Identification of top-down forces regulating cotton aphid population growth in transgenic Bt cotton in central China.

Directory of Open Access Journals (Sweden)

Peng Han

Full Text Available The cotton aphid Aphis gossypii Glover is the main aphid pest in cotton fields in the Yangtze River Valley Cotton-planting Zone (YRZ in central China. Various natural enemies may attack the cotton aphid in Bt cotton fields but no studies have identified potential specific top-down forces that could help manage this pest in the YRZ in China. In order to identify possibilities for managing the cotton aphid, we monitored cotton aphid population dynamics and identified the effect of natural enemies on cotton aphid population growth using various exclusion cages in transgenic Cry1Ac (Bt+CpTI (Cowpea trypsin inhibitor cotton field in 2011. The aphid population growth in the open field (control was significantly lower than those protected or restricted from exposure to natural enemies in the various exclusion cage types tested. The ladybird predator Propylaea japonica Thunberg represented 65% of Coccinellidae predators, and other predators consisted mainly of syrphids (2.1% and spiders (1.5%. The aphid parasitoids Aphidiines represented 76.7% of the total count of the natural enemy guild (mainly Lysiphlebia japonica Ashmead and Binodoxys indicus Subba Rao & Sharma. Our results showed that P. japonica can effectively delay the establishment and subsequent population growth of aphids during the cotton growing season. Aphidiines could also reduce aphid density although their impact may be shadowed by the presence of coccinellids in the open field (likely both owing to resource competition and intraguild predation. The implications of these results are discussed in a framework of the compatibility of transgenic crops and top-down forces exerted by natural enemy guild.

Effects of Elevated Carbon Dioxide on the Growth and Foliar Chemistry of Transgenic Bt Cotton

Institute of Scientific and Technical Information of China (English)

Gang Wu; Fa-Jun Chen; Feng Ge; Yu-Cheng Sun

2007-01-01

A field study was carried out to quantify plant growth and the foliar chemistry of transgenic Bacillus thuringiensis (Bt)cotton (cv. GK-12) exposed to ambient CO2 and elevated (double-ambient) CO2 for different lengths of time (1, 2 and 3 months) in 2004 and 2005. The results indicated that CO2 levels significantly affected plant height, leaf area per plant and leaf chemistry of transgenic Bt cotton. Significantly, higher plant height and leaf area per plant were observed after cotton plants that were grown in elevated CO2 were compared with plants grown in ambient CO2 for 1, 2 and 3 months in the investigation. Simultaneously, significant interaction between CO2 level x investigating year was observed in leaf area per plant. Moreover, foliar total amino acids were increased by 14%, 13%, 11% and 12%, 14%, 10% in transgenic Bt cotton after exposed to elevated CO2 for 1, 2 or 3 months compared with ambient CO2 in 2004 and 2005, respectively. Condensed tannin occurrence increased by 17%, 11%, 9% in 2004 and 12%, 11%, 9% in 2005 in transgenic Bt cotton after being exposed to elevated CO2 for 1, 2 or 3 months compared with ambient CO2 for the same time. However, Bt toxin decreased by 3.0%,2.9%, 3.1% and 2.4%, 2.5%, 2.9% in transgenic Bt cotton after exposed to elevated CO2 for 1, 2 or 3months compared with ambient CO2 for same time in 2004 and 2005, respectively. Furthermore, there was prominent interaction on the foliar total amino acids between the CO2 level and the time of cotton plant being exposed to elevated CO2. It is presumed that elevated CO2 can alter the plant growth and hence ultimately the phenotype allocation to foliar chemistical components of transgenic Bt cotton, which may in turn, affect the plant-herbivore interactions.

Cotton transformation via pollen tube pathway.

Science.gov (United States)

Wang, Min; Zhang, Baohong; Wang, Qinglian

2013-01-01

Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.

Gone with transgenic cotton cropping in the USA. A perception of the presentations and interactions at the Beltwide Cotton Conferences, New Orleans (Louisiana, USA, 4-7/01/2010

Directory of Open Access Journals (Sweden)

Fok, M.

2011-01-01

Full Text Available The 2010 Beltwide Cotton Conferences provided a new vision of the consequences of about 15 years of widespread and uncoordinated cropping of transgenic cotton in the United States. Insect-resistant and/or herbicide-tolerant cotton varieties modified parasite complexes, namely those of insects and weeds damaging cotton crops. The Conferences have revealed that the adaptation solutions so far proposed make illusory the expectations at the launch of transgenic cotton, in terms of effective pest control, cost reduction, and antagonism between chemical and biotech methods. The USA case points out that the technical and economic sustainability of transgenic varieties must lie in a systemic and coordinated approach.

Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

African Journals Online (AJOL)

INERA05

2013-08-14

Aug 14, 2013 ... insects such as honey bees, bumble bees and butterflies. Genetic materials ... cotton fields separated from the transgenes source by wide open space. In Boni ..... Breeding: new strategies in plant improvement. International ...

Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

Science.gov (United States)

Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

2016-06-15

Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

Science.gov (United States)

Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2013-01-01

Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

Competitive release and outbreaks of non-target pests associated with transgenic Bt cotton.

Science.gov (United States)

Zeilinger, Adam R; Olson, Dawn M; Andow, David A

2016-06-01

The adoption of transgenic Bt cotton has, in some cases, led to environmental and economic benefits through reduced insecticide use. However, the distribution of these benefits and associated risks among cotton growers and cotton-growing regions has been uneven due in part to outbreaks of non-target or secondary pests, thereby requiring the continued use of synthetic insecticides. In the southeastern USA, Bt cotton adoption has resulted in increased abundance of and damage from stink bug pests, Euschistus servus and Nezara viridula (Heteroptera: Pentatomidae). While the impact of increased stink bug abundance has been well-documented, the causes have remained unclear. We hypothesize that release from competition with Bt-susceptible target pests may drive stink bug outbreaks in Bt cotton. We first examined the evidence for competitive release of stink bugs through meta-analysis of previous studies. We then experimentally tested if herbivory by Bt-susceptible Helicoverpa zea increases stink bug leaving rates and deters oviposition on non-Bt cotton. Consistent with previous studies, we found differences in leaving rates only for E servus, but we found that both species strongly avoided ovipositing on H. zea-damaged plants. Considering all available evidence, competitive release of stink bug populations in Bt cotton likely contributes to outbreaks, though the relative importance of competitive release remains an open question. Ecological risk assessments of Bt crops and other transgenic insecticidal crops would benefit from greater understanding of the ecological mechanisms underlying non-target pest outbreaks and greater attention to indirect ecological effects more broadly.

No evidence for change in oviposition behaviour of Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) after widespread adoption of transgenic insecticidal cotton.

Science.gov (United States)

Zalucki, M P; Cunningham, J P; Downes, S; Ward, P; Lange, C; Meissle, M; Schellhorn, N A; Zalucki, J M

2012-08-01

Cotton growing landscapes in Australia have been dominated by dual-toxin transgenic Bt varieties since 2004. The cotton crop has thus effectively become a sink for the main target pest, Helicoverpa armigera. Theory predicts that there should be strong selection on female moths to avoid laying on such plants. We assessed oviposition, collected from two cotton-growing regions, by female moths when given a choice of tobacco, cotton and cabbage. Earlier work in the 1980s and 1990s on populations from the same geographic locations indicated these hosts were on average ranked as high, mid and low preference plants, respectively, and that host rankings had a heritable component. In the present study, we found no change in the relative ranking of hosts by females, with most eggs being laid on tobacco, then cotton and least on cabbage. As in earlier work, some females laid most eggs on cotton and aspects of oviposition behaviour had a heritable component. Certainly, cotton is not avoided as a host, and the implications of these finding for managing resistance to Bt cotton are discussed.

Overexpression of a cotton (Gossypium hirsutum) WRKY gene, GhWRKY34, in Arabidopsis enhances salt-tolerance of the transgenic plants.

Science.gov (United States)

Zhou, Li; Wang, Na-Na; Gong, Si-Ying; Lu, Rui; Li, Yang; Li, Xue-Bao

2015-11-01

Soil salinity is one of the most serious threats in world agriculture, and often influences cotton growth and development, resulting in a significant loss in cotton crop yield. WRKY transcription factors are involved in plant response to high salinity stress, but little is known about the role of WRKY transcription factors in cotton so far. In this study, a member (GhWRKY34) of cotton WRKY family was functionally characterized. This protein containing a WRKY domain and a zinc-finger motif belongs to group III of cotton WRKY family. Subcellular localization assay indicated that GhWRKY34 is localized to the cell nucleus. Overexpression of GhWRKY34 in Arabidopsis enhanced the transgenic plant tolerance to salt stress. Several parameters (such as seed germination, green cotyledons, root length and chlorophyll content) in the GhWRKY34 transgenic lines were significantly higher than those in wild type under NaCl treatment. On the contrary, the GhWRKY34 transgenic plants exhibited a substantially lower ratio of Na(+)/K(+) in leaves and roots dealing with salt stress, compared with wild type. Growth status of the GhWRKY34 transgenic plants was much better than that of wild type under salt stress. Expressions of the stress-related genes were remarkably up-regulated in the transgenic plants under salt stress, compared with those in wild type. Based on the data presented in this study, we hypothesize that GhWRKY34 as a positive transcription regulator may function in plant response to high salinity stress through maintaining the Na(+)/K(+) homeostasis as well as activating the salt stress-related genes in cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

Science.gov (United States)

Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

2015-01-01

RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

Science.gov (United States)

Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

2011-04-01

Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

Effects of Soil Salinity on the Expression of Bt Toxin (Cry1Ac and the Control Efficiency of Helicoverpa armigera in Field-Grown Transgenic Bt Cotton.

Directory of Open Access Journals (Sweden)

Jun-Yu Luo

Full Text Available An increasing area of transgenic Bacillus thuringiensis (Bt cotton is being planted in saline-alkaline soil in China. The Bt protein level in transgenic cotton plants and its control efficiency can be affected by abiotic stress, including high temperature, water deficiency and other factors. However, how soil salinity affects the expression of Bt protein, thus influencing the control efficiency of Bt cotton against the cotton bollworm (CBW Helicoverpa armigera (Hübner in the field, is poorly understood. Our objective in the present study was to investigate the effects of soil salinity on the expression of Bt toxin (Cry1Ac and the control efficiency of Helicoverpa armigera in field-grown transgenic Bt cotton using three natural saline levels (1.15 dS m-1 [low soil-salinity], 6.00 dS m-1 [medium soil-salinity] and 11.46 dS m-1 [high soil-salinity]. We found that the Bt protein content in the transgenic Bt cotton leaves and the insecticidal activity of Bt cotton against CBW decreased with the increasing soil salinity in laboratory experiments during the growing season. The Bt protein content of Bt cotton leaves in the laboratory were negatively correlated with the salinity level. The CBW populations were highest on the Bt cotton grown in medium-salinity soil instead of the high-salinity soil in field conditions. A possible mechanism may be that the relatively high-salinity soil changed the plant nutritional quality or other plant defensive traits. The results from this study may help to identify more appropriate practices to control CBW in Bt cotton fields with different soil salinity levels.

High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

Directory of Open Access Journals (Sweden)

Amarjeet Kumar Singh

Full Text Available Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp, which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

Directory of Open Access Journals (Sweden)

Xiemin Qi

2016-07-01

Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

Recent long-distance transgene flow into wild populations conforms to historical patterns of gene flow in cotton (Gossypium hirsutum) at its centre of origin.

Science.gov (United States)

Wegier, A; Piñeyro-Nelson, A; Alarcón, J; Gálvez-Mariscal, A; Alvarez-Buylla, E R; Piñero, D

2011-10-01

Over 95% of the currently cultivated cotton was domesticated from Gossypium hirsutum, which originated and diversified in Mexico. Demographic and genetic studies of this species at its centre of origin and diversification are lacking, although they are critical for cotton conservation and breeding. We investigated the actual and potential distribution of wild cotton populations, as well as the contribution of historical and recent gene flow in shaping cotton genetic diversity and structure. We evaluated historical gene flow using chloroplast microsatellites and recent gene flow through the assessment of transgene presence in wild cotton populations, exploiting the fact that genetically modified cotton has been planted in the North of Mexico since 1996. Assessment of geographic structure through Bayesian spatial analysis, BAPS and Genetic Algorithm for Rule-set Production (GARP), suggests that G. hirsutum seems to conform to a metapopulation scheme, with eight distinct metapopulations. Despite evidence for long-distance gene flow, genetic variation among the metapopulations of G. hirsutum is high (He = 0.894 ± 0.01). We identified 46 different haplotypes, 78% of which are unique to a particular metapopulation, in contrast to a single haplotype detected in cotton cultivars. Recent gene flow was also detected (m = 66/270 = 0.24), with four out of eight metapopulations having transgenes. We discuss the implications of the data presented here with respect to the conservation and future breeding of cotton populations and genetic diversity at its centre of crop origin. © 2011 Blackwell Publishing Ltd.

Energy budgeting and carbon footprint of transgenic cotton-wheat production system through peanut intercropping and FYM addition.

Science.gov (United States)

Singh, Raman Jeet; Ahlawat, I P S

2015-05-01

Two of the most pressing sustainability issues are the depletion of fossil energy resources and the emission of atmospheric green house gases like carbon dioxide to the atmosphere. The aim of this study was to assess energy budgeting and carbon footprint in transgenic cotton-wheat cropping system through peanut intercropping with using 25-50% substitution of recommended dose of nitrogen (RDN) of cotton through farmyard manure (FYM) along with 100% RDN through urea and control (0 N). To quantify the residual effects of previous crops and their fertility levels, a succeeding crop of wheat was grown with varying rates of nitrogen, viz. 0, 50, 100, and 150 kg ha(-1). Cotton + peanut-wheat cropping system recorded 21% higher system productivity which ultimately helped to maintain higher net energy return (22%), energy use efficiency (12%), human energy profitability (3%), energy productivity (7%), carbon outputs (20%), carbon efficiency (17%), and 11% lower carbon footprint over sole cotton-wheat cropping system. Peanut addition in cotton-wheat system increased the share of renewable energy inputs from 18 to 21%. With substitution of 25% RDN of cotton through FYM, share of renewable energy resources increased in the range of 21% which resulted into higher system productivity (4%), net energy return (5%), energy ratio (6%), human energy profitability (74%), energy productivity (6%), energy profitability (5%), and 5% lower carbon footprint over no substitution. The highest carbon footprint (0.201) was recorded under control followed by 50 % substitution of RDN through FYM (0.189). With each successive increase in N dose up to 150 kg N ha(-1) to wheat, energy productivity significantly reduced and share of renewable energy inputs decreased from 25 to 13%. Application of 100 kg N ha(-1) to wheat maintained the highest grain yield (3.71 t ha(-1)), net energy return (105,516 MJ ha(-1)), and human energy profitability (223.4) over other N doses applied to wheat

Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

Cotton (Gossypium hirsutum L.).

Science.gov (United States)

Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

2015-01-01

Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

Science.gov (United States)

Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

2015-07-01

Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. © 2014 Scandinavian Plant Physiology Society.

A Grey Fuzzy Logic Approach for Cotton Fibre Selection

Science.gov (United States)

Chakraborty, Shankar; Das, Partha Protim; Kumar, Vidyapati

2017-06-01

It is a well known fact that the quality of ring spun yarn predominantly depends on various physical properties of cotton fibre. Any variation in these fibre properties may affect the strength and unevenness of the final yarn. Thus, so as to achieve the desired yarn quality and characteristics, it becomes imperative for the spinning industry personnel to identify the most suitable cotton fibre from a set of feasible alternatives in presence of several conflicting properties/attributes. This cotton fibre selection process can be modelled as a Multi-Criteria Decision Making (MCDM) problem. In this paper, a grey fuzzy logic-based approach is proposed for selection of the most apposite cotton fibre from 17 alternatives evaluated based on six important fibre properties. It is observed that the preference order of the top-ranked cotton fibres derived using the grey fuzzy logic approach closely matches with that attained by the past researchers which proves the application potentiality of this method in solving varying MCDM problems in textile industries.

The recovery of Bt toxin content after temperature stress termination in transgenic cotton

Energy Technology Data Exchange (ETDEWEB)

Chen, Y.; Wen, Y.; Zhang, X.; Wang, Y.; Chen, D.

2013-06-01

The insecticidal efficacy of Bt cotton under different environments has generated controversy in recent years. The objective of this study was to investigate possible reasons of the conflicting results caused by temperature stress. Two different types of Bt transgenic cotton cultivars (a Bt cultivar, Sikang1, and an hybrid Bt cultivar, Sikang3) were selected. The plants of the two Bt cultivars were exposed to high temperature (37 degree centigrade), low temperature (18 degree centigrade), and the control (27 degree centigrade) for short (24 h) and long (48 h) periods of stress at peak boll stage, and then moved to the glasshouse where the control plants were maintained. The results showed that the leaf insecticidal toxin content fully recovered within 24 h to the level of control after the end of short duration high-temperature treatment, and recovered mostly within 48 h of the termination of 24 h low-temperature stress. Under long duration high temperature treatment the Bt toxin content required longer recovery periods (48 and 72 h for Sikang3 and Sikang1, respectively) to reach the control level. The Bt protein content only recovered partially at 96 h after the end of the long-duration low-temperature stress, and the concentrations of the Cry1Ac protein were 74% and 77% of the corresponding control for Sikang1 and Sikang3, respectively. The different recovery and increase slowly of the leaf nitrogen metabolic rates after ceasing the heat and cold stress may be possible reason for the above difference. In summary, the duration and type of temperature (cold or heat) stress may cause different Bt insecticidal protein recovery rate due to different recovery rate of enzymes. (Author) 31 refs.

Genetic engineering of cotton with a novel cry2AX1 gene to impart insect resistance against Helicoverpa armigera

Directory of Open Access Journals (Sweden)

Karunamurthy Dhivya

2016-09-01

Full Text Available Embryogenic calli of cotton (Coker310 were cocultivated with the Agrobacterium tumefaciens strain LBA4404 harbouring the codon-optimised, chimeric cry2AX1 gene consisting of sequences from cry2Aa and cry2Ac genes isolated from Indian strains of Bacillus thuringiensis. Forty-eight putative transgenic plants were regenerated, and PCR analysis of these plants revealed the presence of the cry2AX1 gene in 40 plants. Southern blot hybridisation analysis of selected transgenic plants confirmed stable T-DNA integration in the genome of transformed plants. The level of Cry2AX1 protein expression in PCR positive plants ranged from 4.9 to 187.5 ng g-1 of fresh tissue. A transgenic cotton event, TP31, expressing the cry2AX1 gene showed insecticidal activity of 56.66 per cent mortality against Helicoverpa armigera in detached leaf disc bioassay. These results indicate that the chimeric cry2AX1 gene expressed in transgenic cotton has insecticidal activity against H. armigera.

Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton

International Nuclear Information System (INIS)

Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.

2017-01-01

Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)

An Integrated DEMATEL-VIKOR Method-Based Approach for Cotton Fibre Selection and Evaluation

Science.gov (United States)

Chakraborty, Shankar; Chatterjee, Prasenjit; Prasad, Kanika

2018-01-01

Selection of the most appropriate cotton fibre type for yarn manufacturing is often treated as a multi-criteria decision-making (MCDM) problem as the optimal selection decision needs to be taken in presence of several conflicting fibre properties. In this paper, two popular MCDM methods in the form of decision making trial and evaluation laboratory (DEMATEL) and VIse Kriterijumska Optimizacija kompromisno Resenje (VIKOR) are integrated to aid the cotton fibre selection decision. DEMATEL method addresses the interrelationships between various physical properties of cotton fibres while segregating them into cause and effect groups, whereas, VIKOR method helps in ranking all the considered 17 cotton fibres from the best to the worst. The derived ranking of cotton fibre alternatives closely matches with that obtained by the past researchers. This model can assist the spinning industry personnel in the blending process while making accurate fibre selection decision when cotton fibre properties are numerous and interrelated.

A Quality Function Deployment-Based Expert System for Cotton Fibre Selection

Science.gov (United States)

Chakraborty, Shankar; Prasad, Kanika

2018-06-01

The textile industries have seen resurgence in customers' demand for quality products during the preceding few years. This product range is extremely varied, with hand-spun and hand-woven products at one end of the spectrum, while products manufactured from the capital intensive sophisticated machineries at the other end. Since, cotton fibres are predominantly employed as the raw material for manufacturing these products, their proper selection is crucial for sustainable development of the textile/spinning industries. However, availability of numerous cotton fibre alternatives with various physical properties makes this selection process unwieldy and time consuming. Thus, there is need for a structured approach that can incorporate customers' demand into the selection process. This paper demonstrates the application of a structured and logical procedure of selecting the best cotton fibre type to fulfill a set of specified end product requirements through design and development of a quality function deployment (QFD)-based expert system. The QFD technique is employed here to provide due importance to the customers' spoken and unspoken needs, and subsequently calculate the priority weights of the considered cotton fibre properties. Two real time illustrative examples are presented to explicate the applicability and potentiality of the developed expert system to resolve cotton fibre selection problems.

A Quality Function Deployment-Based Expert System for Cotton Fibre Selection

Science.gov (United States)

Chakraborty, Shankar; Prasad, Kanika

2018-01-01

The textile industries have seen resurgence in customers' demand for quality products during the preceding few years. This product range is extremely varied, with hand-spun and hand-woven products at one end of the spectrum, while products manufactured from the capital intensive sophisticated machineries at the other end. Since, cotton fibres are predominantly employed as the raw material for manufacturing these products, their proper selection is crucial for sustainable development of the textile/spinning industries. However, availability of numerous cotton fibre alternatives with various physical properties makes this selection process unwieldy and time consuming. Thus, there is need for a structured approach that can incorporate customers' demand into the selection process. This paper demonstrates the application of a structured and logical procedure of selecting the best cotton fibre type to fulfill a set of specified end product requirements through design and development of a quality function deployment (QFD)-based expert system. The QFD technique is employed here to provide due importance to the customers' spoken and unspoken needs, and subsequently calculate the priority weights of the considered cotton fibre properties. Two real time illustrative examples are presented to explicate the applicability and potentiality of the developed expert system to resolve cotton fibre selection problems.

Distribution and Potential Impact of Feral Cotton on the ...

African Journals Online (AJOL)

Transgenic Bt cotton with insecticidal properties presents a potential solution to the bollworm infestation in Tanzania. However, concerns associated with transgenic crops viz.; transgene flow to wild and feral relatives, increased potential for resistance evolution, need to be addressed prior to adoption of any transgenic crop.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Transgenic cotton coexpressing Vip3A and Cry1Ac has a broad insecticidal spectrum against lepidopteran pests.

Science.gov (United States)

Chen, Wen-Bo; Lu, Guo-Qing; Cheng, Hong-Mei; Liu, Chen-Xi; Xiao, Yu-Tao; Xu, Chao; Shen, Zhi-Cheng; Wu, Kong-Ming

2017-10-01

Although farmers in China have grown transgenic Bt-Cry1Ac cotton to resist the major pest Helicoverpa armigera since 1997 with great success, many secondary lepidopteran pests that are tolerant to Cry1Ac are now reported to cause considerable economic damage. Vip3AcAa, a chimeric protein with the N-terminal part of Vip3Ac and the C-terminal part of Vip3Aa, has a broad insecticidal spectrum against lepidopteran pests and has no cross resistance to Cry1Ac. In the present study, we tested insecticidal activities of Vip3AcAa against Spodoptera litura, Spodoptera exigua, and Agrotis ipsilon, which are relatively tolerant to Cry1Ac proteins. The bioassay results showed that insecticidal activities of Vip3AcAa against these three pests are superior to Cry1Ac, and after an activation pretreatment, Vip3AcAa retained insecticidal activity against S. litura, S. exigua and A. ipsilon that was similar to the unprocessed protein. The putative receptor for this chimeric protein in the brush border membrane vesicle (BBMV) in the three pests was also identified using biotinylated Vip3AcAa toxin. To broaden Bt cotton activity against a wider spectrum of pests, we introduced the vip3AcAa and cry1Ac genes into cotton. Larval mortality rates for S. litura, A. ipsilon and S. exigua that had fed on this new cotton increased significantly compared with larvae fed on non-Bt cotton and Bt-Cry1Ac cotton in a laboratory experiment. These results suggested that the Vip3AcAa protein is an excellent option for a "pyramid" strategy for integrated pest management in China. Copyright © 2017 Elsevier Inc. All rights reserved.

Soil microflora and enzyme activities in rhizosphere of Transgenic Bt cotton hybrid under different intercropping systems and plant protection schedules

Science.gov (United States)

Biradar, D. P.; Alagawadi, A. R.; Basavanneppa, M. A.; Udikeri, S. S.

2012-04-01

Field experiments were conducted over three rainy seasons of 2005-06 to 2007-08 on a Vertisol at Dharwad, Karnataka, India to study the effect of intercropping and plant protection schedules on productivity, soil microflora and enzyme activities in the rhizosphere of transgenic Bt cotton hybrid. The experiment consisted of four intercropping systems namely, Bt cotton + okra, Bt cotton + chilli, Bt cotton + onion + chilli and Bt cotton + redgram with four plant protection schedules (zero protection, protection for Bt cotton, protection for intercrop and protection for both crops). Observations on microbial populations and enzyme activities were recorded at 45, 90, 135 and 185 (at harvest) days after sowing (DAS). Averaged over years, Bt cotton + okra intercropping had significantly higher total productivity than Bt cotton + chilli and Bt cotton + redgram intercropping system and was similar to Bt cotton + chilli + onion intercropping system. With respect to plant protection schedules for bollworms, protection for both cotton and intercrops recorded significantly higher yield than the rest of the treatments. Population of total bacteria, fungi, actinomycetes, P-solubilizers, free-living N2 fixers as well as urease, phosphatase and dehydrogenase enzyme activities increased up to 135 days of crop growth followed by a decline. Among the intercropping systems, Bt cotton + chilli recorded significantly higher population of microorganisms and enzyme activities than other cropping systems. While Bt cotton with okra as intercrop recorded the least population of total bacteria and free-living N2 fixers as well as urease activity. Intercropping with redgram resulted in the least population of actinomycetes, fungi and P-solubilizers, whereas Bt cotton with chilli and onion recorded least activities of dehydrogenase and phosphatase. Among the plant protection schedules, zero protection recorded maximum population of microorganisms and enzyme activities. This was followed by the

The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

Science.gov (United States)

Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

2018-05-11

Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

Inheritance and segregation of exogenous genes in transgenic cotton

Indian Academy of Sciences (India)

1Key Laboratory of Cotton Genetic Improvement of the Ministry of Agriculture, Cotton Research Institute, Chinese. Academy of Agricultural Sciences, Anyang Henan 455 112, People's Republic of China. 2Institute ..... Athens, Greece. Xie D. X. ...

Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

Directory of Open Access Journals (Sweden)

Wen-Qin Bai

Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

Genetic transformation of cry1EC gene into cotton ( Gossypium ...

African Journals Online (AJOL)

Cotton is the chief fibre crop of global importance. It plays a significant role in the national economy. Cotton crop is vulnerable to a number of insect species, especially to the larvae of lepidopteron pests. 60% insecticides sprayed on cotton are meant to control the damage caused by bollworm complex. Transgenic ...

Leaf tissue assay for lepidopteran pests of Bt cotton

Science.gov (United States)

Laboratory measurements of susceptibility to Bt toxins can be a poor indicator of the ability of an insect to survive on transgenic crops. We investigated the potential of using cotton leaf tissue for evaluating heliothine susceptibilities to two dual-gene Bt cottons. A preliminary study was conduct...

Selectivity and stability of vegetation-applied herbicides in cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

T. Barakova

2016-06-01

Full Text Available Abstract. An experiment was carried out during 2013 – 2015 in the experimental field of the Field Crops Institute, Chirpan, with two cotton cultivars − Helius and Darmi (Gossypium hirsutum L.. Herbicides: Goal 2 E, oxyfluorfen (80 ml/da; Linuron 45 SC, linuron (200 ml/da; Wing-P, pendimethalin + dimethenamid (400 ml/da; Merlin 750 WG, isoxaflutol (5 g/da; Bazagran 480 SL, bentazone (150 ml/da were investigated. They were treated separately or combined with growth regulator Amalgerol (500 ml/da or foliar fertilizer Lactofol O (500 ml/da in the budding stage of the cotton. It was established that selectivity is the lowest in the two cotton cultivars with herbicides Linuron 45 CK and Merlin 750 WG. The purpose of this investigation was to establish the selectivity and stability of some herbicides and their tank mixtures on the cotton by influence of different meteorological conditions. It has been found that the highest phytotoxicity on cotton is given the vegetation-applied herbicides Merlin and Linuron. Foliar fertilizer Laktofol O reduces phytotoxicity of herbicides Goal, Wing, Merlin and Bazagran in two cotton cultivars. Herbicides Wing and Bazagran have excellent selectivity for the two cotton cultivars – Helius and Darmi. The highest yield was obtained by vegetation treatment with herbicide Bazagran, followed by herbicides Wing and Goal. Tank mixtures of Goal, Bazagran and Wing with Laktofol, followed by those with Amalgerol are technologically the most valuable. They combine high yield with high stability over the years. Аlone application of herbicides Linuron and Merlin and their tank mixtures with Amalgerol and Laktofol have low estimate.

Does transgenic Cry1Ac + CpTI cotton pollen affect hypopharyngeal gland development and midgut proteolytic enzyme activity in the honey bee Apis mellifera L. (Hymenoptera, Apidae)?

Science.gov (United States)

Han, Peng; Niu, Chang-Ying; Biondi, Antonio; Desneux, Nicolas

2012-11-01

The transgenic Cry1Ac (Bt toxin) + CpTI (Cowpea Trypsin Inhibitor) cotton cultivar CCRI41 is increasingly used in China and potential side effects on the honey bee Apis mellifera L. have been documented recently. Two studies have assessed potential lethal and sublethal effects in young bees fed with CCRI41 cotton pollen but no effect was observed on learning capacities, although lower feeding activity in exposed honey bees was noted (antifeedant effect). The present study aimed at providing further insights into potential side effects of CCRI41 cotton on honey bees. Emerging honey bees were exposed to different pollen diets using no-choice feeding protocols (chronic exposure) in controlled laboratory conditions and we aimed at documenting potential mechanisms underneath the CCRI41 antifeedant effect previously reported. Activity of midgut proteolytic enzyme of young adult honey bees fed on CCRI41 cotton pollen were not significantly affected, i.e. previously observed antifeedant effect was not linked to disturbed activity of the proteolytic enzymes in bees' midgut. Hypopharyngeal gland development was assessed by quantifying total extractable proteins from the glands. Results suggested that CCRI41 cotton pollen carries no risk to hypopharyngeal gland development of young adult honey bees. In the two bioassays, honey bees exposed to 1 % soybean trypsin inhibitor were used as positive controls for both midgut proteolytic enzymes and hypopharyngeal gland proteins quantification, and bees exposed to 48 ppb (part per billion) (i.e. 48 ng g(-1)) imidacloprid were used as controls for exposure to a sublethal concentration of toxic product. The results show that the previously reported antifeedant effect of CCRI41 cotton pollen on honey bees is not linked to effects on their midgut proteolytic enzymes or on the development of their hypopharyngeal glands. The results of the study are discussed in the framework of risk assessment of transgenic crops on honey bees.

Seletividade de amonio-glufosinate isolado e em mistura com pyrithiobac-sodium em algodoeiro transgênico LL® Selectivity of ammonium-glufosinate applied alone or in mixture with pyrithiobac sodium in transgenic LL® cotton

Directory of Open Access Journals (Sweden)

G.B.P. Braz

2012-12-01

Full Text Available Com a recente introdução no Brasil de variedades transgênicas de algodoeiro que apresentam resistência ao amonio-glufosinate (LL®, há escassez de informações tanto a respeito da seletividade de reaplicações desse herbicida, quanto no que se refere a misturas com outros herbicidas. Objetivou-se no presente trabalho avaliar a seletividade de aplicações sequenciais de amonio-glufosinate isolado e em associação com pyrithiobac-sodium em algodão transgênico LL®. Dessa forma, foi instalado um experimento em delineamento de blocos casualizados em arranjo fatorial (3x3+1, empregando-se oito repetições. O primeiro fator correspondeu à aplicação dos tratamentos amonio-glufosinate (500 g ha-1 e amonio-glufosinate + pyrithiobac-sodium (500 + 42 g ha-1 e 500 + 56 g ha-1. O segundo fator foi o número de aplicações sequenciais em pós-emergência do algodoeiro (uma, duas ou três. O tratamento adicional foi composto por testemunha sem aplicação de herbicida. A associação do pyrithiobac-sodium ao amonio-glufosinate causou maiores níveis de fitointoxicação inicial, embora não tenham havido mais sintomas duas semanas após as aplicações. A qualidade de fibra do algodoeiro não foi influenciada por nenhum dos tratamentos herbicidas. O amonio-glufosinate isolado foi seletivo para o algodão LL® em até três aplicações em pós-emergência. O algodoeiro apresentou ainda tolerância a uma aplicação da mistura de amonio-glufosinate + pyrithiobac-sodium, e não se observou qualquer efeito negativo sobre a produtividade de algodão em caroço.Due to the recent introduction of transgenic cotton varities with resistance to ammonium-glufosinate (LL® in Brazil, there is a lack of information related both to the selectivity of sequential reapplications of ammonium-glufosinate and to tank mixture with other herbicides. This work aimed to evaluate the selectivity of sequential applications of ammonium-glufosinate isolated or in

Radiation mutagenesis in development of genetic fundamentals of cotton selection

International Nuclear Information System (INIS)

Musaev, D.A.; Almatov, A.S.

1987-01-01

Some results of investigations on preparation and genetic analysis of mutants in inbreeding lines of genetic collections of cotton plants, as well as problems on mutant application in practical selection are covered. The results show that the scientific authenticity and efficiency of fundamental and applied investigations in the field of experimental mutagenesis of cotton plants,being a facultative self-polinator, depend on keeping necessary methodical requirements. Application of inbreeding lines of genetic collection with marker features as the initial material, isolation of plants usinng self-polination of flowers on all stages of investigation are related to these requirements. Several methodical recommendations on genetic-selective investigations are developed

The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.

Directory of Open Access Journals (Sweden)

Peng Wan

Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.

Selection of Bacillus thuringiensis strains toxic to cotton boll weevil (Anthonomus grandis, Coleoptera: Curculionidae) larvae.

Science.gov (United States)

Pérez, Melisa P; Sauka, Diego H; Onco, María I; Berretta, Marcelo F; Benintende, Graciela B

Preliminary bioassays with whole cultures (WC) of 124 Bacillus thuringiensis strains were performed with neonate larvae of Anthonomus grandis, a major cotton pest in Argentina and other regions of the Americas. Three exotic and four native strains were selected for causing more than 50% mortality. All of them were β-exotoxin producers. The native strains shared similar morphology of parasporal crystals, similar protein pattern and identical insecticidal gene profiles. These features resembled Lepidoptera-toxic strains. Furthermore, these strains showed a Rep-PCR pattern identical to lepidoptericidal strain HD-1, suggesting that these strains may belong to serovar kurstaki. However, some differences were observed in the plasmid profiles and in the production of β-exotoxin. To determine the culture fractions where the insecticidal metabolites were present, bioassays including resuspended spore-crystal pellets, filtered supernatants (FS) were compared with those of WC. Both fractions tested showed some level of insecticidal activity. The results may suggest that the main toxic factors can be found in FS and could be directly correlated with the presence of β-exotoxin. Based on the bioassays with FS and autoclaved FS, the participation of thermolabile virulence factors such as Cry1I in toxicity is neither discarded. In the selected strains, β-exotoxin would be the major associated virulence factor; therefore, their use in biological control of A. grandis should be restricted. Nevertheless, these strains could be the source of genes (e.g., cry1Ia) to produce transgenic cotton plants resistant to this pest. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis

Directory of Open Access Journals (Sweden)

Muhammad Sajjad Ali

2013-07-01

Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

Science.gov (United States)

Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

2018-04-12

Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

Directory of Open Access Journals (Sweden)

Pu Lu

2018-04-01

Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress

A point mutation (L1015F) of the voltage-sensitive sodium channel gene associated with lambda-cyhalothrin resistance in Apolygus lucorum (Meyer-Dür) population from the transgenic Bt cotton field of China.

Science.gov (United States)

Zhen, Congai; Gao, Xiwu

2016-02-01

In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.

Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

Science.gov (United States)

Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

2011-01-01

Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

Suppression of cotton leaf curl disease symptoms in Gossypium hirsutum through over expression of host-encoded miRNAs.

Science.gov (United States)

Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A

2017-12-10

Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected

Effective selection of transgenic papaya plants with the PMI/Man selection system.

Science.gov (United States)

Zhu, Yun J; Agbayani, Ricelle; McCafferty, Heather; Albert, Henrik H; Moore, Paul H

2005-09-01

The selectable marker gene phospho-mannose isomerase (pmi), which encodes the enzyme phospho-mannose isomerase (PMI) to enable selection of transformed cell lines on media containing mannose (Man), was evaluated for genetic transformation of papaya (Carica papaya L.). We found that papaya embryogenic calli have little or no PMI activity and cannot utilize Man as a carbon source; however, when calli were transformed with a pmi gene, the PMI activity was greatly increased and they could utilize Man as efficiently as sucrose. Plants regenerated from selected callus lines also exhibited PMI activity but at a lower specific activity level. Our transformation efficiency with Man selection was higher than that reported using antibiotic selection or with a visual marker. For papaya, the PMI/Man selection system for producing transgenic plants is a highly efficient addition to previously published methods for selection and may facilitate the stacking of multiple transgenes of interest. Additionally, since the PMI/Man selection system does not involve antibiotic or herbicide resistance genes, its use might reduce environmental concerns about the potential flow of those genes into related plant populations.

Cotton genotypes selection through artificial neural networks.

Science.gov (United States)

Júnior, E G Silva; Cardoso, D B O; Reis, M C; Nascimento, A F O; Bortolin, D I; Martins, M R; Sousa, L B

2017-09-27

Breeding programs currently use statistical analysis to assist in the identification of superior genotypes at various stages of a cultivar's development. Differently from these analyses, the computational intelligence approach has been little explored in genetic improvement of cotton. Thus, this study was carried out with the objective of presenting the use of artificial neural networks as auxiliary tools in the improvement of the cotton to improve fiber quality. To demonstrate the applicability of this approach, this research was carried out using the evaluation data of 40 genotypes. In order to classify the genotypes for fiber quality, the artificial neural networks were trained with replicate data of 20 genotypes of cotton evaluated in the harvests of 2013/14 and 2014/15, regarding fiber length, uniformity of length, fiber strength, micronaire index, elongation, short fiber index, maturity index, reflectance degree, and fiber quality index. This quality index was estimated by means of a weighted average on the determined score (1 to 5) of each characteristic of the HVI evaluated, according to its industry standards. The artificial neural networks presented a high capacity of correct classification of the 20 selected genotypes based on the fiber quality index, so that when using fiber length associated with the short fiber index, fiber maturation, and micronaire index, the artificial neural networks presented better results than using only fiber length and previous associations. It was also observed that to submit data of means of new genotypes to the neural networks trained with data of repetition, provides better results of classification of the genotypes. When observing the results obtained in the present study, it was verified that the artificial neural networks present great potential to be used in the different stages of a genetic improvement program of the cotton, aiming at the improvement of the fiber quality of the future cultivars.

Environmental effect of conventional and GM crops of cotton (Gossipium hirsitum L. and corn (Zea mays L.

Directory of Open Access Journals (Sweden)

Kelly Ávila

2011-12-01

Full Text Available In the corn belt of Valle de San Juan and in the cotton zone of El Espinal, municipalities in the department of Tolima (Colombia, 10 conventional corn producers, 10 producers of genetically modified corn, five producers of conventional cotton and 15 producers of transgenic cotton were surveyed in the first half of 2009 to contrast the differences in the environmental impact associated with use of insecticides and herbicides, which were evaluated by estimating the environmental index quotient-EIQ. In the case of maize, an EIQ of 42 was found in the conventional type, while transgenic technology had an EIQ of 3.03. In the cultivation of cotton, an EIQ of 263.59 was found for the conventional type while for transgenic technology this value varied between 335.75 (Nuopal BG/RR and 324.79 (DP 455 BG/RR. These data showed a lower environmental impact using GM technology in the cultivation of maize when compared to the conventional counterpart, in connection with the use of insecticides and herbicides, in the context of time, space and genotypic analysis. This effect was not observed in the case of cotton, where environmental impacts were similar

Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

Science.gov (United States)

Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

2017-09-13

The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

Science.gov (United States)

Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

2015-05-01

Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

Herbicide-resistant cotton (Gossypium hirsutum) plants: an alternative way of manual weed removal.

Science.gov (United States)

Latif, Ayesha; Rao, Abdul Qayyum; Khan, Muhammad Azmat Ullah; Shahid, Naila; Bajwa, Kamran Shehzad; Ashraf, Muhammad Aleem; Abbas, Malik Adil; Azam, Muhammad; Shahid, Ahmad Ali; Nasir, Idrees Ahmad; Husnain, Tayyab

2015-09-17

Cotton yield has been badly affected by different insects and weed competition. In Past Application of multiple chemicals is required to manage insects and weed control was achieved by different conventional means, such as hand weeding, crop rotation and polyculture, because no synthetic chemicals were available. The control methods shifted towards high input and target-oriented methods after the discovery of synthetic herbicide in the 1930s. To utilise the transgenic approach, cotton plants expressing the codon-optimised CEMB GTGene were produced in the present study. Local cotton variety CEMB-02 containing Cry1Ac and Cry2A in single cassette was transformed by synthetic codon-optimised 5-enolpyruvylshikimate-3-phosphate synthase gene cloned into pCAMBIA 1301 vector under 35S promoter with Agrobacterium tumifaciens. Putative transgenic plants were screened in MS medium containing 120 µmol/L glyphosate. Integration and expression of the gene were evaluated by PCR from genomic DNA and ELISA from protein. A 1.4-kb PCR product for Glyphosate and 167-bp product for Cry2A were obtained by amplification through gene specific primers. Expression level of Glyphosate and Bt proteins in two transgenic lines were recorded to be 0.362, 0.325 µg/g leaf and 0.390, 0.300 µg/g leaf respectively. FISH analysis of transgenic lines demonstrates the presence of one and two copy no. of Cp4 EPSPS transgene respectively. Efficacy of the transgene Cp4 EPSPS was further evaluated by Glyphosate spray (41 %) assay at 1900 ml/acre and insect bioassay which shows 100 %mortality of insect feeding on transgenic lines as compared to control. The present study shows that the transgenic lines produced in this study were resistant not only to insects but also equally good against 1900 ml/acre field spray concentration of glyphosate.

Genome Editing in Cotton with the CRISPR/Cas9 System

Directory of Open Access Journals (Sweden)

Wei Gao

2017-08-01

Full Text Available Genome editing is an important tool for gene functional studies as well as crop improvement. The recent development of the CRISPR/Cas9 system using single guide RNA molecules (sgRNAs to direct precise double strand breaks in the genome has the potential to revolutionize agriculture. Unfortunately, not all sgRNAs are equally efficient and it is difficult to predict their efficiency by bioinformatics. In crops such as cotton (Gossypium hirsutum L., with labor-intensive and lengthy transformation procedures, it is essential to minimize the risk of using an ineffective sgRNA that could result in the production of transgenic plants without the desired CRISPR-induced mutations. In this study, we have developed a fast and efficient method to validate the functionality of sgRNAs in cotton using a transient expression system. We have used this method to validate target sites for three different genes GhPDS, GhCLA1, and GhEF1 and analyzed the nature of the CRISPR/Cas9-induced mutations. In our experiments, the most frequent type of mutations observed in cotton cotyledons were deletions (∼64%. We prove that the CRISPR/Cas9 system can effectively produce mutations in homeologous cotton genes, an important requisite in this allotetraploid crop. We also show that multiple gene targeting can be achieved in cotton with the simultaneous expression of several sgRNAs and have generated mutations in GhPDS and GhEF1 at two target sites. Additionally, we have used the CRISPR/Cas9 system to produce targeted gene fragment deletions in the GhPDS locus. Finally, we obtained transgenic cotton plants containing CRISPR/Cas9-induced gene editing mutations in the GhCLA1 gene. The mutation efficiency was very high, with 80.6% of the transgenic lines containing mutations in the GhCLA1 target site resulting in an intense albino phenotype due to interference with chloroplast biogenesis.

Non-recessive Bt toxin resistance conferred by an intracellular cadherin mutation in field-selected populations of cotton bollworm.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins have been planted widely to control insect pests, yet evolution of resistance by the pests can reduce the benefits of this approach. Recessive mutations in the extracellular domain of toxin-binding cadherin proteins that confer resistance to Bt toxin Cry1Ac by disrupting toxin binding have been reported previously in three major lepidopteran pests, including the cotton bollworm, Helicoverpa armigera. Here we report a novel allele from cotton bollworm with a deletion in the intracellular domain of cadherin that is genetically linked with non-recessive resistance to Cry1Ac. We discovered this allele in each of three field-selected populations we screened from northern China where Bt cotton producing Cry1Ac has been grown intensively. We expressed four types of cadherin alleles in heterologous cell cultures: susceptible, resistant with the intracellular domain mutation, and two complementary chimeric alleles with and without the mutation. Cells transfected with each of the four cadherin alleles bound Cry1Ac and were killed by Cry1Ac. However, relative to cells transfected with either the susceptible allele or the chimeric allele lacking the intracellular domain mutation, cells transfected with the resistant allele or the chimeric allele containing the intracellular domain mutation were less susceptible to Cry1Ac. These results suggest that the intracellular domain of cadherin is involved in post-binding events that affect toxicity of Cry1Ac. This evidence is consistent with the vital role of the intracellular region of cadherin proposed by the cell signaling model of the mode of action of Bt toxins. Considered together with previously reported data, the results suggest that both pore formation and cell signaling pathways contribute to the efficacy of Bt toxins.

Preliminarily study on the maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on gastropods

Science.gov (United States)

Zhu, Tingbing; Zhang, Lihong; Zhang, Tanglin; Wang, Yaping; Hu, Wei; Olsen, Rolf Eric; Zhu, Zuoyan

2017-10-01

The present study preliminarily examined the differences in maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on four gastropods species (Bellamya aeruginosa, Radix auricularia, Parafossarulus sinensis and Alocinma longicornis) under laboratory conditions. In the maximum handling size trial, five fish from each age group (1-year-old and 2-year-old) and each genotype (transgenic and non-transgenic) of common carp were individually allowed to feed on B. aeruginosa with wide shell height range. The results showed that maximum handling size increased linearly with fish length, and there was no significant difference in maximum handling size between the two genotypes. In the size selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on three size groups of B. aeruginosa. The results show that the two genotypes of C. carpio favored the small-sized group over the large-sized group. In the species selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on thin-shelled B. aeruginosa and thick-shelled R. auricularia, and five pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on two gastropods species (P. sinensis and A. longicornis) with similar size and shell strength. The results showed that both genotypes preferred thin-shelled Radix auricularia rather than thick-shelled B. aeruginosa, but there were no significant difference in selectivity between the two genotypes when fed on P. sinensis and A. longicornis. The present study indicates that transgenic and non-transgenic C. carpio show similar selectivity of predation on the size- and species-limited gastropods. While this information may be useful for assessing the environmental risk of transgenic carp, it does not necessarily demonstrate that transgenic common carp might

A Developed Meta-model for Selection of Cotton Fabrics Using Design of Experiments and TOPSIS Method

Science.gov (United States)

Chakraborty, Shankar; Chatterjee, Prasenjit

2017-12-01

Selection of cotton fabrics for providing optimal clothing comfort is often considered as a multi-criteria decision making problem consisting of an array of candidate alternatives to be evaluated based of several conflicting properties. In this paper, design of experiments and technique for order preference by similarity to ideal solution (TOPSIS) are integrated so as to develop regression meta-models for identifying the most suitable cotton fabrics with respect to the computed TOPSIS scores. The applicability of the adopted method is demonstrated using two real time examples. These developed models can also identify the statistically significant fabric properties and their interactions affecting the measured TOPSIS scores and final selection decisions. There exists good degree of congruence between the ranking patterns as derived using these meta-models and the existing methods for cotton fabric ranking and subsequent selection.

Transgene flow: Facts, speculations and possible countermeasures

Science.gov (United States)

Ryffel, Gerhart U

2014-01-01

Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

Clomazone selectivity in cotton seeds treated with dietholate and zinc acetate

Directory of Open Access Journals (Sweden)

Miriam Hiroko Inoue

2014-12-01

Full Text Available The objective of this study objective was to evaluate the selectivity of pre-emergence applications the herbicide clomazone cotton seeds treated with dietholate and zinc acetate. The 4 x 2 factorial arrangement was adopted (4 seed treatment methods and 2 clomazone dosages, distributed in a randomized block design with 4 repetitions. In treatments where dietholate and zinc acetate were applied, rates of 0.4 kg ha-1 and 8 ml per kg of seeds were used respectively. The clomazone rates used refer to 0.8 and 1.0 kg ha- 1. The cotton cultivar used was the Fiber Max 966 LL. Independent of treatment, all seeds were treated with tiametoxam insecticide and fludioxonil + metalaxyl-M fungicide at rates of 2.24 and 0.08 + 0.03 g per kg of seed, respectively, to control pests early and limit losses caused by pathogens in germination and seedling emergence. Dietholate and zinc acetate treatment had greater initial effect on cotton plants at 21, 30 and 45 days after application. In phytointoxication symptoms were observed for treatment with dietholate and zinc acetate during the evaluation periods. Seeds treated with dietholate, dietholate and zinc acetate or zinc acetate alone provided a higher number of bolls and seed cotton production compared to the control.

Effects of Soil Water Deficit on Insecticidal Protein Expression in Boll Shells of Transgenic Bt Cotton and the Mechanism

Directory of Open Access Journals (Sweden)

Xiang Zhang

2017-12-01

Full Text Available This study was conducted to investigate the effects of soil water deficit on insecticidal protein expression in boll shells of cotton transgenic for a Bt gene. In 2014, Bt cotton cultivars Sikang 1 (a conventional cultivar and Sikang 3 (a hybrid cultivar were planted in pots and five soil water content treatments were imposed at peak boll stage: 15% (G1, 35% (G2, 40% (G3, 60% (G4, and 75% field capacity (CK, respectively. Four treatments (G2, G3, G4, and CK were repeated in 2015 in the field. Results showed that the insecticidal protein content of boll shells decreased with increasing water deficit. Compared with CK, boll shell insecticidal protein content decreased significantly when soil water content was below 60% of maximum water holding capacity for Sikang 1 and Sikang 3. However, increased Bt gene expression was observed when boll shell insecticidal protein content was significantly reduced. Activity assays of key enzymes in nitrogen metabolism showed that boll shell protease and peptidase increased but nitrogen reductase and glutamic-pyruvic transaminase (GPT decreased. Insecticidal protein content exhibited significant positive correlation with nitrogen reductase and GPT activities; and significant negative correlation with protease and peptidase activities. These findings suggest that the decrease of insecticidal protein content associated with increasing water deficit was a net result of decreased synthesis and increased decomposition.

Yield evaluation and stability analysis in newly selected `KSA' cotton ...

African Journals Online (AJOL)

Yield evaluation and stability analysis in newly selected `KSA' cotton cultivars in Western Kenya. R M Opondo, G A Ombakho. Abstract. (African Crop Science Journal, 1997 5(2): 119-126). http://dx.doi.org/10.4314/acsj.v5i2.27854 · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians ...

GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana.

Science.gov (United States)

Liu, Xiufang; Song, Yunzhi; Xing, Fangyu; Wang, Ning; Wen, Fujiang; Zhu, Changxiang

2016-09-01

WRKY transcription factors are involved in various processes, ranging from plant growth to abiotic and biotic stress responses. Group I WRKY members have been rarely reported compared with group II or III members, particularly in cotton (Gossypium hirsutum). In this study, a group I WRKY gene, namely, GhWRKY25, was cloned from cotton and characterized. Expression analysis revealed that GhWRKY25 can be induced or deduced by the treatments of abiotic stresses and multiple defense-related signaling molecules. Overexpression of GhWRKY25 in Nicotiana benthamiana reduced plant tolerance to drought stress but enhanced tolerance to salt stress. Moreover, more MDA and ROS accumulated in transgenic plants after drought treatment with lower activities of SOD, POD, and CAT. Our study further demonstrated that GhWRKY25 overexpression in plants enhanced sensitivity to the fungal pathogen Botrytis cinerea by reducing the expression of SA or ET signaling related genes and inducing the expression of genes involved in the JA signaling pathway. These results indicated that GhWRKY25 plays negative or positive roles in response to abiotic stresses, and the reduced pathogen resistance may be related to the crosstalk of the SA and JA/ET signaling pathways.

The Role of Transgenic Crops in the Future of Global Food and Feed

OpenAIRE

O. Škubna; H. Řezbová

2012-01-01

The paper is aimed on the problematic of biotech crops planting (GM, transgenic crops). The main aim of this paper is to analyze the trends in the main biotech crops planting groups in the sense of their use for food and feed in the future. The selected groups of biotech crops analyzed in this article are soybeans, maize (corn), cotton and rapeseed (canola). The used methods are chain and basic indexes and regression analysis of times series/ trend data - for predicting on next four years (20...

Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis).

Science.gov (United States)

Oliveira, Gustavo R; Silva, Maria C M; Lucena, Wagner A; Nakasu, Erich Y T; Firmino, Alexandre A P; Beneventi, Magda A; Souza, Djair S L; Gomes, José E; de Souza, José D A; Rigden, Daniel J; Ramos, Hudson B; Soccol, Carlos R; Grossi-de-Sa, Maria F

2011-09-09

The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis

Directory of Open Access Journals (Sweden)

Gomes José E

2011-09-01

Full Text Available Abstract Background The cotton boll weevil (Anthonomus grandis is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Results Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. Conclusions The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

PERIODS OF WEED INTERFERENCE ON TRANSGENIC COTTON ‘IMACD 6001LL’

Directory of Open Access Journals (Sweden)

MARCOS PAULO DA SILVA

2016-01-01

Full Text Available The objective of this study was to determine the periods of weed interference and its impact on productivity of cotton 'IMACD 6001LL'. The experiment was conducted in Jaboticabal, São Paulo, the second crop in 2011 and consisted of two treatment groups: the first culture remained free of competing weeds since of emergence up different periods of its development: (0-15 , 0-25, 0-35, 0-45, 0-55, 0-65, 0-75 and 0-183 days - harvest. In the second treatment group was held to the contrary: the crop was in harmony with the weeds since of emergence up to the same stages of development described above. The treatments were arranged in a randomized block design in four replications. During these periods was evaluated dry matter accumulation by weeds. The cotton yield data were subjected to regression analysis and resulting in a CPWC of 35 DAE, the CPWR was 133 DAE and .The weed community was composed mainly of Raphanus raphanistrum, Amaranthus spp., Cyperus rotundus, Alternanthera tenella and Eleusine indica. Living with this community throughout the cycle resulted in reduction almost 85% in cotton yield.

Evaluating potassium-use-efficiency of five cotton genotypes of pakistan

International Nuclear Information System (INIS)

Hassan, Z.U.; Kubar, K.A.

2014-01-01

Potassium (K) deficiency in Pakistani soils has been recently reported as the major limiting factor affecting sustainable cotton production. The present study was conducted to envisage how K nutrition affect the growth, biomass production, yield and K-use-efficiency of five cotton genotypes, NIBGE-3701, NIBGE-1524 (Bt-transgenic), Sadori, Sindh-1 and SAU-2 (non-Bt conventional), commonly grown in Pakistan. All five genotypes were raised at deficient and adequate K levels, i.e. 0 and 60 kg K/sub 2/O ha-1, respectively. The experiment was performed in plastic pots following a completely randomized factorial design with three repeats. Adequate K nutrition significantly increased various plant growth traits and yield of all cotton genotypes under study, viz. number of sympodia (21%), number of leaves (34%), leaf dry biomass (30%), shoot dry biomass (31%), number of bolls (50%) and yield of seed cotton (92%). Substantial variations were observed among cotton genotypes for their K-use-efficiency and K-response-efficiency. Sadori and SAU-2 were screened as most K-use-efficient cotton genotypes, while Sindh-1 and SAU-2 were ranked as the most K-responsive cotton genotypes. Interestingly, Sadori did not respond to K nutrition. Moreover, Bt cotton genotypes accumulated more K as compared to non-Bt genotypes. The cotton genotype SAU-2 was identified as efficient-response genotype for better adaptation for both low- and high-K-input sustainable cotton agriculture systems. (author)

RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.

Science.gov (United States)

Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping

2018-06-01

Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.

Effect of Iranian Bt cotton on life table of Bemisia tabaci (Hemiptera: Alyrodidae and Cry 1Ab detection in the whitefly honeydew

Directory of Open Access Journals (Sweden)

Solmaz Azimi

2016-09-01

Full Text Available Transgenic cotton expressing the Cry 1Ab protein of Bacillus thuringiensis developing against Helocoverpa armigera may be affect on secondary pest such as Bemisia tabaci. In this study effects of Bt cotton on demographic parameters of B. tabaci were assessed and the data analyzed using the age specific, two-sex life table parameters. Results showed that getting to the adulthood stage, was faster on non-Bt cotton in comparison with Bt cotton. Also the fecundity was higher on non-Bt cotton than that on Bt cotton. Some of the population parameters (r, R0 and T of B. tabaci were affected by the Bt cotton significantly. The intrinsic rate of increase (r on Bt and non-Bt cotton was 0.07 day-1 and 0.1 day-1 , respectively. The net reproductive rate (R0 was 20.68 and 15.04 offspring/individual on Bt and non-Bt cotton, respectively. Mean generation time (T in non-Bt cotton was 27.22 and 34.62 days in Bt cotton. The results indicated that the life history of B. tabaci in the laboratory condition was influenced by host plant quality and Bt cotton was not a suitable host for B. tabaci. The western immunoblot method showed that the Cry protein detection in honeydew was positive which indicated that the Cry protein was ingested. Results revealed that the transgenic cotton could adversely affect the secondary pest and the natural enemies which feed on such pests as a host or their honeydew as a food source should be considered.

Severity of cotton whitefly (bemisia tabaci genn.) population with special reference to abiotic factors

International Nuclear Information System (INIS)

Zia, K.; Bashir, M.H.; Khan, B.S.; Khan, R.R.; Hafeez, F.

2013-01-01

Bemisia tabaci is serious insect and constantly destabilizing the cotton production. The research was conducted to evaluate cotton cultivars (transgenic and non transgenic) for resistance against whitefly and further correlated with weather factors such as temperature, relative humidity and rainfall, during the cropping seasons 2010 and 2011. However, peak population (6.36 per leaf) was recorded from FH-113 followed FH-167 and FH-114, whereas minimum population was recorded from FH-4243 in transgenic group whereas peak population (5.24 per leaf) was recorded from FH- 941 followed by FH-100 and FH- 901 while minimum population was recorded from FH-207, in non transgenic group of cultivars in the year 2010. The incidence and abundance was much high and reaching towards two folds in the year 2011 but the trend of whitefly varied with peak population (11.03 per leaf) recorded from FH -167 followed by FH- 4243 and FH113 (from transgenic group of cultivars) whereas a peak of 10.77 per leaf population of whitefly, recorded followed by FH-901 and FH-941 (from non transgenic group of cultivars). FH-207 found more resistant from all ten cultivars studied in 2011. Correlation among weather factors and whitefly population showed that rainfall was negatively correlated while temperature and relative humidity were positively correlated with whitefly population. In addition to that situation is becoming worse because of shifting from conventional to more advanced transgenic cultivars that are susceptible and serve as host. Moreover, climatic conditions provide addition favor and helps in population buildup, abundance and incidence. (author)

Quantification of toxins in a Cry1Ac?+?CpTI cotton cultivar and its potential effects on the honey bee Apis mellifera L.

OpenAIRE

Han, Peng; Niu, Chang-Ying; Lei, Chao-Liang; Cui, Jin-Jie; Desneux, Nicolas

2010-01-01

Transgenic Cry1Ac?+?CpTI cotton (CCRI41) is increasingly planted throughout China. However, negative effects of this cultivar on the honey bee Apis mellifera L., the most important pollinator for cultivated ecosystem, remained poorly investigated. The objective of our study was to evaluate the potential side effects of transgenic Cry1Ac?+?CpTI pollen from cotton on young adult honey bees A. mellifera L. Two points emphasized the significance of our study: (1) A higher expression level of inse...

Performance of some transgenic cotton cultivars against insect pest complex, virus incidence and yield

International Nuclear Information System (INIS)

Babar, T.K.; Karar, H.; Hasnain, M.; Saleem, M.; Ali, A.

2013-01-01

Five cultivars of cotton i.e., IR4-NIBGE, IR5-NIBGE Bt-121, Sitara-10M and Sitara-11M were screened for resistance against insect pest complex and Cotton Leaf Curl Virus (CLCuV) incidence in the research area of Cotton Research Station, Multan. The result depicted that the most resistant variety against jassids was IR4-NIBGE and Sitara-11M whereas IR4-NIBGE showed the maximum resistance against whitefly infestation. The least susceptible variety to the infestation of thrips was Sitara-10M. The most susceptible variety to the prevalence of Red Cotton Bug (RCB) was IR4-NIBGE. The genotype Bt-121 showed the attack of spotted bollworm. The high population of Dusky Cotton Bug (DCB) was observed on Bt-121 throughout the season. The incidence of virus percentage increased with the passage of time; however, the variety IR5-NIBGE exhibited maximum level of tolerance. Variety Bt-121 gave the maximum yield i.e., 1852 kg per acre followed by IR5-NIBGE, Sitara-11M, Sitara-10M 1584, 1503, 1466 kg per acre respectively. Our results suggest that IR4-NIBGE and Sitara -11M are comparatively tolerant to jassids and whitefly which are the yield losing pest. So IR4-NIBGE and Sitara -11M varieties can be included in IPM programme for the management of these voracious pests. (author)

Functional Characterization of Cotton GaMYB62L, a Novel R2R3 TF in Transgenic Arabidopsis.

Directory of Open Access Journals (Sweden)

Hamama Islam Butt

Full Text Available Drought stress can trigger the production of ABA in plants, in response to adverse conditions, which induces the transcript of stress-related marker genes. The R2R3 MYB TFs are implicated in regulation of various plants developmental, metabolic and multiple environmental stress responses. Here, a R2R3-MYB cloned gene, GaMYB62L, was transformed in Arabidopsis and was functionally characterized. The GaMYB62L protein contains two SANT domains with a conserved R2R3 imperfect repeats. The GaMYB62L cDNA is 1,017 bp with a CDS of 879, encodes a 292-residue polypeptide with MW of 38.78 kD and a pI value of 8.91. Overexpressed GaMYB62L transgenic Arabidopsis have increased proline and chlorophyll content, superior seed germination rate under salt and osmotic stress, less water loss rate with reduced stomatal apertures, high drought avoidance as compared to WT on water deprivation and also significant plant survival rates at low temperature. In addition, overexpressed GaMYB62L lines were more sensitive to ABA mediated germination and root elongation assay. Moreover, ABA induced GaMYB62L overexpression, enhanced the expression of ABA stress related marker genes like RD22, COR15A, ADH1, and RD29A. Together, overexpression of GaMYB62L suggested having developed better drought, salt and cold tolerance in transgenic Arabidopsis and thus presented it as a prospective candidate gene to achieve better abiotic stress tolerance in cotton crop.

Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

Directory of Open Access Journals (Sweden)

Ren Chen

2010-01-01

Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

Drought coping strategies in cotton: increased crop per drop.

Science.gov (United States)

Ullah, Abid; Sun, Heng; Yang, Xiyan; Zhang, Xianlong

2017-03-01

The growth and yield of many crops, including cotton, are affected by water deficit. Cotton has evolved drought specific as well as general morpho-physiological, biochemical and molecular responses to drought stress, which are discussed in this review. The key physiological responses against drought stress in cotton, including stomata closing, root development, cellular adaptations, photosynthesis, abscisic acid (ABA) and jasmonic acid (JA) production and reactive oxygen species (ROS) scavenging, have been identified by researchers. Drought stress induces the expression of stress-related transcription factors and genes, such as ROS scavenging, ABA or mitogen-activated protein kinases (MAPK) signalling genes, which activate various drought-related pathways to induce tolerance in the plant. It is crucial to elucidate and induce drought-tolerant traits via quantitative trait loci (QTL) analysis, transgenic approaches and exogenous application of substances. The current review article highlights the natural as well as engineered drought tolerance strategies in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Quantification of toxins in a Cry1Ac + CpTI cotton cultivar and its potential effects on the honey bee Apis mellifera L.

Science.gov (United States)

Han, Peng; Niu, Chang-Ying; Lei, Chao-Liang; Cui, Jin-Jie; Desneux, Nicolas

2010-11-01

Transgenic Cry1Ac + CpTI cotton (CCRI41) is increasingly planted throughout China. However, negative effects of this cultivar on the honey bee Apis mellifera L., the most important pollinator for cultivated ecosystem, remained poorly investigated. The objective of our study was to evaluate the potential side effects of transgenic Cry1Ac + CpTI pollen from cotton on young adult honey bees A. mellifera L. Two points emphasized the significance of our study: (1) A higher expression level of insecticidal protein Cry1Ac in pollen tissues was detected (when compared with previous reports). In particular, Cry1Ac protein was detected at 300 ± 4.52 ng g(-1) [part per billion (ppb)] in pollen collected in July, (2) Effects on chronic mortality and feeding behaviour in honey bees were evaluated using a no-choice dietary feeding protocol with treated pollen, which guarantee the highest exposure level to bees potentially occurring in natural conditions (worst case scenario). Tests were also conducted using imidacloprid-treated pollen at a concentration of 48 ppb as positive control for sublethal effect on feeding behaviour. Our results suggested that Cry1Ac + CpTI pollen carried no lethal risk for honey bees. However, during a 7-day oral exposure to the various treatments (transgenic, imidacloprid-treated and control), honey bee feeding behaviour was disturbed and bees consumed significantly less CCRI41 cotton pollen than in the control group in which bees were exposed to conventional cotton pollen. It may indicate an antifeedant effect of CCRI41 pollen on honey bees and thus bees may be at risk because of large areas are planted with transgenic Bt cotton in China. This is the first report suggesting a potential sublethal effect of CCRI41 cotton pollen on honey bees. The implications of the results are discussed in terms of risk assessment for bees as well as for directions of future work involving risk assessment of CCRI41 cotton.

Insect pests management of bt cotton through the manipulation of different eco-friendly techniques

International Nuclear Information System (INIS)

Ahmad, N.; Khan, M.H.; Tofique, M.

2011-01-01

This study was designed to manage insect pests of Bt cotton through the manipulation of different eco-friendly techniques. A perusal of data, based on the overall performance of different treatments reflected that lowest population of jassids (0.29) was observed in bio-control treated Bt cotton followed by bio-control treated conventional cotton (0.41). Mean per leaf population of thrips was found lowest in insecticide treated Bt cotton (0.97) which was statically at par with bi-control treated conventional cotton (0.95), biocontrol treated Bt cotton (1.09) and colour traps treated Bt cotton (1.50). In case of white flies, bio-control treated Bt cotton and bio-control treated conventional cotton again proved effective in maintaining the population at lower levels per leaf (0.33 and 0.35 respectively). No bollworms infestation was recorded in transgenic cotton whereas higher attack of the same was observed in the untreated conventional cotton block. The best results were achieved with the application of bio-control agents in combination with Bt cotton resulting in least infestation by insect pests and maximum seed yield of 3657 kg/ha. The population of Chrysoperla carnea was significantly higher in Bt and conventional cotton treated with bio-control agents as compared to the other treatments. The parasitism percentage of Trichogramma chilonis was observed significantly higher in bio-control treated conventional cotton. The studies manifested that combination of bio-control technology with Bt cotton effectively preserves the local beneficial insect fauna indicating its potential to be used as integrated management system against different insect pests of cotton. (author)

Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

Science.gov (United States)

An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

Immune selection of tumor cells in TCR β-chain transgenic mice.

Science.gov (United States)

Silaeva, Yulia Yu; Grinenko, Tatyana S; Vagida, Murad S; Kalinina, Anastasia A; Khromykh, Ludmila M; Kazansky, Dmitry B

2014-10-01

The concept of immunological surveillance implies that immunogenic variants of tumor cells arising in the organism can be recognized by the immune system. Tumor progression is provided by somatic evolution of tumor cells under the pressure of the immune system. The loss of MHC Class I molecules on the surface of tumor cells is one of the most known outcomes of immune selection. This study developed a model of immune selection based on the immune response of TCR 1d1 single β-chain transgenic B10.D2(R101) (K(d)I(d)D(b)) mice to allogeneic EL4 (H-2(b)) thymoma cells. In wild-type B10.D2(R101) mice, immunization with EL4 cells induced a vigorous CTL response targeted to the H-2K(b) molecule and results in full rejection of the tumor cells. In contrast, transgenic mice developed a compromised proliferative response in mixed-lymphocyte response assays and were unable to reject transplanted allogeneic EL4 cells. During the immune response to EL4 cells, CD8(+) T-lymphocytes with endogenous β-chains accumulated predominantly in the spleen of transgenic mice and only a small part of the T-lymphocytes expressing transgenic β-chains became CD8(+)CD44(+)CD62L(-) effectors. Then, instead of a full elimination of tumor cells as in wild-type mice, a reproducible prolonged equilibrium phase and subsequent escape was observed in transgenic mice that resulted in death of 90% of the mice in 40-60 days after grafting. Prolonged exposure of tumor cells to the pressure of the immune system in transgenic mice in vivo resulted in a stable loss of H-2K(b) molecules on the EL4 cell surface. Genetic manipulation of the T-lymphocyte repertoire was sufficient to reproduce the classic pattern of interactions between tumor cells and the immune system, usually observed in reliable syngeneic models of anti-tumor immunity. This newly-developed model could be used in further studies of immunoregulatory circuits common for transplantational and anti-tumor immune responses.

Tri-trophic interactions between Bt cotton, the herbivore Aphis gossypii Glover (Homoptera: Aphididae), and the predator Chrysopa pallens (Rambur) (Neuroptera: Chrysopidae).

Science.gov (United States)

Guo, Jian-Ying; Wan, Fang-Hao; Dong, Liang; Lövei, Gábor L; Han, Zhao-Jun

2008-02-01

Tri-trophic impacts of transgenic Bacillus thuringiensis (Bt) cotton GK12 and NuCOTN 99B were studied using a predator, the great lacewing Chrysopa pallens (Rambur), and its prey, the cotton aphid Aphis gossypii Glover, in laboratory feeding experiments. The parental nontransgenic cotton cultivar of GK12 was used as control. The predator was fed with uniform (aphids from a single cultivar) or mixed prey (aphids from the three cotton cultivars provided on alternate days). Mortality and development of the immature stages, pupal body mass, adult sex ratio, fecundity, and egg viability of C. pallens were measured. When fed GK12-originated aphid prey, pupal body mass of C. pallens was significantly higher than that of the control, more females emerged, and these females laid significantly more eggs. Other parameters were not impacted. Females emerging from larvae maintained on NuCOTN 99B-originated prey laid fewer eggs than those maintained on GK12. Other measurements did not differ significantly between the two Bt cotton cultivars. Compared with the control, mixed feeding significantly prolonged pupal development time and increased pupal body mass and percentage of females but did not affect other parameters. These results indicate that C. pallens is sensitive to aphid prey from different cotton cultivars. Transgenic Bt cotton GK12-originated aphid prey has no adverse impact on survival, development, and fecundity of C. pallens. Between the two Bt cotton cultivars, NuCOTN 99B-originated aphid prey provided to C. pallens in the larval stage may lower female fecundity. Mixed feeding of C. pallens with the two Bt cotton-originated prey and non-Bt prey may have some adverse impacts on pupal development.

Fitness of Bt-resistant cabbage loopers on Bt cotton plants.

Science.gov (United States)

Tetreau, Guillaume; Wang, Ran; Wang, Ping

2017-10-01

Development of resistance to the insecticidal toxins from Bacillus thuringiensis (Bt) in insects is the major threat to the continued success of transgenic Bt crops in agriculture. The fitness of Bt-resistant insects on Bt and non-Bt plants is a key parameter that determines the development of Bt resistance in insect populations. In this study, a comprehensive analysis of the fitness of Bt-resistant Trichoplusia ni strains on Bt cotton leaves was conducted. The Bt-resistant T. ni strains carried two genetically independent mechanisms of resistance to Bt toxins Cry1Ac and Cry2Ab. The effects of the two resistance mechanisms, individually and in combination, on the fitness of the T. ni strains on conventional non-Bt cotton and on transgenic Bt cotton leaves expressing a single-toxin Cry1Ac (Bollgard I) or two Bt toxins Cry1Ac and Cry2Ab (Bollgard II) were examined. The presence of Bt toxins in plants reduced the fitness of resistant insects, indicated by decreased net reproductive rate (R 0 ) and intrinsic rate of increase (r). The reduction in fitness in resistant T. ni on Bollgard II leaves was greater than that on Bollgard I leaves. A 12.4-day asynchrony of adult emergence between the susceptible T. ni grown on non-Bt cotton leaves and the dual-toxin-resistant T. ni on Bollgard II leaves was observed. Therefore, multitoxin Bt plants not only reduce the probability for T. ni to develop resistance but also strongly reduce the fitness of resistant insects feeding on the plants. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Orientation of cotton growers of multan district about heal hazards and pesticide use

International Nuclear Information System (INIS)

Haq, Q.U.; Hussain, R.; Ali, T.; Ahmad, M.

2008-01-01

Cotton growing farmers and cotton pickers are the twin pillars of cotton growing community. Cotton growing farmers (male) are involved in monitoring of quality and quantity of cotton crops by handsome usage of pesticides for better marketing of cotton crops. Whereas, cotton pickers (female) are involved in picking of cotton mainly. To assess their knowledge and source of knowledge about pesticides related health problems, the study was designed and conducted in 20 villages of district Multan selected by multistage random sampling technique. From the selected 20 villages, from the list bearing the villages, mouzas and union councils of district Multan, 220 cotton growers and 150 cotton pickers were selected by simple random sampling technique and interviewed through a reliable and validated interview schedule. The data collected were processed through Statistical Package for Social Sciences (SPSS). The results showed that 75% of cotton growing farmers were having orientation about side effects of pesticides whereas, almost 8% of cotton growers were having no knowledge about side effects of pesticides. (author)

Response of AtNPR1-expressing cotton plants to Fusarium oxysporum f. sp. vasinfectum isolates

Science.gov (United States)

In our earlier investigation, we had demonstrated that transgenic cotton plants expressing AtNPR1 showed significant tolerance to Fusarium oxysporum f. sp. vasinfectum, isolate 11 (Fov11) and several other pathogens. The current study was designed to further characterize the nature of the protectio...

Agrobacterium-mediated transformation of cotton (Gossypium hirsutum) shoot apex with a fungal phytase gene improves phosphorus acquisition.

Science.gov (United States)

Ma, Zhiying; Liu, Jianfeng; Wang, Xingfen

2013-01-01

Cotton is an important world economic crop plant. It is considered that cotton is recalcitrant to in vitro proliferation. Somatic embryogenesis and plant regeneration has been successful by using hypocotyl, whereas it is highly genotype dependent. Here, a genotype-independent cotton regeneration protocol from shoot apices is presented. Shoot apices from 3- to 5-day-old seedlings of cotton are infected with an Agrobacterium strain, EHA105, carrying the binary vector pC-KSA contained phytase gene (phyA) and the marker gene neomycin phosphotransferase (NPTII), and directly regenerated as shoots in vitro. Rooted shoots can be obtained within 6-8 weeks. Plants that survived by leaf painting kanamycin (kan) were -further analyzed by DNA and RNA blottings. The transgenic plants with increased the phosphorus (P) acquisition efficiency were obtained following the transformation method.

Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

Science.gov (United States)

Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk

2015-01-01

Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

Historical Datasets Support Genomic Selection Models for the Prediction of Cotton Fiber Quality Phenotypes Across Multiple Environments.

Science.gov (United States)

Gapare, Washington; Liu, Shiming; Conaty, Warren; Zhu, Qian-Hao; Gillespie, Vanessa; Llewellyn, Danny; Stiller, Warwick; Wilson, Iain

2018-03-20

Genomic selection (GS) has successfully been used in plant breeding to improve selection efficiency and reduce breeding time and cost. However, there has not been a study to evaluate GS prediction models that may be used for predicting cotton breeding lines across multiple environments. In this study, we evaluated the performance of Bayes Ridge Regression, BayesA, BayesB, BayesC and Reproducing Kernel Hilbert Spaces regression models. We then extended the single-site GS model to accommodate genotype × environment interaction (G×E) in order to assess the merits of multi- over single-environment models in a practical breeding and selection context in cotton, a crop for which this has not previously been evaluated. Our study was based on a population of 215 upland cotton ( Gossypium hirsutum ) breeding lines which were evaluated for fiber length and strength at multiple locations in Australia and genotyped with 13,330 single nucleotide polymorphic (SNP) markers. BayesB, which assumes unique variance for each marker and a proportion of markers to have large effects, while most other markers have zero effect, was the preferred model. GS accuracy for fiber length based on a single-site model varied across sites, ranging from 0.27 to 0.77 (mean = 0.38), while that of fiber strength ranged from 0.19 to 0.58 (mean = 0.35) using randomly selected sub-populations as the training population. Prediction accuracies from the M×E model were higher than those for single-site and across-site models, with an average accuracy of 0.71 and 0.59 for fiber length and strength, respectively. The use of the M×E model could therefore identify which breeding lines have effects that are stable across environments and which ones are responsible for G×E and so reduce the amount of phenotypic screening required in cotton breeding programs to identify adaptable genotypes. Copyright © 2018, G3: Genes, Genomes, Genetics.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

Science.gov (United States)

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

Directory of Open Access Journals (Sweden)

Hee-Jong Woo

Full Text Available Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

Directory of Open Access Journals (Sweden)

Waqas Malik

2014-01-01

Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.

Correlations and Correlated Responses in Upland Cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Echekwu, CA.

2001-01-01

Full Text Available Plant breeders must be concerned with the total array of economic characters in their efforts to develop a crop variety acceptable to farmers. Their selection endeavours must therefore take into consideration how changes in one trait affect, simultaneously changes in other economic attributes. The importance of correlations and correlated responses is therefore self evident in plant breeding endeavours. In this study F3 progenies from a cross between two cotton lines SAMCOT-9 x Y422 were evaluated for two years and performance data were used to obtain correlations between nine agronomic and fibre quality traits in upland cotton. The results indicated that plant helght was significantly and positively correlated with seed cotton yield, number of sympodial and monopodial branches, seed index, fibre length and micronaire index. Positive and significant correlations were also obtained between : seed cotton yield, tint percent and fibre strength and fibre length. Significant negative correlations were obtained between : plant height and lint percent ; number of monopodial branches, sympodial branches and lint percent ; fibre length, fibre strength and micronaire index. The correlated responses in the other eight traits when selection was practiced for seed cotton yield in the present study shows that it might be more profitable to practice direct selection for seed cotton yield compared to selecting for seed cotton yield through any of the other traits.

Flavonoid biosynthesis controls fiber color in naturally colored cotton

Directory of Open Access Journals (Sweden)

Hai-Feng Liu

2018-04-01

Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.

CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

2017-07-01

The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton.

Science.gov (United States)

Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang

2017-04-04

Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis.

Cotton for removal of aquatic oil spills

International Nuclear Information System (INIS)

Parker, H.W.; Fedler, C.B.; Heintz, C.E.; Nash, P.T.; Carr, D.L.; Lu, M.

1992-01-01

Raw cotton has considerable potential for selective removal of spilled oil and oil products from surface waters, since the natural waxes on the raw cotton make it preferentially oil wet. This potential was recognized in the early seventies at Texas Tech University. More recently other research workers have considered cotton as an adsorbent for spilled oil. The adsorbent market is now dominated by synthetic materials, such as air-blown polypropylene fiber, inorganic clays, and recycled paper and paper products. This paper further examines the potential of cotton in relation to these other adsorbents. Emphasis is placed on the potential for complete biodegradation of oil-soaked cotton adsorbents as a means avoiding the expense for incineration and/or the long-term environmental risk associated with placing the used adsorbents in landfills

Genomic studies for drought tolerance in cotton (abstract)

International Nuclear Information System (INIS)

Mahboob-ur-Rehman; Ullah, I.; Asir, M.; Zafar, Y.; Malik, K.A.

2005-01-01

The cotton germplasm developed in Pakistan has not been screened comprehensively for their response to water stress, which is a pre-requisite in exploring different metabolic pathways, development of genome maps, isolation of genes etc. The objectives of the study were to identify drought tolerant/sensitive cotton genotypes, development of genetic linkage maps, and to identify the most robust DNA markers leading towards marker-assisted selection (MAS). A field trial was conducted to investigate variation in gas exchange parameters and productivity traits in 32 cotton cultivars/promising strains under water stress environment and to ascertain association among these physiological and productivity traits. Photosynthetic rate (P), stomatal conductance (gs) and transpiration rate (E) were significantly reduced under water stress. Substantial genotypic variation for gas exchange parameters especially photosynthetic rate were observed with a significant association with productivity traits under water-limited environment elucidating its use as an indirect selection criterion for seed cotton yield. Moreover, the genotypes FH-901 and CIM-1100 were found the most sensitive and tolerant cultivars, respectively. Four hundred eighty random primers were surveyed on different cotton genotypes involved in population development programs. Out of these, 32 polymorphic primers were identified which are being converted into sequence characterized amplified regions (SCARs). Similarly, 25 out of 150 microstatellite loci (SSRs) were polymorphic among the cotton genotypes. Amplified fragment length polymorphism (AFLP) fingerprinting technique is being exploited to search for additional polymorphisms. The study will have impact on cotton breeding programme by reducing span to develop drought tolerant cotton varieties. (author)

Employing in vitro directed molecular evolution for the selection of α-amylase variant inhibitors with activity toward cotton boll weevil enzyme.

Science.gov (United States)

da Silva, Maria Cristina Mattar; Del Sarto, Rafael Perseghini; Lucena, Wagner Alexandre; Rigden, Daniel John; Teixeira, Fabíola Rodrigues; Bezerra, Caroline de Andrade; Albuquerque, Erika Valéria Saliba; Grossi-de-Sa, Maria Fatima

2013-09-20

Numerous species of insect pests attack cotton plants, out of which the cotton boll weevil (Anthonomus grandis) is the main insect in Brazil and must be controlled to avert large economic losses. Like other insect pests, A. grandis secretes a high level of α-amylases in the midgut lumen, which are required for digestion of carbohydrates. Thus, α-amylase inhibitors (α-AIs) represent a powerful tool to apply in the control of insect pests. Here, we applied DNA shuffling and phage display techniques and obtained a combinatorial library containing 10⁸ α-AI variant forms. From this library, variants were selected exhibiting in vitro affinity for cotton boll weevil α-amylases. Twenty-six variant sequences were cloned into plant expression vectors and expressed in Arabidopsis thaliana. Transformed plant extracts were assayed in vitro to select specific and potent α-amylase inhibitors against boll weevil amylases. While the wild type inhibitors, used to create the shuffled library, did not inhibit the A. grandis α-amylases, three α-AI mutants, named α-AIC3, α-AIA11 and α-AIG4 revealed high inhibitory activities against A. grandis α-amylases in an in vitro assay. In summary, data reported here shown the potential biotechnology of new α-AI variant genes for cotton boll weevil control. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton

Directory of Open Access Journals (Sweden)

Md. Mizanur Rahman

2015-01-01

Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.

Cadmium-induced ultramorphological and physiological changes in leaves of two transgenic cotton cultivars and their wild relative

International Nuclear Information System (INIS)

Daud, M.K.; Variath, M.T.; Ali, Shafaqat; Najeeb, U.; Jamil, Muhammad; Hayat, Y.; Dawood, M.; Khan, Muhammad Imran; Zaffar, M.; Cheema, Sardar Alam; Tong, X.H.; Zhu Shuijin

2009-01-01

The present study describes cadmium-induced alterations in the leaves as well as at the whole plant level in two transgenic cotton cultivars (BR001 and GK30) and their wild relative (Coker 312) using both ultramorphological and physiological indices. With elevated levels of Cd (i.e. 10, 100, 1000 μM), the mean lengths of root, stem and leaf and leaf width as well as their fresh and dry biomasses linearly decreased over their respective controls. Moreover, root, stem and leaf water absorption capacities progressively stimulated, which were high in leaves followed by roots and stems. BR001 accumulated more cadmium followed by GK30 and Coker 312. Root and shoot cadmium uptakes were significantly and directly correlated with each other as well as with leaf, stem and root water absorption capacities. The ultrastructural modifications in leaf mesophyll cells were triggered with increase in Cd stress regime. They were more obvious in BR001 followed by GK30 and Coker 312. Changes in morphology of chloroplast, increase in number and size of starch grains as well as increase in number of plastoglobuli were the noticed qualitative effects of Cd on photosynthetic organ. Cd in the form of electron dense granules could be seen inside the vacuoles and attached to the cell walls in all these cultivars. From the present experiment, it can be well established that both apoplastic and symplastic bindings are involved in Cd detoxification in these cultivars. Absence of tonoplast invagination reveals that Cd toxic levels did not cause water stress in any cultivars. Additionally, these cultivars possess differential capabilities towards Cd accumulation and its sequestration.

Evaluation of two cotton varieties CRSP1 and CRSP2 for genetic transformation efficiency, expression of transgenes Cry1Ac + Cry2A, GT gene and insect mortality

Directory of Open Access Journals (Sweden)

Arfan Ali

2016-03-01

Full Text Available Expression of the transgene with a desirable character in crop plant is the ultimate goal of transgenic research. Transformation of two Bt genes namely Cry1Ac and Cry2A cloned as separate cassette under 35S promoter in pKHG4 plant expression vector was done by using shoot apex cut method of Agrobacterium. Molecular confirmation of putative transgenic cotton plants for Cry1Ac, Cry2A and GT gene was done through PCR and ELISA. Transformation efficiency of CRSP-1 and CRSP-2 was calculated to be 1.2 and 0.8% for Cry1Ac while 0.9 and 0.6% for Cry2A and 1.5 and 0.7% for GTG respectively. CRSP-1 was found to adopt natural environment (acclimatized earlier than CRSP-2 when exposed to sunlight for one month. Expression of Cry1Ac, Cry2A and GTG was found to be 1.2, 1 and 1.3 ng/μl respectively for CRSP-1 as compared to CRSP-2 where expression was recorded to be 0.9, 0.5 and 0.9 ng/μl respectively. FISH analysis of the transgenic CRSP-1 and CRSP-2 demonstrated the presence of one and two copy numbers respectively. Similarly, the response of CRSP-1 against Glyphosate @1900 ml/acre was far better with almost negligible necrotic spot and efficient growth after spray as compared to CRSP-2 where some plants were found to have necrosis and negative control where the complete decay of plant was observed after seven days of spray assay. Similarly, almost 100% mortality of 2nd instar larvae of Heliothis armigera was recorded after three days in CRSP-1 as compared CRSP-2 where insect mortality was found to be less than 90%. Quantitatively speaking non transgenic plants were found with 23–90% leaf damage by insect, while CRSP-1 was with less than 5% and CRSP-2 with 17%. Taken together CRSP1 was found to have better insect control and weedicide resistance along with its natural ability of genetic modification and can be employed by the valuable farmers for better insect control and simultaneously for better production.

Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

NARCIS (Netherlands)

Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

2011-01-01

Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

Toxicity to cotton boll weevil Anthonomus grandis of a trypsin inhibitor from chickpea seeds.

Science.gov (United States)

de P G Gomes, Angélica; Dias, Simoni C; Bloch, Carlos; Melo, Francislete R; Furtado, José R; Monnerat, Rose G; Grossi-de-Sá, Maria F; Franco, Octávio L

2005-02-01

Cotton (Gossypium hirsutum L.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil Anthonomus grandis. Adult A. grandis feed on fruits and leaf petioles, reducing drastically the crop production. The predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. The present study describes a novel proteinase inhibitor from chickpea seeds (Cicer arietinum L.) and its effects against A. grandis. This inhibitor, named CaTI, was purified by using affinity Red-Sepharose Cl-6B chromatography, followed by reversed-phase HPLC (Vydac C18-TP). SDS-PAGE and MALDI-TOF analyses, showed a unique monomeric protein with a mass of 12,877 Da. Purified CaTI showed significant inhibitory activity against larval cotton boll weevil serine proteinases (78%) and against bovine pancreatic trypsin (73%), when analyzed by fluorimetric assays. Although the molecular mass of CaTI corresponded to alpha-amylase/trypsin bifunctional inhibitors masses, no inhibitory activity against insect and mammalian alpha-amylases was observed. In order to observe CaTI in vivo effects, an inhibitor rich fraction was added to an artificial diet at different concentrations. At 1.5% (w/w), CaTI caused severe development delay, several deformities and a mortality rate of approximately 45%. These results suggested that CaTI could be useful in the production of transgenic cotton plants with enhanced resistance toward cotton boll weevil.

Pest diagnosis and pesticide use by cotton growers of multan area and their and their occupational health

International Nuclear Information System (INIS)

Haq, Q.U.; Fareedi, I.A.; Iftkhar, N.

2008-01-01

Economy of Pakistan is based on exports of cotton and cotton products, and cotton-growing farmers are the vertebrae of Economical backbone of the country. Cotton growing farmers (male) involved in monitoring of quality and quantity of cotton crops by handsome usage of pesticides for better yield and marketing. To assess their knowledge for diagnosing the pests, attacking their crops and their orientation about the pesticide chemicals and their usage, study in hand was designed and conducted in 20 villages of district Multan selected by multistage random sampling technique. The selected 20 villages, from the list bearing the villages, mouzas and union councils of district Multan. 220 cotton growers were selected by simple random sampling technique and interviewed through a reliable and validated interview schedule. The data collected were processed through Statistical Package for Social Sciences (SPSS). The results showed that almost 71% of cotton growing farmers were in a position to diagnose the pests, damaging their cotton crops whereas; almost 29% of respondents had no pest diagnosis concept. The data showed that 75% of cotton growing farmers were having orientation about side effects of pesticide chemicals, whereas almost 94% of respondents were involved in pesticide using practices. (author)

Nutrient Uptake by High-Yielding Cotton Crop in Brazil

Directory of Open Access Journals (Sweden)

José Luís Vilela Vieira

2018-02-01

Full Text Available ABSTRACT: Determining nutrient uptake and accumulation rates by cotton crops is important to define management strategies, especially for transgenic varieties, which are cultivated using high-technology approaches that require substantial investment to maximize yield. Currently in Brazil, the states of Bahia and Mato Grosso are responsible for 84.4 % of the total cotton growing area. In the present study, two trials were conducted in 2013, one that involved planting FM 940 GLT, FM 980 GLT, and FM 913 GLT varieties in the state of Bahia and the other which involved FM 940 GLT and FM 980 GLT varieties in the state of Mato Grosso. The aim of the two trials was to represent the two regions that currently encompass the largest areas of cotton cultivation. Tissue samples, consisting of leaves, stems, and reproductive components, were collected eleven times during the crop cycle for determination of nutrient content and shoot dry matter. After weighing, plant tissue samples were dried and ground to determine nutrient contents. Because there were no overall differences in nutrient contents and biomass accumulation of the varieties during the crop cycle, we undertook joint analysis of the data from all varieties at each site. Favorable climatic conditions in Bahia promoted plant biomass production that was twice as much as plants grown in Mato Grosso, with cotton yields of 6.2 and 3.8 t ha−1 of lint and seed, respectively. The maximum nutrient accumulation occurred between 137-150 days after emergence (DAE for N; 143-148 for P; 172-185 for K; 100 for Ca; 144-149 for Mg; and 153-158 for S. Maximum uptake ranged from 218-362 kg ha−1 N; 26-53 kg ha−1 P; 233-506 kg ha−1 K; 91-202 kg ha−1 Ca; 28-44 kg ha−1 Mg; and 19-61 kg ha−1 S. On average, the sites revealed nutrient export of 14, 2, 23, 3, 2, and 2 kg t−1 of lint and seed for N, P, K, Ca, Mg, and S, respectively, with little variation among sites. Extraction of nutrients per area by cotton

An Assessment of Current Policy Initiatives in Zambia's Cotton Sector

OpenAIRE

Zulu, Ballard; Tschirley, David L.

2004-01-01

This paper assesses three of these policy initiatives: input credit provision for smallholder producers of selected cash crops including cotton, the proposed creation of a Cotton Board, and the emergence in 2003 of District Council levies as a point of conflict between local governments and cotton companies. The purpose of the paper is to provide guidance to public and private decision makers regarding key modifications which may need to be made to these policies to ensure continued healthy d...

What are farmers really planting? Measuring the presence and effectiveness of Bt cotton in Pakistan.

Directory of Open Access Journals (Sweden)

David J Spielman

's transgenic cotton seed market.

Transgenic plants expressing the AaIT/GNA fusion protein show increased resistance and toxicity to both chewing and sucking pests.

Science.gov (United States)

Liu, Shu-Min; Li, Jie; Zhu, Jin-Qi; Wang, Xiao-Wei; Wang, Cheng-Shu; Liu, Shu-Sheng; Chen, Xue-Xin; Li, Sheng

2016-04-01

The adoption of pest-resistant transgenic plants to reduce yield losses and decrease pesticide use has been successful. To achieve the goal of controlling both chewing and sucking pests in a given transgenic plant, we generated transgenic tobacco, Arabidopsis, and rice plants expressing the fusion protein, AaIT/GNA, in which an insecticidal scorpion venom neurotoxin (Androctonus australis toxin, AaIT) is fused to snowdrop lectin (Galanthus nivalis agglutinin, GNA). Compared with transgenic tobacco and Arabidopsis plants expressing AaIT or GNA, transgenic plants expressing AaIT/GNA exhibited increased resistance and toxicity to one chewing pest, the cotton bollworm, Helicoverpa armigera. Transgenic tobacco and rice plants expressing AaIT/GNA showed increased resistance and toxicity to two sucking pests, the whitefly, Bemisia tabaci, and the rice brown planthopper, Nilaparvata lugens, respectively. Moreover, in the field, transgenic rice plants expressing AaIT/GNA exhibited a significant improvement in grain yield when infested with N. lugens. This study shows that expressing the AaIT/GNA fusion protein in transgenic plants can be a useful approach for controlling pests, particularly sucking pests which are not susceptible to the toxin in Bt crops. © 2015 Institute of Zoology, Chinese Academy of Sciences.

Principal variance component analysis of crop composition data: a case study on herbicide-tolerant cotton.

Science.gov (United States)

Harrison, Jay M; Howard, Delia; Malven, Marianne; Halls, Steven C; Culler, Angela H; Harrigan, George G; Wolfinger, Russell D

2013-07-03

Compositional studies on genetically modified (GM) and non-GM crops have consistently demonstrated that their respective levels of key nutrients and antinutrients are remarkably similar and that other factors such as germplasm and environment contribute more to compositional variability than transgenic breeding. We propose that graphical and statistical approaches that can provide meaningful evaluations of the relative impact of different factors to compositional variability may offer advantages over traditional frequentist testing. A case study on the novel application of principal variance component analysis (PVCA) in a compositional assessment of herbicide-tolerant GM cotton is presented. Results of the traditional analysis of variance approach confirmed the compositional equivalence of the GM and non-GM cotton. The multivariate approach of PVCA provided further information on the impact of location and germplasm on compositional variability relative to GM.

China's Cotton Policy and the Impact of China's WTO Accession and Bt Cotton Adoption on the Chinese and U.S. Cotton Sectors

OpenAIRE

Cheng Fang; Bruce A. Babcock

2003-01-01

In this paper we provide an analysis of China's cotton policy and develop a framework to quantify the impact of both China's World Trade Organization (WTO) accession and Bt (Bacillus thuringiensis) cotton adoption on Chinese and U.S. cotton sectors. We use a Chinese cotton sector model consisting of supply, demand, price linkages, and textiles output equations. A two-stage framework model provides gross cropping area and total area for cotton and major subsitute crops from nine cotton-produci...

Brazilian Free-tailed Bats (Tadarida brasiliensis) as Insect Pest Regulators in Transgenic and Conventional Cotton Crops

Science.gov (United States)

During the past 12,000 years agricultural systems have transitioned from natural habitats to conventional agricultural regions, and recently to large areas of genetically- engineered (GE) croplands. This GE revolution occurred for cotton in a span of slightly more than a decade w...

Satellite-based monitoring of cotton evapotranspiration

Science.gov (United States)

Dalezios, Nicolas; Dercas, Nicholas; Tarquis, Ana Maria

2016-04-01

Water for agricultural use represents the largest share among all water uses. Vulnerability in agriculture is influenced, among others, by extended periods of water shortage in regions exposed to droughts. Advanced technological approaches and methodologies, including remote sensing, are increasingly incorporated for the assessment of irrigation water requirements. In this paper, remote sensing techniques are integrated for the estimation and monitoring of crop evapotranspiration ETc. The study area is Thessaly central Greece, which is a drought-prone agricultural region. Cotton fields in a small agricultural sub-catchment in Thessaly are used as an experimental site. Daily meteorological data and weekly field data are recorded throughout seven (2004-2010) growing seasons for the computation of reference evapotranspiration ETo, crop coefficient Kc and cotton crop ETc based on conventional data. Satellite data (Landsat TM) for the corresponding period are processed to estimate cotton crop coefficient Kc and cotton crop ETc and delineate its spatiotemporal variability. The methodology is applied for monitoring Kc and ETc during the growing season in the selected sub-catchment. Several error statistics are used showing very good agreement with ground-truth observations.

Impact of Bollgard cotton on Indian cotton production and Income of ...

Indian Academy of Sciences (India)

Impact of Bollgard cotton on Indian cotton production and Income of cotton farmers. Presentation made in the Seventy Second Annual Meeting Indian Academy of Sciences, Bangalore at Devi Ahilya Vishwavidyalaya Indore 11th November 2006.

A primary study of high performance transgenic rice through maize UBI-1 promoter fusing selective maker gene

International Nuclear Information System (INIS)

Shen, J.; Cai, P.; Qing, F.

2012-01-01

Based on the expression vector pBI121, we successfully constructed a plant over-expression vector of Hspa4 gene fusing with selective maker gene (hygromycin-resistance gene) driven by the Ubi-1 promoter (pBI121-Ubi-Hpt-Hspa4, p121UHH). The plant expression vectors p121UHH and pCAMBIA1301-Ubi-Hspa4 (p1301UH) were transformed into the rice callus, mediated by Agrobacterium tumefaciens. We screened 17 p121UHH-positive transgenic plants and 15 p1301UH-positive transgenic plants by the hygromycin-resistance gene. The pick-up rate of the resistance callus was 51.7% and 42.5%, respectively, and the rate of regeneration for the resistance callus was 51.2% and 49.1%, respectively. The result of polymerase chain reaction (P CR) identification indicated that the pick-up rate of positive transgenic plants was 51.7% and 42.5% and the total transformation efficiency was 16.5% and 6.2%, and the former was 2.66 time s of the later. The results of the experiment indicate that the possibility of the appearance of false positive results in the fusing of a plant over-expression vector with a selective maker gene is much less. (author)

Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

Science.gov (United States)

Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

2013-09-01

An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

Genotype-by-sowing date interaction effects on cotton yield and quality in irrigated condition of dera ismail khan, pakistan

International Nuclear Information System (INIS)

Usman, K.; Khan, S.; Ayatullah, A.

2016-01-01

Cotton is a major export commodity of Pakistan. It is affected by variable environmental conditions throughout the country which limits its production. A 2-year field study was conducted in 2012 and 2013 at Cotton Research Station, Dera Ismail Khan, Pakistan to evaluate the effects of six sowing dates on yield and quality attributes of four cotton genotypes. The experiments were laid out in split-plot within a randomized complete block design with three replications. Main plots treatments were six sowing dates, namely March 20, April 4, April 19, May 4, May 19, and June 3 while subplots treatments were four approved transgenic varieties of cotton (CIM-598, CIM-599, CIM-602, and Ali Akber-703). Results revealed that earlier planting produced more vegetative growth rather than lint yield while late planting induced flowering and boll formation when temperature was much cold that adversely affected cotton yield and quality. The results further indicate that the genotype CIM-599 scored first rank in number of bolls plant-1, boll weight, seed cotton yield, ginning out turn, fiber length, fiber strength, fiber fineness, and fiber uniformity when sown on April 19. CIM-598 was the next suitable genotype after CIM-599 which produced higher yield and quality traits in April 19 sowing. Earlier and later sowing than April 19 resulted in lower cotton yield and quality characters due to unfavorable environmental conditions and shorter growth period, respectively. Thus it is concluded that the genotype, CIM-599 sown on April 19 suits well to the study area and had the potential to optimize cotton yield and quality in irrigated condition of Dera Ismail Khan, Pakistan. (author)

Impact of efficient refuge policies for Bt cotton in India on world cotton trade

OpenAIRE

Singla, Rohit; Johnson, Phillip N.; Misra, Sukant K.

2010-01-01

India is a major cotton producing country in the world along with the U.S. and China. A change in the supply of and demand for cotton in the Indian market has the potential to have an impact on world cotton trade. This study evaluates the implications of efficient Bt cotton refuge policies in India on world and U.S. cotton markets. It can be hypothesized that increased refuge requirements for Bt cotton varieties in India could decrease the world supply of cotton because of the lower yield pot...

Effects of the mutation of selected genes of cotton leaf curl Kokhran virus on infectivity, symptoms and the maintenance of cotton leaf curl Multan betasatellite

NARCIS (Netherlands)

Iqbal, Z.; Sattar, M.N.; Kvarnheden, A.; Mansoor, S.; Briddon, R.W.

2012-01-01

Cotton leaf curl Kokhran virus (CLCuKoV) is a cotton-infecting monopartite begomovirus (family Geminiviridae). The effects of mutation of the coat protein (CP), V2, C2 and C4 genes of CLCuKoV on infectivity and symptoms in Nicotiana benthamiana were investigated. Each mutation introduced a premature

Incipient resistance of Helicoverpa punctigera to the Cry2Ab Bt toxin in Bollgard II cotton.

Directory of Open Access Journals (Sweden)

Sharon Downes

Full Text Available Combinations of dissimilar insecticidal proteins ("pyramids" within transgenic plants are predicted to delay the evolution of pest resistance for significantly longer than crops expressing a single transgene. Field-evolved resistance to Bacillus thuringiensis (Bt transgenic crops has been reported for first generation, single-toxin varieties and the Cry1 class of proteins. Our five year data set shows a significant exponential increase in the frequency of alleles conferring Cry2Ab resistance in Australian field populations of Helicoverpa punctigera since the adoption of a second generation, two-toxin Bt cotton expressing this insecticidal protein. Furthermore, the frequency of cry2Ab resistance alleles in populations from cropping areas is 8-fold higher than that found for populations from non-cropping regions. This report of field evolved resistance to a protein in a dual-toxin Bt-crop has precisely fulfilled the intended function of monitoring for resistance; namely, to provide an early warning of increases in frequencies that may lead to potential failures of the transgenic technology. Furthermore, it demonstrates that pyramids are not 'bullet proof' and that rapid evolution to Bt toxins in the Cry2 class is possible.

Critical osmotic, ionic and physiological indicators of salinity tolerance in cotton (gossypium hirsutum l.) for cultivar selection

International Nuclear Information System (INIS)

Munis, M.F.H.; Tu, L.; Ziaf, K; Tan, J.; Deng, F.; Zhang, X.

2010-01-01

Salinity affects the germination, growth and ultimately the yield of cotton (Gossypium hirsutum L.) which demands reliable traits for the evaluation and selection of salt tolerant cultivars. Here, ten major osmotic, ionic and physiological parameters have been studied to distinguish the effect of salinity in two different cultivars of cotton. Plants were grown in hydroponic system and exposed to different salinity levels of NaCl followed by its recovery under non saline conditions. Data was recorded at three different stages i.e., before stress, after stress and after recovery for comparative study. Recovery assay proved to be very helpful in extracting reliable results. Both cultivars showed significantly different response to Na+ and K+ accumulation and phenotypically salt tolerant cultivar (Coker 312) accumulated less Na+ and more K+ in comparison with susceptible (Simian 3). Decrease in leaf area, seed germination and seedling growth were also conclusive to differentiate these cultivars. We also found other physiological parameters like relative leaf water content (RLWC), plant fresh-weight (PFW), plant dry-weight (PDW), relative growth rate (RGR) and stomatal behavior as good indicators of salinity but could not find their significant role to differentiate two closely relevant cultivars regarding salinity tolerance. Our studies revealed that proline accumulation and chlorophyll concentration are not significant to be used as accurate indicators to characterize the sensitivity of cotton cultivars to salinity. We found post-recovery analysis to be very useful in understanding the role and behavior of different indicators of salinity. (author)

Dictionary of Cotton

Science.gov (United States)

The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

Effect of low doses gamma irradiation of cotton seeds

International Nuclear Information System (INIS)

Al-Oudat, M.; Khalifa, Kh.

1996-01-01

Field experiments and then large scale application of irradiated cotton seeds (C.V. Aleppo-40) were carried out during three seasons (1986, 1987 and 1988) for field experiment at ACSAD Station in Dier-Ezzor and 1988, 1989 and 1990 for large scale application at Euphrate's Basin, Al-Ghab and Salamia, farmers farms. The above areas were selected as they represent major cotton production areas in Syria. The aims of the experiments were to study the effect of low doses of gamma irradiation 0, 5, 10, 20, 30, 40 and 50 Gy on cotton yield and to look for the optimum dose of gamma irradiation to obtain best results. The results show that, there were positive effect (P<0.95) for doses 5-30 Gy in increasing cotton yield. The highest increase was at dose of 10 Gy. which as 19.5% higher than control. For the large scale application using 10 Gy the increase in cotton yield varied from 10-39% compared to control. (author). 11 refs., 6 figs

Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

Science.gov (United States)

Meyer, P; Heidmann, I

1994-05-25

We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

Heterosis and correlation in interspecific and intraspecific hybrids of cotton.

Science.gov (United States)

Munir, S; Hussain, S B; Manzoor, H; Quereshi, M K; Zubair, M; Nouman, W; Shehzad, A N; Rasul, S; Manzoor, S A

2016-06-24

Interspecific and intraspecific hybrids show varying degrees of heterosis for yield and yield components. Yield-component traits have complex genetic relationships with each other. To determine the relationship of yield-component traits and fiber traits with seed cotton yield, six lines (Bt. CIM-599, CIM-573, MNH-786, CIM-554, BH-167, and GIZA-7) and three test lines (MNH-886, V4, and CIM-557) were crossed in a line x tester mating design. Heterosis was observed for seed cotton yield, fiber traits, and for other yield-component traits. Heterosis in interspecific hybrids for seed cotton yield was more prominent than in intraspecific hybrids. The interspecific hybrid Giza-7 x MNH-886 had the highest heterosis (114.77), while among intraspecific hybrids, CIM-554 x CIM-557 had the highest heterosis (61.29) for seed cotton yield. A major trait contributing to seed cotton yield was bolls/plant followed by boll weight. Correlation studies revealed that bolls/plant, boll weight, lint weight/boll, lint index, seed index, lint/seed, staple length, and staple strength were significantly and positively associated with seed cotton yield. Selection based on boll weight, boll number, lint weight/boll, and lint index will be helpful for improving cotton seed yield.

Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

Science.gov (United States)

Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

2016-09-01

Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

History of cotton fiber bioscience research at USDA-ARS Southern Regional Research Center

Science.gov (United States)

Improving fiber quality has been an important breeding goal for cotton breeders. Better understanding of fiber development helps cotton scientists to devise a strategy for crop improvement either through marker-assisted selection or via manipulation of fiber genes. USDA-ARS Southern Regional Researc...

Intraspecific Variability of Rotylenchulus reniformis from Cotton-growing Regions in the United States

OpenAIRE

Agudelo, Paula; Robbins, Robert T.; Stewart, James McD.; Szalanski, Allen L.

2005-01-01

Reniform nematode (Rotylenchulus reniformis) is a major pest of cotton in the southeastern United States. The objective of this study was to examine the variation of reniform nematode populations from cotton-growing locations in the United States where it is prevalent. Multivariate analysis of variance and discriminant analysis were used to determine the variability of morphology in males and immature females. Reproduction indices of populations were measured on selected soybean and cotton ge...

Landscape crop composition effects on cotton yield, Lygus hesperus densities and pesticide use.

Science.gov (United States)

Meisner, Matthew H; Zaviezo, Tania; Rosenheim, Jay A

2017-01-01

Landscape crop composition surrounding agricultural fields is known to affect the density of crop pests, but quantifying these effects, as well as measuring how they translate to changes in yield, is difficult. Using a large dataset consisting of 1498 records of commercial cotton production in California between 1997 and 2008, we explored the relationship between landscape composition and cotton yield, the density of Lygus hesperus (a key cotton pest) at field-level and within-field spatial scales and pesticide use. We found that the crop composition immediately adjacent to a cotton field was associated with substantial differences in cotton yield, L. hesperus density and pesticide use. Furthermore, crops that tended to be associated with increased L. hesperus density also tended to be associated with increased pesticide use and decreased cotton yield. Our results suggest a possible mechanism by which landscape composition can affect cotton yield: by increasing the density of pests which in turn damage cotton plants. Our quantification of how surrounding crops affect pest densities, and in turn yield, in cotton fields has significant impacts for cotton farmers, who can use this information to help optimize crop selection and ranch layout. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Use of transgenic seeds in Brazilian agriculture and concentration of agricultural production to large agribusinesses.

Science.gov (United States)

Marinho, C D; Martins, F J O; Amaral Júnior, A T; Gonçalves, L S A; Amaral, S C S; de Mello, M P

2012-07-19

We identified the commercial releases of genetically modified organisms (GMOs) in Brazil, their characteristics, the types of genetic transformation used, and the companies responsible for the development of these GMOs, classifying them into two categories: private companies, subdivided into multinational and national, and public institutions. The data came from the data bank of the national registration of cultivars and the service of national protection of cultivars of the Ministry of Agriculture, Fishing and Supply (MAPA). This survey was carried out from 1998 to February 12, 2011. Until this date, 27 GMOs had been approved, including five for soybean, 15 for maize and seven for cotton cultivars. These GMOs have been used for the development of 766 cultivars, of which, 305 are soybean, 445 are maize, and 13 are cotton cultivars. The Monsato Company controls 73.2% of the transgenic cultivars certified by the MAPA; a partnership between Dow AgroSciences and DuPont accounts for 21.4%, and Syngenta controls 4.96%. Seed supply by these companies is almost a monopoly supported by law, giving no choice for producers and leading to the fast replacement of conventional cultivars by transgenic cultivars, which are expensive and exclude small producers from the market, since seeds cannot be kept for later use. This situation concentrates production in the hands of a few large national agribusiness entrepreneurs.

Using Winter Annual Cover Crops in a Virginia No-till Cotton Production System

OpenAIRE

Daniel, James B. II

1997-01-01

Cotton (Gossypium hirsutum L.) is a low residue crop, that may not provide sufficient surface residue to reduce erosion and protect the soil. A winter annual cover crop could alleviate erosion between cotton crops. Field experiments were conducted to evaluate selected winter annual cover crops for biomass production, ground cover, and N assimilation. The cover crop treatments were monitored under no-till and conventional tillage systems for the effects on soil moisture, cotton yield and qu...

Application of a high-speed breeding technology to apple (Malus × domestica) based on transgenic early flowering plants and marker-assisted selection.

Science.gov (United States)

Flachowsky, Henryk; Le Roux, Pierre-Marie; Peil, Andreas; Patocchi, Andrea; Richter, Klaus; Hanke, Magda-Viola

2011-10-01

Breeding of apple (Malus × domestica) remains a slow process because of protracted generation cycles. Shortening the juvenile phase to achieve the introgression of traits from wild species into prebreeding material within a reasonable time frame is a great challenge. In this study, we evaluated early flowering transgenic apple lines overexpressing the BpMADS4 gene of silver birch with regard to tree morphology in glasshouse conditions. Based on the results obtained, line T1190 was selected for further analysis and application to fast breeding. The DNA sequences flanking the T-DNA were isolated and the T-DNA integration site was mapped on linkage group 4. The inheritance and correctness of the T-DNA integration were confirmed after meiosis. A crossbred breeding programme was initiated by crossing T1190 with the fire blight-resistant wild species Malus fusca. Transgenic early flowering F(1) seedlings were selected and backcrossed with 'Regia' and 98/6-10 in order to introgress the apple scab Rvi2, Rvi4 and powdery mildew Pl-1, Pl-2 resistance genes and the fire blight resistance quantitative trait locus FB-F7 present in 'Regia'. Three transgenic BC'1 seedlings pyramiding Rvi2, Rvi4 and FB-F7, as well as three other BC'1 seedlings combining Pl-1 and Pl-2, were identified. Thus, the first transgenic early flowering-based apple breeding programme combined with marker-assisted selection was established. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

Science.gov (United States)

Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

Market forces and technological substitutes cause fluctuations in the value of bat pest-control services for cotton.

Directory of Open Access Journals (Sweden)

Laura López-Hoffman

Full Text Available Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the "economic benefits" arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars due to the introduction and widespread adoption of Bt (Bacillus thuringiensis cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function--in this case bat population numbers--is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.

Market forces and technological substitutes cause fluctuations in the value of bat pest-control services for cotton

Science.gov (United States)

López-Hoffman, Laura; Wiederholt, Ruscena; Sansone, Chris; Bagstad, Kenneth J.; Cryan, Paul M.; Diffendorfer, James E.; Goldstein, Joshua; LaSharr, Kelsie; Loomis, John; McCracken, Gary; Medellin, Rodrigo A.; Russell, Amy; Semmens, Darius J.

2014-01-01

Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the “economic benefits” arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana) to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars) due to the introduction and widespread adoption of Bt (Bacillus thuringiensis) cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function – in this case bat population numbers – is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.

Efficacy evaluation of selected herbicides on weed control and productivity evaluation of Bt cotton in Punjab.

Science.gov (United States)

Singh, Kulvir; Rathore, Pankaj

2015-07-01

Field experiments were conducted during Kharif 2012 and 2013 to evaluate the efficacy of different herbicides for weed management in cotton. Highest seed cotton yield (3537.3 kg ha(-1)) was recorded in weed free plots followed by pendimethalin @1.0 kg a.i ha(-1) as Pre.em.+quizalofopethyl @50 g a.i ha(-1) post-em at 2-4 weed leaf stage + one hoeing (3318.9 kg ha") owing to improved number of bolls per plant and boll weight. Statistically least yield was recorded underweedy check (1435.4 kg ha(-1)). Application of pyrithiobac sodium could not express any visible toxic effect on crop indicating its selectivity for cotton, although none of the tested new chemicals i.e., pyrithiobac sodium@ 62.5g a.i ha(-1) and quizalofopethyl @50g a.i ha(-1) when applied alone could not outperform the existing recommended chemicals for weed management. Yield losses to the extent of 6.2-59.4% were recorded due to weed competition. Weed control efficiency (WCE) was highest under weed free check (86.8%) followed by pendimethalin @1.0 kg a.i ha(-1) as Pre. em.+quizalofopethyl @50g a.i ha(-1), at 2-4 weed leaf stage + one hoeing (73.7%), whereas minimum values were for weedy check (24.7%). Though net returns (r94660 ha(-1)) were highest for weed free check but higher B:C ratio (2:11) was observed for pendimethalin @1.0 kg a.i ha(-1) as Pre em.+quizalofopethyl @50 g a.i ha(-1) post-em at 2-4 weed leaf stage+one hoeing. Therefore, for reasons such as labor shortage besides their timely availability, using these herbicides in combination with cultural practices could be the practical solution foreconomically efficient and effective weed management.

Indian Bt cotton varieties do not affect the performance of cotton aphids.

Directory of Open Access Journals (Sweden)

Nora C Lawo

Full Text Available Cotton varieties expressing Cry proteins derived from the soil bacterium Bacillus thuringiensis (Bt are grown worldwide for the management of pest Lepidoptera. To prevent non-target pest outbreaks and to retain the biological control function provided by predators and parasitoids, the potential risk that Bt crops may pose to non-target arthropods is addressed prior to their commercialization. Aphids play an important role in agricultural systems since they serve as prey or host to a number of predators and parasitoids and their honeydew is an important energy source for several arthropods. To explore possible indirect effects of Bt crops we here examined the impact of Bt cotton on aphids and their honeydew. In climate chambers we assessed the performance of cotton aphids, Aphis gossypii Glover (Hemiptera: Aphididae when grown on three Indian Bt (Cry1Ac cotton varieties (MECH 12, MECH 162, MECH 184 and their non-transformed near isolines. Furthermore, we examined whether aphids pick up the Bt protein and analyzed the sugar composition of aphid honeydew to evaluate its suitability for honeydew-feeders. Plant transformation did not have any influence on aphid performance. However, some variation was observed among the three cotton varieties which might partly be explained by the variation in trichome density. None of the aphid samples contained Bt protein. As a consequence, natural enemies that feed on aphids are not exposed to the Cry protein. A significant difference in the sugar composition of aphid honeydew was detected among cotton varieties as well as between transformed and non-transformed plants. However, it is questionable if this variation is of ecological relevance, especially as honeydew is not the only sugar source parasitoids feed on in cotton fields. Our study allows the conclusion that Bt cotton poses a negligible risk for aphid antagonists and that aphids should remain under natural control in Bt cotton fields.

GhCAX3 gene, a novel Ca(2+/H(+ exchanger from cotton, confers regulation of cold response and ABA induced signal transduction.

Directory of Open Access Journals (Sweden)

Lian Xu

Full Text Available As a second messenger, Ca(2+ plays a major role in cold induced transduction via stimulus-specific increases in [Ca(2+]cyt, which is called calcium signature. During this process, CAXs (Ca(2+/H(+ exchangers play critical role. For the first time, a putative Ca(2+/H(+ exchanger GhCAX3 gene from upland cotton (Gossypium hirsutum cv. 'YZ-1' was isolated and characterized. It was highly expressed in all tissues of cotton except roots and fibers. This gene may act as a regulator in cotton's response to abiotic stresses as it could be up-regulated by Ca(2+, NaCl, ABA and cold stress. Similar to other CAXs, it was proved that GhCAX3 also had Ca(2+ transport activity and the N-terminal regulatory region (NRR through yeast complementation assay. Over-expression of GhCAX3 in tobacco showed less sensitivity to ABA during seed germination and seedling stages, and the phenotypic difference between wild type (WT and transgenic plants was more significant when the NRR was truncated. Furthermore, GhCAX3 conferred cold tolerance in yeast as well as in tobacco seedlings based on physiological and molecular studies. However, transgenic plant seeds showed more sensitivity to cold stress compared to WT during seed germination, especially when expressed in N-terminal truncated version. Finally, the extent of sensitivity in transgenic lines was more severe than that in WT line under sodium tungstate treatment (an ABA repressor, indicating that ABA could alleviate cold sensitivity of GhCAX3 seeds, especially in short of its NRR. Meanwhile, we also found that overexpression of GhCAX3 could enhance some cold and ABA responsive marker genes. Taken together, these results suggested that GhCAX3 plays important roles in the cross-talk of ABA and cold signal transduction, and compared to full-length of GhCAX3, the absence of NRR could enhance the tolerance or sensitivity to cold stress, depending on seedling's developmental stages.

Dictionary of cotton: Picking & ginning

Science.gov (United States)

Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

Selection of bee species for environmental risk assessment of GM cotton in the Brazilian Cerrado

Directory of Open Access Journals (Sweden)

Carmen Sílvia Soares Pires

2014-08-01

Full Text Available The objective of this work was to list potential candidate bee species for environmental risk assessment (ERA of genetically modified (GM cotton and to identify the most suited bee species for this task, according to their abundance and geographical distribution. Field inventories of bee on cotton flowers were performed in the states of Bahia and Mato Grosso, and in Distrito Federal, Brazil. During a 344 hour sampling, 3,470 bees from 74 species were recovered, at eight sites. Apis mellifera dominated the bee assemblages at all sites. Sampling at two sites that received no insecticide application was sufficient to identify the three most common and geographically widespread wild species: Paratrigona lineata, Melissoptila cnecomola, and Trigona spinipes, which could be useful indicators of pollination services in the ERA. Indirect ordination of common wild species revealed that insecticides reduced the number of native bee species and that interannual variation in bee assemblages may be low. Accumulation curves of rare bee species did not saturate, as expected in tropical and megadiverse regions. Species-based approaches are limited to analyze negative impacts of GM cotton on pollinator biological diversity. The accumulation rate of rare bee species, however, may be useful for evaluating possible negative effects of GM cotton on bee diversity.

Functional characterization of AGAMOUS-subfamily members from cotton during reproductive development and in response to plant hormones.

Science.gov (United States)

de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio

2017-03-01

Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum

Analyse comparative de la rentabilité des systèmes de production de coton biologique, conventionnel et transgénique au Burkina Faso

Directory of Open Access Journals (Sweden)

Vognan, G.

2017-01-01

Full Text Available Comparative Analysis of the Profitability of Organic, Conventional, and Transgenic Cotton Farming Systems in Burkina Faso. This research aimed to compare the profitability of cotton cropping systems (cotton and rotation crops according to three production modes: organic, conventional, and transgenic. The study was conducted in Burkina Faso on a sample of 180 households of which 60 households from organic cotton system, 60 households from conventional cotton system, and 60 households from transgenic cotton system. It came out that the production costs of the various crops in the transgenic and conventional systems are higher than those of the organic system. The differences in the production costs for the three modes of production are highly significant especially for cotton, corn, sorghum and groundnut. In terms of profitability, there's no significant difference in the margins generated by the different modes of cotton production. On the other hand, the sensitivity analysis revealed that organic cotton is financially more resilient to cotton price fluctuation and chemical inputs cost. Actually, organic cotton production seems to be a viable option to alleviate poverty in the present context of climate change.

Genetic and DNA methylation changes in cotton (Gossypium genotypes and tissues.

Directory of Open Access Journals (Sweden)

Kenji Osabe

Full Text Available In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP assays including a methylation insensitive enzyme (BsiSI, and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC. DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.

Science.gov (United States)

Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W

2014-01-01

In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change

Science.gov (United States)

Huang, Jian; Hao, HongFei

2018-05-01

Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change.

Science.gov (United States)

Huang, Jian; Hao, HongFei

2018-05-11

Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

Research on detecting heterogeneous fibre from cotton based on linear CCD camera

Science.gov (United States)

Zhang, Xian-bin; Cao, Bing; Zhang, Xin-peng; Shi, Wei

2009-07-01

The heterogeneous fibre in cotton make a great impact on production of cotton textile, it will have a bad effect on the quality of product, thereby affect economic benefits and market competitive ability of corporation. So the detecting and eliminating of heterogeneous fibre is particular important to improve machining technics of cotton, advance the quality of cotton textile and reduce production cost. There are favorable market value and future development for this technology. An optical detecting system obtains the widespread application. In this system, we use a linear CCD camera to scan the running cotton, then the video signals are put into computer and processed according to the difference of grayscale, if there is heterogeneous fibre in cotton, the computer will send an order to drive the gas nozzle to eliminate the heterogeneous fibre. In the paper, we adopt monochrome LED array as the new detecting light source, it's lamp flicker, stability of luminous intensity, lumens depreciation and useful life are all superior to fluorescence light. We analyse the reflection spectrum of cotton and various heterogeneous fibre first, then select appropriate frequency of the light source, we finally adopt violet LED array as the new detecting light source. The whole hardware structure and software design are introduced in this paper.

Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection

Directory of Open Access Journals (Sweden)

Broder Christopher C

2009-05-01

Full Text Available Abstract Background Current small animal models for studying HIV-1 infection are very limited, and this continues to be a major obstacle for studying HIV-1 infection and pathogenesis, as well as for the urgent development and evaluation of effective anti-HIV-1 therapies and vaccines. Previously, it was shown that HIV-1 can infect cotton rats as indicated by development of antibodies against all major proteins of the virus, the detection of viral cDNA in spleen and brain of challenged animals, the transmission of infectious virus, albeit with low efficiency, from animal to animal by blood, and an additional increase in the mortality in the infected groups. Results Using in vitro experiments, we now show that cotton rat cell lines engineered to express human receptor complexes for HIV-1 (hCD4 along with hCXCR4 or hCCR5 support virus entry, viral cDNA integration, and the production of infectious virus. Conclusion These results further suggest that the development of transgenic cotton rats expressing human HIV-1 receptors may prove to be useful small animal model for HIV infection.

Phytoremediation of small organic contaminants using transgenic plants

Science.gov (United States)

James, C Andrew; Strand, Stuart E

2010-01-01

The efficacy of transgenic plants in the phytoremediation of small organic contaminants has been investigated. Two principal strategies have been pursued (1) the manipulation of phase I metabolic activity to enhance in planta degradation rates, or to impart novel metabolic activity, and (2) the enhanced secretion of reactive enzymes from roots leading to accelerated ex planta degradation of organic contaminants. A pair of dehalogenase genes from Xanthobacter autotrophicus was expressed in tobacco resulting in the dehalogenation of 1,2-dichloroethane, which was otherwise recalcitrant. A laccase gene from cotton was overexpressed in Arabidopsis thaliana resulting in increased secretory laccase activity and the enhanced resistance to trichlorophenol in soils. Although the results to date are promising, much of the work has been limited to laboratory settings; field demonstrations are needed. PMID:19342219

Systems for harvesting and handling cotton plant residue

Energy Technology Data Exchange (ETDEWEB)

Coates, W. [Univ. of Arizona, Tucson, AZ (United States)

1993-12-31

In the warmer regions of the United States, cotton plant residue must be buried to prevent it from serving as an overwintering site for insect pests such as the pink bollworm. Most of the field operations used to bury the residue are high energy consumers and tend to degrade soil structure, thereby increasing the potential for erosion. The residue is of little value as a soil amendment and consequently is considered a negative value biomass. A commercial system to harvest cotton plant residue would be of both economic and environmental benefit to cotton producers. Research has been underway at the University of Arizona since the spring of 1991 to develop a commercially viable system for harvesting cotton plant residue. Equipment durability, degree of densification, energy required, cleanliness of the harvested material, and ease of product handling and transport are some of the performance variables which have been measured. Two systems have proven superior. In both, the plants are pulled from the ground using an implement developed specifically for the purpose. In one system, the stalks are baled using a large round baler, while in the other the stalks are chopped with a forage harvester, and then made into packages using a cotton module maker. Field capacities, energy requirements, package density and durability, and ease of handling with commercially available equipment have been measured for both systems. Selection of an optimum system for a specific operation depends upon end use of the product, and upon equipment availability.

Natural Dyeing and UV Protection of Raw and Bleached/Mercerised Cotton

Directory of Open Access Journals (Sweden)

Čuk Nina

2017-05-01

Full Text Available Dyeing with natural dyes extracted from curcuma, green tea, avocado seed, pomegranate peel and horse chestnut bark was studied to evaluate the dyeability and ultraviolet (UV blocking properties of raw and bleached/mercerised cotton fabrics. 20 g/l of powdered plant material was extracted in distilled water and used as a dyeing bath. No mordants were used to obtain ecologically friendly finishing. The colour of samples was measured on a refl ectance spectrophotometer, while UV-blocking properties were analysed with UV-Vis spectrophotometer. The results showed that dyeing increased UV protection factor (UPF to all samples, however much higher UPF values were measured for the dyed raw cotton samples. The highest UPF values were obtained on both cotton fabrics dyed with pomegranate peel and green tea extracts, giving them excellent protective properties (UPF 50+. The lowest UPF values were obtained by dyeing cotton with avocado seed extract and curcumin. Dyeing with selected dyes is not stable to washing, so the UV-blocking properties worsen after repetitive washing. However, raw cotton samples retain their very good Uvblocking properties, while bleached/mercerised cotton fabrics do not provide even satisfactory UV-blocking properties. No correlation between CIE L*a*b*, K/S and UPF values were found.

Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

Science.gov (United States)

Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

2018-01-05

Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Selection of housekeeping genes and demonstration of RNAi in cotton leafhopper, Amrasca biguttula biguttula (Ishida)

Science.gov (United States)

Gupta, Mridula; Pandher, Suneet; Kaur, Gurmeet; Rathore, Pankaj; Palli, Subba Reddy

2018-01-01

Amrasca biguttula biguttula (Ishida) commonly known as cotton leafhopper is a severe pest of cotton and okra. Not much is known on this insect at molecular level due to lack of genomic and transcriptomic data. To prepare for functional genomic studies in this insect, we evaluated 15 common housekeeping genes (Tub, B-Tub, EF alpha, GADPH, UbiCF, RP13, Ubiq, G3PD, VATPase, Actin, 18s, 28s, TATA, ETF, SOD and Cytolytic actin) during different developmental stages and under starvation stress. We selected early (1st and 2nd), late (3rd and 4th) stage nymphs and adults for identification of stable housekeeping genes using geNorm, NormFinder, BestKeeper and RefFinder software. Based on the different algorithms, RP13 and VATPase are identified as the most suitable reference genes for quantification of gene expression by reverse transcriptase quantitative PCR (RT-qPCR). Based on RefFinder which comprehended the results of three algorithms, RP13 in adults, Tubulin (Tub) in late nymphs, 28S in early nymph and UbiCF under starvation stress were identified as the most stable genes. We also developed methods for feeding double-stranded RNA (dsRNA) incorporated in the diet. Feeding dsRNA targeting Snf7, IAP, AQP1, and VATPase caused 56.17–77.12% knockdown of targeted genes compared to control and 16 to 48% mortality of treated insects when compared to control. PMID:29329327

Selection of housekeeping genes and demonstration of RNAi in cotton leafhopper, Amrasca biguttula biguttula (Ishida.

Directory of Open Access Journals (Sweden)

Satnam Singh

Full Text Available Amrasca biguttula biguttula (Ishida commonly known as cotton leafhopper is a severe pest of cotton and okra. Not much is known on this insect at molecular level due to lack of genomic and transcriptomic data. To prepare for functional genomic studies in this insect, we evaluated 15 common housekeeping genes (Tub, B-Tub, EF alpha, GADPH, UbiCF, RP13, Ubiq, G3PD, VATPase, Actin, 18s, 28s, TATA, ETF, SOD and Cytolytic actin during different developmental stages and under starvation stress. We selected early (1st and 2nd, late (3rd and 4th stage nymphs and adults for identification of stable housekeeping genes using geNorm, NormFinder, BestKeeper and RefFinder software. Based on the different algorithms, RP13 and VATPase are identified as the most suitable reference genes for quantification of gene expression by reverse transcriptase quantitative PCR (RT-qPCR. Based on RefFinder which comprehended the results of three algorithms, RP13 in adults, Tubulin (Tub in late nymphs, 28S in early nymph and UbiCF under starvation stress were identified as the most stable genes. We also developed methods for feeding double-stranded RNA (dsRNA incorporated in the diet. Feeding dsRNA targeting Snf7, IAP, AQP1, and VATPase caused 56.17-77.12% knockdown of targeted genes compared to control and 16 to 48% mortality of treated insects when compared to control.

POTASSIUM FERTILIZATION AND SOIL MANAGEMENT SYSTEMS FOR COTTON CROPS

Directory of Open Access Journals (Sweden)

VITOR MARQUES VIDAL

2017-01-01

Full Text Available Cotton has great socio-economic importance due to its use in textile industry, edible oil and biodiesel production and animal feed. Thus, the objective of this work was to identify the best potassium rate and soil management for cotton crops and select among cultivars, the one that better develops in the climatic conditions of the Cerrado biome in the State of Goiás, Brazil. Thus, the effect of five potassium rates (100, 150, 200, 250 and 300 kg ha-1 of K2O and two soil management systems (no-till and conventional tillage on the growth, development and reproduction of four cotton cultivars (BRS-371, BRS-372, BRS-286 and BRS-201 was evaluated. The data on cotton growth and development were subjected to analysis of variance; the data on potassium rates were subjected to regression analysis; and the data on cultivars and soil management to mean test. The correlation between the vegetative and reproductive variables was also assessed. The conventional tillage system provides the best results for the herbaceous cotton, regardless of the others factors evaluated. The cultivar BRS-286 has the best results in the conditions evaluated. The cultivar BRS-371 under no-till system present the highest number of fruiting branches at a potassium rate of 105.5% and highest number of floral buds at a potassium rate of 96.16%. The specific leaf area was positively correlated with the number of bolls per plant at 120 days after emergence of the herbaceous cotton.

Polyploidization altered gene functions in cotton (Gossypium spp.).

Science.gov (United States)

Xu, Zhanyou; Yu, John Z; Cho, Jaemin; Yu, Jing; Kohel, Russell J; Percy, Richard G

2010-12-16

Cotton (Gossypium spp.) is an important crop plant that is widely grown to produce both natural textile fibers and cottonseed oil. Cotton fibers, the economically more important product of the cotton plant, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that large numbers of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across At and Dt subgenomes of tetraploid AD cottons. In the present study, the organization and evolution of the fiber development genes were investigated through the construction of an integrated genetic and physical map of fiber development genes whose functions have been verified and confirmed. A total of 535 cotton fiber development genes, including 103 fiber transcription factors, 259 fiber development genes, and 173 SSR-contained fiber ESTs, were analyzed at the subgenome level. A total of 499 fiber related contigs were selected and assembled. Together these contigs covered about 151 Mb in physical length, or about 6.7% of the tetraploid cotton genome. Among the 499 contigs, 397 were anchored onto individual chromosomes. Results from our studies on the distribution patterns of the fiber development genes and transcription factors between the At and Dt subgenomes showed that more transcription factors were from Dt subgenome than At, whereas more fiber development genes were from At subgenome than Dt. Combining our mapping results with previous reports that more fiber QTLs were mapped in Dt subgenome than At subgenome, the results suggested a new functional hypothesis for tetraploid cotton. After the merging of the two diploid Gossypium genomes, the At subgenome has provided most of the genes for fiber development, because it continues to function similar to its fiber producing diploid A genome ancestor. On the other hand, the Dt subgenome, with its non-fiber producing D genome ancestor

Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

Science.gov (United States)

Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

2017-03-01

An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

GhZFP1, a novel CCCH-type zinc finger protein from cotton, enhances salt stress tolerance and fungal disease resistance in transgenic tobacco by interacting with GZIRD21A and GZIPR5.

Science.gov (United States)

Guo, Ying-Hui; Yu, Yue-Ping; Wang, Dong; Wu, Chang-Ai; Yang, Guo-Dong; Huang, Jin-Guang; Zheng, Cheng-Chao

2009-01-01

* Zinc finger proteins are a superfamily involved in many aspects of plant growth and development. However, CCCH-type zinc finger proteins involved in plant stress tolerance are poorly understood. * A cDNA clone designated Gossypium hirsutum zinc finger protein 1 (GhZFP1), which encodes a novel CCCH-type zinc finger protein, was isolated from a salt-induced cotton (G. hirsutum) cDNA library using differential hybridization screening and further studied in transgenic tobacco Nicotiana tabacum cv. NC89. Using yeast two-hybrid screening (Y2H), proteins GZIRD21A (GhZFP1 interacting and responsive to dehydration protein 21A) and GZIPR5 (GhZFP1 interacting and pathogenesis-related protein 5), which interacted with GhZFP1, were isolated. * GhZFP1 contains two typical zinc finger motifs (Cx8Cx5Cx3H and Cx5Cx4Cx3H), a putative nuclear export sequence (NES) and a potential nuclear localization signal (NLS). Transient expression analysis using a GhZFP1::GFP fusion gene in onion epidermal cells indicated a nuclear localization for GhZFP1. RNA blot analysis showed that the GhZFP1 transcript was induced by salt (NaCl), drought and salicylic acid (SA). The regions in GhZFP1 that interact with GZIRD21A and GZIPR5 were identified using truncation mutations. * Overexpression of GhZFP1 in transgenic tobacco enhanced tolerance to salt stress and resistance to Rhizoctonia solani. Therefore, it appears that GhZFP1 might be involved as an important regulator in plant responses to abiotic and biotic stresses.

Seletividade de clomazone isolado ou em mistura para a cultura do algodoeiro Selectivity of clomazone applied alone or in tank mixtures to cotton

Directory of Open Access Journals (Sweden)

H.A Dan

2011-09-01

Full Text Available O clomazone destaca-se como um dos principais herbicidas utilizados em pré-emergência na cultura do algodoeiro, mesmo levando-se em conta o fato de que muito pouco se sabe em relação à sua seletividade para a cultura. Objetivou-se com este trabalho avaliar a seletividade do clomazone isolado ou em mistura com outros herbicidas utilizados em pré-emergência na cultura do algodoeiro. O delineamento experimental foi o de blocos ao acaso, com quatro repetições, com a utilização de testemunhas duplas. Foram avaliados 13 tratamentos, os quais foram constituídos de clomazone isolado ou combinado com os herbicidas S-metolachlor, diuron, prometryne, alachlor, oxyfluorfen e trifluralin. Foram avaliados porcentagem de fitointoxicação, estande final, altura de plantas, número de maçãs e rendimento final de algodão em caroço. O clomazone, isolado nas doses de 1,00 e 1,25 kg ha-1 ou em associação com S-metolachlor (0,76 kg ha-1, diuron (1,50 kg ha-1, prometryne (1,50 kg ha-1, alachlor (1,44 kg ha-1 e trifluralin (1,80 kg ha-1, foi seletivo à cultura do algodão cv. Nu Opal. Em contrapartida, sua associação com oxyfluorfen (1,25 + 0,19 kg ha-1, trifluralin + diuron (1,25 + 1,80 + 1,50 kg ha-1 e trifluralin + prometryne (1,25 + 1,80 + 1,50 kg ha-1 proporcionou redução na produtividade do algodoeiro.Clomazone is one of the most important herbicides applied in pre-emergence in cotton, even though not much is known about its selectivity to this crop. This work was carried out to evaluate the selectivity of clomazone applied alone or in tank mixtures with other herbicides applied in pre-emergence in cotton. The experiment was designed as a randomized block, with four replicates, using two-fold checks. Thirteen treatments were evaluated, constituted by different combinations of clomazone with S-metolachlor, diuron, prometryne, alachlor, oxyfluorfen, and trifluralin. After herbicide application, visual crop injury was evaluated, as well as

Superoleophobic cotton textiles

NARCIS (Netherlands)

Leng, B.; Shao, Z.; With, de G.; Ming, W.

2009-01-01

Common cotton textiles are hydrophilic and oleophilic in nature. Superhydrophobic cotton textiles have the potential to be used as self-cleaning fabrics, but they typically are not super oil-repellent. Poor oil repellency may easily compromise the self-cleaning property of these fabrics. Here, we

7 CFR 1205.319 - Cotton-producing region.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

Examining cotton in rotation with rice and cotton in rotation with other crops using natural experiment

Science.gov (United States)

Sun, Ling; Zhu, Zesheng

2017-08-01

This paper is to show the ability of remote sensing image analysis combined with statistical analysis to characterize the environmental risk assessment of cotton in rotation with rice and cotton in rotation with other crops in two ways: (1) description of rotation period of cotton in rotation with rice and cotton in rotation with other crops by the observational study or natural experiment; (2) analysis of rotation period calculation of cotton in rotation with rice and cotton in rotation with other crops. Natural experimental results show that this new method is very promising for determining crop rotation period for estimating regional averages of environmental risk. When it is applied to determining crop rotation period, two requested remote sensing images of regional crop are required at least.

SELECTIVITY OF INSECTICIDES TO PREDATORS OF PESTS COTTON PLANT SELETIVIDADE DE INSETICIDAS AOS PREDADORES DAS PRAGAS DO ALGODOEIRO

Directory of Open Access Journals (Sweden)

Julio Cezar Silveira Nunes

2007-09-01

Full Text Available

The selectivity of insecticides for the complex of predators of the pests of cotton plant was evaluated in field experiment, in Goiânia- Goiás (Brazil, during the crop 1998/99. The experimental design was the randomized blocks with seven treatments and four repetitions (check, clorfluazuron, Bacillus thuringiensis, alanycarb, endosulfan and acephate in two amounts. The samplings were accomplished in beforeapplication, two days, seven and fourteen days after the treatment. For the obtained results (Henderson & Tilton, the products, in the decreasing order of selectivity, were: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

KEY-WORDS: Insecta; insecticides; cotton plant; predators.

A seletividade de inseticidas para o complexo das pragas do algodoeiro foi avaliada em experimento de campo, em Goiânia (GO, durante a safra 1998/99. O delineamento experimental foi em blocos ao acaso com sete tratamentos testemunha, clorfluazuron, B. thuringiensis, alanycarb, endosulfan e acephate em duas dosagens, em quatro repetições. As amostragens foram realizadas em pré-aplicação; aos dois, sete e quatorze dias após as pulverizações. Pelos resultados obtidos (fórmula de Herderson & Tilton, os produtos, na ordem decrescente de seletividade, foram: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

PALAVRAS-CHAVE: Insecta; inseticidas; algodão; predadores.

The Impacts of U.S. Cotton Programs on the West and Central African Countries Cotton Export Earnings

OpenAIRE

Fadiga, Mohamadou L.; Mohanty, Samarendu; Pan, Suwen

2005-01-01

This study uses a stochastic simulation approach based on a partial equilibrium structural econometric model of the world fiber market to examine the effects of a removal of U.S. cotton programs on the world market. The effects on world cotton prices and African export earnings were analyzed. The results suggest that on average an elimination of U.S. cotton programs would lead to a marginal increase in the world cotton prices thus resulting in minimal gain for cotton exporting countries in Af...

Locally Grown: Examining Attitudes and Perceptions About Organic Cotton Production and Manufacturing Between Mississippi Cotton Growers and Consumers

Directory of Open Access Journals (Sweden)

Charles Freeman

2016-06-01

Full Text Available The purpose of this study is to examine attitudes and perceptions about organic cotton of Mississippi cotton growers and producers in comparison to fashion-conscious consumers, including advantages/disadvantages of growing and production processes, quality control, consumer preferences, and competitive price structures/profit margins. A sample size of 16 local Mississippi growers and/or producers and 44 undergraduate students at a mid-major Southeastern university were chosen to participate in the study. Instruments were developed based on current research and the definition of organic cotton production defined by the United States Department of Agriculture. Results indicate 75% of growers and producers do not perceive a quality difference between organic and conventionally grown cotton, while 72.7% of the consumers report organically grown cotton is capable of producing a higher quality product compared to conventionally grown cotton. Even with an increase in organic cotton prices (25- 40% higher premium, only 25% of growers and producers would be willing to convert, while a majority (52.3% of consumers would not be willing to spend more than 25% extra for an organically grown cotton product. Consumers indicate the negative effects of conventionally grown cotton, yet many report little knowledge about organic cotton production, while growers/producers immediately dismiss organically grown cotton as a retail marketing strategy.

Effective dominance of resistance of Spodoptera frugiperda to Bt maize and cotton varieties: implications for resistance management

Science.gov (United States)

Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. De A. E.; Omoto, Celso

2016-10-01

The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants.

Superamphiphobic cotton fabrics with enhanced stability

Energy Technology Data Exchange (ETDEWEB)

Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)

2015-11-30

Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

Asymmetric evolution and domestication in allotetraploid cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Lei Fang

2017-04-01

Full Text Available Polyploidy plays a major role in genome evolution, which corresponds to environmental changes over millions of years. The mechanisms of genome evolution, particularly during the process of domestication, are of broad interest in the fields of plant science and crop breeding. Upland cotton is derived from the hybridization and polyploidization of its ancient A and D diploid ancestors. As a result, cotton is a model for polyploid genome evolution and crop domestication. To explore the genomic mysteries of allopolyploid cotton, we investigated asymmetric evolution and domestication in the A and D subgenomes. Interestingly, more structural rearrangements have been characterized in the A subgenome than in the D subgenome. Correspondingly, more transposable elements, a greater number of lost and disrupted genes, and faster evolution have been identified in the A subgenome. In contrast, the centromeric retroelement (RT-domain related sequence of tetraploid cotton derived from the D subgenome progenitor was found to have invaded the A subgenome centromeres after allotetrapolyploid formation. Although there is no genome-wide expression bias between the subgenomes, as with expression-level alterations, gene expression bias of homoeologous gene pairs is widespread and varies from tissue to tissue. Further, there are more positively selected genes for fiber yield and quality in the A subgenome and more for stress tolerance in the D subgenome, indicating asymmetric domestication. This review highlights the asymmetric subgenomic evolution and domestication of allotetraploid cotton, providing valuable genomic resources for cotton research and enhancing our understanding of the basis of many other allopolyploids.

Expression of genes associated with carbohydrate metabolism in cotton stems and roots

Directory of Open Access Journals (Sweden)

Scheffler Jodi

2009-01-01

Full Text Available Abstract Background Cotton (Gossypium hirsutum L is an important crop worldwide that provides fiber for the textile industry. Cotton is a perennial plant that stores starch in stems and roots to provide carbohydrates for growth in subsequent seasons. Domesticated cotton makes these reserves available to developing seeds which impacts seed yield. The goals of these analyses were to identify genes and physiological pathways that establish cotton stems and roots as physiological sinks and investigate the role these pathways play in cotton development during seed set. Results Analysis of field-grown cotton plants indicated that starch levels peaked about the time of first anthesis and then declined similar to reports in greenhouse-grown cotton plants. Starch accumulated along the length of the stem and the shape and size of the starch grains from stems were easily distinguished from transient starch. Microarray analyses compared gene expression in tissues containing low levels of starch with tissues rapidly accumulating starch. Statistical analysis of differentially expressed genes indicated increased expression among genes associated with starch synthesis, starch degradation, hexose metabolism, raffinose synthesis and trehalose synthesis. The anticipated changes in these sugars were largely confirmed by measuring soluble sugars in selected tissues. Conclusion In domesticated cotton starch stored prior to flowering was available to support seed production. Starch accumulation observed in young field-grown plants was not observed in greenhouse grown plants. A suite of genes associated with starch biosynthesis was identified. The pathway for starch utilization after flowering was associated with an increase in expression of a glucan water dikinase gene as has been implicated in utilization of transient starch. Changes in raffinose levels and levels of expression of genes controlling trehalose and raffinose biosynthesis were also observed in vegetative

Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

Science.gov (United States)

Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

2016-08-01

Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants.

Science.gov (United States)

Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

2015-01-01

Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods.

Cost Efficiency In U.S. Corn, Soybean, Wheat, and Cotton Production

OpenAIRE

Cooke, Stephen C.

1991-01-01

Between 1974 and 1983, intertemporal cost efficiency for u.s. field crops increased about 1.4 to 1.2% percent for corn, soybeans, and wheat and .2% per year for cotton. competitive advantage in 1983 was held by central Illinois and north central Iowa in corn, central Illinois in soybeans, the Washington Palouse and central North Dakota in wheat, and southern California in cotton relative to the other selected regions in the study. Scale economies exist in corn, soybean and wheat but not in co...

The Cotton WRKY Gene GhWRKY41 Positively Regulates Salt and Drought Stress Tolerance in Transgenic Nicotiana benthamiana.

Directory of Open Access Journals (Sweden)

Xiaoqian Chu

Full Text Available WRKY transcription factors constitute a very large family of proteins in plants and participate in modulating plant biological processes, such as growth, development and stress responses. However, the exact roles of WRKY proteins are unclear, particularly in non-model plants. In this study, Gossypium hirsutum WRKY41 (GhWRKY41 was isolated and transformed into Nicotiana benthamiana. Our results showed that overexpression of GhWRKY41 enhanced the drought and salt stress tolerance of transgenic Nicotiana benthamiana. The transgenic plants exhibited lower malondialdehyde content and higher antioxidant enzyme activity, and the expression of antioxidant genes was upregulated in transgenic plants exposed to osmotic stress. A β-glucuronidase (GUS staining assay showed that GhWRKY41 was highly expressed in the stomata when plants were exposed to osmotic stress, and plants overexpressing GhWRKY41 exhibited enhanced stomatal closure when they were exposed to osmotic stress. Taken together, our findings demonstrate that GhWRKY41 may enhance plant tolerance to stress by functioning as a positive regulator of stoma closure and by regulating reactive oxygen species (ROS scavenging and the expression of antioxidant genes.

U.S. Cotton Prices and the World Cotton Market: Forecasting and Structural Change

OpenAIRE

Isengildina-Massa, Olga; MacDonald, Stephen

2009-01-01

The purpose of this study was to analyze structural changes that took place in the cotton industry in recent years and develop a statistical model that reflects the current drivers of U.S. cotton prices. Legislative changes authorized the U.S. Department of Agriculture to resume publishing cotton price forecasts for the first time in 79 years. In addition, systematic problems have become apparent in the forecasting models used by USDA and elsewhere, highlighting the need for an updated review...

Strategies for soil-based precision agriculture in cotton

Science.gov (United States)

Neely, Haly L.; Morgan, Cristine L. S.; Stanislav, Scott; Rouze, Gregory; Shi, Yeyin; Thomasson, J. Alex; Valasek, John; Olsenholler, Jeff

2016-05-01

The goal of precision agriculture is to increase crop yield while maximizing the use efficiency of farm resources. In this application, UAV-based systems are presenting agricultural researchers with an opportunity to study crop response to environmental and management factors in real-time without disturbing the crop. The spatial variability soil properties, which drive crop yield and quality, cannot be changed and thus keen agronomic choices with soil variability in mind have the potential to increase profits. Additionally, measuring crop stress over time and in response to management and environmental conditions may enable agronomists and plant breeders to make more informed decisions about variety selection than the traditional end-of-season yield and quality measurements. In a previous study, seed-cotton yield was measured over 4 years and compared with soil variability as mapped by a proximal soil sensor. It was found that soil properties had a significant effect on seed-cotton yield and the effect was not consistent across years due to different precipitation conditions. However, when seed-cotton yield was compared to the normalized difference vegetation index (NDVI), as measured using a multispectral camera from a UAV, predictions improved. Further improvement was seen when soil-only pixels were removed from the analysis. On-going studies are using UAV-based data to uncover the thresholds for stress and yield potential. Long-term goals of this research include detecting stress before yield is reduced and selecting better adapted varieties.

The water footprint of cotton consumption: An assessment of the impact of worldwide consumption of cotton products on the water resources in the cotton producing countries

NARCIS (Netherlands)

Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

2006-01-01

The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this paper is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

Separation and recycling of cotton from cotton/PET blends by depolymerization of PET catalyzed by bases and ionic liquids

NARCIS (Netherlands)

Bouwhuis, G.H. (Gerrit); Brinks, G.J. (Ger); Groeneveld, R.A.J. (Richard); Oelerich, J. (Jens)

2014-01-01

The recycling of post consumer cotton textile waste is highly requested, due to the high environmental impact of cotton production. Often cotton is mixed in blends with polyethylene terephthalate (PET). For the generation of high value products from recycled cotton, it essential that PET is

The Development of a Remote Sensor System and Decision Support Systems Architecture to Monitor Resistance Development in Transgenic Crops

Science.gov (United States)

Cacas, Joseph; Glaser, John; Copenhaver, Kenneth; May, George; Stephens, Karen

2008-01-01

The United States Environmental Protection Agency (EPA) has declared that "significant benefits accrue to growers, the public, and the environment" from the use of transgenic pesticidal crops due to reductions in pesticide usage for crop pest management. Large increases in the global use of transgenic pesticidal crops has reduced the amounts of broad spectrum pesticides used to manage pest populations, improved yield and reduced the environmental impact of crop management. A significant threat to the continued use of this technology is the evolution of resistance in insect pest populations to the insecticidal Bt toxins expressed by the plants. Management of transgenic pesticidal crops with an emphasis on conservation of Bt toxicity in field populations of insect pests is important to the future of sustainable agriculture. A vital component of this transgenic pesticidal crop management is establishing the proof of concept basic understanding, situational awareness, and monitoring and decision support system tools for more than 133650 square kilometers (33 million acres) of bio-engineered corn and cotton for development of insect resistance . Early and recent joint NASA, US EPA and ITD remote imagery flights and ground based field experiments have provided very promising research results that will potentially address future requirements for crop management capabilities.

The "Cotton Problem"

OpenAIRE

Baffes, John

2005-01-01

Cotton is an important cash crop in many developing economies, supporting the livelihoods of millions of poor households. In some countries it contributes as much as 40 percent of merchandise exports and more than 5 percent of gross domestic product (GDP). The global cotton market, however, has been subject to numerous policy interventions, to the detriment of nonsubsidized producers. This ...

Tensile Properties of Single Jersey and 1×1 Rib Knitted Fabrics Made from 100% Cotton and Cotton/Lycra Yarns

Directory of Open Access Journals (Sweden)

Dereje Berihun Sitotaw

2017-01-01

Full Text Available The tensile properties such as tensile strength which is measured as breaking force in Newton (N and elongation percent (% at break of single jersey and 1×1 rib (knitted with full needles knitted fabrics made from 100% cotton and cotton/Lycra yarns (5% Lycra yarn content in 95% combed cotton yarn are investigated in this research. The sample fabrics are conditioned for 24 hours at 20±1°C temperature and 65±2% relative humidity before testing. Ten specimens (five for lengthwise and five for widthwise have been taken from each of the two knitted structures, those made from 100% cotton and cotton/Lycra (at 95/5 percent ratio blend yarns. According to the discussion and as found from the investigations, the tensile properties of single jersey and 1×1 rib knitted fabrics made from 100% cotton and cotton/Lycra yarns are significantly different from each other and both of the knitted fabrics have high elongation percent at break with cotton/Lycra blend yarns as compared to 100% cotton yarn. Knitted fabrics made from cotton/Lycra blended yarn have low breaking force and high elongation percent at break relative to knitted fabrics made from 100% cotton yarns.

Identification of cotton properties to improve yarn count quality by using regression analysis

International Nuclear Information System (INIS)

Amin, M.; Ullah, M.; Akbar, A.

2014-01-01

Identification of raw material characteristics towards yarn count variation was studied by using statistical techniques. Regression analysis is used to meet the objective. Stepwise regression is used for mode) selection, and coefficient of determination and mean squared error (MSE) criteria are used to identify the contributing factors of cotton properties for yam count. Statistical assumptions of normality, autocorrelation and multicollinearity are evaluated by using probability plot, Durbin Watson test, variance inflation factor (VIF), and then model fitting is carried out. It is found that, invisible (INV), nepness (Nep), grayness (RD), cotton trash (TR) and uniformity index (VI) are the main contributing cotton properties for yarn count variation. The results are also verified by Pareto chart. (author)

Can we stop transgenes from taking a walk on the wild side?

Science.gov (United States)

Dlugosch, Katrina M; Whitton, Jeannette

2008-03-01

Whether the potential costs associated with broad-scale use of genetically modified organisms (GMOs) outweigh possible benefits is highly contentious, including within the scientific community. Even among those generally in favour of commercialization of GM crops, there is nonetheless broad recognition that transgene escape into the wild should be minimized. But is it possible to achieve containment of engineered genetic elements in the context of large scale agricultural production? In a previous study, Warwick et al. (2003) documented transgene escape via gene flow from herbicide resistant (HR) canola (Brassica napus) into neighbouring weedy B. rapa populations (Fig. 1) in two agricultural fields in Quebec, Canada. In a follow-up study in this issue of Molecular Ecology, Warwick et al. (2008) show that the transgene has persisted and spread within the weedy population in the absence of selection for herbicide resistance. Certainly a trait like herbicide resistance is expected to spread when selected through the use of the herbicide, despite potentially negative epistatic effects on fitness. However, Warwick et al.'s findings suggest that direct selection favouring the transgene is not required for its persistence. So is there any hope of preventing transgene escape into the wild?

Generation of Length Distribution, Length Diagram, Fibrogram, and Statistical Characteristics by Weight of Cotton Blends

Directory of Open Access Journals (Sweden)

B. Azzouz

2007-01-01

Full Text Available The textile fibre mixture as a multicomponent blend of variable fibres imposes regarding the proper method to predict the characteristics of the final blend. The length diagram and the fibrogram of cotton are generated. Then the length distribution, the length diagram, and the fibrogram of a blend of different categories of cotton are determined. The length distributions by weight of five different categories of cotton (Egyptian, USA (Pima, Brazilian, USA (Upland, and Uzbekistani are measured by AFIS. From these distributions, the length distribution, the length diagram, and the fibrogram by weight of four binary blends are expressed. The length parameters of these cotton blends are calculated and their variations are plotted against the mass fraction x of one component in the blend .These calculated parameters are compared to those of real blends. Finally, the selection of the optimal blends using the linear programming method, based on the hypothesis that the cotton blend parameters vary linearly in function of the components rations, is proved insufficient.

Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

Science.gov (United States)

Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

2016-10-01

An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

Variation in water-use efficiency and its relation to carbon isotope ratio in cotton

International Nuclear Information System (INIS)

Saranga, Y.; Flash, I.; Yakir, D.

1998-01-01

Cotton (Gossypium spp.) is often exposed to drought, which adversely affects both yield and quality. Improved water-use efficiency (WUE = total dry matter produced or yield harvested / water used) is expected to reduce these adverse effects. Genetic variability in WUE and its association with photosynthetic rate and carbon isotope ratio (13C/12C) in cotton are reported in this paper. WUE of six cotton cultivars--G. hirsutum L., G. barbadense L., and an interspecific F1 hybrid (G. hirsutum x G. barbadense, ISH), was examined under two irrigation regimes in two field trials. The greatest WUE was obtained by two G. hirsutum cultivars (2.55 g dry matter or 1.12 g seed-cotton L-1 H2O) the ISH obtained similar or somewhat lower values, and that G. barbadense cultivars and one G. hirsutum cultivar exhibited the lowest values (2.1 g dry matter or 0.8 to 0.85 g seed-cotton L-1 H2O). These results indicate that different cotton cultivars may have evolved different environmental adaptations that affect their WUE. Photosynthetic rate was correlated with WUE in only a few cases emphasizing the limitation of this parameter as a basis for estimating crop WUE. Under both trials WUE was positively correlated with carbon isotope ratio, indicating the potential of this technique as a selection criterion for improving cotton WUE

The multi-year effects of repeatedly growing cotton with moderate resistance to Meloidogyne incognita

Science.gov (United States)

Kemerait, Robert C.

2009-01-01

Meloidogyne incognita causes more damage to cotton in the US than any other pathogen. The objective of this study was to document the cumulative effect of moderate resistance on M. incognita population density, root galling, and yield suppression in the southern United States on a moderately resistant cotton genotype grown continuously for three years. Cotton genotypes were Phytogen PH98-3196 (77% suppression of M. incognita), Acala NemX (85% suppression of M. incognita), and Delta and Pine Land DP458 B/R (susceptible standard, 0% suppression). Cotton was grown in fumigated and non-fumigated plots to measure yield loss. Each genotype and nematicide combination was planted in the same place for three years at two sites to document cumulative effects. In 2006, following three years of the different genotypes, all plots at one site were planted with susceptible cotton to document residual effects of planting resistant genotypes. Root galling and nematode population densities in the soil were significantly lower, and percentage yield suppression was numerically lower, when moderately resistant cotton was grown compared to the susceptible standard in both fields in all three years. Differences between susceptible and moderately resistant genotypes are established quickly (after only one season) and then either maintained at similar levels or slightly increased in subsequent years depending on initial nematode levels. However, when susceptible cotton was grown following three years of the moderately resistant genotypes, the nematode suppression provided by moderate resistance was undetectable by the end of the first season. Moderately resistant cotton genotypes are more beneficial than previously reported and should be pursued for nematode management. Rotation of moderately resistant and susceptible cotton could be used along with nematicides to manage root-knot nematodes in a continuous cotton cropping system and reduce selection pressure on the nematodes. PMID:22661787

Evidence that agricultural use of pesticides selects pyrethroid resistance within Anopheles gambiae s.l. populations from cotton growing areas in Burkina Faso, West Africa.

Directory of Open Access Journals (Sweden)

Aristide Sawdetuo Hien

Full Text Available Many studies have shown the role of agriculture in the selection and spread of resistance of Anopheles gambiae s.l. to insecticides. However, no study has directly demonstrated the presence of insecticides in breeding sources as a source of selection for this resistance. It is in this context that we investigated the presence of pesticide residues in breeding habitats and their formal involvement in vector resistance to insecticides in areas of West Africa with intensive farming. This study was carried out from June to November 2013 in Dano, southwest Burkina Faso in areas of conventional (CC and biological cotton (BC growing. Water and sediment samples collected from breeding sites located near BC and CC fields were submitted for chromatographic analysis to research and titrate the residual insecticide content found there. Larvae were also collected in these breeding sites and used in toxicity tests to compare their mortality to those of the susceptible strain, Anopheles gambiae Kisumu. All tested mosquitoes (living and dead were analyzed by PCR for species identification and characterization of resistance genes. The toxicity analysis of water from breeding sites showed significantly lower mortality rates in breeding site water from biological cotton (WBC growing sites compared to that from conventional cotton (WCC sites respective to both An. gambiae Kisumu (WBC: 80.75% vs WCC: 92.75% and a wild-type strain (49.75% vs 66.5%. The allele frequencies L1014F, L1014S kdr, and G116S ace -1R mutations conferring resistance, respectively, to pyrethroids and carbamates / organophosphates were 0.95, 0.4 and 0.12. Deltamethrin and lambda-cyhalothrin were identified in the water samples taken in October/November from mosquitoes breeding in the CC growing area. The concentrations obtained were respectively 0.0147ug/L and 1.49 ug/L to deltamethrin and lambdacyhalothrin. Our results provided evidence by direct analysis (biological and chromatographic tests

The water footprint of cotton consumption

NARCIS (Netherlands)

Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

2005-01-01

The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this report is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

Response of successive three generations of cotton bollworm, Helicoverpa armigera (Hübner), fed on cotton bolls, under elevated CO2

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

The growth, development and consumption of successive three generations of cotton bollworm, Helicoverpa armigera (Hübner), fed on cotton bolls grown under elevated CO2 (double-ambient vs. ambient) in open-top chambers were examined. Significant decreases in protein, total amino acid, water and nitrogen content and increases in free fatty acid were observed in cotton bolls. Changes in quality of cotton bolls affected the growth, development and food utilization of H. armigera. Significantly longer larval development duration in three successive generations and lower pupal weight of the second and third generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower fecundity was also found in successive three generations of H. armigera fed on cotton bolls grown under elevated CO2. The consumption per larva occurred significant increase in successive three generations and frass per larva were also significantly increased during the second and third generations under elevated CO2. Significantly lower relative growth rate, efficiency of conversion of ingested food and significant higher relative consumption rate in successive three generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower potential female fecundity, larval numbers and population consumption were found in the second and third generations of cotton bollworm fed on cotton bolls grown under elevated CO2. The integrative effect of higher larval mortality rate and lower adult fecundity resulted in significant decreases in potential population consumption in the latter two generations. The results show that elevated CO2 adversely affects cotton bolls quality, which indicates the potential population dynamics and potential population consumption of cotton bollworm will alleviate the harm to the plants in the future rising CO2 atmosphere.

Structure and properties of tempo-oxidized cotton fibers

Directory of Open Access Journals (Sweden)

Milanovic Jovana

2012-01-01

Full Text Available In this paper, the influence of the catalytic oxidation using water soluble and stable nitroxyl radical 2,2´,6,6´-tetramethylpiperidine-1-oxyl (TEMPO on structure and properties of cotton fibers was studied. In particular, the selective TEMPO-mediated oxidation has become very interesting way for introduction of functional groups into cellulose fibers with the aim to obtain oxycellulose fibers with specific properties. Unmodified and modified fibers were characterized in terms of weight loss values, introduced functional groups and crystallinity index. Also, oxidized fibers were characterized in terms of the sorption, morphological, and physico-mechanical properties. The TEMPO-oxidized cotton fibers show a minimum increase of fineness (from 1.32 to 1.28 dtex and increase of crystallinity index (up to 91.9%, while the tensile strength of fibers decreases (up to 10.82 cN/tex. By the TEMPO-mediated oxidation of cotton fibers significant amount of carboxyl groups (up to 0.795 mmol/g cell can be introduced into cellulose fibers. Introduced hydrophilic carboxyl groups increases the sorption properties of oxidized fibers, that can be used directly or for further chemical modification.

Gene expression in developing fibres of Upland cotton (Gossypium hirsutum L.) was massively altered by domestication.

Science.gov (United States)

Rapp, Ryan A; Haigler, Candace H; Flagel, Lex; Hovav, Ran H; Udall, Joshua A; Wendel, Jonathan F

2010-11-15

Understanding the evolutionary genetics of modern crop phenotypes has a dual relevance to evolutionary biology and crop improvement. Modern upland cotton (Gossypium hirsutum L.) was developed following thousands of years of artificial selection from a wild form, G. hirsutum var. yucatanense, which bears a shorter, sparser, layer of single-celled, ovular trichomes ('fibre'). In order to gain an insight into the nature of the developmental genetic transformations that accompanied domestication and crop improvement, we studied the transcriptomes of cotton fibres from wild and domesticated accessions over a developmental time course. Fibre cells were harvested between 2 and 25 days post-anthesis and encompassed the primary and secondary wall synthesis stages. Using amplified messenger RNA and a custom microarray platform designed to interrogate expression for 40,430 genes, we determined global patterns of expression during fibre development. The fibre transcriptome of domesticated cotton is far more dynamic than that of wild cotton, with over twice as many genes being differentially expressed during development (12,626 versus 5273). Remarkably, a total of 9465 genes were diagnosed as differentially expressed between wild and domesticated fibres when summed across five key developmental time points. Human selection during the initial domestication and subsequent crop improvement has resulted in a biased upregulation of components of the transcriptional network that are important for agronomically advanced fibre, especially in the early stages of development. About 15% of the differentially expressed genes in wild versus domesticated cotton fibre have no homology to the genes in databases. We show that artificial selection during crop domestication can radically alter the transcriptional developmental network of even a single-celled structure, affecting nearly a quarter of the genes in the genome. Gene expression during fibre development within accessions and expression

Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L. Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

Directory of Open Access Journals (Sweden)

Renesh Bedre

Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

Analysis of caustic soda of different manufacturers in pakistan for mercerization of cotton textiles

International Nuclear Information System (INIS)

Zahid, B.; Faisal, S.; Siddique, S.H.

2017-01-01

Pakistan has sufficient production capacity of caustic soda to cater the needs of the local industry. Presently, Pakistan has four major plants with production capacity around 435,000 mega ton per year of caustic soda of various grades. Textile industry of Pakistan is the major consumer of produced high grade caustic soda; as the presence of any impurities especially dissolved salts and metals is unfavorable for wet processing of cotton. This study investigates the performance of three different local brands of caustic soda intended for use in textile wet processing of cotton fabric specifically for mercerization process. The brands were selected based on their purity grades. The selected caustic soda samples were chemically analyzed for the presence of impurities. Twenty seven cotton fabric samples (nine samples of each brand) were prepared by mercerization in slack state. The cotton fabric samples were tested for changes in surface morphology, tensile strength (warp and weft), tear strength, air permeability and K/S (Colour Strength). The results were analyzed using one-way ANOVA (Analysis of Variance) to ascertain the statistical equivalence within and between the tested brands. The results showed no significant differences across the tested brands at a 95% confidence level except for air permeability and K/S in blue shade. (author)

Evaluation of cotton stalks destroyers

OpenAIRE

Bianchini, Aloisio; Borges, Pedro H. de M.

2013-01-01

The destruction of the cotton crop residues (cotton stalks) is a mandatory procedure in Brazil for prophylactic issues, but is a subject unexplored by the research and there are few studies that deal with this issue. However, this is not encouraged in recent decades, studies aimed at developing and evaluating equipment for this purpose. The present study had the objective to evaluate six methods for mechanical destruction of cotton crop residues. Each method was defined based on the principle...

Cotton : Market setting, trade policies, and issues

OpenAIRE

Baffes, John

2004-01-01

The value of world cotton production in 2000-01 has been estimated at about $20 billion, down from $35 billion in 1996-97 when cotton prices were 50 percent higher. Although cotton's share in world merchandise trade is insignificant (about 0.12 percent), it is very important to a number of developing countries. Cotton accounts for approximately 40 percent of total merchandise export earnin...

Investigating Genetic Diversity Among Cotton Genotypes Available in the Iranian Gene Bank (Gossypium sp. Using ISSR Molecular Marker

Directory of Open Access Journals (Sweden)

F Shahriari Ahmadi

2013-04-01

Full Text Available Cotton is one of the most important world crops and is considered as a major cash crop in the North East of Iran. All selections in plant breeding are based on diversity and an increase in genetic diversity determines the range of selection. In the present study, 24 cultivars of cotton available at the research station for cotton in the East of Iran -Kashmar- were studied using the ISSR marker. A total number of 13 primers, with repeated simple sequences, were used for the amplification of genomic DNA. Overall, 128 bands were obtained, 109 of which showed polymorphism. To evaluate genetic similarity between cultivars, cluster analysis accompanied by the similarity coefficient developed by Jaccard and Nee (1972, were applied using the UPGMA method. Dendrogram analysis showed a high diversity in the cotton cultivars and two main groups with 70 percent genetic similarity dividing the cotton cultivars into two main groups; namely, tetraploid and diploid. The highest polymorphism percentage was related to 5' (CT8RC3' (100% and the lowest belonged to 5' (AG8YA3' and 5' (TC8G3' (25% primers. Based on the similarity matrix, the highest genetic similarity was found in Varamin and Khordad and the lowest in Avangard and Bakhtegan cultivars. Based on the obtained results, ISSR markers can be efficiently used for the investigation of genetic diversity among cotton cultivars.

Carbon contributions from roots in cotton based rotations

Science.gov (United States)

Tan, D. K. Y.; Hulugalle, N. R.

2012-04-01

Most research on the decline in soil organic carbon (SOC) stocks in Australian cotton farming systems has focussed on the inputs from above-ground crop residues, with contribution from roots being less studied. This paper aims to outline the contribution of cotton roots and roots of other crops to soil carbon stocks in furrow-irrigated Vertisols in several cotton (Gossypium hirsutum L.)-based rotations. Data was collected from cotton-based rotation systems: cotton monoculture, cotton-vetch (Vicia benghalensis) Roth.), cotton-wheat (Triticum aestivum L.), cotton-wheat-vetch, cotton-corn, corn-corn, cotton-sorghum (Sorghum bicolor L.) and from BollgardTM II (Bt) and non-Bt cotton. Land management systems were permanent beds, with or without standing stubble, and conventional tillage. Root growth in the surface 0.10 m was measured with the core-break method, and that in the 0.10 to 1.0 m depth with a minirhizotron and I-CAP image capture system. These measurements were used to derive root C added to soil through intra-seasonal root death (Clost), C in roots remaining at the end of season (Croot), and total root C added to soil (Ctotal = Croot + Clost). Ctotal in non-Bt cotton (Sicot 80RRF, 0.9 t C/ha/year) was higher than in Bt cotton (Sicot 80RRF, 0.6 t C/ha/year). Overall, Ctotal from cotton roots ranges between 0.5 to 5 t C/ha/year, with Clost contributing 25-70%. Ctotal was greater with vetch than with wheat and was in the order of vetch in cotton-wheat-vetch (5.1 t C/ha/year) > vetch in cotton-vetch (1.9 t C/ha/year) > wheat in cotton-wheat (1.6 t C/ha/year) = wheat in cotton-wheat-vetch (1.7 t C/ha/year). Intra-seasonal root mortality accounted for 12% of total root carbon in vetch and 36% in wheat. Average corn Ctotal with monoculture was 9.3 t/ha and with cotton-corn 5.0 t/ha. Ctotal averaged between both treatments was, thus, of the order of 7.7 t C/ha/year and average Clost 0.04 t/ha/yr. Sorghum roots contributed less carbon with conventional tillage (8.2 t

Cotton leaf curl Burewala virus with intact or mutant transcriptional activator proteins: complexity of cotton leaf curl disease.

Science.gov (United States)

Kumar, Jitendra; Gunapati, Samatha; Alok, Anshu; Lalit, Adarsh; Gadre, Rekha; Sharma, Naresh C; Roy, Joy K; Singh, Sudhir P

2015-05-01

Cotton leaf curl disease (CLCuD) is a serious disease of cotton on the Indian subcontinent. In the present study, three cotton leaf curl viruses, cotton leaf curl Burewala virus (CLCuBuV), cotton leaf curl Kokhran virus (CLCuKoV) and cotton leaf curl Multan virus (CLCuMV), and their associated satellites, cotton leaf curl Multan betasatellite (CLCuMB) and cotton leaf curl Multan alphasatellite (CLCuMA), were detected. CLCuBuV with either intact (CLCuBuV-1) or mutant (CLCuBuV-2) transcriptional activator protein (TrAP) were detected in different plants. Agroinoculation with CLCuBuV-1 or CLCuBuV-2 together with CLCuMB and CLCuMA, resulted in typical leaf curling and stunting of tobacco plants. Inoculation with CLCuKoV or an isolate of CLCuMV (CLCuMV-2), together with CLCuMB and CLCuMA, induced severe leaf curling, while the other isolate of CLCuMV (CLCuMV-1), which was recombinant in origin, showed mild leaf curling in tobacco. To investigate the effect of intact or mutant TrAP and also the recombination events, CLCuBuV-1, CLCuBuV-2, CLCuMV-1 or CLCuMV-2 together with the satellites (CLCuMA and CLCuMB) were transferred to cotton via whitefly-mediated transmission. Cotton plants containing CLCuBuV-1, CLCuBuV-2 or CLCuMV-2 together with satellites showed curling and stunting, whereas the plants having CLCuMV-1 and the satellites showed only mild and indistinguishable symptoms. CLCuBuV-1 (intact TrAP) showed severe symptoms in comparison to CLCuBuV-2 (mutant TrAP). The present study reveals that two types of CLCuBuV, one with an intact TrAP and the other with a mutant TrAP, exist in natural infection of cotton in India. Additionally, CLCuMuV-1, which has a recombinant origin, induces mild symptoms in comparison to the other CLCuMV isolates.

Processing and properties of PCL/cotton linter compounds

Energy Technology Data Exchange (ETDEWEB)

Bezerra, Elieber Barros; Franca, Danyelle Campos; Morais, Dayanne Diniz de Souza; Araujo, Edcleide Maria [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Departamento de Engenharia de Materiais; Rosa, Morsyleide de Freitas; Morais, Joao Paulo Saraiva [Embrapa Tropical Agroindustia, Fortaleza, CE (Brazil); Wellen, Renate Maria Ramos, E-mail: wellen.renate@gmail.com [Universidade Federal da Paraiaba (UFPB), Joao Pessoa, PB (Brazil)

2017-03-15

Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton nanolinter compounds. Adding cotton linter to PCL did not change its crystalline character as showed by XRD; however an increase in degree of crystallinity was observed by means of DSC. From mechanical tests in tension was observed an increase in ductility of PCL, and from mechanical tests in flexion an increase in elastic modulus upon addition of cotton linter, whereas impact strength presented lower values for PCL/cotton linter and PCL/cotton nanolinter compounds. SEM images showed that PCL presents plastic fracture and cotton linter has an interlacing fibril structure with high L/D ratio, which are in agreement with matrix/fibril morphology observed for PCL/cotton linter compounds. PCL/cotton linter compounds made in this work cost less than neat PCL matrix and presented improved properties making feasible its commercial use. (author)

Biological control of cotton aphid (Aphis gossypii Glover) in cotton (inter)cropping systems in China : a simulation study

NARCIS (Netherlands)

Xia, J.

1997-01-01

Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on

Selective WGA uptake in the hippocampus from the locus coeruleus of DBH-WGA transgenic mice

Directory of Open Access Journals (Sweden)

Susan G eWalling

2012-05-01

Full Text Available We generated transgenic mice in which a transsynaptic tracer, wheat germ agglutinin (WGA, was specifically expressed in the locus coeruleus neurons under the control of the dopamine-β-hydroxylase gene promoter. WGA protein was produced in more than 95% of the tyrosine hydroxylase-positive locus coeruleus neurons sampled. Transynaptic transfer of WGA was most evident in CA3 neurons of the hippocampus, but appeared absent in CA1 neurons. Faint but significant WGA immunoreactivity was observed surrounding the nuclei of dentate granule cells. Putative hilar mossy cells, identified by the presence of calretinin in the ventral hippocampus, appeared uniformly positive for transynaptically transferred WGA protein. GAD67-positive interneurons in the hilar and CA3 regions tended to be WGA-positive, although a subset of them did not show WGA co-localization. The same mixed WGA uptake profile was apparent when examining co-localization with parvalbumin. The selective uptake of WGA by dentate granule cells, mossy cells and CA3 pyramidal neurons is consistent with evidence for a large proportion of conventional synapses adjacent to locus coeruleus axonal varicosities in these regions. The lack of WGA uptake in the CA1 region and its relatively sparse innervation by dopamine-β-hydroxylase-positive fibers suggest that a majority of the tyrosine hydroxylase-positive classical synapses revealed by electron microscopy in that region may be producing dopamine. The overall pattern of WGA uptake in these transgenic mice suggests a selective role for the granule cell-mossy cell-CA3 network in processing novelty or the salient environmental contingency changes signaled by locus coeruleus activity.

Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

Science.gov (United States)

Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

Development and validation of SUCROS-Cotton : A potential crop growth simulation model for cotton

NARCIS (Netherlands)

Zhang, L.; Werf, van der W.; Cao, W.; Li, B.; Pan, X.; Spiertz, J.H.J.

2008-01-01

A model for the development, growth and potential production of cotton (SUCROS-Cotton) was developed. Particular attention was given to the phenological development of the plant and the plasticity of fruit growth in response to temperature, radiation, daylength, variety traits, and management. The

Cotton trends in India

Indian Academy of Sciences (India)

First page Back Continue Last page Graphics. Cotton trends in India. A crop of significant economic importance, valued at over Rs. 15000 Crs. Provides income to 60 million people. Crucial raw material for Rs 83000 Crores textile industry out of which Rs 45754 crores is exports. Approx. 20 Million acres of cotton provides ...

Ergonomic Evaluation of Battery Powered Portable Cotton Picker

Science.gov (United States)

Dixit, A.; Manes, G. S.; Singh, A.; Prakash, A.; Mahal, J. S.

2012-09-01

Ergonomic evaluation of battery powered portable manual cotton picker was carried out on two subjects for three cotton varieties and was compared against manual method of picking. It is a hand operated machine and has a pair of chain with small sharp edged teeth and sprockets and is operated by a light weight 12 V battery. Cotton gets entangled with the chain and is collected and guided into the collection bag. Average heart rate, oxygen consumption, workload, energy expenditure was more in case of cotton picking by manual cotton picker as compared to manual picking for both the subjects for all three cotton variety types. Oxygen consumption varied from 0.81 to 0.97 l/min, workload varied from 36.32 to 46.16 W and energy expenditure varied from 16.83 to 20.33 kJ/min for both the subject in case of machine picking for all three cotton varieties. The maximum discomfort experienced by the subjects during picking cotton by manual cotton picker was in right wrist palm, right forearm, upper and lower back, left shoulder and in lower legs and both feet.

7 CFR 1427.1203 - Eligible ELS cotton.

Science.gov (United States)

2010-01-01

... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton... must be either: (1) Baled lint, including baled lint classified by USDA's Agricultural Marketing..., under the provisions of this subpart, has been made available; (2) Imported ELS cotton; (3) Raw...

Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

Directory of Open Access Journals (Sweden)

Zainul A Khan

Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

Science.gov (United States)

Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

Energy usage for cotton ginning in Australia

Energy Technology Data Exchange (ETDEWEB)

Ismail, S.A. [MARA Univ. of Technology, Shah Alam (Malaysia). Faculty of Applied Sciences; Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture; Chen, G.; Baillie, C.; Symes, T. [Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture

2010-07-01

This paper reported on a study that evaluated the energy consumption of cotton gins used in Australia. The average electricity use is 52.3 kWh per bale. In practicality, the electricity consumption for different gins is correlated linearly with the bale numbers produced. The cost of electricity is therefore important in cotton ginning operations. The power factor in all the gins monitored in this study was greater than 0.85. The study showed that the use of gas dryers was highly influenced by the cotton moisture and regulated drying temperature. In general, electricity and gas consumption comprised 61 and 39 per cent of total energy use respectively. The study showed that 60.38 kg of carbon dioxide are emitted for ginning each bale of cotton. This paper described a newly developed method for monitoring the energy performance in cotton gins. Detailed monitoring and analysis carried out at 2 gin sites revealed that electricity consumption is not influenced much by changes in trash content in the module, degree of moisture and lint quality. However, the cotton variety influences the energy consumption. Cotton handling constituted nearly 50 per cent of the power used in both gins.

Association of Dermatological Conditions of External Ear with the Use of Cotton Buds

Directory of Open Access Journals (Sweden)

Salahuddin Ahmed

2014-09-01

Full Text Available Background: The habit of cleaning the external auditory canal with cotton buds is a common practice of the masses. It has strong association with neurodermatitis and contact dermatitis of the external ear. It is also associated with acute otitis externa, rupture of tympanic membrane causing bleeding and temporary hearing loss in some cases. In many cases the injury will heal but damage to minuscule bones deep inside the ear can cause permanent deafness. Objective: The objective of this study was to determine the association of dermatological condition of external ear with the use of cotton buds. Materials and Methods: This case control study was done from January to October 2012 in the Ear Nose Throat Department of Pakistan Level III Hospital, Darfur, Sudan. Sixty seven patients with dermatological diseases of external ear were cases and 83 subjects without dermatological diseases of external ear were selected as controls. Results: Among 67 cases, 58 were cotton bud users and among 83 controls only 29 were cotton bud users. Different types of dermatological diseases were neurodermatitis (34.32%, otitis externa (28.36%, contact dermatitis (26.87% and wax impaction (8.95%. Ninety three percent of cotton bud users were ignorant of harmful effects of this bad habit. Conclusion: There is a strong association of dermatological diseases of external ear with the use of cotton bud which should be discouraged by fortifying the warning by manufacturers and health education at various educational levels.

[Effects of cotton stalk biochar on microbial community structure and function of continuous cropping cotton rhizosphere soil in Xinjiang, China].

Science.gov (United States)

Gu, Mei-ying; Tang, Guang-mu; Liu, Hong-liang; Li, Zhi-qiang; Liu, Xiao-wei; Xu, Wan-li

2016-01-01

In this study, field trials were conducted to examine the effects of cotton stalk biochar on microbial population, function and structural diversity of microorganisms in rhizosphere soil of continuous cotton cropping field in Xinjiang by plate count, Biolog and DGGE methods. The experiment was a factorial design with four treatments: 1) normal fertilization with cotton stalk removed (NPK); 2) normal fertilization with cotton stalk powdered and returned to field (NPKS); 3) normal fertilization plus cotton stalk biochar at 22.50 t · hm⁻² (NPKB₁); and 4) normal fertilization plus cotton stalk biochar at 45.00 t · hm⁻² (NPKB₂). The results showed that cotton stalk biochar application obviously increased the numbers of bacteria and actinomycetes in the rhizospheric soil. Compared with NPK treatment, the number of fungi was significantly increased in the NPKB₁treatment, but not in the NPKB₂ treatment. However, the number of fungi was generally lower in the biochar amended (NPKB₁, NPKB₂) than in the cotton stalk applied plots (NPKS). Application of cotton stalk biochar increased values of AWCD, and significantly improved microbial richness index, suggesting that the microbial ability of utilizing carbohydrates, amino acids and carboxylic acids, especially phenolic acids was enhanced. The number of DGGE bands of NPKB₂ treatment was the greatest, with some species of Gemmatimonadetes, Acidobacteria, Proteobacteria and Actinobacteria being enriched. UPGMC Cluster analysis pointed out that bacterial communities in the rhizospheric soil of NPKB₂ treatment were different from those in the NPK, NPKS and NPKB₁treatments, which belonged to the same cluster. These results indicated that application of cotton stalk biochar could significantly increase microbial diversity and change soil bacterial community structure in the cotton rhizosphere soil, thus improving the health of soil ecosystem.

Expression of transgenes targeted to the Gt(ROSA26Sor locus is orientation dependent.

Directory of Open Access Journals (Sweden)

Douglas Strathdee

2006-12-01

Full Text Available Targeting transgenes to a chosen location in the genome has a number of advantages. A single copy of the DNA construct can be inserted by targeting into regions of chromatin that allow the desired developmental and tissue-specific expression of the transgene.In order to develop a reliable system for reproducibly expressing transgenes it was decided to insert constructs at the Gt(ROSA26Sor locus. A cytomegalovirus (CMV promoter was used to drive expression of the Tetracycline (tet transcriptional activator, rtTA2(s-M2, and test the effectiveness of using the ROSA26 locus to allow transgene expression. The tet operator construct was inserted into one allele of ROSA26 and a tet responder construct controlling expression of EGFP was inserted into the other allele.Expression of the targeted transgenes was shown to be affected by both the presence of selectable marker cassettes and by the orientation of the transgenes with respect to the endogenous ROSA26 promoter. These results suggest that transcriptional interference from the endogenous gene promoter or from promoters in the selectable marker cassettes may be affecting transgene expression at the locus. Additionally we have been able to determine the optimal orientation for transgene expression at the ROSA26 locus.

Artificial neural nets application in the cotton yarn industry

Directory of Open Access Journals (Sweden)

Gilberto Clóvis Antoneli

2016-06-01

Full Text Available The competitiveness in the yarn production sector has led companies to search for solutions to attain quality yarn at a low cost. Today, the difference between them, and thus the sector, is in the raw material, meaning processed cotton and its characteristics. There are many types of cotton with different characteristics due to its production region, harvest, storage and transportation. Yarn industries work with cotton mixtures, which makes it difficult to determine the quality of the yarn produced from the characteristics of the processed fibers. This study uses data from a conventional spinning, from a raw material made of 100% cotton, and presents a solution with artificial neural nets that determine the thread quality information, using the fibers’ characteristics values and settings of some process adjustments. In this solution a neural net of the type MultiLayer Perceptron with 11 entry neurons (8 characteristics of the fiber and 3 process adjustments, 7 output neurons (yarn quality and two types of training, Back propagation and Conjugate gradient descent. The selection and organization of the production data of the yarn industry of the cocamar® indústria de fios company are described, to apply the artificial neural nets developed. In the application of neural nets to determine yarn quality, one concludes that, although the ideal precision of absolute values is lacking, the presented solution represents an excellent tool to define yarn quality variations when modifying the raw material composition. The developed system enables a simulation to define the raw material percentage mixture to be processed in the plant using the information from the stocked cotton packs, thus obtaining a mixture that maintains the stability of the entire productive process.

Influence of Tencel/cotton blends on knitted fabric performance

Directory of Open Access Journals (Sweden)

Alaa Arafa Badr

2016-09-01

Full Text Available The requirements in terms of wearing comfort with sportswear, underwear and outerwear are widely linked to the use of new fibers. Today, Tencel fiber is one of the most important developments in regenerated cellulosic fiber. However, the relation between Tencel fiber properties and fabric characteristics has not been enough studied in the literature especially the influence of fiber materials on mechanical, Ultraviolet Protection Factor (UPF and absorption properties. Therefore, in this study, knitted fabric samples were manufactured with eight different yarns with two fabric types (single jersey and single jersey with Lycra. 30/1-Ne yarns from natural and regenerated cellulosic fibers: 50% Tencel-LF/50% cotton, 67% Tencel-LF/33% cotton, 67% Tencel-STD/33% cotton, 70% bamboo/30% cotton, 100% bamboo, 100% Modal, 100% Micro-Modal and 100% cotton were employed. Then, all the produced fabrics were subjected to five cycles laundering and then flat dried. The results show that 67% Tencel-LF/33% cotton has more flexural rigidity and withdrawing handle force than 67% Tencel-STD/33% cotton fabric, while 67% Tencel-STD/33% cotton has a merit of durability during bursting test. Blending Egyptian cotton fibers with bamboo and Tencel as in 70/30% bamboo/cotton and 50/50% Tencel-LF/cotton improve UPF of the produced fabric.

Semiochemicals from herbivory induced cotton plants enhance the foraging behavior of the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Magalhães, D M; Borges, M; Laumann, R A; Sujii, E R; Mayon, P; Caulfield, J C; Midega, C A O; Khan, Z R; Pickett, J A; Birkett, M A; Blassioli-Moraes, M C

2012-12-01

The boll weevil, Anthonomus grandis, has been monitored through deployment of traps baited with aggregation pheromone components. However, field studies have shown that the number of insects caught in these traps is significantly reduced during cotton squaring, suggesting that volatiles produced by plants at this phenological stage may be involved in attraction. Here, we evaluated the chemical profile of volatile organic compounds (VOCs) emitted by undamaged or damaged cotton plants at different phenological stages, under different infestation conditions, and determined the attractiveness of these VOCs to adults of A. grandis. In addition, we investigated whether or not VOCs released by cotton plants enhanced the attractiveness of the aggregation pheromone emitted by male boll weevils. Behavioral responses of A. grandis to VOCs from conspecific-damaged, heterospecific-damaged (Spodoptera frugiperda and Euschistus heros) and undamaged cotton plants, at different phenological stages, were assessed in Y-tube olfactometers. The results showed that volatiles emitted from reproductive cotton plants damaged by conspecifics were attractive to adults boll weevils, whereas volatiles induced by heterospecific herbivores were not as attractive. Additionally, addition of boll weevil-induced volatiles from reproductive cotton plants to aggregation pheromone gave increased attraction, relative to the pheromone alone. The VOC profiles of undamaged and mechanically damaged cotton plants, in both phenological stages, were not different. Chemical analysis showed that cotton plants produced qualitatively similar volatile profiles regardless of damage type, but the quantities produced differed according to the plant's phenological stage and the herbivore species. Notably, vegetative cotton plants released higher amounts of VOCs compared to reproductive plants. At both stages, the highest rate of VOC release was observed in A. grandis-damaged plants. Results show that A. grandis uses

Computer-based irrigation scheduling for cotton crop

International Nuclear Information System (INIS)

Laghari, K.Q.; Memon, H.M.

2008-01-01

In this study a real time irrigation schedule for cotton crop has been tested using mehran model, a computer-based DDS (Decision Support System). The irrigation schedule was set on selected MAD (Management Allowable Depletion) and the current root depth position. The total 451 mm irrigation water applied to the crop field. The seasonal computed crop ET (Evapotranspiration) was estimated 421.32 mm and actual (ET/sub ca/) observed was 413 mm. The model over-estimated seasonal ET by only 1.94. WUE (Water Use Efficiency) for seed-cotton achieved 6.59 Kg (ha mm)/sup -1/. The statistical analysis (R/sup 2/=0.96, ARE%=2.00, T-1.17 and F=550.57) showed good performance of the model in simulated and observed ET values. The designed Mehran model is designed quite versatile for irrigation scheduling and can be successfully used as irrigation DSS tool for various crop types. (author)

Superhydrophobic cotton by fluorosilane modification

CSIR Research Space (South Africa)

Erasmus, E

2009-12-01

Full Text Available the treatment with fluorinated or silicon compounds)1-4 and by enhancing the surface roughness with a fractal structure5-8. Cotton, a cellulose-based material, that is greatly hydrophilic, is more benefited when made hydrophobic. Modification of cotton...

Restoration of spermatogenesis and male fertility using an androgen receptor transgene.

Directory of Open Access Journals (Sweden)

William H Walker

Full Text Available Androgens signal through the androgen receptor (AR to regulate male secondary sexual characteristics, reproductive tract development, prostate function, sperm production, bone and muscle mass as well as body hair growth among other functions. We developed a transgenic mouse model in which endogenous AR expression was replaced by a functionally modified AR transgene. A bacterial artificial chromosome (BAC was constructed containing all AR exons and introns plus 40 kb each of 5' and 3' regulatory sequence. Insertion of an internal ribosome entry site and the EGFP gene 3' to AR allowed co-expression of AR and EGFP. Pronuclear injection of the BAC resulted in six founder mice that displayed EGFP production in appropriate AR expressing tissues. The six founder mice were mated into a Sertoli cell specific AR knockout (SCARKO background in which spermatogenesis is blocked at the meiosis stage of germ cell development. The AR-EGFP transgene was expressed in a cyclical manner similar to that of endogenous AR in Sertoli cells and fertility was restored as offspring were produced in the absence of Sertoli cell AR. Thus, the AR-EGFP transgene under the control of AR regulatory elements is capable of rescuing AR function in a cell selective, AR-null background. These initial studies provide proof of principle that a strategy employing the AR-EGFP transgene can be used to understand AR functions. Transgenic mice expressing selective modifications of the AR-EGFP transgene may provide crucial information needed to elicit the molecular mechanisms by which AR acts in the testis and other androgen responsive tissues.

Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

Science.gov (United States)

The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

Cotton fiber quality determined by fruit position, temperature and management

OpenAIRE

Wang, X.; Evers, J.B.; Zhang, L.; Mao, L.; Pan, X.; Li, Z.

2013-01-01

CottonXL is a tool to explore cotton fiber quality in relation to fruit position, to improve cotton quality by optimizing cotton plant structure, as well as to help farmers understand how the structure of the cotton plant determines crop growth and quality.

The merging of two dynasties--identification of an African cotton leaf curl disease-associated begomovirus with cotton in Pakistan.

Directory of Open Access Journals (Sweden)

Muhammad Nouman Tahir

Full Text Available Cotton leaf curl disease (CLCuD is a severe disease of cotton that occurs in Africa and Pakistan/northwestern India. The disease is caused by begomoviruses in association with specific betasatellites that differ between Africa and Asia. During survey of symptomatic cotton in Sindh (southern Pakistan Cotton leaf curl Gezira virus (CLCuGV, the begomovirus associated with CLCuD in Africa, was identified. However, the cognate African betasatellite (Cotton leaf curl Gezira betasatellite was not found. Instead, two Asian betasatellites, the CLCuD-associated Cotton leaf curl Multan betasatellite (CLCuMB and Chilli leaf curl betasatellite (ChLCB were identified. Inoculation of the experimental plant species Nicotiana benthamiana showed that CLCuGV was competent to maintain both CLCuMB and ChLCB. Interestingly, the enations typical of CLCuD were only induced by CLCuGV in the presence of CLCuMB. Also in infections involving both CLCuMB and ChLCB the enations typical of CLCuMB were less evident. This is the first time an African begomovirus has been identified on the Indian sub-continent, highlight the growing threat of begomoviruses and particularly the threat of CLCuD causing viruses to cotton cultivation in the rest of the world.

The signal peptide-like segment of hpaXm is required for its association to the cell wall in transgenic tobacco plants.

Science.gov (United States)

Li, Le; Miao, Weiguo; Liu, Wenbo; Zhang, Shujian

2017-01-01

Harpins, encoded by hrp (hypersensitive response and pathogenicity) genes of Gram-negative plant pathogens, are elicitors of hypersensitive response (HR). HpaXm is a novel harpin-like protein described from cotton leaf blight bacteria, Xanthomonas citri subsp. malvacearum-a synonym of X. campestris pv. malvacearum (Smith 1901-1978). A putative signal peptide (1-MNSLNTQIGANSSFL-15) of hpaXm was predicted in the nitroxyl-terminal (N-terminal)by SignalP (SignalP 3.0 server). Here, we explored the function of the N-terminal leader peptide like segment of hpaXm using transgenic tobacco (Nicotiana tabacum cv. Xanthi nc.). Transgenic tobacco lines expressing the full-length hpaXm and the signal peptide-like segment-deleted mutant hpaXmΔLP were developed using transformation mediated by Agrobacterium tumefaciens. The target genes were confirmed integrated into the tobacco genomes and expressed normally. Using immune colloidal-gold detection technique, hpaXm protein was found to be transferred to the cytoplasm, the cell membrane, and organelles such as chloroplasts, mitochondria, and nucleus, as well as the cell wall. However, the deletion mutant hpaXmΔLP expressed in transgenic tobacco was found unable to cross the membrane to reach the cell wall. Additionally, soluble proteins extracted from plants transformed with hpaXm and hpaXmΔLP were bio-active. Defensive micro-HR induced by the transgene expression of hpaXm and hpaXmΔLP were observed on transgenic tobacco leaves. Disease resistance bioassays to tobacco mosaic virus (TMV) showed that tobacco plants transformed with hpaXm and with hpaXmΔLP exhibited enhanced resistance to TMV. In summary, the N-terminal signal peptide-like segment (1-45 bp) in hpaXm sequence is not necessary for transgene expression, bioactivity of hpaXm and resistance to TMV in transgenic tobacco, but is required for the protein to be translocated to the cell wall.

Microbial contamination of water-soaked cotton gauze and its cause.

Science.gov (United States)

Oie, S; Yoshida, H; Kamiya, A

2001-01-01

Seven in-use cotton gauze samples and three cotton balls soaked in sterile distilled water in canisters were investigated 7 days after they were prepared in hospital. All samples were contaminated with bacteria including 10(6) to 10(7) colony forming units/ml of Pseudomonas aeruginosa. In vitro viability tests using cotton gauze and cotton balls soaked in sterile distilled water revealed rapid proliferation of P. aeruginosa, Serratia marcescens and Candida albicans. Since the cotton gauze and the cotton balls were soaked in water containing nutrients, such as protein and glucose, these materials may be readily contaminated with bacteria including P. aeruginosa. Thus, when using cotton gauze and cotton balls containing water, microbial contamination should be expected.

Efficient transformation and regeneration of transgenic cassava using the neomycin phosphotransferase gene as aminoglycoside resistance marker gene.

Science.gov (United States)

Niklaus, Michael; Gruissem, Wilhelm; Vanderschuren, Hervé

2011-01-01

Cassava is one of the most important crops in the tropics. Its industrial use for starch and biofuel production is also increasing its importance for agricultural production in tropical countries. In the last decade cassava biotechnology has emerged as a valuable alternative to the breeding constraints of this highly heterozygous crop for improved trait development of cassava germplasm. Cassava transformation remains difficult and time-consuming because of limitations in selecting transgenic tissues and regeneration of transgenic plantlets. We have recently reported an efficient and robust cassava transformation protocol using the hygromycin phosphotransferase II (hptII) gene as selection marker and the aminoglycoside hygromycin at optimal concentrations to maximize the regeneration of transgenic plantlets. In the present work, we expanded the transformation protocol to the use of the neomycin phosphotransferase II (nptII) gene as selection marker. Several aminoglycosides compatible with the use of nptII were tested and optimal concentrations for cassava transformation were determined. Given its efficiency equivalent to hptII as selection marker with the described protocol, the use of nptII opens new possibilities to engineer transgenic cassava lines with multiple T-DNA insertions and to produce transgenic cassava with a resistance marker gene that is already deregulated in several commercial transgenic crops.

Fabrication of boronate-decorated polyhedral oligomeric silsesquioxanes grafted cotton fiber for the selective enrichment of nucleosides in urine.

Science.gov (United States)

Gao, Li; Wei, Yinmao

2016-06-01

Various cotton fiber based boronate-affinity adsorbents are recently developed for the sample pretreatment of cis-diol-containing biomolecules, but most do not have efficient capacity due to limited binding sites on the surface of cotton fibers. To increase the density of boronate groups on the surface of cotton fiber, polyhedral oligomeric silsesquioxanes were used to modify cotton fiber to provide plentiful reactive sites for subsequent functionalization with 4-formylphenylboronic acid. The new adsorbent showed special recognition ability towards cis-diols and high adsorption capacity (175 μg/g for catechol, 250 μg/g for dopamine, 400 μg/g for adenosine). The in-pipette-tip solid-phase extraction was investigated under different conditions, including pH and ionic strength of solution, adsorbent amount, pipette times, washing solvent, and elution solvent. The in-pipette-tip solid-phase extraction coupled with high-performance liquid chromatography was used to analyze four nucleosides in urine samples. Under the optimal extraction conditions, the detection limits were determined to be between 5.1 and 6.1 ng/mL (S/N  =  3), and the linearity ranged from 20 to 500 ng/mL for these analytes. The accuracy of the analytical method was examined by studying the relative recoveries of analytes in real urine samples with recoveries varying from 83 to 104% (RSD = 3.9-10.2%, n = 3). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Radiation synthesis of silver nanostructures in cotton matrix

International Nuclear Information System (INIS)

Chmielewska, Dagmara; Sartowska, Bożena

2012-01-01

Cotton is one of the most popular natural fibres, composed mainly of cellulose, which finds a wide range of applications in paper, textile and health care products industry. Researchers have focused their interest on the synthesis of cotton nanocomposites, which enhances its mechanical, thermal and antimicrobial properties by the incorporation of various nanoparticles into the cotton matrix. Silver is one of the most popular antimicrobial agents with a wide spectrum of antibacterial and antifungal activity that results from a complex mechanism of its interactions with the cells of harmful microorganism. In this work, electron beam radiation was applied to synthesise silver nanostructures in cotton fibres. Investigations of the influence of the initial silver salt concentration on the size and distribution of the obtained silver nanostructures were carried out. A detailed characterisation of these nanocomposites with SEM-BSE and EDS methods was performed. TGA and DSC analyses were performed to assess the influence of different size silver nanoparticles and the effect of electron beam irradiation on the thermal properties of cotton fibres. A microbiological investigation to determine the antibacterial activity of Ag-cotton nanocomposites was carried out. - Highlights: ► Ag NPs embedded in cotton matrix were synthesised by electron beam irradiation. ► Concentration of silver salt solution influences on size of silver nanoparticles. ► Silver content as well as irradiation affect thermal properties of cotton fabrics. ► Ag-cotton nanocomposites exhibit antibacterial activity against bacteria and fungi.

(Pleurotus pulmonarius) grown on cotton waste and cassava peel

African Journals Online (AJOL)

This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

Site specific N application and remote sensing of cotton crop

Science.gov (United States)

A spatial variable nitrogen (N) rate trial and remote sensing of cotton crop was conducted during 2003 at Paul Good Farms, Mississippi, USA. The N rate trial consisted of three, 8-row transects at the east and west side of the field that were selected to represent variable soil and elevation feature...

Acoustical evaluation of carbonized and activated cotton nonwovens.

Science.gov (United States)

Jiang, N; Chen, J Y; Parikh, D V

2009-12-01

An activated carbon fiber nonwoven (ACF) was manufactured from a cotton nonwoven fabric. For the ACF acoustic application, a nonwoven composite of ACF with cotton nonwoven as a base layer was developed. Also produced were the composites of the cotton nonwoven base layer with a layer of glassfiber nonwoven, and the cotton nonwoven base layer with a layer of cotton fiber nonwoven. Their noise absorption coefficients and sound transmission loss were measured using the Brüel and Kjaer impedance tube instrument. Statistical significance of the differences between the composites was tested using the method of Duncan's grouping. The study concluded that the ACF composite exhibited a greater ability to absorb normal incidence sound waves than the composites with either glassfiber or cotton fiber. The analysis of sound transmission loss revealed that the three composites still obeyed the mass law of transmission loss. The composite with the surface layer of cotton fiber nonwoven possessed a higher fabric density and therefore showed a better sound insulation than the composites with glassfiber and ACF.

Transcriptome analysis of cytoplasmic male sterility and restoration in CMS-D8 cotton.

Science.gov (United States)

Suzuki, Hideaki; Rodriguez-Uribe, Laura; Xu, Jiannong; Zhang, Jinfa

2013-10-01

A global view of differential expression of genes in CMS-D8 of cotton was presented in this study which will facilitate the understanding of cytoplasmic male sterility in cotton. Cytoplasmic male sterility (CMS) is a maternally inherited trait in higher plants which is incapable of producing functional pollen. However, the male fertility can be restored by one or more nuclear-encoded restorer genes. A genome-wide transcriptome analysis of CMS and restoration in cotton is currently lacking. In this study, Affymetrix GeneChips© Cotton Genome Array containing 24,132 transcripts was used to compare differentially expressed (DE) genes of flower buds at the meiosis stage between CMS and its restorer cotton plants conditioned by the D8 cytoplasm. A total of 458 (1.9 %) of DE genes including 127 up-regulated and 331 down-regulated ones were identified in the CMS-D8 line. Quantitative RT-PCR was used to validate 10 DE genes selected from seven functional categories. The most frequent DE gene group was found to encode putative proteins involved in cell wall expansion, such as pectinesterase, pectate lyase, pectin methylesterase, glyoxal oxidase, polygalacturonase, indole-3-acetic acid-amino synthetase, and xyloglucan endo-transglycosylase. Genes in cytoskeleton category including actin, which plays a key role in cell wall expansion, cell elongation and cell division, were also highly differentially expressed between the fertile and CMS plants. This work represents the first study in utilizing microarray to identify CMS-related genes by comparing overall DE genes between fertile and CMS plants in cotton. The results provide evidence that many CMS-associated genes are mainly involved in cell wall expansion. Further analysis will be required to elucidate the molecular mechanisms of male sterility which will facilitate the development of new hybrid cultivars in cotton.

The economic impact and the distribution of benefits and risk from the adoption of insect resistant (Bt) cotton in West Africa:

OpenAIRE

Falck-Zepeda, Jose; Horna, Daniela; Smale, Melinda

2007-01-01

"Cotton is the largest source of export receipts of several West African countries. Statistics however show a decreasing tendency in cotton yields and an increasing tendency in pesticide use. Under this circumstances there appear to be potential payoffs from the use of biotechnology products in the farming systems of the region. In this study we estimate different scenarios for the potential deployment of insect resistant cotton in selected countries in West Africa (WA). We use an economic su...

Using cotton plant residue to produce briquettes

Energy Technology Data Exchange (ETDEWEB)

Coates, W. [University of Arizona, Tucson, AZ (United States). Bioresources Research Facility

2000-07-01

In Arizona, cotton (Gossypium) plant residue left in the field following harvest must be buried to prevent it from serving as an overwintering site for insects such as the pink bollworm. Most tillage operations employed to incorporate the residue into the soil are energy intensive and often degrade soil structure. Trials showed that cotton plant residue could be incorporated with pecan shells to produce commercially acceptable briquettes. Pecan shell briquettes containing cotton residue rather than waste paper were slightly less durable, when made using equivalent weight mixtures and moisture contents. Proximate and ultimate analyses showed the only difference among briquette samples to be a higher ash content in those made using cotton plant residue. Briquettes made with paper demonstrated longer flame out time, and lower ash percentage, compared to those made with cotton plant residue. (author)

7 CFR 27.21 - Preparation of samples of cotton.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...

STIFFNESS MODIFICATION OF COTTON IN CHITOSAN TREATMENT

Directory of Open Access Journals (Sweden)

CAMPOS Juan

2017-05-01

Full Text Available Chitosan is a biopolymer obtained from chitin, and among their most important aspects highlights its applications in a lot of industrial sectors due to its intrinsic properties, especially in the textile sector. In the last years, chitosan is widely used in the cotton and wool finishing processes due to its bond between them and its properties as an antifungical and antimicrobial properties. In this paper three different molecular weight chitosan are used in the finishing process of cotton to evaluate its influence in the surface properties modification. In order to evaluate the effect of the treatment with chitosan, flexural stiffness test is performed in warp and weft direction, and then the total value is calculated. The cotton fabric is treated with 5 g/L of different types of chitosan in an impregnation bath. This study shows the extent of surface properties modification of the cotton provided by three types of chitosan treatment. The results show that all types of chitosan modify the cotton flexural rigidity properties but the one which modifies it in a relevant manner is chitosan originated from shrimps. Chitosan, textile, flexural stiffnes, chitin, cotton.

Genome-wide analysis of the HD-ZIP IV transcription factor family in Gossypium arboreum and GaHDG11 involved in osmotic tolerance in transgenic Arabidopsis.

Science.gov (United States)

Chen, Eryong; Zhang, Xueyan; Yang, Zhaoen; Wang, Xiaoqian; Yang, Zuoren; Zhang, Chaojun; Wu, Zhixia; Kong, Depei; Liu, Zhao; Zhao, Ge; Butt, Hamama Islam; Zhang, Xianlong; Li, Fuguang

2017-06-01

HD-ZIP IV proteins belong to the homeodomain-leucine zipper (HD-ZIP) transcription factor family and are involved in trichome development and drought stress in plants. Although some functions of the HD-ZIP IV group are well understood in Arabidopsis, little is known about their function in cotton. In this study, HD-ZIP genes were identified from three Gossypium species (G. arboreum, G. raimondii and G. hirsutum) and clustered into four families (HD-ZIP I, II, III and IV) to separate HD-ZIP IV from the other three families. Systematic analyses of phylogeny, gene structure, conserved domains, and expression profiles in different plant tissues and the expression patterns under osmotic stress in leaves were further conducted in G. arboreum. More importantly, ectopic overexpression of GaHDG11, a representative of the HD-ZIP IV family, confers enhanced osmotic tolerance in transgenic Arabidopsis plants, possibly due to elongated primary root length, lower water loss rates, high osmoprotectant proline levels, significant levels of antioxidants CAT, and/or SOD enzyme activity with reduced levels of MDA. Taken together, these observations may lay the foundation for future functional analysis of cotton HD-ZIP IV genes to unravel their biological roles in cotton.

Preparation and characterization of regenerated cellulose membranes from natural cotton fiber

Directory of Open Access Journals (Sweden)

Yanjuan CAO

2015-06-01

Full Text Available A series of organic solutions with different cellulose concentrations are prepared by dissolving natural cotton fibers in lithium chloride/dimethyl acetamide (LiCl/DMAC solvent system after the activation of cotton fibers. Under different coagulating bath, the regenerated cellulose membranes are formed in two kinds of coagulation baths, and two coating methods including high-speed spin technique (KW-4A spin coating machine and low-speed scraping (AFA-Ⅱ Film Applicator are selected in this paper. The macromolecular structure, mechanical properties, crystallinity, thermal stability and wetting property of the regenerated cellulose membrane are characterized by Scanning Electron Microscope(SEM, Fourier Transform Infrared Spectroscopy (FT-IR,X-ray diffraction (XRD, Thermogravimetric analysis (TG and contacting angle tester. The effects of mass fraction, coagulation bath type, membrane forming process on the regenerated membrane properties are investigated. Experimental results show that the performance of regenerated cellulose membrane is relatively excellent under the condition of using the KW-4A high-speed spin method, water coagulation bath, and when mass fraction of cellulose is 3.5%. The crystallinity of the regenerated cellulose membrane changes a lot compared with natural cotton fibers. The variation trend of thermal stability is similar with that of cotton fiber. But thermal stability is reduced to some degree, while the wetting ability is improved obviously.

Survival and preference of cotton boll weevil adults for alternative food sources

Directory of Open Access Journals (Sweden)

M. Pimenta

Full Text Available Abstract Plants that have potential as alternative food source (floral nectar, pollen and plant tissues to the boll weevil during the intercropping season were evaluated considering the prevalent conditions of Cerrado in the Central Brazil. Initially, we tested the nutritional adequacy for the survival of the insect of flower resource (pollen and nectar provided by eight plant species (fennel, mexican sunflower, castor bean, okra, hibiscus, sorghum, pigeonpea and sunn hemp. Subsequently, we tested if the resources provided by the selected plants continued to be exploited by the boll weevil in the presence of cotton plant, its main food source average longevity of boll weevil adults was significantly longer when they were fed on hibiscus’ flowers (166.6 ± 74.4 and okra flowers (34.7 ± 28.9 than when they fed on flowers of other six species. Subsequently, the preference of the boll weevil in the use of resources was compared between okra or hibiscus and cotton plants, in dual choice experiments. Boll weevils preferred plants of the three species in the reproductive stages than those in vegetative stages. Although the cotton plant in the reproductive stage was the most preferred plant of all, boll weevils preferred flowering okra and hibiscus than cotton at the vegetative stage.

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

Candidate Gene Identification of Flowering Time Genes in Cotton

Directory of Open Access Journals (Sweden)

Corrinne E. Grover

2015-07-01

Full Text Available Flowering time control is critically important to all sexually reproducing angiosperms in both natural ecological and agronomic settings. Accordingly, there is much interest in defining the genes involved in the complex flowering-time network and how these respond to natural and artificial selection, the latter often entailing transitions in day-length responses. Here we describe a candidate gene analysis in the cotton genus , which uses homologs from the well-described flowering network to bioinformatically and phylogenetically identify orthologs in the published genome sequence from Ulbr., one of the two model diploid progenitors of the commercially important allopolyploid cottons, L. and L. Presence and patterns of expression were evaluated from 13 aboveground tissues related to flowering for each of the candidate genes using allopolyploid as a model. Furthermore, we use a comparative context to determine copy number variability of each key gene family across 10 published angiosperm genomes. Data suggest a pattern of repeated loss of duplicates following ancient whole-genome doubling events in diverse lineages. The data presented here provide a foundation for understanding both the parallel evolution of day-length neutrality in domesticated cottons and the flowering-time network, in general, in this important crop plant.

Thwarting one of cotton's nemeses

International Nuclear Information System (INIS)

Senft, D.

1991-01-01

There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system

Proteomics profiling of fiber development and domestication in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Pathak, Dharminder; Chen, Sixue; Wendel, Jonathan F

2014-12-01

Comparative proteomic analyses were performed to detail the evolutionary consequences of strong directional selection for enhanced fiber traits in modern upland cotton (Gossypium hirsutum L.). Using two complementary proteomic approaches, 2-DE and iTRAQ LC-MS/MS, fiber proteomes were examined for four representative stages of fiber development. Approximately 1,000 protein features were characterized using each strategy, collectively resulting in the identification and functional categorization of 1,223 proteins. Unequal contributions of homoeologous proteins were detected for over a third of the fiber proteome, but overall expression was balanced with respect to the genome-of-origin in the allopolyploid G. hirsutum. About 30% of the proteins were differentially expressed during fiber development within wild and domesticated cotton. Notably, domestication was accompanied by a doubling of protein developmental dynamics for the period between 10 and 20 days following pollination. Expression levels of 240 iTRAQ proteins and 293 2-DE spots were altered by domestication, collectively representing multiple cellular and metabolic processes, including metabolism, energy, protein synthesis and destination, defense and stress response. Analyses of homoeolog-specific expression indicate that duplicated gene products in cotton fibers can be differently regulated in response to selection. These results demonstrate the power of proteomics for the analysis of crop domestication and phenotypic evolution.

75 FR 50847 - Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders

Science.gov (United States)

2010-08-18

... Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders AGENCY... Assistance Program (EAAP) and clarifying the definition of ``active shipping order.'' DATES: Effective Date... address that matter this rule amends in the payment calculation for semi-processed and reginned motes in 7...

THE ELASTICITY OF EXPORT DEMAND FOR US COTTON

OpenAIRE

Paudel, Laxmi; Houston, Jack E.; Adhikari, Murali; Devkota, Nirmala

2004-01-01

There exist conflicting views among the researchers about the magnitudes of US cotton export demand elasticity, ranging from the highly inelastic to highly elastic. An Armington model was used to analyze the export demand elasticity of US Cotton. Our analysis confirms an elastic nature of US cotton export demand.

7 CFR 1427.23 - Cotton loan deficiency payments.

Science.gov (United States)

2010-01-01

..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan... intentions to receive a loan deficiency payment on the identified commodity or (ii) A completed request for a... cotton based on a locked-in adjusted world price, provide identifying numbers for modules or other...

Fourier transform infrared imaging of Cotton trash mixtures

Science.gov (United States)

There is much interest in the identification of trash types comingled with cotton lint. A good understanding of the specific trash types present can lead to the fabrication of new equipment which can identify and sort cotton trash found with cotton fiber. Conventional methods, including the High Vo...

Gene cloning: exploring cotton functional genomics and genetic improvement

Institute of Scientific and Technical Information of China (English)

Diqiu LIU; Xianlong ZHANG

2008-01-01

Cotton is the most important natural fiber plant in the world. The genetic improvement of the quality of the cotton fiber and agricultural productivity is imperative under the situation of increasing consumption and rapid development of textile technology. Recently, the study of cotton molecular biology has progressed greatly. A lot of specifically or preferentially expressed cotton fiber genes were cloned and analyzed. On the other hand, identification of stress response genes expressed in cotton was performed by other research groups. The major stress factors were studied including the wilt pathogens Verticillium dahliae, Fusarium oxy-sporum f. sp. vasinfectum, bacterial blight, root-knot nematode, drought, and salt stress. What is more, a few genes related to the biosynthesis of gossypol, other sesquiterpene phytoalexins and the major seed oil fatty acids were isolated from cotton. In the present review, we focused on the major advances in cotton gene cloning and expression profiling in the recent years.

[TSA improve transgenic porcine cloned embryo development and transgene expression].

Science.gov (United States)

Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

2011-07-01

Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.

Science.gov (United States)

Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E

2016-01-01

The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants.

Transgenic oil palm: production and projection.

Science.gov (United States)

Parveez, G K; Masri, M M; Zainal, A; Majid, N A; Yunus, A M; Fadilah, H H; Rasid, O; Cheah, S C

2000-12-01

Oil palm is an important economic crop for Malaysia. Genetic engineering could be applied to produce transgenic oil palms with high value-added fatty acids and novel products to ensure the sustainability of the palm oil industry. Establishment of a reliable transformation and regeneration system is essential for genetic engineering. Biolistic was initially chosen as the method for oil palm transformation as it has been the most successful method for monocotyledons to date. Optimization of physical and biological parameters, including testing of promoters and selective agents, was carried out as a prerequisite for stable transformation. This has resulted in the successful transfer of reporter genes into oil palm and the regeneration of transgenic oil palm, thus making it possible to improve the oil palm through genetic engineering. Besides application of the Biolistics method, studies on transformation mediated by Agrobacterium and utilization of the green fluorescent protein gene as a selectable marker gene have been initiated. Upon the development of a reliable transformation system, a number of useful targets are being projected for oil palm improvement. Among these targets are high-oleate and high-stearate oils, and the production of industrial feedstock such as biodegradable plastics. The efforts in oil palm genetic engineering are thus not targeted as commodity palm oil. Due to the long life cycle of the palm and the time taken to regenerate plants in tissue culture, it is envisaged that commercial planting of transgenic palms will not occur any earlier than the year 2020.

Potential factors impacting season-long expression of Cry1Ac in 13 commercial varieties of Bollgard® cotton

Directory of Open Access Journals (Sweden)

John J. Adamczyk, Jr.

2001-11-01

Full Text Available Thirteen commercial varieties of transgenic Cry1Ac Bacillus thuringiensis Berliner (Bt cotton were examined across two sites in 2000 for potential factors that impact endotoxin expression. In all cases, two varieties (NuCOTN 33B and DP 458B/RR, Delta and Pineland Co., Scott, MS expressed more Cry1Ac than the other 11 varieties in various plant structures. These two varieties share the same parental background (DP 5415. Furthermore, when the next generation of plants were tested in the greenhouse, the same varietal patterns were exhibited. These data strongly suggest that factors such as parental background had a stronger impact on the expression of Cry1Ac than the environment.

3rd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

2nd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

1st stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

Inter-Simple Sequence Repeat (ISSR Markers to Study Genetic Diversity Among Cotton Cultivars in Associated with Salt Tolerance

Directory of Open Access Journals (Sweden)

Ali Akbar ABDI

2012-11-01

Full Text Available Developing salt-tolerant crops is very important as a significant proportion of cultivated land is salt-affected. Screening and selection of salt tolerant genotypes of cotton using DNA molecular markers not only introduce tolerant cultivars useful for hybridization and breeding programs but also detect DNA regions involved in mechanism of salinity tolerance. To study this, 28 cotton cultivars, including 8 Iranian cotton varieties were grown in pots under greenhouse condition and three salt treatments were imposed with salt solutions (0, 70 and 140 mM NaCl. Eight agronomic traits including root length, root fresh weight, root dry weight, chlorophyll and fluorescence index, K+ and Na+ contents in shoot (above ground biomass, and K+/Na+ ratio were measured. Cluster analysis of cultivars based on measured agronomic traits, showed �Cindose� and �Ciacra� as the most tolerant cultivars, and �B-557� and �43347� as the most sensitive cultivars of salt damage. A total of 65 polymorphic DNA fragments were generated at 14 inter-simple sequence repeat (ISSR loci. Plants of 28 cultivars of cotton grouped into three clusters based on ISSR markers. Regression analysis of markers in relation with traits data showed that 23, 33 and 30 markers associated with the measured traits in three salt treatments respectively. These markers might help breeders in any marker assisted selection program in order to improving cotton cultivars against salt stress.

Study of radiation induced grafting of [(methacryloylamino)-propyl] trimethyl ammonium chlorite (MPTAC) on to cotton fabrics and its application

International Nuclear Information System (INIS)

Selambakkannu, S.

2014-01-01

Quaternary ammonium salt, [(methacryloylamino)-propyl] trimethyl ammonium chlorite (MPTAC) had been used as monomer in mutual radiation grafting process on cotton fabrics with the aid of high energy gamma radiation source. The polymer chains of MPTAC were successfully grafted covalently onto cotton fabrics. Effect of selected experimental variables such as irradiation dose, monomer concentration, and ambient conditions and effect of inhibitors on extent of grafting had been analyzed. Grafting yield increases steadily with monomer concentration. The highest grafting yield obtained at 2 kGy and reduces thereafter then become almost constant at higher dose range. The grafted samples characterized for its surface morphology. Finally the grafted cotton subjected to its dye uptake capacity and antibacterial efficacy. The grafted cotton fiber was used in absorption studies of aqueous basic dye solution, namely AB74. The grafted cotton posses very good dye uptake capacity. The maximum dye uptake capacity of the grafted cotton sample was 150 mg/g. Antibacterial efficacy has been tested by qualitative and quantitative methods against model bacteria S. aureus and E. coli from gram positive and gram negative respectively. 20 % grafted cotton was found to be responsible of 2 log cycle reductions for the E.coli and S.aureus colonies. (author)

Cover Crop Biomass Harvest Influences Cotton Nitrogen Utilization and Productivity

Directory of Open Access Journals (Sweden)

F. Ducamp

2012-01-01

Full Text Available There is a potential in the southeastern US to harvest winter cover crops from cotton (Gossypium hirsutum L. fields for biofuels or animal feed use, but this could impact yields and nitrogen (N fertilizer response. An experiment was established to examine rye (Secale cereale L. residue management (RM and N rates on cotton productivity. Three RM treatments (no winter cover crop (NC, residue removed (REM and residue retained (RET and four N rates for cotton were studied. Cotton population, leaf and plant N concentration, cotton biomass and N uptake at first square, and cotton biomass production between first square and cutout were higher for RET, followed by REM and NC. However, leaf N concentration at early bloom and N concentration in the cotton biomass between first square and cutout were higher for NC, followed by REM and RET. Seed cotton yield response to N interacted with year and RM, but yields were greater with RET followed by REM both years. These results indicate that a rye cover crop can be beneficial for cotton, especially during hot and dry years. Long-term studies would be required to completely understand the effect of rye residue harvest on cotton production under conservation tillage.

Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues.

Science.gov (United States)

Viana, Antonio A B; Fragoso, Rodrigo R; Guimarães, Luciane M; Pontes, Naiara; Oliveira-Neto, Osmundo B; Artico, Sinara; Nardeli, Sarah M; Alves-Ferreira, Marcio; Batista, João A N; Silva, Maria C M; Grossi-de-Sa, Maria F

2011-11-24

Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

Leaf-level carbon isotope discrimination and its relationship with yield components as a tool for cotton phenotyping in unfavorable conditions

Directory of Open Access Journals (Sweden)

Giovani Greigh Brito

2014-07-01

Full Text Available The initial goal of this study was to measure the efficiency of carbon isotope discrimination (Δ in distinguishing between cotton plant genotypes subjected to two water regimes. In addition, ∆ measurements, leaf water potential and gas exchange ratios were monitored. Using Brazilian breeding lines, this study also tested the usability of ∆ as a proxy for selecting high-performing yield components in cotton plants grown in unfavorable conditions, particularly water deficiency. For these experiments, ∆ and yield components were measured and their correlations analyzed. Differences among cotton genotypes for Δ (p < 0.0001 were verified, and it was found that this variable was significantly correlated with gas exchange. There was a significant positive correlation between Δ and seed cotton yield only in the site experiencing severe water deficiency (Santa Helena de Goiás. However, Δ had a significant negative correlation with fiber percentage. Our results indicate that Δ is a suitable tool for cotton phenotyping, and it may be applied in cotton breeding programs that aim to produce high-performing yield components in unfavorable conditions.

Genetic variation and heritability for cotton seed, fiber and oil traits in gossypium hirsutum

International Nuclear Information System (INIS)

Khan, N.U.; Farhatullah; Batool, S.; Makhdoom, K.; Marwat, K.B.; Hassan, G.; Ahmad, W.; Khan, H.U.

2010-01-01

The research work pertaining to the study of genetic variability, heritability, genetic gain and correlation for cottonseed, fiber and cottonseed oil % in Gossypium hirsutum cultivars was conducted during 2005 at NWFP Agricultural University Peshawar, Pakistan. Analysis of variance manifested highly significant differences among the genotypes for all the traits except seeds per locule. Genetic potential range of eight cotton cultivars for different parameters was recorded i.e. seeds locule-1 (6.33 to 6.60), seeds boll-1 (26.10 to 28.47), seed index (8.61 to 9.69 g), lint index (5.35 to 6.05 g), lint % (35.17 to 38.13 %), seed cotton yield (1200 to 2450 kg ha/sup -1/) and cottonseed oil % (27.52 to 30.15%). Genetic variances were found almost greater than the environmental variances for all the traits except seeds locule-1 and seed index. High broad sense heritability and selection response were also formulated for seeds boll-1 (0.67, 0.84), seed index (0.77, 0.47 g), lint index (0.96, 0.33 g), lint % (0.96, 1.66 %), seed cotton yield (0.98, 643.16 kg) and cottonseed oil % (0.87, 1.28 %), respectively. Correlation of yield with other traits was found positive for majority of traits except seeds locule-1 and cotton seed oil %. Seed cotton yield is our ultimate goal in growing cotton besides lint %. Highest seed cotton yield was recorded in CIM-499 followed by CIM-473, CIM-496 and CIM-506 and were also found as the second and third top scoring genotypes for seeds per boll, seed index, lint % and cottonseed oil %. Cultivar SLH-279 performed better for lint index, lint % and oil %. This type of correlation is rarely found and ultra desirable by the cotton breeders and a little genetic gain in seed and lint traits, and oil content is a great accomplishment. (author)

Effects of Different Densities of Cotton (Gossypium Hirsutum and Common Lambsquarter (Chenopodium Album on Some Cotton Growth Characteristics in Birjand Condition

Directory of Open Access Journals (Sweden)

M. Velayati

2011-01-01

Full Text Available Abstract Weeds are problematic plants in agroecosystems as a competitor for crops. In order to evaluate effects of cotton (Gossypium hirsutum and common lambsquarter (Chenopodium album densities on some crop growth indices, a study was conducted during 2006 in Experimental Station of Faculty of Agriculture, The University of Birjand as factorial experiment based on complete randomized block design with four replications. Three densities of cotton (6, 9 and 12 Pl.m-2 and four weed densities (0, 6, 9 and 12 Pl.m-2 were used to provide different weed interference levels. Indeed, three plots in each replication were intended to cultivation of lambsquarter alone at 6, 9 or 12 Pl.m-2. Results showed that crop growth rate (CGR of cotton was influenced by weed density, and its relative growth rate (RGR and net assimilation rate (NAR indicated a declining trend as weed density increased. Dry matter accumulation of cotton also was affected negatively by weed densities, as interference of lambsquarter at 6, 9 and 12 Pl.m-2 resulted to 35, 42 and 48 percent dry matter reduction, respectively, than weed-free treatment. Increasing of cotton density could partly compensate for negative impact of weed attendance on cotton growth. Thus, it seems higher plant densities can be used as a managing tool against weeds in cotton fields to avoid reduction of yield. Keywords: Cotton, Density, Weed, competition, Growth analysis

Transgenic approaches in potato: effects on glycoalkaloids levels

African Journals Online (AJOL)

Sayyar

2013-02-20

Feb 20, 2013 ... Tax and Vernon, 2001). The inserted transgene varies in ... regions are disfavored under selective conditions as the case in previous studies. .... human consumption at concentration >200 mg/1000 g of total tuber weight ...

21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

Science.gov (United States)

2010-04-01

... used in dry food packaging. 182.70 Section 182.70 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry food packaging that are generally recognized as safe for their intended use, within the meaning of...

Relay cropping of wheat (Triticum aestivum L.) in cotton (Gossypium hirsutum L.) improves the profitability of cotton-wheat cropping system in Punjab, Pakistan.

Science.gov (United States)

Sajjad, Aamer; Anjum, Shakeel Ahmad; Ahmad, Riaz; Waraich, Ejaz Ahmad

2018-01-01

Delayed sowing of wheat (Triticum aestivum L.) in cotton-based system reduces the productivity and profitability of the cotton-wheat cropping system. In this scenario, relay cropping of wheat in standing cotton might be a viable option to ensure the timely wheat sowing with simultaneous improvement in wheat yields and system profitability. This 2-year study (2012-2013 and 2013-2014) aimed to evaluate the influence of sowing dates and relay cropping combined with different management techniques of cotton sticks on the wheat yield, soil physical properties, and the profitability of the cotton-wheat system. The experiment consisted of five treatments viz. (S1) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, (S2) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator, (S3) sowing of wheat at the 7th of November as relay crop in standing cotton with broadcast method, (S4) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, and (S5) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator. The highest seed cotton yield was observed in the S5 treatment which was statistically similar with the S3 and S4 treatments; seed cotton yield in the S1 and S2 treatments has been the lowest in both years of experimentation. However, the S2 treatment produced substantially higher root length, biological yield, and grain yield of wheat than the other treatments. The lower soil bulk density at 0-10-cm depth was recorded in the S2 treatment which was statistically similar with the S5 treatment during both years of experimentation. The volumetric water contents, net

Rapid characterization of transgenic and non-transgenic soybean oils by chemometric methods using NIR spectroscopy

Science.gov (United States)

Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard

Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.

Influence of irrigation water types and stress levels on cotton fibre and yarn quality for different varieties

International Nuclear Information System (INIS)

Nazar, A.; Ishaq, W.

2012-01-01

Cotton fibre quality is being deteriorated day by day due to various reasons and shortage/ poor quality of irrigation water is one of the reasons for the low quality of cotton fibre. The effect of the stress of water can be seen on the fibre length, strength and elongation. All these properties of fibre have also a significant influence on yarn characteristics and thus the yarn quality is also dependent on agronomic practices including irrigation. When new varieties are evolved it becomes necessary to examine such cotton varieties keenly, so that one which reflects maximum agricultural as well as industrial benefits can be recommended. The present study was planned to explore the spinning performance of various cotton varieties under different water quality treatments and water stress levels. Cotton of four varieties (CIM-501, CIM-496, CIM-499, and NIAB-111) under different types of irrigation water (canal water and tube well water) and different water stress levels (75ET, 100ET and 125ET) were selected for this research. The effect of these treatments was investigated on cotton fibre span length, strength and fibre elongation as well as on yarn quality. The study revealed that effect of different cotton varieties, water types and water stress levels on fibre and yarn quality was highly significant. Yarn characteristics showed greater values for the canal water similarly fibre length and elongations were better for canal water. Yarn tensile properties were decreased with increase in the water stress. The overall results indicated that the cotton variety NIAB-111 performed better as compared to other varieties. It is suggested that the cotton farmers may be trained by the agri. extension staff regarding maintenance of fibre quality through cultural practices and better irrigation techniques. (author)

Weed flora, yield losses and weed control in cotton crop

OpenAIRE

Jabran, Khawar

2016-01-01

Cotton (Gossypium spp.) is the most important fiber crop of world and provides fiber, oil, and animals meals. Weeds interfere with the growth activities of cotton plants and compete with it for resources. All kinds of weeds (grasses, sedges, and broadleaves) have been noted to infest cotton crop. Weeds can cause more than 30% decrease in cotton productivity. Several methods are available for weed control in cotton. Cultural control carries significance for weed control up to a certain extent....

Increasing cotton stand establishment in soils prone to soil crusting

Science.gov (United States)

Many factors can contribute to poor cotton stand establishment, and cotton is notorious for its weak seedling vigor. Soil crusting can be a major factor hindering cotton seedling emergence in many of the cotton production regions of the US and the world. Crusting is mainly an issue in silty soils ...

7 CFR 28.107 - Original cotton standards and reserve sets.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Original cotton standards and reserve sets. 28.107... Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a) The containers of the original Universal Standards and other official cotton standards of the United...

Cotton Production in Mali: Subsidies or Sustainable Development?

Science.gov (United States)

Moore, Lindsey

2007-01-01

Current trade rules concerning cotton subsidies are intricately linked with poverty and hunger in Mali. Over half of Mali's economy and over 30 million people depend directly on cotton. It is the main cash crop and the most important source of export revenue. Cotton also plays a key role in development policies and in the fight against poverty by…

Resistance to glufosinate is proportional to phosphinothricin acetyltransferase expression and activity in LibertyLink(®) and WideStrike(®) cotton.

Science.gov (United States)

Carbonari, Caio A; Latorre, Débora O; Gomes, Giovanna L G C; Velini, Edivaldo D; Owens, Daniel K; Pan, Zhiqiang; Dayan, Franck E

2016-04-01

Insertion of the gene encoding phosphinothricin acetyltransferase (PAT) has resulted in cotton plants resistant to the herbicide glufosinate. However, the lower expression and commensurate reduction in PAT activity is a key factor in the low level of injury observed in the WideStrike(®) cotton and relatively high level of resistance observed in LibertyLink(®) cotton. LibertyLink(®) cotton cultivars are engineered for glufosinate resistance by overexpressing the bar gene that encodes phosphinothricin acetyltransferase (PAT), whereas the insect-resistant WideStrike(®) cultivars were obtained using the similar pat gene as a selectable marker. The latter cultivars carry some level of resistance to glufosinate which enticed certain farmers to select this herbicide for weed control with WideStrike(®) cotton. The potency of glufosinate on conventional FM 993, insect-resistant FM 975WS, and glufosinate-resistant IMACD 6001LL cotton cultivars was evaluated and contrasted to the relative levels of PAT expression and activity. Conventional cotton was sensitive to glufosinate. The single copy of the pat gene present in the insect-resistant cultivar resulted in very low RNA expression of the gene and undetectable PAT activity in in vitro assays. Nonetheless, the presence of this gene provided a good level of resistance to glufosinate in terms of visual injury and effect on photosynthetic electron transport. The injury is proportional to the amount of ammonia accumulation. The strong promoter associated with bar expression in the glufosinate-resistant cultivar led to high RNA expression levels and PAT activity which protected this cultivar from glufosinate injury. While the insect-resistant cultivar demonstrated a good level of resistance to glufosinate, its safety margin is lower than that of the glufosinate-resistant cultivar. Therefore, farmers should be extremely careful in using glufosinate on cultivars not expressly designed and commercialized as resistant to this

[Effects of soil wetting pattern on the soil water-thermal environment and cotton root water consumption under mulched drip irrigation].

Science.gov (United States)

Li, Dong-wei; Li, Ming-si; Liu, Dong; Lyu, Mou-chao; Jia, Yan-hui

2015-08-01

Abstract: To explore the effects of soil wetting pattern on soil water-thermal environment and water consumption of cotton root under mulched drip irrigation, a field experiment with three drip intensities (1.69, 3.46 and 6.33 L · h(-1)), was carried out in Shihezi, Xinjiang Autonomous Region. The soil matric potential, soil temperature, cotton root distribution and water consumption were measured during the growing period of cotton. The results showed that the main factor influencing the soil temperature of cotton under plastic mulch was sunlight. There was no significant difference in the soil temperature and root water uptake under different treatments. The distribution of soil matrix suction in cotton root zone under plastic mulch was more homogeneous under ' wide and shallow' soil wetting pattern (W633). Under the 'wide and shallow' soil wetting pattern, the average difference of cotton root water consumption between inner row and outer row was 0.67 mm · d(-1), which was favorable to the cotton growing trimly at both inner and outer rows; for the 'narrow and deep' soil wetting pattern (W169), the same index was 0.88 mm · d(-1), which was unfavorable to cotton growing uniformly at both inner and outer rows. So, we should select the broad-shallow type soil wetting pattern in the design of drip irrigation under mulch.

Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus

Directory of Open Access Journals (Sweden)

Schrago Carlos EG

2011-08-01

Full Text Available Abstract Background In response to infection, viral genomes are processed by Dicer-like (DCL ribonuclease proteins into viral small RNAs (vsRNAs of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV, a member of the genus Polerovirus, family Luteoviridae. Results Deep sequencing of small RNAs (sRNAs from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. Conclusions This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.

Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus.

Science.gov (United States)

Silva, Tatiane F; Romanel, Elisson A C; Andrade, Roberto R S; Farinelli, Laurent; Østerås, Magne; Deluen, Cécile; Corrêa, Régis L; Schrago, Carlos E G; Vaslin, Maite F S

2011-08-24

In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.

Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.

Science.gov (United States)

Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F

2013-10-01

Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Cotton contamination

CSIR Research Space (South Africa)

Van der Sluijs, MHJ

2018-05-01

Full Text Available This review focusses on physical forms of contaminant including the presence, prevention and/or removal of foreign bodies, stickiness and seed-coat fragments rather than the type and quantity of chemical residues that might be present in cotton...

Minimization of operational impacts on spectrophotometer color measurements for cotton

Science.gov (United States)

A key cotton quality and processing property that is gaining increasing importance is the color of the cotton. Cotton fiber in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), using the parameters Rd and +b. Rd and +b are specific to cotton fiber and are not typical ...

Screening cotton genotypes for seedling drought tolerance

Directory of Open Access Journals (Sweden)

Penna Julio C. Viglioni

1998-01-01

Full Text Available The objectives of this study were to adapt a screening method previously used to assess seedling drought tolerance in cereals for use in cotton (Gossypium hirsutum L. and to identify tolerant accessions among a wide range of genotypes. Ninety genotypes were screened in seven growth chamber experiments. Fifteen-day-old seedlings were subjected to four 4-day drought cycles, and plant survival was evaluated after each cycle. Three cycles are probably the minimum required in cotton work. Significant differences (at the 0.05 level or lower among entries were obtained in four of the seven experiments. A "confirmation test" with entries previously evaluated as "tolerant" (high survival and "susceptible" (low survival was run. A number of entries duplicated their earlier performance, but others did not, which indicates the need to reevaluate selections. Germplasms considered tolerant included: `IAC-13-1', `IAC-RM4-SM5', `Minas Sertaneja', `Acala 1517E-1' and `4521'. In general, the technique is simple, though time-consuming, with practical value for screening a large number of genotypes. Results from the screening tests generally agreed with field information. The screening procedure is suitable to select tolerant accessions from among a large number of entries in germplasm collections as a preliminary step in breeding for drought tolerance. This research also demonstrated the need to characterize the internal lack of uniformity in growth chambers to allow for adequate designs of experiments.

Recent progress on technologies and applications of transgenic ...

African Journals Online (AJOL)

USER

2010-06-14

Jun 14, 2010 ... embryo with DNA or viral vectors is possible, but this approach does not have the ... re-injecting them to cock testis is the most efficient and cost-effective strategy to .... transgenic manipulation, but also allows the selection of.

The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae as a new menace to cotton in Egypt and its chemical control

Directory of Open Access Journals (Sweden)

El-Zahi El-Zahi Saber

2016-04-01

Full Text Available The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae is a polyphagous sap sucking insect with a wide geographical and host range causing severe losses in economically important crops. This study represents the first record of P. solenopsis as a new insect attacking cotton plants (Gossypium barbadense var. Giza 86 in Kafr El-Sheikh governorate, Egypt. The insect was noticed on cotton plants for the first time during its growing season of 2014. The mealybug specimens were collected from infested cotton plants and identified as P. solenopsis. In an attempt to control this pest, eight toxic materials viz., imidacloprid, thiamethoxam, flonicamid, emamectin-benzoate, chlorpyrifos, methomyl, deltamethrin and mineral oil (KZ-oil, belonging to different chemical groups, were tested for their influence against P. solenopsis on cotton under field conditions. Methomyl, imidacloprid, thiamethoxam and chlorpyrifos showed the highest efficacy against P. solenopsis recording 92.3 to 80.4% reduction of the insect population. Flonicamid, emamectin-benzoate and KZ-oil failed to exhibit sufficient P. solenopsis control.

Contemporary evolution of a Lepidopteran species, Heliothis virescens, in response to modern agricultural practices.

Science.gov (United States)

Fritz, Megan L; DeYonke, Alexandra M; Papanicolaou, Alexie; Micinski, Stephen; Westbrook, John; Gould, Fred

2018-01-01

Adaptation to human-induced environmental change has the potential to profoundly influence the genomic architecture of affected species. This is particularly true in agricultural ecosystems, where anthropogenic selection pressure is strong. Heliothis virescens primarily feeds on cotton in its larval stages, and US populations have been declining since the widespread planting of transgenic cotton, which endogenously expresses proteins derived from Bacillus thuringiensis (Bt). No physiological adaptation to Bt toxin has been found in the field, so adaptation in this altered environment could involve (i) shifts in host plant selection mechanisms to avoid cotton, (ii) changes in detoxification mechanisms required for cotton-feeding vs. feeding on other hosts or (iii) loss of resistance to previously used management practices including insecticides. Here, we begin to address whether such changes occurred in H. virescens populations between 1997 and 2012, as Bt-cotton cultivation spread through the agricultural landscape. For our study, we produced an H. virescens genome assembly and used this in concert with a ddRAD-seq-enabled genome scan to identify loci with significant allele frequency changes over the 15-year period. Genetic changes at a previously described H. virescens insecticide target of selection were detectable in our genome scan and increased our confidence in this methodology. Additional loci were also detected as being under selection, and we quantified the selection strength required to elicit observed allele frequency changes at each locus. Potential contributions of genes near loci under selection to adaptive phenotypes in the H. virescens cotton system are discussed. © 2017 John Wiley & Sons Ltd.

Genetic diversity in upland cotton for cotton leaf curl virus disease, earliness and fiber quality

International Nuclear Information System (INIS)

Saeed, F.; Farooq, J.; Mahmood, A.; Hussain, T.

2014-01-01

In Pakistan during last two decades the major factor limiting cotton production is cotton leaf curl virus disease (CLCuD). For estimation of genetic diversity regarding CLCuD tolerance, fiber quality and some yield contributing traits, 101 cotton genotypes imported from USA were evaluated. Different statistical procedures like cluster, principle components (PC) and correlation analysis were employed to identify the suitable genotypes that can be further exploited in breeding programme. Significant associations were found between yield contributing trait, boll weight and fiber related trait, staple length. Earliness related traits, like days taken to 1 square and days taken to 1 flower had positive correlation with each other and both these traits also showed their positive association with ginning out turn. The negative significant correlation of CLCuD was obtained with monopodial branches, sympodial branches and plant height. Principal component (PC) analysis showed first five PCs having eigen value >1 explaining 67.8% of the total variation with days to st 1 square and flowering along with plant height and sympodia plant which were being the most important characters in PC1. Cluster analysis classified 101 accessions into five divergent groups. The genotypes in st cluster 1 only showed reasonable values for days to 1 square and flower, sympodia per plant, ginning out turn, staple length and fiber fineness and the genotypes in cluster 5 showed promising values for the traits like cotton leaf curl virus, ginning out turn and fiber fineness. The genotypes in cluster 1 and 5 may be combined to obtain desirable traits related to earliness and better disease tolerance. Scatter plot and tree diagrams demonstrated sufficient diversity among the cotton accessions for various traits and some extent of association between various clusters. It is concluded that diversity among the genotypes could be utilized for the development of CLCuD resistant lines with increased seed

Response of cotton genotypes to boron under-b-adequate conditions

International Nuclear Information System (INIS)

Shah, J. A.; Sial, M. A.; Hassan, Z. U.; Rajpar, I.

2015-01-01

Balanced boron (B) application is well-known to enhance the cotton production; however, the narrow range between B-deficiency and toxicity levels makes it difficult to manage. Cotton genotypes extensively differ in their response to B requirements. The adequate dose of B for one genotype may be insufficient or even toxic to other genotype. The effects of boron (B) on seed cotton yield and its various yield associated traits were studied on 10 cotton genotypes of Pakistan. The pot studies were undertaken to categorize cotton genotypes using B-deficient (control) and B-adequate (2.0 kg B ha-1) levels arranged in CRD with four repeats. The results indicated that the seed cotton yield, yield attributes and B-uptake of genotypes were comparatively decreased in B-deficient stressed treatment. Genotype NIA-Ufaq exhibited wide range of adaptation and ranked as efficient-responsive, as it produced higher seed cotton yield under both B-regimes. SAU-2 and CIM-506 were highly-efficient and remaining all genotypes were medium-efficient. Genotype Sindh-1 produced low seed cotton yield under B deficient condition and ranked as low-efficient. B-efficient cotton genotypes can be grown in B deficient soils without B application. (author)

Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin

2013-03-28

Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G

Developing Bisexual Attract-and-Kill for Polyphagous Insects: Ecological Rationale versus Pragmatics.

Science.gov (United States)

Gregg, Peter C; Del Socorro, Alice P; Hawes, Anthony J; Binns, Matthew R

2016-07-01

We discuss the principles of bisexual attract-and-kill, in which females as well as males are targeted with an attractant, such as a blend of plant volatiles, combined with a toxicant. While the advantages of this strategy have been apparent for over a century, there are few products available to farmers for inclusion in integrated pest management schemes. We describe the development, registration, and commercialization of one such product, Magnet(®), which was targeted against Helicoverpa armigera and H. punctigera in Australian cotton. We advocate an empirical rather than theoretical approach to selecting and blending plant volatiles for such products, and emphasise the importance of field studies on ecologically realistic scales of time and space. The properties required of insecticide partners also are discussed. We describe the studies that were necessary to provide data for registration of the Magnet(®) product. These included evidence of efficacy, including local and area-wide impacts on the target pest, non-target impacts, and safety for consumers and applicators. In the decade required for commercial development, the target market for Magnet(®) has been greatly reduced by the widespread adoption of transgenic insect-resistant cotton in Australia. We discuss potential applications in resistance management for transgenic cotton, and for other pests in cotton and other crops.

Less is more: strategies to remove marker genes from transgenic plants

Science.gov (United States)

2013-01-01

Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583

Less is more: strategies to remove marker genes from transgenic plants.

Science.gov (United States)

Yau, Yuan-Yeu; Stewart, C Neal

2013-04-23

Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.

Insecticide use and practices among cotton farmers in northern ...

African Journals Online (AJOL)

Cotton (Gossypium hirsutum L.) is an important cash crop in Uganda. Insecticide application practices among cotton growers in northern Uganda were examined to determine the pests targeted and the compliance of control measures with the standards recommended by the Uganda's Cotton Development Organization ...

78 FR 68983 - Cotton Futures Classification: Optional Classification Procedure

Science.gov (United States)

2013-11-18

...-AD33 Cotton Futures Classification: Optional Classification Procedure AGENCY: Agricultural Marketing... regulations to allow for the addition of an optional cotton futures classification procedure--identified and... response to requests from the U.S. cotton industry and ICE, AMS will offer a futures classification option...

MicroRNA expression profiling during upland cotton gland forming ...

African Journals Online (AJOL)

Jane

2011-08-15

Aug 15, 2011 ... 2Key Laboratory of Cotton Genetic Improvement, Cotton Research Institute of the Chinese Academy of Agricultural. Sciences, Ministry of ... terpenoid aldehyde biosynthesis pathway, genetic engineering and molecular breeding of cotton. ... toxic to non-ruminant animals and humans, which means that large ...

Evaluation of Brevibacillus brevis as a potential plant growth promoting rhizobacteria for cotton (Gossypium hirsutum) crop.

Science.gov (United States)

Nehra, Vibha; Saharan, Baljeet Singh; Choudhary, Madhu

2016-01-01

The present investigation was undertaken to isolate, screen and evaluate a selected promising PGPR Brevibacillus brevis on cotton crop. Out of 156 bacterial isolates one of the most promising isolate was analyzed for the various PGP traits. A seed germination analysis was conducted with cotton seeds to evaluate the potential of the isolate to promote plant growth. The bacterial isolate was checked for its growth and survival at high temperatures. The isolate was also analyzed for the PGP traits exhibited after the heat treatment. To identify the isolate morphological, biochemical and molecular characterization was performed. The isolate was found positive for many of the PGP attributes like IAA, ARA, anti-fungal activity and ammonia production. Effect of seed bacterization on various plant growth parameters was used as an indicator. The isolate showed significant growth and exhibited various PGP traits at high temperature making it suitable as an inoculant for cotton crop. Isolate was identified as Brevibacillus brevis [SVC(II)14] based on phenotypic as well as genotypic attributes and after conducting this research we propose that the B. brevis which is reported for the first time for its PGP potential in cotton, exerts its beneficial effects on cotton crop through combined modes of actions.

Spatial Distribution of Eggs of Alabama argillacea Hübner and Heliothis virescens Fabricius (Lepidoptera: Noctuidae on Bt and non-BtCotton

Directory of Open Access Journals (Sweden)

TATIANA R. RODRIGUES

2015-12-01

Full Text Available ABSTRACT Among the options to control Alabama argillacea (Hübner, 1818 and Heliothis virescens (Fabricius, 1781 on cotton, insecticide spraying and biological control have been extensively used. The GM'Bt' cotton has been introduced as an extremely viable alternative, but it is yet not known how transgenic plants affect populations of organisms that are interrelated in an agroecosystem. For this reason, it is important to know how the spatial arrangement of pests and beneficial insect are affected, which may call for changes in the methods used for sampling these species. This study was conducted with the goal to investigate the pattern of spatial distribution of eggs of A. argillacea and H. virescens in DeltaOpalTM (non-Bt and DP90BTMBt cotton cultivars. Data were collected during the agricultural year 2006/2007 in two areas of 5,000 m2, located in in the district of Nova América, Caarapó municipality. In each sampling area, comprising 100 plots of 50 m2, 15 evaluations were performed on two plants per plot. The sampling consisted in counting the eggs. The aggregation index (variance/mean ratio, Morisita index and exponent k of the negative binomial distribution and chi-square fit of the observed and expected values to the theoretical frequency distribution (Poisson, Binomial and Negative Binomial Positive, showed that in both cultivars, the eggs of these species are distributed according to the aggregate distribution model, fitting the pattern of negative binomial distribution.

Producing Organic Cotton: A Toolkit - Crop Guide, Projekt guide, Extension tools

OpenAIRE

Eyhorn, Frank

2005-01-01

The CD compiles the following extension tools on organic cotton: Organic Cotton Crop Guide, Organic Cotton Training Manual, Soil Fertility Training Manual, Organic Cotton Project Guide, Record keeping tools, Video "Organic agriculture in the Nimar region", Photos for illustration.

A facile method to fabricate superhydrophobic cotton fabrics

Science.gov (United States)

Zhang, Ming; Wang, Shuliang; Wang, Chengyu; Li, Jian

2012-11-01

A facile and novel method for fabricating superhydrophobic cotton fabrics is described in the present work. The superhydrophobic surface has been prepared by utilizing cationic poly (dimethyldiallylammonium chloride) and silica particles together with subsequent modification of (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The size distribution of silica particles was measured by Particle Size Analyzer. The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, the superhydrophobic durability of coated cotton textiles has been evaluated by exposure, immersion and washing tests. The results show that the treated cotton fabrics exhibited excellent chemical stability and outstanding non-wettability with the WCA of 155 ± 2°, which offers an opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications.

Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

Science.gov (United States)

Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

2016-01-01

Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

Science.gov (United States)

Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

1999-01-01

Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

Milkweed, stink bugs, and Georgia cotton

Science.gov (United States)

In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...

Recombinant Cry1Ia protein is highly toxic to cotton boll weevil (Anthonomus grandis Boheman) and fall armyworm (Spodoptera frugiperda).

Science.gov (United States)

Martins, E S; Aguiar, R W D S; Martins, N F; Melatti, V M; Falcão, R; Gomes, A C M M; Ribeiro, B M; Monnerat, R G

2008-05-01

To evaluate the activity of cry1Ia gene against cotton pests, Spodoptera frugiperda and Anthonomus grandis. Had isolated and characterized a toxin gene from the Bacillus thuringiensis S1451 strain which have been previously shown to be toxic to S. frugiperda and A. grandis. The toxin gene (cry1Ia) was amplified by PCR, sequenced, and cloned into the genome of a baculovirus. The Cry1Ia protein was expressed in baculovirus infected insect cells, producing protein inclusions in infected cells. The Cry1Ia protein has used in bioassays against to S. frugiperda and A. grandis. Bioassays using the purified recombinant protein showed high toxicity to S. frugiperda and A. grandis larvae. Molecular modelling of the Cry1Ia protein translated from the DNA sequence obtained in this work, showed that this protein possibly posses a similar structure to the Cry3A protein. Ultrastructural analysis of midgut cells from A. grandis incubated with the Cry1Ia toxin, showed loss of microvilli integrity. The results indicate that the cry1Ia is a good candidate for the construction of transgenic plants resistant to these important cotton pests.

Fabrication of cotton fabric with superhydrophobicity and flame retardancy.

Science.gov (United States)

Zhang, Ming; Wang, Chengyu

2013-07-25

A simple and facile method for fabricating the cotton fabric with superhydrophobicity and flame retardancy is described in the present work. The cotton fabric with the maximal WCA of 160° has been prepared by the covalent deposition of amino-silica nanospheres and the further graft with (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The geometric microstructure of silica spheres was measured by transmission electron microscopy (TEM). The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, diverse performances of superhydrophobic cotton textiles have been evaluated as well. The results exhibited the outstanding superhydrophobicity, excellent waterproofing durability and flame retardancy of the cotton fabric after treatment, offering a good opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications. Copyright © 2013 Elsevier Ltd. All rights reserved.

Transcriptome analysis of Gossypium hirsutum flower buds infested by cotton boll weevil (Anthonomus grandis) larvae.

Science.gov (United States)

Artico, Sinara; Ribeiro-Alves, Marcelo; Oliveira-Neto, Osmundo Brilhante; de Macedo, Leonardo Lima Pepino; Silveira, Sylvia; Grossi-de-Sa, Maria Fátima; Martinelli, Adriana Pinheiro; Alves-Ferreira, Marcio

2014-10-04

data will aid in the selection of target genes to genetically engineer cotton to control the cotton boll weevil.

DS read-out transcription in transgenic tomato plants

NARCIS (Netherlands)

Rudenko, George N.; Nijkamp, H. John J.; Hille, Jacques

1994-01-01

To select for Ds transposition in transgenic tomato plants a phenotypic excision assay, based on restoration of hygromycin phosphotransferase (HPT II) gene expression, was employed. Some tomato plants, however, expressed the marker gene even though the Ds had not excised. Read-out transcriptional

At-line cotton color measurements by portable color spectrophotometers

Science.gov (United States)

As a result of reports of cotton bales that had significant color changes from their initial Uster® High Volume Instrument (HVI™) color measurements, a program was implemented to measure cotton fiber color (Rd, +b) at-line in remote locations (warehouse, mill, etc.). The measurement of cotton fiber...

7 CFR 27.25 - Additional samples of cotton; drawing.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed, separate samples, if desired, may be drawn and furnished to the owner of the cotton. ...

DeepCotton: in-field cotton segmentation using deep fully convolutional network

Science.gov (United States)

Li, Yanan; Cao, Zhiguo; Xiao, Yang; Cremers, Armin B.

2017-09-01

Automatic ground-based in-field cotton (IFC) segmentation is a challenging task in precision agriculture, which has not been well addressed. Nearly all the existing methods rely on hand-crafted features. Their limited discriminative power results in unsatisfactory performance. To address this, a coarse-to-fine cotton segmentation method termed "DeepCotton" is proposed. It contains two modules, fully convolutional network (FCN) stream and interference region removal stream. First, FCN is employed to predict initially coarse map in an end-to-end manner. The convolutional networks involved in FCN guarantee powerful feature description capability, simultaneously, the regression analysis ability of neural network assures segmentation accuracy. To our knowledge, we are the first to introduce deep learning to IFC segmentation. Second, our proposed "UP" algorithm composed of unary brightness transformation and pairwise region comparison is used for obtaining interference map, which is executed to refine the coarse map. The experiments on constructed IFC dataset demonstrate that our method outperforms other state-of-the-art approaches, either in different common scenarios or single/multiple plants. More remarkable, the "UP" algorithm greatly improves the property of the coarse result, with the average amplifications of 2.6%, 2.4% on accuracy and 8.1%, 5.5% on intersection over union for common scenarios and multiple plants, separately.

Problems and achievements of cotton (Gossypium Hirsutum L. weeds control

Directory of Open Access Journals (Sweden)

T. Barakova

2017-09-01

Full Text Available Abstract. Weed control in the cultivation of cotton is critical to the yield and quality of production. The influence of economically important weeds was studied. Chemical control is the most effective method of weed control in cotton but much of the information on it relates to primary weed infestation. Problems with primary weed infestation in cotton have been solved to a significant extent. The question of secondary weed infestation with annual and perennial graminaceous weeds during the period of cotton vegetation is also determined largely by the use of antigraminaceous herbicides. The data related to herbicides to effectively control secondary germinated broadleaf weeds in conventional technology for cotton growing are quite scarce, even globally. We are still seeking effective herbicides for control of these weeds in cotton crops. Studies on their influence on the sowing characteristics of cotton seed and the quality of cotton fiber are still insufficient. In the scientific literature there is not enough information on these questions. The combinations of herbicides, as well as their tank mixtures with fertilizers or plant growth regulators are more efficient than autonomous application. Often during their combined application higher synergistic effect on yield is produced. There is information about cotton cultivars resistant to glyphosate. These cultivars are GMO and they are banned within the European Union, including Bulgaria.

Study of mungbean intercropping in cotton planted with different techniques

International Nuclear Information System (INIS)

Khan, M.B.; Khaliq, A.

2004-01-01

Bio-economic efficiency of different cotton-based intercropping systems was determined at the Agronomic Research Area, University of Agriculture, Faisalabad, (Pakistan) during 1996-1997 and 1997-98. Cotton cultivar NIAB-78 was planted in 80-cm apart single rows and 120-cm spaced double row strips with the help of a single row hand drill. Intercropping systems were cotton alone and cotton + mungbean. Experiment was laid out in a RCBD with split arrangements in four replications. Planting patterns were kept in main plots and intercropping systems in sub-plots. Inter crop was sown in the space between 80-cm apart single rows as well as 120-cm spaced double row strips. Competition functions like relative crowding coefficient, competitive ratio, aggressivity, land equivalent ratio and area time equivalent ratio were calculated for the assessment of the benefits of the intercropping. Partial budget was prepared for determining net field benefits of the systems under study. Growing of cotton in 120-cm spaced double row strips proved superior to 80-cm spaced single rows. Intercropping decreased the seed cotton production significantly in both years, however, inter crop not only covered this loss but also increased overall productivity. Higher net field benefit (NFB) was obtained from cotton + mungbean than sole cropping of cotton. Farmers with small land holdings, seriously constrained by low crop income can adopt the practice of intercropping of mungbean in cotton. (author)

Fourier-transform imaging of cotton and botanical and field trash mixtures

Science.gov (United States)

Botanical and field cotton trash comingled with cotton lint can greatly reduce the marketability and quality of cotton. Trash can be found comingled with cotton lint during harvesting, ginning, and processing, thus this study is of interest. Attenuated Total Reflectance-Fourier Transform Infrared (A...

MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).

Science.gov (United States)

He, Qiuling; Zhu, Shuijin; Zhang, Baohong

2014-09-01

MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.

7 CFR 1427.174 - Maturity of seed cotton loans.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427.174 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION... Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...

The preparation and antibacterial effects of dopa-cotton/AgNPs

International Nuclear Information System (INIS)

Xu Hong; Shi Xue; Ma Hui; Lv Yihang; Zhang Linping; Mao Zhiping

2011-01-01

Silver nanoparticles (AgNPs) have been known to have powerful antibacterial activity. In this paper, in situ generation of AgNPs on the surface of dopamine modified cotton fabrics (dopa-cotton/AgNPs) in aqueous solution under room temperature is presented. X-ray photoelectron spectroscopy (XPS) and field emission scanning electron microscope (FE-SEM) were used to analyze the surface chemical composition and the morphology of the modified cotton fabrics, respectively. The results indicated that the surface of cotton fabrics was successfully coated with polydopamine and AgNPs. The cotton fabrics with AgNPs showed durable antibacterial activity.

A cytochrome P450 monooxygenase commonly used for negative selection in transgenic plants causes growth anomalies by disrupting brassinosteroid signaling

Directory of Open Access Journals (Sweden)

Manivasagam Sindhu

2011-04-01

Full Text Available Abstract Background Cytochrome P450 monooxygenases form a large superfamily of enzymes that catalyze diverse reactions. The P450SU1 gene from the soil bacteria Streptomyces griseolus encodes CYP105A1 which acts on various substrates including sulfonylurea herbicides, vitamin D, coumarins, and based on the work presented here, brassinosteroids. P450SU1 is used as a negative-selection marker in plants because CYP105A1 converts the relatively benign sulfonyl urea pro-herbicide R7402 into a highly phytotoxic product. Consistent with its use for negative selection, transgenic Arabidopsis plants were generated with P450SU1 situated between recognition sequences for FLP recombinase from yeast to select for recombinase-mediated excision. However, unexpected and prominent developmental aberrations resembling those described for mutants defective in brassinosteroid signaling were observed in many of the lines. Results The phenotypes of the most affected lines included severe stunting, leaf curling, darkened leaves characteristic of anthocyanin accumulation, delayed transition to flowering, low pollen and seed yields, and delayed senescence. Phenotype severity correlated with P450SU1 transcript abundance, but not with transcript abundance of other experimental genes, strongly implicating CYP105A1 as responsible for the defects. Germination and seedling growth of transgenic and control lines in the presence and absence of 24-epibrassinolide indicated that CYP105A1 disrupts brassinosteroid signaling, most likely by inactivating brassinosteroids. Conclusions Despite prior use of this gene as a genetic tool, deleterious growth in the absence of R7402 has not been elaborated. We show that this gene can cause aberrant growth by disrupting brassinosteroid signaling and affecting homeostasis.

Marketing policies and economic interests in the cotton sector of Kenya

NARCIS (Netherlands)

Dijkstra, T.

1990-01-01

This report, which is based on field research carried out in 1988, examines the marketing arrangements for raw cotton, cotton lint and cotton seed in Kenya, as well as the relationships and conflicts between the actors involved. The report starts with the history of cotton production and marketing

76 FR 32067 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

Science.gov (United States)

2011-06-03

... ``Any AUP cotton'' and replacing it with the phrase ``Mature AUP cotton'' to clarify the AUP cotton must be mature in order to calculate a conversion factor between AUP cotton and ELS cotton. List of... dividing Price A by 85 percent of Price B. * * * * * (f) Mature AUP cotton harvested or appraised from...

Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum).

Science.gov (United States)

Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing

2014-11-06

Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved

Seletividade de herbicidas aplicados em pré-emergência na cultura do algodão Selectivity of herbicides applied to pre-emergent cotton crops

Directory of Open Access Journals (Sweden)

Miriam Hiroko Inoue

2013-03-01

Full Text Available A cultura do algodão tem grande importância econômica e social, visto que é a fibra mais utilizada no setor têxtil. Contudo é uma cultura que apresenta alta sensibilidade a plantas daninhas e há poucos herbicidas seletivos à cultura. Neste contexto o trabalho objetivou avaliar a seletividade de herbicidas aplicados em pré-emergência na cultura do algodão. Os herbicidas alachlor, S-metolachlor, diuron, prometryne, trifluralin e oxyfluorfen foram aplicados isoladamente e em misturas sobre a variedade FMT-701, nas localidades de Diamantino-MT e Campos de Júlio-MT. O delineamento experimental utilizado foi em blocos casualizados com 16 tratamentos e 4 repetições. Para avaliar a seletividade foram realizadas avaliações de altura aos 36; 66 e 150 dias após a aplicação (DAA, fitointoxicação aos 14; 21; 29 e 36 DAA, estande aos 21 e 49 DAA, número de maçãs aos 141 DAA e produtividade do algodão em caroço aos 193 DAA. Os dados foram submetidos à análise conjunta e ao teste de agrupamento Scott-Knott (p>0,05. Os resultados indicaram que alguns tratamentos proporcionaram menor altura de plantas em determinadas avaliações e grande parte dos tratamentos causou injúrias na fase inicial da cultura. Verificou-se que os tratamentos não proporcionaram diferença significativa para as características de estande de plantas, número de maçãs e produtividade de algodão em caroço, comprovando que todos os tratamentos avaliados podem ser utilizados no manejo de plantas daninhas.The cultivation of cotton has great economic and social importance as it is the most widely used fibre in the textile sector. It is however a crop that is highly sensitive tweeds, and there are few selective herbicides for the crop. With this in mind, this study aimed to evaluate the selectivity of herbicides applied to pre-emergent cotton crops. The herbicides, alachlor, S-metolachlor, diuron, prometryne, trifluralin and oxyfluorfen were applied both

Cotton in Benin: governance and pest management

NARCIS (Netherlands)

Togbe, C.E.

2013-01-01

Key words: cotton, synthetic pesticides, neem oil (Azadirachta indica), Beauveria bassiana,

Bacillus thuringiensis, field experiment, farmers’ participation

Pests are one of the main factors limiting cotton production worldwide. Most of the pest

control

Ecoinformatics reveals effects of crop rotational histories on cotton yield.

Science.gov (United States)

Meisner, Matthew H; Rosenheim, Jay A

2014-01-01

Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

Ecoinformatics reveals effects of crop rotational histories on cotton yield.

Directory of Open Access Journals (Sweden)

Matthew H Meisner

Full Text Available Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

Weed hosts of cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae).

Science.gov (United States)

Vennila, S; Prasad, Y G; Prabhakar, M; Agarwal, Meenu; Sreedevi, G; Bambawale, O M

2013-03-01

The exotic cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) invaded India during 2006, and caused widespread infestation across all nine cotton growing states. P. solenopsis also infested weeds that aided its faster spread and increased severity across cotton fields. Two year survey carried out to document host plants of P. solenopsis between 2008 and 2010 revealed 27, 83, 59 and 108 weeds belonging to 8, 18, 10 and 32 families serving as alternate hosts at North, Central, South and All India cotton growing zones, respectively. Plant species of four families viz., Asteraceae, Amaranthaceae, Malvaceae and Lamiaceae constituted almost 50% of the weed hosts. While 39 weed species supported P. solenopsis multiplication during the cotton season, 37 were hosts during off season. Higher number of weeds as off season hosts (17) outnumbering cotton season (13) at Central over other zones indicated the strong carryover of the pest aided by weeds between two cotton seasons. Six, two and seven weed hosts had the extreme severity of Grade 4 during cotton, off and cotton + off seasons, respectively. Higher number of weed hosts of P. solenopsis were located at roadside: South (12) > Central (8) > North (3) zones. Commonality of weed hosts was higher between C+S zones, while no weed host was common between N+S zones. Paper furnishes the wide range of weed hosts of P. solenopsis, discusses their significance, and formulated general and specific cultural management strategies for nationwide implementation to prevent its outbreaks.

Elemental analysis of cotton by laser-induced breakdown spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Schenk, Emily R.; Almirall, Jose R.

2010-05-01

Laser-induced breakdown spectroscopy (LIBS) has been applied to the elemental characterization of unprocessed cotton. This research is important in forensic and fraud detection applications to establish an elemental fingerprint of U.S. cotton by region, which can be used to determine the source of the cotton. To the best of our knowledge, this is the first report of a LIBS method for the elemental analysis of cotton. The experimental setup consists of a Nd:YAG laser that operates at the fundamental wavelength as the LIBS excitation source and an echelle spectrometer equipped with an intensified CCD camera. The relative concentrations of elements Al, Ba, Ca, Cr, Cu, Fe, Mg, and Sr from both nutrients and environmental contributions were determined by LIBS. Principal component analysis was used to visualize the differences between cotton samples based on the elemental composition by region in the U.S. Linear discriminant analysis of the LIBS data resulted in the correct classification of >97% of the cotton samples by U.S. region and >81% correct classification by state of origin.

Transgenic algae engineered for higher performance

Science.gov (United States)

Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

2014-10-21

The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

Comparative genomic analysis of the PKS genes in five species and expression analysis in upland cotton

Directory of Open Access Journals (Sweden)

Xueqiang Su

2017-10-01

Full Text Available Plant type III polyketide synthase (PKS can catalyse the formation of a series of secondary metabolites with different structures and different biological functions; the enzyme plays an important role in plant growth, development and resistance to stress. At present, the PKS gene has been identified and studied in a variety of plants. Here, we identified 11 PKS genes from upland cotton (Gossypium hirsutum and compared them with 41 PKS genes in Populus tremula, Vitis vinifera, Malus domestica and Arabidopsis thaliana. According to the phylogenetic tree, a total of 52 PKS genes can be divided into four subfamilies (I–IV. The analysis of gene structures and conserved motifs revealed that most of the PKS genes were composed of two exons and one intron and there are two characteristic conserved domains (Chal_sti_synt_N and Chal_sti_synt_C of the PKS gene family. In our study of the five species, gene duplication was found in addition to Arabidopsis thaliana and we determined that purifying selection has been of great significance in maintaining the function of PKS gene family. From qRT-PCR analysis and a combination of the role of the accumulation of proanthocyanidins (PAs in brown cotton fibers, we concluded that five PKS genes are candidate genes involved in brown cotton fiber pigment synthesis. These results are important for the further study of brown cotton PKS genes. It not only reveals the relationship between PKS gene family and pigment in brown cotton, but also creates conditions for improving the quality of brown cotton fiber.

CATEGORIZATION OF EXTRANEOUS MATTER IN COTTON USING MACHINE VISION SYSTEMS

Science.gov (United States)

The Cotton Trash Identification System (CTIS) was developed at the Southwestern Cotton Ginning Research Laboratory to identify and categorize extraneous matter in cotton. The CTIS bark/grass categorization was evaluated with USDA-Agricultural Marketing Service (AMS) extraneous matter calls assigned ...

Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay.

Science.gov (United States)

Kozaki, Tomoaki; Lee, Soomin; Nishimura, Takayuki; Katsuura, Tetsuo; Yasukouchi, Akira

2011-01-10

Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO). In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). The melatonin levels were analyzed in duplicate using commercially available ELISA kits. The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL). The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level (<6 pg/mL), although the BA plots didn't show proportional and relative biases, there was no significant correlation between passive and cotton saliva collection samples. Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.

Transgenic plants: from first successes to future applications.

Science.gov (United States)

Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

2013-01-01

This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

Chemical analysis of plasma-assisted antimicrobial treatment on cotton

International Nuclear Information System (INIS)

Kan, C W; Lam, Y L; Yuen, C W M; Luximon, A; Lau, K W; Chen, K S

2013-01-01

This paper explores the use of plasma treatment as a pretreatment process to assist the application of antimicrobial process on cotton fabric with good functional effect. In this paper, antimicrobial finishing agent, Microfresh Liquid Formulation 9200-200 (MF), and a binder (polyurethane dispersion, Microban Liquid Formulation R10800-0, MB) will be used for treating the cotton fabric for improving the antimicrobial property and pre-treatment of cotton fabric by plasma under atmospheric pressure will be employed to improve loading of chemical agents. The chemical analysis of the treated cotton fabric will be conducted by Fourier transform Infrared Spectroscopy.

Chloroplast localization of Cry1Ac and Cry2A protein- an alternative way of insect control in cotton

Directory of Open Access Journals (Sweden)

Adnan Muzaffar

2015-01-01

Full Text Available BACKGROUND: Insects have developed resistance against Bt-transgenic plants. A multi-barrier defense system to weaken their resistance development is now necessary. One such approach is to use fusion protein genes to increase resistance in plants by introducing more Bt genes in combination. The locating the target protein at the point of insect attack will be more effective. It will not mean that the non-green parts of the plants are free of toxic proteins, but it will inflict more damage on the insects because they are at maximum activity in the green parts of plants. RESULTS: Successful cloning was achieved by the amplification of Cry2A, Cry1Ac, and a transit peptide. The appropriate polymerase chain reaction amplification and digested products confirmed that Cry1Ac and Cry2A were successfully cloned in the correct orientation. The appearance of a blue color in sections of infiltrated leaves after 72 hours confirmed the successful expression of the construct in the plant expression system. The overall transformation efficiency was calculated to be 0.7%. The amplification of Cry1Ac-Cry2A and Tp2 showed the successful integration of target genes into the genome of cotton plants. A maximum of 0.673 μg/g tissue of Cry1Ac and 0.568 μg/g tissue of Cry2A was observed in transgenic plants. We obtained 100% mortality in the target insect after 72 hours of feeding the 2nd instar larvae with transgenic plants. The appearance of a yellow color in transgenic cross sections, while absent in the control, through phase contrast microscopy indicated chloroplast localization of the target protein. CONCLUSION: Locating the target protein at the point of insect attack increases insect mortality when compared with that of other transgenic plants. The results of this study will also be of great value from a biosafety point of view.

Field Comparison of Fertigation Vs. Surface Irrigation of Cotton Crop

International Nuclear Information System (INIS)

Janat, M.

2004-01-01

Based on previous results of the same nature, one nitrogen rate 180 kg N ha -1 was tested under two-irrigation methods, surface irrigation and drip fertigation of cotton (Cultivar Rakka-5) for two consecutive seasons 2000 and 2001. The study aimed to answer various questions regarding the applicability of drip fertigation at farm level and the effect of its employment on yield and growth parameters, compared to surface irrigation. Nitrogen fertilizer was either injected in eight equally split applications for the drip fertigated cotton or divided in four unequally split applications as recommend by Ministry of Agriculture (20% before planting, 40% at thinning, 20% after 60 days from planting and 20% after 75 days after planting). 15 N labeled urea was used to evaluate nitrogen fertilizer efficiency. The experimental design was randomized block design with seven replicates. Results showed that drip fertigation led to water saving exceeding 50% in some cases. Field germination percentage was highly increased under drip- fertigated cotton relative to surface-irrigated cotton. Dry matter and seed cotton yield of surface-irrigated cotton was slightly higher than that of drip-fertigated cotton in the first growing season. The reason for that was due to the hot spill that occurred in the region, which exposed the cotton crop to water stress and consequently pushed the cotton into early flowering. Lint properties were not affected by the introduction of drip-fertigation. Actually some properties were improved relative to the standard properties identified by the cotton Bureau.Nitrogen uptake was slightly increased under drip fertigation whereas nitrogen use efficiencies were not constant along the growing seasons. The reason for that could be lateral leaching and root proliferation into the labeled and unlabeled subplots. Field water use efficiency was highly increased for both growing seasons under drip fertigation practice. The rate of field water use efficiencies

Passive and active protection of cotton textiles

NARCIS (Netherlands)

Bochove, C. van

1967-01-01

In rotproofing of cotton a distinction is made between passive and active protection. In passive protection, the structure of the cotton fibre is modified in such a way that the fibre can longer be attacked. This modification of structure can be effected on different levels: microscopical,

Incorporating a Sorghum Habitat for Enhancing Lady Beetles (Coleoptera: Coccinellidae in Cotton

Directory of Open Access Journals (Sweden)

P. G. Tillman

2012-01-01

Full Text Available Lady beetles (Coleoptera: Coccinellidae prey on insect pests in cotton. The objective of this 2 yr on-farm study was to document the impact of a grain sorghum trap crop on the density of Coccinellidae on nearby cotton. Scymnus spp., Coccinella septempunctata (L., Hippodamia convergens Guérin-Méneville, Harmonia axyridis (Pallas, Coleomegilla maculata (De Geer, Cycloneda munda (Say, and Olla v-nigrum (Mulsant were found in sorghum over both years. Lady beetle compositions in sorghum and cotton and in yellow pyramidal traps were similar. For both years, density of lady beetles generally was higher on cotton with sorghum than on control cotton. Our results indicate that sorghum was a source of lady beetles in cotton, and thus incorporation of a sorghum habitat in farmscapes with cotton has great potential to enhance biocontrol of insect pests in cotton.

Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts.

Science.gov (United States)

Hulse-Kemp, Amanda M; Ashrafi, Hamid; Zheng, Xiuting; Wang, Fei; Hoegenauer, Kevin A; Maeda, Andrea B V; Yang, S Samuel; Stoffel, Kevin; Matvienko, Marta; Clemons, Kimberly; Udall, Joshua A; Van Deynze, Allen; Jones, Don C; Stelly, David M

2014-10-30

Cotton (Gossypium spp.) is the largest producer of natural fibers for textile and is an important crop worldwide. Crop production is comprised primarily of G. hirsutum L., an allotetraploid. However, elite cultivars express very small amounts of variation due to the species monophyletic origin, domestication and further bottlenecks due to selection. Conversely, wild cotton species harbor extensive genetic diversity of prospective utility to improve many beneficial agronomic traits, fiber characteristics, and resistance to disease and drought. Introgression of traits from wild species can provide a natural way to incorporate advantageous traits through breeding to generate higher-producing cotton cultivars and more sustainable production systems. Interspecific introgression efforts by conventional methods are very time-consuming and costly, but can be expedited using marker-assisted selection. Using transcriptome sequencing we have developed the first gene-associated single nucleotide polymorphism (SNP) markers for wild cotton species G. tomentosum, G. mustelinum, G. armourianum and G. longicalyx. Markers were also developed for a secondary cultivated species G. barbadense cv. 3-79. A total of 62,832 non-redundant SNP markers were developed from the five wild species which can be utilized for interspecific germplasm introgression into cultivated G. hirsutum and are directly associated with genes. Over 500 of the G. barbadense markers have been validated by whole-genome radiation hybrid mapping. Overall 1,060 SNPs from the five different species have been screened and shown to produce acceptable genotyping assays. This large set of 62,832 SNPs relative to cultivated G. hirsutum will allow for the first high-density mapping of genes from five wild species that affect traits of interest, including beneficial agronomic and fiber characteristics. Upon mapping, the markers can be utilized for marker-assisted introgression of new germplasm into cultivated cotton and in

Integrated nutrients management for 'desi' cotton

International Nuclear Information System (INIS)

Qazi, M.A.; Akram, M.; Ahmad, N.; Khattak, M.A.

2007-01-01

Intensive cropping with no return of crop residues and other organic inputs result in the loss of soil organic matter (SOM) and nutrient supply in (Desi) cotton-wheat cropping system in Pakistan. For appraisal of problem and finding solution to sustainability, we evaluated six treatments comprised of two fertilizer doses and three management techniques over a period of three years (2003-05) monitoring their effects on seed cotton yield and soil fertility. The techniques included chemical fertilizers, municipal solid waste manure (MSWM) integrated with chemical fertilizers in 1:4 ratios with, and without pesticides. The results revealed that cotton yields. Were enhanced by 19% due to site-specific fertilizer dose over conventional dose. Ignoring weeds control by means of herbicided application resulted in 5% decrease of seed cotton yield in IPNM technique positive effect of MSWM integration was noted on soil test phosphorus and SOM. Site-specific fertilizer application and integrated plant nutrient management by MSWM proved their suitability as the techniques not only improve soil quality in terms of sustained levels of organic matter and phosphorus but also provide a safe way of waste disposal. (author)

Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack

Directory of Open Access Journals (Sweden)

Hensel Goetz

2012-09-01

Full Text Available Abstract Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT and a synthetic green fluorescent protein gene (gfp. Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants.

Exploring potential and opportunities for pakistan cotton export

International Nuclear Information System (INIS)

Afridi, G. S.; Tariq, S. A.

2016-01-01

Agriculture is the single largest shareholder to GDP an employment to labour force. It has major share in export but unfortunately unable to meet international standards. This study aims to analyze the pattern of Pakistan cotton export, and to explore sector's export potential and opportunities. This new research endeavor with well-tested analytical tools enabled the trade experts and policy makers to explore the answer of lackness for diversification in export, HS-2- digits aggregated data for cotton sub-sectors have been used with latest data from 2004 to 2013 for the panel 39 countries. Revealed comparative advantage (RCA) index and gravity model approach was employed considering country and time specific fixed effect. The RCA index revealed that cotton sub-sectors have comparative advantage in export and there is gradual gain in the competitiveness with time. The opportunity exists in the markets of low, lower-middle and upper middle income countries and countries those have fair trade (low tariff and non-tariff barriers) for cotton export. Greater export potential lies with malaysia, kenya jordan, thailand, mauritius, netherlands norway, Australia and russian federation for export of cotton, however, export potential for cotton has been exhausted with canada, france, india, iran and saudi arabia. The study provide the policy information that countries of Latin america, eastern europe, central asia and northern africa are virgin for export. Therefore, pakistan should penetrate in these markets for export of cotton and other agricultural products. cognizant to new trade theories, pakistan focus on quality to gain maximum trade volume in the markets of high income countries, Pakistan may develop trade agreement with ASEAN, SAFTA, and EU-27 for export of agricultural products. (author)

Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay

Directory of Open Access Journals (Sweden)

Katsuura Tetsuo

2011-01-01

Full Text Available Abstract Background Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO. In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Methods Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection and into clear sterile tubes (passive saliva collection. The melatonin levels were analyzed in duplicate using commercially available ELISA kits. Results The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL. The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level ( Conclusion Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.

SSR-based association mapping of salt tolerance in cotton (Gossypium hirsutum L.).

Science.gov (United States)

Zhao, Y L; Wang, H M; Shao, B X; Chen, W; Guo, Z J; Gong, H Y; Sang, X H; Wang, J J; Ye, W W

2016-05-25

The identification of simple sequence repeat (SSR) markers associated with salt tolerance in cotton contributes to molecular assisted selection (MAS), which can improve the efficiency of traditional breeding. In this study, 134 samples of upland cotton cultivars were selected. The seedling emergence rates were tested under 0.3% NaCl stress. A total of 74 SSR markers were used to scan the genomes of these samples. To identify SSR markers associated with salt tolerance, an association analysis was performed between salt tolerance and SSR markers using TASSEL 2.1, based on the analysis of genetic structure using Structure 2.3.4. The results showed that the seedling emergence rates of 134 cultivars were significantly different, and 27 salt-sensitive and 10 salt-tolerant cultivars were identified. A total of 148 loci were found in 74 SSR markers involving 246 allelic variations, which ranged from 2 to 7 with an average of 3.32 per SSR marker. The gene diversity ranged from 0.0295 to 0.4959, with the average being 0.2897. The polymorphic information content ranged from0.0290 to 0.3729, with the average being 0.2381. This natural population was classified into two subgroups by Structure 2.3.4, containing 89 and 45 samples, respectively. Finally, eight SSR sites associated with salt tolerance ware found through an association analysis, with the rate of explanation ranging from 2.91 to 7.82% and an average of 4.32%. These results provide reference data for the use MAS for salt tolerance in cotton.

Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

Science.gov (United States)

Pons, Elsa; Peris, Josep E; Peña, Leandro

2012-07-15

The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

Processing and Properties of PCL/Cotton Linter Compounds

OpenAIRE

Bezerra,Elieber Barros; França,Danyelle Campos; Morais,Dayanne Diniz de Souza; Rosa,Morsyleide de Freitas; Morais,João Paulo Saraiva; Araújo,Edcleide Maria; Wellen,Renate Maria Ramos

2017-01-01

Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton...

Cycling of fertilizer and cotton crop residue nitrogen

International Nuclear Information System (INIS)

Rochester, I.J.; Constable, G.A.; MacLeod, D.A.

1993-01-01

Mineral nitrogen (N), nitrate and ammonium contents were monitored in N-fertilized soils supporting cotton crops to provide information on the nitrification, mineralization and immobilization processes operating in the soil. The relative contributions of fertilizer N, previous cotton crop residue N and indigenous soil N to the mineral N pools and to the current crop's N uptake were calculated. After N fertilizer (urea) application, the soil's mineral N content rose rapidly and subsequently declined at a slower rate. The recovery of 15 N-labelled urea as mineral N declined exponentially with time. Biological immobilization (and possibly denitrification to some extent) were believed to be the major processes reducing post-application soil mineral N content. Progressively less N was mineralized upon incubation of soil sampled through the growing season. Little soil N (either from urea or crop residue) was mineralized at crop maturity. Cycling of N was evident between the soil mineral and organic N pools throughout the cotton growing season. Considerable quantities of fertilizer N were immobilized by the soil micro biomass; immobilized N was remineralized and subsequently taken up by the cotton crop. A large proportion of the crop N was taken up in the latter part of the season when the soil mineral N content was low. It is suggested that much of the N taken up by cotton was derived from microbial sources, rather than crop residues. The application of cotton crop residue (stubble) slightly reduced the mineral N content in the soil by encouraging biological immobilization. 15 N was mineralized very slowly from the labelled crop residue and did not contribute significantly to the supply of N to the current crop. Recovery of labelled fertilizer N and labelled crop residue N by the cotton crop was 28% and 1%, respectively. In comparison, the apparent recovery of fertilizer N was 48%. Indigenous soil N contributed 68% of the N taken up by the cotton crop. 33 refs., 1 tab

Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

OpenAIRE

Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.; Nettelbeck, Dirk M.

2010-01-01

Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show t...

Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

OpenAIRE

Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

2011-01-01

In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

Resilient modulus of black cotton soil

Directory of Open Access Journals (Sweden)

K.H. Mamatha

2017-03-01

Full Text Available Resilient modulus (MR values of pavement layers are the basic input parameters for the design of pavements with multiple layers in the current mechanistic empirical pavement design guidelines. As the laboratory determination of resilient modulus is costly, time consuming and cumbersome, several empirical models are developed for the prediction of resilient modulus for different regions of the world based on the database of resilient modulus values of local soils. For use of these relationships there is a need to verify the suitability of these models for local conditions. Expansive clay called black cotton soil (BC soil is found in several parts of India and is characterized by low strength and high compressibility. This soil shows swell – shrink behaviour upon wetting and drying and are problematic. The BC soil shows collapse behaviour on soaking and therefore the strength of the soil needs to be improved. Additive stabilization is found to be very effective in stabilizing black cotton soils and generally lime is used to improve the strength and durability of the black cotton soil. In this paper, the results of repeated load tests on black cotton soil samples for the determination of MR under soaked and unsoaked conditions at a relative compaction levels of 100% and 95% of both standard and modified proctor conditions are reported. The results indicate that the black cotton soil fails to meet the density requirement of the subgrade soil and shows collapse behaviour under soaked condition. To overcome this, lime is added as an additive to improve the strength of black cotton soil and repeated load tests were performed as per AASHTO T 307 - 99 for MR determination. The results have shown that the samples are stable under modified proctor condition with MR values ranging from 36 MPa to 388 MPa for a lime content of 2.5% and curing period ranging from 7 to 28 days. Also, it is observed that, the CBR based resilient modulus is not in agreement

Changes in cotton gin energy consumption apportioned by ten functions

Science.gov (United States)

The public is concerned about air quality and sustainability. Cotton producers, gin owners and plant managers are concerned about rising energy prices. Both have an interest in cotton gin energy consumption trends. Changes in cotton gins’ energy consumption over the past fifty years, a period of ...

farmers' knowledge and perceptions of cotton insect pests and their

African Journals Online (AJOL)

Prince Acheampong

A survey of 337 cotton farmers in the three northern regions of Ghana was ... five applications were made during the season. ... Keywords: cotton, farmer knowledge and perception, insect pest control, Ghana. .... bordered on tests of farmers' knowledge of cotton insect pests, their damage ..... Agricultural Experiment Station.

Remote sensing techniques for monitoring the Rio Grande Valley cotton stalk destruction program

Energy Technology Data Exchange (ETDEWEB)

Richardson, A.J.; Gerbermann, A.H.; Summy, K.R.; Anderson, G.L. (Department of Agriculture, Weslaco, TX (United States))

1993-09-01

Post harvest cotton (Gossypium hirsutum L.) stalk destruction is a cultural practice used in the Rio Grande Valley to suppress over wintering populations of boll weevils (Anthonomus grandis Boheman) without using chemicals. Consistent application of this practice could substantially reduce insecticide usage, thereby minimizing environmental hazards and increasing cotton production profits. Satellite imagery registered within a geographic information system was used to monitor the cotton stalk destruction program in the Rio Grande Valley. We found that cotton stalk screening procedures based on standard multispectral classification techniques could not reliably distinguish cotton from sorghum. Greenness screening for cotton plant stalks after the stalk destruction deadline was possible only where ground observations locating cotton fields were available. These findings indicate that a successful cotton stalk destruction monitoring program will require satellite images and earth referenced data bases showing cotton field locations.

Induced mutations for improvement of desi cotton

International Nuclear Information System (INIS)

Waghmare, V.N.; Mohan, Punit; Singh, Phundan; Gururajan, K.N.

2000-01-01

Desi cotton varieties of Gossypium arboreum have wide adaptability and are relatively tolerant to biotic (insect pests and diseases) and abiotic (moisture and salt) stresses. Desi varieties have got potential to yield even under adverse and low input situations. Most of them are synchronous in maturity and possess consistent fibre properties. Despite such merits, very little attention has been paid for improvement of desi cotton. The present area under arboreum varieties is 17.0% (15.30 lakh ha.) against 65% (35.75 lakh ha) during 1947-48. Deliberate attempts are required to improve G. arboreum for its economic and quality characters to compete with upland varieties in rainfed cotton ecology

Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

Science.gov (United States)

Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

2010-04-01

Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

Effects of saliva collection using cotton swab on cortisol enzyme immunoassay.

Science.gov (United States)

Kozaki, Tomoaki; Hashiguchi, Nobuko; Kaji, Yumi; Yasukouchi, Akira; Tochihara, Yutaka

2009-12-01

Cotton swabs are among the most commonly used devices for collecting saliva, but various studies have reported that their use impacts the results of salivary cortisol assays. These studies, however, estimated this impact by comparing the average of the concentration and/or scatter plots. In the present study, we estimated the impact of cotton swabs on the results of salivary cortisol enzyme immunoassay (EIA) by Bland-Altman plot. Eight healthy males (aged 20-23 years) provided four saliva samples on different days to yield a total of 32 samples. Saliva samples were collected directly in plastic tubes using plastic straws and then pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). There was a lower correlation between cotton and passive saliva collection. Individually, four subjects showed a negative correlation between passive and cotton saliva collection. A Bland-Altman plot indicated that cotton swabs causes a proportional bias on the EIA assay result. Our findings indicate a considerable effect of using cotton swabs for saliva collection, and subject-specific variability in the impact. A Bland-Altman plot further suggests possible reasons for this effect.

Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues

Directory of Open Access Journals (Sweden)

Viana Antonio AB

2011-11-01

Full Text Available Abstract Background Cotton (Gossypium spp. is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2 family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2 and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2 and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

International Nuclear Information System (INIS)

Robab, U.E.; )

2014-01-01

The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

Perspectives on transgenic, herbicide-resistant crops in the United States almost 20 years after introduction.

Science.gov (United States)

Duke, Stephen O

2015-05-01

Herbicide-resistant crops have had a profound impact on weed management. Most of the impact has been by glyphosate-resistant maize, cotton, soybean and canola. Significant economic savings, yield increases and more efficacious and simplified weed management have resulted in widespread adoption of the technology. Initially, glyphosate-resistant crops enabled significantly reduced tillage and reduced the environmental impact of weed management. Continuous use of glyphosate with glyphosate-resistant crops over broad areas facilitated the evolution of glyphosate-resistant weeds, which have resulted in increases in the use of tillage and other herbicides with glyphosate, reducing some of the initial environmental benefits of glyphosate-resistant crops. Transgenic crops with resistance to auxinic herbicides, as well as to herbicides that inhibit acetolactate synthase, acetyl-CoA carboxylase and hydroxyphenylpyruvate dioxygenase, stacked with glyphosate and/or glufosinate resistance, will become available in the next few years. These technologies will provide additional weed management options for farmers, but will not have all of the positive effects (reduced cost, simplified weed management, lowered environmental impact and reduced tillage) that glyphosate-resistant crops had initially. In the more distant future, other herbicide-resistant crops (including non-transgenic ones), herbicides with new modes of action and technologies that are currently in their infancy (e.g. bioherbicides, sprayable herbicidal RNAi and/or robotic weeding) may affect the role of transgenic, herbicide-resistant crops in weed management. Published 2014. This article is a U.S. Government work and is in the public domain in the USA. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Spatial and temporal distribution of cotton squares and small cotton bolls fallen on ground after damage by boll weevil and the efficiency of the equipment used to collect them

Directory of Open Access Journals (Sweden)

Carlos Alberto Domingues da Silva

Full Text Available ABSTRACT: In this study, we determined the spatial and temporal distribution of fallen cotton squares and small cotton bolls fallen damaged by boll weevil and the efficiency and time interval of the equipment used to collect cotton samples. Spatial and temporal distribution of cotton squares and small cotton bolls fallen on the soil damaged by boll weevil among cotton rows was determined in an experimental design of randomized blocks in a factorial arrangement of 4x3, represented by soil surface tracks located at 1-11cm, 12-22cm, 23-33cm, and 34-44cm away from the planting row of cotton plants 70, 85, and 100 days of age. Efficiency and collection time interval of the cotton samples fallen on the soil infested by boll weevil by plastic rakes that were straight or fan-shaped, big broom, collector instrument model CNPA and aspirator of leaves ‘Trapp’ were determined in randomized block design with five treatments, 10 repetitions for each. Results demonstrated that the collection of cotton samples must be performed with greater attention to soil strips located below the cotton top projection and aspirator ‘Trapp’ of leaves was more appropriate for the operation as it used less time of collection with similar efficiency to other available equipment.

Transformation and evaluation of Cry1Ac+Cry2A and GTGene in Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Agung Nugroho Puspito

2015-11-01

Full Text Available More than 50 countries around the globe cultivate cotton on a large scale. It is a major cash crop of Pakistan and is considered white gold because it is highly important to the economy of Pakistan. In addition to its importance, cotton cultivation faces several problems, such as insect pests, weeds, and viruses. In the past, insects have been controlled by insecticides, but this method caused a severe loss to the economy. However, conventional breeding methods have provided considerable breakthroughs in the improvement of cotton, but it also has several limitations. In comparison with conventional methods, biotechnology has the potential to create genetically modified plants that are environmentally safe and economically viable. In this study, a local cotton variety VH 289 was transformed with two Bt genes (Cry1Ac and Cry2A and a herbicide resistant gene (cp4 EPSPS using the Agrobacterium mediated transformation method. The constitutive CaMV 35S promoter was attached to the genes taken from Bacillus thuringiensis (Bt and to an herbicide resistant gene during cloning, and this promoter was used for the expression of the genes in cotton plants. This construct was used to develop the Glyphosate Tolerance Gene (GTGene for herbicide tolerance and insecticidal gene (Cry1Ac and Cry2A for insect tolerance in the cotton variety VH 289. The transgenic cotton variety performed 85% better compared with the non-transgenic variety. The study results suggest that farmers should use the transgenic cotton variety for general cultivation to improve the production of cotton.

Evaluation of selected acaricides against two-spotted spider mite (Acari: Tetranychidae) on greenhouse cotton using multispectral data

Science.gov (United States)

Two-spotted spider mite (TSSM), Tetranychus urticae (Koch), is an early season pest of cotton in the mid-southern United States and causes reduction in yield, fiber quality and impaired seed germination. Objectives of this study were to investigate the efficacy of abamectin and spiromesifen with two...

Single and multiple in-season measurements as indicators of at-harvest cotton boll damage caused by verde plant bug (Hemiptera: Miridae).

Science.gov (United States)

Brewer, Michael J; Armstrong, J Scott; Parker, Roy D

2013-06-01

The ability to monitor verde plant bug, Creontiades signatus Distant (Hemiptera: Miridae), and the progression of cotton, Gossypium hirsutum L., boll responses to feeding and associated cotton boll rot provided opportunity to assess if single in-season measurements had value in evaluating at-harvest damage to bolls and if multiple in-season measurements enhanced their combined use. One in-season verde plant bug density measurement, three in-season plant injury measurements, and two at-harvest damage measurements were taken in 15 cotton fields in South Texas, 2010. Linear regression selected two measurements as potentially useful indicators of at-harvest damage: verde plant bug density (adjusted r2 = 0.68; P = 0.0004) and internal boll injury of the carpel wall (adjusted r2 = 0.72; P = 0.004). Considering use of multiple measurements, a stepwise multiple regression of the four in-season measurements selected a univariate model (verde plant bug density) using a 0.15 selection criterion (adjusted r2 = 0.74; P = 0.0002) and a bivariate model (verde plant bug density-internal boll injury) using a 0.25 selection criterion (adjusted r2 = 0.76; P = 0.0007) as indicators of at-harvest damage. In a validation using cultivar and water regime treatments experiencing low verde plant bug pressure in 2011 and 2012, the bivariate model performed better than models using verde plant bug density or internal boll injury separately. Overall, verde plant bug damaging cotton bolls exemplified the benefits of using multiple in-season measurements in pest monitoring programs, under the challenging situation when at-harvest damage results from a sequence of plant responses initiated by in-season insect feeding.

Using atmospheric pressure plasma treatment for treating grey cotton fabric.

Science.gov (United States)

Kan, Chi-Wai; Lam, Chui-Fung; Chan, Chee-Kooi; Ng, Sun-Pui

2014-02-15

Conventional wet treatment, desizing, scouring and bleaching, for grey cotton fabric involves the use of high water, chemical and energy consumption which may not be considered as a clean process. This study aims to investigate the efficiency of the atmospheric pressure plasma (APP) treatment on treating grey cotton fabric when compared with the conventional wet treatment. Grey cotton fabrics were treated with different combinations of plasma parameters with helium and oxygen gases and also through conventional desizing, scouring and bleaching processes in order to obtain comparable results. The results obtained from wicking and water drop tests showed that wettability of grey cotton fabrics was greatly improved after plasma treatment and yielded better results than conventional desizing and scouring. The weight reduction of plasma treated grey cotton fabrics revealed that plasma treatment can help remove sizing materials and impurities. Chemical and morphological changes in plasma treated samples were analysed by FTIR and SEM, respectively. Finally, dyeability of the plasma treated and conventional wet treated grey cotton fabrics was compared and the results showed that similar dyeing results were obtained. This can prove that plasma treatment would be another choice for treating grey cotton fabrics. Copyright © 2013 Elsevier Ltd. All rights reserved.

Development of transgenic wheat (Triticum aestivum L.) expressing avidin gene conferring resistance to stored product insects.

Science.gov (United States)

Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed

2015-07-22

Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.

Fiber quality challenges facing the cotton industry

Science.gov (United States)

The cotton industry is in the midst of an exciting time with increased domestic consumption, but also facing pressure from other crops and the global marketplace. In order to ensure the US cotton crop remains the fiber of choice for the world it is important to keep an eye on the challenges to fibe...

Within canopy distribution of cotton seed N

Science.gov (United States)

Whole cotton seeds can be an important component of dairy rations. Nitrogen content of the seed is an important determinant of the feed value of the seed. Efforts to increase the seed value as feed will be enhanced with knowledge of the range and distribution of seed N within the cotton crop. This s...

Global alteration of microRNAs and transposon-derived small RNAs in cotton (Gossypium hirsutum) during Cotton leafroll dwarf polerovirus (CLRDV) infection.

Science.gov (United States)

Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S

2012-11-01

Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.

Various rates of k and Na influence growth, seed cotton yield and ionic ratio of two cotton varieties in soil culture

International Nuclear Information System (INIS)

Ali, L.; Maqsood, M.A.; Ashraf, M.

2009-01-01

Cotton is generally grown on alkaline calcareous soils in arid and semi-arid areas of the country. Sodium can interact with other earth cations like K, Ca and Mg. Therefore, a pot study was conducted to investigate the growth, yield and ionic response of two cotton varieties. Four levels of K and Na were developed after considering indigenous K, Na status in soil. The treatments of K+Na in mg/kg were adjusted as, 105+37.5, 135+30 135+37.5 and 105+30 (control). Control treatment represented indigenous K, Na status of soil. The experiment continued until maturity. Application of K and Na increased seed cotton yield and boll weight significantly (p<0.01). Both varieties varied non-significantly with respect to K:Na ratio in leaf. The beneficial effects of Na with K application over control on seed cotton yield and boll weight were greater in NIBGE-2 than in MNH-786. Increase in seed cotton yield was attributed to maximum boll weight of both varieties. Significant negative correlation (r= -0.89, - 0.76, n= 4) was found between K:Na ratio and K use efficiency in shoot of NIBGE-2 and MNH-786, respectively. (author)

Fiber sample presentation system for spectrophotometer cotton fiber color measurements

Science.gov (United States)

The Uster® High Volume Instrument (HVI) is used to class U.S. cotton for fiber color, yielding the industry accepted, cotton-specific color parameters Rd and +b. The HVI examines a 9 square inch fiber sample, and it is also used to test large AMS standard cotton “biscuits” or rectangles. Much inte...

IMPROVED SPECTROPHOTOMETER FIBER SAMPLING SYSTEM FOR COTTON FIBER COLOR MEASUREMENTS

Science.gov (United States)

Cotton in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), and the parameters Rd and +b are used to designate color grades for cotton fiber. However, Rd and +b are cotton-specific color parameters, and the need existed to demonstrate the relationships of Rd and +b to...

Understanding the relationship between cotton fiber properties and non-cellulosic cell wall polysaccharides

DEFF Research Database (Denmark)

Rajasundaram, Dhivyaa; Runavot, Jean-Luc; Guo, Xiaoyuan

2014-01-01

cotton fibers, which are of both biological and industrial importance. To this end, we attempted to study cotton fiber characteristics together with glycan arrays using regression based approaches. Taking advantage of the comprehensive microarray polymer profiling technique (CoMPP), 32 cotton lines from...... different cotton species were studied. The glycan array was generated by sequential extraction of cell wall polysaccharides from mature cotton fibers and screening samples against eleven extensively characterized cell wall probes. Also, phenotypic characteristics of cotton fibers such as length, strength...

Modern trends on development of cotton production and processing chain Uzbekistan

OpenAIRE

Abdimumin Alikulov

2010-01-01

The cotton production complex of Uzbekistan has high rating comparing other export oriented branches. Cotton fiber value in 2008 share made 12% from total export of the country. The paper observes some trends and policy developments in cotton industry development.

Cyclophosphamide increases transgene expression mediated by an oncolytic adenovirus in glioma-bearing mice monitored by bioluminescence imaging

NARCIS (Netherlands)

Lamfers, Martine L. M.; Fulci, Giulia; Gianni, Davide; Tang, Yi; Kurozumi, Kazuhiko; Kaur, Balveen; Moeniralm, Sharif; Saeki, Yoshinaga; Carette, Jan E.; Weissleder, Ralph; Vandertop, W. Peter; van Beusechem, Victor W.; Dirven, Clemens M. F.; Chiocca, E. Antonio

2006-01-01

Approaches to improve the oncolytic potency of replication-competent adenoviruses include the insertion of therapeutic transgenes into the viral genome. Little is known about the levels and duration of in vivo transgene expression by cells infected with such "armed" viruses. Using a tumor-selective

Quantification and characterization of cotton crop biomass residue

Science.gov (United States)

Cotton crop residual biomass remaining in the field after mechanical seed cotton harvest is not typically harvested and utilized off-site thereby generating additional revenue for producers. Recently, interest has increased in utilizing biomass materials as feedstock for the production of fuel and ...

Governing the transnational organic cotton network from Benin

NARCIS (Netherlands)

Glin, L.C.; Mol, A.P.J.; Oosterveer, P.J.M.; Vodouhè, S.

2012-01-01

In this article, we attempt to conceptualize the historical development and the governance structure of the transnational organic cotton network from Benin. We aim to discover how the organic cotton production-consumption network is governed locally and internationally. Existing bodies of literature

Zinc comprising coordination compounds as growth stimulants of cotton seeds

International Nuclear Information System (INIS)

Yusupov, Z.N.; Nurmatov, T.M.; Rakhimova, M.M.; Dzhafarov, M.I.; Nikolaeva, T.B.

1991-01-01

Present article is devoted to zinc comprising coordination compounds as growth stimulants of cotton seeds. The influence of zinc coordination compounds with physiologically active ligands on germinative energy and seed germination of cotton was studied. The biogical activity and effectiveness of zinc comprising coordination compounds at application them for humidification of cotton seeds was studied as well.

Women cotton pickers perceptions about health hazards due to pesticide use in irrigated punjab

International Nuclear Information System (INIS)

Abbas, M.; Mehmood, I.; Bashir, A.; Hassan, S.

2015-01-01

In Pakistan, cotton crop has special importance from the perspective of largest employment generation both for males and females in the production and value chains. Cotton picking is primarily a female specific activity in all cropping zones of Pakistan. Women cotton pickers mostly belong to poor rural society involved in this labour force to feed their families. Cotton pickers in Pakistan face some serious health related problems due to heavy use of pesticides on cotton crop. The present study was designed to investigate the problem faced by women cotton pickers and their role in household decision making. Overall 150 women cotton pickers were interviewed from Bahawalnagar, Sahiwal and Vehari districts of cotton-wheat zone of the Punjab. Summary statistics of women cotton pickers' showed mean average age was 33 years and had 2.4 ears of formal schooling and 10 years of cotton picking experience. The main reasons for cotton picking reported were to reduce family financial burden (30%) followed by better access to food and resource (23%) and better education of children (21%). Majority of the respondents (97.33%) reported that the mode of payments of cotton picking was in cash and the most of the respondents (83.70%) reported that they got wages in time. Only few respondents (8.70%) were aware of health hazards due to pesticides and only 10% women wear protective clothes during cotton picking. Majority of the respondents (76%) wash their clothes after cotton picking whereas almost all the respondents wash their hand after cotton picking. The women cotton pickers faced health problem, tiredness (54.5%), mental disturbance (9.90%) and fatigue (8.00%). More than 58% women reported their involvement in household decision making regarding food and groceries while 30.6% women involved in decision about education of children. It is suggested that the female cotton pickers should be educated about the importance (in terms of disease treatment and long-run health costs

Cotton proteomics for deciphering the mechanism of environment stress response and fiber development.

Science.gov (United States)

Zhou, Meiliang; Sun, Guoqing; Sun, Zhanmin; Tang, Yixiong; Wu, Yanmin

2014-06-13

Cotton fiber is considered as the backbone of the textile industry. The productivity of cotton crop is severely hampered by the occurrence of pathogens, pests, and various environmental factors. Nevertheless, cotton plant has developed sophisticated mechanisms to respond to environment stresses to avoid detrimental effects on its growth and development. Therefore, understanding the mechanisms of cotton fiber development and environment stress response is of considerable interest for designing agriculture breeding strategies to ensure sustainable productivity. The application of proteomics technologies to advance our knowledge in cotton fiber development and abiotic/biotic stress tolerance has increased dramatically in the last 5years as evidenced by the large amount of publications in this area. This review summarizes the work which has been reported for cotton proteomics and evaluates the findings in context of the approaches that are widely employed with the aim to generate novel insight useful for cotton improvement. Cotton (Gossypium spp.) is considered as the foremost commercially important fiber crop grown all over the world and is deemed as the backbone of the textile industry. Cotton is also an important source of edible oil seed and a nutrient-rich food crop as cottonseed contains high-quality protein and oil. The growth and productivity of cotton crop are often hampered by various biotic stress factors, such as insect pests and pathogens. In addition, cotton plants are frequently subjected to unavoidable environmental factors that cause abiotic stress, such as salt, heat and drought. Proteomic techniques provide one of the best options for understanding the gene function and phenotypic changes during cotton fiber development and stress response. This review first summarizes the work which has been reported for cotton proteomics about cotton fiber development and abiotic/biotic stress tolerance, and also evaluates the findings in context of the approaches

HVI Colorimeter and Color Spectrophotometer Relationships and Their Impacts on Developing "Traceable" Cotton Color Standards

Science.gov (United States)

Color measurements of cotton fiber and cotton textile products are important quality parameters. The Uster® High Volume Instrument (HVI) is an instrument used globally to classify cotton quality, including cotton color. Cotton color by HVI is based on two cotton-specific color parameters—Rd (diffuse...

Single-Wall Carbon Nanotube-Coated Cotton Yarn for Electrocardiography Transmission

Directory of Open Access Journals (Sweden)

Yuliang Zhao

2018-03-01

Full Text Available We fabricated a type of conductive fabric, specifically single-wall carbon nanotube-coated cotton yarns (SWNT-CYs, for electrocardiography (ECG signal transmission utilizing a “dipping and drying” method. The conductive cotton yarns were prepared by dipping cotton yarns in SWNTs (single-wall carbon nanotubes solutions and then drying them at room temperature—a simple process that shows consistency in successfully coating cotton yarns with conductive carbon nanotubes (CNTs. The influence of fabrication conditions on the conductivity properties of SWNT-CYs was investigated. The results demonstrate that our conductive yarns can transmit weak bio-electrical (i.e., ECG signals without significant attenuation and distortion. Our conductive cotton yarns, which combine the flexibility of conventional fabrics and the good conductivity of SWNTs, are promising materials for wearable electronics and sensor applications in the future.

In vitro microbiologic evaluation of PTFE and cotton as spacer materials.

Science.gov (United States)

Paranjpe, Avina; Jain, Sumita; Alibhai, Karim J; Wadhwani, Chandur P; Darveau, Richard P; Johnson, James D

2012-09-01

To microbiologically evaluate the efficacy of cotton and polytetrafluoroethylene (PTFE) tape used as spacer materials. Twenty-six extracted human molars were restored using either cotton or PTFE tape as spacers under a standardized provisional restorative material (Cavit). The teeth were incubated for 7 days in a culture of Streptococcus gordonii or in liquid media alone. The spacers were removed and tested for bacterial contamination. The access cavities were also evaluated for bacterial contamination. Nine of 10 teeth with cotton spacers and one of 10 teeth with PTFE spacers were positive for S gordonii growth. The nine teeth in the cotton group also showed contamination of the access cavities. Even under optimal conditions, cotton spacers may cause leakage into the access cavities. Cotton fibers may serve as a route for bacterial contamination of the access cavities and root canal space. In contrast, PTFE tape did not provide an avenue for bacterial contamination.

Cleanability Improvement of Cotton Fabrics Through Their Topographical Changes Due to the Conditioning with Cellulase Enzyme

NARCIS (Netherlands)

Calvimontes, A.; Lant, N.J.; Dutschk, Victoria

2012-01-01

In this study, topographical changes of woven cotton fabrics conditioned with a cellulase enzyme during several wash–dry cycles are systematically studied. A recent study of cellulase enzyme effect on cellulose films has proven that this substance selectively attacks amorphous regions of cellulose,

The cotton farming pipeline of Malawi and South Africa: Management implications

Directory of Open Access Journals (Sweden)

J. P. Grundling

2008-12-01

Full Text Available Purpose of the study: The purpose this paper is to identify and describe the characteristics and influences of the cotton farming pipeline in Malawi and South Africa. Problem investigated: A broad based approach was followed to investigate the cotton farming pipeline to identify the major driving forces of the cotton pipeline in each of the respective countries. Research approach: A qualitative field research approach was followed to compile data on cotton farming in Malawi and South Africa. Data was compiled upstream from input suppliers, downstream from ginners, cotton transport conveyors, cotton marketing managers and agricultural government officials as well as from farmers and agricultural organizations. Findings: In Malawi a family farming model is followed versus an industrial model of production in South Africa. Despite the differences in approach, the farmers in both countries are faced with similar problems. In this regard, an urgent rethinking of the technological conditions of production and the possibilities of technological change is needed. Recommendations: The research proposes that these countries can benefit from establishing institutions like agricultural co-operatives and mechanisms like the development of a free traffic mechanism of seed-cotton. Conclusion: The present research may assist in developing first layer managerial recommendations that could enhance the sustainability and co-existence of cotton farming in the two countries.

Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa

Science.gov (United States)

While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

Effect of cotton leaf-curl virus on the yield-components and fibre properties of cotton genotypes under varying plant spacing and nitrogen fertilizer

International Nuclear Information System (INIS)

Ahmad, S.; Hayat, K.; Ashraf, F.; Sadiq, M.A.

2008-01-01

Cotton leaf-curl virus (CLCu VB. Wala strain) is one of the major biotic constraints of cotton production in Punjab. Development of resistant cotton genotype is the most feasible, economical and effective method to combat this hazardous problem, but so far no resistant genotype has been reported. Therefore, the objective of this study was to compare yield and yield-components and fiber traits of different genotypes/varieties under different plant spacing and nitrogen fertilizer as a management strategy to cope with this viral disease. Field experiment was conducted during 2006-07 to evaluate the effect of genotype, plant spacing and nitrogen fertilizer on cotton. Five genotypes (MNH-786, MNH-789, MNH- 6070, CIM- 496, and BH-160), three plant-spacings (15, 30 and 45 cm) and three nitrogen fertilizer-levels (6.5, 8.6 and 11 bags Urea / ha) were studied. Results showed that significant differences exist for plant height, no. of bolls/m/sup -2/, seed-cotton yield (kg/ha) due to genotype, interaction of genotype with plant spacing and nitrogen fertilizer level. Whereas boll weight, ginning out-turn, staple length and fiber fineness were not affected significantly by the plant spacing and nitrogen fertilizer, the effect due to genotype was significant for these traits. CLCuV infestation varied significantly with genotypes, while all other factors, i.e., plant spacing and nitrogen fertilizers, have non-significant effect. As the major objective of cotton cultivation is production of lint for the country and seed- cotton yield for the farmers, it is noted that genotypes grown in narrow plant-spacing (15 cm) and higher nitrogen fertilizer level (11.0 bags of urea/ha) produced maximum seed-cotton yield under higher CLCu V infestation in case of CIM-496, MNH-789 and BH-I60, while the new strain MNH-6070 gave maximum yield under 30cm plant-spacing and 8.6 bags of urea/ha has the 2.3% CLCu V infestation was observed in this variety. From the present study, it is concluded that

Field evaluation of Bt cotton crop impact on nontarget pests: cotton aphid and boll weevil.

Science.gov (United States)

Sujii, E R; Togni, P H B; de A Ribeiro, P; de A Bernardes, T; Milane, P V G N; Paula, D P; Pires, C S S; Fontes, E M G

2013-02-01

Bt cotton plants expressing Cry1Ac protein have high specificity for the control of lepidopteran larvae. However, studies conducted in several countries have shown these plants have a differential impact on nontarget herbivores. The aim of this study was to compare the colonization rates and population abundance of the cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae) and the boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae), in plots of Bt (Nuopal) and non-Bt cotton (Delta Opal) in an experimental field in Brasilia, DF, Brazil. No difference was observed in the preference and colonization by winged aphids to plants from the two treatments. There was no significant difference in abundance of wingless aphids or in the production of winged aphids between treatments. Apparently, the parameters that control factors such as fecundity, survival, and dispersal were similar on both Bt and non-Bt plants. Monitoring of plants for coccinellids, a specialist predator of aphids, and ants that act on the dispersal of aphids among plants showed no significant difference between Bt and non-Bt plants, supporting the inference above. Regarding the effect on boll weevil, there was also no significant difference between treatments in the total number of fruiting structures attacked in each plot, the percentage of fruiting structures attacked per plant or on the number of weevils emerging from fruits with boll weevil damage from egg-laying, when damaged fruit samples were held in the laboratory. Based on these results, we conclude that there is no impact of Bt cotton crop expressing Cry1Ac on the nontarget herbivores tested under field conditions.

Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

Science.gov (United States)

Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

2005-04-01

Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

7 CFR 28.8 - Classification of cotton; determination.

Science.gov (United States)

2010-01-01

... Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of the Act, the classification of any cotton shall be determined by the quality of a sample in accordance... employees will determine all fiber property measurements using High Volume Instruments. The classification...

Current status of genetic engineering in cotton (Gossypium hirsutum L): an assessment.

Science.gov (United States)

Chakravarthy, Vajhala S K; Reddy, Tummala Papi; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

2014-06-01

Cotton is considered as the foremost commercially important fiber crop and is deemed as the backbone of the textile industry. The productivity of cotton crop, worldwide, is severely hampered by the occurrence of pests, weeds, pathogens apart from various environmental factors. Several beneficial agronomic traits, viz., early maturity, improved fiber quality, heat tolerance, etc. have been successfully incorporated into cotton varieties employing conventional hybridization and mutation breeding. Crop losses, due to biotic factors, are substantial and may be reduced through certain crop protection strategies. In recent years, pioneering success has been achieved through the adoption of modern biotechnological approaches. Genetically engineered cotton varieties, expressing Bacillus thuringiensis cry genes, proved to be highly successful in controlling the bollworm complex. Various other candidate genes responsible for resistance to insect pests and pathogens, tolerance to major abiotic stress factors such as temperature, drought and salinity, have been introduced into cotton via genetic engineering methods to enhance the agronomic performance of cotton cultivars. Furthermore, genes for improving the seed oil quality and fiber characteristics have been identified and introduced into cotton cultivars. This review provides a brief overview of the various advancements made in cotton through genetic engineering approaches.

The prevalence of byssinosis among cotton workers in the north of Benin.

Science.gov (United States)

Hinson, A V; Schlünssen, V; Agodokpessi, G; Sigsgaards, T; Fayomi, B

2014-10-01

Cotton is the main agricultural export product in Benin. Cotton dust is thus present in the air during the handling and processing of cotton. This dust contains a mixture of substances including ground up plant matter, fibres, bacteria, fungi, soil, pesticides, noncotton matter, and other contaminants. While cotton processing is decreasing in industrialized countries, it is increasing in developing countries. Cotton processing, particularly in the early processes of spinning, can cause byssinosis. To determine the respiratory effects of cotton dust exposure among cotton mill workers in Benin. In a cross-sectional study, 109 workers exposed to cotton dust and 107 unexposed workers were studied. The International Commission on Occupational Health (ICOH) questionnaire was used for data collection on respiratory symptoms. For each worker, crossshift pulmonary function was performed with a dry spirometer. Based on the severity of respiratory symptoms and spirometry byssinosis was defined and classified according to the criteria of Schilling, et al. The mean ± SD age of the exposed and unexposed workers was 46.3 ± 7.8 and 37.0 ± 8.3 years, respectively (pcotton mill workers in Benin is high and needs prompt attention of health care workers and policymakers.

Structure and properties of cotton fabrics treated with functionalized dialdehyde chitosan.

Science.gov (United States)

He, Xuemei; Tao, Ran; Zhou, Tianchi; Wang, Chunxia; Xie, Kongliang

2014-03-15

In this research, modified cotton fabrics were prepared by pad-dry-cure technique from the aldehyde chitosan solution containing 3-aminopropyltriethoxysilane (APTES) and 1,2-ethanediamine (EDA) respectively. The structural characterization of the modified cotton fabrics was performed by attenuated total reflection ATR, scanning electron microscopy (SEM) and thermogravimetry (TG) analysis and physical mechanical properties were measured. The adsorption kinetics of modified cotton fabrics were also investigated by using the pseudo first-order and pseudo second-order kinetic model. The dyeing rate constant k1, k2 and half adsorption time t1/2 were calculated, respectively. The results show that the mechanical properties of different modified cotton fabrics were improved, and the surface color depth values (K/S), UV index UPF and anti-wrinkle properties were better than those of untreated cotton. Dyeing kinetics data at different temperatures indicate that Direct Pink 12B up-take on the modified cotton fabrics fitted to pseudo second-order kinetic model. Copyright © 2014 Elsevier Ltd. All rights reserved.

Efficacy of Cotton Root Destruction and Winter Cover Crops for Suppression of Hoplolaimus columbus.

Science.gov (United States)

Davis, R F; Baird, R E; McNeil, R D

2000-12-01

The efficacy of rye (Secale cereale) and wheat (Triticum aestivum) winter cover crops and cotton stalk and root destruction (i.e., pulling them up) were evaluated in field tests during two growing seasons for Hoplolaimus columbus management in cotton. The effect of removing debris from the field following root destruction also was evaluated. Wheat and rye produced similar amounts of biomass, and both crops produced more biomass (P Cover crops did not suppress H. columbus population levels or increase subsequent cotton yields. Cotton root destruction did not affect cotton stand or plant height the following year. Cotton root destruction lowered (P rye or wheat cover crop or cotton root destruction following harvest is ineffective for H. columbus management in cotton.

Genome-wide functional analysis of cotton (Gossypium hirsutum in response to drought.

Directory of Open Access Journals (Sweden)

Yun Chen

Full Text Available Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6 of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene analysis showed that the normal biophysical profiles of cotton (cultivar J-13 were affected by drought stress, and some cellular metabolic processes (including photosynthesis were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

Pilot scale cotton gin trash energy recovery

Energy Technology Data Exchange (ETDEWEB)

Harp, S.L. [Oklahoma State Univ., Stillwater, OK (United States)

1993-12-31

During the summer of 1992 a 520,000 kcal/h (2,064,400 Btu/hr) biomass combustor was installed at a cotton gin in southwestern Oklahoma. The gin has a capacity of approximately 35 bales per hour. Each bale of cotton ginned weighs about 227 kg (500 lb) and produces about 68 kg (150 lb) of trash. Therefore, this gin produces about 52,360 kg (115,500 lb) of trash per day during a typical ginning season. Approximately 2 million kg (4 million lb) of gin trash are produced at this site each year. Cotton must first be dried to about 3-5% moisture content before the ginning process is begun. To accomplish this at this gin, two six million Btu/hour direct fired gas heaters are used to heat air for drying the cotton. The biomass combustor was installed to operate in parallel with one of the heaters to supply heated air for the drying process. A pneumatic conveying system was installed to intercept a portion of the gin trash and divert it to the burner. The burner was operated during the 1992 ginning season, which lasted from September through November, with few problems.

Influence of cover crops on insect pests and predators in conservation tillage cotton.

Science.gov (United States)

Tillman, Glynn; Schomberg, Harry; Phatak, Sharad; Mullinix, Benjamin; Lachnicht, Sharon; Timper, Patricia; Olson, Dawn

2004-08-01

In fall 2000, an on-farm sustainable agricultural research project was established for cotton, Gossypium hirsutum L., in Tift County, Georgia. The objective of our 2-yr research project was to determine the impact of several cover crops on pest and predator insects in cotton. The five cover crop treatments included 1) cereal rye, Secale cereale L., a standard grass cover crop; 2) crimson clover, Trifolium incarnatum L., a standard legume cover crop; 3) a legume mixture of balansa clover, Trifolium michelianum Savi; crimson clover; and hairy vetch, Vicia villosa Roth; 4) a legume mixture + rye combination; and 5) no cover crop in conventionally tilled fields. Three main groups or species of pests were collected in cover crops and cotton: 1) the heliothines Heliothis virescens (F.) and Helicoverpa zea (Boddie); 2) the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois); and 3) stink bugs. The main stink bugs collected were the southern green stink bug, Nezara viridula (L.); the brown stink bug, Euschistus servus (Say); and the green stink bug, Acrosternum hilare (Say). Cotton aphids, Aphis gossypii Glover, were collected only on cotton. For both years of the study, the heliothines were the only pests that exceeded their economic threshold in cotton, and the number of times this threshold was exceeded in cotton was higher in control cotton than in crimson clover and rye cotton. Heliothine predators and aphidophagous lady beetles occurred in cover crops and cotton during both years of the experiment. Geocoris punctipes (Say), Orius insidiosus (Say), and red imported fire ant, Solenopsis invicta Buren were relatively the most abundant heliothine predators observed. Lady beetles included the convergent lady beetle, Hippodamia convergens Guérin-Méneville; the sevenspotted lady beetle, Coccinella septempunctata L.; spotted lady beetle, Coleomegilla maculata (DeGeer); and the multicolored Asian lady beetle, Harmonia axyridis (Pallas). Density of G. punctipes was

5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

Science.gov (United States)

Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

2017-08-01

Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

Radiation degradation of short-cotton linters

International Nuclear Information System (INIS)

Ma Zue Teh; Zhou Rui Min

1984-01-01

Radiation degradation of short-cotton linters has been studied by using X-ray diffraction, an infrared spectrometer and a viscosimeter. Average molecular weight and crystallinity of short-cotton linters and the change of reducing sugar in γ-radiation degradation were examined. It was found that cellulosic saccharification in hydrolysis was enhanced with preirradiation of linter. This probably resulted from the radiation induced change of cellulosic structure. Sensitizers to promote radiation degradation effect were investigated. Carbon tetrachloride has been found to be effective. (author)

7 CFR 1427.16 - Movement and protection of warehouse-stored cotton.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Movement and protection of warehouse-stored cotton. 1427.16 Section 1427.16 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY... Cotton Loan and Loan Deficiency Payments § 1427.16 Movement and protection of warehouse-stored cotton. (a...

Current university and USDA lab cotton contamination research

Science.gov (United States)

U.S. cotton is considered to have some of the lowest levels of contamination in the world. However, that reputation is in jeopardy as complaints of contamination from domestic and foreign mills are on the rise. Cotton contamination can be classified under four major categorizes: fabrics and strings ...

cotton fabric 51

African Journals Online (AJOL)

DR. AMINU

1Department of Chemistry, Federal College of Education, Kano – Nigeria. 2Department of ... its versatility were examined taken into consideration, the molecular structure. ... hemicelluloses, pectin, coloring matter and ash ... temperature for a fixed period of time. These processes rendered the cotton 99% cellulose in nature.

Combining ability analysis in intraspecific f/sub 1/ diallel cross of upland cotton

International Nuclear Information System (INIS)

Khan, S.A.; Khan, N.U.; Mohammad, F.

2011-01-01

The research work comprised of combining ability and genetic variability in a 6 X 6 F1 diallel cross which was carried out during crop seasons 2008 and 2009 at Khyber Pakhtunkhwa Agricultural University, Peshawar, Pakistan. The parental genotypes (CIM-446, CIM-496, CIM-499, CIM-506, CIM-554 and CIM-707) were crossed in a complete diallel fashion during 2008. The 30 F1 hybrids and their parents were grown in a randomized complete block (RCB) design with three replications during 2009. Genotypes manifested significant (p less than or equal to 0.01) differences for days to first flowering, locules boll/sup -1/, seeds locule/sup -1/, lint % and seed cotton yield plant/sup -1/. The F1 hybrids showed significant increase over parents in mean values for all the traits. The correlation of seed cotton yield was significantly positive with majority of yield traits and negative with days to first flowering and lint %. Mean squares due to general (GCA) and specific combining ability (SCA) were highly significant for all the traits, except locules for GCA. Mean squares due to GCA were higher in magnitude than SCA for majority of the traits and their inheritance was mainly governed by additive type of gene action and partially by non-additive. Selection in such promising hybrids could be used in segregating generations, and also some specific cross combinations can be used for hybrid cotton production to increase the seed cotton yield. The best general combiners (CIM-446 and CIM-554) followed by CIM-496 and their utilization as one of the parents produced best specific F1 hybrids (CIM-446 X CIM-499, CIM-446 X CIM-554, CIM-496 X CIM-707 and CIM-506 X CIM-554) having valuable SCA determination and remarkable mean performance for most of the traits. Reciprocal crosses having prominent maternal effects also involved one of the general combiners for majority of the traits. The promising hybrids also exhibited earliness through which the crop can escape from pests attack and soil can

Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

Science.gov (United States)

Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

2013-08-01

Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

[New advances in animal transgenic technology].

Science.gov (United States)

Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang

2010-06-01

Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.

ENERGY USE EFFICIENCY AND ECONOMICAL ANALYSIS IN COTTON PRODUCTION SYSTEM IN AN ARID REGION: A CASE STUDY FOR ISFAHAN PROVINCE, IRAN

Directory of Open Access Journals (Sweden)

Mortaza Zahedi

2014-01-01

Full Text Available The objective of this survey was to evaluate the energy consumption and the economic analysis of cotton production in Esfahan province of Iran. For this purpose, data were selected from 47 cotton growers using a face-to-face questionnaire. The results indicate that cotton production consumed a total energy of 52507.8 MJ ha-1. Among sources of input energy, the contribution of energy related to diesel fuel (47% was highest, followed by chemical fertilizers (20% and water for irrigation (12%. The shares of direct and non renewable energy were 68.3% and 77.7%, respectively. The impacts of indirect and non-renewable energy on cotton yield were higher than those of direct and renewable energy. Energy use efficiency, specific energy, energy productivity, energy intensiveness, and net energy were 0.7, 19.2 MJ-1 kg, 0.10 kg MJ-1, 27.2 MJ-1 $ -1, -15625.2 MJ-1ha-1, respectively. Total cost of cotton production was 1927.9 $ ha-1. About 67% of the cost of production was variable costs, while 33% was fixed costs. The benefit to cost ratio was estimated 1.22. It is suggested that efforts to increase energy efficiency of cotton production in the investigated area should primarily focus on proper use of fertilizers and irrigation systems and also on saving diesel fuel by improving machinery operating performance.

The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

Science.gov (United States)

Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

2010-11-01

Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

Science.gov (United States)

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

Conductive Cotton Textile from Safely Functionalized Carbon Nanotubes

Directory of Open Access Journals (Sweden)

Mohammad Jellur Rahman

2015-01-01

Full Text Available Electroconductive cotton textile has been prepared by a simple dipping-drying coating technique using safely functionalized multiwalled carbon nanotubes (f-MWCNTs. Owing to the surface functional groups, the f-MWCNTs become strongly attached with the cotton fibers forming network armors on their surfaces. As a result, the textile exhibits enhanced electrical properties with improved thermal conductivity and therefore is demonstrated as a flexible electrothermal heating element. The fabricated f-MWCNTs/cotton textile can be heated uniformly from room temperature to ca. 100°C within few minutes depending on the applied voltage. The textile shows good thermal stability and repeatability during a long-term heating test.

The Optimal Tax on Antebellum U.S. Cotton Exports

OpenAIRE

Douglas A. Irwin

2001-01-01

The United States produced about 80 percent of the world's cotton in the decades prior to the Civil War. How much monopoly power did the United States possess in the world cotton market and what would have been the effect of an optimal export tax? This paper estimates the elasticity of foreign demand for U.S. cotton exports and uses the elasticity in a simple partial equilibrium model to calculate the optimal export tax and its effect on prices, trade, and welfare. The results indicate that t...

Increased frequency of pink bollworm resistance to Bt toxin Cry1Ac in China.

Directory of Open Access Journals (Sweden)

Peng Wan

Full Text Available Transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The main approach for delaying pest adaptation to Bt crops uses non-Bt host plants as "refuges" to increase survival of susceptible pests. To delay evolution of pest resistance to transgenic cotton producing Bt toxin Cry1Ac, the United States and some other countries have required refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. The "natural" refuge strategy focuses on cotton bollworm (Helicoverpa armigera, the primary target of Bt cotton in China that attacks many crops, but it does not apply to another major pest, pink bollworm (Pectinophora gossypiella, which feeds almost entirely on cotton in China. Here we report data showing field-evolved resistance to Cry1Ac by pink bollworm in the Yangtze River Valley of China. Laboratory bioassay data from 51 field-derived strains show that the susceptibility to Cry1Ac was significantly lower during 2008 to 2010 than 2005 to 2007. The percentage of field populations yielding one or more survivors at a diagnostic concentration of Cry1Ac increased from 0% in 2005-2007 to 56% in 2008-2010. However, the median survival at the diagnostic concentration was only 1.6% from 2008 to 2010 and failure of Bt cotton to control pink bollworm has not been reported in China. The early detection of resistance reported here may promote proactive countermeasures, such as a switch to transgenic cotton producing toxins distinct from Cry1A toxins, increased planting of non-Bt cotton, and integration of other management tactics together with Bt cotton.