ultraviolet and optical imaging (F275W and F606W, respectively) with emission line catalogs derived from WFC3 IR G141 grism spectroscopy to search for escaping Lyman continuum (LyC) emission from homogeneously selected z ∼ 2.5 SFGs. We detect no escaping Lyman continuum from SFGs selected on [O ii] nebular emission ( N = 208) and, within a narrow redshift range, on [O iii]/[O ii]. We measure 1 σ upper limits to the LyC escape fraction relative to the non-ionizing UV continuum from [O ii] emitters, f {sub esc} ≲ 5.6%, and strong [O iii]/[O ii] > 5 ELGs, f {sub esc} ≲ 14.0%. Our observations are not deep enough to detect f {sub esc} ∼ 10% typical of low-redshift Lyman continuum emitters. However, we find that this population represents a small fraction of the star-forming galaxy population at z ∼ 2. Thus, unless the number of extreme emission line galaxies grows substantially to z ≳ 6, such galaxies may be insufficient for reionization. Deeper survey data in the rest-frame ionizing UV will be necessary to determine whether strong line ratios could be useful for pre-selecting LyC leakers at high redshift.

  20. The Lyman Continuum Escape Fraction of Emission Line-selected z ∼ 2.5 Galaxies Is Less Than 15%

    International Nuclear Information System (INIS)

    Rutkowski, Michael J.; Hayes, Matthew; Scarlata, Claudia; Mehta, Vihang; Henry, Alaina; Hathi, Nimish; Koekemoer, Anton M.; Cohen, Seth; Windhorst, Rogier; Teplitz, Harry I.; Haardt, Francesco; Siana, Brian

    2017-01-01

    Recent work suggests that strong emission line, star-forming galaxies (SFGs) may be significant Lyman continuum leakers. We combine archival Hubble Space Telescope broadband ultraviolet and optical imaging (F275W and F606W, respectively) with emission line catalogs derived from WFC3 IR G141 grism spectroscopy to search for escaping Lyman continuum (LyC) emission from homogeneously selected z ∼ 2.5 SFGs. We detect no escaping Lyman continuum from SFGs selected on [O ii] nebular emission ( N = 208) and, within a narrow redshift range, on [O iii]/[O ii]. We measure 1 σ upper limits to the LyC escape fraction relative to the non-ionizing UV continuum from [O ii] emitters, f _e_s_c ≲ 5.6%, and strong [O iii]/[O ii] > 5 ELGs, f _e_s_c ≲ 14.0%. Our observations are not deep enough to detect f _e_s_c ∼ 10% typical of low-redshift Lyman continuum emitters. However, we find that this population represents a small fraction of the star-forming galaxy population at z ∼ 2. Thus, unless the number of extreme emission line galaxies grows substantially to z ≳ 6, such galaxies may be insufficient for reionization. Deeper survey data in the rest-frame ionizing UV will be necessary to determine whether strong line ratios could be useful for pre-selecting LyC leakers at high redshift.

  1. Data compression can discriminate broilers by selection line, detect haplotypes, and estimate genetic potential for complex phenotypes.

    Science.gov (United States)

    Hudson, N J; Hawken, R J; Okimoto, R; Sapp, R L; Reverter, A

    2017-09-01

    Accurately establishing the relationships among individuals lays the foundation for genetic analyses such as genome-wide association studies and identification of selection signatures. Of particular interest to the poultry industry are estimates of genetic merit based on molecular data. These estimates can be commercially exploited in marker-assisted breeding programs to accelerate genetic improvement. Here, we test the utility of a new method we have recently developed to estimate animal relatedness and applied it to genetic parameter estimation in commercial broilers. Our approach is based on the concept of data compression from information theory. Using the real-world compressor gzip to estimate normalized compression distance (NCD) we have built compression-based relationship matrices (CRM) for 988 chickens from 4 commercial broiler lines-2 male and 2 female lines. For all pairs of individuals, we found a strong negative relationship between the commonly used genomic relationship matrix (GRM) and NCD. This reflects the fact that "similarity" is the inverse of "distance." The CRM explained more genetic variation than the corresponding GRM in 2 of 3 phenotypes, with corresponding improvements in accuracy of genomic-enabled predictions of breeding value. A sliding-window version of the analysis highlighted haplotype regions of the genome apparently under selection in a line-specific manner. In the male lines, we retrieved high population-specific scores for IGF-1 and a cognate receptor, INSR. For the female lines, we detected an extreme score for a region containing a reproductive hormone receptor (GNRHR). We conclude that our compression-based method is a valid approach to established relationships and identify regions under selective pressure in commercial lines of broiler chickens. © 2017 Poultry Science Association Inc.

  2. AFLP and AMP Fingerprints as Markers to Evaluate Genetic Differences between Medicago truncatula Line Jemalong and 2HA, a New Line Produced by in vitro Culture Selection

    Directory of Open Access Journals (Sweden)

    R.R. Irwanto

    2008-09-01

    Full Text Available A new line, Medicago truncatula cv. Jemalong 2HA (herein known as 2HA has been developed via repetitive regeneration and selection of M. truncatula cv. Jemalong. During somatic embryogenesis, 2HA produces 500 times more embryos than its progenitor, Jemalong. It is interesting to study if those two lines are isogenic or has genetic differences. The main objectives of the study was to evaluate the genotypic differences between Jemalong and 2HA also to evaluate the methylation event in 2HA utilized two DNA fingerprinting techniques, i.e AFLP fingerprints (Amplified Length of Polymorphism and AMP (Amplified Methylation Polymorphism. The results showed that AFLP analysis using eight primers combinations could not detect any differences between Jemalong and 2HA. However, using AMP methylation sensitive primers it could detect 15 polymorphisms out of 840 markers. These results lead to a conclusion that Jemalong and 2HA are isogenic lines. 2HA may have higher regeneration capacities due to methylation process which occurs during the production of 2HA through repetitive regeneration cycles.

  3. Selective breeding of two lines of guinea pigs differing in bronchial sensitivity to acetylcholine and histamine exposure.

    Science.gov (United States)

    Mikami, H; Nishibata, R; Kawamoto, Y; Ino, T

    1991-04-01

    We developed two lines of guinea pigs, one as model animals for bronchial asthma with bronchial hypersensitivity and the other with hyposensitivity as a control. In the last four years, the bronchial hypersensitive line (BHS) and hyposensitive line (BHR), both derived from Hartley strain guinea pigs, have been selected by using bronchial reactivity to acetylcholine and to histamine as parameters. Both lines have reached the F6 generation. The following results were obtained with the two lines: 1) Sib and cous in matings, and mating of selected consanguineous individuals were adopted in breeding BHS and BHR. The breeding started with six families, each, but in the F6 generation the number of families decreased to two in each line. 2) Appearance rates of hyper- or hyposensitivity to acetylcholine and histamine increased with successive generations in both lines, which had been completely separated by the F6 generation. 3) Coefficients of inbreeding in BHS and BHR in the F6 generation ranged from 42% to 45% in the former and 42% in the latter. 4) Heritabilities (h2) of BHS and BHR for the appearance rates of sensitivity to acetylcholine were presumed to be 0.54 in the former and 0.69 in the latter. 5) No difference in the body weight of 0, 20, and 40 day-old BHS was observed in any generation. On the other hand, the body weight of 20 and 40 day-old BHR tended to decrease with successive generations. 6) Mean litter sizes of BHS and BHR in each of the generations ranged from 2.24 to 3.47 animals in the former and from 2.63 to 3.38 animals in the latter.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

    NARCIS (Netherlands)

    Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

    2017-01-01

    BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

  5. An automatic optimum number of well-distributed ground control lines selection procedure based on genetic algorithm

    Science.gov (United States)

    Yavari, Somayeh; Valadan Zoej, Mohammad Javad; Salehi, Bahram

    2018-05-01

    The procedure of selecting an optimum number and best distribution of ground control information is important in order to reach accurate and robust registration results. This paper proposes a new general procedure based on Genetic Algorithm (GA) which is applicable for all kinds of features (point, line, and areal features). However, linear features due to their unique characteristics are of interest in this investigation. This method is called Optimum number of Well-Distributed ground control Information Selection (OWDIS) procedure. Using this method, a population of binary chromosomes is randomly initialized. The ones indicate the presence of a pair of conjugate lines as a GCL and zeros specify the absence. The chromosome length is considered equal to the number of all conjugate lines. For each chromosome, the unknown parameters of a proper mathematical model can be calculated using the selected GCLs (ones in each chromosome). Then, a limited number of Check Points (CPs) are used to evaluate the Root Mean Square Error (RMSE) of each chromosome as its fitness value. The procedure continues until reaching a stopping criterion. The number and position of ones in the best chromosome indicate the selected GCLs among all conjugate lines. To evaluate the proposed method, a GeoEye and an Ikonos Images are used over different areas of Iran. Comparing the obtained results by the proposed method in a traditional RFM with conventional methods that use all conjugate lines as GCLs shows five times the accuracy improvement (pixel level accuracy) as well as the strength of the proposed method. To prevent an over-parametrization error in a traditional RFM due to the selection of a high number of improper correlated terms, an optimized line-based RFM is also proposed. The results show the superiority of the combination of the proposed OWDIS method with an optimized line-based RFM in terms of increasing the accuracy to better than 0.7 pixel, reliability, and reducing systematic

  6. First- and Second-Line Targeted Systemic Therapy in Hepatocellular Carcinoma—An Update on Patient Selection and Response Evaluation

    Directory of Open Access Journals (Sweden)

    Johann von Felden

    2016-11-01

    Full Text Available Advanced hepatocellular carcinoma (HCC with vascular invasion and/or extrahepatic spread and preserved liver function, according to stage C of the Barcelona Clinic Liver Cancer (BCLC classification, has a dismal prognosis. The multi-targeted tyrosine-kinase receptor inhibitor (TKI sorafenib is the only proven active substance in systemic HCC therapy for first-line treatment. In this review, we summarize current aspects in patient selection and management of side effects, and provide an update on response evaluation during first-line sorafenib therapy. Since second-line treatment options have been improved with the successful completion of the RESORCE trial, demonstrating a survival benefit for second-line treatment with the TKI regorafenib, response monitoring during first-line therapy will be critical to deliver optimal systemic therapy in HCC. To this regard, specific side effects, in particular worsening of arterial hypertension and diarrhea, might suggest treatment response during first-line sorafenib therapy; however, clear predictive clinical markers, as well as laboratory test or serum markers, are not established. Assessment of radiologic response according to the modified Response Evaluation Criteria in Solid Tumors (mRECIST is helpful to identify patients who do not benefit from sorafenib treatment.

  7. Recent advances in the development of new transgenic animal technology.

    Science.gov (United States)

    Miao, Xiangyang

    2013-03-01

    Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

  8. Correction to: Generation and characterization of tissue-type plasminogen activator transgenic rats.

    Science.gov (United States)

    Ito, Yusuke; Noguchi, Kengo; Morishima, Yoshiyuki; Yamaguchi, Kyoji

    2018-01-01

    In the original publication of the article, the sentence in "Result" section have been incorrectly published as: "Three lines of tPA Tg rats were generated and analyzed by Southern blotting to confirm the presence of the transgene in genomic DNA. When rat DNA was digested with EcoRI and hybridized to the tPA probe described in "Materials and methods", a 1.0 kb band was detected (Fig. 1a, b). One founder line was selected because of its high copy number (about ten copies) of tPA gene and itansgene) and 4.4 kb (endogenous gene) reding appearance, body weight, hematology, and systematization." The corrected sentence should read as: "Three lines of tPA Tg rats were generated and analyzed by Southern blotting to confirm the presence of the transgene in genomic DNA. When rat DNA was digested with EcoRI and hybridized to the tPA probe described in "Materials and methods", a 1.0 kb band was detected (Fig. 1a, b). One founder line was selected because of its high copy number (about ten copies) of tPA gene and its lack of detectable abnormal findings, including appearance, body weight, hematology, and systematization." The original article has been corrected.

  9. Transgenic approaches in potato: effects on glycoalkaloids levels

    African Journals Online (AJOL)

    Sayyar

    2013-02-20

    Feb 20, 2013 ... Tax and Vernon, 2001). The inserted transgene varies in ... regions are disfavored under selective conditions as the case in previous studies. .... human consumption at concentration >200 mg/1000 g of total tuber weight ...

  10. Gene flow from transgenic common beans expressing the bar gene.

    Science.gov (United States)

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

  11. Design and Management of Field Trials of Transgenic Cereals

    Science.gov (United States)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  12. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  13. Selection of an analytical line for determining lithium in aluminum alloys by laser induced breakdown spectrometry

    International Nuclear Information System (INIS)

    Lednev, V.N.; Yakovlev, A.V.; Labutin, T.A.; Popov, A.M.; Zorov, N.B.

    2007-01-01

    Possibilities for determining lithium in aluminum alloys by laser spark spectrometry are studied. The optimum conditions for registering the emission signal of lithium at which the effect of the continuous background radiation of the laser plasma attains a minimum are found. The possibility of determining lithium by laser spark spectrometry using the spectral line at 610 nm is studied for the first time. A comparison of the detection limits and sensitivities of determining lithium by emission its lines at 610 and 671 nm has indicated the advisability of using the line 610 nm for the studied alloys. The detection limit calculated using the 3σ test was found to be 230 ppm (610 nm) and 870 ppm (671 nm) [ru

  14. Evaluation of TFAM and FABP4 gene polymorphisms in three lines of Nellore cattle selected for growth.

    Science.gov (United States)

    Ayres, D R; Souza, F R P; Mercadante, M E Z; Fonseca, L F S; Tonhati, H; Cyrillo, J N S G; Bonilha, S F M; Albuquerque, L G

    2010-10-19

    We analyzed the polymorphisms TFAM HaeIII, TFAM MboI and FABP4 MspA1I in three Nellore lines selected for growth in order to evaluate how selection affects the frequencies of these polymorphisms and evaluate their association with growth and carcass traits in Zebu cattle. Birth, weaning and yearling weights, rump height, longissimus muscle area, backfat thickness, and rump fat thickness were analyzed. The sample was constituted of animals from two lines selected for yearling weight (NeS and NeT), and a control line (NeC), established in 1980, at the São Paulo Instituto de Zootecnia. Two hundred and seventy-two heifers were genotyped for TFAM gene SNPs, and 325 heifers were genotyped for the FABP4 SNP. High frequencies were observed for the alleles A (TFAM HaeIII), C (TFAM MboI) and C (FABP4 MspA1I). Significant differences in allele frequencies between NeS and NeT were observed for the TFAM HaeIII, and between the line NeT and lines NeC and NeS for the FABP4 MspA1I SNP. Five haplotypes were observed for the two polymorphisms in the TFAM gene, haplotype AACC being the most frequent. None of the markers separately or according to haplotype was significantly associated with the growth and carcass traits. The low frequencies of alleles that are associated with high marbling scores and thick subcutaneous fat in taurine breeds might explain the low means for these traits in Nellore cattle.

  15. A dominant-negative mutation within AtMYB90 blocks flower pigment production in transgenic tobacco.

    Science.gov (United States)

    During de novo shoot induction in cultured transgenic tobacco callus a spontaneous mutation within the coding region of a AtMYB90 transgene produced a plant line in which the original transgene-induced over-pigmented phenotype (dark red/purple from anthocyanin overproduction in most tissues) was los...

  16. Genetic variation assessed with microsatellites in mass selection lines of the Pacific oyster ( Crassostrea gigas) in China

    Science.gov (United States)

    Wang, Xubo; Li, Qi; Yu, Hong; Kong, Lingfeng

    2016-12-01

    Four successive mass selection lines of the Pacific oyster, Crassostrea gigas, selected for faster growth in breeding programs in China were examined at ten polymorphic microsatellite loci to assess the level of allelic diversity and estimate the effective population size. These data were compared with those of their base population. The results showed that the genetic variation of the four generations were maintained at high levels with an average allelic richness of 18.8-20.6, and a mean expected heterozygosity of 0.902-0.921. They were not reduced compared with those of their base population. Estimated effective population sizes based on temporal variances in microsatellite frequencies were smaller to that of sex ratio-corrected broodstock count estimates. Using a relatively large number of broodstock and keeping an equal sex ratio in the broodstock each generation may have contributed to retaining the original genetic diversity and maintaining relatively large effective population size. The results obtained in this study showed that the genetic variation was not affected greatly by mass selection progress and high genetic variation still existed in the mass selection lines, suggesting that there is still potential for increasing the gains in future generations of C. gigas. The present study provided important information for future genetic improvement by selective breeding, and for the design of suitable management guidelines for genetic breeding of C. gigas.

  17. Mice from lines selectively bred for high voluntary wheel running exhibit lower blood pressure during withdrawal from wheel access.

    Science.gov (United States)

    Kolb, Erik M; Kelly, Scott A; Garland, Theodore

    2013-03-15

    Exercise is known to be rewarding and have positive effects on mental and physical health. Excessive exercise, however, can be the result of an underlying behavioral/physiological addiction. Both humans who exercise regularly and rodent models of exercise addiction sometimes display behavioral withdrawal symptoms, including depression and anxiety, when exercise is denied. However, few studies have examined the physiological state that occurs during this withdrawal period. Alterations in blood pressure (BP) are common physiological indicators of withdrawal in a variety of addictions. In this study, we examined exercise withdrawal in four replicate lines of mice selectively bred for high voluntary wheel running (HR lines). Mice from the HR lines run almost 3-fold greater distances on wheels than those from non-selected control lines, and have altered brain activity as well as increased behavioral despair when wheel access is removed. We tested the hypothesis that male HR mice have an altered cardiovascular response (heart rate, systolic, diastolic, and mean arterial pressure [MAP]) during exercise withdrawal. Measurements using an occlusion tail-cuff system were taken during 8 days of baseline, 6 days of wheel access, and 2 days of withdrawal (wheel access blocked). During withdrawal, HR mice had significantly lower systolic BP, diastolic BP, and MAP than controls, potentially indicating a differential dependence on voluntary wheel running in HR mice. This is the first characterization of a cardiovascular withdrawal response in an animal model of high voluntary exercise. Copyright © 2013. Published by Elsevier Inc.

  18. Accuracy and simultaneous selection gains for N-stress tolerance and N-use efficiency in maize tropical lines

    Directory of Open Access Journals (Sweden)

    Leandro de Freitas Mendonça

    Full Text Available ABSTRACT Maize plants can be N-use efficient or N-stress tolerant. The first have high yields in favorable environments but is drastically affected under stress conditions; whereas the second show satisfactory yields in stressful environments but only moderate ones under optimal conditions. In this context, our aim was to assess the possibility of selecting tropical maize lines that are simultaneously N-stress tolerant and N-use efficient and check for differences between simultaneous selection statistical methods. Sixty-four tropical maize lines were evaluated for Nitrogen Agronomic Efficiency (NAE and Low Nitrogen Tolerance (LNTI response indices and two per se selection indices, Low Nitrogen Agronomic Efficiency (LNAE and Harmonic Mean of Relative Performance (HMRP. We performed eight selection scenarios: LNAE; HMRP; Additive index; Mulamba-Mock index; and Independent culling levels. The last three was predicted by REML/BLUP single-trait and multi-trait using genotypic values of NAE and LNTI. The REML/BLUP multi-trait analysis was superior to the single-trait analysis due to high unfavorable correlation between NAE and LNTI. However, the accuracy and genotypic determination coefficient of NAE and LNTI were too low. Thus, neither single- nor multi-trait analysis achieved a good result for simultaneous selection nor N-use efficiency nor N-stress tolerance. LNAE obtained satisfactorily accurate values and genotypic determination coefficient, but its performance in selection gain was worse than HMRP, particularly in terms of N-use efficiency. Therefore, because of the superior performance in accuracy, genotypic determination coefficient and selection, HMRP was considered the best simultaneous selection methodology of the scenarios tested for N-use efficiency and N-stress tolerance.

  19. Transgenics in Agriculture

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

  20. A COUP-TFII Human Embryonic Stem Cell Reporter Line to Identify and Select Atrial Cardiomyocytes

    NARCIS (Netherlands)

    Schwach, Verena; Verkerk, Arie O.; Mol, Mervyn; Monshouwer-Kloots, Jantine J.; Devalla, Harsha D.; Orlova, Valeria V.; Anastassiadis, Konstantinos; Mummery, Christine L.; Davis, Richard P.; Passier, Robert

    2017-01-01

    Reporter cell lines have already proven valuable in identifying, tracking, and purifying cardiac subtypes and progenitors during differentiation of human pluripotent stem cells (hPSCs). We previously showed that chick ovalbumin upstream promoter transcription factor II (COUP-TFII) is highly enriched

  1. Physiological and molecular analysis of selected Kenyan maize lines for aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) toxicity is an important limitation to maize production in many tropical and sub-tropical acid soil areas. The aim of this study was to survey the variation in Al tolerance in a panel of maize lines adapted for Kenya and look for novel sources of Al tolerance. 112 Kenyan maize accessio...

  2. Behavioural profiles of two Wistar rat lines selectively bred for high or low anxiety-related behaviour.

    Science.gov (United States)

    Liebsch, G; Montkowski, A; Holsboer, F; Landgraf, R

    1998-08-01

    Over the past years, two breeding lines, derived originally from outbred Wistar rats, have been established that differ markedly and consistently in their anxiety-related behaviour in the elevated plus-maze. At the age of ten weeks, rats were tested once on the elevated plus-maze and the males and females displaying the most anxious and the least anxious behaviour were sib-mated to start a new generation of the high anxiety-related behaviour (HAB) and the low anxiety-related behaviour (LAB) lines, respectively. The resulting difference in emotionality between these two lines was also evident in an open field test and correlated with differences in the forced swim test. In the open field, the HAB rats tended to be less active and explored the central zone of the open field much less than the LAB animals. In the forced swim test, HAB rats started floating earlier, spent significantly more time in this immobile posture and struggled less than LAB rats. However, in an olfactory-cued social discrimination task there was no difference between male and female animals from either line. The overall performance in these various behavioural tests suggests that selective breeding has resulted in rat lines not only differing markedly in their innate anxiety-related behaviour in the plus-maze, but also in other stress-related behavioural performances, suggesting a close link between the emotional evaluation of a novel and stressful situation and an individual's coping strategy.

  3. Biologic activity of the novel orally bioavailable selective inhibitor of nuclear export (SINE) KPT-335 against canine melanoma cell lines

    Science.gov (United States)

    2014-01-01

    Background Exportin 1 (XPO1, also known as CRM1), is a chaperone protein responsible for the export of over 200 target proteins out of the nucleus. The expression and activity of XPO1 is upregulated in several human cancers and its expression is also linked to the development of chemotherapy resistance. Recent studies using both human and murine cancer cell lines have demonstrated that XPO1 is a relevant target for therapeutic intervention. The present study sought to characterize the biologic activity of an orally bioavailable selective inhibitor of nuclear export (SINE), KPT-335, against canine melanoma cell lines as a prelude to future clinical trials in dogs with melanoma. Results We evaluated the effects of KPT-335 on 4 canine malignant melanoma cell lines and found that KPT-335 inhibited proliferation, blocked colony formation, and induced apoptosis of treated cells at biologically relevant concentrations of drug. Additionally, KPT-335 downregulated XPO1 protein while inducing a concomitant increase in XPO1 messenger RNA. Lastly, KPT-335 treatment of cell lines upregulated the expression of both protein and mRNA for the tumor suppressor proteins p53 and p21, and promoted their nuclear localization. Conclusions KPT-335 demonstrates biologic activity against canine melanoma cell lines at physiologically relevant doses, suggesting that KPT-335 may represent a viable treatment option for dogs with malignant melanoma. PMID:25022346

  4. A Novel Inhibitor Of Topoisomerase I is Selectively Toxic For A Subset of Non-Small Cell Lung Cancer Cell Lines | Office of Cancer Genomics

    Science.gov (United States)

    SW044248, identified through a screen for chemicals that are selectively toxic for NSCLC cell lines, was found to rapidly inhibit macromolecular synthesis in sensitive, but not in insensitive cells. SW044248 killed approximately 15% of a panel of 74 NSCLC cell lines and was non-toxic to immortalized human bronchial cell lines.

  5. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  6. THE JET POWER AND EMISSION-LINE CORRELATIONS OF RADIO-LOUD OPTICALLY SELECTED QUASARS

    International Nuclear Information System (INIS)

    Punsly, Brian; Zhang Shaohua

    2011-01-01

    In this Letter, the properties of the extended radio emission form Sloan Digital Sky Survey Data Release 7 quasars with 0.4 20-30 kpc). The frequency of quasars with FR II level extended radio emission is ∼2.3% and >0.4% of quasars have FR I level extended radio emission. The lower limit simply reflects the flux density limit of the survey. The distribution of the long-term time-averaged jet powers of these quasars, Q-bar , has a broad peak ∼3 x 10 44 erg s -1 that turns over below 10 44 erg s -1 and sources above 10 45 erg s -1 are extremely rare. It is found that the correlation between the bolometric (total thermal) luminosity of the accretion flow, L bol , and Q-bar is not strong. The correlation of Q-bar with narrow line luminosity is stronger than the correlation with broad line luminosity and the continuum luminosity. It is therefore concluded that previous interpretations of correlations of Q-bar with narrow line strengths in radio galaxies as a direct correlation of jet power and accretion power have been overstated. It is explained why this interpretation mistakenly overlooks the sizeable fraction of sources with weak accretion luminosity and powerful jets discovered by Ogle et al.

  7. Spectral properties of the narrow-line region in Seyfert galaxies selected from the SDSS-DR7

    Science.gov (United States)

    Vaona, L.; Ciroi, S.; Di Mille, F.; Cracco, V.; La Mura, G.; Rafanelli, P.

    2012-12-01

    Although the properties of the narrow-line region (NLR) of active galactic nuclei (AGN) have been deeply studied by many authors in the past three decades, many questions are still open. The main goal of this work is to explore the NLR of Seyfert galaxies by collecting a large statistical spectroscopic sample of Seyfert 2 and Intermediate-type Seyfert galaxies having a high signal-to-noise ratio in order to take advantage of a high number of emission lines to be accurately measured. 2153 Seyfert 2 and 521 Intermediate-type Seyfert spectra were selected from Sloan Digital Sky Survey Data Release 7 (SDSS-DR7) with a diagnostic diagram based on the oxygen emission-line ratios. All the emission lines, broad components included, were measured by means of a self-developed code, after the subtraction of the stellar component. Physical parameters, such as internal reddening, ionization parameter, temperature, density, gas and stellar velocity dispersion were determined for each object. Furthermore, we estimated mass and radius of the NLR, kinetic energy of the ionized gas and black hole accretion rate. From the emission-line analysis and the estimated physical properties, it appears that the NLR is similar in Seyfert 2 and Intermediate-Seyfert galaxies. The only differences, lower extinction, gas kinematics in general not dominated by the host galaxy gravitational potential and higher percentage of [O III]λ5007 blue asymmetries in Intermediate-Seyfert, can be ascribed to an effect of inclination of our line of sight with respect to the torus axis.

  8. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.

    Science.gov (United States)

    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K

    2014-09-01

    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite.

  9. High spin spectroscopy near the N=Z line: Channel selection and excitation energy systematics

    Energy Technology Data Exchange (ETDEWEB)

    Svensson, C.E.; Cameron, J.A.; Flibotte, S. [McMaster Univ., Ontario (Canada)] [and others

    1996-12-31

    The total {gamma}-ray and charged-particle energies emitted in fusion-evaporation reactions leading to N=Z compound systems in the A = 50-70 mass region have been measured with the 8{pi} {gamma}-ray spectrometer and the miniball charged-particle detector array. A new method of channel selection has been developed which combines particle identification with these total energy measurements and greatly improves upon the selectivity possible with particle detection alone. In addition, the event by event measurement of total {gamma}-ray energies using the BGO ball of the 8{pi} spectrometer has allowed a determination of excitation energies following particle evaporation for a large number of channels in several different reactions. The new channel selection procedure and excitation energy systematics are illustrated with data from the reaction of {sup 24}Mg on {sup 40}Ca at E{sub lab} = 80MeV.

  10. Progress in selection for sodium chloride, 2,4-D dichlorophenoxy acetic acid (2,4-D) and streptomycin tolerance in Citrus sinensis ovular callus lines

    International Nuclear Information System (INIS)

    Kochba, J.; Spiegel-Roy, P.

    1982-01-01

    Citrus sinensis (cultivar Shamouti) nucellar embryogenic callus lines with greatly increased tolerance to salinity (NaCl), 2,4-D and streptomycin were selected. Selected lines were found stable after removal of selection pressure. Gamma irradiation at 8-16 kR was also employed and found to speed up selections. Embryos from NaCl and 2,4-D tolerant lines also showed increased tolerance. Embryogenesis in selected lines, suppressed during selection procedures, was regained by growing cultures in the presence of galactose or lactose as the sole carbon source. A schedule was worked out furthering development of embryos into plantlets. Conditions for adventive shoot formation from embryonic shoot segments were established, thus allowing cloning of embryos. A procedure was worked out for suspension culture and agar plating of cell groups. (author)

  11. Selective apoptosis induction in MCF-7 cell line by truncated minimal functional region of Apoptin

    International Nuclear Information System (INIS)

    Shen Ni, Lim; Allaudin, Zeenathul Nazariah bt; Mohd Lila, Mohd Azmi b; Othman, Abas Mazni b; Othman, Fauziah bt

    2013-01-01

    Chicken Anemia Virus (CAV) VP3 protein (also known as Apoptin), a basic and proline-rich protein has a unique capability in inducing apoptosis in cancer cells but not in normal cells. Five truncated Apoptin proteins were analyzed to determine their selective ability to migrate into the nucleus of human breast adenocarcinoma MCF-7 cells for inducing apoptosis. For identification of the minimal selective domain for apoptosis, the wild-type Apoptin gene had been reconstructed by PCR to generate segmental deletions at the N’ terminal and linked with nuclear localization sites (NLS1 and NLS2). All the constructs were fused with maltose-binding protein gene and individually expressed by in vitro Rapid Translation System. Standardized dose of proteins were delivered into human breast adenocarcinoma MCF-7 cells and control human liver Chang cells by cytoplasmic microinjection, and subsequently observed for selective apoptosis effect. Three of the truncated Apoptin proteins with N-terminal deletions spanning amino acid 32–83 retained the cancer selective nature of wild-type Apoptin. The proteins were successfully translocated to the nucleus of MCF-7 cells initiating apoptosis, whereas non-toxic cytoplasmic retention was observed in normal Chang cells. Whilst these truncated proteins retained the tumour-specific death effector ability, the specificity for MCF-7 cells was lost in two other truncated proteins that harbor deletions at amino acid 1–31. The detection of apoptosing normal Chang cells and MCF-7 cells upon cytoplasmic microinjection of these proteins implicated a loss in Apoptin’s signature targeting activity. Therefore, the critical stretch spanning amino acid 1–31 at the upstream of a known hydrophobic leucine-rich stretch (LRS) was strongly suggested as one of the prerequisite region in Apoptin for cancer targeting. Identification of this selective domain provides a platform for developing small targets to facilitating carrier-mediated-transport across

  12. Development of highly regenerable callus lines and biolistic transformation of turf-type common bermudagrass [Cynodon dactylon (L.) Pers.].

    Science.gov (United States)

    Li, L; Qu, R

    2004-01-01

    Common bermudagrass, Cynodon dactylon, is a widely used warm-season turf and forage species in the temperate and tropical regions of the world. Improvement of bermudagrass via biotechnology depends on improved tissue culture responses, especially in plant regeneration, and a successful scheme to introduce useful transgenes. When the concentration of 6-benzylaminopurine was adjusted in the culture medium, yellowish, compact calluses were observed from young inflorescence tissue culture of var. J1224. Nine long-term, highly regenerable callus lines (including a suspension-cultured line) were subsequently established, of which six were used for biolistic transformation. Five independent transgenic events, with four producing green plants, were obtained following hygromycin B selection from one callus line. Three transgenic events displayed resistance to the herbicide glufosinate, and one of these showed beta-glucuronidase activity since the co-transformation vector used in the experiments contained both the gusA and bar genes.

  13. Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

    Science.gov (United States)

    Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

    2014-12-10

    Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

  14. 40 CFR 1045.310 - How must I select engines for production-line testing?

    Science.gov (United States)

    2010-07-01

    ... select and test one more engine. Then, calculate the required sample size for the model year as described.... It defines 95% confidence intervals for a one-tail distribution. σ = Test sample standard deviation (see paragraph (c)(2) of this section). x = Mean of emission test results of the sample. STD = Emission...

  15. Selection of scFvs specific for the HepG2 cell line using ribosome ...

    Indian Academy of Sciences (India)

    Madhsudhan

    the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.

  16. Increased Expression of the Na,K-ATPase alpha4 Isoform Enhances Sperm Motility in Transgenic Mice1

    Science.gov (United States)

    Jimenez, Tamara; Sanchez, Gladis; McDermott, Jeffrey P.; Nguyen, Anh-Nguyet; Kumar, T. Rajendra; Blanco, Gustavo

    2010-01-01

    The Na,K-ATPase alpha4 (ATP1A4) isoform is specifically expressed in male germ cells and is highly prevalent in spermatozoa. Although selective inhibition of alpha4 activity with ouabain has been shown to affect sperm motility, a more direct analysis of the role of this isoform in sperm movement has not yet been demonstrated. To establish this, we engineered transgenic mice that express the rat alpha4 isoform fused to green fluorescent protein in male germ cells, under the control of the mouse protamine 1 promoter. We showed that the rat Atp1a4 transgene is expressed in mouse spermatozoa and that it is localized to the sperm flagellum. In agreement with increased expression of the alpha4 isoform, sperm from transgenic mice displayed higher alpha4-specific Na,K-ATPase activity and binding of fluorescently labeled ouabain than wild-type mice. In contrast, expression and activity of ATP1A1 (alpha1), the other Na,K-ATPase alpha isoform present in sperm, remained unchanged. Similar to wild-type mice, mice expressing the alpha4 transgene exhibited normal testis and sperm morphology and no differences in fertility. However, compared to wild-type mice, sperm from transgenic mice displayed plasma membrane hyperpolarization and higher total and progressive motility. Other parameters of motility also increased, including straight-line, curvilinear, and average path velocities and amplitude of lateral head displacement. In addition, sperm from the transgenic mice showed enhanced sperm hyperactive motility, but no changes in progesterone-induced acrosome reaction. Altogether, these results provide new genetic evidence for the role of the ATP1A4 isoform in sperm motility, under both noncapacitating and capacitating conditions. PMID:20826726

  17. A multi attribute decision making method for selection of optimal assembly line

    Directory of Open Access Journals (Sweden)

    B. Vijaya Ramnath

    2011-01-01

    Full Text Available With globalization, sweeping technological development, and increasing competition, customers are placing greater demands on manufacturers to increase quality, flexibility, on time delivery of product and less cost. Therefore, manufacturers must develop and maintain a high degree of coherence among competitive priorities, order winning criteria and improvement activities. Thus, the production managers are making an attempt to transform their organization by adopting familiar and beneficial management philosophies like cellular manufacturing (CM, lean manufacturing (LM, green manufacturing (GM, total quality management (TQM, agile manufacturing (AM, and just in time manufacturing (JIT. The main objective of this paper is to propose an optimal assembly method for an engine manufacturer’s assembly line in India. Currently, the Indian manufacturer is following traditional assembly method where the raw materials for assembly are kept along the sideways of conveyor line. It consumes more floor space, more work in process inventory, more operator's walking time and more operator's walking distance per day. In order to reduce the above mentioned wastes, lean kitting assembly is suggested by some managers. Another group of managers suggest JIT assembly as it consumes very less inventory cost compared to other types of assembly processes. Hence, a Multi-attribute decision making model namely analytical hierarchy process (AHP is applied to analyse the alternative assembly methods based on various important factors.

  18. Induction of mutations in Thai rice varieties and subsequent selection and testing of beneficial mutant lines

    Energy Technology Data Exchange (ETDEWEB)

    Dasananda, S; Khambanonda, P [Ministry of Agriculture, Bangkok (Thailand)

    1970-03-01

    Ionizing radiations were first used in the Thailand Rice Breeding Program in 1955 when seeds of two recommended varieties were sent to the United States of America for treatment. As a result, five promising mutant lines are at present in regional yield tests where they are being considered for recommendation to rice growers. During the period 1960-1961 an unsuccessful attempt was made to induce resistance to blast in three susceptible varieties by exposing seeds to a local source of ionizing radiation In 1964, after an elapse of about 4 years, another attempt was made to utilize ionizing radiations in the breeding program by treating seeds of two recommended varieties. In 1965, a co-ordinated rice mutation breeding program was initiated under the auspices of the Joint FAO/IAEA Division of Atomic Energy in Food and Agriculture which resulted in treating seeds of twelve different rice varieties with both ethyl methane sulphonate and gamma rays from a {sup 60}Co gamma cell. The results so far indicate that mutagenic agents have been successful in producing genetic variability. Differences in heading date, mature plant height and plant type are frequently observed in the M{sub 2} and M{sub 3} generations. Several lines obtained from two of the irradiated varieties have exhibited a higher degree of resistance to blast than the parental material. From 15-kR treatments of non-glutinous varieties, mutants with glutinous endosperm have been obtained. Not all varieties gave the same response to treatment. (author)

  19. Selected plantar pressure characteristics associated with the skating performance of national in-line speed skaters.

    Science.gov (United States)

    Wu, Wen-Lan; Hsu, Hsiu-Tao; Chu, I-Hua; Tsai, Feng-Hua; Liang, Jing-Min

    2017-06-01

    In order to help coaches analyse the techniques of professional in-line speed skaters for making the required fine adjustments and corrections in their push-off work, this study analysed the specific plantar pressure characteristics during a 300-m time-trial test. Fourteen elite in-line speed skaters from the national team were recruited in this study. The total completion time of the 300-m time-trial test, duration of each skating phase, and plantar pressure distribution were measured. The correlation between plantar pressure distribution and skating performance was assessed using Pearson correlation analyses. The results showed that the contact time of the total foot and force-time integral (FTI) in the medial forefoot were significantly correlated with the duration of the start phase, and the FTIs in the medial forefoot of the gliding (left) leg and lateral forefoot of the pushing (right) leg were significantly correlated with the duration of the turning phase. The maximum force in the medial heel, medial forefoot, and median forefoot and the FTI in the medial heel and medial forefoot were significantly correlated with the duration of the linear acceleration phase. The results suggest that a correct plantar loading area and push-off strategy can enhance the skating performance.

  20. Genetic parameters and selection for resistance to bacterial spot in recombinant F6 lines of Capsicum annuum

    Directory of Open Access Journals (Sweden)

    Messias Gonzaga Pereira

    2009-01-01

    Full Text Available This study aimed to advance generations and select superior sweet pepper genotypes with resistance tobacterial spot, using the breeding method Single Seed Descent (SSD based on the segregating population derived from thecross between Capsicum annuum L. UENF 1421 (susceptible, non-pungent and UENF 1381 (resistant, pungent. Thesegregating F3 generation was grown in pots in a greenhouse until the F5 generation. The F6 generation was grown in fieldconditions. The reaction to bacterial spot was evaluated by inoculation with isolate ENA 4135 of Xanthomonas campestris pv.vesicatoria, based on a score scale and by calculating the area under the disease progress curve (AUDPC. The presence orabsence of capsaicin was also assessed. Eighteen F6 lines were bacterial leaf spot-resistant. Since no capsaicin was detectedin the F6 lines 032, 316, 399, 434, and 517, these will be used in the next steps of the sweet pepper breeding program.

  1. Chickens from lines artificially selected for juvenile low and high body weight differ in glucose homeostasis and pancreas physiology.

    Science.gov (United States)

    Sumners, L H; Zhang, W; Zhao, X; Honaker, C F; Zhang, S; Cline, M A; Siegel, P B; Gilbert, E R

    2014-06-01

    Artificial selection of White Plymouth Rock chickens for juvenile (day 56) body weight resulted in two divergent genetic lines: hypophagic low weight (LWS) chickens and hyperphagic obese high weight (HWS) chickens, with the latter more than 10-fold heavier than the former at selection age. A study was designed to investigate glucose regulation and pancreas physiology at selection age in LWS chickens and HWS chickens. Oral glucose tolerance and insulin sensitivity tests revealed differences in threshold sensitivity to insulin and glucose clearance rate between the lines. Results from real-time PCR showed greater pancreatic mRNA expression of four glucose regulatory genes (preproinsulin, PPI; preproglucagon, PPG; glucose transporter 2, GLUT2; and pancreatic duodenal homeobox 1, Pdx1) in LWS chickens, than HWS chickens. Histological analysis of the pancreas revealed that HWS chickens have larger pancreatic islets, less pancreatic islet mass, and more pancreatic inflammation than LWS chickens, all of which presumably contribute to impaired glucose metabolism. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Sigma Virus (DMelSV Incidence in Lines of Drosophila melanogaster Selected for Survival following Infection with Bacillus cereus

    Directory of Open Access Journals (Sweden)

    Meghan L. Bentz

    2017-01-01

    Full Text Available The immune response of Drosophila melanogaster is complex and involves both specific and general responses to parasites. In this study we tested for cross-immunity for bacteria and viruses by scoring the incidence of infection with the vertically transmitted Sigma virus (DMelSV in the progeny of a cross between females transmitting DMelSV at high frequencies and males from lines subjected to three selection regimes related to resistance to Bacillus cereus. There was no significant difference in transmission of DMelSV among selection regimes, though results suggest that the B. cereus selected lines had lower rates of infection by DMelSV. We found a significant difference in viral infection with respect to the sex of the progeny, with males consistently less likely to be infected than females. Given a finite energy budget, flies that have experienced immune system challenge may show alterations in other life history traits. Later eclosing progeny were also less likely to be infected than earlier eclosing progeny, indicating a relationship with development time. Finally, there was a significant interaction between the timing of collection and the sex of the progeny, such that later eclosing males were the most resistant group. Increased development time is sometimes associated with increased energy acquisition; from this perspective, increased development time may be associated with acquiring sufficient resources for effective resistance.

  3. Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers.

    Science.gov (United States)

    Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa

    2010-03-01

    Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.

  4. Dehydrins Impart Protection against Oxidative Stress in Transgenic Tobacco Plants.

    Science.gov (United States)

    Halder, Tanmoy; Upadhyaya, Gouranga; Basak, Chandra; Das, Arup; Chakraborty, Chandrima; Ray, Sudipta

    2018-01-01

    Environmental stresses generate reactive oxygen species (ROS) which might be detrimental to the plants when produced in an uncontrolled way. However, the plants ameliorate such stresses by synthesizing antioxidants and enzymes responsible for the dismutation of ROS. Additionally, the dehydrins were also able to protect the inactivation of the enzyme lactate dehydrogenase against hydroxyl radicals (OH ⋅ ) generated during Fenton's reaction. SbDhn1 and SbDhn2 overexpressing transgenic tobacco plants were able to protect against oxidative damage. Transgenic tobacco lines showed better photosynthetic efficiency along with high chlorophyll content, soluble sugar and proline. However, the malonyl dialdehyde (MDA) content was significantly lower in transgenic lines. Experimental evidence demonstrates the protective effect of dehydrins on electron transport chain in isolated chloroplast upon methyl viologen (MV) treatment. The transgenic tobacco plants showed significantly lower superoxide radical generation () upon MV treatment. The accumulation of the H 2 O 2 was also lower in the transgenic plants. Furthermore, in the transgenic plants the expression of ROS scavenging enzymes was higher compared to non-transformed (NT) or vector transformed (VT) plants. Taken together these data, during oxidative stress dehydrins function by scavenging the () directly and also by rendering protection to the enzymes responsible for the dismutation of () thereby significantly reducing the amount of hydrogen peroxides formed. Increase in proline content along with other antioxidants might also play a significant role in stress amelioration. Dehydrins thus function co-operatively with other protective mechanisms under oxidative stress conditions rendering protection in stress environment.

  5. Selection of maintaining, method for keeping of biologial purity, patternship and health, regarding viruses infection of distinguished potato breeding lines

    Directory of Open Access Journals (Sweden)

    Luiza MIKE

    2008-05-01

    Full Text Available A large number of potato varieties and distinguished breeding lines disappeared as an effect of nonfavourable climatically conditions and especially by viruses diseases, as well as other biological and viruses degeneration. To avoid the negative effect of degeneration on potato varieties and distinguished breeding lines, the method of selection for maintaining and multiplication of potato is applying in Romania in the frame of National Center for Maintaining of potato varieties and distinguished breeding lines Apa Rosie, Covasna County, which belong to the Station for Research and Development of Potato, Targu Secuiesc, Covasna County.In this center are maintained and multiplied all distinguished varieties and breeding centers from Romania (National Institute for research and Development of Potato and Sugar beet Brasov, Research and Development Station for Agriculture Suceava, Research and Development Station for Potato Targu Secuiesc, Research and development Station for Potato Miercurea Ciuc.Using the method of selection for maintaining it is possible an early identification of somatic mutations, disease (especially viruses infection by visual elimination or by serological testing.The viruses’ infection of potato leads to disturbed the metabolism of plants and produces anatomical – morphological alters as: mosaic, crinkle, rolling, browning of leaves and plants deformation.The disturbing of plant metabolism has as negative effect the reduction of vegetation period, decreasing the yield capacity, depreciation of physical and chemical quality of tubers.The genetically complex structure of cultivated potato (2n = 4x = 48 and strong segregation of long – expected characters in the obtained future progeny by sexual hybridization, complicated many times by nonfavourable linkage, are the backgrounds for initiation of maintain selection.

  6. Desmoid-type fibromatosis: a front-line conservative approach to select patients for surgical treatment.

    Science.gov (United States)

    Fiore, Marco; Rimareix, Françoise; Mariani, Luigi; Domont, Julien; Collini, Paola; Le Péchoux, Cecile; Casali, Paolo G; Le Cesne, Axel; Gronchi, Alessandro; Bonvalot, Sylvie

    2009-09-01

    Surgery is still the standard treatment for desmoid-type fibromatosis (DF). Recently, the Institut Gustave Roussy (IGR), Villejuif, France, reported a series of patients treated with a front-line conservative approach (no surgery and no radiotherapy). The disease remained stable in more than half of patients. This study was designed to evaluate this approach on the natural history of the disease in a larger series of patients. A total of 142 patients presenting to the IGR or Istituto Nazionale Tumori (INT), Milan, Italy, were initially treated using a front-line deliberately conservative policy. Their progression-free survival (PFS) was observed and a multivariate analysis was performed for major clinical variables. Seventy-four patients presented with primary tumor, 68 with recurrence. Eighty-three patients received a "wait & see" policy (W&S), whereas 59 were initially offered medical therapy (MT), mainly hormonal therapy and chemotherapy. A family history of sporadic colorectal cancer was present in 8% of patients. The 5-year PFS was 49.9% for the W&S group and 58.6% for the medically treated patients (P = 0.3196). Similar results emerged for primary and recurrent DF. Multivariate analysis identified no clinical variables as independent predictors of PFS. In the event of progression, all patients were subsequently managed safely. A conservative policy could be a safe approach to primary and recurrent DF, which could avoid unnecessary morbidity from surgery and/or radiation therapy. Half of patients had medium-term stable disease after W&S or MT. A multidisciplinary, stepwise approach should be prospectively tested in DF.

  7. Rapid selection and proliferation of CD133+ cells from cancer cell lines: chemotherapeutic implications.

    Directory of Open Access Journals (Sweden)

    Sarah E Kelly

    2010-04-01

    Full Text Available Cancer stem cells (CSCs are considered a subset of the bulk tumor responsible for initiating and maintaining the disease. Several surface cellular markers have been recently used to identify CSCs. Among those is CD133, which is expressed by hematopoietic progenitor cells as well as embryonic stem cells and various cancers. We have recently isolated and cultured CD133 positive [CD133+] cells from various cancer cell lines using a NASA developed Hydrodynamic Focusing Bioreactor (HFB (Celdyne, Houston, TX. For comparison, another bioreactor, the rotary cell culture system (RCCS manufactured by Synthecon (Houston, TX was used. Both the HFB and the RCCS bioreactors simulate aspects of hypogravity. In our study, the HFB increased CD133+ cell growth from various cell lines compared to the RCCS vessel and to normal gravity control. We observed a +15-fold proliferation of the CD133+ cellular fraction with cancer cells that were cultured for 7-days at optimized conditions. The RCCS vessel instead yielded a (-4.8-fold decrease in the CD133+cellular fraction respect to the HFB after 7-days of culture. Interestingly, we also found that the hypogravity environment of the HFB greatly sensitized the CD133+ cancer cells, which are normally resistant to chemo treatment, to become susceptible to various chemotherapeutic agents, paving the way to less toxic and more effective chemotherapeutic treatment in patients. To be able to test the efficacy of cytotoxic agents in vitro prior to their use in clinical setting on cancer cells as well as on cancer stem cells may pave the way to more effective chemotherapeutic strategies in patients. This could be an important advancement in the therapeutic options of oncologic patients, allowing for more targeted and personalized chemotherapy regimens as well as for higher response rates.

  8. Program scheme using common source lines in channel stacked NAND flash memory with layer selection by multilevel operation

    Science.gov (United States)

    Kim, Do-Bin; Kwon, Dae Woong; Kim, Seunghyun; Lee, Sang-Ho; Park, Byung-Gook

    2018-02-01

    To obtain high channel boosting potential and reduce a program disturbance in channel stacked NAND flash memory with layer selection by multilevel (LSM) operation, a new program scheme using boosted common source line (CSL) is proposed. The proposed scheme can be achieved by applying proper bias to each layer through its own CSL. Technology computer-aided design (TCAD) simulations are performed to verify the validity of the new method in LSM. Through TCAD simulation, it is revealed that the program disturbance characteristics is effectively improved by the proposed scheme.

  9. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Amit Kumar Chaturvedi

    Full Text Available Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13 showed significantly enhanced salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  10. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Science.gov (United States)

    Chaturvedi, Amit Kumar; Patel, Manish Kumar; Mishra, Avinash; Tiwari, Vivekanand; Jha, Bhavanath

    2014-01-01

    Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13) showed significantly enhanced salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA) analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed) condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  11. Efficient Banknote Recognition Based on Selection of Discriminative Regions with One-Dimensional Visible-Light Line Sensor

    Directory of Open Access Journals (Sweden)

    Tuyen Danh Pham

    2016-03-01

    Full Text Available Banknote papers are automatically recognized and classified in various machines, such as vending machines, automatic teller machines (ATM, and banknote-counting machines. Previous studies on automatic classification of banknotes have been based on the optical characteristics of banknote papers. On each banknote image, there are regions more distinguishable than others in terms of banknote types, sides, and directions. However, there has been little previous research on banknote recognition that has addressed the selection of distinguishable areas. To overcome this problem, we propose a method for recognizing banknotes by selecting more discriminative regions based on similarity mapping, using images captured by a one-dimensional visible light line sensor. Experimental results with various types of banknote databases show that our proposed method outperforms previous methods.

  12. Efficient Banknote Recognition Based on Selection of Discriminative Regions with One-Dimensional Visible-Light Line Sensor.

    Science.gov (United States)

    Pham, Tuyen Danh; Park, Young Ho; Kwon, Seung Yong; Park, Kang Ryoung; Jeong, Dae Sik; Yoon, Sungsoo

    2016-03-04

    Banknote papers are automatically recognized and classified in various machines, such as vending machines, automatic teller machines (ATM), and banknote-counting machines. Previous studies on automatic classification of banknotes have been based on the optical characteristics of banknote papers. On each banknote image, there are regions more distinguishable than others in terms of banknote types, sides, and directions. However, there has been little previous research on banknote recognition that has addressed the selection of distinguishable areas. To overcome this problem, we propose a method for recognizing banknotes by selecting more discriminative regions based on similarity mapping, using images captured by a one-dimensional visible light line sensor. Experimental results with various types of banknote databases show that our proposed method outperforms previous methods.

  13. No effects of power line frequency extremely low frequency electromagnetic field exposure on selected neurobehavior tests of workers inspecting transformers and distribution line stations versus controls.

    Science.gov (United States)

    Li, Li; Xiong, De-fu; Liu, Jia-wen; Li, Zi-xin; Zeng, Guang-cheng; Li, Hua-liang

    2014-03-01

    We aimed to evaluate the interference of 50 Hz extremely low frequency electromagnetic field (ELF-EMF) occupational exposure on the neurobehavior tests of workers performing tour-inspection close to transformers and distribution power lines. Occupational short-term "spot" measurements were carried out. 310 inspection workers and 300 logistics staff were selected as exposure and control. The neurobehavior tests were performed through computer-based neurobehavior evaluation system, including mental arithmetic, curve coincide, simple visual reaction time, visual retention, auditory digit span and pursuit aiming. In 500 kV areas electric field intensity at 71.98% of total measured 590 spots were above 5 kV/m (national occupational standard), while in 220 kV areas electric field intensity at 15.69% of total 701 spots were above 5 kV/m. Magnetic field flux density at all the spots was below 1,000 μT (ICNIRP occupational standard). The neurobehavior score changes showed no statistical significance. Results of neurobehavior tests among different age, seniority groups showed no significant changes. Neurobehavior changes caused by daily repeated ELF-EMF exposure were not observed in the current study.

  14. Evaluation of yield in Gamma Radiated Lines Selected from Mutated Generations of Mungbean (Vigna radiata)

    International Nuclear Information System (INIS)

    Aye Thandar; Phyu Hnin Htike; Myo Myint

    2010-12-01

    The induced mutation through different gamma radiation frequencies 50, 100, 150, 200, 250, 300, 350, 400, 450 and 500Gy in mungbean was studied for yield components in M3 generation. A Randomized Complete Block Design (RCBD) was employed with three replications in this experiment. The data collected from M3 generation were subjected to statistical analysis with the help of Excel (Microsoft office 2007) and for pairs wise comparison of groups was by SPSS program.In primary yield components, there were no significant difference in M3 generation of pods per plant, pod length and seeds per pod except 100 seeds weight. The plant treated with 250 Gy and 400Gy exploited the maximum value of one hundred seeds weight and yield per plant , respectively. Although there was no significant difference in secondary yield components; 50% flowering days, 50% maturity days and plant height in this generation, highest plant height at 200Gy and early flowering and maturity at 300Gy were obserded. The selection of individual plants in the M3 generation was carried out for high yield. In mutant selection, 250Gy and 400Gy revealed relatively more number of plants having good characters such as more number of pods per plant and longer pod length but not in other treatments and control.

  15. The sunflower transcription factor HaHB11 improves yield, biomass and tolerance to flooding in transgenic Arabidopsis plants.

    Science.gov (United States)

    Cabello, Julieta V; Giacomelli, Jorge I; Piattoni, Claudia V; Iglesias, Alberto A; Chan, Raquel L

    2016-03-20

    HaHB11 is a member of the sunflower homeodomain-leucine zipper I subfamily of transcription factors. The analysis of a sunflower microarray hybridized with RNA from HaHB11-transformed leaf-disks indicated the regulation of many genes encoding enzymes from glycolisis and fermentative pathways. A 1300bp promoter sequence, fused to the GUS reporter gene, was used to transform Arabidopsis plants showing an induction of expression after flooding treatments, concurrently with HaHB11 regulation by submergence in sunflower. Arabidopsis transgenic plants expressing HaHB11 under the control of the CaMV 35S promoter and its own promoter were obtained and these plants exhibited significant increases in rosette and stem biomass. All the lines produced more seeds than controls and particularly, those of high expression level doubled seeds yield. Transgenic plants also showed tolerance to flooding stress, both to submergence and waterlogging. Carbohydrates contents were higher in the transgenics compared to wild type and decreased less after submergence treatments. Finally, transcript levels of selected genes involved in glycolisis and fermentative pathways as well as the corresponding enzymatic activities were assessed both, in sunflower and transgenic Arabidopsis plants, before and after submergence. Altogether, the present work leads us to propose HaHB11 as a biotechnological tool to improve crops yield, biomass and flooding tolerance. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Transgenic algae engineered for higher performance

    Science.gov (United States)

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  17. Construction of a multicontrol sterility system for a maize male-sterile line and hybrid seed production based on the ZmMs7 gene encoding a PHD-finger transcription factor.

    Science.gov (United States)

    Zhang, Danfeng; Wu, Suowei; An, Xueli; Xie, Ke; Dong, Zhenying; Zhou, Yan; Xu, Liwen; Fang, Wen; Liu, Shensi; Liu, Shuangshuang; Zhu, Taotao; Li, Jinping; Rao, Liqun; Zhao, Jiuran; Wan, Xiangyuan

    2018-02-01

    Although hundreds of genetic male sterility (GMS) mutants have been identified in maize, few are commercially used due to a lack of effective methods to produce large quantities of pure male-sterile seeds. Here, we develop a multicontrol sterility (MCS) system based on the maize male sterility 7 (ms7) mutant and its wild-type Zea mays Male sterility 7 (ZmMs7) gene via a transgenic strategy, leading to the utilization of GMS in hybrid seed production. ZmMs7 is isolated by a map-based cloning approach and encodes a PHD-finger transcription factor orthologous to rice PTC1 and Arabidopsis MS1. The MCS transgenic maintainer lines are developed based on the ms7-6007 mutant transformed with MCS constructs containing the (i) ZmMs7 gene to restore fertility, (ii) α-amylase gene ZmAA and/or (iii) DNA adenine methylase gene Dam to devitalize transgenic pollen, (iv) red fluorescence protein gene DsRed2 or mCherry to mark transgenic seeds and (v) herbicide-resistant gene Bar for transgenic seed selection. Self-pollination of the MCS transgenic maintainer line produces transgenic red fluorescent seeds and nontransgenic normal colour seeds at a 1:1 ratio. Among them, all the fluorescent seeds are male fertile, but the seeds with a normal colour are male sterile. Cross-pollination of the transgenic plants to male-sterile plants propagates male-sterile seeds with high purity. Moreover, the transgene transmission rate through pollen of transgenic plants harbouring two pollen-disrupted genes is lower than that containing one pollen-disrupted gene. The MCS system has great potential to enhance the efficiency of maize male-sterile line propagation and commercial hybrid seed production. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Multilocation trial of potential selected mutant lines of groundnut (arachis hypogaea) at 3 location in Peninsular Malaysia

    International Nuclear Information System (INIS)

    Abdul Rahim Harun; Rusli Ibrahim; Khairuddin Abdul Rahim; Shuhaimi Shamsuddin

    2002-01-01

    Two fixed mutant lines of groundnut derived from cultivar Matjan were selected for their yield potential at M 1 0 generation. Multilocation trial of these mutants (MJ40/42 and MJ20/165-5) was carried out to evaluate genotype stability at different climate and soil types in Peninsular Malaysia. The mutant lines were planted and compared with their parent (Matjan) and control variety (MKT1). The identified locations were in Taiping (Perak), Machang (Kelantan), and Air Hitam (Johor). The soils at the locations were of the Serdang, Bungor and Rengam series, respectively. The trial was carried out simultaneously in the same year at each location. Mutant MJ20/165-5 showed stable performance at all location compared to other genotypes tested. Its yield was higher than the parent in Kelantan and Johor trial and showed similar performance in Perak. This mutant also showed better yield performance than the control varieties in the Kelantan trial. Meanwhile, mutant line MJ40/42 gave better yield in Kelantan and Johor but did not perform well in Perak as compared to its parent and control varieties. (Author)

  19. Extreme Emission Line Galaxies in CANDELS: Broad-Band Selected, Star-Bursting Dwarf Galaxies at Z greater than 1

    Science.gov (United States)

    vanderWel, A.; Straughn, A. N.; Rix, H.-W.; Finkelstein, S. L.; Koekemoer, A. M.; Weiner, B. J.; Wuyts, S.; Bell, E. F.; Faber, S. M.; Trump, J. R.; hide

    2012-01-01

    We identify an abundant population of extreme emission line galaxies (EELGs) at redshift z approx. 1.7 in the Cosmic Assembly Near-IR Deep Extragalactic Legacy Survey (CANDELS) imaging from Hubble Space Telescope/Wide Field Camera 3 (HST/WFC3). 69 EELG candidates are selected by the large contribution of exceptionally bright emission lines to their near-infrared broad-band magnitudes. Supported by spectroscopic confirmation of strong [OIII] emission lines . with rest-frame equivalent widths approx. 1000A in the four candidates that have HST/WFC3 grism observations, we conclude that these objects are galaxies with approx.10(exp 8) Solar Mass in stellar mass, undergoing an enormous starburst phase with M*/M* of only approx. 15 Myr. These bursts may cause outflows that are strong enough to produce cored dark matter profiles in low-mass galaxies. The individual star formation rates and the co-moving number density (3.7x10(exp -4) Mpc(sup -3) can produce in approx.4 Gyr much of the stellar mass density that is presently contained in 10(exp 8) - 10(exp 9) Solar Mass dwarf galaxies. Therefore, our observations provide a strong indication that many or even most of the stars in present-day dwarf galaxies formed in strong, short-lived bursts, mostly at z > 1.

  20. Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4.

    Science.gov (United States)

    Dale, James; James, Anthony; Paul, Jean-Yves; Khanna, Harjeet; Smith, Mark; Peraza-Echeverria, Santy; Garcia-Bastidas, Fernando; Kema, Gert; Waterhouse, Peter; Mengersen, Kerrie; Harding, Robert

    2017-11-14

    Banana (Musa spp.) is a staple food for more than 400 million people. Over 40% of world production and virtually all the export trade is based on Cavendish banana. However, Cavendish banana is under threat from a virulent fungus, Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) for which no acceptable resistant replacement has been identified. Here we report the identification of transgenic Cavendish with resistance to TR4. In our 3-year field trial, two lines of transgenic Cavendish, one transformed with RGA2, a gene isolated from a TR4-resistant diploid banana, and the other with a nematode-derived gene, Ced9, remain disease free. Transgene expression in the RGA2 lines is strongly correlated with resistance. Endogenous RGA2 homologs are also present in Cavendish but are expressed tenfold lower than that in our most resistant transgenic line. The expression of these homologs can potentially be elevated through gene editing, to provide non-transgenic resistance.

  1. Aspects of Salt Tolerance in a NaCl-Selected Stable Cell Line of Citrus sinensis1

    Science.gov (United States)

    Ben-Hayyim, Gozal; Kochba, Joshua

    1983-01-01

    A NaCl-tolerant cell line which was selected from ovular callus of `Shamouti' orange (Citrus sinensis L. Osbeck) proved to be a true cell line variant. This conclusion is based on the following observations. (a) Cells which have been removed from the selection pressure for at least four passages retain the same NaCl tolerance as do cells which are kept constantly on 0.2 molar NaCl. (b) Na+ and Cl− uptake are considerably lower in salt-tolerant cells (R-10) than in salt-sensitive cells (L-5) at a given external NaCl concentration. (c) Growth of salt-tolerant cells is markedly suppressed upon replacement of NaCl by KCl, whereas the growth of salt-sensitive cells is only slightly affected. Accumulation of K+ and Cl− accompanies the inhibition of growth. Experiments carried out with sodium and potassium sulfate suggest that the toxic effect is due to the accumulated Cl−. (d) Removal of Ca2+ from the growth medium severely inhibits the growth of salt-tolerant cells in the presence of NaCl, while it has a minor effect on growth of salt-sensitive cells in the presence of NaCl. (e) Electron micrographs show that the salt-tolerant cells have very big vacuoles when exposed to salt, while the size of the vacuoles of the salt-sensitive cells does not change. Images Fig. 3 PMID:16663067

  2. Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

    Directory of Open Access Journals (Sweden)

    Raquel Sampaio Oliveira

    2016-02-01

    Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  3. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

    Science.gov (United States)

    de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  4. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    Science.gov (United States)

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  5. Intrathymic selection of NK1.1+α/β T cell antigen receptor (TCR)+ cells in transgenic mice bearing TCR specific for chicken ovalbumin and restricted to I-Ad

    Science.gov (United States)

    Iwabuchi, Chikako; Iwabuchi, Kazuya; Nakagawa, Ken-ichi; Takayanagi, Toshiaki; Nishihori, Hiroki; Tone, Saori; Ogasawara, Kazumasa; Good, Robert A.; Onoé, Kazunori

    1998-01-01

    Generation and negative selection of NK1.1+α/β T cell receptor (TCR)+ thymocytes were analyzed using TCR-transgenic (B10.D2 × DO10)F1 and (C57BL/6 × DO10)F1 mice and Rag-1−/−/DO10 mice, which had been established by breeding and backcrossing between Rag-1−/− and DO10 mice. Almost all T cells from these mice were shown to bear Vα13/Vβ8.2 that is specific for chicken ovalbumin (cOVA) and restricted to I-Ad. A normal proportion of the NK1.1+ Vα13/Vβ8.2+ thymocytes was generated in these mice. However, the actual cell number of both NK1.1+ and NK1.1− thymocytes in I-Ad/d mice (positive selecting background) was larger than that in I-Ab/d mice (negative selecting background). Markedly low but significant proportions of NK1.1+ Vα13/Vβ8.2+ cells were detected in the spleens from I-Ad/d and I-Ab/d mice. It was shown that the splenic NK1.1+ T cells of the I-Ab/d mice were anergized against stimulation through TCR. When (B10.D2 × DO10)F1 and (C57BL/6 × DO10)F1 mice were given cOVA, extensive or intermediate elimination of NK1.1+α/βTCR+ thymocytes was induced in I-Ad/d or I-Ab/d mice, respectively. However, the clonal elimination was not as complete as that seen in the major NK1.1− thymocyte population. The present findings indicate that normal generation of NK1.1+α/βTCR+ thymocytes occurs in the absence of Vα14-Jα281 and that substantial negative selection operates on the NK1.1+α/βTCR+ cells. PMID:9653164

  6. Overexpression of host plant urease in transgenic silkworms.

    Science.gov (United States)

    Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

    2015-06-01

    Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

  7. Comparison of productive and carcass traits and economic value of lines selected for different criteria, slaughtered at similar weights

    Directory of Open Access Journals (Sweden)

    K. Szendrő

    2016-03-01

    Full Text Available The aim of the experiment was to compare 3 genetic groups, slaughtered at similar weights, to examine their productive and carcass traits and economic value. Three lines of the Pannon Breeding Programme, selected for different criteria, were examined in the experiment. Pannon Ka (PKa, maternal line does were inseminated with semen of PKa, Pannon White (PWhite or Pannon Large (PLarge, terminal line bucks. The kits (PKa×PKa, PWhite×PKa, PLarge×PKa; n=60 in each genetic group were weaned at 35 d of age and reared until 88, 83 and 79, respectively, when they reached similar body weights for slaughtering (2.8 kg. The weight gain of PLarge×PKa was the largest (51.0 g/d and that of PKa×PKa was the smallest (47.2 g/d, while PWhite×PKa (41.8 g/d was intermediate (P<0.001. Difference was found in feed conversion ratio between weaning and the age of slaughter  PKa×PKa: 3.03 respect to PWhite×PKa: 2.75 and PLarge×PKa: 2.66; , P<0.05. Dressing out percentage and ratio of hind part to reference carcass of PWhite×PKa, PLarge×PKa and PKa×PKa were 62.4 and 37.7, 61.8 and 37.5, 61.3 and 36.8%, respectively (P<0.01. Results show that PLarge×PKa rabbits were able to exceed the average economic indicators compared to other groups. It may be concluded that the production performance of growing rabbits was affected by the adult weight, but the carcass traits were influenced by the computer tomography (CT-based selection.

  8. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    Science.gov (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  9. Transgenic poplars with reduced lignin show impaired xylem conductivity, growth efficiency and survival

    Science.gov (United States)

    Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss

    2011-01-01

    We studied xylem anatomy and hydraulic architecture in 14 transgenic insertion events and a control line of hybrid poplar (Populus spp.) that varied in lignin content. Transgenic events had different levels of down-regulation of two genes encoding 4-coumarate:coenzyme A ligase (4CL). Two-year-old trees were characterized after...

  10. EDDINGTON RATIO DISTRIBUTION OF X-RAY-SELECTED BROAD-LINE AGNs AT 1.0 < z < 2.2

    International Nuclear Information System (INIS)

    Suh, Hyewon; Hasinger, Günther; Steinhardt, Charles; Silverman, John D.; Schramm, Malte

    2015-01-01

    We investigate the Eddington ratio distribution of X-ray-selected broad-line active galactic nuclei (AGNs) in the redshift range 1.0 < z < 2.2, where the number density of AGNs peaks. Combining the optical and Subaru/Fiber Multi Object Spectrograph near-infrared spectroscopy, we estimate black hole masses for broad-line AGNs in the Chandra Deep Field South (CDF-S), Extended Chandra Deep Field South (E-CDF-S), and the XMM-Newton Lockman Hole (XMM-LH) surveys. AGNs with similar black hole masses show a broad range of AGN bolometric luminosities, which are calculated from X-ray luminosities, indicating that the accretion rate of black holes is widely distributed. We find a substantial fraction of massive black holes accreting significantly below the Eddington limit at z ≲ 2, in contrast to what is generally found for luminous AGNs at high redshift. Our analysis of observational selection biases indicates that the “AGN cosmic downsizing” phenomenon can be simply explained by the strong evolution of the comoving number density at the bright end of the AGN luminosity function, together with the corresponding selection effects. However, one might need to consider a correlation between the AGN luminosity and the accretion rate of black holes, in which luminous AGNs have higher Eddington ratios than low-luminosity AGNs, in order to understand the relatively small fraction of low-luminosity AGNs with high accretion rates in this epoch. Therefore, the observed downsizing trend could be interpreted as massive black holes with low accretion rates, which are relatively fainter than less-massive black holes with efficient accretion

  11. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    Science.gov (United States)

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  12. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  13. Selection of the optimal combination of water vapor absorption lines for detection of temperature in combustion zones of mixing supersonic gas flows by diode laser absorption spectrometry

    International Nuclear Information System (INIS)

    Mironenko, V.R.; Kuritsyn, Yu.A.; Bolshov, M.A.; Liger, V.V.

    2017-01-01

    Determination of a gas medium temperature by diode laser absorption spectrometry (DLAS) is based on the measurement of integral intensities of the absorption lines of a test molecule (generally water vapor molecule). In case of local thermodynamic equilibrium temperature is inferred from the ratio of the integral intensities of two lines with different low energy levels. For the total gas pressure above 1 atm the absorption lines are broadened and one cannot find isolated well resolved water vapor absorption lines within relatively narrow spectral interval of fast diode laser (DL) tuning range (about 3 cm"−"1). For diagnostics of a gas object in the case of high temperature and pressure DLAS technique can be realized with two diode lasers working in different spectral regions with strong absorption lines. In such situation the criteria of the optimal line selection differs significantly from the case of narrow lines. These criteria are discussed in our work. The software for selection the optimal spectral regions using the HITRAN-2012 and HITEMP data bases is developed. The program selects spectral regions of DL tuning, minimizing the error of temperature determination δT/T, basing on the attainable experimental error of line intensity measurement δS. Two combinations of optimal spectral regions were selected – (1.392 & 1.343 μm) and (1.392 & 1.339 μm). Different algorithms of experimental data processing are discussed.

  14. 49 CFR 542.1 - Procedures for selecting new light duty truck lines that are likely to have high or low theft rates.

    Science.gov (United States)

    2010-10-01

    ... lines that are likely to have high or low theft rates. 542.1 Section 542.1 Transportation Other... OF TRANSPORTATION PROCEDURES FOR SELECTING LIGHT DUTY TRUCK LINES TO BE COVERED BY THE THEFT... or low theft rates. (a) Scope. This section sets forth the procedures for motor vehicle manufacturers...

  15. Fluoroorotic acid-selected Nicotiana plumbaginifolia cell lines with a stable thymine starvation phenotype have lost the thymine-regulated transcriptional program.

    Science.gov (United States)

    Santoso, D; Thornburg, R

    2000-08-01

    We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines.

  16. Fluoroorotic Acid-Selected Nicotiana plumbaginifolia Cell Lines with a Stable Thymine Starvation Phenotype Have Lost the Thymine-Regulated Transcriptional Program1

    Science.gov (United States)

    Santoso, Djoko; Thornburg, Robert

    2000-01-01

    We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines. PMID:10938367

  17. Rapid and selective expansion of nonclonotypic T cells in regulatory T cell-deficient, foreign antigen-specific TCR-transgenic scurfy mice: antigen-dependent expansion and TCR analysis.

    Science.gov (United States)

    Sharma, Rahul; Ju, Angela Chiao-Ying; Kung, John T; Fu, Shu Man; Ju, Shyr-Te

    2008-11-15

    Foreign Ag-specific TCR-transgenic (Tg) mice contain a small fraction of T cells bearing the endogenous Vbeta and Valpha chains as well as a population expressing an intermediate level of Tg TCR. Importantly, these minor nonclonotypic populations contain > or = 99% of the CD4(+)Foxp3(+) regulatory T cells (Treg) and, despite low overall Treg expression, peripheral tolerance is maintained. In the OT-II TCR (OVA-specific, Vbeta5(high)Valpha2(high)) Tg scurfy (Sf) mice (OT-II Sf) that lack Treg, nonclonotypic T cells markedly expanded in the periphery but not in the thymus. Expanded T cells expressed memory/effector phenotype and were enriched in blood and inflamed lungs. In contrast, Vbeta5(high)Valpha2(high) clonotypic T cells were not expanded, displayed the naive phenotype, and found mainly in the lymph nodes. Importantly, Vbeta5(neg) T cells were able to transfer multiorgan inflammation in Rag1(-/-) recipients. T cells bearing dual TCR (dual Vbeta or dual Valpha) were demonstrated frequently in the Vbeta5(int) and Valpha2(int) populations. Our study demonstrated that in the absence of Treg, the lack of peripheral expansion of clonotypic T cells is due to the absence of its high-affinity Ag OVA. Thus, the rapid expansion of nonclonotypic T cells in OT-II Sf mice must require Ag (self and foreign) with sufficient affinity. Our study has implications with respect to the roles of Ag and dual TCR in the selection and regulation of Treg and Treg-controlled Ag-dependent T cell expansion in TCR Tg and TCR Tg Sf mice, respectively.

  18. Transgenic oil palm: production and projection.

    Science.gov (United States)

    Parveez, G K; Masri, M M; Zainal, A; Majid, N A; Yunus, A M; Fadilah, H H; Rasid, O; Cheah, S C

    2000-12-01

    Oil palm is an important economic crop for Malaysia. Genetic engineering could be applied to produce transgenic oil palms with high value-added fatty acids and novel products to ensure the sustainability of the palm oil industry. Establishment of a reliable transformation and regeneration system is essential for genetic engineering. Biolistic was initially chosen as the method for oil palm transformation as it has been the most successful method for monocotyledons to date. Optimization of physical and biological parameters, including testing of promoters and selective agents, was carried out as a prerequisite for stable transformation. This has resulted in the successful transfer of reporter genes into oil palm and the regeneration of transgenic oil palm, thus making it possible to improve the oil palm through genetic engineering. Besides application of the Biolistics method, studies on transformation mediated by Agrobacterium and utilization of the green fluorescent protein gene as a selectable marker gene have been initiated. Upon the development of a reliable transformation system, a number of useful targets are being projected for oil palm improvement. Among these targets are high-oleate and high-stearate oils, and the production of industrial feedstock such as biodegradable plastics. The efforts in oil palm genetic engineering are thus not targeted as commodity palm oil. Due to the long life cycle of the palm and the time taken to regenerate plants in tissue culture, it is envisaged that commercial planting of transgenic palms will not occur any earlier than the year 2020.

  19. Analyses of pancreas development by generation of gfp transgenic zebrafish using an exocrine pancreas-specific elastaseA gene promoter

    International Nuclear Information System (INIS)

    Wan Haiyan; Korzh, Svitlana; Li Zhen; Mudumana, Sudha Puttur; Korzh, Vladimir; Jiang Yunjin; Lin Shuo; Gong Zhiyuan

    2006-01-01

    In contrast to what we know on development of endocrine pancreas, the formation of exocrine pancreas remains poorly understood. To create an animal model that allows observation of exocrine cell differentiation, proliferation, and morphogenesis in living animals, we used the zebrafish elastaseA (elaA) regulatory sequence to develop transgenic zebrafish that display highly specific exocrine pancreas expression of GFP in both larvae and adult. By following GFP expression, we found that the pancreas in early development was a relatively compact organ and later extended posterior along the intestine. By transferring the elaA:gfp transgene into slow muscle omitted mutant that is deficient in receiving Hedgehog signals, we further showed that Hedgehog signaling is required for exocrine morphogenesis but not for cell differentiation. We also applied the morpholino knockdown and toxin-mediated cell ablation approaches to this transgenic line. We showed that the development of exocrine pancreas is Islet-1 dependent. Injection of the diphtheria toxin A (DTA) construct under the elastaseA promoter resulted in selective ablation of exocrine cells while the endocrine cells and other endodermal derivatives (liver and intestine) were not affected. Thus, our works demonstrated the new transgenic line provided a useful experimental tool in analyzing exocrine pancreas development

  20. Single molecule Raman spectroscopic assay to detect transgene from GM plants.

    Science.gov (United States)

    Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph

    2017-09-01

    Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond.

    Science.gov (United States)

    Ting, Jonathan T; Feng, Guoping

    2014-01-01

    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more "extra" genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines.

  2. Design of the prototype of a beam transport line for handling and selection of low energy laser-driven beams

    Energy Technology Data Exchange (ETDEWEB)

    Schillaci, F., E-mail: francesco.schillaci@eli-beams.eu [INFN-LNS, Catania (Italy); Maggiore, M. [INFN-LNL, Legnaro (Italy); Cirrone, G.A.P.; Cuttone, G.; Pisciotta, P.; Costa, M.; Rifuggiato, D.; Romano, F. [INFN-LNS, Catania (Italy); Scuderi, V. [INFN-LNS, Catania (Italy); Institute of Physics of the ASCR, ELI-Beamlines Project, Prague (Czech Republic)

    2016-11-21

    A first prototype of transport beam-line for laser-driven ion beams to be used for the handling of particles accelerated by high-power laser interacting with solid targets has been realized at INFN. The goal is the production of a controlled and stable beam in terms of energy and angular spread. The beam-line consists of two elements: an Energy Selection System (ESS), already realized and characterized with both conventional and laser-accelerated beams, and a Permanent Magnet Quadrupole system (PMQ) designed, in collaboration with SIGMAPHI (Fr), to improve the ESS performances. In this work a description of the ESS system and some results of its characterization with conventional beams are reported, in order to provide a complete explanation of the acceptance calculation. Then, the matching with the PMQ system is presented and, finally, the results of preliminary simulations with a realistic laser-driven energy spectrum are discussed demonstrating the possibility to provide a good quality beam downstream the systems.

  3. TL transgenic mouse strains

    International Nuclear Information System (INIS)

    Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.

    1993-01-01

    As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)

  4. Segregation and expression of transgenes in the progenies of Bt ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-17

    Apr 17, 2012 ... segregation was observed in BC1F1, BC1F2 and F2 populations derived .... randomly chosen at the tillering stage respectively and were ground .... Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line ...

  5. Transgenic engineering of male-specific muscular hypertrophy

    DEFF Research Database (Denmark)

    Pirottin, D.; Grobet, L.; Adamantidis, A.

    2005-01-01

    Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 ...

  6. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    Science.gov (United States)

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  7. Experimental determination of line strengths for selected carbon monoxide and carbon dioxide absorption lines at temperatures between 295 and 1250 K

    International Nuclear Information System (INIS)

    Medvecz, P.J.; Nichols, K.M.

    1994-01-01

    Fourier transform infrared absorption spectroscopy has been used for the determination of the line strengths of 41 CO and CO 2 absorption lines at temperatures between 295 and 1250 K. The CO vibrational-rotational lines were from the P branch of the fundamental absorption band (2150--1950 cm -1 ) while the CO 2 vibrational-rotational lines were from the far wing of the R branch of the ν 3 fundamental band (2395--2380 cm -1 ). The intensities of the lines were measured from absorption spectra recorded in a high-temperature gas cell containing known concentrations of CO/CO 2 /N 2 gas mixtures at atmospheric pressure. Absorption spectra were recorded through the cell with the use of a moderate-resolution Fourier transform infrared spectrometer. The absorption spectra were mathematically corrected for distortions resulting from the finite resolution of the spectrometer and for peak overlap. Line strength measurements were made from the corrected peaks by using the Bouguer-Lambert law and assuming a Lorentzian line profile. The experimentally obtained line strengths were evaluated by statistical calculations, by consideration of the validity of the Bouguer-Lambert assumption for these data, by comparison with existing room-temperature and high-temperature data, and by comparison with theoretical calculations. For CO, the statistical analysis suggests that the reported values have an uncertainty of ±10--12%, which is similar to the observed discrepancies with other reported values at room temperature. At high temperatures, the difference between these data and previously reported data and theoretical predictions is less than 10%. For CO 2 , the statistical uncertainty associated with the line strength calculations is less than 5%, which is also the approximate level of agreement with existing room-temperature data

  8. A Comparison Between House Mouse Lines Selected for Attack Latency or Nest-Building : Evidence for a Genetic Basis of Alternative Behavioral Strategies

    NARCIS (Netherlands)

    Sluyter, Frans; Bult, Abel; Lynch, Carol B.; Oortmerssen, Geert A. van; Koolhaas, Jaap M.

    House mouse lines bidirectionally selected for either nest-building behavior or attack latency were tested for both attack latency and nest-building behavior under identical conditions. Male mice selected for high nest-building behavior had shorter attack latencies, i.e., were more aggressive, than

  9. Correlated effects of selection for immunity in White Leghorn chicken lines on natural antibodies and specific antibody responses to KLH and M. butyricum

    NARCIS (Netherlands)

    Minozzi, G.; Parmentier, H.K.; Mignon-Grasteau, S.; Nieuwland, M.G.B.; Bed'hom, B.; Gourichon, D.; Minvielle, F.; Pinard-van der Laan, M.H.

    2008-01-01

    Background - The effect of selection for three general immune response traits on primary antibody responses (Ab) to Mycobacterium butyricum or keyhole limpet hemocyanin (KLH) was studied in four experimental lines of White Leghorn chicken. Birds underwent 12 generations of selection for one of three

  10. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  11. Improving Blast Resistance of a Thermo-Sensitive Genic Male Sterile Rice Line GD-8S by Molecular Marker-Assisted Selection

    Directory of Open Access Journals (Sweden)

    Wu-ge LIU

    2008-09-01

    Full Text Available The broad-spectrum blast resistance gene Pi-1, from donor line BL122, was introduced into a thermo-sensitive genic male sterile rice line GD-8S, which possessed good grain quality but high susceptibility to rice blast, by using backcross breeding and molecular marker-assisted selection. Five elite improved male sterile lines, RGD8S-1, RGD8S-2, RGD8S-3, RGD8S-4 and RGD8S-5, were selected based on the results of molecular marker analysis, spikelet sterility, recovery rate of genetic background and agronomic traits. Thirty-three representative blast isolates collected from Guangdong Province, China were used to inoculate the improved lines and the original line GD-8S artificially. The resistance frequencies of the improved lines ranged from 76.47% to 100%, much higher than that of the original line GD-8S (9.09%. On the agronomic characters, there were no significant differences between the improved lines and GD-8S except for flag leaf length and panicle number per plant. The improved lines could be used for breeding hybrid rice with high blast resistance.

  12. Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

    Directory of Open Access Journals (Sweden)

    Tina Schäfer

    2012-01-01

    Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

  13. Transgene x environment interactions in genetically modified wheat.

    Science.gov (United States)

    Zeller, Simon L; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard

    2010-07-12

    The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  14. Transgene x environment interactions in genetically modified wheat.

    Directory of Open Access Journals (Sweden)

    Simon L Zeller

    Full Text Available BACKGROUND: The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM plants. METHODS AND FINDINGS: We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. CONCLUSIONS: Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  15. Development and drought tolerance assay of marker-free transgenic rice with OsAPX2 using biolistic particle-mediated co-transformation

    Directory of Open Access Journals (Sweden)

    Dan Feng

    2017-08-01

    Full Text Available Abiotic stresses such as drought, salinity, and low temperature cause–losses in rice production worldwide. The emergence of transgenic technology has enabled improvements in the drought resistance of rice plants and helped avert crop damage due to drought stress. Selectable marker genes conferring resistance to antibiotics or herbicides have been widely used to identify genetically modified plants. However, the use of such markers has limited the public acceptance of genetically modified organisms. Marker-free materials (i.e., those containing a single foreign gene may be more easily accepted by the public and more likely to find common use. In the present study, we created marker-free drought-tolerant transgenic rice plants using particle bombardment. Overall, 842 T0 plants overexpressing the rice ascorbate peroxidase-coding gene OsAPX2 were generated. Eight independent marker-free lines were identified from T1 seedlings using the polymerase chain reaction. The molecular characteristics of these lines were examined, including the expression level, copy number, and flanking sequences of OsAPX2, in the T2 progeny. A simulated drought test using polyethylene glycol and a drought-tolerance test of seedlings confirmed that the marker-free lines carrying OsAPX2 showed significantly improved drought tolerance in seedlings. In the field, the yield of the wild-type plant decreased by 60% under drought conditions compared with normal conditions. However, the transgenic line showed a yield loss of approximately 26%. The results demonstrated that marker-free transgenic lines significantly improved grain yield under drought-stressed conditions.

  16. CYT387, a selective JAK1/JAK2 inhibitor: in vitro assessment of kinase selectivity and preclinical studies using cell lines and primary cells from polycythemia vera patients.

    Science.gov (United States)

    Pardanani, A; Lasho, T; Smith, G; Burns, C J; Fantino, E; Tefferi, A

    2009-08-01

    Somatic mutations in Janus kinase 2 (JAK2), including JAK2V617F, result in dysregulated JAK-signal transducer and activator transcription (STAT) signaling, which is implicated in myeloproliferative neoplasm (MPN) pathogenesis. CYT387 is an ATP-competitive small molecule that potently inhibits JAK1/JAK2 kinases (IC(50)=11 and 18 nM, respectively), with significantly less activity against other kinases, including JAK3 (IC(50)=155 nM). CYT387 inhibits growth of Ba/F3-JAK2V617F and human erythroleukemia (HEL) cells (IC(50) approximately 1500 nM) or Ba/F3-MPLW515L cells (IC(50)=200 nM), but has considerably less activity against BCR-ABL harboring K562 cells (IC=58 000 nM). Cell lines harboring mutated JAK2 alleles (CHRF-288-11 or Ba/F3-TEL-JAK2) were inhibited more potently than the corresponding pair harboring mutated JAK3 alleles (CMK or Ba/F3-TEL-JAK3), and STAT-5 phosphorylation was inhibited in HEL cells with an IC(50)=400 nM. Furthermore, CYT387 selectively suppressed the in vitro growth of erythroid colonies harboring JAK2V617F from polycythemia vera (PV) patients, an effect that was attenuated by exogenous erythropoietin. Overall, our data indicate that the JAK1/JAK2 selective inhibitor CYT387 has potential for efficacious treatment of MPN harboring mutated JAK2 and MPL alleles.

  17. Transgenics, agroindustry and food sovereignty

    Directory of Open Access Journals (Sweden)

    Xavier Alejandro León Vega

    2014-10-01

    Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

  18. Assessment of DGAT1 and LEP gene polymorphisms in three Nelore (Bos indicus) lines selected for growth and their relationship with growth and carcass traits.

    Science.gov (United States)

    Souza, F R P; Mercadante, M E Z; Fonseca, L F S; Ferreira, L M S; Regatieri, I C; Ayres, D R; Tonhati, H; Silva, S L; Razook, A G; Albuquerque, L G

    2010-02-01

    The aim of this study was to analyze LEP and DGAT1 gene polymorphisms in 3 Nelore lines selected for growth and to evaluate their effects on growth and carcass traits. Traits analyzed were birth, weaning, and yearling weight, rump height, LM area, backfat thickness, and rump fat thickness obtained by ultrasound. Two SNP in the LEP gene [LEP 1620(A/G) and LEP 305(T/C)] and the K232A mutation in the DGAT1 gene were analyzed. The sample consisted of 357 Nelore heifers from 2 lines selected for yearling weight and a control line, established in 1980, at the Estação Experimental de Zootecnia de Sertãozinho (Sertãozinho, Brazil). Three genotypes were obtained for each marker. Differences in allele frequencies among the 3 lines were only observed for the DGAT1 K232A polymorphism, with the frequency of the A allele being greater in the control line than in the selected lines. The DGAT1 K232A mutation was associated only with rump height, whereas LEP 1620(A/G) was associated with weaning weight and LEP 305(T/C) with birth weight and backfat thickness. However, more studies, with larger data sets, are necessary before these makers can be used for marker-assisted selection.

  19. Post-mortem re-cloning of a transgenic red fluorescent protein dog.

    Science.gov (United States)

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun

    2011-12-01

    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.

  20. Enhanced leaf photosynthesis as a target to increase grain yield: insights from transgenic rice lines with variable Rieske FeS protein content in the cytochrome b6 /f complex.

    Science.gov (United States)

    Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants. © 2015 John Wiley & Sons Ltd.

  1. Transgenic mosquitoes expressing a phospholipase A(2 gene have a fitness advantage when fed Plasmodium falciparum-infected blood.

    Directory of Open Access Journals (Sweden)

    Ryan C Smith

    Full Text Available Genetically modified mosquitoes have been proposed as an alternative strategy to reduce the heavy burden of malaria. In recent years, several proof-of-principle experiments have been performed that validate the idea that mosquitoes can be genetically modified to become refractory to malaria parasite development.We have created two transgenic lines of Anophelesstephensi, a natural vector of Plasmodium falciparum, which constitutively secrete a catalytically inactive phospholipase A2 (mPLA2 into the midgut lumen to interfere with Plasmodium ookinete invasion. Our experiments show that both transgenic lines expressing mPLA2 significantly impair the development of rodent malaria parasites, but only one line impairs the development of human malaria parasites. In addition, when fed on malaria-infected blood, mosquitoes from both transgenic lines are more fecund than non-transgenic mosquitoes. Consistent with these observations, cage experiments with mixed populations of transgenic and non-transgenic mosquitoes show that the percentage of transgenic mosquitoes increases when maintained on Plasmodium-infected blood.Our results suggest that the expression of an anti-Plasmodium effector gene gives transgenic mosquitoes a fitness advantage when fed malaria-infected blood. These findings have important implications for future applications of transgenic mosquito technology in malaria control.

  2. IVF or IUI as first-line treatment in unexplained subfertility: the conundrum of treatment selection markers.

    Science.gov (United States)

    Tjon-Kon-Fat, R I; Tajik, P; Zafarmand, M H; Bensdorp, A J; Bossuyt, P M M; Oosterhuis, G J E; van Golde, R; Repping, S; Lambers, M D A; Slappendel, E; Perquin, D; Pelinck, M J; Gianotten, J; Maas, J W M; Eijkemans, M J C; van der Veen, F; Mol, B W; van Wely, M

    2017-05-01

    Are there treatment selection markers that could aid in identifying couples, with unexplained or mild male subfertility, who would have better chances of a healthy child with IVF with single embryo transfer (IVF-SET) than with IUI with ovarian stimulation (IUI-OS)? We did not find any treatment selection markers that were associated with better chances of a healthy child with IVF-SET instead of IUI-OS in couples with unexplained or mild male subfertility. A recent trial, comparing IVF-SET to IUI-OS, found no evidence of a difference between live birth rates and multiple pregnancy rates. It was suggested that IUI-OS should remain the first-line treatment instead of IVF-SET in couples with unexplained or mild male subfertility and female age between 18 and 38 years. The question remains whether there are some couples that may have higher pregnancy chances if treated with IVF-SET instead of IUI. We performed our analyses on data from the INeS trial, where couples with unexplained or mild male subfertility and an unfavourable prognosis for natural conception were randomly allocated to IVF-SET, IVF in a modified natural cycle or IUI-OS. In view of the aim of this study, we only used data of the comparison between IVF-SET (201 couples) and IUI-OS (207 couples). We pre-defined the following baseline characteristics as potential treatment selection markers: female age, ethnicity, smoking status, type of subfertility (primary/secondary), duration of subfertility, BMI, pre-wash total motile count and Hunault prediction score. For each potential treatment selection marker, we explored the association with the chances of a healthy child after IVF-SET and IUI-OS and tested if there was an interaction with treatment. Given the exploratory nature of our analysis, we used a P-value of 0.1. None of the markers were associated with higher chances of a healthy child from IVF-SET compared to IUI-OS (P-value for interaction >0.10). Since this is the first large study that looked at

  3. Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field.

    Science.gov (United States)

    Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat

    2018-04-01

    The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.

  4. Relationship Between Selected Strength and Power Assessments to Peak and Average Velocity of the Drive Block in Offensive Line Play.

    Science.gov (United States)

    Jacobson, Bert H; Conchola, Eric C; Smith, Doug B; Akehi, Kazuma; Glass, Rob G

    2016-08-01

    Jacobson, BH, Conchola, EC, Smith, DB, Akehi, K, and Glass, RG. Relationship between selected strength and power assessments to peak and average velocity of the drive block in offensive line play. J Strength Cond Res 30(8): 2202-2205, 2016-Typical strength training for football includes the squat and power clean (PC) and routinely measured variables include 1 repetition maximum (1RM) squat and 1RM PC along with the vertical jump (VJ) for power. However, little research exists regarding the association between the strength exercises and velocity of an actual on-the-field performance. The purpose of this study was to investigate the relationship of peak velocity (PV) and average velocity (AV) of the offensive line drive block to 1RM squat, 1RM PC, the VJ, body mass (BM), and body composition. One repetition maximum assessments for the squat and PC were recorded along with VJ height, BM, and percent body fat. These data were correlated with PV and AV while performing the drive block. Peal velocity and AV were assessed using a Tendo Power and Speed Analyzer as the linemen fired, from a 3-point stance into a stationary blocking dummy. Pearson product analysis yielded significant (p ≤ 0.05) correlations between PV and AV and the VJ, the squat, and the PC. A significant inverse association was found for both PV and AV and body fat. These data help to confirm that the typical exercises recommended for American football linemen is positively associated with both PV and AV needed for the drive block effectiveness. It is recommended that these exercises remain the focus of a weight room protocol and that ancillary exercises be built around these exercises. Additionally, efforts to reduce body fat are recommended.

  5. Serotonin-mediated central fatigue underlies increased endurance capacity in mice from lines selectively bred for high voluntary wheel running.

    Science.gov (United States)

    Claghorn, Gerald C; Fonseca, Ivana A T; Thompson, Zoe; Barber, Curtis; Garland, Theodore

    2016-07-01

    Serotonin (5-hydroxytryptamine; 5-HT) is implicated in central fatigue, and 5-HT1A pharmaceuticals are known to influence locomotor endurance in both rodents and humans. We studied the effects of a 5-HT1A agonist and antagonist on both forced and voluntary exercise in the same set of mice. This cohort of mice was taken from 4 replicate lines of mice that have been selectively bred for high levels of voluntary wheel running (HR) as compared with 4 non-selected control (C) lines. HR mice run voluntarily on wheels about 3× as many revolutions per day as compared with C, and have greater endurance during forced treadmill exercise. We hypothesized that drugs targeting serotonin receptors would have differential effects on locomotor behavior of HR and C mice. Subcutaneous injections of a 5-HT1A antagonist (WAY-100,635), a combination of 5-HT1A agonist and a 5-HT1A/1B partial agonist (8-OH-DPAT+pindolol), or physiological saline were given to separate groups of male mice before the start of each of three treadmill trials. The same manipulations were used later during voluntary wheel running on three separate nights. WAY-100,635 decreased treadmill endurance in HR but not C mice (dose by linetype interaction, P=0.0014). 8-OH-DPAT+pindolol affected treadmill endurance (PWheel running was reduced in HR but not C mice at the highest dose of 8-OH-DPAT+pindolol (dose by linetype, P=0.0221), but was not affected by WAY-100,635 treatment. These results provide further evidence that serotonin signaling is an important determinant of performance during both forced and voluntary exercise. Although the elevated wheel running of HR mice does not appear related to alterations in serotonin signaling, their enhanced endurance capacity does. More generally, our results indicate that both forced and voluntary exercise can be affected by an intervention that acts (primarily) centrally. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Direct visualization of membrane architecture of myelinating cells in transgenic mice expressing membrane-anchored EGFP.

    Science.gov (United States)

    Deng, Yaqi; Kim, BongWoo; He, Xuelian; Kim, Sunja; Lu, Changqing; Wang, Haibo; Cho, Ssang-Goo; Hou, Yiping; Li, Jianrong; Zhao, Xianghui; Lu, Q Richard

    2014-04-01

    Myelinogenesis is a complex process that involves substantial and dynamic changes in plasma membrane architecture and myelin interaction with axons. Highly ramified processes of oligodendrocytes in the central nervous system (CNS) make axonal contact and then extrapolate to wrap around axons and form multilayer compact myelin sheathes. Currently, the mechanisms governing myelin sheath assembly and axon selection by myelinating cells are not fully understood. Here, we generated a transgenic mouse line expressing the membrane-anchored green fluorescent protein (mEGFP) in myelinating cells, which allow live imaging of details of myelinogenesis and cellular behaviors in the nervous systems. mEGFP expression is driven by the promoter of 2'-3'-cyclic nucleotide 3'-phosphodiesterase (CNP) that is expressed in the myelinating cell lineage. Robust mEGFP signals appear in the membrane processes of oligodendrocytes in the CNS and Schwann cells in the peripheral nervous system (PNS), wherein mEGFP expression defines the inner layers of myelin sheaths and Schmidt-Lanterman incisures in adult sciatic nerves. In addition, mEGFP expression can be used to track the extent of remyelination after demyelinating injury in a toxin-induced demyelination animal model. Taken together, the membrane-anchored mEGFP expression in the new transgenic line would facilitate direct visualization of dynamic myelin membrane formation and assembly during development and process remodeling during remyelination after various demyelinating injuries.

  7. Transgenic Alfalfa Plants Expressing the Sweetpotato Orange Gene Exhibit Enhanced Abiotic Stress Tolerance

    Science.gov (United States)

    Wang, Zhi; Ke, Qingbo; Kim, Myoung Duck; Kim, Sun Ha; Ji, Chang Yoon; Jeong, Jae Cheol; Lee, Haeng-Soon; Park, Woo Sung; Ahn, Mi-Jeong; Li, Hongbing; Xu, Bingcheng; Deng, Xiping; Lee, Sang-Hoon; Lim, Yong Pyo; Kwak, Sang-Soo

    2015-01-01

    Alfalfa (Medicago sativa L.), a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr) is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye) under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants), three lines (SOR2, SOR3, and SOR8) selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV)-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands. PMID:25946429

  8. Seletividade de amonio-glufosinate isolado e em mistura com pyrithiobac-sodium em algodoeiro transgênico LL® Selectivity of ammonium-glufosinate applied alone or in mixture with pyrithiobac sodium in transgenic LL® cotton

    Directory of Open Access Journals (Sweden)

    G.B.P. Braz

    2012-12-01

    Full Text Available Com a recente introdução no Brasil de variedades transgênicas de algodoeiro que apresentam resistência ao amonio-glufosinate (LL®, há escassez de informações tanto a respeito da seletividade de reaplicações desse herbicida, quanto no que se refere a misturas com outros herbicidas. Objetivou-se no presente trabalho avaliar a seletividade de aplicações sequenciais de amonio-glufosinate isolado e em associação com pyrithiobac-sodium em algodão transgênico LL®. Dessa forma, foi instalado um experimento em delineamento de blocos casualizados em arranjo fatorial (3x3+1, empregando-se oito repetições. O primeiro fator correspondeu à aplicação dos tratamentos amonio-glufosinate (500 g ha-1 e amonio-glufosinate + pyrithiobac-sodium (500 + 42 g ha-1 e 500 + 56 g ha-1. O segundo fator foi o número de aplicações sequenciais em pós-emergência do algodoeiro (uma, duas ou três. O tratamento adicional foi composto por testemunha sem aplicação de herbicida. A associação do pyrithiobac-sodium ao amonio-glufosinate causou maiores níveis de fitointoxicação inicial, embora não tenham havido mais sintomas duas semanas após as aplicações. A qualidade de fibra do algodoeiro não foi influenciada por nenhum dos tratamentos herbicidas. O amonio-glufosinate isolado foi seletivo para o algodão LL® em até três aplicações em pós-emergência. O algodoeiro apresentou ainda tolerância a uma aplicação da mistura de amonio-glufosinate + pyrithiobac-sodium, e não se observou qualquer efeito negativo sobre a produtividade de algodão em caroço.Due to the recent introduction of transgenic cotton varities with resistance to ammonium-glufosinate (LL® in Brazil, there is a lack of information related both to the selectivity of sequential reapplications of ammonium-glufosinate and to tank mixture with other herbicides. This work aimed to evaluate the selectivity of sequential applications of ammonium-glufosinate isolated or in

  9. Transgene teknikker erstatter problematisk avl

    DEFF Research Database (Denmark)

    Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

    2016-01-01

    Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

  10. A built-in mechanism to mitigate the spread of insect-resistance and herbicide-tolerance transgenes into weedy rice populations.

    Directory of Open Access Journals (Sweden)

    Chengyi Liu

    Full Text Available BACKGROUND: The major challenge of cultivating genetically modified (GM rice (Oryza sativa at the commercial scale is to prevent the spread of transgenes from GM cultivated rice to its coexisting weedy rice (O. sativa f. spontanea. The strategic development of GM rice with a built-in control mechanism can mitigate transgene spread in weedy rice populations. METHODOLOGY/PRINCIPAL FINDINGS: An RNAi cassette suppressing the expression of the bentazon detoxifying enzyme CYP81A6 was constructed into the T-DNA which contained two tightly linked transgenes expressing the Bt insecticidal protein Cry1Ab and the glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, respectively. GM rice plants developed from this T-DNA were resistant to lepidopteran pests and tolerant to glyphosate, but sensitive to bentazon. The application of bentazon of 2000 mg/L at the rate of 40 mL/m(2, which is approximately the recommended dose for the field application to control common rice weeds, killed all F(2 plants containing the transgenes generated from the Crop-weed hybrids between a GM rice line (CGH-13 and two weedy rice strains (PI-63 and PI-1401. CONCLUSIONS/SIGNIFICANCE: Weedy rice plants containing transgenes from GM rice through gene flow can be selectively killed by the spray of bentazon when a non-GM rice variety is cultivated alternately in a few-year interval. The built-in control mechanism in combination of cropping management is likely to mitigate the spread of transgenes into weedy rice populations.

  11. A Built-In Mechanism to Mitigate the Spread of Insect-Resistance and Herbicide-Tolerance Transgenes into Weedy Rice Populations

    Science.gov (United States)

    Liu, Chengyi; Li, Jingjing; Gao, Jianhua; Shen, Zhicheng; Lu, Bao-Rong; Lin, Chaoyang

    2012-01-01

    Background The major challenge of cultivating genetically modified (GM) rice (Oryza sativa) at the commercial scale is to prevent the spread of transgenes from GM cultivated rice to its coexisting weedy rice (O. sativa f. spontanea). The strategic development of GM rice with a built-in control mechanism can mitigate transgene spread in weedy rice populations. Methodology/Principal Findings An RNAi cassette suppressing the expression of the bentazon detoxifying enzyme CYP81A6 was constructed into the T-DNA which contained two tightly linked transgenes expressing the Bt insecticidal protein Cry1Ab and the glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), respectively. GM rice plants developed from this T-DNA were resistant to lepidopteran pests and tolerant to glyphosate, but sensitive to bentazon. The application of bentazon of 2000 mg/L at the rate of 40 mL/m2, which is approximately the recommended dose for the field application to control common rice weeds, killed all F2 plants containing the transgenes generated from the Crop-weed hybrids between a GM rice line (CGH-13) and two weedy rice strains (PI-63 and PI-1401). Conclusions/Significance Weedy rice plants containing transgenes from GM rice through gene flow can be selectively killed by the spray of bentazon when a non-GM rice variety is cultivated alternately in a few-year interval. The built-in control mechanism in combination of cropping management is likely to mitigate the spread of transgenes into weedy rice populations. PMID:22359609

  12. Visual selection and maintenance of the cell lines with high plant regeneration ability and low ploidy level in Dianthus acicularis by monitoring with flow cytometry analysis.

    Science.gov (United States)

    Shiba, Tomonori; Mii, Masahiro

    2005-12-01

    Efficient plant regeneration system from cell suspension cultures was established in D. acicularis (2n=90) by monitoring ploidy level and visual selection of the cultures. The ploidy level of the cell cultures closely related to the shoot regeneration ability. The cell lines comprising original ploidy levels (2C+4C cells corresponding to DNA contents of G1 and G2 cells of diploid plant, respectively) showed high regeneration ability, whereas those containing the cells with 8C or higher DNA C-values showed low or no regeneration ability. The highly regenerable cell lines thus selected consisted of compact cell clumps with yellowish color and relatively moderate growth, suggesting that it is possible to select visually the highly regenerable cell lines with the original ploidy level. All the regenerated plantlets from the highly regenerable cell cultures exhibited normal phenotypes and no variations in ploidy level were observed by flow cytometry (FCM) analysis.

  13. Water absorption lines, 931-961 nm - Selected intensities, N2-collision-broadening coefficients, self-broadening coefficients, and pressure shifts in air

    Science.gov (United States)

    Giver, L. P.; Gentry, B.; Schwemmer, G.; Wilkerson, T. D.

    1982-01-01

    Intensities were measured for 97 lines of H2O vapor between 932 and 961 nm. The lines were selected for their potential usefulness for remote laser measurements of H2O vapor in the earth's atmosphere. The spectra were obtained with several different H2O vapor abundances and N2 broadening gas pressures; the spectral resolution was 0.046/cm FWHM. Measured H2O line intensities range from 7 x 10 to the -25th to 7 x 10 to the -22nd/cm per (molecules/sq cm). H2O self-broadening coefficients were measured for 13 of these strongest lines; the mean value was 0.5/cm per atm. N2-collision-broadening coefficients were measured for 73 lines, and the average was 0.11 cm per atm HWHM. Pressure shifts in air were determined for a sample of six lines between 948 and 950 nm; these lines shift to lower frequency by an amount comparable to 0.1 of the collision-broadened widths measured in air or N2. The measured intensities of many lines of 300-000 band are much larger than expected from prior computations, in some cases by over an order of magnitude. Coriolis interactions with the stronger 201-000 band appear to be the primary cause of the enhancement of these line intensities.

  14. Magnetic field selective enhancement of Li I lines comparing Li II line in laser ablated lithium plasma at 10- 2 mbar air ambient gas

    Science.gov (United States)

    Liu, Ping; Wu, Ding; Sun, Liying; Hai, Ran; Liu, Jiamin; Ding, Hongbin

    2017-11-01

    In this paper, the effect of magnetic field (1.1 T) on the atomic and ionic spectral emission of a laser produced lithium plasma at low pressure has been investigated. The experimental results indicate that magnetic field enhances the intensities of Li I spectral lines but reduces the Li II spectral lines intensities. In this study, two narrowband filters were placed before the ICCD camera to observe the evolution feature of Li II spectral line (548.39 nm, 2p3P2,1,0 → 2s3S1) and Li I spectral line (610.30 nm, 3d2P3/2, 5/2 → 2p2P1/2, 3/2), respectively. The plasma dynamic images show that with the magnetic field, the number density of luminous Li atoms is higher, while the number density of luminous Li ions is lower in comparison to the field-free case. The reduced Li II spectral intensities indicate that the quenching rate of Li ions in the excited state is greater than that without the magnetic field. The enhanced impact frequency of recombination indicates that magnetic field increases the recombination process of electron and Li ions. All of these observations strongly suggest that magnetic confinement increases the recombination process of the electrons with Li ions in the plasma, which results in the decrease in the intensity of Li II line. The results are useful for applying laser-induced breakdown spectroscopy (LIBS) to in-situ diagnose the processes of lithium wall conditioning in EAST tokamak.

  15. Effects of size, sex, and voluntary running speeds on costs of locomotion in lines of laboratory mice selectively bred for high wheel-running activity.

    Science.gov (United States)

    Rezende, Enrico L; Kelly, Scott A; Gomes, Fernando R; Chappell, Mark A; Garland, Theodore

    2006-01-01

    Selective breeding for over 35 generations has led to four replicate (S) lines of laboratory house mice (Mus domesticus) that run voluntarily on wheels about 170% more than four random-bred control (C) lines. We tested whether S lines have evolved higher running performance by increasing running economy (i.e., decreasing energy spent per unit of distance) as a correlated response to selection, using a recently developed method that allows for nearly continuous measurements of oxygen consumption (VO2) and running speed in freely behaving animals. We estimated slope (incremental cost of transport [COT]) and intercept for regressions of power (the dependent variable, VO2/min) on speed for 49 males and 47 females, as well as their maximum VO2 and speeds during wheel running, under conditions mimicking those that these lines face during the selection protocol. For comparison, we also measured COT and maximum aerobic capacity (VO2max) during forced exercise on a motorized treadmill. As in previous studies, the increased wheel running of S lines was mainly attributable to increased average speed, with males also showing a tendency for increased time spent running. On a whole-animal basis, combined analysis of males and females indicated that COT during voluntary wheel running was significantly lower in the S lines (one-tailed P=0.015). However, mice from S lines are significantly smaller and attain higher maximum speeds on the wheels; with either body mass or maximum speed (or both) entered as a covariate, the statistical significance of the difference in COT is lost (one-tailed P> or =0.2). Thus, both body size and behavior are key components of the reduction in COT. Several statistically significant sex differences were observed, including lower COT and higher resting metabolic rate in females. In addition, maximum voluntary running speeds were negatively correlated with COT in females but not in males. Moreover, males (but not females) from the S lines exhibited

  16. Selection of high quality male sterility line of Indica rice by field-free magnetic space inducement and its characters

    International Nuclear Information System (INIS)

    Yu Qiucheng; Huang Baocai; Zhang Zhiming; Liu Luxiang; Xu Guozhan

    2006-01-01

    The sterility lines Yu-08A was developed through the treatment of free-magnetic field for one year and selection by back-crossing with its parent in vitro and in the field from 1995 to 2000. The abortive fertility of sterility (Yu-08A) was stable and free-setting was 100%. The propagation yield of Yu-08A was 58.1% higher than that of Zhensan 97A, and the hybrid propagation of Yu-08A crossing-over with 97-066 was 62.6% higher than that of Zhensan 97A crossing-over with Minghui 63 in the same season and the same field. The yield of hybrid (Yuyou No.1, obtained from Yu-08A crossing-over with 97-066) was 5%8% higher than Zhensan 97A crossing-over with Minghuei 63. the rice quality of hybrid Yuyou No.1 reaches the second grade high-quality standard issued by the Ministry of Agriculture. (authors)

  17. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  18. Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

    Science.gov (United States)

    Balic, Anamaria; Mina, Mina

    2011-01-01

    Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

  19. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    Science.gov (United States)

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  20. A wheat calreticulin gene (TaCRT1) contributes to drought tolerance in transgenic arabidopsis

    International Nuclear Information System (INIS)

    Xiang, V.; Du, C.; Jia, H.; Song, M.; Wang, Y.; Ma, Z.

    2018-01-01

    The TaCRT1 gene is a member of calreticulin (CRT) family in wheat. In our previous study, we showed that transgenic tobacco lines over expressing wheat TaCRT1 showed enhanced tolerance to salt stress. This study aimed to determine whether TaCRT1 over expression would increase drought tolerance in transgenic Arabidopsis. Over expression of TaCRT1 in Arabidopsis plants enhances tolerance to drought stress. However, the transgenic line was found to retard the growth. Moreover, the transgenic line showed decreased water loss but higher sensitivity to exogenous abscisic acid (ABA) compared with the wild type (Col-0). Meanwhile, the transgenic line had the elevated endogenous ABA level. The semi-quantitative RT-PCR (sqRT-PCR) analysis showed that transcription levels of ABA-biosynthesizing gene (NCED3) and ABA-responsive gene (ABF3) were higher in the transgenic line than that in the Col-0 under normal condition. The above results implied that the TaCRT1 might be able to used as a potential target to improve the drought tolerance in crops. (author)

  1. High blood pressure in transgenic mice carrying the rat angiotensinogen gene.

    Science.gov (United States)

    Kimura, S; Mullins, J J; Bunnemann, B; Metzger, R; Hilgenfeldt, U; Zimmermann, F; Jacob, H; Fuxe, K; Ganten, D; Kaling, M

    1992-01-01

    Transgenic mice were generated by injecting the entire rat angiotensinogen gene into the germline of NMRI mice. The resulting transgenic animals were characterized with respect to hemodynamics, parameters of the renin angiotension system, and expression of the transgene. The transgenic line TGM(rAOGEN)123 developed hypertension with a mean arterial blood pressure of 158 mmHg in males and 132 mmHg in females. In contrast, the transgenic line TGM(rAOGEN)92 was not hypertensive. Rat angiotensinogen was detectable only in plasma of animals of line 123. Total plasma angiotensinogen and plasma angiotensin II concentrations were about three times as high as those of negative control mice. In TGM(rAOGEN)123 the transgene was highly expressed in liver and brain. Transcripts were also detected in heart, kidney and testis. In TGM(rAOGEN)92 the brain was the main expressing organ. In situ hybridization revealed an mRNA distribution in the brain of TGM(rAOGEN)123 similar to the one in rat. In TGM(rAOGEN)92 the expression pattern in the brain was aberrant. These data indicate that overexpression of the angiotensinogen gene in liver and brain leads to the development of hypertension in transgenic mice. The TGM(rAOGEN)123 constitutes a high angiotensin II type of hypertension and may provide a new experimental animal model to study the kinetics and function of the renin angiotensin system. Images PMID:1547785

  2. Generation of Marker- and/or Backbone-Free Transgenic Wheat Plants via Agrobacterium-Mediated Transformation.

    Science.gov (United States)

    Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin

    2016-01-01

    Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.

  3. Generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium-mediated transformation

    Directory of Open Access Journals (Sweden)

    Wang Genping

    2016-09-01

    Full Text Available Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154 and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154 were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium-mediated transformation will be useful to facilitate the creation of ‘clean’ GM wheat containing only the foreign genes of agronomic importance.

  4. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System

    Directory of Open Access Journals (Sweden)

    Zhanqi Dong

    2018-02-01

    Full Text Available The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV immediate early-1 (ie-1 gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-/sgRNA(-, Cas9(+/sgRNA(-, Cas9(-/sgRNA(+, and Cas9(+/sgRNA(+. We demonstrated that the Cas9(+/sgRNA(+ transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+/sgRNA(+ transgenic lines shows that the median lethal dose (LD50 is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+/sgRNA(+ transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  5. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System.

    Science.gov (United States)

    Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui

    2018-01-01

    The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 ( ie-1 ) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  6. The stability of transgene expression and effect of DNA methylation ...

    African Journals Online (AJOL)

    In this paper, we selected transgenic birch (Betula platyphylla Suk) plants, which included nonsilencing plants, transcriptional silence plants including TP96, TP74, TP73 and the post-transcriptional silence ones (TP67 and TP72). The transcription of the bgt gene in different tissues and organs were significantly different.

  7. Recent progress on technologies and applications of transgenic ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... embryo with DNA or viral vectors is possible, but this approach does not have the ... re-injecting them to cock testis is the most efficient and cost-effective strategy to .... transgenic manipulation, but also allows the selection of.

  8. DS read-out transcription in transgenic tomato plants

    NARCIS (Netherlands)

    Rudenko, George N.; Nijkamp, H. John J.; Hille, Jacques

    1994-01-01

    To select for Ds transposition in transgenic tomato plants a phenotypic excision assay, based on restoration of hygromycin phosphotransferase (HPT II) gene expression, was employed. Some tomato plants, however, expressed the marker gene even though the Ds had not excised. Read-out transcriptional

  9. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  10. Loss in MCL-1 function sensitizes non-Hodgkin's lymphoma cell lines to the BCL-2-selective inhibitor venetoclax (ABT-199)

    International Nuclear Information System (INIS)

    Phillips, D C; Xiao, Y; Lam, L T; Litvinovich, E; Roberts-Rapp, L; Souers, A J; Leverson, J D

    2015-01-01

    As a population, non-Hodgkin's lymphoma (NHL) cell lines positive for the t(14;18) translocation and/or possessing elevated BCL2 copy number (CN; BCL2 High ) are exquisitely sensitive to navitoclax or the B-cell lymphoma protein-2 (BCL-2)-selective inhibitor venetoclax. Despite this, some BCL2 High cell lines remain resistant to either agent. Here we show that the MCL-1-specific inhibitor A-1210477 sensitizes these cell lines to navitoclax. Chemical segregation of this synergy with the BCL-2-selective inhibitor venetoclax or BCL-X L -selective inhibitor A-1155463 indicated that MCL-1 and BCL-2 are the two key anti-apoptotic targets for sensitization. Similarly, the CDK inhibitor flavopiridol downregulated MCL-1 expression and synergized with venetoclax in BCL2 High NHL cell lines to a similar extent as A-1210477. A-1210477 also synergized with navitoclax in the majority of BCL2 Low NHL cell lines. However, chemical segregation with venetoclax or A-1155463 revealed that synergy was driven by BCL-X L inhibition in this population. Collectively these data emphasize that BCL2 status is predictive of venetoclax potency in NHL not only as a single agent, but also in the adjuvant setting with anti-tumorigenic agents that inhibit MCL-1 function. These studies also potentially identify a patient population (BCL2 Low ) that could benefit from BCL-X L (navitoclax)-driven combination therapy

  11. Study the chemical composition and agronomic traits for some durum wheat lines (Triticum durum) selected from M4-irradiated populations under drought stress

    International Nuclear Information System (INIS)

    Khalil, M.K.; Nesiem, M.R.A.; Kasem, M.K.M.; Basyouny, M.A.E.

    2010-01-01

    Field and laboratory experiments were carried out during four successive seasons 2005-2009 to access the effectiveness of gamma rays on inducing new drought tolerance lines from two durum wheat cultivars, i.e. Sohag 3 and Beni Suef 3. Irradiated grains (0, 150, 250 and 350 Gy) of both cultivars were sown and at harvest, 20 grains (M1) from each treatment were planted as in the first season. In the second season, grains of 61 plants were selected as they had the following higher criteria, i.e. yield, grain yield/plant, plant height, tillering and 100 grains weight. The selected variants should exceed by 50 % or more the control. Grains of the 61 selected plants were individually sown under drought or non-stress conditions, at the end of this season, six selected putative lines had superiority over their parents. The S1 and S2 lines have an excellent grain yield per plant under non stress condition as compared to Sohag3. The S3 and S4 lines have the superiority for grain yield per plant under drought condition as compared to Sohag 3. The B1 and B2 lines have the superiority for grain yield per plant under non stress condition comparing with Beni Suef 3. In the fourth season, growth, chemical composition and yield of the six putative lines as well as Sohag 3 and Beni Suef 3 were determined under non stress and drought conditions. The results showed a significant increase in the number of leaves on the main stem and tillering number/plant for S1, S2, B1 and B2 as compared each with their corresponding parent under non stress condition. Also, S3 and S4 lines had the same results comparing with Sohag 3 under drought condition. The results of S3 and S4 showed and accumulation of organic protective osmolytes such as sugar proline and free amino acids. As well as N, P, K and Ca concentrations in shoots and roots as compared to Sohag 3 .The putative lines S1, S2 and B1 showed a significant increase for grain yield per plant comparing with their controls under non stress

  12. Selective on-line detection of boronic acids and derivatives in high-performance liquid chromatography eluates by post-column reaction with alizarin

    NARCIS (Netherlands)

    Duval, F.L.; Wardani, P.A.; Zuilhof, H.; Beek, van T.A.

    2015-01-01

    An on-line high-performance liquid chromatography (HPLC) method for the rapid and selective detection of boronic acids in complex mixtures was developed. After optimization experiments at an HPLC flow rate of 0.40 mL/min, the HPLC-separated analytes were mixed post-column with a solution of 75 µM

  13. How and When Accentuation Influences Temporally Selective Attention and Subsequent Semantic Processing during On-Line Spoken Language Comprehension: An ERP Study

    Science.gov (United States)

    Li, Xiao-qing; Ren, Gui-qin

    2012-01-01

    An event-related brain potentials (ERP) experiment was carried out to investigate how and when accentuation influences temporally selective attention and subsequent semantic processing during on-line spoken language comprehension, and how the effect of accentuation on attention allocation and semantic processing changed with the degree of…

  14. Active galactic nuclei emission line diagnostics and the mass-metallicity relation up to redshift z ∼ 2: The impact of selection effects and evolution

    International Nuclear Information System (INIS)

    Juneau, Stéphanie; Bournaud, Frédéric; Daddi, Emanuele; Elbaz, David; Duc, Pierre-Alain; Gobat, Raphael; Jean-Baptiste, Ingrid; Le Floc'h, Émeric; Pannella, Maurilio; Schreiber, Corentin; Charlot, Stéphane; Lehnert, M. D.; Pacifici, Camilla; Trump, Jonathan R.; Brinchmann, Jarle; Dickinson, Mark

    2014-01-01

    Emission line diagnostic diagrams probing the ionization sources in galaxies, such as the Baldwin-Phillips-Terlevich (BPT) diagram, have been used extensively to distinguish active galactic nuclei (AGN) from purely star-forming galaxies. However, they remain poorly understood at higher redshifts. We shed light on this issue with an empirical approach based on a z ∼ 0 reference sample built from ∼300,000 Sloan Digital Sky Survey galaxies, from which we mimic selection effects due to typical emission line detection limits at higher redshift. We combine this low-redshift reference sample with a simple prescription for luminosity evolution of the global galaxy population to predict the loci of high-redshift galaxies on the BPT and Mass-Excitation (MEx) diagnostic diagrams. The predicted bivariate distributions agree remarkably well with direct observations of galaxies out to z ∼ 1.5, including the observed stellar mass-metallicity (MZ) relation evolution. As a result, we infer that high-redshift star-forming galaxies are consistent with having normal interstellar medium (ISM) properties out to z ∼ 1.5, after accounting for selection effects and line luminosity evolution. Namely, their optical line ratios and gas-phase metallicities are comparable to that of low-redshift galaxies with equivalent emission-line luminosities. In contrast, AGN narrow-line regions may show a shift toward lower metallicities at higher redshift. While a physical evolution of the ISM conditions is not ruled out for purely star-forming galaxies and may be more important starting at z ≳ 2, we find that reliably quantifying this evolution is hindered by selections effects. The recipes provided here may serve as a basis for future studies toward this goal. Code to predict the loci of galaxies on the BPT and MEx diagnostic diagrams and the MZ relation as a function of emission line luminosity limits is made publicly available.

  15. Active galactic nuclei emission line diagnostics and the mass-metallicity relation up to redshift z ∼ 2: The impact of selection effects and evolution

    Energy Technology Data Exchange (ETDEWEB)

    Juneau, Stéphanie; Bournaud, Frédéric; Daddi, Emanuele; Elbaz, David; Duc, Pierre-Alain; Gobat, Raphael; Jean-Baptiste, Ingrid; Le Floc' h, Émeric; Pannella, Maurilio; Schreiber, Corentin [CEA-Saclay, DSM/IRFU/SAp, F-91191 Gif-sur-Yvette (France); Charlot, Stéphane; Lehnert, M. D.; Pacifici, Camilla [UPMC-CNRS, UMR 7095, Institut d' Astrophysique de Paris, F-75014 Paris (France); Trump, Jonathan R. [University of California Observatories/Lick Observatory, University of California, Santa Cruz, CA 95064 (United States); Brinchmann, Jarle [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Dickinson, Mark, E-mail: stephanie.juneau@cea.fr [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States)

    2014-06-10

    Emission line diagnostic diagrams probing the ionization sources in galaxies, such as the Baldwin-Phillips-Terlevich (BPT) diagram, have been used extensively to distinguish active galactic nuclei (AGN) from purely star-forming galaxies. However, they remain poorly understood at higher redshifts. We shed light on this issue with an empirical approach based on a z ∼ 0 reference sample built from ∼300,000 Sloan Digital Sky Survey galaxies, from which we mimic selection effects due to typical emission line detection limits at higher redshift. We combine this low-redshift reference sample with a simple prescription for luminosity evolution of the global galaxy population to predict the loci of high-redshift galaxies on the BPT and Mass-Excitation (MEx) diagnostic diagrams. The predicted bivariate distributions agree remarkably well with direct observations of galaxies out to z ∼ 1.5, including the observed stellar mass-metallicity (MZ) relation evolution. As a result, we infer that high-redshift star-forming galaxies are consistent with having normal interstellar medium (ISM) properties out to z ∼ 1.5, after accounting for selection effects and line luminosity evolution. Namely, their optical line ratios and gas-phase metallicities are comparable to that of low-redshift galaxies with equivalent emission-line luminosities. In contrast, AGN narrow-line regions may show a shift toward lower metallicities at higher redshift. While a physical evolution of the ISM conditions is not ruled out for purely star-forming galaxies and may be more important starting at z ≳ 2, we find that reliably quantifying this evolution is hindered by selections effects. The recipes provided here may serve as a basis for future studies toward this goal. Code to predict the loci of galaxies on the BPT and MEx diagnostic diagrams and the MZ relation as a function of emission line luminosity limits is made publicly available.

  16. [Biofuels, food security and transgenic crops].

    Science.gov (United States)

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.

  17. PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation.

    Science.gov (United States)

    Nath, Manoj; Garg, Bharti; Sahoo, Ranjan Kumar; Tuteja, Narendra

    2015-01-01

    Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na(+)) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na(+) level, respectively. All the varieties and transgenic lines of rice accumulate differential Na(+) ions in root and shoot. However, roots accumulate high Na(+) as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na(+) transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na(+) transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.

  18. Constitutive expression of a fungus-inducible carboxylesterase improves disease resistance in transgenic pepper plants.

    Science.gov (United States)

    Ko, Moonkyung; Cho, Jung Hyun; Seo, Hyo-Hyoun; Lee, Hyun-Hwa; Kang, Ha-Young; Nguyen, Thai Son; Soh, Hyun Cheol; Kim, Young Soon; Kim, Jeong-Il

    2016-08-01

    Resistance against anthracnose fungi was enhanced in transgenic pepper plants that accumulated high levels of a carboxylesterase, PepEST in anthracnose-susceptible fruits, with a concurrent induction of antioxidant enzymes and SA-dependent PR proteins. A pepper esterase gene (PepEST) is highly expressed during the incompatible interaction between ripe fruits of pepper (Capsicum annuum L.) and a hemibiotrophic anthracnose fungus (Colletotrichum gloeosporioides). In this study, we found that exogenous application of recombinant PepEST protein on the surface of the unripe pepper fruits led to a potentiated state for disease resistance in the fruits, including generation of hydrogen peroxide and expression of pathogenesis-related (PR) genes that encode mostly small proteins with antimicrobial activity. To elucidate the role of PepEST in plant defense, we further developed transgenic pepper plants overexpressing PepEST under the control of CaMV 35S promoter. Molecular analysis confirmed the establishment of three independent transgenic lines carrying single copy of transgenes. The level of PepEST protein was estimated to be approximately 0.002 % of total soluble protein in transgenic fruits. In response to the anthracnose fungus, the transgenic fruits displayed higher expression of PR genes, PR3, PR5, PR10, and PepThi, than non-transgenic control fruits did. Moreover, immunolocalization results showed concurrent localization of ascorbate peroxidase (APX) and PR3 proteins, along with the PepEST protein, in the infected region of transgenic fruits. Disease rate analysis revealed significantly low occurrence of anthracnose disease in the transgenic fruits, approximately 30 % of that in non-transgenic fruits. Furthermore, the transgenic plants also exhibited resistance against C. acutatum and C. coccodes. Collectively, our results suggest that overexpression of PepEST in pepper confers enhanced resistance against the anthracnose fungi by activating the defense signaling

  19. Expression of transgenes targeted to the Gt(ROSA26Sor locus is orientation dependent.

    Directory of Open Access Journals (Sweden)

    Douglas Strathdee

    2006-12-01

    Full Text Available Targeting transgenes to a chosen location in the genome has a number of advantages. A single copy of the DNA construct can be inserted by targeting into regions of chromatin that allow the desired developmental and tissue-specific expression of the transgene.In order to develop a reliable system for reproducibly expressing transgenes it was decided to insert constructs at the Gt(ROSA26Sor locus. A cytomegalovirus (CMV promoter was used to drive expression of the Tetracycline (tet transcriptional activator, rtTA2(s-M2, and test the effectiveness of using the ROSA26 locus to allow transgene expression. The tet operator construct was inserted into one allele of ROSA26 and a tet responder construct controlling expression of EGFP was inserted into the other allele.Expression of the targeted transgenes was shown to be affected by both the presence of selectable marker cassettes and by the orientation of the transgenes with respect to the endogenous ROSA26 promoter. These results suggest that transcriptional interference from the endogenous gene promoter or from promoters in the selectable marker cassettes may be affecting transgene expression at the locus. Additionally we have been able to determine the optimal orientation for transgene expression at the ROSA26 locus.

  20. Syringolin A selectively labels the 20 S proteasome in murine EL4 and wild-type and bortezomib-adapted leukaemic cell lines.

    Science.gov (United States)

    Clerc, Jérôme; Florea, Bogdan I; Kraus, Marianne; Groll, Michael; Huber, Robert; Bachmann, André S; Dudler, Robert; Driessen, Christoph; Overkleeft, Herman S; Kaiser, Markus

    2009-11-02

    The natural product syringolin A (SylA) is a potent proteasome inhibitor with promising anticancer activities. To further investigate its potential as a lead structure, selectivity profiling with cell lysates was performed. At therapeutic concentrations, a rhodamine-tagged SylA derivative selectively bound to the 20 S proteasome active sites without detectable off-target labelling. Additional profiling with lysates of wild-type and bortezomib-adapted leukaemic cell lines demonstrated the retention of this proteasome target and subsite selectivity as well as potency even in clinically relevant cell lines. Our studies, therefore, propose that further development of SylA might indeed result in an improved small molecule for the treatment of leukaemia.

  1. The Mechanism of the Silencing of a Transgene, NCED3‐LUC, in Arabidopsis Thaliana

    KAUST Repository

    Zhao, Junsong

    2011-06-20

    The Arabidopsis thaliana NCED3‐LUC transgenic line was constructed by several groups to study the regulatory network of the NCED3 gene, the protein of which catalyzes the rate‐limiting step of ABA biosynthesis under drought. The transgenic luciferase gene is expressed when the plants encounter drought stress. Intriguingly, this transgenic luciferase gene is silenced after propagation for several generations. To determine the mechanism of this gene silencing, we used a forward genetics approach. The seeds of NCED3‐LUC (referred as the ‘wild type’) were mutagenized by ethane methyl sulfonate (EMS). One mutant line, denoted as #73, with recovered luciferase activity was selected for further study. Analysis of the methylation status by bisulfite sequencing revealed that the transgenic NCED3 promoter in the #73 mutant had less methylation than the wild type. Demethylation was also evident for the endogenous NCED3 promoter and retrotransposon AtSN1 in the #73 mutant. The phenotype of #73 mutant includes small size, rapid dehydration rate, altered morphology, and a thin epicuticular wax layer. By use of map‐based cloning, the region containing the mutated gene was delimited to a contig of two BAC clones, F11F19 and F9C22, on chromosome 2. Our results indicate that NCED3‐LUC gene silencing results from hypermethylation of its promoter region, but additional study is required to determine the exact position of the mutated gene and to fully understand the mechanism of NCED3‐LUC silencing. 4 ACKNOWLEDGEMENTS I would like to take this opportunity to thank my committee chair, Professor Jian‐Kang Zhu, who is also the supervisor of my master’s thesis, for his guidance throughout the course of this research. I also would like to thank my committee members, Professor Liming Xiong and Professor Samir Hamdan, for their patience and support in reviewing my thesis. My appreciation also goes to Dr. Zhenyu Wang for taking time to teach me basic experimental skills and

  2. Untranslatable tospoviral NSs fragment coupled with L conserved region enhances transgenic resistance against the homologous virus and a serologically unrelated tospovirus.

    Science.gov (United States)

    Yazhisai, Uthaman; Rajagopalan, Prem Anand; Raja, Joseph A J; Chen, Tsung-Chi; Yeh, Shyi-Dong

    2015-08-01

    Tospoviruses cause severe damages to important crops worldwide. In this study, Nicotiana benthamiana transgenic lines carrying individual untranslatable constructs comprised of the conserved region of the L gene (denoted as L), the 5' half of NSs coding sequence (NSs) or the antisense fragment of whole N coding sequence (N) of Watermelon silver mottle virus (WSMoV), individually or in combination, were generated. A total of 15-17 transgenic N. benthamiana lines carrying individual transgenes were evaluated against WSMoV and the serologically unrelated Tomato spotted wilt virus (TSWV). Among lines carrying single or chimeric transgenes, the level of resistance ranged from susceptible to completely resistant against WSMoV. From the lines carrying individual transgenes and highly resistant to WSMoV (56-63% of lines assayed), 30% of the L lines (3/10 lines assayed) and 11% of NSs lines (1/9 lines assayed) were highly resistant against TSWV. The chimeric transgenes provided higher degrees of resistance against WSMoV (80-88%), and the NSs fragment showed an additive effect to enhance the resistance to TSWV. Particularly, the chimeric transgenes with the triple combination of fragments, namely L/NSs/N or HpL/NSs/N (a hairpin construct), provided a higher degree of resistance (both 50%, with 7/14 lines assayed) against TSWV. Our results indicate that the untranslatable NSs fragment is able to enhance the transgenic resistance conferred by the L conserved region. The better performance of L/NSs/N and HpL/NSs/N in transgenic N. benthamiana lines suggests their potential usefulness in generating high levels of enhanced transgenic resistance against serologically unrelated tospoviruses in agronomic crops.

  3. ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.

    Directory of Open Access Journals (Sweden)

    Donal McHugh

    Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.

  4. Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains.

    Science.gov (United States)

    Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A

    2017-02-01

    Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T 3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.

  5. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  6. The effects of disruptive and stabilizing selection on body size in Drosophila melanogaster. III. Genetic analysis of two lines with different reactions to disruptive selection with mating of opposite extremes

    NARCIS (Netherlands)

    Bos, M.; Scharloo, W.

    1974-01-01

    A genetic analysis was made of two lines which when subjected to disruptive selection with compulsary mating of opposite extremes (D−) showed a different response viz. one, D−-1, showing predominantly an increase of environmental variance and possibly interaction variance, the other, D−-2, showing

  7. Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field.

    Science.gov (United States)

    Brunner, Susanne; Stirnweis, Daniel; Diaz Quijano, Carolina; Buesing, Gabriele; Herren, Gerhard; Parlange, Francis; Barret, Pierre; Tassy, Caroline; Sautter, Christof; Winzeler, Michael; Keller, Beat

    2012-05-01

    Resistance (R) genes protect plants very effectively from disease, but many of them are rapidly overcome when present in widely grown cultivars. To overcome this lack of durability, strategies that increase host resistance diversity have been proposed. Among them is the use of multilines composed of near-isogenic lines (NILs) containing different disease resistance genes. In contrast to classical R-gene introgression by recurrent backcrossing, a transgenic approach allows the development of lines with identical genetic background, differing only in a single R gene. We have used alleles of the resistance locus Pm3 in wheat, conferring race-specific resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici), to develop transgenic wheat lines overexpressing Pm3a, Pm3c, Pm3d, Pm3f or Pm3g. In field experiments, all tested transgenic lines were significantly more resistant than their respective nontransformed sister lines. The resistance level of the transgenic Pm3 lines was determined mainly by the frequency of virulence to the particular Pm3 allele in the powdery mildew population, Pm3 expression levels and most likely also allele-specific properties. We created six two-way multilines by mixing seeds of the parental line Bobwhite and transgenic Pm3a, Pm3b and Pm3d lines. The Pm3 multilines were more resistant than their components when tested in the field. This demonstrates that the difference in a single R gene is sufficient to cause host-diversity effects and that multilines of transgenic Pm3 wheat lines represent a promising strategy for an effective and sustainable use of Pm3 alleles. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  8. Improved antioxidant activity in transgenic Perilla frutescens plants via overexpression of the γ-tocopherol methyltransferase (γ-tmt) gene.

    Science.gov (United States)

    Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min

    2015-09-01

    The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis.

  9. An optimized procedure for preconcentration, determination and on-line recovery of palladium using highly selective diphenyldiketone-monothiosemicarbazone modified silica gel

    International Nuclear Information System (INIS)

    Sharma, R.K.; Pandey, Amit; Gulati, Shikha; Adholeya, Alok

    2012-01-01

    Highlights: ► Diphenyldiketone-monothiosemicarbazone modified silica gel. ► Highly selective, efficient and reusable chelating resin. ► Solid phase extraction system for on-line separation and preconcentration of Pd(II) ions. ► Application in catalytic converter and spiked tap water samples for on-line recovery of Pd(II) ions. - Abstract: A novel, highly selective, efficient and reusable chelating resin, diphenyldiketone-monothiosemicarbazone modified silica gel, was prepared and applied for the on-line separation and preconcentration of Pd(II) ions in catalytic converter and spiked tap water samples. Several parameters like effect of pH, sample volume, flow rate, type of eluent, and influence of various ionic interferences, etc. were evaluated for effective adsorption of palladium at trace levels. The resin was found to be highly selective for Pd(II) ions in the pH range 4–5 with a very high sorption capacity of 0.73 mmol/g and preconcentration factor of 335. The present environment friendly procedure has also been applied for large-scale extraction by employing the use of newly designed reactor in which on-line separation and preconcentration of Pd can be carried out easily and efficiently in short duration of time.

  10. Evaluation of growth characters and yield components for six durum wheat lines (triticum durum deaf) selected from M4 and M5 - irradiated population under drought conditions

    International Nuclear Information System (INIS)

    Nesiem, M. R. A.; Kassem, M. K. M.; Basyouny, M. A. E.

    2012-12-01

    Grain of two durum wheat cultivars, Sohag 3 and Beni Suef 3 were irradiated with gamma ray doses 0, 150, 250 and 350 Gy to obtain new durum wheat lines, characterized by high yielding and drought tolerance. Irradiated grains were cultivated in the field under normal and drought conditions 2005 - 2010 seasons. 20 grain (M 1 ) from each treatment was planed as in the first season. In the second season (M 2 ), grains of 61 plants were selected as thy had the following higher criteria, i.e yield, grain yield / plant, plant height, tillering and 100 grains weight. The selected variants should exceed by 50% or more than control. Grains of the 61 selected plants were individually sown under normal and drought condition. At the end of this season, six selected putative line had superiority over their parents. The S1 and S2 lines had an excellent grain yield per plant under normal condition but S3 and S4 lines had superiority for grain yield per plant under drought condition as compared to parents Sohag3. B1 and B2 lines had the superiority for grain per plant under normal condition comparing with the parent Beni Suef3. In the fourth season (M4),growth, chemical compositions and yield as well as its components of the six putative lines as well as the parents Sohag 3 and Beni Suef 3 were determined under normal and drought conditions. The results showed a significant under normal and drought conditions. The results showed a significant increase in the number of leaves on the main stem and tillering number / plant for S1, S2, B1, B2 as compared with their corresponding parent under normal condition. Also, S3 and S4 line shad the same results comparing with the parent Sohag3 under drought condition. The results of S3 and S4 showed an accumulation of organic protective asmolytes such as sugar, proline and free amino acid. As well as N, P, K, and Ca concentrations in shoots and roots as compared to the parent Sohag 3 . The putative line S1, A2 and B1 showed significant increase

  11. Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

    Directory of Open Access Journals (Sweden)

    Yu-Guo Yuan

    2014-01-01

    Full Text Available To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC containing a hybrid goat β-lactoglobulin (BLG promoter/cytomegalovirus (CMV enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT. Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2% from the non-transfected line and five recipients delivered six kids (1.8% from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P<0.05. Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.

  12. Optimization of cell line development in the GS-CHO expression system using a high-throughput, single cell-based clone selection system.

    Science.gov (United States)

    Nakamura, Tsuyoshi; Omasa, Takeshi

    2015-09-01

    Therapeutic antibodies are commonly produced by high-expressing, clonal and recombinant Chinese hamster ovary (CHO) cell lines. Currently, CHO cells dominate as a commercial production host because of their ease of use, established regulatory track record, and safety profile. CHO-K1SV is a suspension, protein-free-adapted CHO-K1-derived cell line employing the glutamine synthetase (GS) gene expression system (GS-CHO expression system). The selection of high-producing mammalian cell lines is a crucial step in process development for the production of therapeutic antibodies. In general, cloning by the limiting dilution method is used to isolate high-producing monoclonal CHO cells. However, the limiting dilution method is time consuming and has a low probability of monoclonality. To minimize the duration and increase the probability of obtaining high-producing clones with high monoclonality, an automated single cell-based clone selector, the ClonePix FL system, is available. In this study, we applied the high-throughput ClonePix FL system for cell line development using CHO-K1SV cells and investigated efficient conditions for single cell-based clone selection. CHO-K1SV cell growth at the pre-picking stage was improved by optimizing the formulation of semi-solid medium. The efficiency of picking and cell growth at the post-picking stage was improved by optimization of the plating time without decreasing the diversity of clones. The conditions for selection, including the medium formulation, were the most important factors for the single cell-based clone selection system to construct a high-producing CHO cell line. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  13. FHL1 reduces dystrophy in transgenic mice overexpressing FSHD muscular dystrophy region gene 1 (FRG1.

    Directory of Open Access Journals (Sweden)

    Sandra J Feeney

    Full Text Available Facioscapulohumeral muscular dystrophy (FSHD is an autosomal-dominant disease with no effective treatment. The genetic cause of FSHD is complex and the primary pathogenic insult underlying the muscle disease is unknown. Several disease candidate genes have been proposed including DUX4 and FRG1. Expression analysis studies of FSHD report the deregulation of genes which mediate myoblast differentiation and fusion. Transgenic mice overexpressing FRG1 recapitulate the FSHD muscular dystrophy phenotype. Our current study selectively examines how increased expression of FRG1 may contribute to myoblast differentiation defects. We generated stable C2C12 cell lines overexpressing FRG1, which exhibited a myoblast fusion defect upon differentiation. To determine if myoblast fusion defects contribute to the FRG1 mouse dystrophic phenotype, this strain was crossed with skeletal muscle specific FHL1-transgenic mice. We previously reported that FHL1 promotes myoblast fusion in vitro and FHL1-transgenic mice develop skeletal muscle hypertrophy. In the current study, FRG1 mice overexpressing FHL1 showed an improvement in the dystrophic phenotype, including a reduced spinal kyphosis, increased muscle mass and myofiber size, and decreased muscle fibrosis. FHL1 expression in FRG1 mice, did not alter satellite cell number or activation, but enhanced myoblast fusion. Primary myoblasts isolated from FRG1 mice showed a myoblast fusion defect that was rescued by FHL1 expression. Therefore, increased FRG1 expression may contribute to a muscular dystrophy phenotype resembling FSHD by impairing myoblast fusion, a defect that can be rescued by enhanced myoblast fusion via expression of FHL1.

  14. RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

    Science.gov (United States)

    Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

    2017-01-01

    Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

  15. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    Science.gov (United States)

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  16. A novel match-line selective charging scheme for high-speed, low-power and noise-tolerant content-addressable memory

    KAUST Repository

    Hasan, Muhammad Mubashwar; Rashid, Abdul B M Harun Ur; Hussain, Muhammad Mustafa

    2010-01-01

    Content-addressable memory (CAM) is an essential component for high-speed lookup intensive applications. This paper presents a match-line selective charging technique to increase speed and reduce the energy per bit per search while increasing the noise-tolerance. Simulation in TSMC 0.18 μm technology with 64×72 Ternary CAM shows the match-line energy reduction of 45% compared to the conventional currentsaving scheme with the reduction of minimum cycle time by 68% and the improvement of noise-tolerance by 96%.

  17. A novel match-line selective charging scheme for high-speed, low-power and noise-tolerant content-addressable memory

    KAUST Repository

    Hasan, Muhammad Mubashwar

    2010-06-01

    Content-addressable memory (CAM) is an essential component for high-speed lookup intensive applications. This paper presents a match-line selective charging technique to increase speed and reduce the energy per bit per search while increasing the noise-tolerance. Simulation in TSMC 0.18 μm technology with 64×72 Ternary CAM shows the match-line energy reduction of 45% compared to the conventional currentsaving scheme with the reduction of minimum cycle time by 68% and the improvement of noise-tolerance by 96%.

  18. Direct determination of Ti content in sunscreens with laser-induced breakdown spectroscopy: Line selection method for high TiO{sub 2} nanoparticle concentration

    Energy Technology Data Exchange (ETDEWEB)

    Menneveux, Jérôme; Wang, Fang; Lu, Shan; Bai, Xueshi; Motto-Ros, Vincent [Institut Lumière Matière, UMR5306 Université Lyon 1-CNRS, Université de Lyon, 69622 Villeurbanne Cedex (France); Gilon, Nicole [Institut des Sciences Analytiques, UMR5280 Université Lyon 1-CNRS, Université de Lyon, 69622 Villeurbanne Cedex (France); Chen, Yanping [Department of Physics and Astrophysics, Shanghai Jiao Tong University, Shanghai 200240 (China); Yu, Jin, E-mail: jin.yu@univ-lyon1.fr [Institut Lumière Matière, UMR5306 Université Lyon 1-CNRS, Université de Lyon, 69622 Villeurbanne Cedex (France); Department of Physics and Astrophysics, Shanghai Jiao Tong University, Shanghai 200240 (China)

    2015-07-01

    Sunscreen represents a large variety of creams which, in the analytical point of view, exhibit a similar matrix. Such matrix corresponds to a semi-solid emulsion of mixture of oil and water. The formulation of a cream can include metal and nonmetal elements in different contents in order to realize specific pharmaceutical or cosmetic functions designed for the product. The complex matrix of these materials makes their analysis challenging for classical elemental analytical techniques with specific and complicated sample pretreatment procedures needed for reliable quantification. In this work we demonstrate and assess direct determination, without any pretreatment, of elemental content, especially for metallic element such as titanium, in a sunscreen using laser-induced breakdown spectroscopy (LIBS). The used configuration corresponds to that of indirect ablation of a thin film of cream applied on the surface of a pure aluminum target. We especially focused, in this work, on the case of high concentration of TiO{sub 2} nanoparticle in cream. Such choice was justified first by the fact that such concentration level is usually found in commercial sunscreens. On the other hand, titanium presents a large number of lines, neutral as well as singly ionized, in the spectral range from the near UV to the near IR. It provides therefore an ideal case to study line selection method to manage the effect of self-absorption, which becomes unavoidable at high concentration level, and to optimize measurement precision. Through such study, we try to deduce a quantifiable and generalizable line selection method for high performance LIBS measurements. More specifically, calibration curves were first established using 6 laboratory-prepared samples. The quadratic term of the curves was then studied as a function of the intensity of the used lines and their type (neutral or ion, resonant or non-resonant). The prediction performance of the lines was assessed with 2 validation samples with

  19. NARROW-LINE X-RAY-SELECTED GALAXIES IN THE CHANDRA -COSMOS FIELD. I. OPTICAL SPECTROSCOPIC CATALOG

    Energy Technology Data Exchange (ETDEWEB)

    Pons, E.; Watson, M. G. [University of Leicester, Leicester (United Kingdom); Elvis, M.; Civano, F. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States)

    2016-04-20

    The COSMOS survey is a large and deep survey with multiwavelength observations of sources from X-rays to the UV, allowing an extensive study of their properties. The central 0.9 deg{sup 2} of the COSMOS field have been observed by Chandra with a sensitivity up to 1.9 × 10{sup −16} erg cm{sup −2} s{sup −1} in the full (0.5–10 keV) band. Photometric and spectroscopic identification of the Chandra -COSMOS (C-COSMOS) sources is available from several catalogs and campaigns. Despite the fact that the C-COSMOS galaxies have a reliable spectroscopic redshift in addition to a spectroscopic classification, the emission-line properties of this sample have not yet been measured. We present here the creation of an emission-line catalog of 453 narrow-line sources from the C-COSMOS spectroscopic sample. We have performed spectral fitting for the more common lines in galaxies ([O ii] λ 3727, [Ne iii] λ 3869, H β , [O iii] λλ 4959, 5007, H α , and [N ii] λλ 6548, 6584). These data provide an optical classification for 151 (i.e., 33%) of the C-COSMOS narrow-line galaxies based on emission-line diagnostic diagrams.

  20. Long-Term Monitoring of the Broad-Line Region Properties in a Selected Sample of AGN

    Energy Technology Data Exchange (ETDEWEB)

    Ilić, Dragana [Department of Astronomy, Faculty of Mathematics, University of Belgrade, Belgrade (Serbia); Shapovalova, Alla I. [Special Astrophysical Observatory, Russian Academy of Sciences, Nizhnii Arkhyz (Russian Federation); Popović, Luka Č. [Department of Astronomy, Faculty of Mathematics, University of Belgrade, Belgrade (Serbia); Astronomical Observatory, Belgrade (Serbia); Chavushyan, Vahram [Instituto Nacional de Astrofísica, Óptica y Electrónica, Puebla (Mexico); Burenkov, Alexander N. [Special Astrophysical Observatory, Russian Academy of Sciences, Nizhnii Arkhyz (Russian Federation); Kollatschny, Wolfram [Institut fuer Astrophysik, Universitaet Goettingen, Göttingen (Germany); Kovačević, Andjelka [Department of Astronomy, Faculty of Mathematics, University of Belgrade, Belgrade (Serbia); Marčeta-Mandić, Sladjana [Department of Astronomy, Faculty of Mathematics, University of Belgrade, Belgrade (Serbia); Astronomical Observatory, Belgrade (Serbia); Rakić, Nemanja [Department of Astronomy, Faculty of Mathematics, University of Belgrade, Belgrade (Serbia); Faculty of Science, University of Banjaluka, Banjaluka, Republic of Srpska (Bosnia and Herzegovina); La Mura, Giovanni; Rafanelli, Piero, E-mail: dilic@math.rs [Department of Physics and Astronomy, University of Padova, Padova (Italy)

    2017-09-14

    We present the results of the long-term optical monitoring campaign of active galactic nuclei (AGN) coordinated by the Special Astrophysical Observatory of the Russian Academy of Science. This campaign has produced a remarkable set of optical spectra, since we have monitored for several decades different types of broad-line (type 1) AGN, from a Seyfert 1, double-peaked line, radio loud and radio quiet AGN, to a supermassive binary black hole candidate. Our analysis of the properties of the broad line region (BLR) of these objects is based on the variability of the broad emission lines. We hereby give a comparative review of the variability properties of the broad emission lines and the BLR of seven different type 1 AGNs, emphasizing some important results, such as the variability rate, the BLR geometry, and the presence of the intrinsic Baldwin effect. We are discussing the difference and similarity in the continuum and emission line variability, focusing on what is the impact of our results to the supermassive black hole mass determination from the BLR properties.

  1. Long-Term Monitoring of the Broad-Line Region Properties in a Selected Sample of AGN

    Directory of Open Access Journals (Sweden)

    Dragana Ilić

    2017-09-01

    Full Text Available We present the results of the long-term optical monitoring campaign of active galactic nuclei (AGN coordinated by the Special Astrophysical Observatory of the Russian Academy of Science. This campaign has produced a remarkable set of optical spectra, since we have monitored for several decades different types of broad-line (type 1 AGN, from a Seyfert 1, double-peaked line, radio loud and radio quiet AGN, to a supermassive binary black hole candidate. Our analysis of the properties of the broad line region (BLR of these objects is based on the variability of the broad emission lines. We hereby give a comparative review of the variability properties of the broad emission lines and the BLR of seven different type 1 AGNs, emphasizing some important results, such as the variability rate, the BLR geometry, and the presence of the intrinsic Baldwin effect. We are discussing the difference and similarity in the continuum and emission line variability, focusing on what is the impact of our results to the supermassive black hole mass determination from the BLR properties.

  2. Progress on researches of transgenic alfalfa

    International Nuclear Information System (INIS)

    Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

    2010-01-01

    In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

  3. TRANSGENIC STRATEGY FOR IDENTIFYING SYNAPTIC CONNECTIONS IN MICE BY FLUORESCENCE COMPLEMENTATION (GRASP

    Directory of Open Access Journals (Sweden)

    Masahito eYamagata

    2012-02-01

    Full Text Available In the "GFP reconstitution across synaptic partners" (GRASP method, non-fluorescent fragments of GFP are expressed in two different neurons; the fragments self-assemble at synapses between the two to form a fluorophore. GRASP has proven useful for light microscopic identification of synapses in two invertebrate species, Caenorhabditis elegans and Drosophila melanogaster, but has not yet been applied to vertebrates. Here, we describe GRASP constructs that function in mammalian cells and implement a transgenic strategy in which a Cre-dependent gene switch leads to expression of the two fragments in mutually exclusive neuronal subsets in mice. Using a transgenic line that expresses Cre selectively in rod photoreceptors, we demonstrate labeling of synapses in the outer plexiform layer of the retina. Labeling is specific, in that synapses made by rods remain labeled for at least 6 months whereas nearby synapses made by intercalated cone photoreceptors on many of the same interneurons remain unlabeled. We also generated antisera that label reconstituted GFP but neither fragment in order to amplify the GRASP signal and thereby increase the sensitivity of the method.

  4. Biotechnology network promotes knowledge of transgenics

    International Nuclear Information System (INIS)

    Blanco Picado, Patricia; Valdez Melara, Marta

    2015-01-01

    Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

  5. Partially Purified Extracts of Sea Anemone Anemonia viridis Affect the Growth and Viability of Selected Tumour Cell Lines

    Directory of Open Access Journals (Sweden)

    Matteo Bulati

    2016-01-01

    Full Text Available In the last few years, marine species have been investigated for the presence of natural products with anticancer activity. Using reversed phase chromatography, low molecular weight proteins were fractionated from the sea anemone Anemonia viridis. Four different fractions were evaluated for their cytotoxic activity by means of erythrocyte haemolysis test, MTS, and LDH assays. Finally, the antiproliferative activities of three of these fractions were studied on PC3, PLC/PRF/5, and A375 human cancer cell lines. Our analysis revealed that the four fractions showed different protein contents and diverse patterns of activity towards human PBMC and cancer cell lines. Interestingly, fractions III and IV exerted cytotoxic effects on human cells. Conversely, fractions I and II displayed very low toxic effects associated with antiproliferative activities on cancer cell lines.

  6. Partially Purified Extracts of Sea Anemone Anemonia viridis Affect the Growth and Viability of Selected Tumour Cell Lines.

    Science.gov (United States)

    Bulati, Matteo; Longo, Alessandra; Masullo, Tiziana; Vlah, Sara; Bennici, Carmelo; Bonura, Angela; Salamone, Monica; Tagliavia, Marcello; Nicosia, Aldo; Mazzola, Salvatore; Colombo, Paolo; Cuttitta, Angela

    2016-01-01

    In the last few years, marine species have been investigated for the presence of natural products with anticancer activity. Using reversed phase chromatography, low molecular weight proteins were fractionated from the sea anemone Anemonia viridis . Four different fractions were evaluated for their cytotoxic activity by means of erythrocyte haemolysis test, MTS, and LDH assays. Finally, the antiproliferative activities of three of these fractions were studied on PC3, PLC/PRF/5, and A375 human cancer cell lines. Our analysis revealed that the four fractions showed different protein contents and diverse patterns of activity towards human PBMC and cancer cell lines. Interestingly, fractions III and IV exerted cytotoxic effects on human cells. Conversely, fractions I and II displayed very low toxic effects associated with antiproliferative activities on cancer cell lines.

  7. Handmade cloned transgenic sheep rich in omega-3 Fatty acids.

    Directory of Open Access Journals (Sweden)

    Peng Zhang

    Full Text Available Technology of somatic cell nuclear transfer (SCNT has been adapted worldwide to generate transgenic animals, although the traditional procedure relies largely on instrumental micromanipulation. In this study, we used the modified handmade cloning (HMC established in cattle and pig to produce transgenic sheep with elevated levels of omega-3 (n-3 fatty acids. Codon-optimized nematode mfat-1 was inserted into a eukaryotic expression vector and was transferred into the genome of primary ovine fibroblast cells from a male Chinese merino sheep. Reverse transcriptase PCR, gas chromatography, and chromosome analyses were performed to select nuclear donor cells capable of converting omega-6 (n-6 into n-3 fatty acids. Blastocysts developed after 7 days of in vitro culture were surgically transplanted into the uterus of female ovine recipients of a local sheep breed in Xinjiang. For the HMC, approximately 8.9% (n  =925 of reconstructed embryos developed to the blastocyst stage. Four recipients became pregnant after 53 blastocysts were transplanted into 29 naturally cycling females, and a total of 3 live transgenic lambs were produced. Detailed analyses on one of the transgenic lambs revealed a single integration of the modified nematode mfat-1 gene at sheep chromosome 5. The transgenic sheep expressed functional n-3 fatty acid desaturase, accompanied by more than 2-folds reduction of n-6/n-3 ratio in the muscle (p<0.01 and other major organs/tissues (p<0.05. To our knowledge, this is the first report of transgenic sheep produced by the HMC. Compared to the traditional SCNT method, HMC showed an equivalent efficiency but proved cheaper and easier in operation.

  8. Fourier Transform Spectroscopy of Carbonyl Sulfide from 3700 to 4800 cm -1and Selection of a Line-Pointing Program

    Science.gov (United States)

    Naı̈m, S.; Fayt, A.; Bredohl, H.; Blavier, J.-F.; Dubois, I.

    1998-11-01

    We have measured the Fourier transform spectrum of natural OCS from 3700 to 4800 cm-1with a near Doppler resolution and a line-position accuracy between 4 and 8 × 10-5cm-1. For the normal isotopic species, 37 vibrational transitions have been analyzed for both frequencies and intensities. We also report 15 bands of OC34S, eight bands of O13CS, nine bands of OC33S, and two bands of18OCS. Important effective Herman-Wallis terms are explained on the basis of eigenvectors. A comparison of different line-pointing programs is also presented.

  9. mlo-based powdery mildew resistance in hexaploid bread wheat generated by a non-transgenic TILLING approach.

    Science.gov (United States)

    Acevedo-Garcia, Johanna; Spencer, David; Thieron, Hannah; Reinstädler, Anja; Hammond-Kosack, Kim; Phillips, Andrew L; Panstruga, Ralph

    2017-03-01

    Wheat is one of the most widely grown cereal crops in the world and is an important food grain source for humans. However, wheat yields can be reduced by many abiotic and biotic stress factors, including powdery mildew disease caused by Blumeria graminis f.sp. tritici (Bgt). Generating resistant varieties is thus a major effort in plant breeding. Here, we took advantage of the non-transgenic Targeting Induced Lesions IN Genomes (TILLING) technology to select partial loss-of-function alleles of TaMlo, the orthologue of the barley Mlo (Mildew resistance locus o) gene. Natural and induced loss-of-function alleles (mlo) of barley Mlo are known to confer durable broad-spectrum powdery mildew resistance, typically at the expense of pleiotropic phenotypes such as premature leaf senescence. We identified 16 missense mutations in the three wheat TaMlo homoeologues, TaMlo-A1, TaMlo-B1 and TaMlo-D1 that each lead to single amino acid exchanges. Using transient gene expression assays in barley single cells, we functionally analysed the different missense mutants and identified the most promising candidates affecting powdery mildew susceptibility. By stacking of selected mutant alleles we generated four independent lines with non-conservative mutations in each of the three TaMlo homoeologues. Homozygous triple mutant lines and surprisingly also some of the homozygous double mutant lines showed enhanced, yet incomplete, Bgt resistance without the occurrence of discernible pleiotropic phenotypes. These lines thus represent an important step towards the production of commercial non-transgenic, powdery mildew-resistant bread wheat varieties. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Selective Method for the Determination of Manganese in End-fitting of Spoolable Reinforced Plastic Line Pipe for Petroleum Industries

    Science.gov (United States)

    Shao, Xiaodong; Zhang, Dongna; Li, Houbu; Cai, Xuehua

    2017-10-01

    The fact that spoolable reinforced plastic line pipe is more flexible and spoolable than steel, and is also much lighter, means that it can becarried and deployedfrom smaller vessels and managed more easily. It was well known that manganese is an important element in end-fitting of spoolable reinforced plastic line pipe. In this paper, a simple spectrophotometric method was described for the determination of manganese in end-fitting of spoolable reinforced plastic line pipe. The method was based on the oxidation-reduction reaction between ammonium persulfate and manganese(II) producing manganese(VII) in the presence of silver nitrate as a catalyst. The characteristic wavelength of maximum absorption of manganese(VII) was obtained locating at 530 nm. Under the optimum reaction conditions the absorption value was proportional to the concentration of manganese in the range of 0.50%˜1.80% (R2 = 0.9997), and the relative standard deviation was less than 3.0% (n=5). The proposed method was applied successfully to determine manganese in end-fitting of spoolable reinforced plastic line pipe samples.

  11. Application of ABTS radical cation for selective on-line detection of radical scavengers in HPLC eluates

    NARCIS (Netherlands)

    Koleva, [No Value; Niederlander, HAG; van Beek, TA

    2001-01-01

    The radical cation 2,2 ' -azinobis-(3 -ethylbenzothiazoline-6-sulfonate), (ABTS(.+)) was utilized in an on-line HPLC method for the detection of radical scavengers in complex matrixes. The HPLC-separated analytes react postcolumn with the preformed ABTS(.+), and the induced bleaching is detected as

  12. A Selective Stratistical Study of Transaction Activity in a Large On-Line Automated Circulation System. Final Report.

    Science.gov (United States)

    Guthrie, Gerry D.

    The objective of this study was to provide the library community with basic statistical data from on-line activity in the Ohio State University Libraries' Circulation System. Over 1.6 million archive records in the circulation system for 1972 were investigated to produce subject reports of circulation activity, activity reports by collection…

  13. CD133 expression is not selective for tumor initiating or radioresistant cell populations in the CRC line HCT-116

    International Nuclear Information System (INIS)

    Seidel, Claudia; Dietrich, Antje; Wondrak, Marit; Kunz-Schughart, Leoni A.; Grade, Marian; Ried, Thomas

    2009-01-01

    The hypothesis of certain subpopulations of cancer cells with stem-cell like characteristics that might be responsible for treatment resistance and recurrence of disease is still challenging and under quite controversial discussion. In most studies, surrogate cell surface antigens such as the 92-110 kDa transmembrane glycoprotein CD133 (human Prominin-1) were labeled to isolate particular small cancer cell populations for studying their tumorigenic potential. In colorectal carcinomas (CRC) for example, a small CD133 positive (CD133 + ) cell population has recently been described to be enriched for tumor-initiating/cancer stem cells (TIC/CSC) as compared to the CD133 negative (CD133) population. Furthermore, it was documented that the CD133 + subpopulation could exclusively be maintained in culture as spheres under serum-free conditions. Addition of serum resulted in cell differentiation, growth in 2-D and downregulation of CD133 expression. This would imply that established colorectal cancer (CRC) cell lines that have been grown under adherent, serum-supplemented conditions for years should be devoid of CD133 + cells and TIC/CSC, respectively, which seems contradictory to the finding that many CRC lines produce tumors in nude mice models. In order to gain insight into this paradox, we studied the expression of CD133 in numerous established CRC lines under standard culture conditions and chose one particular cell line based on its expression pattern to study the behavior of CD133 + / CD133 - subpopulations

  14. Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

    Directory of Open Access Journals (Sweden)

    Lori A. McEachern

    2012-01-01

    Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

  15. Comparison of feed energy costs of maintenance, lean deposition, and fat deposition in three lines of mice selected for heat loss.

    Science.gov (United States)

    Eggert, D L; Nielsen, M K

    2006-02-01

    Three replications of mouse selection populations for high heat loss (MH), low heat loss (ML), and a nonselected control (MC) were used to estimate the feed energy costs of maintenance and gain and to test whether selection had changed these costs. At 21 and 49 d of age, mice were weighed and subjected to dual x-ray densitometry measurement for prediction of body composition. At 21 d, mice were randomly assigned to an ad libitum, an 80% of ad libitum, or a 60% of ad libitum feeding group for 28-d collection of individual feed intake. Data were analyzed using 3 approaches. The first approach was an attempt to partition energy intake between costs for maintenance, fat deposition, and lean deposition for each replicate, sex, and line by multiple regression of feed intake on the sum of daily metabolic weight (kg(0.75)), fat gain, and lean gain. Approach II was a less restrictive attempt to partition energy intake between costs for maintenance and total gain for each replicate, sex, and line by multiple regression of feed intake on the sum of daily metabolic weight and total gain. Approach III used multiple regression on the entire data set with pooled regressions on fat and lean gains, and subclass regressions for maintenance. Contrasts were conducted to test the effect of selection (MH - ML) and asymmetry of selection [(MH + ML)/2 - MC] for the various energy costs. In approach I, there were no differences between lines for costs of maintenance, fat deposition, or protein deposition, but we question our ability to estimate these accurately. In approach II, selection changed both cost of maintenance (P = 0.03) and gain (P = 0.05); MH mice had greater per unit costs than ML mice for both. Asymmetry of the selection response was found in approach II for the cost of maintenance (P = 0.06). In approach III, the effect of selection (P maintenance cost, but asymmetry of selection (P > 0.17) was not evident. Sex effects were found for the cost of fat deposition (P = 0.02) in

  16. Simultaneous detection of transgenic DNA by surface plasmon resonance imaging with potential application to gene doping detection.

    Science.gov (United States)

    Scarano, Simona; Ermini, Maria Laura; Spiriti, Maria Michela; Mascini, Marco; Bogani, Patrizia; Minunni, Maria

    2011-08-15

    Surface plasmon resonance imaging (SPRi) was used as the transduction principle for the development of optical-based sensing for transgenes detection in human cell lines. The objective was to develop a multianalyte, label-free, and real-time approach for DNA sequences that are identified as markers of transgenosis events. The strategy exploits SPRi sensing to detect the transgenic event by targeting selected marker sequences, which are present on shuttle vector backbone used to carry out the transfection of human embryonic kidney (HEK) cell lines. Here, we identified DNA sequences belonging to the Cytomegalovirus promoter and the Enhanced Green Fluorescent Protein gene. System development is discussed in terms of probe efficiency and influence of secondary structures on biorecognition reaction on sensor; moreover, optimization of PCR samples pretreatment was carried out to allow hybridization on biosensor, together with an approach to increase SPRi signals by in situ mass enhancement. Real-time PCR was also employed as reference technique for marker sequences detection on human HEK cells. We can foresee that the developed system may have potential applications in the field of antidoping research focused on the so-called gene doping.

  17. Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

    Directory of Open Access Journals (Sweden)

    Xiuling Cao

    Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

  18. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    Science.gov (United States)

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

  19. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance.

    Science.gov (United States)

    Ma, Hao; Song, Congfeng; Borth, Wayne; Sether, Diane; Melzer, Michael; Hu, John

    2011-10-20

    Tomato spotted wilt virus (TSWV) has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX) in tomato and petunia is related to TSWV resistance. The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  20. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance

    Directory of Open Access Journals (Sweden)

    Ma Hao

    2011-10-01

    Full Text Available Abstract Background Tomato spotted wilt virus (TSWV has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX in tomato and petunia is related to TSWV resistance. Results The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. Conclusion In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  1. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  2. Cyclophosphamide increases transgene expression mediated by an oncolytic adenovirus in glioma-bearing mice monitored by bioluminescence imaging

    NARCIS (Netherlands)

    Lamfers, Martine L. M.; Fulci, Giulia; Gianni, Davide; Tang, Yi; Kurozumi, Kazuhiko; Kaur, Balveen; Moeniralm, Sharif; Saeki, Yoshinaga; Carette, Jan E.; Weissleder, Ralph; Vandertop, W. Peter; van Beusechem, Victor W.; Dirven, Clemens M. F.; Chiocca, E. Antonio

    2006-01-01

    Approaches to improve the oncolytic potency of replication-competent adenoviruses include the insertion of therapeutic transgenes into the viral genome. Little is known about the levels and duration of in vivo transgene expression by cells infected with such "armed" viruses. Using a tumor-selective

  3. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  4. Tie-1-directed expression of Cre recombinase in endothelial cells of embryoid bodies and transgenic mice

    DEFF Research Database (Denmark)

    Gustafsson, E; Brakebusch, C; Hietanen, K

    2001-01-01

    Tissue-specific gene inactivation using the Cre-loxP system has become an important tool to unravel functions of genes when the conventional null mutation is lethal. We report here the generation of a transgenic mouse line expressing Cre recombinase in endothelial cells. In order to avoid...... the production and screening of multiple transgenic lines we used embryonic stem cell and embryoid body technology to identify recombinant embryonic stem cell clones with high, endothelial-specific Cre activity. One embryonic stem cell clone that showed high Cre activity in endothelial cells was used to generate...... germline chimeras. The in vivo efficiency and specificity of the transgenic Cre was analysed by intercrossing the tie-1-Cre line with the ROSA26R reporter mice. At initial stages of vascular formation (E8-9), LacZ staining was detected in almost all cells of the forming vasculature. Between E10 and birth...

  5. Sustainable Supplier Selection with A Fuzzy Multi-Criteria Decision Making Method Based on Triple Bottom Line

    OpenAIRE

    Öztürk, Burcu Avcı; Özçelik , Funda

    2014-01-01

    To meet the demands of various stakeholders and to comply with environmental legislations, businesses started to look at their supply chain to enhance their overall sustainability profile. Supply chain operations with sustainability awareness have become an important issue in recent years and make the sustainable supplier performance evaluation and selection process as a central concept of sustainable supply chain management. In this study, supplier selection problem is modelled within the co...

  6. Screening and Selection of High Carotenoid Producing in Vitro Tomato Cell Culture Lines for [13C]-Carotenoid Production

    OpenAIRE

    Engelmann, Nancy J.; Campbell, Jessica K.; Rogers, Randy B.; Rupassara, S. Indumathie; Garlick, Peter J.; Lila, Mary Ann; Erdman, John W.

    2010-01-01

    Isotopically labeled tomato carotenoids, phytoene, phytofluene, and lycopene, are needed for mammalian bioavailability and metabolism research but are currently commercially unavailable. The goals of this work were to establish and screen multiple in vitro tomato cell lines for carotenoid production, test the best producers with or without the bleaching herbicides, norflurazon and 2-(4-chlorophenyl-thio)-triethylamine (CPTA), and to use the greatest carotenoid accumulator for in vitro 13C-lab...

  7. The Effects of Allicin, a Reactive Sulfur Species from Garlic, on a Selection of Mammalian Cell Lines

    Directory of Open Access Journals (Sweden)

    Martin C. H. Gruhlke

    2016-12-01

    Full Text Available Garlic (Allium sativum L. has been used as a spice and medicinal plant since ancient times. Garlic produces the thiol-reactive defence substance, allicin, upon wounding. The effects of allicin on human lung epithelium carcinoma (A549, mouse fibroblast (3T3, human umbilical vein endothelial cell (HUVEC, human colon carcinoma (HT29 and human breast cancer (MCF7 cell lines were tested. To estimate toxic effects of allicin, we used a standard MTT-test (methylthiazoltetrazolium for cell viability and 3H-thymidine incorporation for cell proliferation. The glutathione pool was measured using monobromobimane and the formation of reactive species was identified using 2′,7′-dichlorofluoresceine-diacetate. The YO-PRO-1 iodide staining procedure was used to estimate apoptosis. Allicin reduced cell viability and cell proliferation in a concentration dependent manner. In the bimane test, it was observed that cells treated with allicin showed reduced fluorescence, suggesting glutathione oxidation. The cell lines tested differed in sensitivity to allicin in regard to viability, cell proliferation and glutathione oxidation. The 3T3 and MCF-7 cells showed a higher proportion of apoptosis compared to the other cell types. These data show that mammalian cell lines differ in their sensitivity and responses to allicin.

  8. Combination of Trichoderma harzianum endochitinase and a membrane-affecting fungicide on control of Alternaria leaf spot in transgenic broccoli plants.

    Science.gov (United States)

    Mora, A; Earle, E D

    2001-04-01

    Progeny from transgenic broccoli (cv. Green Comet) expressing a Trichoderma harzianum endochitinase gene were used to assess the interaction between endochitinase and the fungicide Bayleton in the control of Alternaria brassicicola. In vitro assays have shown synergistic effects of endochitinase and fungicides on fungal pathogens. Our study examined the in planta effects of endochitinase and Bayleton, individually and in combination. Two month old transgenic and non-transgenic plants were sprayed with ED50 levels of Bayleton and/or inoculated with an A. brassicicola spore suspension. Disease levels in non-sprayed transgenic plants were not statistically different from sprayed transgenic plants nor from sprayed non-transgenic controls. Thus endochitinase-transgenic plants alone provided a significant reduction of disease severity, comparable to the protection by fungicide on non-transgenic plants. Comparison of the expected additive and observed effects revealed no synergism between endochitinase and Bayleton (at ED50 level), and usually less than an additive effect. Some transgenic lines sprayed with fungicide at doses higher than ED50 showed resistance similar to the non-sprayed transgenic lines, again suggesting no synergistic effect. Lack of synergism may be due to incomplete digestion of the cell wall by endochitinase, so that the effect of Bayleton at the cell membrane is not enhanced.

  9. Highly phosphorylated functionalized rice starch produced by transgenic rice expressing the potato GWD1 gene

    DEFF Research Database (Denmark)

    Chen, Yaling; Sun, Xiao-Feng; Zhou, Xin

    2017-01-01

    Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges...... content was positively correlated with short chains of DP6-12. The starch pasting temperature, peak viscosity and the breakdown were lower but the setback was higher for transgenic rice flour. The 6-P content was negatively correlated with texture adhesiveness but positively correlated...

  10. Essential Oil Content of the Rhizome of Curcuma purpurascens Bl. (Temu Tis) and Its Antiproliferative Effect on Selected Human Carcinoma Cell Lines

    Science.gov (United States)

    Hong, Sok-Lai; Lee, Guan-Serm; Ahmed Hamdi, Omer Abdalla; Awang, Khalijah; Aznam Nugroho, Nurfina

    2014-01-01

    Curcuma purpurascens Bl., belonging to the Zingiberaceae family, is known as temu tis in Yogyakarta, Indonesia. In this study, the hydrodistilled dried ground rhizome oil was investigated for its chemical content and antiproliferative activity against selected human carcinoma cell lines (MCF7, Ca Ski, A549, HT29, and HCT116) and a normal human lung fibroblast cell line (MRC5). Results from GC-MS and GC-FID analysis of the rhizome oil of temu tis showed turmerone as the major component, followed by germacrone, ar-turmerone, germacrene-B, and curlone. The rhizome oil of temu tis exhibited strong cytotoxicity against HT29 cells (IC50 value of 4.9 ± 0.4 μg/mL), weak cytotoxicity against A549, Ca Ski, and HCT116 cells (with IC50 values of 46.3 ± 0.7, 32.5 ± 1.1, and 35.0 ± 0.3 μg/mL, resp.), and no inhibitory effect against MCF7 cells. It exhibited mild cytotoxicity against a noncancerous human lung fibroblast cell line (MRC5), with an IC50 value of 25.2 ± 2.7 μg/mL. This is the first report on the chemical composition of this rhizome's oil and its selective antiproliferative effect on HT29. The obtained data provided a basis for further investigation of the mode of cell death. PMID:25177723

  11. A transgenic approach to study argininosuccinate synthetase gene expression

    Science.gov (United States)

    2014-01-01

    Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage

  12. β-Caryophyllene, a Compound Isolated from the Biblical Balm of Gilead (Commiphora gileadensis, Is a Selective Apoptosis Inducer for Tumor Cell Lines

    Directory of Open Access Journals (Sweden)

    Eitan Amiel

    2012-01-01

    Full Text Available The biblical balm of Gilead (Commiphora gileadensis was investigated in this study for anticancerous activity against tumor cell lines. The results obtained from ethanol-based extracts and from essential oils indicated that β-caryophyllene (trans-(1R,9S-8-methylene-4,11,11-trimethylbicyclo[7.2.0]undec-4-ene is a key component in essential oils extracted from the balm of Gilead. β-Caryophyllene can be found in spice blends, citrus flavors, soaps, detergents, creams, and lotions, as well as in a variety of food and beverage products, and it is known for its anti-inflammatory, local anaesthetic, and antifungal properties. It is also a potent cytotoxic compound over a wide range of cell lines. In the current paper, we found that Commiphora gileadensis stem extracts and essential oil have an antiproliferative proapoptotic effect against tumor cells and not against normal cells. β-caryophyllene caused a potent induction of apoptosis accompanied by DNA ladder and caspase-3 catalytic activity in tumor cell lines. In summary, we showed that C. gileadensis stems contain an apoptosis inducer that acts, in a selective manner, against tumor cell lines and not against normal cells.

  13. Plant breeding by using radiation mutation - Selection of herbicide-resistant cell lines by using {gamma}-rays

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyo Yeon [Sunchun University, Sunchun (Korea); Seo, Yong Weon [Korea University, Seoul (Korea)

    2000-04-01

    In order to develop the herbicide resistant cell lines, micro calli derived from rice anther culture and mature seed of wheat cultivars were irradiated with gamma rays. 1) The callus was dedifferentiated by 7 or 21 day pretreatment at 7 deg. C in two rice cultivars, Ilpumbyeo ad Dongjinbyeo. 2) To check the optimum concentration of herbicide, three herbicides were tested with micro calli. 3) The optimum dose of gamma ray to seeds of wheat seemed to be from 100 to 150 Gy. 4) AFLP and RAPD technique were established to develope herbicide resistant molecular marker in rice. 34 refs., 10 figs., 5 tabs. (Author)

  14. [Transgenic wheat (Triticum aestivum L.) with increased resistance to the storage pest obtained by Agrobacterium tumefaciens--mediated].

    Science.gov (United States)

    Bi, Rui-Ming; Jia, Hai-Yan; Feng, De-Shun; Wang, Hong-Gang

    2006-05-01

    The transgenic wheat of improved resistance to the storage pest was production. We have introduced the cowpea trypsin inhibitor gene (CpTI) into cultured embryonic callus cells of immature embryos of wheat elite line by Agrobacterium-mediated method. Independent plantlets were obtained from the kanamycin-resistant calli after screening. PCR and real time PCR analysis, PCR-Southern and Southern blot hybridization indicated that there were 3 transgenic plants viz. transformed- I, II and III (T- I, T-II and T-III). The transformation frequencies were obviously affected by Agrobacterium concentration, the infection duration and transformation treatment. The segregations of CpTI in the transgenic wheat progenies were not easily to be elucidated, and some transgenic wheat lines (T- I and T-III) showed Mendelian segregations. The determinations of insect resistance to the stored grain insect of wheat viz. the grain moth (Sitotroga cerealella Olivier) indicated that the 3 transgenic wheat progeny seeds moth-resistance was improved significantly. The seed moth-eaten ratio of T- I, T-II, T-III and nontransformed control was 19.8%, 21.9%, 32.9% and 58.3% respectively. 3 transgenic wheat T1 PCR-positive plants revealed that the 3 transgenic lines had excellent agronomic traits. They supplied good germplasm resource of insect-resistance for wheat genetic improvement.

  15. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    Directory of Open Access Journals (Sweden)

    Qiyan Jiang

    2014-04-01

    Full Text Available The transcription factor dehydration-responsive element binding protein (DREB is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L. and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed longer coleoptiles and radicles and a greater radicle number at the germination stage, as well as greater root length, fresh weight, and tiller number per plant at the seedling stage. The yield-related traits of transgenic lines were also improved compared with the wild type, indicating enhanced salt tolerance in transgenic lines overexpressing GmDREB1. Proteomics analysis revealed that osmotic- and oxidative-stress-related proteins were up-regulated in transgenic wheat leaves under salt stress conditions. Transgenic wheat had higher levels of proline and betaine and lower levels of malondialdehyde and relative electrolyte leakage than the wild type. These results suggest that GmDREB1 regulates the expression of osmotic- and oxidative-stress-related proteins that reduce the occurrence of cell injury caused by high salinity, thus improving the salt tolerance of transgenic wheat.

  16. Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat

    OpenAIRE

    Chen, Liang; Zhang, ZengYan; Liang, HongXia; Liu, HongXia; Du, LiPu; Xu, Huijun; Xin, Zhiyong

    2008-01-01

    Wheat sharp eyespot, primarily caused by a soil-borne fungus Rhizoctonia cerealis, has become one of the most serious diseases of wheat in China. In this study, an ethylene response factor (ERF) gene from a wheat relative Thinopyrum intermedium, TiERF1, was characterized further, transgenic wheat lines expressing TiERF1 were developed, and the resistance of the transgenic wheat lines against R. cerealis was investigated. Southern blotting analysis indicated that at least two copies of the TiE...

  17. Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

    Science.gov (United States)

    Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

    2017-09-13

    The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

  18. Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

    Science.gov (United States)

    Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

    2017-06-01

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  19. 40 CFR 1051.310 - How must I select vehicles or engines for production-line testing?

    Science.gov (United States)

    2010-07-01

    ... engines, randomly select and test one more engine. Then, calculate the required sample size for the model... distribution. σ = Test sample standard deviation (see paragraph (c)(2) of this section). x = Mean of emission... sample size for the model year as described in paragraph (c) of this section. (3) In the first test...

  20. pOsNAR2.1:OsNAR2.1 expression enhances nitrogen uptake efficiency and grain yield in transgenic rice plants.

    Science.gov (United States)

    Chen, Jingguang; Fan, Xiaoru; Qian, Kaiyun; Zhang, Yong; Song, Miaoquan; Liu, Yu; Xu, Guohua; Fan, Xiaorong

    2017-10-01

    The nitrate (NO3-) transporter has been selected as an important gene maker in the process of environmental adoption in rice cultivars. In this work, we transferred another native OsNAR2.1 promoter with driving OsNAR2.1 gene into rice plants. The transgenic lines with exogenous pOsNAR2.1:OsNAR2.1 constructs showed enhanced OsNAR2.1 expression level, compared with wild type (WT), and 15 N influx in roots increased 21%-32% in response to 0.2 mm and 2.5 mm 15NO3- and 1.25 mm 15 NH 4 15 NO 3 . Under these three N conditions, the biomass of the pOsNAR2.1:OsNAR2.1 transgenic lines increased 143%, 129% and 51%, and total N content increased 161%, 242% and 69%, respectively, compared to WT. Furthermore in field experiments we found the grain yield, agricultural nitrogen use efficiency (ANUE), and dry matter transfer of pOsNAR2.1:OsNAR2.1 plants increased by about 21%, 22% and 21%, compared to WT. We also compared the phenotypes of pOsNAR2.1:OsNAR2.1 and pOsNAR2.1:OsNRT2.1 transgenic lines in the field, found that postanthesis N uptake differed significantly between them, and in comparison with the WT. Postanthesis N uptake (PANU) increased approximately 39% and 85%, in the pOsNAR2.1:OsNAR2.1 and pOsNAR2.1:OsNRT2.1 transgenic lines, respectively, possibly because OsNRT2.1 expression was less in the pOsNAR2.1:OsNAR2.1 lines than in the pOsNAR2.1:OsNRT2.1 lines during the late growth stage. These results show that rice NO 3 - uptake, yield and NUE were improved by increased OsNAR2.1 expression via its native promoter. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Quantitative trait loci for maysin synthesis in maize (Zea mays L.) lines selected for high silk maysin content.

    Science.gov (United States)

    Meyer, J D F; Snook, M E; Houchins, K E; Rector, B G; Widstrom, N W; McMullen, M D

    2007-06-01

    Maysin is a naturally occurring C-glycosyl flavone found in maize (Zea mays L.) silk tissue that confers resistance to corn earworm (Helicoverpa zea, Boddie). Recently, two new maize populations were derived for high silk maysin. The two populations were named the exotic populations of maize (EPM) and the southern inbreds of maize (SIM). Quantitative trait locus (QTL) analysis was employed to determine which loci were responsible for elevated maysin levels in inbred lines derived from the EPM and SIM populations. The candidate genes consistent with QTL position included the p (pericarp color), c2 (colorless2), whp1 (white pollen1) and in1 (intensifier1) loci. The role of these loci in controlling high maysin levels in silks was tested by expression analysis and use of the loci as genetic markers onto the QTL populations. These studies support p, c2 and whp1, but not in1, as loci controlling maysin. Through this study, we determined that the p locus regulates whp1 transcription and that increased maysin in these inbred lines was primarily due to alleles at both structural and regulatory loci promoting increased flux through the flavone pathway by increasing chalcone synthase activity.

  2. Screening and selection of high carotenoid producing in vitro tomato cell culture lines for [13C]-carotenoid production.

    Science.gov (United States)

    Engelmann, Nancy J; Campbell, Jessica K; Rogers, Randy B; Rupassara, S Indumathie; Garlick, Peter J; Lila, Mary Ann; Erdman, John W

    2010-09-22

    Isotopically labeled tomato carotenoids, phytoene, phytofluene, and lycopene, are needed for mammalian bioavailability and metabolism research but are currently commercially unavailable. The goals of this work were to establish and screen multiple in vitro tomato cell lines for carotenoid production, test the best producers with or without the bleaching herbicides, norflurazon and 2-(4-chlorophenyl-thio)triethylamine (CPTA), and to use the greatest carotenoid accumulator for in vitro 13C-labeling. Different Solanum lycopersicum allelic variants for high lycopene and varying herbicide treatments were compared for carotenoid accumulation in callus and suspension culture, and cell suspension cultures of the hp-1 line were chosen for isotopic labeling. When grown with [U]-13C-glucose and treated with CPTA, hp-1 suspensions yielded highly enriched 13C-lycopene with 45% of lycopene in the M+40 form and 88% in the M+35 to M+40 isotopomer range. To the authors' knowledge this is the first report of highly enriched 13C-carotenoid production from in vitro plant cell culture.

  3. Magnetic field-induced modification of selection rules for Rb D 2 line monitored by selective reflection from a vapor nanocell

    Science.gov (United States)

    Klinger, Emmanuel; Sargsyan, Armen; Tonoyan, Ara; Hakhumyan, Grant; Papoyan, Aram; Leroy, Claude; Sarkisyan, David

    2017-08-01

    Magnetic field-induced giant modification of the probabilities of five transitions of 5S1 / 2,Fg = 2 → 5P3 / 2,Fe = 4 of 85Rb and three transitions of 5S1 / 2,Fg = 1 → 5P3 / 2,Fe = 3 of 87Rb forbidden by selection rules for zero magnetic field has been observed experimentally and described theoretically for the first time. For the case of excitation with circularly-polarized (σ+) laser radiation, the probability of Fg = 2,mF = - 2 → Fe