Radioreceptor assay of opioid peptides in selected canine brain regions
International Nuclear Information System (INIS)
Desiderio, D.M.; Takeshita, H.
1985-01-01
A radioreceptor assay using the opioid delta receptor-preferring ligand D- 2 ala, D- 5 leu leucine enkephalin ( 3 H-DADL) and the broader-specificity ligand 3 H-etorphine was used to measure five HPLC-purified neuropeptide fractions derived from the peptide-rich fraction of tissue homogenates of nine anatomical regions of the canine brain. The receptoractive peptides studied were methionine enkephalin, alpha-neo-endorphin, dynorphin 1-8, methionine enkephalin-Arg-Phe, and leucine enkephalin. These peptides derive from two larger precursors: proenkephalin A, which contains methionine enkephalin, leucine enkephalin, methionine enkephalin-Arg-Phe; and proenkephalin B, which contains alpha-neo-endorphin and dynorphin 1-8. Receptoractive peptides were measured in the peptide-rich fraction derived from homogenates of canine hypothalamus, pituitary, caudate nucleus, amygdala, hippocampus, mid-brain, thalamus, pons-medulla, and cortex
Radioreceptor assay of opioid peptides in selected canine brain regions
Energy Technology Data Exchange (ETDEWEB)
Desiderio, D.M.; Takeshita, H.
1985-09-01
A radioreceptor assay using the opioid delta receptor-preferring ligand D-/sup 2/ala, D-/sup 5/leu leucine enkephalin (/sup 3/H-DADL) and the broader-specificity ligand /sup 3/H-etorphine was used to measure five HPLC-purified neuropeptide fractions derived from the peptide-rich fraction of tissue homogenates of nine anatomical regions of the canine brain. The receptoractive peptides studied were methionine enkephalin, alpha-neo-endorphin, dynorphin 1-8, methionine enkephalin-Arg-Phe, and leucine enkephalin. These peptides derive from two larger precursors: proenkephalin A, which contains methionine enkephalin, leucine enkephalin, methionine enkephalin-Arg-Phe; and proenkephalin B, which contains alpha-neo-endorphin and dynorphin 1-8. Receptoractive peptides were measured in the peptide-rich fraction derived from homogenates of canine hypothalamus, pituitary, caudate nucleus, amygdala, hippocampus, mid-brain, thalamus, pons-medulla, and cortex.
Serotonin transporter and dopamine transporter imaging in the canine brain
International Nuclear Information System (INIS)
Peremans, Kathelijne; Goethals, Ingeborg; De Vos, Filip; Dobbeleir, A.; Ham, Hamphrey; Van Bree, Henri; Heeringen, Cees van; Audenaert, Kurt
2006-01-01
The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [ 123 I]-β-CIT and [ 123 I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models
Expression and activity of the urokinase plasminogen activator system in canine primary brain tumors
Directory of Open Access Journals (Sweden)
Rossmeisl JH
2017-04-01
Full Text Available John H Rossmeisl,1–3 Kelli Hall-Manning,4 John L Robertson,1,3,5 Jamie N King,1,2 Rafael V Davalos,3,5 Waldemar Debinski,3 Subbiah Elankumaran6,† 1Veterinary and Comparative Neuro-Oncology Laboratory, 2Department of Small Animal Clinical Sciences, 3The Brain Tumor Center of Excellence, Wake Forest Baptist Medical Center Comprehensive Cancer Center, Winston-Salem, NC, 4Virginia Tech Animal Laboratory Services, Virginia-Maryland College of Veterinary Medicine, 5Department of Biomedical Engineering and Mechanics, Virginia Tech-Wake Forest University School of Biomedical Engineering and Sciences, Virginia Tech, 6Department of Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Blacksburg, VA, USA†The authors regret to advise of the passing of Dr Subbiah Elankumaran prior to publicationBackground: The expression of the urokinase plasminogen activator receptor (uPAR, a glycosylphosphatidylinositol-anchored protein family member, and the activity of its ligand, urokinase-type plasminogen activator (uPA, have been associated with the invasive and metastatic potentials of a variety of human brain tumors through their regulation of extracellular matrix degradation. Domesticated dogs develop naturally occurring brain tumors that share many clinical, phenotypic, molecular, and genetic features with their human counterparts, which has prompted the use of the dogs with spontaneous brain tumors as models to expedite the translation of novel brain tumor therapeutics to humans. There is currently little known regarding the role of the uPA system in canine brain tumorigenesis. The objective of this study was to characterize the expression of uPAR and the activity of uPA in canine brain tumors as justification for the development of uPAR-targeted brain tumor therapeutics in dogs.Methods: We investigated the expression of uPAR in 37 primary canine brain tumors using immunohistochemistry, Western blotting, real
Serotonin transporter and dopamine transporter imaging in the canine brain
Energy Technology Data Exchange (ETDEWEB)
Peremans, Kathelijne [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Goethals, Ingeborg [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); De Vos, Filip [Laboratory of Radiopharmacy, Pharmaceutical Sciences, Ghent University, B-9000 Ghent (Belgium); Dobbeleir, A. [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Ham, Hamphrey [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); Van Bree, Henri [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Heeringen, Cees van [Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium); Audenaert, Kurt [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium) and Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium)]. E-mail: kurt.audenaert@ugent.be
2006-10-15
The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [{sup 123}I]-{beta}-CIT and [{sup 123}I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models.
Li, Jonathan Y; Middleton, Dana M; Chen, Steven; White, Leonard; Ellinwood, N Matthew; Dickson, Patricia; Vite, Charles; Bradbury, Allison; Provenzale, James M
2017-08-01
Purpose We describe a novel technique for measuring diffusion tensor imaging metrics in the canine brain. We hypothesized that a standard method for region of interest placement could be developed that is highly reproducible, with less than 10% difference in measurements between raters. Methods Two sets of canine brains (three seven-week-old full-brains and two 17-week-old single hemispheres) were scanned ex-vivo on a 7T small-animal magnetic resonance imaging system. Strict region of interest placement criteria were developed and then used by two raters to independently measure diffusion tensor imaging metrics within four different white-matter regions within each specimen. Average values of fractional anisotropy, radial diffusivity, and the three eigenvalues (λ1, λ2, and λ3) within each region in each specimen overall and within each individual image slice were compared between raters by calculating the percentage difference between raters for each metric. Results The mean percentage difference between raters for all diffusion tensor imaging metrics when pooled by each region and specimen was 1.44% (range: 0.01-5.17%). The mean percentage difference between raters for all diffusion tensor imaging metrics when compared by individual image slice was 2.23% (range: 0.75-4.58%) per hemisphere. Conclusion Our results indicate that the technique described is highly reproducible, even when applied to canine specimens of differing age, morphology, and image resolution. We propose this technique for future studies of diffusion tensor imaging analysis in canine brains and for cross-sectional and longitudinal studies of canine brain models of human central nervous system disease.
In vivo electrical conductivity imaging of a canine brain using a 3 T MREIT system
International Nuclear Information System (INIS)
Kim, Hyung Joong; Oh, Tong In; Kim, Young Tae; Lee, Byung Il; Woo, Eung Je; Lee, Soo Yeol; Seo, Jin Keun; Kwon, Ohin; Park, Chunjae; Kang, Byeong Teck; Park, Hee Myung
2008-01-01
Magnetic resonance electrical impedance tomography (MREIT) aims at producing high-resolution cross-sectional conductivity images of an electrically conducting object such as the human body. Following numerous phantom imaging experiments, the most recent study demonstrated successful conductivity image reconstructions of postmortem canine brains using a 3 T MREIT system with 40 mA imaging currents. Here, we report the results of in vivo animal imaging experiments using 5 mA imaging currents. To investigate any change of electrical conductivity due to brain ischemia, canine brains having a regional ischemic model were scanned along with separate scans of canine brains having no disease model. Reconstructed multi-slice conductivity images of in vivo canine brains with a pixel size of 1.4 mm showed a clear contrast between white and gray matter and also between normal and ischemic regions. We found that the conductivity value of an ischemic region decreased by about 10–14%. In a postmortem brain, conductivity values of white and gray matter decreased by about 4–8% compared to those in a live brain. Accumulating more experience of in vivo animal imaging experiments, we plan to move to human experiments. One of the important goals of our future work is the reduction of the imaging current to a level that a human subject can tolerate. The ability to acquire high-resolution conductivity images will find numerous clinical applications not supported by other medical imaging modalities. Potential applications in biology, chemistry and material science are also expected
Identification of the rostral migratory stream in the canine and feline brain.
Directory of Open Access Journals (Sweden)
Saafan Z Malik
Full Text Available In the adult rodent brain, neural progenitor cells migrate from the subventricular zone of the lateral ventricle towards the olfactory bulb in a track known as the rostral migratory stream (RMS. To facilitate the study of neural progenitor cells and stem cell therapy in large animal models of CNS disease, we now report the location and characteristics of the normal canine and feline RMS. The RMS was found in Nissl-stained sagittal sections of adult canine and feline brains as a prominent, dense, continuous cellular track beginning at the base of the anterior horn of the lateral ventricle, curving around the head of the caudate nucleus and continuing laterally and ventrally to the olfactory peduncle before entering the olfactory tract and bulb. To determine if cells in the RMS were proliferating, the thymidine analog 5-bromo-2-deoxyuridine (BrdU was administered and detected by immunostaining. BrdU-immunoreactive cells were present throughout this track. The RMS was also immunoreactive for markers of proliferating cells, progenitor cells and immature neurons (Ki-67 and doublecortin, but not for NeuN, a marker of mature neurons. Luxol fast blue and CNPase staining indicated that myelin is closely apposed to the RMS along much of its length and may provide guidance cues for the migrating cells. Identification and characterization of the RMS in canine and feline brain will facilitate studies of neural progenitor cell biology and migration in large animal models of neurologic disease.
Low-field-strength magnetic resonance imaging in the canine brain
International Nuclear Information System (INIS)
Esteve Ratsch, B.
2000-06-01
Magnetic resonance imaging (MRI; 0,23 T) of the canine brain was performed. Each scan plane was compared with corresponding anatomic sections. The best imaging planes to visualize various anatomic structures were determined. Low-field-strength MRI allowed the good definition of all relevant anatomic structures of the brain of 55 dogs with the exception of most cranial nerves. White matter could be best differentiated using proton-weighted images. On T1-weighted images the contrast of white matter was markedly limited in the living dogs in contrast to the examined canine specimens. The relative size of the lateral ventricle was defined as the ratio of the size of the lateral ventricle and the size of the half brain. The relative size of the lateral ventricle of Yorkshire Terrier dogs (5,35 %) was significantly (p 0,05) in the relative size of the lateral ventricles of healthy Yorkshire Terrier dogs (5,35 %) and Yorkshire Terrier dogs with neurological symptoms (7,06 %). Asymmetric lateral ventricles were very common in the examined dogs independently from body size, skull shape and neurological status. Occasionally the septum telencephali was not developed completely. 11 of 12 intracranial neoplasm could be delineated using low-field-strength MRI. Anatomic site, number of intracerebral lesions, limitation, shape and growth pattern, secondary brain lesions and development of peritumoral edema were described for each intracranial neoplasm as well as its signal intensity on T1- and T2-weighted images and contrast enhancement pattern. MRI did not allow an accurate diagnosis of tumor type, nevertheless skull shape (brachycephalic/dolichocephalic), anatomic site and number of intracerebral lesions facilitated a presumable diagnosis of the tumor type. (author)
Anisotropic Conductivity Tensor Imaging of In Vivo Canine Brain Using DT-MREIT.
Jeong, Woo Chul; Sajib, Saurav Z K; Katoch, Nitish; Kim, Hyung Joong; Kwon, Oh In; Woo, Eung Je
2017-01-01
We present in vivo images of anisotropic electrical conductivity tensor distributions inside canine brains using diffusion tensor magnetic resonance electrical impedance tomography (DT-MREIT). The conductivity tensor is represented as a product of an ion mobility tensor and a scale factor of ion concentrations. Incorporating directional mobility information from water diffusion tensors, we developed a stable process to reconstruct anisotropic conductivity tensor images from measured magnetic flux density data using an MRI scanner. Devising a new image reconstruction algorithm, we reconstructed anisotropic conductivity tensor images of two canine brains with a pixel size of 1.25 mm. Though the reconstructed conductivity values matched well in general with those measured by using invasive probing methods, there were some discrepancies as well. The degree of white matter anisotropy was 2 to 4.5, which is smaller than previous findings of 5 to 10. The reconstructed conductivity value of the cerebrospinal fluid was about 1.3 S/m, which is smaller than previous measurements of about 1.8 S/m. Future studies of in vivo imaging experiments with disease models should follow this initial trial to validate clinical significance of DT-MREIT as a new diagnostic imaging modality. Applications in modeling and simulation studies of bioelectromagnetic phenomena including source imaging and electrical stimulation are also promising.
Qeska, V; Barthel, Y; Iseringhausen, M; Tipold, A; Stein, V M; Khan, M A; Baumgärtner, W; Beineke, A
2013-12-15
Canine distemper virus (CDV) infection causes immunosuppression and demyelinating leukoencephalitis in dogs. In viral diseases, an ambiguous function of regulatory T cells (Treg), with both beneficial effects by reducing immunopathology and detrimental effects by inhibiting antiviral immunity, has been described. However, the role of Treg in the pathogenesis of canine distemper remains unknown. In order to determine the effect of CDV upon immune homeostasis, the amount of Foxp3(+) Treg in spleen and brain of naturally infected dogs has been determined by immunohistochemistry. In addition, splenic cytokine expression has been quantified by reverse transcriptase polymerase chain reaction. Splenic depletion of Foxp3(+) Treg was associated with an increased mRNA-expression of tumor necrosis factor and decreased transcription of interleukin-2 in the acute disease phase, indicative of disturbed immunological counter regulation in peripheral lymphoid organs. In the brain, a lack of Foxp3(+) Treg in predemyelinating and early demyelinating lesions and significantly increased infiltrations of Foxp3(+) Treg in chronic demyelinating lesions were observed. In conclusion, disturbed peripheral and CNS immune regulation associated with a reduction of Treg represents a potential prerequisite for excessive neuroinflammation and early lesion development in canine distemper leukoencephalitis. © 2013 Elsevier B.V. All rights reserved.
Pilot Study on Long Term Effects of HZE Exposure on the Canine Brain
Budinger, T.; Brennan, K.; Pearlstein, R.
A ground-based pilot experiment was initiated in December 1992 to evaluate the long term effects on health and aging after HZE cosmic radiation of the canine brain. Six adult male beagle dogs (1 yr) from the UC Davis breeding colony at the Laboratory for Energy Related Health Research were researched in this study. Iron nuclei at 600 MeV/amu (180 keV/mm) were used to irradiate the whole brain. The fluence of 3 x 106 iron nuclei/ cm2 mimics the HZE exposure (all > He) for a 2- year mission to Mars. The HZE irradiation was a fully stripped iron particle beam at the LBNL BEVALAC. Using a Raster Scanner we were able to spread the beam to deliver a uniform dose over the brain. The total dose to the brain was 200 cGy. Four dogs were whole brain irradiated with iron and two dogs served as litter-mate controls. The control dogs received a similar amount of background neutron irradiation as the irradiated dogs. One of the control dogs died suddenly 3/98 of intestinal cancer unrelated to the brain irradiation. That brain was not harvested before autolysis had prevented analysis. Periodic PET metabolism and yearly MRI studies have been done on these dog's brain since irradiation. All dogs had yearly physical, neurological and blood chemistry work-ups. PET imaging was performed with the Donner 600-crystal high-resolution PET (2.6 mm resolution) and with the commercial PET, CTI/Siemens ECAT 951 PET Scanner (5 mm resolution). NMR imaging is performed with the 1 5T GE Signa at UCSF using T spoiled gradient imaging.1 sequences for T1 contrast at 1 mm resolution as well as a T2 weighted spin echo imaging sequence at 1 mm resolution. A major goal of this work is to present an accurate method for measuring surface areas and volumes of the irradiated vs the non-irradiated canine brain using MRI data which are isotropic in resolution at the 1 mm level. This allows us to monitor the changes in brain size with aging and radiation exposure. Nine years post irradiation, these dog brains
Immunohistochemical study of doublecortin and nucleostemin in canine brain
Directory of Open Access Journals (Sweden)
E. De Nevi
2013-03-01
Full Text Available Finding a marker of neural stem cells remains a medical research priority. It was reported that the proteins doublecortin and nucleostemin were related with stem/progenitor cells in central nervous system. The aim of the present immunohistochemical study was to evaluate the expression of these proteins and their pattern of distribution in canine brain, including age-related changes, and in non-nervous tissues. We found that doublecortin had a more specific expression pattern, related with neurogenesis and neuronal migration, while nucleostemin was expressed in most cells of almost every tissue studied. The immunolabeling of both proteins decreased with age. We may conclude that nucleostemin is not a specific marker of stem/progenitor cells in the dog. Doublecortin, however, is not an exclusive marker of neural stem cells, but also of neuronal precursors.
CCK-5: sequence analysis of a small cholecystokinin from canine brain and intestine
International Nuclear Information System (INIS)
Shively, J.; Reeve, J.R. Jr.; Eysselein, V.E.; Ben-Avram, C.; Vigna, S.R.; Walsh, J.H.
1987-01-01
The purpose of this study is to purify and to characterize chemically cholecystokinin (CCK)-like peptides present in brain and gut extracts that elute from gel filtration after the octapeptide. Canine small intestinal mucosa and brain were boiled in water and then extracted in cold trifluoroacetic acid, and cholecystokinin-like immunoreactivity was determined by carboxyl-terminal specific radioimmunoassay. Gel permeation chromatography on Sephadex G-50 revealed a form of CCK apparently smaller than CCK-8. Microsequence analysis showed that the amino terminal primary sequence of this small CCK was Gly-Trp-Met-Asp. Immunochemical and chromatographic analysis indicated that the carboxyl-terminal residue was Phe-NH 2 and thus the full sequence is Gly-Trp-Met-Asp-Phe-NH 2 . An antibody that recognizes synthetic CCK-8, CCK-5, and CCK-equally did not reveal the presence of significant amounts of CCK-4. These results indicate that CCK-5 is the major CCK form smaller than the octapeptide present in brain and small intestine. This finding, coupled with the demonstration by others that CCK-5 interacts with high-affinity brain CCK receptors, indicates that CCK-5 may play a physiological role in brain function
Milne, Marjorie E; Steward, Christopher; Firestone, Simon M; Long, Sam N; O'Brien, Terrence J; Moffat, Bradford A
2016-04-01
To develop representative MRI atlases of the canine brain and to evaluate 3 methods of atlas-based segmentation (ABS). 62 dogs without clinical signs of epilepsy and without MRI evidence of structural brain disease. The MRI scans from 44 dogs were used to develop 4 templates on the basis of brain shape (brachycephalic, mesaticephalic, dolichocephalic, and combined mesaticephalic and dolichocephalic). Atlas labels were generated by segmenting the brain, ventricular system, hippocampal formation, and caudate nuclei. The MRI scans from the remaining 18 dogs were used to evaluate 3 methods of ABS (manual brain extraction and application of a brain shape-specific template [A], automatic brain extraction and application of a brain shape-specific template [B], and manual brain extraction and application of a combined template [C]). The performance of each ABS method was compared by calculation of the Dice and Jaccard coefficients, with manual segmentation used as the gold standard. Method A had the highest mean Jaccard coefficient and was the most accurate ABS method assessed. Measures of overlap for ABS methods that used manual brain extraction (A and C) ranged from 0.75 to 0.95 and compared favorably with repeated measures of overlap for manual extraction, which ranged from 0.88 to 0.97. Atlas-based segmentation was an accurate and repeatable method for segmentation of canine brain structures. It could be performed more rapidly than manual segmentation, which should allow the application of computer-assisted volumetry to large data sets and clinical cases and facilitate neuroimaging research and disease diagnosis.
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
In vivo proton MR spectroscopy of canine status epilepticus
International Nuclear Information System (INIS)
Sandstrom, J.C.; Partington, C.R.; Perman, W.H.
1988-01-01
Invasive studies of rodent seizure models have demonstrated twice-normal lactate accumulation at the seizure focus. The authors investigated metabolic changes in canine kainic acid-induced seizures by means of in vivo volume-selective water-suppressed proton MR spectroscopy (MVSTE pulse sequence). Spectra from several experiments are presented demonstrating changes in lactate and MR imaging-visible lipid concentration. Spectra were obtained with interlaced acquisition from the brain and an external standard for relative quantification, with best-case line width of 4 Hz and typical line widths of 7-15 Hz at 1.5 T. Direct injection of NAA and lactate in the brain allowed in vivo identification of resonances
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
T1 changes of canine brain in hyponatremic hypoosmosis induced by peritoneal dialysis with water
International Nuclear Information System (INIS)
Tsuji, Takayuki; Fujimoto, Toshiro; Fujii, Masatoshi; Nakano, Toshihiko; Shimooki, Susumu.
1991-01-01
Changes of canine brain T 1 s measured in right and left white (W-T 1 ) and gray (G-T 1 ) matter, thalamus (T-T 1 ), and caudate nucleus (C-T 1 ) in coronal view with a head coil was studied in anesthesized and automatically ventilated 11 mongrel dogs (9.2±2.2 kg) using 0.1 T MR imager (Mark-J, Siemens-Asahi Meditech) before and every 30 minutes after infusion of distilled water warmed at 37degC into abdominal cavity (192±50 ml/kg) up to 120 minute later. Hemolysis (2→85 mg/dl: before→after 120 min) increased in association with total protein (5.9→8.0 g/dl) while sodium (147→122 mEq/l) and osmolarity (302→263 mOsm/kg) decreased. G-T 1 (388→394 ms) and W-T 1 (287→305 ms) did not change significantly, but T-T 1 prolonged early (331→349 ms) at 60 min (p 1 (356→376 ms) did at 90 min (p 1 (363 ms) and C-T 1 (382 ms) elongated from initial each T 1 significantly (p<0.01) 7% and 6% at 120 min, respectively. Basal nuclei, especially thalamus, in canine brain became edematous at the early stage of hyponatremic hypoosmosis induced by peritoneal dialysis with water. (author)
Selective vulnerability in brain hypoxia
DEFF Research Database (Denmark)
Cervos-Navarro, J.; Diemer, Nils Henrik
1991-01-01
Neuropathology, selective vulnerability, brain hypoxia, vascular factors, excitotoxicity, ion homeostasis......Neuropathology, selective vulnerability, brain hypoxia, vascular factors, excitotoxicity, ion homeostasis...
Evolution of brain region volumes during artificial selection for relative brain size.
Kotrschal, Alexander; Zeng, Hong-Li; van der Bijl, Wouter; Öhman-Mägi, Caroline; Kotrschal, Kurt; Pelckmans, Kristiaan; Kolm, Niclas
2017-12-01
The vertebrate brain shows an extremely conserved layout across taxa. Still, the relative sizes of separate brain regions vary markedly between species. One interesting pattern is that larger brains seem associated with increased relative sizes only of certain brain regions, for instance telencephalon and cerebellum. Till now, the evolutionary association between separate brain regions and overall brain size is based on comparative evidence and remains experimentally untested. Here, we test the evolutionary response of brain regions to directional selection on brain size in guppies (Poecilia reticulata) selected for large and small relative brain size. In these animals, artificial selection led to a fast response in relative brain size, while body size remained unchanged. We use microcomputer tomography to investigate how the volumes of 11 main brain regions respond to selection for larger versus smaller brains. We found no differences in relative brain region volumes between large- and small-brained animals and only minor sex-specific variation. Also, selection did not change allometric scaling between brain and brain region sizes. Our results suggest that brain regions respond similarly to strong directional selection on relative brain size, which indicates that brain anatomy variation in contemporary species most likely stem from direct selection on key regions. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Energy Technology Data Exchange (ETDEWEB)
Tsuji, Takayuki; Fujimoto, Toshiro (Tokyo Medical and Dental Univ. (Japan). Inst. for Medical and Dental Engineering); Fujii, Masatoshi; Nakano, Toshihiko; Shimooki, Susumu
1991-09-01
Changes of canine brain T{sub 1}s measured in right and left white (W-T{sub 1}) and gray (G-T{sub 1}) matter, thalamus (T-T{sub 1}), and caudate nucleus (C-T{sub 1}) in coronal view with a head coil was studied in anesthesized and automatically ventilated 11 mongrel dogs (9.2{+-}2.2 kg) using 0.1 T MR imager (Mark-J, Siemens-Asahi Meditech) before and every 30 minutes after infusion of distilled water warmed at 37degC into abdominal cavity (192{+-}50 ml/kg) up to 120 minute later. Hemolysis (2{yields}85 mg/dl: before{yields}after 120 min) increased in association with total protein (5.9{yields}8.0 g/dl) while sodium (147{yields}122 mEq/l) and osmolarity (302{yields}263 mOsm/kg) decreased. G-T{sub 1} (388{yields}394 ms) and W-T{sub 1} (287{yields}305 ms) did not change significantly, but T-T{sub 1} prolonged early (331{yields}349 ms) at 60 min (p<0.05) and C-T{sub 1} (356{yields}376 ms) did at 90 min (p<0.05). T-T{sub 1} (363 ms) and C-T{sub 1} (382 ms) elongated from initial each T{sub 1} significantly (p<0.01) 7% and 6% at 120 min, respectively. Basal nuclei, especially thalamus, in canine brain became edematous at the early stage of hyponatremic hypoosmosis induced by peritoneal dialysis with water. (author).
Magnetic resonance spectroscopy of the canine brain at 3.0 T and 7.0 T.
Martin-Vaquero, Paula; da Costa, Ronaldo C; Echandi, Rita L; Sammet, Christina L; Knopp, Michael V; Sammet, Steffen
2012-08-01
The purpose of this study was to evaluate the feasibility of proton magnetic resonance spectroscopy (1H MRS) to study the concentration of metabolites in the brain of dogs at 3.0 and 7.0 T. Four healthy male beagles were scanned using 3.0 T and 7.0 T human magnetic resonance imaging (MRI) units. The results obtained showed that all dogs had excellent quality spectra for a small (1 cm3) and large (8 cm3) voxel at 3.0 T, whereas only 2 dogs had high quality spectra at 7.0 T due to insufficient water suppression. 1H MRS at 3.0 T appears to be a reliable method to study metabolite concentrations in the canine brain. The development of more advanced water suppression techniques is necessary to improve the results at 7.0 T. Copyright © 2011 Elsevier Ltd. All rights reserved.
Hicks, Jill; Barber, Renee; Childs, Bronwen; Kirejczyk, Shannon Gm; Uhl, Elizabeth W
2017-04-17
A 6-year-old spayed female miniature schnauzer presented with generalized seizures and progressive multifocal intracranial neurologic disease. Thoracic radiographs and computed tomography (CT) revealed a large solitary pulmonary mass within the right cranial lung lobe. On brain magnetic resonance imaging (MRI), a solitary intraparenchymal mass within the left piriform lobe had a "target" appearance on both pre- and postcontrast sequences. Cerebrospinal fluid was unremarkable and histopathology indicated both masses represented histiocytic sarcoma. This case represents an uncommonly reported MRI appearance of histiocytic sarcoma in the canine brain and a large, solitary-appearing pulmonary histiocytic sarcoma in the same dog. © 2017 American College of Veterinary Radiology.
Energy Technology Data Exchange (ETDEWEB)
Moran, Jean M. [Univ. of Idaho, Idaho Falls, ID (United States)
1992-02-01
Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models.
International Nuclear Information System (INIS)
Moran, J.M.
1992-02-01
Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models
Low-Field Magnetic Resonance Imaging of Canine Hydrocephalus
Directory of Open Access Journals (Sweden)
Z. Adamiak* and M. Jaskólska and A. Pomianowski1
2012-01-01
Full Text Available The aim of presented study was to evaluate selected surface spine coil, and low-field magnetic resonance (MR selected sequences in diagnosing hydrocephalus in dogs. This paper discusses 19 dogs (14 canine patients with hydrocephalus and 5 healthy dogs, of five breeds, subjected to low-field magnetic resonance imaging (MRI of hydrocephalus. Area of the lateral ventricles and brain were examined in dogs with hydrocephalus using low-field MRI (at 0.25 Tesla. The MRI of FSE REL, SE, FLAIR, STIR, 3D HYCE, T3DT1, GE STIR 3D and 3D SHARC sequences with an indication of the most effective sequences are described. Additionally, coils for MR were compared, and models for infusion anesthesia were described. As a result of performed study all estimated sequences were diagnostically useful. However, spinal coil No. 2 (ESAOTE was the most optimal for examining and positioning the cranium.
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Primate brain architecture and selection in relation to sex.
Lindenfors, Patrik; Nunn, Charles L; Barton, Robert A
2007-05-10
Social and competitive demands often differ between the sexes in mammals. These differing demands should be expected to produce variation in the relative sizes of various brain structures. Sexual selection on males can be predicted to influence brain components handling sensory-motor skills that are important for physical competition or neural pathways involving aggression. Conversely, because female fitness is more closely linked to ecological factors and social interactions that enable better acquisition of resources, social selection on females should select for brain components important for navigating social networks. Sexual and social selection acting on one sex could produce sexual dimorphism in brain structures, which would result in larger species averages for those same brain structures. Alternatively, sex-specific selection pressures could produce correlated effects in the other sex, resulting in larger brain structures for both males and females of a species. Data are presently unavailable for the sex-specific sizes of brain structures for anthropoid primates, but under either scenario, the effects of sexual and social selection should leave a detectable signal in average sizes of brain structures for different species. The degree of male intra-sexual selection was positively correlated with several structures involved in autonomic functions and sensory-motor skills, and in pathways relating to aggression and aggression control. The degree of male intra-sexual selection was not correlated with relative neocortex size, which instead was significantly positively correlated with female social group size, but negatively correlated with male group size. Sexual selection on males and social selection on females have exerted different effects on primate brain architecture. Species with a higher degree of male intra-sexual selection carry a neural signature of an evolutionary history centered on physical conflicts, but no traces of increased demands on
Primate brain architecture and selection in relation to sex
Directory of Open Access Journals (Sweden)
Nunn Charles L
2007-05-01
Full Text Available Abstract Background Social and competitive demands often differ between the sexes in mammals. These differing demands should be expected to produce variation in the relative sizes of various brain structures. Sexual selection on males can be predicted to influence brain components handling sensory-motor skills that are important for physical competition or neural pathways involving aggression. Conversely, because female fitness is more closely linked to ecological factors and social interactions that enable better acquisition of resources, social selection on females should select for brain components important for navigating social networks. Sexual and social selection acting on one sex could produce sexual dimorphism in brain structures, which would result in larger species averages for those same brain structures. Alternatively, sex-specific selection pressures could produce correlated effects in the other sex, resulting in larger brain structures for both males and females of a species. Data are presently unavailable for the sex-specific sizes of brain structures for anthropoid primates, but under either scenario, the effects of sexual and social selection should leave a detectable signal in average sizes of brain structures for different species. Results The degree of male intra-sexual selection was positively correlated with several structures involved in autonomic functions and sensory-motor skills, and in pathways relating to aggression and aggression control. The degree of male intra-sexual selection was not correlated with relative neocortex size, which instead was significantly positively correlated with female social group size, but negatively correlated with male group size. Conclusion Sexual selection on males and social selection on females have exerted different effects on primate brain architecture. Species with a higher degree of male intra-sexual selection carry a neural signature of an evolutionary history centered on
Directory of Open Access Journals (Sweden)
Ciaputa Rafał
2015-04-01
Full Text Available Immunohistochemical profiles of the most common canine testicular tumours, including the Leydig cell tumours, seminomas, and Sertoli cell tumours were analysed, and the results were compared with those obtained in the corresponding types of human testicular neoplasms. The expressions of vimentin, von Willebrand factor (FVIII, chromogranin A, synaptophysin, and MCM3 were quantified. In the case of Sertoli cell tumours, only canine ones were analysed, since this type of tumour is very rarely diagnosed in men. The expression of the analysed proteins in the testicular tumours was similar. The von Willebrand factor exhibited the strongest expression in Leydig cell tumours in dogs and men, while vimentin was expressed more strongly in dogs (96.7% had an intensity at +++ than in men (62.5% had +++ in the Leydigioma. The immunoexpression of MCM3 in seminomas was high in both men and dogs – 90% +++ and 100% +++ respectively. The lack of chromogranin A and synaptophysin was observed in almost 100% of seminomas in men and dogs. This differed from the results obtained for Leydigioma, where chromogranin A was expressed in 70% of dogs at +++ and in 100% of men at ++++. The results may indicate that the antibodies were selected correctly. Their analysis and interpretation provides valuable information concerning the nature of the studied tumours.
International Nuclear Information System (INIS)
Nadeau, Marie-Ève; Rico, Charlène; Tsoi, Mayra; Vivancos, Mélanie; Filimon, Sabin; Paquet, Marilène; Boerboom, Derek
2015-01-01
Valosin containing protein (VCP) is a critical mediator of protein homeostasis and may represent a valuable therapeutic target for several forms of cancer. Overexpression of VCP occurs in many cancers, and often in a manner correlating with malignancy and poor outcome. Here, we analyzed VCP expression in canine lymphoma and assessed its potential as a therapeutic target for this disease. VCP expression in canine lymphomas was evaluated by immunoblotting and immunohistochemistry. The canine lymphoma cell lines CLBL-1, 17–71 and CL-1 were treated with the VCP inhibitor Eeyarestatin 1 (EER-1) at varying concentrations and times and were assessed for viability by trypan blue exclusion, apoptosis by TUNEL and caspase activity assays, and proliferation by propidium iodide incorporation and FACS. The mechanism of EER-1 action was determined by immunoblotting and immunofluorescence analyses of Lys48 ubiquitin and markers of ER stress (DDIT3), autophagy (SQSTM1, MAP1LC3A) and DNA damage (γH2AFX). TRP53/ATM-dependent signaling pathway activity was assessed by immunoblotting for TRP53 and phospho-TRP53 and real-time RT-PCR measurement of Cdkn1a mRNA. VCP expression levels in canine B cell lymphomas were found to increase with grade. EER-1 treatment killed canine lymphoma cells preferentially over control peripheral blood mononuclear cells. EER-1 treatment of CLBL-1 cells was found to both induce apoptosis and cell cycle arrest in G1. Unexpectedly, EER-1 did not appear to act either by inducing ER stress or inhibiting the aggresome-autophagy pathway. Rather, a rapid and dramatic increase in γH2AFX expression was noted, indicating that EER-1 may act by promoting DNA damage accumulation. Increased TRP53 phosphorylation and Cdkn1a mRNA levels indicated an activation of the TRP53/ATM DNA damage response pathway in response to EER-1, likely contributing to the induction of apoptosis and cell cycle arrest. These results correlate VCP expression with malignancy in canine B cell
Positive selection on gene expression in the human brain
DEFF Research Database (Denmark)
Khaitovich, Philipp; Tang, Kun; Franz, Henriette
2006-01-01
Recent work has shown that the expression levels of genes transcribed in the brains of humans and chimpanzees have changed less than those of genes transcribed in other tissues [1] . However, when gene expression changes are mapped onto the evolutionary lineage in which they occurred, the brain...... shows more changes than other tissues in the human lineage compared to the chimpanzee lineage [1] , [2] and [3] . There are two possible explanations for this: either positive selection drove more gene expression changes to fixation in the human brain than in the chimpanzee brain, or genes expressed...... in the brain experienced less purifying selection in humans than in chimpanzees, i.e. gene expression in the human brain is functionally less constrained. The first scenario would be supported if genes that changed their expression in the brain in the human lineage showed more selective sweeps than other genes...
Peptide YY receptors in the brain
International Nuclear Information System (INIS)
Inui, A.; Oya, M.; Okita, M.
1988-01-01
Radiolabelled ligand binding studies demonstrated that specific receptors for peptide YY are present in the porcine as well as the canine brains. Peptide YY was bound to brain tissue membranes via high-affinity (dissociation constant, 1.39 X 10(-10)M) and low-affinity (dissociation constant, 3.72 X 10(-8)M) components. The binding sites showed a high specificity for peptide YY and neuropeptide Y, but not for pancreatic polypeptide or structurally unrelated peptides. The specific activity of peptide YY binding was highest in the hippocampus, followed by the pituitary gland, the hypothalamus, and the amygdala of the porcine brain, this pattern being similarly observed in the canine brain. The results suggest that peptide YY and neuropeptide Y may regulate the function of these regions of the brain through interaction with a common receptor site
Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)
International Nuclear Information System (INIS)
Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.
1986-01-01
Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain
Appearance of the canine meninges in subtraction magnetic resonance images.
Lamb, Christopher R; Lam, Richard; Keenihan, Erin K; Frean, Stephen
2014-01-01
The canine meninges are not visible as discrete structures in noncontrast magnetic resonance (MR) images, and are incompletely visualized in T1-weighted, postgadolinium images, reportedly appearing as short, thin curvilinear segments with minimal enhancement. Subtraction imaging facilitates detection of enhancement of tissues, hence may increase the conspicuity of meninges. The aim of the present study was to describe qualitatively the appearance of canine meninges in subtraction MR images obtained using a dynamic technique. Images were reviewed of 10 consecutive dogs that had dynamic pre- and postgadolinium T1W imaging of the brain that was interpreted as normal, and had normal cerebrospinal fluid. Image-anatomic correlation was facilitated by dissection and histologic examination of two canine cadavers. Meningeal enhancement was relatively inconspicuous in postgadolinium T1-weighted images, but was clearly visible in subtraction images of all dogs. Enhancement was visible as faint, small-rounded foci compatible with vessels seen end on within the sulci, a series of larger rounded foci compatible with vessels of variable caliber on the dorsal aspect of the cerebral cortex, and a continuous thin zone of moderate enhancement around the brain. Superimposition of color-encoded subtraction images on pregadolinium T1- and T2-weighted images facilitated localization of the origin of enhancement, which appeared to be predominantly dural, with relatively few leptomeningeal structures visible. Dynamic subtraction MR imaging should be considered for inclusion in clinical brain MR protocols because of the possibility that its use may increase sensitivity for lesions affecting the meninges. © 2014 American College of Veterinary Radiology.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Effects of intracarotid ioxaglate on the normal blood-brain barrier
International Nuclear Information System (INIS)
Wilcox, J.; Sage, M.R.
1985-01-01
Using two different models, the effect on the blood-brain barrier of intracarotid injections of sodium/meglumine ioxaglate at similar iodine concentrations (280 mgI/ml) was investigated. In both models the degree of blood-brain barrier damage was assessed visually using Evans' Blue stain. Quantitative assessment of blood-brain barrier disruption was made by contrast enhancement as measured by CT of the dog brain, and by 99m Tc-pertechnetate uptake by the brain in the rabbit model. No Evans' Blue staining was observed in any study using the canine/CT model. Slight staining was observed in two studies with ioxaglate using the rabbit/pertechnetate model. Statistical analysis of results from the canine/CT model did not detect any damage to the blood-brain barrier with either ioxaglate or saline control studies (P>0.1). However, in the rabbit/pertechnetate model a slight increase in disruption of the blood-brain barrier was observed with ioxaglate compared with control studies, but this was only significant at the 0.1 level. The results suggest that the rabbit/pertechnetate model is a more sensitive measure of blood-brain barrier disruption than the canine/CT model. This study also demonstrates that blood-brain barrier disruption following intracarotid injection of ioxaglate is minimal. (orig.)
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Reference genes for reverse transcription quantitative PCR in canine brain tissue
Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C
2015-01-01
BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Segmentation of the Canine Corpus Callosum using Diffusion Tensor Imaging Tractography
Pierce, T.T.; Calabrese, E.; White, L.E.; Chen, S.D.; Platt, S.R.; Provenzale, J.M.
2014-01-01
Background We set out to determine functional white matter (WM) connections passing through the canine corpus callosum useful for subsequent studies of canine brains that serve as models for human WM pathway disease. Based on prior studies, we anticipated that the anterior corpus callosum would send projections to the anterior cerebral cortex while progressively posterior segments would send projections to more posterior cortex. Methods A post mortem canine brain was imaged using a 7T MRI producing 100 micron isotropic resolution DTI analyzed by tractography. Using ROIs within cortical locations, which were confirmed by a Nissl stain that identified distinct cortical architecture, we successfully identified 6 important WM pathways. We also compared fractional anisotropy (FA), apparent diffusion coefficient (ADC), radial diffusivity (RD), and axial diffusivity (AD) in tracts passing through the genu and splenium. Results Callosal fibers were organized based upon cortical destination, i.e. fibers from the genu project to the frontal cortex. Histologic results identified the motor cortex based on cytoarchitectonic criteria that allowed placement of ROIs to discriminate between frontal and parietal lobes. We also identified cytoarchitecture typical of the orbital frontal, anterior frontal, and occipital regions and placed ROIs accordingly. FA, ADC, RD and AD values were all higher in posterior corpus callosum fiber tracts. Conclusions Using 6 cortical ROIs, we identified 6 major white matter tracts that reflect major functional divisions of the cerebral hemispheres and we derived quantitative values that can be used for study of canine models of human WM pathological states. PMID:24370161
Segmentation of the canine corpus callosum using diffusion-tensor imaging tractography.
Pierce, Theodore T; Calabrese, Evan; White, Leonard E; Chen, Steven D; Platt, Simon R; Provenzale, James M
2014-01-01
We set out to determine functional white matter (WM) connections passing through the canine corpus callosum; these WM connections would be useful for subsequent studies of canine brains that serve as models for human WM pathway disease. Based on prior studies, we anticipated that the anterior corpus callosum would send projections to the anterior cerebral cortex whereas progressively posterior segments would send projections to more posterior cortex. A postmortem canine brain was imaged using a 7-T MRI system producing 100-μm-isotropic-resolution diffusion-tensor imaging analyzed by tractography. Using regions of interest (ROIs) within cortical locations, which were confirmed by a Nissl stain that identified distinct cortical architecture, we successfully identified six important WM pathways. We also compared fractional anisotropy (FA), apparent diffusion coefficient (ADC), radial diffusivity, and axial diffusivity in tracts passing through the genu and splenium. Callosal fibers were organized on the basis of cortical destination (e.g., fibers from the genu project to the frontal cortex). Histologic results identified the motor cortex on the basis of cytoarchitectonic criteria that allowed placement of ROIs to discriminate between frontal and parietal lobes. We also identified cytoarchitecture typical of the orbital frontal, anterior frontal, and occipital regions and placed ROIs accordingly. FA, ADC, radial diffusivity, and axial diffusivity values were all higher in posterior corpus callosum fiber tracts. Using six cortical ROIs, we identified six major WM tracts that reflect major functional divisions of the cerebral hemispheres, and we derived quantitative values that can be used for study of canine models of human WM pathologic states.
A digital atlas of the dog brain.
Directory of Open Access Journals (Sweden)
Ritobrato Datta
Full Text Available There is a long history and a growing interest in the canine as a subject of study in neuroscience research and in translational neurology. In the last few years, anatomical and functional magnetic resonance imaging (MRI studies of awake and anesthetized dogs have been reported. Such efforts can be enhanced by a population atlas of canine brain anatomy to implement group analyses. Here we present a canine brain atlas derived as the diffeomorphic average of a population of fifteen mesaticephalic dogs. The atlas includes: 1 A brain template derived from in-vivo, T1-weighted imaging at 1 mm isotropic resolution at 3 Tesla (with and without the soft tissues of the head; 2 A co-registered, high-resolution (0.33 mm isotropic template created from imaging of ex-vivo brains at 7 Tesla; 3 A surface representation of the gray matter/white matter boundary of the high-resolution atlas (including labeling of gyral and sulcal features. The properties of the atlas are considered in relation to historical nomenclature and the evolutionary taxonomy of the Canini tribe. The atlas is available for download (https://cfn.upenn.edu/aguirre/wiki/public:data_plosone_2012_datta.
Directory of Open Access Journals (Sweden)
Nick Van Laeken
Full Text Available This first-in-dog study evaluates the use of the PET-radioligand [11C]DASB to image the density and availability of the serotonin transporter (SERT in the canine brain. Imaging the serotonergic system could improve diagnosis and therapy of multiple canine behavioural disorders. Furthermore, as many similarities are reported between several human neuropsychiatric conditions and naturally occurring canine behavioural disorders, making this tracer available for use in dogs also provide researchers an interesting non-primate animal model to investigate human disorders. Five adult beagles underwent a 90 minutes dynamic PET scan and arterial whole blood was sampled throughout the scan. For each ROI, the distribution volume (VT, obtained via the one- and two- tissue compartment model (1-TC, 2-TC and the Logan Plot, was calculated and the goodness-of-fit was evaluated by the Akaike Information Criterion (AIC. For the preferred compartmental model BPND values were estimated and compared with those derived by four reference tissue models: 4-parameter RTM, SRTM2, MRTM2 and the Logan reference tissue model. The 2-TC model indicated in 61% of the ROIs a better fit compared to the 1-TC model. The Logan plot produced almost identical VT values and can be used as an alternative. Compared with the 2-TC model, all investigated reference tissue models showed high correlations but small underestimations of the BPND-parameter. The highest correlation was achieved with the Logan reference tissue model (Y = 0.9266 x + 0.0257; R2 = 0.9722. Therefore, this model can be put forward as a non-invasive standard model for future PET-experiments with [11C]DASB in dogs.
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
A Functional-genetic Scheme for Seizure Forecasting in Canine Epilepsy.
Bou Assi, E; Nguyen, D K; Rihana, S; Sawan, M
2017-09-13
The objective of this work is the development of an accurate seizure forecasting algorithm that considers brain's functional connectivity for electrode selection. We start by proposing Kmeans-directed transfer function, an adaptive functional connectivity method intended for seizure onset zone localization in bilateral intracranial EEG recordings. Electrodes identified as seizure activity sources and sinks are then used to implement a seizure-forecasting algorithm on long-term continuous recordings in dogs with naturallyoccurring epilepsy. A precision-recall genetic algorithm is proposed for feature selection in line with a probabilistic support vector machine classifier. Epileptic activity generators were focal in all dogs confirming the diagnosis of focal epilepsy in these animals while sinks spanned both hemispheres in 2 of 3 dogs. Seizure forecasting results show performance improvement compared to previous studies, achieving average sensitivity of 84.82% and time in warning of 0.1. Achieved performances highlight the feasibility of seizure forecasting in canine epilepsy. The ability to improve seizure forecasting provides promise for the development of EEGtriggered closed-loop seizure intervention systems for ambulatory implantation in patients with refractory epilepsy.
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Park, Surim; Choi, Ul Soo; Kim, Eun Ju; Lee, Jong Hyun; Lee, Hae Beom; Cho, Ho Seong; Kim, Wonil; Lim, Chae Woong; Kim, Bumseok
2016-04-28
We describe coinfection with Hepatozoon sp. and canine distemper virus (CDV) in a yellow-throated marten ( Martes flavigula koreana). We found Hepatozoon cysts in muscular tissue and viral inclusion bodies in the brain. Hepatozoon sp., and CDV was confirmed in blood and brain, respectively, by PCR.
2014-01-01
Background Exportin 1 (XPO1, also known as CRM1), is a chaperone protein responsible for the export of over 200 target proteins out of the nucleus. The expression and activity of XPO1 is upregulated in several human cancers and its expression is also linked to the development of chemotherapy resistance. Recent studies using both human and murine cancer cell lines have demonstrated that XPO1 is a relevant target for therapeutic intervention. The present study sought to characterize the biologic activity of an orally bioavailable selective inhibitor of nuclear export (SINE), KPT-335, against canine melanoma cell lines as a prelude to future clinical trials in dogs with melanoma. Results We evaluated the effects of KPT-335 on 4 canine malignant melanoma cell lines and found that KPT-335 inhibited proliferation, blocked colony formation, and induced apoptosis of treated cells at biologically relevant concentrations of drug. Additionally, KPT-335 downregulated XPO1 protein while inducing a concomitant increase in XPO1 messenger RNA. Lastly, KPT-335 treatment of cell lines upregulated the expression of both protein and mRNA for the tumor suppressor proteins p53 and p21, and promoted their nuclear localization. Conclusions KPT-335 demonstrates biologic activity against canine melanoma cell lines at physiologically relevant doses, suggesting that KPT-335 may represent a viable treatment option for dogs with malignant melanoma. PMID:25022346
Kotrschal, Alexander; Rogell, Björn; Bundsen, Andreas; Svensson, Beatrice; Zajitschek, Susanne; Brännström, Ioana; Immler, Simone; Maklakov, Alexei A; Kolm, Niclas
2013-01-21
The large variation in brain size that exists in the animal kingdom has been suggested to have evolved through the balance between selective advantages of greater cognitive ability and the prohibitively high energy demands of a larger brain (the "expensive-tissue hypothesis"). Despite over a century of research on the evolution of brain size, empirical support for the trade-off between cognitive ability and energetic costs is based exclusively on correlative evidence, and the theory remains controversial. Here we provide experimental evidence for costs and benefits of increased brain size. We used artificial selection for large and small brain size relative to body size in a live-bearing fish, the guppy (Poecilia reticulata), and found that relative brain size evolved rapidly in response to divergent selection in both sexes. Large-brained females outperformed small-brained females in a numerical learning assay designed to test cognitive ability. Moreover, large-brained lines, especially males, developed smaller guts, as predicted by the expensive-tissue hypothesis, and produced fewer offspring. We propose that the evolution of brain size is mediated by a functional trade-off between increased cognitive ability and reproductive performance and discuss the implications of these findings for vertebrate brain evolution. Copyright © 2013 Elsevier Ltd. All rights reserved.
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Canine hippocampal formation composited into three-dimensional structure using MPRAGE.
Jung, Mi-Ae; Nahm, Sang-Soep; Lee, Min-Su; Lee, In-Hye; Lee, Ah-Ra; Jang, Dong-Pyo; Kim, Young-Bo; Cho, Zang-Hee; Eom, Ki-Dong
2010-07-01
This study was performed to anatomically illustrate the living canine hippocampal formation in three-dimensions (3D), and to evaluate its relationship to surrounding brain structures. Three normal beagle dogs were scanned on a MR scanner with inversion recovery segmented 3D gradient echo sequence (known as MP-RAGE: Magnetization Prepared Rapid Gradient Echo). The MRI data was manually segmented and reconstructed into a 3D model using the 3D slicer software tool. From the 3D model, the spatial relationships between hippocampal formation and surrounding structures were evaluated. With the increased spatial resolution and contrast of the MPRAGE, the canine hippocampal formation was easily depicted. The reconstructed 3D image allows easy understanding of the hippocampal contour and demonstrates the structural relationship of the hippocampal formation to surrounding structures in vivo.
Qian, Rong; Yang, Weizhong; Wang, Xiumei; Xu, Zhen; Liu, Xiaodong; Sun, Bing
2015-01-01
Previous studies have confirmed that traumatic brain injury (TBI) can induce general adaptation syndrome (GAS), which subsequently results in myocardial dysfunction and damage in some patients with acute TBI; this condition is also termed as cerebral-cardiac syndrome. However, most clinicians ignore the detection and treatment of myocardial dysfunction, and instead concentrate only on the serious neural damage that is observed in acute TBI, which is one of the most important fatal factors. Therefore, clarification is urgently needed regarding the relationship between TBI and myocardial dysfunction. In the present study, we evaluated 18 canine models of acute TBI, by using real-time myocardial contrast echocardiography and strain rate imaging to accurately evaluate myocardial function and regional microcirculation, including the strain rate of the different myocardial segments, time-amplitude curves, mean ascending slope of the curve, and local myocardial blood flow. Our results suggest that acute TBI often results in cerebral-cardiac syndrome, which rapidly progresses to the serious stage within 3 days. This study is the first to provide comprehensive ultrasonic characteristics of cerebral-cardiac syndrome in an animal model of TBI.
MREIT conductivity imaging of the postmortem canine abdomen using CoReHA
International Nuclear Information System (INIS)
Jeon, Kiwan; Lee, Chang-Ock; Minhas, Atul S; Kim, Young Tae; Jeong, Woo Chul; Kim, Hyung Joong; Woo, Eung Je; Kang, Byeong Teck; Park, Hee Myung; Seo, Jin Keun
2009-01-01
Magnetic resonance electrical impedance tomography (MREIT) is a new bio-imaging modality providing cross-sectional conductivity images from measurements of internal magnetic flux densities produced by externally injected currents. Recent experimental results of postmortem and in vivo imaging of the canine brain demonstrated its feasibility by showing conductivity images with meaningful contrast among different brain tissues. MREIT image reconstructions involve a series of data processing steps such as k-space data handling, phase unwrapping, image segmentation, meshing, modelling, finite element computation, denoising and so on. To facilitate experimental studies, we need a software tool that automates these data processing steps. In this paper, we summarize such an MREIT software package called CoReHA (conductivity reconstructor using harmonic algorithms). Performing imaging experiments of the postmortem canine abdomen, we demonstrate how CoReHA can be utilized in MREIT. The abdomen with a relatively large field of view and various organs imposes new technical challenges when it is chosen as an imaging domain. Summarizing a few improvements in the experimental MREIT technique, we report our first conductivity images of the postmortem canine abdomen. Illustrating reconstructed conductivity images, we discuss how they discern different organs including the kidney, spleen, stomach and small intestine. We elaborate, as an example, that conductivity images of the kidney show clear contrast among cortex, internal medulla, renal pelvis and urethra. We end this paper with a brief discussion on future work using different animal models
Sexual selection and the evolution of brain size in primates.
Schillaci, Michael A
2006-12-20
Reproductive competition among males has long been considered a powerful force in the evolution of primates. The evolution of brain size and complexity in the Order Primates has been widely regarded as the hallmark of primate evolutionary history. Despite their importance to our understanding of primate evolution, the relationship between sexual selection and the evolutionary development of brain size is not well studied. The present research examines the evolutionary relationship between brain size and two components of primate sexual selection, sperm competition and male competition for mates. Results indicate that there is not a significant relationship between relative brain size and sperm competition as measured by relative testis size in primates, suggesting sperm competition has not played an important role in the evolution of brain size in the primate order. There is, however, a significant negative evolutionary relationship between relative brain size and the level of male competition for mates. The present study shows that the largest relative brain sizes among primate species are associated with monogamous mating systems, suggesting primate monogamy may require greater social acuity and abilities of deception.
International Nuclear Information System (INIS)
Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq
2011-01-01
This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.
Blixenkrone-Møller, M
1989-09-01
Using an indirect immunofluorescence technique, the distribution of viral antigen in various tissues and blood mononuclear leukocytes was studied in wild mink, either vaccinated with an attenuated vaccine strain of canine distemper virus (CDV) or experimentally inoculated with the virulent Snyder-Hill strain of CDV. Viral antigen was detected in cells of the lymphoid system 6 to 12 days after vaccination. From 2 to 3 days after inoculation with the virulent strain, CDV antigen was demonstrated in cells of the lymphoid system and, during the incubation period, the antigen had spread to the epithelia and brain at days 6 and 12, respectively. In clinical cases of acute fatal canine distemper, the viral antigen was detected in a wide variety of tissues, including the cells of the lymphoid system, epithelial cells of skin, mucous membranes, lung, kidney, and cells of the CNS. The diagnostic importance of CDV antigen detection is discussed on the basis of these findings.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.
Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H
2006-02-01
The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.
In vivo measurement of cell proliferation in canine brain tumor using C-11-labeled FMAU and PET
International Nuclear Information System (INIS)
Conti, Peter S.; Bading, James R.; Mouton, Peter P.; Links, Jonathan M.; Alauddin, Mian M.; Fissekis, John D.; Ravert, Hayden T.; Hilton, John; Wong, Dean F.; Anderson, James H.
2008-01-01
measured by direct tissue analysis with BUdR in a canine brain tumor model, suggesting that [ 11 C]FMAU is useful for the imaging of cell proliferation in cancers
Homologous recombination is a force in the evolution of canine distemper virus.
Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing
2017-01-01
Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Selective estrogen receptor modulators as brain therapeutic agents
Arévalo, María Ángeles; Santos-Galindo, María; Lagunas, Natalia; Azcoitia, I.; García-Segura, Luis M.
2011-01-01
Selective estrogen receptor modulators (SERMs), used for the treatment of breast cancer, osteoporosis, and menopausal symptoms, affect the nervous system. Some SERMs trigger neuroprotective mechanisms and reduce neural damage in different experimental models of neural trauma, brain inflammation, neurodegenerative diseases, cognitive impairment, and affective disorders. New SERMs with specific actions on neurons and glial cells may represent promising therapeutic tools for the brain. © 2011 So...
Sexual selection and the evolution of brain size in primates.
Directory of Open Access Journals (Sweden)
Michael A Schillaci
Full Text Available Reproductive competition among males has long been considered a powerful force in the evolution of primates. The evolution of brain size and complexity in the Order Primates has been widely regarded as the hallmark of primate evolutionary history. Despite their importance to our understanding of primate evolution, the relationship between sexual selection and the evolutionary development of brain size is not well studied. The present research examines the evolutionary relationship between brain size and two components of primate sexual selection, sperm competition and male competition for mates. Results indicate that there is not a significant relationship between relative brain size and sperm competition as measured by relative testis size in primates, suggesting sperm competition has not played an important role in the evolution of brain size in the primate order. There is, however, a significant negative evolutionary relationship between relative brain size and the level of male competition for mates. The present study shows that the largest relative brain sizes among primate species are associated with monogamous mating systems, suggesting primate monogamy may require greater social acuity and abilities of deception.
Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study
Directory of Open Access Journals (Sweden)
Zeeshan Iqbal Bhat
2013-01-01
Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Biotinylated dextran amine anterograde tracing of the canine corticospinal tract?
Han, Xiao; Lv, Guangming; Wu, Huiqun; Ji, Dafeng; Sun, Zhou; Li, Yaofu; Tang, Lemin
2012-01-01
In this study, biotinylated dextran amine (BDA) was microinjected into the left cortical motor area of the canine brain. Fluorescence microscopy results showed that a large amount of BDA-labeled pyramidal cells were visible in the left cortical motor area after injection. In the left medulla oblongata, the BDA-labeled corticospinal tract was evenly distributed, with green fluorescence that had a clear boundary with the surrounding tissue. The BDA-positive corticospinal tract entered into the ...
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Selective neuronal vulnerability to oxidative stress in the brain
Directory of Open Access Journals (Sweden)
Xinkun Wang
2010-03-01
Full Text Available Oxidative stress (OS, caused by the imbalance between the generation and detoxification of reactive oxygen and nitrogen species (ROS/RNS, plays an important role in brain aging, neurodegenerative diseases, and other related adverse conditions, such as ischemia. While ROS/RNS serve as signaling molecules at physiological levels, an excessive amount of these molecules leads to oxidative modification and, therefore, dysfunction of proteins, nucleic acids, and lipids. The response of neurons to this pervasive stress, however, is not uniform in the brain. While many brain neurons can cope with a rise in OS, there are select populations of neurons in the brain that are vulnerable. Because of their selective vulnerability, these neurons are usually the first to exhibit functional decline and cell death during normal aging, or in age-associated neurodegenerative diseases, such as Alzheimer’s disease. Understanding the molecular and cellular mechanisms of selective neuronal vulnerability (SNV to OS is important in the development of future intervention approaches to protect such vulnerable neurons from the stresses of the aging process and the pathological states that lead to neurodegeneration. In this review, the currently known molecular and cellular factors that contribute to SNV to OS are summarized. Included among the major underlying factors are high intrinsic OS, high demand for ROS/RNS-based signaling, low ATP production, mitochondrial dysfunction, and high inflammatory response in vulnerable neurons. The contribution to the selective vulnerability of neurons to OS by other intrinsic or extrinsic factors, such as deficient DNA damage repair, low calcium-buffering capacity, and glutamate excitotoxicity, are also discussed.
Genotyping and pathobiologic characterization of canine parvovirus circulating in Nanjing, China.
Zhao, Yanbing; Lin, Yan; Zeng, Xujian; Lu, Chengping; Hou, Jiafa
2013-08-29
Canine parvovirus (CPV) is an important pathogen that causes acute enteric disease in dogs. It has mutated and spread throughout the world in dog populations. We provide an update on the molecular characterization of CPV that circulated in Nanjing, a provincial capital in China between 2009 and 2012. Seventy rectal swab samples were collected from the dogs diagnosed with CPV infection in 8 animal hospitals of Nanjing. Sequence analysis of VP2 genes of 31 samples revealed that 29 viral strains belonged to CPV-2a subtype, while other two strains were classified into CPV-2b. To investigate the pathogenicity of the prevalent virus, we isolated CPV-2a and performed the animal experiment. Nine beagles were inoculated with 105.86 of 50% tissue culture infectious doses (TCID50) of the virus. All the experimentally infected beagles exhibited mild to moderate mucoid or watery diarrhea on day 4 post-infection (p.i.). On day 9 p.i., characteristic histopathological lesions were clearly observed in multiple organs of infected dogs, including liver, spleen, kidney, brain and all segments of the small and large intestines, while viral DNA and antigen staining could be detected in the sampled tissues. It is notable that canine parvovirus was isolated in one from two brain samples processed. Our results indicated that CPV-2a is the predominant subtype in Nanjing of China. And this virus caused extensive lesions in a variety of tissues, including the brain.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Jenkins, Eileen K.; DeChant, Mallory T.; Perry, Erin B.
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines. PMID:29651421
Directory of Open Access Journals (Sweden)
Eileen K. Jenkins
2018-03-01
Full Text Available The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
Jenkins, Eileen K; DeChant, Mallory T; Perry, Erin B
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
Acute traumatic brain-stem hemorrhage produced by sudden caudal displacement of the brain
International Nuclear Information System (INIS)
Mirvis, S.E.; Wolf, A.L.; Thompson, R.K.
1990-01-01
This paper determines in an experimental canine study and a clinical review, whether acute caudal displacement of the brain following blunt trauma produces hemorrhage in the rostral anterior midline of the brain stem by tethering the basilar to the fixed carotid arteries. In four dogs, a balloon catheter was suddenly inflated over the frontal lobe; in two, the carotid-basilar vascular connections were severed prior to balloon inflation. ICP was monitored during and after balloon inflation. Hemorrhage was verified by MR imaging and direct inspection of the fixed brain specimens. Admission CT scans demonstrating acute traumatic brain stem hemorrhage (TBH) in human patients were reviewed to determine the site of TBH, predominant site of impact, and neurologic outcome
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Youn, Sung Won; Jung, Keun-Hwa; Chu, Kon; Lee, Jong-Young; Lee, Soon-Tae; Bahn, Jae-jun; Park, Dong-Kyu; Yu, Jung-Suk; Kim, So-Yun; Kim, Manho; Lee, Sang Kun; Han, Moon-Hee; Roh, Jae-Kyu
2015-01-01
Stem cell therapy is currently being studied with a view to rescuing various neurological diseases. Such studies require not only the discovery of potent candidate cells but also the development of methods that allow optimal delivery of those candidates to the brain tissues. Given that the blood-brain barrier (BBB) precludes cells from entering the brain, the present study was designed to test whether hyperosmolar mannitol securely opens the BBB and enhances intra-arterial cell delivery. A noninjured normal canine model in which the BBB was presumed to be closed was used to evaluate the feasibility and safety of the tested protocol. Autologous adipose tissue-derived pericytes with platelet-derived growth factor receptor β positivity were utilized. Cells were administered 5 min after mannitol pretreatment using one of following techniques: (1) bolus injection of a concentrated suspension, (2) continuous infusion of a diluted suspension, or (3) bolus injection of a concentrated suspension that had been shaken by repeated syringe pumping. Animals administered a concentrated cell suspension without mannitol pretreatment served as a control group. Vital signs, blood parameters, neurologic status, and major artery patency were kept stable throughout the experiment and the 1-month posttreatment period. Although ischemic lesions were noted on magnetic resonance imaging in several mongrel dogs with concentrated cell suspension, the injection technique using repeated syringe shaking could avert this complication. The cells were detected in both ipsilateral and contralateral cortices and were more frequent at the ipsilateral and frontal locations, whereas very few cells were observed anywhere in the brain when mannitol was not preinjected. These data suggest that intra-arterial cell infusion with mannitol pretreatment is a feasible and safe therapeutic approach in stable brain diseases such as chronic stroke.
An experimental in-vivo canine model for adult shunt infection
Directory of Open Access Journals (Sweden)
Procop Gary
2008-10-01
Full Text Available Abstract Background Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional "human" shunts, and that a shunt infection could be established so that further studies could then be planned. Methods Hydrocephalus was induced in seven dogs (Canis familiaris by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison. Results All the dogs remained well after shunting. Examination of removed shunt components revealed S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three "negative" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source. Conclusion Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013
DEFF Research Database (Denmark)
Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted
2015-01-01
During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit...... distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Thiruvenkatachari, Badri; Javidi, Hanieh; Griffiths, Sarah Elizabeth; Shah, Anwar A; Sandler, Jonathan
2017-10-01
Maxillary canines are generally considered important both cosmetically and functionally. Most claims on the importance of maxillary canines, however, have been based on expert opinions and clinician-based studies. There are no scientific studies in the literature reporting on their cosmetic importance or how laypeople perceive a smile treated by maxillary canine extractions. Our objective was to investigate whether there is any difference in the perceptions of patients' smiles treated by extracting either maxillary canines or first premolars, as judged by orthodontists, dentists, and laypeople. This retrospective study included 24 participants who had unilateral or bilateral extraction of maxillary permanent canines and fixed appliances in the maxillary and mandibular arches to comprehensively correct the malocclusion, selected from orthodontic patients treated at Chesterfield Royal Hospital NHS trust in the United Kingdom over the last 20 years. The control group of patients had extraction of maxillary first premolars followed by fixed appliances and finished to an extremely high standard judged by the requirement that they had been submitted for the Membership in Orthodontics examination. The finished Peer Assessment Rating scores for this group were less than 5. The end-of-treatment frontal extraoral smiling and frontal intraoral views were presented for both groups. The photographs were blinded for extraction choice and standardized for size and brightness using computer software (Adobe Photoshop CC version 14.0; Adobe Systems, San Jose, Calif). The work file was converted to an editable pdf file and e-mailed to the assessors. The assessor panel consisted of 30 members (10 orthodontists, 10 dentists, and 10 laypeople), who were purposely selected. The measures were rated on a 10-point Likert scale. The attractiveness ratings were not statistically significantly different between the canine extraction and premolar extraction groups, with a mean difference of 0
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Selective Heart, Brain and Body Perfusion in Open Aortic Arch Replacement.
Maier, Sven; Kari, Fabian; Rylski, Bartosz; Siepe, Matthias; Benk, Christoph; Beyersdorf, Friedhelm
2016-09-01
Open aortic arch replacement is a complex and challenging procedure, especially in post dissection aneurysms and in redo procedures after previous surgery of the ascending aorta or aortic root. We report our experience with the simultaneous selective perfusion of heart, brain, and remaining body to ensure optimal perfusion and to minimize perfusion-related risks during these procedures. We used a specially configured heart-lung machine with a centrifugal pump as arterial pump and an additional roller pump for the selective cerebral perfusion. Initial arterial cannulation is achieved via femoral artery or right axillary artery. After lower body circulatory arrest and selective antegrade cerebral perfusion for the distal arch anastomosis, we started selective lower body perfusion simultaneously to the selective antegrade cerebral perfusion and heart perfusion. Eighteen patients were successfully treated with this perfusion strategy from October 2012 to November 2015. No complications related to the heart-lung machine and the cannulation occurred during the procedures. Mean cardiopulmonary bypass time was 239 ± 33 minutes, the simultaneous selective perfusion of brain, heart, and remaining body lasted 55 ± 23 minutes. One patient suffered temporary neurological deficit that resolved completely during intensive care unit stay. No patient experienced a permanent neurological deficit or end-organ dysfunction. These high-risk procedures require a concept with a special setup of the heart-lung machine. Our perfusion strategy for aortic arch replacement ensures a selective perfusion of heart, brain, and lower body during this complex procedure and we observed excellent outcomes in this small series. This perfusion strategy is also applicable for redo procedures.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Application of a semi-automatic ROI setting system for brain PET images to animal PET studies
International Nuclear Information System (INIS)
Kuge, Yuji; Akai, Nobuo; Tamura, Koji
1998-01-01
ProASSIST, a semi-automatic ROI (region of interest) setting system for human brain PET images, has been modified for use with the canine brain, and the performance of the obtained system was evaluated by comparing the operational simplicity for ROI setting and the consistency of ROI values obtained with those by a conventional manual procedure. Namely, we created segment maps for the canine brain by making reference to the coronal section atlas of the canine brain by Lim et al., and incorporated them into the ProASSIST system. For the performance test, CBF (cerebral blood flow) and CMRglc (cerebral metabolic rate in glucose) images in dogs with or without focal cerebral ischemia were used. In ProASSIST, brain contours were defined semiautomatically. In the ROI analysis of the test image, manual modification of the contour was necessary in half cases examined (8/16). However, the operation was rather simple so that the operation time per one brain section was significantly shorter than that in the manual operation. The ROI values determined by the system were comparable with those by the manual procedure, confirming the applicability of the system to these animal studies. The use of the system like the present one would also merit the more objective data acquisition for the quantitative ROI analysis, because no manual procedure except for some specifications of the anatomical features is required for ROI setting. (author)
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Genomic prediction of traits related to canine hip dysplasia
Directory of Open Access Journals (Sweden)
Enrique eSanchez-Molano
2015-03-01
Full Text Available Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD, which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different genomic selection methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods, and results were compared with a pedigree-based approach (BLUP using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that genomic selection is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection would not be as effective as genomic selection. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, genomic selection is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy
Phanwanich, Warangkhana; Kumdee, Orrawan; Ritthipravat, Panrasee; Wongsawat, Yodchanan
2011-01-01
Animal-Assisted Therapy (AAT) is the science that employs the merit of human-animal interaction to alleviate mental and physical problems of persons with disabilities. However, to achieve the goal of AAT for persons with severe disabilities (e.g. spinal cord injury and amyotrophic lateral sclerosis), real-time animal language interpretation is needed. Since canine behaviors can be visually distinguished from its tail, this paper proposes the automatic real-time interpretation of canine tail language for human-canine interaction in the case of persons with severe disabilities. Canine tail language is captured via two 3-axis accelerometers. Directions and frequency are selected as our features of interests. New fuzzy rules and center of gravity (COG)-based defuzzification method are proposed in order to interpret the features into three canine emotional behaviors, i.e., agitate, happy, and scare as well as its blended emotional behaviors. The emotional behavior model is performed in the simulated dog. The average recognition rate in real dog is 93.75% accuracy.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Replicable Expansion and Differentiation of Neural Precursors from Adult Canine Skin
Directory of Open Access Journals (Sweden)
Thomas Duncan
2017-08-01
Full Text Available Repopulation of brain circuits by neural precursors is a potential therapeutic strategy for neurodegenerative disorders; however, choice of cell is critical. Previously, we introduced a two-step culture system that generates a high yield of neural precursors from small samples of adult canine skin. Here, we probe their gene and protein expression profiles in comparison with dermal fibroblasts and brain-derived neural stem cells and characterize their neuronal potential. To date, we have produced >50 skin-derived neural precursor (SKN lines. SKNs can be cultured in a highly replicable fashion and uniformly express a panel of identifying markers. Upon differentiation, they self-upregulate neural specification genes, generating neurons with basic electrophysiological functionality. This unique population of neural precursors, derived from mature skin, overcomes many of the practical issues that have limited clinical translation of alternative cell types. Easily accessible, neuronally committed, and patient specific, SKNs may have potential for the treatment of brain disorders.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Selective vulnerability related to aging in large-scale resting brain networks.
Zhang, Hong-Ying; Chen, Wen-Xin; Jiao, Yun; Xu, Yao; Zhang, Xiang-Rong; Wu, Jing-Tao
2014-01-01
Normal aging is associated with cognitive decline. Evidence indicates that large-scale brain networks are affected by aging; however, it has not been established whether aging has equivalent effects on specific large-scale networks. In the present study, 40 healthy subjects including 22 older (aged 60-80 years) and 18 younger (aged 22-33 years) adults underwent resting-state functional MRI scanning. Four canonical resting-state networks, including the default mode network (DMN), executive control network (ECN), dorsal attention network (DAN) and salience network, were extracted, and the functional connectivities in these canonical networks were compared between the younger and older groups. We found distinct, disruptive alterations present in the large-scale aging-related resting brain networks: the ECN was affected the most, followed by the DAN. However, the DMN and salience networks showed limited functional connectivity disruption. The visual network served as a control and was similarly preserved in both groups. Our findings suggest that the aged brain is characterized by selective vulnerability in large-scale brain networks. These results could help improve our understanding of the mechanism of degeneration in the aging brain. Additional work is warranted to determine whether selective alterations in the intrinsic networks are related to impairments in behavioral performance.
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins
Directory of Open Access Journals (Sweden)
J. Michael Plavcan
2012-03-01
Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Percutaneous intradiscal ozone (O3)-injection: an experimental study in canines
International Nuclear Information System (INIS)
Yu Zhijian; He Xiaofeng; Chen Yong; Zeng Qingle; Liu Chihong; Zhao Zhongqing; Lu Yong; Li Yanhao
2002-01-01
Objective: To evaluate the influence of ozone on normal nucleus pulpous and the safety of intradiscal ozone-injection for the treatment of herniated lumbar disc. Methods: Ozone was injected into selected lumbar discs (3 ml) and the para-spinal space (7 ml) with 20 G Chiba needle under fluoroscopy in five canines. The ozone concentration was 30 μg/ml and 50 μg/ml respectively. Two discs were selected for each concentration. Total 20 discs were injected. Three of the canines were given one-time ozone-injection and were sacrificed for pathology one week, one month and two months respectively after the procedure, and the other two canines were given two-time ozone-injection and were sacrificed one month and two months respectively after the procedure. The specimens including nucleus pulpous, end-plate, spinal cord, nerve root, and greater psoas muscle were observed macroscopically and microscopically. Results: No serious behavior abnormalities were observed in all animals. The atrophy of nucleus pulpous could be observed one month after ozone-injection due to significant reduction of water and extensive proliferation of collagenous fiber. The influence on the atrophy of nucleus pulpous demonstrated no apparent difference between the selected two concentrations of ozone, but was more apparent with two-time injection than that with one-time injection. The end-plates increased slightly or moderately in thickness in 16 simples and a few of fibers in greater psoas muscle suffered slight atrophy in 5 samples. Conclusion: It is suggested that percutaneous intradiscal ozone-injection is a safe method, and can cause gradual atrophy of nucleus pulpous. This study provides the evidence of the feasibility and value of this procedure's application in clinics
Prognostic factors in canine appendicular osteosarcoma - a meta-analysis.
Boerman, Ilse; Selvarajah, Gayathri T; Nielen, Mirjam; Kirpensteijn, Jolle
2012-05-15
Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
LENUS (Irish Health Repository)
Synodinos, Philippos N
2010-12-01
Transposition is defined as the interchange of position between two adjacent teeth within the same quadrant of the dental arch. Permanent maxillary canine-premolar transposition is the most commonly observed transposition in the human dentition. Its prevalence is relatively low and its aetiology remains unclear, although it has been associated with genetic factors. It may also be related to a combination of localised factors such as malformation of adjacent teeth, tooth agenesis, retention of the deciduous canine and a history of local trauma. Treatment is selected on an individual case basis after thoroughly considering the overall facial and dental characteristics, duration of treatment, cost, patient preference and the orthodontist\\'s experience. This article provides a case report of maxillary canine transposition in the permanent dentition, successfully managed with orthodontic treatment.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
US evaluation of volume brain lesions produced by high-intensity focused US
International Nuclear Information System (INIS)
Chua, R.V.; Chua, G.T.; Fry, F.J.; Franklin, T.D.; Wills, E.R.; Hastings, J.S.; Sanghui, N.T.
1987-01-01
Eighteen volume brain lesions produced by high-intensity focused US in the right cerebral hemispheres of research canines were evaluated by diagnostic US from immediately after ablation up to 62 days later. Animals were killed and perfused for whole-brain recovery. US evaluation of whole-brain specimens was performed. Histologic analysis of brain sections verified lesion placement, size, and tissue response to US. These sections were compared with US studies for correlation data. Correlation data suggest that US visualization may aid in accurate placement of volume brain lesions and in evaluation of effects of high-intensity focuses US in normal brain
Behling-Kelly, Erica
2016-03-01
The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
Directory of Open Access Journals (Sweden)
Bonnie K Harrington
Full Text Available Acalabrutinib (ACP-196 is a second-generation inhibitor of Bruton agammaglobulinemia tyrosine kinase (BTK with increased target selectivity and potency compared to ibrutinib. In this study, we evaluated acalabrutinib in spontaneously occurring canine lymphoma, a model of B-cell malignancy similar to human diffuse large B-cell lymphoma (DLBCL. First, we demonstrated that acalabrutinib potently inhibited BTK activity and downstream effectors in CLBL1, a canine B-cell lymphoma cell line, and primary canine lymphoma cells. Acalabrutinib also inhibited proliferation in CLBL1 cells. Twenty dogs were enrolled in the clinical trial and treated with acalabrutinib at dosages of 2.5 to 20mg/kg every 12 or 24 hours. Acalabrutinib was generally well tolerated, with adverse events consisting primarily of grade 1 or 2 anorexia, weight loss, vomiting, diarrhea and lethargy. Overall response rate (ORR was 25% (5/20 with a median progression free survival (PFS of 22.5 days. Clinical benefit was observed in 30% (6/20 of dogs. These findings suggest that acalabrutinib is safe and exhibits activity in canine B-cell lymphoma patients and support the use of canine lymphoma as a relevant model for human non-Hodgkin lymphoma (NHL.
Long-term periodontal response to orthodontic treatment of palatally impacted maxillary canines.
Caprioglio, Alberto; Vanni, Arianna; Bolamperti, Laura
2013-06-01
One of the most important aspects to take into consideration when evaluating the outcome of treatment of impacted maxillary canines is the final periodontal status. The aim of the present study was to evaluate the long-term periodontal response of palatally impacted maxillary canines aligned using a codified procedure and the 'Easy Cuspid' compared with contralateral spontaneously erupted teeth. The periodontal conditions of the adjacent teeth were also considered. From an initial sample of 124 patients, 33 patients (24 females and 9 males) were selected. All patients who had undergone surgical orthodontic treatment conducted in accordance with a standardized protocol were recalled for follow-up at an average of 4.6 years after the end of treatment. The average treatment time was 29 months and the mean eruption time of the previously impacted tooth was 3.1 months. The average probing depth values showed no significant clinical differences. Probing depths recorded at the vestibular surface of the lateral incisor (P alignment of palatally impacted canines without damage to the periodontium.
Jain, Shikha; Shetty, K Sadashiva; Jain, Shweta; Jain, Sachin; Prakash, A T; Agrawal, Mamta
2015-07-01
To assess the null hypothesis that there is no difference in the rate of dental development and the occurrence of selected developmental anomalies related to shape, number, structure, and position of teeth between subjects with impacted mandibular canines and those with normally erupted canines. Pretreatment records of 42 subjects diagnosed with mandibular canines impaction (impaction group: IG) were compared with those of 84 subjects serving as a control reference sample (control group: CG). Independent t-tests were used to compare mean dental ages between the groups. Intergroup differences in distribution of subjects based on the rate of dental development and occurrence of selected dental anomalies were assessed using χ(2) tests. Odds of late, normal, and early developers and various categories of developmental anomalies between the IG and the CG were evaluated in terms of odds ratios. Mean dental age for the IG was lower than that for the CG in general. Specifically, this was true for girls (P dental development and occurrence of positional anomalies also reached statistical significance (P anomalies compared with controls (odds ratios 3.00 and 2.82, respectively; P dental development compared with the female orthodontic patients. Increased frequency of positional developmental anomalies was also remarkable in the IG.
Development of new therapy for canine mammary cancer with recombinant measles virus
Directory of Open Access Journals (Sweden)
Koichiro Shoji
2016-01-01
Full Text Available Oncolytic virotherapy is a promising treatment strategy for cancer. We previously generated a recombinant measles virus (rMV-SLAMblind that selectively uses a poliovirus receptor-related 4 (PVRL4/Nectin4 receptor, but not signaling lymphocyte activation molecule (SLAM. We demonstrated that the virus exerts therapeutic effects against human breast cancer cells. Here, we examined the applicability of rMV-SLAMblind to treating canine mammary cancers (CMCs. We found that the susceptibilities of host cells to rMV-SLAMblind were dependent on canine Nectin-4 expression. Nectin-4 was detected in four of nine CMC cell lines. The rMV-SLAMblind efficiently infected those four Nectin-4-positive cell lines and was cytotoxic for three of them (CF33, CHMm, and CTBm. In vivo experiment showed that the administration of rMV-SLAMblind greatly suppressed the progression of tumors in mice xenografted with a CMC cell line (CF33. Immunohistochemistry revealed that canine Nectin-4 was expressed in 45% of canine mammary tumors, and the tumor cells derived from one clinical specimen were efficiently infected with rMV-SLAMblind. These results suggest that rMV-SLAMblind infects CMC cells and displays antitumor activity in vitro, in xenografts, and ex vivo. Therefore, oncolytic virotherapy with rMV-SLAMblind can be a novel method for treating CMCs.
Why is Southern African canine babesiosis so virulent? An evolutionary perspective
Directory of Open Access Journals (Sweden)
Penzhorn Barend L
2011-04-01
Full Text Available Abstract Canine babesiosis is a common, highly virulent disease in Southern Africa with even pups and juveniles being severely affected. This contrasts with bovine babesiosis, for example, where host, parasite and vector co-evolved and young animals develop immunity after infection without showing clinical signs. Babesia rossi, the main causative organism of canine babesiosis in sub-Saharan Africa, was first described from a side-striped jackal (Canis adustus in Kenya. Although data are meagre, there is evidence that indigenous African canids, such as jackals and wild dogs (Lycaon pictus, can harbour the parasite without showing untoward effects. Dogs are not indigenous to Africa. The vast majority of dogs presented at veterinary facilities in South Africa represent recently introduced European, Asian or American breeds. The contention is that B. rossi is a new challenge to which these dogs have not adapted. With intensive treatment of clinical cases, natural selection is effectively negated and the status quo will probably be maintained indefinitely. It is postulated that Babesia vogeli, which frequently results in unapparent infections or mild manifestations in dogs, represents or is closely related to the ancestral form of the canine parasite, possibly originating from wolves (Canis lupus.
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
Xu, Ren; Jiang, Ning; Dosen, Strahinja; Lin, Chuang; Mrachacz-Kersting, Natalie; Dremstrup, Kim; Farina, Dario
2016-08-01
In this study, we present a novel multi-class brain-computer interface (BCI) for communication and control. In this system, the information processing is shared by the algorithm (computer) and the user (human). Specifically, an electro-tactile cycle was presented to the user, providing the choice (class) by delivering timely sensory input. The user discriminated these choices by his/her endogenous sensory ability and selected the desired choice with an intuitive motor task. This selection was detected by a fast brain switch based on real-time detection of movement-related cortical potentials from scalp EEG. We demonstrated the feasibility of such a system with a four-class BCI, yielding a true positive rate of ∼ 80% and ∼ 70%, and an information transfer rate of ∼ 7 bits/min and ∼ 5 bits/min, for the movement and imagination selection command, respectively. Furthermore, when the system was extended to eight classes, the throughput of the system was improved, demonstrating the capability of accommodating a large number of classes. Combining the endogenous sensory discrimination with the fast brain switch, the proposed system could be an effective, multi-class, gaze-independent BCI system for communication and control applications.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
The effect of buccal corticotomy on accelerating orthodontic tooth movement of maxillary canine
Jahanbakhshi, Mohammad Reza; Motamedi, Ali Mohammad Kalantar; Feizbakhsh, Masoud; Mogharehabed, Ahmad
2016-01-01
Background: Selective alveolar corticotomy is defined as an intentional injury to cortical bone. This technique is an effective means of accelerating orthodontic tooth movement. The aim of this study is to evaluate the effect of buccal corticotomy in accelerating maxillary canine retraction. Materials and Methods: The sample in this clinical trial study consisted of 15 adult female patients with therapeutic need for extraction of maxillary first premolars and maximum canine retraction. By use of split-mouth design, at the time of premolars extraction, buccal corticotomy was performed around the maxillary first premolar, randomly on one side of maxilla, and the other side was reserved as the control side. Canine retraction was performed by use of friction – less mechanic with simple vertical loop. Every 2 weeks, distance between canines and second premolars was measured until complete space closure. The velocity of space closure was calculated to evaluate the effect of this technique in accelerating orthodontic tooth movement. The obtained data were statistically analyzed using independent t-test, and the significance was set at 0.05. Results: The rate of canine retraction was significantly higher on the corticotomy side than the control side by an average of 1.8 mm/month versus 1.1 mm/month in the corticotomy side and control side, respectively (P orthodontic tooth movement about two times faster than conventional orthodontics and it is significant in early stages after surgical porsedure. Therefore Buccal corticotomy is a useful adjunct technique for accelerating orthodontic tooth movement. PMID:27605986
Choi, Chi-Bong; Kim, Sang-Young; Lee, Sung-Ho; Jahng, Geon-Ho; Kim, Hwi-Yool; Choe, Bo-Young; Ryu, Kyung-Nam; Yang, Dal-Mo; Yim, Sung-Vin; Choi, Woo-Suk
2011-01-01
Parkinson's disease (PD) is a neurodegenerative disorder characterized by the progressive loss of the dopaminergic neurons in the substantia nigra pars compacta, which projects to the striatum. We induced a selective loss of nigrostriatal dopamine neurons, by infusing the mitochondrial complex 1 inhibitor 1-methyl 4-phenyl 1,2,3,6-tetrahydropyridine (MPTP) into adult beagle dogs (N=5). Single voxel ¹H water suppressed magnetic resonance spectroscopy (¹H-MRS) at 3 T was used to assess the metabolic changes in the striatum of canine before and after MPTP intoxication. The metabolite spectra obtained from the striatum (voxel size: 2 cm³) showed a lower N-acetyl aspartate to total creatine (creatine+phosphocreatine) ratio after MPTP intoxication. There were no significant differences in other metabolite ratios such as glutamate+glutamine, choline-containing compounds (glycerophosphocholine+phophorylcholine and myo-inositol). Our findings indicated that ¹H-MRS is a sensitive, noninvasive measure of neural toxicity and biochemical alterations of the striatum in a canine model of PD, and further studies are needed to confirm brain metabolic changes in association with progression of MPTP-intoxication. Copyright © 2011 Elsevier Inc. All rights reserved.
Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina
2015-09-30
During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be
The Genetics of Canine Skull Shape Variation
Schoenebeck, Jeffrey J.; Ostrander, Elaine A.
2013-01-01
A dog’s craniofacial diversity is the result of continual human intervention in natural selection, a process that began tens of thousands of years ago. To date, we know little of the genetic underpinnings and developmental mechanisms that make dog skulls so morphologically plastic. In this Perspectives, we discuss the origins of dog skull shapes in terms of history and biology and highlight recent advances in understanding the genetics of canine skull shapes. Of particular interest are those molecular genetic changes that are associated with the development of distinct breeds. PMID:23396475
2015-01-01
Treatment of brain injury following circulatory arrest is a challenging health issue with no viable therapeutic options. Based on studies in a clinically relevant large animal (canine) model of hypothermic circulatory arrest (HCA)-induced brain injury, neuroinflammation and excitotoxicity have been identified as key players in mediating the brain injury after HCA. Therapy with large doses of valproic acid (VPA) showed some neuroprotection but was associated with adverse side effects. For the first time in a large animal model, we explored whether systemically administered polyamidoamine (PAMAM) dendrimers could be effective in reaching target cells in the brain and deliver therapeutics. We showed that, upon systemic administration, hydroxyl-terminated PAMAM dendrimers are taken up in the brain of injured animals and selectively localize in the injured neurons and microglia in the brain. The biodistribution in other major organs was similar to that seen in small animal models. We studied systemic dendrimer–drug combination therapy with two clinically approved drugs, N-acetyl cysteine (NAC) (attenuating neuroinflammation) and valproic acid (attenuating excitotoxicity), building on positive outcomes in a rabbit model of perinatal brain injury. We prepared and characterized dendrimer-NAC (D-NAC) and dendrimer-VPA (D-VPA) conjugates in multigram quantities. A glutathione-sensitive linker to enable for fast intracellular release. In preliminary efficacy studies, combination therapy with D-NAC and D-VPA showed promise in this large animal model, producing 24 h neurological deficit score improvements comparable to high dose combination therapy with VPA and NAC, or free VPA, but at one-tenth the dose, while significantly reducing the adverse side effects. Since adverse side effects of drugs are exaggerated in HCA, the reduced side effects with dendrimer conjugates and suggestions of neuroprotection offer promise for these nanoscale drug delivery systems. PMID:24499315
Mishra, Manoj K; Beaty, Claude A; Lesniak, Wojciech G; Kambhampati, Siva P; Zhang, Fan; Wilson, Mary A; Blue, Mary E; Troncoso, Juan C; Kannan, Sujatha; Johnston, Michael V; Baumgartner, William A; Kannan, Rangaramanujam M
2014-03-25
Treatment of brain injury following circulatory arrest is a challenging health issue with no viable therapeutic options. Based on studies in a clinically relevant large animal (canine) model of hypothermic circulatory arrest (HCA)-induced brain injury, neuroinflammation and excitotoxicity have been identified as key players in mediating the brain injury after HCA. Therapy with large doses of valproic acid (VPA) showed some neuroprotection but was associated with adverse side effects. For the first time in a large animal model, we explored whether systemically administered polyamidoamine (PAMAM) dendrimers could be effective in reaching target cells in the brain and deliver therapeutics. We showed that, upon systemic administration, hydroxyl-terminated PAMAM dendrimers are taken up in the brain of injured animals and selectively localize in the injured neurons and microglia in the brain. The biodistribution in other major organs was similar to that seen in small animal models. We studied systemic dendrimer-drug combination therapy with two clinically approved drugs, N-acetyl cysteine (NAC) (attenuating neuroinflammation) and valproic acid (attenuating excitotoxicity), building on positive outcomes in a rabbit model of perinatal brain injury. We prepared and characterized dendrimer-NAC (D-NAC) and dendrimer-VPA (D-VPA) conjugates in multigram quantities. A glutathione-sensitive linker to enable for fast intracellular release. In preliminary efficacy studies, combination therapy with D-NAC and D-VPA showed promise in this large animal model, producing 24 h neurological deficit score improvements comparable to high dose combination therapy with VPA and NAC, or free VPA, but at one-tenth the dose, while significantly reducing the adverse side effects. Since adverse side effects of drugs are exaggerated in HCA, the reduced side effects with dendrimer conjugates and suggestions of neuroprotection offer promise for these nanoscale drug delivery systems.
Characterization and modulation of canine mast cell derived eicosanoids
Lin, Tzu-Yin; London, Cheryl A.
2013-01-01
Mast cells play an important role in both innate and acquired immunity as well as several pathological conditions including allergy, arthritis and neoplasia. They influence these processes by producing a variety of mediators including cytokines, chemokines and eicosanoids. Very little is currently known about the spectrum of inflammatory mediators, particularly eicosanoids (prostaglandins and leukotrienes), produced by canine mast cells. This is important since modulating mast cell derived eicosanoids may help in the treatment of autoimmune and inflammatory disorders. The purpose of this study was to investigate the spectrum of eicosanoids produced by normal canine mast cells and to evaluate the effects of cytokines and non-steroidal anti-inflammatory mediators (NSAIDS) on eicosanoid production and release. Canine bone marrow derived cultured mast cells (cBMCMCs) expressed COX-1, COX-2, and 5-LOX and synthesized and released PGD2, PGE2, LTB4, and LTC4 following activation by a variety of stimuli. The selective COX-2 NSAIDs carprofen (Rimadyl®) and deracoxib (Deramaxx®) inhibited PGD2 and PGE2 production but only slightly inhibited LTB4 and LTC4. The mixed COX-1/COX-2 inhibitor piroxicam blocked PGD2 and PGE2 production, but upregulated LTC4 following treatment while tepoxilan (Zubrin®), a pan COX/LOX inhibitor, markedly reduced the production of all eicosanoids. The LOX inhibitor nordihydroguaiaretic acid (NDGA) prevented LTB4/LTC4 release and BMBMC degranulation. Pre-incubation of cBMCMCs with IL-4 and SCF sensitized these cells to degranulation in response to substance P. In conclusion, canine BMCMCs produce an array of eicosanoids similar to those produced by mast cells from other species. Tepoxilan appeared to be the most effective NSAID for blocking eicosanoid production and thus may be useful for modulating mast cell mediated responses in dogs. PMID:20036014
Comparison of BNCT and GdNCT efficacy in treatment of canine cancer
Energy Technology Data Exchange (ETDEWEB)
Mitin, V.N. [Russian Cancer Research Center of the RAMS, Kashirskoe shosse, 24, 115478 Moscow (Russian Federation); Kulakov, V.N.; Khokhlov, V.F.; Sheino, I.N. [State Research Center Institute of Biophysics, Zhivopisnaya ul., 46, 123182 Moscow (Russian Federation); Arnopolskaya, A.M. [Russian Cancer Research Center of the RAMS, Kashirskoe shosse, 24, 115478 Moscow (Russian Federation)], E-mail: ariana_777@inbox.ru; Kozlovskaya, N.G. [Russian Cancer Research Center of the RAMS, Kashirskoe shosse, 24, 115478 Moscow (Russian Federation); Zaitsev, K.N.; Portnov, A.A. [Moscow Engineering Physics Institute, Kashirskoe shosse, 31, 115409 Moscow (Russian Federation)
2009-07-15
In this study efficacy of antineoplastic action of gadolinium NCT and boron NCT in cases of canine melanoma and osteosarcoma was compared. Canine spontaneous tumors, such as melanoma and osteosarcoma, have clinical common features with human malignancies, so these tumors in dogs can be considered as clinical model of human melanoma and osteosarcoma. The study has been carried out on 33 dogs with oral cavity melanoma and 9 dogs with osteosarcoma. Dogs with spontaneous melanoma of oral cavity and osteosarcoma of extremities were selected by the results of clinical examination. Irradiation was carried out at the NCT facility of the IRT MEPhI reactor. Neutron irradiation without boron or gadolinium was chosen as a control method to evaluate the efficacy of NCT.
Comparison of BNCT and GdNCT efficacy in treatment of canine cancer
International Nuclear Information System (INIS)
Mitin, V.N.; Kulakov, V.N.; Khokhlov, V.F.; Sheino, I.N.; Arnopolskaya, A.M.; Kozlovskaya, N.G.; Zaitsev, K.N.; Portnov, A.A.
2009-01-01
In this study efficacy of antineoplastic action of gadolinium NCT and boron NCT in cases of canine melanoma and osteosarcoma was compared. Canine spontaneous tumors, such as melanoma and osteosarcoma, have clinical common features with human malignancies, so these tumors in dogs can be considered as clinical model of human melanoma and osteosarcoma. The study has been carried out on 33 dogs with oral cavity melanoma and 9 dogs with osteosarcoma. Dogs with spontaneous melanoma of oral cavity and osteosarcoma of extremities were selected by the results of clinical examination. Irradiation was carried out at the NCT facility of the IRT MEPhI reactor. Neutron irradiation without boron or gadolinium was chosen as a control method to evaluate the efficacy of NCT.
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Air pollution and brain damage.
Calderón-Garcidueñas, Lilian; Azzarelli, Biagio; Acuna, Hilda; Garcia, Raquel; Gambling, Todd M; Osnaya, Norma; Monroy, Sylvia; DEL Tizapantzi, Maria Rosario; Carson, Johnny L; Villarreal-Calderon, Anna; Rewcastle, Barry
2002-01-01
Exposure to complex mixtures of air pollutants produces inflammation in the upper and lower respiratory tract. Because the nasal cavity is a common portal of entry, respiratory and olfactory epithelia are vulnerable targets for toxicological damage. This study has evaluated, by light and electron microscopy and immunohistochemical expression of nuclear factor-kappa beta (NF-kappaB) and inducible nitric oxide synthase (iNOS), the olfactory and respiratory nasal mucosae, olfactory bulb, and cortical and subcortical structures from 32 healthy mongrel canine residents in Southwest Metropolitan Mexico City (SWMMC), a highly polluted urban region. Findings were compared to those in 8 dogs from Tlaxcala, a less polluted, control city. In SWMMC dogs, expression of nuclear neuronal NF-kappaB and iNOS in cortical endothelial cells occurred at ages 2 and 4 weeks; subsequent damage included alterations of the blood-brain barrier (BBB), degenerating cortical neurons, apoptotic glial white matter cells, deposition of apolipoprotein E (apoE)-positive lipid droplets in smooth muscle cells and pericytes, nonneuritic plaques, and neurofibrillary tangles. Persistent pulmonary inflammation and deteriorating olfactory and respiratory barriers may play a role in the neuropathology observed in the brains of these highly exposed canines. Neurodegenerative disorders such as Alzheimer's may begin early in life with air pollutants playing a crucial role.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
PiB fails to map amyloid deposits in cerebral cortex of aged dogs with canine cognitive dysfunction
DEFF Research Database (Denmark)
Fast, Rikke; Rodell, Anders; Gjedde, Albert
2013-01-01
to the understanding of AD. However, the sensitivity of the biomarker Pittsburgh Compound B (PiB) to the presence of Aβ in humans and in other mammalian species is in doubt. To test the sensitivity and assess the distribution of Aβ in dog brain, we mapped the brains of dogs with signs of CCD (n = 16) and a control......]PiB in the cerebellum, compared to the cerebral cortex. Retention in the cerebellum is at variance with evidence from brains of humans with AD. To confirm the lack of sensitivity, we stained two dog brains with the immunohistochemical marker 6E10, which is sensitive to the presence of both Aβ and Aβ precursor protein......Dogs with Canine Cognitive Dysfunction (CCD) accumulate amyloid beta (Aβ) in the brain. As the cognitive decline and neuropathology of these old dogs share features with Alzheimer's disease (AD), the relation between Aβ and cognitive decline in animal models of cognitive decline is of interest...
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Selectively altering belief formation in the human brain
Sharot, Tali; Kanai, Ryota; Marston, David; Korn, Christoph W.; Rees, Geraint; Dolan, Raymond J.
2012-01-01
Humans form beliefs asymmetrically; we tend to discount bad news but embrace good news. This reduced impact of unfavorable information on belief updating may have important societal implications, including the generation of financial market bubbles, ill preparedness in the face of natural disasters, and overly aggressive medical decisions. Here, we selectively improved people’s tendency to incorporate bad news into their beliefs by disrupting the function of the left (but not right) inferior frontal gyrus using transcranial magnetic stimulation, thereby eliminating the engrained “good news/bad news effect.” Our results provide an instance of how selective disruption of regional human brain function paradoxically enhances the ability to incorporate unfavorable information into beliefs of vulnerability. PMID:23011798
Neuroprotection by selective neuronal deletion of Atg7 in neonatal brain injury
Xie, Cuicui; Ginet, Vanessa; Sun, Yanyan; Koike, Masato; Zhou, Kai; Li, Tao; Li, Hongfu; Li, Qian; Wang, Xiaoyang; Uchiyama, Yasuo; Truttmann, Anita C.; Kroemer, Guido; Puyal, Julien; Blomgren, Klas; Zhu, Changlian
2016-01-01
ABSTRACT Perinatal asphyxia induces neuronal cell death and brain injury, and is often associated with irreversible neurological deficits in children. There is an urgent need to elucidate the neuronal death mechanisms occurring after neonatal hypoxia-ischemia (HI). We here investigated the selective neuronal deletion of the Atg7 (autophagy related 7) gene on neuronal cell death and brain injury in a mouse model of severe neonatal hypoxia-ischemia. Neuronal deletion of Atg7 prevented HI-induced autophagy, resulted in 42% decrease of tissue loss compared to wild-type mice after the insult, and reduced cell death in multiple brain regions, including apoptosis, as shown by decreased caspase-dependent and -independent cell death. Moreover, we investigated the lentiform nucleus of human newborns who died after severe perinatal asphyxia and found increased neuronal autophagy after severe hypoxic-ischemic encephalopathy compared to control uninjured brains, as indicated by the numbers of MAP1LC3B/LC3B (microtubule-associated protein 1 light chain 3)-, LAMP1 (lysosomal-associated membrane protein 1)-, and CTSD (cathepsin D)-positive cells. These findings reveal that selective neuronal deletion of Atg7 is strongly protective against neuronal death and overall brain injury occurring after HI and suggest that inhibition of HI-enhanced autophagy should be considered as a potential therapeutic target for the treatment of human newborns developing severe hypoxic-ischemic encephalopathy. PMID:26727396
ΔNp63 mediates cellular survival and metastasis in canine osteosarcoma.
Cam, Maren; Gardner, Heather L; Roberts, Ryan D; Fenger, Joelle M; Guttridge, Denis C; London, Cheryl A; Cam, Hakan
2016-07-26
p63 is a structural homolog within the 53 family encoding two isoforms, ΔNp63 and TAp63. The oncogenic activity of ΔNp63 has been demonstrated in multiple cancers, however the underlying mechanisms that contribute to tumorigenesis are poorly characterized. Osteosarcoma (OSA) is the most common primary bone tumor in dogs, exhibiting clinical behavior and molecular biology essentially identical to its human counterpart. The purpose of this study was to evaluate the potential contribution of ΔNp63 to the biology of canine OSA. As demonstrated by qRT-PCR, nearly all canine OSA cell lines and tissues overexpressed ΔNp63 relative to normal control osteoblasts. Inhibition of ΔNp63 by RNAi selectively induced apoptosis in the OSA cell lines overexpressing ΔNp63. Knockdown of ΔNp63 upregulated expression of the proapoptotic Bcl-2 family members Puma and Noxa independent of p53. However the effects of ΔNp63 required transactivating isoforms of p73, suggesting that ΔNp63 promotes survival in OSA by repressing p73-dependent apoptosis. In addition, ΔNp63 modulated angiogenesis and invasion through its effects on VEGF-A and IL-8 expression, and STAT3 phosphorylation. Lastly, the capacity of canine OSA cell lines to form pulmonary metastasis was directly related to expression levels of ΔNp63 in a murine model of metastatic OSA. Together, these data demonstrate that ΔNp63 inhibits apoptosis and promotes metastasis, supporting continued evaluation of this oncogene as a therapeutic target in both human and canine OSA.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Naci, Lorina; Cusack, Rhodri; Jia, Vivian Z; Owen, Adrian M
2013-05-29
The interpretation of human thought from brain activity, without recourse to speech or action, is one of the most provoking and challenging frontiers of modern neuroscience. In particular, patients who are fully conscious and awake, yet, due to brain damage, are unable to show any behavioral responsivity, expose the limits of the neuromuscular system and the necessity for alternate forms of communication. Although it is well established that selective attention can significantly enhance the neural representation of attended sounds, it remains, thus far, untested as a response modality for brain-based communication. We asked whether its effect could be reliably used to decode answers to binary (yes/no) questions. Fifteen healthy volunteers answered questions (e.g., "Do you have brothers or sisters?") in the fMRI scanner, by selectively attending to the appropriate word ("yes" or "no"). Ninety percent of the answers were decoded correctly based on activity changes within the attention network. The majority of volunteers conveyed their answers with less than 3 min of scanning, suggesting that this technique is suited for communication in a reasonable amount of time. Formal comparison with the current best-established fMRI technique for binary communication revealed improved individual success rates and scanning times required to detect responses. This novel fMRI technique is intuitive, easy to use in untrained participants, and reliably robust within brief scanning times. Possible applications include communication with behaviorally nonresponsive patients.
Goebel, Katie; Merner, Nancy D
2017-05-01
Canines are excellent models for cancer studies due to their similar physiology and genomic sequence to humans, companion status and limited intra-breed heterogeneity. Due to their affliction to mammary cancers, canines can serve as powerful genetic models of hereditary breast cancers. Variants within known human breast cancer susceptibility genes only explain a fraction of familial cases. Thus, further discovery is necessary but such efforts have been thwarted by genetic heterogeneity. Reducing heterogeneity is key, and studying isolated human populations have helped in the endeavour. An alternative is to study dog pedigrees, since artificial selection has resulted in extreme homogeneity. Identifying the genetic predisposition to canine mammary tumours can translate to human discoveries - a strategy currently underutilized. To explore this potential, we reviewed published canine mammary tumour genetic studies and proposed benefits of next generation sequencing canine cohorts to facilitate moving beyond incremental advances.
Cherry, Rose L; Smith, Jodi D; Ben-Shlomo, Gil
2018-01-01
Labial mucosa transplantation for the treatment of canine keratoconjunctivitis sicca (KCS) has been reported recently. Postoperative alleviation of clinical signs was noted and assumed to be the result of labial salivary glands providing lubrication to the ocular tissue. The aim of this study was to evaluate the presence of minor salivary glands (MSG) in the canine oral mucosa. Oral mucosal biopsies were collected from six dogs that died (n = 1) or were euthanized (n = 5) for reasons unrelated to this study. The breeds included were two Doberman Pinschers, one Labrador Retriever, one Portuguese Water Dog, one German Shepherd Dog, and one mixed canine. Three were spayed females, and three were castrated males with the median age of 9 years (range, 6-13 years). Samples were obtained by an 8-mm punch biopsy at the following locations of the canine oral cavity: upper rostral labial mucosa at midline, lower rostral labial mucosa at midline, upper labial mucosa near the commissure, lower labial mucosa near the commissure, and buccal mucosa approximately 1 cm caudal to the commissure. Samples were routinely processed with hematoxylin and eosin, and periodic acid-Schiff stains. Samples were evaluated by light microscopy. At the selected locations, no MSG or other secreting cells were detected. Minor salivary glands are not associated with alleviation of canine KCS symptoms following labial mucosa transplantation. Further studies are needed to determine the mechanism leading to the transient improvement of KCS symptoms in canine patients following labial mucosa transplantation. © 2017 American College of Veterinary Ophthalmologists.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Makhlouf, Mohamed; Aboul-Ezz, Amr; Fayed, Mona Salah; Hafez, Hend
2018-02-15
The current study was carried out to compare the amount of tooth movement during canine retraction comparing two different retraction mechanics; friction mechanics represented by a NiTi closed coil spring versus frictionless mechanics represented by T - loop, and their effect on root resorption using Cone Beam Computed Tomography (CBCT). Ten patients were selected in a split-mouth study design that had a malocclusion that necessitates the extraction of maxillary first premolars and retraction of maxillary canines. The right maxillary canines were retracted using T - loops fabricated from 0.017 X 0.025 TMA wires. The left maxillary canines received NiTi coil spring with 150 gm of retraction force. Pre retraction and post retraction Cone Beam Computed Tomography were taken to evaluate the amount of tooth movement and root resorption using three-dimensional planes. T - loop side showed statistically significant higher mean anteroposterior measurement than NiTi coil spring side, indicating a lower amount of canine movement pre and post a canine retraction. Concerning the root resorption, there was no statistically significant change in the mean measurements of canine root length post retraction. The NiTi coil spring side showed more distal movement more than the T-loop side. Both retraction mechanics with controlled retraction force, do not cause root resorption.
Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni
2016-12-01
Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi
Prognostic factors in canine appendicular osteosarcoma – a meta-analysis
2012-01-01
Background Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. Results A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Conclusions Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma. PMID:22587466
Prognostic factors in canine appendicular osteosarcoma – a meta-analysis
Directory of Open Access Journals (Sweden)
Boerman Ilse
2012-05-01
Full Text Available Abstract Background Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP, bone alkaline phosphatase (BALP, infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. Results A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location, looking at both survival time (ST and disease free interval (DFI. The third factor (age was studied in a qualitative manner. Both elevated SALP level and the (proximal humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Conclusions Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.
Cationization increases brain distribution of an amyloid-beta protofibril selective F(ab')2 fragment
Syvänen, Stina; Edén, Desireé; Sehlin, Dag
2017-01-01
Antibodies and fragments thereof are, because of high selectivity for their targets, considered as potential therapeutics and biomarkers for several neurological disorders. However, due to their large molecular size, antibodies/fragments do not easily penetrate into the brain. The aim of the present study was to improve the brain distribution via adsorptive-mediated transcytosis of an amyloid-beta (A beta) protofibril selective F(ab')2 fragment (F(ab')2-h158). F(ab')2-h158 was cationized to d...
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
A Wearable Channel Selection-Based Brain-Computer Interface for Motor Imagery Detection.
Lo, Chi-Chun; Chien, Tsung-Yi; Chen, Yu-Chun; Tsai, Shang-Ho; Fang, Wai-Chi; Lin, Bor-Shyh
2016-02-06
Motor imagery-based brain-computer interface (BCI) is a communication interface between an external machine and the brain. Many kinds of spatial filters are used in BCIs to enhance the electroencephalography (EEG) features related to motor imagery. The approach of channel selection, developed to reserve meaningful EEG channels, is also an important technique for the development of BCIs. However, current BCI systems require a conventional EEG machine and EEG electrodes with conductive gel to acquire multi-channel EEG signals and then transmit these EEG signals to the back-end computer to perform the approach of channel selection. This reduces the convenience of use in daily life and increases the limitations of BCI applications. In order to improve the above issues, a novel wearable channel selection-based brain-computer interface is proposed. Here, retractable comb-shaped active dry electrodes are designed to measure the EEG signals on a hairy site, without conductive gel. By the design of analog CAR spatial filters and the firmware of EEG acquisition module, the function of spatial filters could be performed without any calculation, and channel selection could be performed in the front-end device to improve the practicability of detecting motor imagery in the wearable EEG device directly or in commercial mobile phones or tablets, which may have relatively low system specifications. Finally, the performance of the proposed BCI is investigated, and the experimental results show that the proposed system is a good wearable BCI system prototype.
Deprivation selectively modulates brain potentials to food pictures
Stockburger, Jessica; Weike, Almut I.; Hamm, Alfons O.; Schupp, Harald Thomas
2008-01-01
Event-related brain potentials (ERPs) were used to examine whether the processing of food pictures is selectively modulated by changes in the motivational state of the observer. Sixteen healthy male volunteers were tested twice 1 week apart, either after 24 hr of food deprivation or after normal food intake. ERPs were measured while participants viewed appetitive food pictures as well as standard emotional and neutral control pictures. Results show that the ERPs to food pictures in a hungry, ...
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Diagnosis, prevention, and management of canine hip dysplasia: a review
Directory of Open Access Journals (Sweden)
Schachner ER
2015-05-01
Full Text Available Emma R Schachner, Mandi J Lopez Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA, USA Abstract: Canine hip dysplasia (CHD is a polygenic and multifactorial developmental disorder characterized by coxofemoral (hip joint laxity, degeneration, and osteoarthritis (OA. Current diagnostic techniques are largely subjective measures of joint conformation performed at different stages of development. Recently, measures on three-dimensional images generated from computed tomography scans predicted the development of OA associated with CHD. Continued refinement of similar imaging methods may improve diagnostic imaging techniques to identify dogs predisposed to degenerative hip joint changes. By current consensus, joint changes consistent with CHD are influenced by genetic predisposition as well as environmental and biomechanical factors; however, despite decades of work, the relative contributions of each to the development and extent of CHD signs remain elusive. Similarly, despite considerable effort to decipher the genetic underpinnings of CHD for selective breeding programs, relevant genetic loci remain equivocal. As such, prevention of CHD within domestic canine populations is marginally successful. Conservative management is often employed to manage signs of CHD, with lifelong maintenance of body mass as one of the most promising methods. Surgical intervention is often employed to prevent joint changes or restore joint function, but there are no gold standards for either goal. To date, all CHD phenotypes are considered as a single entity in spite of recognized differences in expression and response to environmental conditions and treatment. Identification of distinct CHD phenotypes and targeting evidence-based conservative and invasive treatments for each may significantly advance prevention and management of a prevalent, debilitating condition in canine companions. Keywords: canine
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Can Xanthophyll-Membrane Interactions Explain Their Selective Presence in the Retina and Brain?
Widomska, Justyna; Zareba, Mariusz; Subczynski, Witold Karol
2016-01-01
Epidemiological studies demonstrate that a high dietary intake of carotenoids may offer protection against age-related macular degeneration, cancer and cardiovascular and neurodegenerative diseases. Humans cannot synthesize carotenoids and depend on their dietary intake. Major carotenoids that have been found in human plasma can be divided into two groups, carotenes (nonpolar molecules, such as β-carotene, α-carotene or lycopene) and xanthophylls (polar carotenoids that include an oxygen atom in their structure, such as lutein, zeaxanthin and β-cryptoxanthin). Only two dietary carotenoids, namely lutein and zeaxanthin (macular xanthophylls), are selectively accumulated in the human retina. A third carotenoid, meso-zeaxanthin, is formed directly in the human retina from lutein. Additionally, xanthophylls account for about 70% of total carotenoids in all brain regions. Some specific properties of these polar carotenoids must explain why they, among other available carotenoids, were selected during evolution to protect the retina and brain. It is also likely that the selective uptake and deposition of macular xanthophylls in the retina and brain are enhanced by specific xanthophyll-binding proteins. We hypothesize that the high membrane solubility and preferential transmembrane orientation of macular xanthophylls distinguish them from other dietary carotenoids, enhance their chemical and physical stability in retina and brain membranes and maximize their protective action in these organs. Most importantly, xanthophylls are selectively concentrated in the most vulnerable regions of lipid bilayer membranes enriched in polyunsaturated lipids. This localization is ideal if macular xanthophylls are to act as lipid-soluble antioxidants, which is the most accepted mechanism through which lutein and zeaxanthin protect neural tissue against degenerative diseases. PMID:27030822
Can Xanthophyll-Membrane Interactions Explain Their Selective Presence in the Retina and Brain?
Directory of Open Access Journals (Sweden)
Justyna Widomska
2016-01-01
Full Text Available Epidemiological studies demonstrate that a high dietary intake of carotenoids may offer protection against age-related macular degeneration, cancer and cardiovascular and neurodegenerative diseases. Humans cannot synthesize carotenoids and depend on their dietary intake. Major carotenoids that have been found in human plasma can be divided into two groups, carotenes (nonpolar molecules, such as β-carotene, α-carotene or lycopene and xanthophylls (polar carotenoids that include an oxygen atom in their structure, such as lutein, zeaxanthin and β-cryptoxanthin. Only two dietary carotenoids, namely lutein and zeaxanthin (macular xanthophylls, are selectively accumulated in the human retina. A third carotenoid, meso-zeaxanthin, is formed directly in the human retina from lutein. Additionally, xanthophylls account for about 70% of total carotenoids in all brain regions. Some specific properties of these polar carotenoids must explain why they, among other available carotenoids, were selected during evolution to protect the retina and brain. It is also likely that the selective uptake and deposition of macular xanthophylls in the retina and brain are enhanced by specific xanthophyll-binding proteins. We hypothesize that the high membrane solubility and preferential transmembrane orientation of macular xanthophylls distinguish them from other dietary carotenoids, enhance their chemical and physical stability in retina and brain membranes and maximize their protective action in these organs. Most importantly, xanthophylls are selectively concentrated in the most vulnerable regions of lipid bilayer membranes enriched in polyunsaturated lipids. This localization is ideal if macular xanthophylls are to act as lipid-soluble antioxidants, which is the most accepted mechanism through which lutein and zeaxanthin protect neural tissue against degenerative diseases.
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Evolution of canine parvovirus--a need for new vaccines?
Truyen, Uwe
2006-10-05
Canine parvovirus (CPV) is a new virus, which is continuing to evolve, giving rise to new antigenic types and virus mutants that spread through the dog population. The most successful mutants, from an evolutionary perspective, appear to be selected by improved binding to the CPV receptor, the canine transferrin receptor, and by an extended host range, which for the newer antigenic types now includes both the dog and the cat. The new viruses also show antigenic differences that can be defined by binding of certain monoclonal antibodies; they also differ in their reactivity in virus neutralisation tests, using immune sera raised against the various antigenic types. These differences may influence the susceptibility of young animals to infection at the time when the level of maternally derived antibody decreases to the minimum protective titre. This minimum protective titre may vary depending on the infecting virus type. There is, however, a high degree of cross-protection between the virus types and the true relevance of the differences in neutralisation titer is currently not known.
da Costa Monini, André; Júnior, Luiz Gonzaga Gandini; Vianna, Alexandre Protásio; Martins, Renato Parsekian
2017-05-01
To evaluate the rate of lower canine retraction, anchorage loss, and changes on lower canines and first molars axial inclination using self-ligating and conventional brackets. Twenty-five adult patients with a treatment plan involving extractions of four first premolars were selected for this split-mouth trial and had either conventional or self-ligating brackets bonded to lower canines in a block randomization. Retraction was accomplished using 100-g nickel titanium closed-coil springs, which were reactivated each 4 weeks. Oblique radiographs were taken before and after total canine retraction and the cephalograms were superimposed on stable structures of the mandible. Cephalometric points were digitized twice by a single-blinded operator for error control and the average of the points were used to determine the following variables: canine cusp horizontal changes, molar cusp horizontal changes, and angulation changes in canines and molars. Paired t tests were used to analyze the blinded data for group differences. All patients reached final phase without bracket debonds. No differences were found between the two groups for all variables tested. No serious harm was observed. Both brackets showed the same rate of canine retraction and loss of anteroposterior anchorage of the molars. No changes were found between brackets regarding the inclination of canines and first molars. Using self-ligating brackets to retract lower canines will not increase the velocity of tooth movement, does not increase anchorage, and does not decrease tipping.
Boron neutron capture therapy: Brain Tumor Treatment Evaluation Program
International Nuclear Information System (INIS)
Griebenow, M.L.; Dorn, R.V. III; Gavin, P.R.; Spickard, J.H.
1988-01-01
The United States (US) Department of Energy (DOE) recently initiated a focused, multidisciplined program to evaluate Boron Neutron Capture Therapy (BNCT) for the treatment of brain tumors. The program, centered at the DOE/endash/Idaho National Engineering Laboratory (INEL), will develop the analytical, diagnostic and treatment tools, and the database required for BNCT technical assessment. The integrated technology will be evaluated in a spontaneously-occurring canine brain-tumor model. Successful animal studies are expected to lead to human clinical trials within four to five years. 2 refs., 3 figs
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
In-vitro antiviral efficacy of ribavirin and interferon-alpha against canine distemper virus.
Carvalho, Otávio V; Saraiva, Giuliana L; Ferreira, Caroline G T; Felix, Daniele M; Fietto, Juliana L R; Bressan, Gustavo C; Almeida, Márcia R; Silva Júnior, Abelardo
2014-10-01
Canine distemper is a highly contagious disease with high incidence and lethality in the canine population. The objective of this study was to evaluate the efficacy of antiviral action with ribavirin (RBV), interferon-alpha (IFNα), and combinations of RBV and IFNα against canine distemper virus (CDV). Vero cells inoculated with CDV were treated with RBV, IFNα, and combinations of these drugs. The efficacy to inhibit viral replication was evaluated by adding the compounds at different times to determine which step of the viral replicative process was affected. Both drugs were effective against CDV in vitro. The IFNα was the most active compound, with an average IC50 (50% inhibitory concentration) value lower than the IC50 of the RBV. Ribavirin (RBV) was more selective than IFNα, however, and neither drug showed extracellular antiviral activity. The combination of RBV and IFNα exhibited antiviral activity for the intra- and extracellular stages of the replicative cycle of CDV, although the intracellular viral inhibition was higher. Both RBV and IFNα showed high antiviral efficacy against CDV, and furthermore, RBV + IFNα combinations have shown greater interference range in viral infectivity. These compounds could potentially be used to treat clinical disease associated with CDV infection.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Origgi, F C; Plattet, P; Sattler, U; Robert, N; Casaubon, J; Mavrot, F; Pewsner, M; Wu, N; Giovannini, S; Oevermann, A; Stoffel, M H; Gaschen, V; Segner, H; Ryser-Degiorgis, M-P
2012-11-01
An ongoing canine distemper epidemic was first detected in Switzerland in the spring of 2009. Compared to previous local canine distemper outbreaks, it was characterized by unusually high morbidity and mortality, rapid spread over the country, and susceptibility of several wild carnivore species. Here, the authors describe the associated pathologic changes and phylogenetic and biological features of a multiple highly virulent canine distemper virus (CDV) strain detected in and/or isolated from red foxes (Vulpes vulpes), Eurasian badgers (Meles meles), stone (Martes foina) and pine (Martes martes) martens, from a Eurasian lynx (Lynx lynx), and a domestic dog. The main lesions included interstitial to bronchointerstitial pneumonia and meningopolioencephalitis, whereas demyelination--the classic presentation of CDV infection--was observed in few cases only. In the brain lesions, viral inclusions were mainly in the nuclei of the neurons. Some significant differences in brain and lung lesions were observed between foxes and mustelids. Swiss CDV isolates shared together with a Hungarian CDV strain detected in 2004. In vitro analysis of the hemagglutinin protein from one of the Swiss CDV strains revealed functional and structural differences from that of the reference strain A75/17, with the Swiss strain showing increased surface expression and binding efficiency to the signaling lymphocyte activation molecule (SLAM). These features might be part of a novel molecular signature, which might have contributed to an increase in virus pathogenicity, partially explaining the high morbidity and mortality, the rapid spread, and the large host spectrum observed in this outbreak.
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Interspecies dynamics among bacteria associated with canine periodontal disease.
Sanguansermsri, P; Nobbs, A H; Jenkinson, H F; Surarit, R
2018-02-01
The etiology and pathogenic mechanisms associated with canine periodontal disease are less well understood than the disease in humans. In this study we have reconstructed defined consortia biofilms in vitro of microorganisms identified as prevalent in a same-breed cohort of dogs with or without periodontal disease. Frederiksenia canicola and Neisseria canis were selected as potential early colonizers of salivary pellicle, and Fusobacterium nucleatum and Porphyromonas gulae were included as high incidence canine oral bacteria. N. canis formed a biofilm substratum under aerobic conditions, but was unable to tolerate anaerobic conditions. Fr. canicola exhibited synergistic biofilm growth with Po. gulae under anaerobic conditions, but displayed an antagonistic relationship with Fu. nucleatum. However, strong co-adhesion between Fu. nucleatum and Po. gulae was able to overcome the inhibitory effects of Fr. canicola to facilitate three-species biofilm formation. Parvimonas micra, an anaerobic, asaccharolytic Gram-positive coccus found only under disease conditions in vivo, was able to form biofilms in conjunction with Fr. canicola and Po. gulae. Furthermore, the specific proteolytic activities of biofilms containing Fr. canicola and Po. gulae or Fu. nucleatum and Po. gulae were increased several-fold upon the addition of Pa. micra. This suggests that anaerobic cocci such as Pa. micra might provide a catalyst for progressive tissue destruction, inflammation and alveolar bone loss in canine periodontal disease, in keeping with the keystone-pathogen hypothesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Directory of Open Access Journals (Sweden)
Catherine A. Blunt
2013-05-01
Full Text Available Successful treatment of canine pyoderma has become compromised owing to the development of antimicrobial resistance with accompanying recurrence of infection. Canine skin samples submitted to a veterinary diagnostic laboratory for microbiological culture and sensitivity between January 2007 and June 2010, from which Staphylococcus intermedius was isolated, were selected for this investigation. Antimicrobial resistance of S. intermedius was most prevalent with reference to ampicillin followed by resistance to tetracycline and then potentiated sulphonamides. In general, antimicrobial resistance was low and very few methicillin-resistant isolates were detected. Temporal trends were not noted, except for ampicillin, with isolates becoming more susceptible, and potentiated sulphonamides (co-trimoxazole, with isolates becoming more resistant. In general, both the Kirby–Bauer disc diffusion and broth dilution minimum inhibitory concentration tests yielded similar results for the antimicrobial agents tested. The main difference was evident in the over-estimation of resistance by the Kirby–Bauer test for ampicillin, co-trimoxazole, penicillin and doxycycline. Knowledge of trends in bacterial resistance is important for veterinarians when presented with canine pyoderma. Analysis of antimicrobial susceptibility profiles of S. intermedius isolated from canine pyodermas will guide veterinarians’ use of the most appropriate agent and encourage prudent use of antimicrobials in companion animals.
Male and female brain evolution is subject to contrasting selection pressures in primates
Directory of Open Access Journals (Sweden)
Dunbar Robin IM
2007-05-01
Full Text Available Abstract The claim that differences in brain size across primate species has mainly been driven by the demands of sociality (the "social brain" hypothesis is now widely accepted. Some of the evidence to support this comes from the fact that species that live in large social groups have larger brains, and in particular larger neocortices. Lindenfors and colleagues (BMC Biology 5:20 add significantly to our appreciation of this process by showing that there are striking differences between the two sexes in the social mechanisms and brain units involved. Female sociality (which is more affiliative is related most closely to neocortex volume, but male sociality (which is more competitive and combative is more closely related to subcortical units (notably those associated with emotional responses. Thus different brain units have responded to different selection pressures.
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Hirvonen, J; Goodwin, R S; Li, C-T; Terry, G E; Zoghbi, S S; Morse, C; Pike, V W; Volkow, N D; Huestis, M A; Innis, R B
2012-06-01
Chronic cannabis (marijuana, hashish) smoking can result in dependence. Rodent studies show reversible downregulation of brain cannabinoid CB(1) (cannabinoid receptor type 1) receptors after chronic exposure to cannabis. However, whether downregulation occurs in humans who chronically smoke cannabis is unknown. Here we show, using positron emission tomography imaging, reversible and regionally selective downregulation of brain cannabinoid CB(1) receptors in human subjects who chronically smoke cannabis. Downregulation correlated with years of cannabis smoking and was selective to cortical brain regions. After ∼4 weeks of continuously monitored abstinence from cannabis on a secure research unit, CB(1) receptor density returned to normal levels. This is the first direct demonstration of cortical cannabinoid CB(1) receptor downregulation as a neuroadaptation that may promote cannabis dependence in human brain.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Selective localization of IgG from cerebrospinal fluid to brain parenchyma
DEFF Research Database (Denmark)
Mørch, Marlene Thorsen; Forsberg Sørensen, Sofie; Khorooshi, Reza M. H.
2018-01-01
the cerebrospinal fluid and induce subpial and periventricular NMO-like lesions and blood-brain barrier breakdown, in a complement-dependent manner. To investigate how IgG trafficking from cerebrospinal fluid to brain parenchyma can be influenced by injury. IgG from healthy donors was intrathecally injected...... into the cerebrospinal fluid via cisterna magna at 1, 2, 4, or 7 days after a distal stereotactic sterile needle insertion to the striatum. Antibody deposition, detected by staining for human IgG, peaked 1 day after the intrathecal injection and was selectively seen close to the needle insertion. When NMO...
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Dai, Yu-Jie; Zhang, Xin; Yang, Yang; Nan, Hai-Yan; Yu, Ying; Sun, Qian; Yan, Lin-Feng; Hu, Bo; Zhang, Jin; Qiu, Zi-Yu; Gao, Yi; Cui, Guang-Bin; Chen, Bi-Liang; Wang, Wen
2018-03-14
The incidence of pain disorders in women is higher than in men, making gender differences in pain a research focus. The human insular cortex is an important brain hub structure for pain processing and is divided into several subdivisions, serving different functions in pain perception. Here we aimed to examine the gender differences of the functional connectivities (FCs) between the twelve insular subdivisions and selected pain-related brain structures in healthy adults. Twenty-six healthy males and 11 age-matched healthy females were recruited in this cross-sectional study. FCs between the 12 insular subdivisions (as 12 regions of interest (ROIs)) and the whole brain (ROI-whole brain level) or 64 selected pain-related brain regions (64 ROIs, ROI-ROI level) were measured between the males and females. Significant gender differences in the FCs of the insular subdivisions were revealed: (1) The FCs between the dorsal dysgranular insula (dId) and other brain regions were significantly increased in males using two different techniques (ROI-whole brain and ROI-ROI analyses); (2) Based on the ROI-whole brain analysis, the FC increases in 4 FC-pairs were observed in males, including the left dId - the right median cingulate and paracingulate/ right posterior cingulate gyrus/ right precuneus, the left dId - the right median cingulate and paracingulate, the left dId - the left angular as well as the left dId - the left middle frontal gyrus; (3) According to the ROI-ROI analysis, increased FC between the left dId and the right rostral anterior cingulate cortex was investigated in males. In summary, the gender differences in the FCs of the insular subdivisions with pain-related brain regions were revealed in the current study, offering neuroimaging evidence for gender differences in pain processing. ClinicalTrials.gov, NCT02820974 . Registered 28 June 2016.
Raffan, Hazel; Guevar, Julien; Poyade, Matthieu; Rea, Paul M
2017-01-01
Current methods used to communicate and present the complex arrangement of vasculature related to the brain and spinal cord is limited in undergraduate veterinary neuroanatomy training. Traditionally it is taught with 2-dimensional (2D) diagrams, photographs and medical imaging scans which show a fixed viewpoint. 2D representations of 3-dimensional (3D) objects however lead to loss of spatial information, which can present problems when translating this to the patient. Computer-assisted learning packages with interactive 3D anatomical models have become established in medical training, yet equivalent resources are scarce in veterinary education. For this reason, we set out to develop a workflow methodology creating an interactive model depicting the vasculature of the canine brain that could be used in undergraduate education. Using MR images of a dog and several commonly available software programs, we set out to show how combining image editing, segmentation and surface generation, 3D modeling and texturing can result in the creation of a fully interactive application for veterinary training. In addition to clearly identifying a workflow methodology for the creation of this dataset, we have also demonstrated how an interactive tutorial and self-assessment tool can be incorporated into this. In conclusion, we present a workflow which has been successful in developing a 3D reconstruction of the canine brain and associated vasculature through segmentation, surface generation and post-processing of readily available medical imaging data. The reconstructed model was implemented into an interactive application for veterinary education that has been designed to target the problems associated with learning neuroanatomy, primarily the inability to visualise complex spatial arrangements from 2D resources. The lack of similar resources in this field suggests this workflow is original within a veterinary context. There is great potential to explore this method, and introduce
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
Directory of Open Access Journals (Sweden)
Maria T.S. Frade
2015-02-01
Full Text Available Infections by free-living amoebae can cause systemic disease in animals and humans. We describe the epidemiological, clinical and pathological aspects of disseminated acanthamoebiasis associated with canine distemper in three dogs of the semiarid region of Paraíba, Northeastern Brazil. Affected dogs developed progressive neurological and respiratory signs that progressed to death within in two to 20 days. Gross lesions were irregular and with yellow-reddish nodules randomly distributed in the lungs, heart, kidneys, spleen, lymph nodes, adrenals, and intestine. One dog had foci of malacia in the parietal cortex and another one in nucleus of brain basis. Histologically, pyogranulomas with areas of necrosis and hemorrhage in all organs affected were observed, associated with myriads of intralesional amoebic trophozoites. All three cases were concomitant canine distemper, that possibly triggered immunosuppression in the dogs. The diagnosis was performed through microscopic findings of infection by free-living amoebae and confirmed Acanthamoeba sp. by immunohistochemistry
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
Swept frequency measurements of microwave antennas in feline and canine brain
International Nuclear Information System (INIS)
Salcman, M.; Neuberth, G.; Nudelman, R.W.; Ferraro, F.T.; Hartman, M.
1986-01-01
Interstitial microwave hyperthermia may prove to be an important therapy for malignant brain tumors. For safety and efficiency, the size and number of intracranial microwave antennas needs to be limited. Low power swept frequency measurements of VSWR were carried out in the brains of anesthetized cats and dogs utilizing stereotactically placed monopole antennas. The coupling efficiency of antennas at any frequency was degraded (VSWR>2:1) if a length of antenna less than 2h was inserted or if a plastic catheter was utilized. Such measurements indicate that (h) can be shortened 25% from the resonant length without seriously degrading antenna performance. The total length can be halved if a catheter with a high dielectric is used. High power tests (2-10w) of short antennas at 915 MHz in a ceramic catheter (e = 10) at 45-50 0 C produce thermal fields approximately 2 cm in diameter in normal brain. It should be possible to efficiently and safely heat human brain tumors of average size utilizing these antennas and catheters at 915 MHz
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.
Directory of Open Access Journals (Sweden)
Yue Huang
Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
Brain activity associated with selective attention, divided attention and distraction.
Salo, Emma; Salmela, Viljami; Salmi, Juha; Numminen, Jussi; Alho, Kimmo
2017-06-01
Top-down controlled selective or divided attention to sounds and visual objects, as well as bottom-up triggered attention to auditory and visual distractors, has been widely investigated. However, no study has systematically compared brain activations related to all these types of attention. To this end, we used functional magnetic resonance imaging (fMRI) to measure brain activity in participants performing a tone pitch or a foveal grating orientation discrimination task, or both, distracted by novel sounds not sharing frequencies with the tones or by extrafoveal visual textures. To force focusing of attention to tones or gratings, or both, task difficulty was kept constantly high with an adaptive staircase method. A whole brain analysis of variance (ANOVA) revealed fronto-parietal attention networks for both selective auditory and visual attention. A subsequent conjunction analysis indicated partial overlaps of these networks. However, like some previous studies, the present results also suggest segregation of prefrontal areas involved in the control of auditory and visual attention. The ANOVA also suggested, and another conjunction analysis confirmed, an additional activity enhancement in the left middle frontal gyrus related to divided attention supporting the role of this area in top-down integration of dual task performance. Distractors expectedly disrupted task performance. However, contrary to our expectations, activations specifically related to the distractors were found only in the auditory and visual cortices. This suggests gating of the distractors from further processing perhaps due to strictly focused attention in the current demanding discrimination tasks. Copyright © 2017 Elsevier B.V. All rights reserved.
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Quantitative analysis of task selection for brain-computer interfaces
Llera, Alberto; Gómez, Vicenç; Kappen, Hilbert J.
2014-10-01
Objective. To assess quantitatively the impact of task selection in the performance of brain-computer interfaces (BCI). Approach. We consider the task-pairs derived from multi-class BCI imagery movement tasks in three different datasets. We analyze for the first time the benefits of task selection on a large-scale basis (109 users) and evaluate the possibility of transferring task-pair information across days for a given subject. Main results. Selecting the subject-dependent optimal task-pair among three different imagery movement tasks results in approximately 20% potential increase in the number of users that can be expected to control a binary BCI. The improvement is observed with respect to the best task-pair fixed across subjects. The best task-pair selected for each subject individually during a first day of recordings is generally a good task-pair in subsequent days. In general, task learning from the user side has a positive influence in the generalization of the optimal task-pair, but special attention should be given to inexperienced subjects. Significance. These results add significant evidence to existing literature that advocates task selection as a necessary step towards usable BCIs. This contribution motivates further research focused on deriving adaptive methods for task selection on larger sets of mental tasks in practical online scenarios.
Selection of optimal treatment scheme for brain metastases of non-small cell lung cancer
International Nuclear Information System (INIS)
Dong Mingxin; Zhao Tong; Huang Jingzi; Yu Shukun; Ma Yan; Tian Zhongcheng; Jin Xiangshun; Quan Jizhong; Liu Jin; Wang Dongxu
2006-01-01
Objective: To select the optimal treatment scheme for brain metastases of non-small cell lung cancers (NSCLCs). Methods: Seventy-two NSCLC cases diagnosesd by pathology with brain metastases were randomly classified into three groups, Group I, 24 cases with whole brain conventional external fractioned irradiation of D T 36-41 Gy/4-5 w, Group II, 22 eases with y-knife treatment plus whole brain conventional external fractioned irradiation, and Group III, 26 cases with γ-knife plus whole brain conventional external fractioned irradiation in combination with chemotherapy of Vm-26. The surrounding area of tumor was strictly covered with 50% para-central-dosal curve in γ-knife treatment (D T 16-25 Gy with a mean of 16 Gy). The muirleaf collimator was selected according to the volume of tumors. Chemotherapy of Vm-26 (60 mg/m 2 d1-3) was applied during the treatment with whole brain conventional external fractioned irradiation (D T 19-29 Gy/2-3 w), 21 days in a period, 2 periods in total. Results: The median survival time was estimated to be 6.0 months (ranged from 1.2 to 19.0 months) in the Group I, 9.2 months (4.4-30 months) in the Group II, and 10.8 months (5.2-42.2 months) in the Group III. The 1-year and 2-year survival rates were 34.6% and 12.6% , 62.2% and 30.2%, and 70.8% and 35.6% respectively in Group I, Group II, and Group III, respectively. Conclusion: For brain metastases of NSCLC, γ-knife plus whole brain conventional external fractioned irradiation combined with treatment of Vm-26 had a significantly beneficial influence on improvement of the local control and 1-year and 2-year survival. There was no complaint about the side-effects of the treatment. (authors)
Edwards, Darren J; Wood, Rodger
2016-01-01
This study explored over-selectivity (executive dysfunction) using a standard unsupervised categorization task. Over-selectivity has been demonstrated using supervised categorization procedures (where training is given); however, little has been done in the way of unsupervised categorization (without training). A standard unsupervised categorization task was used to assess levels of over-selectivity in a traumatic brain injury (TBI) population. Individuals with TBI were selected from the Tertiary Traumatic Brain Injury Clinic at Swansea University and were asked to categorize two-dimensional items (pictures on cards), into groups that they felt were most intuitive, and without any learning (feedback from experimenter). This was compared against categories made by a control group for the same task. The findings of this study demonstrate that individuals with TBI had deficits for both easy and difficult categorization sets, as indicated by a larger amount of one-dimensional sorting compared to control participants. Deficits were significantly greater for the easy condition. The implications of these findings are discussed in the context of over-selectivity, and the processes that underlie this deficit. Also, the implications for using this procedure as a screening measure for over-selectivity in TBI are discussed.
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Ramnanan, Christopher J.; Saraswathi, Viswanathan; Smith, Marta S.; Donahue, E. Patrick; Farmer, Ben; Farmer, Tiffany D.; Neal, Doss; Williams, Philip E.; Lautz, Margaret; Mari, Andrea; Cherrington, Alan D.; Edgerton, Dale S.
2011-01-01
In rodents, acute brain insulin action reduces blood glucose levels by suppressing the expression of enzymes in the hepatic gluconeogenic pathway, thereby reducing gluconeogenesis and endogenous glucose production (EGP). Whether a similar mechanism is functional in large animals, including humans, is unknown. Here, we demonstrated that in canines, physiologic brain hyperinsulinemia brought about by infusion of insulin into the head arteries (during a pancreatic clamp to maintain basal hepatic insulin and glucagon levels) activated hypothalamic Akt, altered STAT3 signaling in the liver, and suppressed hepatic gluconeogenic gene expression without altering EGP or gluconeogenesis. Rather, brain hyperinsulinemia slowly caused a modest reduction in net hepatic glucose output (NHGO) that was attributable to increased net hepatic glucose uptake and glycogen synthesis. This was associated with decreased levels of glycogen synthase kinase 3β (GSK3β) protein and mRNA and with decreased glycogen synthase phosphorylation, changes that were blocked by hypothalamic PI3K inhibition. Therefore, we conclude that the canine brain senses physiologic elevations in plasma insulin, and that this in turn regulates genetic events in the liver. In the context of basal insulin and glucagon levels at the liver, this input augments hepatic glucose uptake and glycogen synthesis, reducing NHGO without altering EGP. PMID:21865644
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
Freeman, A Courtenay; Platt, Simon R; Holmes, Shannon; Kent, M; Robinson, Kelsey; Howerth, Elizabeth; Eagleson, Joe; Bouras, Alexandros; Kaluzova, Milota; Hadjipanayis, Constantinos G
2018-05-01
Cetuximab conjugated iron-oxide nanoparticles (cetuximab-IONPs) have shown both in-vitro and in-vivo anti-tumor efficacy against gliomas. The purpose of this pilot study was to evaluate the safety and potential efficacy of cetuximab-IONPs for treatment of spontaneously occurring intracranial gliomas in canines after convection-enhanced delivery (CED). The use of CED allowed for direct infusion of the cetuximab-IONPs both intratumorally and peritumorally avoiding the blood brain barrier (BBB) and limiting systemic effects. A total of eight dogs participated in the study and only two developed mild post-operative complications, which resolved with medical therapy. All canines underwent a single CED treatment of the cetuximab-IONPs over 3 days and did not receive any further adjuvant treatments. Volumetric analysis showed a median reduction in tumor size of 54.9% by MRI at 1-month (4-6 weeks) follow-up. Five dogs were euthanized due to recurrence of neurological signs other than seizures, two due to recurrent seizures, and one dog died in his sleep. Median survival time after surgery was 248 days (mean 367 days).
DEFF Research Database (Denmark)
Nielsen, Line; Søgaard, Mette; Jensen, Trine Hammer
2009-01-01
The mechanisms behind the in vivo virulence of immunosuppressive wild-type Morbillivirus infections are still not fully understood. To investigate lymphotropism and host responses we have selected the natural host model of canine distemper virus (CDV) infection in mink. This model displays...
Selective sensation based brain-computer interface via mechanical vibrotactile stimulation.
Yao, Lin; Meng, Jianjun; Zhang, Dingguo; Sheng, Xinjun; Zhu, Xiangyang
2013-01-01
In this work, mechanical vibrotactile stimulation was applied to subjects' left and right wrist skins with equal intensity, and a selective sensation perception task was performed to achieve two types of selections similar to motor imagery Brain-Computer Interface. The proposed system was based on event-related desynchronization/synchronization (ERD/ERS), which had a correlation with processing of afferent inflow in human somatosensory system, and attentional effect which modulated the ERD/ERS. The experiments were carried out on nine subjects (without experience in selective sensation), and six of them showed a discrimination accuracy above 80%, three of them above 95%. Comparative experiments with motor imagery (with and without presence of stimulation) were also carried out, which further showed the feasibility of selective sensation as an alternative BCI task complementary to motor imagery. Specifically there was significant improvement ([Formula: see text]) from near 65% in motor imagery (with and without presence of stimulation) to above 80% in selective sensation on some subjects. The proposed BCI modality might well cooperate with existing BCI modalities in the literature in enlarging the widespread usage of BCI system.
Selective Sensation Based Brain-Computer Interface via Mechanical Vibrotactile Stimulation
Yao, Lin; Meng, Jianjun; Zhang, Dingguo; Sheng, Xinjun; Zhu, Xiangyang
2013-01-01
In this work, mechanical vibrotactile stimulation was applied to subjects’ left and right wrist skins with equal intensity, and a selective sensation perception task was performed to achieve two types of selections similar to motor imagery Brain-Computer Interface. The proposed system was based on event-related desynchronization/synchronization (ERD/ERS), which had a correlation with processing of afferent inflow in human somatosensory system, and attentional effect which modulated the ERD/ERS. The experiments were carried out on nine subjects (without experience in selective sensation), and six of them showed a discrimination accuracy above 80%, three of them above 95%. Comparative experiments with motor imagery (with and without presence of stimulation) were also carried out, which further showed the feasibility of selective sensation as an alternative BCI task complementary to motor imagery. Specifically there was significant improvement () from near 65% in motor imagery (with and without presence of stimulation) to above 80% in selective sensation on some subjects. The proposed BCI modality might well cooperate with existing BCI modalities in the literature in enlarging the widespread usage of BCI system. PMID:23762253
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Directory of Open Access Journals (Sweden)
Hiroki Yamazaki
Full Text Available Canine histiocytic sarcoma (CHS is an aggressive malignant neoplasm that originates from histiocytic lineage cells, including dendritic cells and macrophages, and is characterized by progressive local infiltration and a very high metastatic potential. Survivin is as an apoptotic inhibitory factor that has major functions in cell proliferation, including inhibition of apoptosis and regulation of cell division, and is expressed in most types of human and canine malignant neoplasms, including melanoma and osteosarcoma. To investigate whether survivin was expressed at high levels in CHS and whether its expression was correlated with the aggressive biological behavior of CHS, we assessed relation between survivin expression and CHS progression, as well as the effects of survivin inhibition on the biological activities of CHS cells. We comparatively analyzed the expression of 6 selected anti-apoptotic genes, including survivin, in specimens from 30 dogs with histiocytic sarcoma and performed annexin V staining to evaluate apoptosis, methylthiazole tetrazolium assays to assess cell viability and chemosensitivity, and latex bead assays to measure changes in phagocytic activities in 4 CHS cell lines and normal canine fibroblasts transfected with survivin siRNA. Survivin gene expression levels in 30 specimens were significantly higher than those of the other 6 genes. After transfection with survivin siRNA, apoptosis, cell growth inhibition, enhanced chemosensitivity, and weakened phagocytic activities were observed in all CHS cell lines. In contrast, normal canine fibroblasts were not significantly affected by survivin knockdown. These results suggested that survivin expression may mediate the aggressive biological activities of CHS and that survivin may be an effective therapeutic target for the treatment of CHS.
Prediction of the size of unerupted canines and premolars in an Iranian population
Directory of Open Access Journals (Sweden)
Mashaallah Khanehmasjedi
2013-01-01
Full Text Available Background and Aim: One of the important aspects of diagnosis and treatment planning in the mixed dentition is estimation of the size of unerupted permanent canines and premolars. One of the most commonly used the prediction methods are Tanaka and Johnston, which are based on data from a sample of Northern European descent children. The accuracy of this method when applied to a different ethnic population is questionable. The aim of this study was to determine the modified equations from Tanaka and Johnston for Iranian population. Materials and Methods: This study was an analytic and cross-sectional investigation with the randomized cluster sampling in Ahwaz. Fifty four students of 14-18 years age (32 girls, 22 boys were selected between 320 students and plaster models of their maxillary and mandibular arches were prepared. Subjects had fully erupted teeth, class I canine and molar relationship and presented no proximal caries or fillings, morphological anomalies, missing teeth or occlusal abrasion, and bruxism. The mesiodistal crown diameters of the permanent teeth were measured with using the sharpened boley gauge (accuracy 0.01 mm. The data were analyzed by using the regression correlation analyses and t-test. Results: The size of permanent canines and premolars were larger in maxilla than mandible and males than females. These values in Iran were different from other countries. Conclusion: In this study to predict the space (in mm required for alignment of unerupted canine and premolars in Iranian children, halve the sum of mesiodistal dimension of the four mandibular incisors and add the respective constants 10.5 for upper jaw and 10 for lower jaw.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Deprivation selectively modulates brain potentials to food pictures.
Stockburger, Jessica; Weike, Almut I; Hamm, Alfons O; Schupp, Harald T
2008-08-01
Event-related brain potentials (ERPs) were used to examine whether the processing of food pictures is selectively modulated by changes in the motivational state of the observer. Sixteen healthy male volunteers were tested twice 1 week apart, either after 24 hr of food deprivation or after normal food intake. ERPs were measured while participants viewed appetitive food pictures as well as standard emotional and neutral control pictures. Results show that the ERPs to food pictures in a hungry, rather than satiated, state were associated with enlarged positive potentials over posterior sensor sites in a time window of 170-310 ms poststimulus. Minimum-norm analysis suggests the enhanced processing of food cues primarily in occipito-temporo-parietal regions. In contrast, processing of standard emotional and neutral pictures was not modulated by food deprivation. Considered from the perspective of motivated attention, the selective change of food cue processing may reflect a state-dependent change in stimulus salience.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
A meiotic linkage map of the silver fox, aligned and compared to the canine genome.
Kukekova, Anna V; Trut, Lyudmila N; Oskina, Irina N; Johnson, Jennifer L; Temnykh, Svetlana V; Kharlamova, Anastasiya V; Shepeleva, Darya V; Gulievich, Rimma G; Shikhevich, Svetlana G; Graphodatsky, Alexander S; Aguirre, Gustavo D; Acland, Gregory M
2007-03-01
A meiotic linkage map is essential for mapping traits of interest and is often the first step toward understanding a cryptic genome. Specific strains of silver fox (a variant of the red fox, Vulpes vulpes), which segregate behavioral and morphological phenotypes, create a need for such a map. One such strain, selected for docility, exhibits friendly dog-like responses to humans, in contrast to another strain selected for aggression. Development of a fox map is facilitated by the known cytogenetic homologies between the dog and fox, and by the availability of high resolution canine genome maps and sequence data. Furthermore, the high genomic sequence identity between dog and fox allows adaptation of canine microsatellites for genotyping and meiotic mapping in foxes. Using 320 such markers, we have constructed the first meiotic linkage map of the fox genome. The resulting sex-averaged map covers 16 fox autosomes and the X chromosome with an average inter-marker distance of 7.5 cM. The total map length corresponds to 1480.2 cM. From comparison of sex-averaged meiotic linkage maps of the fox and dog genomes, suppression of recombination in pericentromeric regions of the metacentric fox chromosomes was apparent, relative to the corresponding segments of acrocentric dog chromosomes. Alignment of the fox meiotic map against the 7.6x canine genome sequence revealed high conservation of marker order between homologous regions of the two species. The fox meiotic map provides a critical tool for genetic studies in foxes and identification of genetic loci and genes implicated in fox domestication.
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
DEFF Research Database (Denmark)
Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias
2015-01-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Recent developments in Canine Cognitive Dysfunction Syndrome
Directory of Open Access Journals (Sweden)
Alejandro Seisdedos Benzal
2016-04-01
Full Text Available Canine Cognitive Dysfunction Syndrome (CCD is a neurodegenerative disease affecting aging dogs. CCD is an underdiagnosed disease that involves at least 14% of geriatric dogs, but apparently less than 2% of diseased dogs are diagnosed. There are several physiopathological similarities between Alzheimer disease (AD and CCD, developing amyloid-β deposits in brain parenchyma and blood vessels, brain atrophy and neuronal loss. The clinical signs lead to behavioural changes. They are unspecific and could appear as soon as seven years of age, but are more relevant in senior dogs. The abnormal behaviour could be classified following the acronym DISHA: Disorientation in the immediate environment; altered Interactions with humans and other animals; Sleep-wake cycle disturbances; House-soiling; and changes in Activity levels. There is no specific diagnostic test or biomarker to demonstrate the presence of CCD; therefore, it is often assessed by ruling out other diseases that may cause similar behavioural changes. Veterinarians have to be able to make an accurate account of veterinary history asking for abnormal behaviour that could be misreported by the owners. CCD is a neurodegenerative disorder that cannot be cured. It is possible to delay the progression of the clinical signs and improve the quality of life of patients, but like in AD, the progression of the illness will depend on the individual. There are three treatment pathways, which could be used in combination: drug therapy to improve cognition and reduce anxiety, antioxidant diet and nutraceutical supplements to reduce the progression of the illness, and finally, environmental enrichment to maintain brain activity. The aim of this review article is to contribute to the knowledge of the illness, presenting recent advances in the pathophysiology, diagnosis and treatment of the disease
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Joint Genomic Prediction of Canine Hip Dysplasia in UK and US Labrador Retrievers
Directory of Open Access Journals (Sweden)
Stefan M. Edwards
2018-03-01
Full Text Available Canine hip dysplasia, a debilitating orthopedic disorder that leads to osteoarthritis and cartilage degeneration, is common in several large-sized dog breeds and shows moderate heritability suggesting that selection can reduce prevalence. Estimating genomic breeding values require large reference populations, which are expensive to genotype for development of genomic prediction tools. Combining datasets from different countries could be an option to help build larger reference datasets without incurring extra genotyping costs. Our objective was to evaluate genomic prediction based on a combination of UK and US datasets of genotyped dogs with records of Norberg angle scores, related to canine hip dysplasia. Prediction accuracies using a single population were 0.179 and 0.290 for 1,179 and 242 UK and US Labrador Retrievers, respectively. Prediction accuracies changed to 0.189 and 0.260, with an increased bias of genomic breeding values when using a joint training set (biased upwards for the US population and downwards for the UK population. Our results show that in this study of canine hip dysplasia, little or no benefit was gained from using a joint training set as compared to using a single population as training set. We attribute this to differences in the genetic background of the two populations as well as the small sample size of the US dataset.
Directory of Open Access Journals (Sweden)
F Tecles, A Tvarijonaviciute and JJ Cerón*
2013-11-01
Full Text Available In the present report, a new assay combining specific substrates and a selective BChE inhibitor (ethopropazine hydrochloride was used to measure both AChE and BChE in canine whole blood samples. Acetylthiocholine iodide (ATCI and butyrylthiocholine iodide (BTCI were used as substrates, whereas 2,2’-dithiodipiridine was used as chromophore. Ethopropazine concentration inhibiting over 95% BChE with minimum AChE inhibition was fixed at 0.3mM. The results confirmed that whole blood cholinesterase activity measured with BTCI in absence of ethopropazine corresponded with serum BChE, whereas whole blood cholinesterase analysed with ATCI in presence of ethopropazine reflected mainly erythrocytes and plasma AChE activity. This procedure showed good repeatability, it was easy and fast, and can be routinely used in veterinary laboratories.
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
van Rijn, Inge; de Graaf, Cees; Smeets, Paul A M
2018-04-01
Statements regarding pleasantness, taste intensity or caloric content on a food label may influence the attention consumers pay to such characteristics during consumption. There is little research on the effects of selective attention on taste perception and associated brain activation in regular drinks. The aim of this study was to investigate the effect of selective attention on hedonics, intensity and caloric content on brain responses during tasting drinks. Using functional MRI brain responses of 27 women were measured while they paid attention to the intensity, pleasantness or caloric content of fruit juice, tomato juice and water. Brain activation during tasting largely overlapped between the three selective attention conditions and was found in the rolandic operculum, insula and overlying frontal operculum, striatum, amygdala, thalamus, anterior cingulate cortex and middle orbitofrontal cortex (OFC). Brain activation was higher during selective attention to taste intensity compared to calories in the right middle OFC and during selective attention to pleasantness compared to intensity in the right putamen, right ACC and bilateral middle insula. Intensity ratings correlated with brain activation during selective attention to taste intensity in the anterior insula and lateral OFC. Our data suggest that not only the anterior insula but also the middle and lateral OFC are involved in evaluating taste intensity. Furthermore, selective attention to pleasantness engaged regions associated with food reward. Overall, our results indicate that selective attention to food properties can alter the activation of gustatory and reward regions. This may underlie effects of food labels on the consumption experience of consumers.
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Directory of Open Access Journals (Sweden)
Weidong Xiong
2010-06-01
Full Text Available Glioblastoma multiforme (GBM is the most common primary brain tumor in adults and carries a dismal prognosis. We have developed a conditional cytotoxic/immunotherapeutic approach using adenoviral vectors (Ads encoding the immunostimulatory cytokine, human soluble fms-like tyrosine kinase 3 ligand (hsFlt3L and the conditional cytotoxic molecule, i.e., Herpes Simplex Type 1- thymide kinase (TK. This therapy triggers an anti-tumor immune response that leads to tumor regression and anti-tumor immunological memory in intracranial rodent cancer models. We aim to test the efficacy of this immunotherapy in dogs bearing spontaneous GBM. In view of the controversy regarding the effect of human cytokines on dog immune cells, and considering that the efficacy of this treatment depends on hsFlt3L-stimulated dendritic cells (DCs, in the present work we tested the ability of Ad-encoded hsFlt3L to generate DCs from dog peripheral blood and compared its effects with canine IL-4 and GM-CSF.Our results demonstrate that hsFlT3L expressed form an Ad vector, generated DCs from peripheral blood cultures with very similar morphological and phenotypic characteristics to canine IL-4 and GM-CSF-cultured DCs. These include phagocytic activity and expression of CD11c, MHCII, CD80 and CD14. Maturation of DCs cultured under both conditions resulted in increased secretion of IL-6, TNF-alpha and IFN-gamma. Importantly, hsFlt3L-derived antigen presenting cells showed allostimulatory potential highlighting their ability to present antigen to T cells and elicit their proliferation.These results demonstrate that hsFlt3L induces the proliferation of canine DCs and support its use in upcoming clinical trials for canine GBM. Our data further support the translation of hsFlt3L to be used for dendritic cells' vaccination and gene therapeutic approaches from rodent models to canine patients and its future implementation in human clinical trials.
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Ivanovska, Ana; Grolli, Stefano; Borghetti, Paolo; Ravanetti, Francesca; Conti, Virna; De Angelis, Elena; Macchi, Francesca; Ramoni, Roberto; Martelli, Paolo; Gazza, Ferdinando; Cacchioli, Antonio
2017-10-01
Immunophenotypical characterization of mesenchymal stem cells is fundamental for the design and execution of sound experimental and clinical studies. The scarce availability of species-specific antibodies for canine antigens has hampered the immunophenotypical characterization of canine mesenchymal stem cells (MSC). The aim of this study was to select a panel of species-specific direct antibodies readily useful for canine mesenchymal stem cells characterization. They were isolated from perivisceral and subcutaneous adipose tissue samples collected during regular surgeries from 8 dogs. Single color flow cytometric analysis of mesenchymal stem cells (P3) deriving from subcutaneous and perivisceral adipose tissue with a panel of 7 direct anti-canine antibodies revealed two largely homogenous cell populations with a similar pattern: CD29 + , CD44 + , CD73 + , CD90 + , CD34 - , CD45 - and MHC-II - with no statistically significant differences among them. Antibody reactivity was demonstrated on canine peripheral blood mononuclear cells. The similarities are reinforced by their in vitro cell morphology, trilineage differentiation ability and RT-PCR analysis (CD90 + , CD73 + , CD105 + , CD44 + , CD13 + , CD29 + , Oct-4 + gene and CD31 - and CD45 - expression). Our results report for the first time a comparison between the immunophenotypic profile of canine MSC deriving from perivisceral and subcutaneous adipose tissue. The substantial equivalence between the two populations has practical implication on clinical applications, giving the opportunity to choose the source depending on the patient needs. The results contribute to routine characterization of MSC populations grown in vitro, a mandatory process for the definition of solid and reproducible laboratory and therapeutic procedures. Copyright © 2017 Elsevier Ltd. All rights reserved.
Canine Intracranial Meningioma: Case report
Directory of Open Access Journals (Sweden)
José Ricardo Gomes de Carvalho
2016-11-01
Full Text Available ABSTRACT. Carvalho J.R.G., Vasconcellos C.H.C., Bastos I. P.B., Trajano F.L.C., Costa T.S. & Fernandes J.I [Canine Intracranial Meningioma: Case report.] Meningioma intracraniano canino: Relato de caso. Revista Brasileira de Medicina Veterinária, 38(supl. 3:1- 7, 2016. Programa de Pós-Graduação em Ciências Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465 Km 7, Seropédica, RJ 23.897-000, Brasil, E-mail: vetjulio@yahoo.com.br Intracranial neoplasms usually show their signals in a moderate way, revealing a long background of nonspecific signs, making the diagnosis more difficult. The meningioma is the most common intracranial neoplasm in dogs and cats. Along the years, the Veterinary Medicine has experienced important technological improvements, making it possible the diagnosis of a lot of diseases. Therefore, diseases considered not common in the past, started being diagnosed more frequently, for instance, brain lesions. The objective of this research is to report a case of intracranial meningioma in a Boxer dog that arrived at the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, highlighting its clinical improvement, diagnosis and treatment.
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
Positive selection on the nonhomologous end-joining factor Cernunnos-XLF in the human lineage
Directory of Open Access Journals (Sweden)
Jurka Jerzy
2006-06-01
Full Text Available Abstract Background Cernunnos-XLF is a nonhomologous end-joining factor that is mutated in patients with a rare immunodeficiency with microcephaly. Several other microcephaly-associated genes such as ASPM and microcephalin experienced recent adaptive evolution apparently linked to brain size expansion in humans. In this study we investigated whether Cernunnos-XLF experienced similar positive selection during human evolution. Results We obtained or reconstructed full-length coding sequences of chimpanzee, rhesus macaque, canine, and bovine Cernunnos-XLF orthologs from sequence databases and sequence trace archives. Comparison of coding sequences revealed an excess of nonsynonymous substitutions consistent with positive selection on Cernunnos-XLF in the human lineage. The hotspots of adaptive evolution are concentrated around a specific structural domain, whose analogue in the structurally similar XRCC4 protein is involved in binding of another nonhomologous end-joining factor, DNA ligase IV. Conclusion Cernunnos-XLF is a microcephaly-associated locus newly identified to be under adaptive evolution in humans, and possibly played a role in human brain expansion. We speculate that Cernunnos-XLF may have contributed to the increased number of brain cells in humans by efficient double strand break repair, which helps to prevent frequent apoptosis of neuronal progenitors and aids mitotic cell cycle progression. Reviewers This article was reviewed by Chris Ponting and Richard Emes (nominated by Chris Ponting, Kateryna Makova, Gáspár Jékely and Eugene V. Koonin.
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
Goal selection versus process control in a brain-computer interface based on sensorimotor rhythms.
Royer, Audrey S; He, Bin
2009-02-01
In a brain-computer interface (BCI) utilizing a process control strategy, the signal from the cortex is used to control the fine motor details normally handled by other parts of the brain. In a BCI utilizing a goal selection strategy, the signal from the cortex is used to determine the overall end goal of the user, and the BCI controls the fine motor details. A BCI based on goal selection may be an easier and more natural system than one based on process control. Although goal selection in theory may surpass process control, the two have never been directly compared, as we are reporting here. Eight young healthy human subjects participated in the present study, three trained and five naïve in BCI usage. Scalp-recorded electroencephalograms (EEG) were used to control a computer cursor during five different paradigms. The paradigms were similar in their underlying signal processing and used the same control signal. However, three were based on goal selection, and two on process control. For both the trained and naïve populations, goal selection had more hits per run, was faster, more accurate (for seven out of eight subjects) and had a higher information transfer rate than process control. Goal selection outperformed process control in every measure studied in the present investigation.
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Canine adenovirus type 2 vector generation via I-Sce1-mediated intracellular genome release.
Directory of Open Access Journals (Sweden)
Sandy Ibanes
Full Text Available When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2 vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation.
Canine Adenovirus Type 2 Vector Generation via I-Sce1-Mediated Intracellular Genome Release
Ibanes, Sandy; Kremer, Eric J.
2013-01-01
When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2) vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER) fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation. PMID:23936483
Selective Estrogen Receptor Modulators regulate reactive microglia after penetrating brain injury
Directory of Open Access Journals (Sweden)
George E. Barreto
2014-06-01
Full Text Available Following brain injury, microglia assume a reactive-like state and secrete pro-inflammatory molecules that can potentiate damage. A therapeutic strategy that may limit microgliosis is of potential interest. In this context, selective estrogen receptor modulators, such as raloxifene and tamoxifen, are known to reduce microglia activation induced by neuroinflammatory stimuli in young animals. In the present study, we have assessed whether raloxifene and tamoxifen are able to affect microglia activation after brain injury in young and aged animals in time points relevant to clinics, which is hours after brain trauma. Volume fraction of MHC-II+ microglia was estimated according to the point-counting method of Weibel within a distance of 350 μm from the lateral border of the wound, and cellular morphology was measured by fractal analysis. Two groups of animals were studied: 1 young rats, ovariectomized at 2 months of age; and 2 aged rats, ovariectomized at 18 months of age. Fifteen days after ovariectomy animals received a stab wound brain injury and the treatment with estrogenic compounds. Our findings indicate that raloxifene and tamoxifen reduced microglia activation in both young and aged animals. Although the volume fraction of reactive microglia was found lower in aged animals, this was accompanied by important changes in cell morphology, where aged microglia assume a bushier and hyperplasic aspect when compared to young microglia. These data suggest that early regulation of microglia activation provides a mechanism by which SERMs may exert a neuroprotective effect in the setting of a brain trauma.
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Laura Nordio
2017-05-01
Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.
Models of experimental saccular aneurysms of carotid arteries in canine
International Nuclear Information System (INIS)
Zhang Haixia; Cheng Yingsheng; Li Minghua
2006-01-01
Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)
Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Prins, NH; van der Grijn, A; Lefebvre, RA; Akkermans, LMA; Schuurkes, JAJ
1 We aimed to study 5-HT4 receptors in canine stomach contractility both in vivo and in vitro. 2 In anaesthetized Beagle dogs, the selective 5-HT4 receptor agonist prucalopride (i.v.) induced dose-dependent tonic stomach contractions under isobaric conditions, an effect that was antagonized by the
Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations
Directory of Open Access Journals (Sweden)
Steiner JM
2014-10-01
Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
CANINE DISTEMPER IN A VACCINATED SNOW LEOPARD ( PANTHERA UNCIA).
Chinnadurai, Sathya K; Kinsel, Michael J; Adkesson, Michael J; Terio, Karen
2017-12-01
A 6-yr-old male snow leopard ( Panthera uncia) presented with acute seizures, hyperthermia, and tachypnea. Because of a diagnosis of anuric renal failure, the animal was euthanized. On histopathologic examination, numerous intralesional intracytoplasmic and intranuclear inclusions were found in the lungs, lymph nodes, and stomach. Positive immunohistochemical staining for canine distemper virus (CDV) was found in the lungs and, to a lesser extent, in the lymph nodes and brain. Molecular testing yielded a CDV H gene sequence that was closely related to CDV isolates concurrently found in wild raccoons from adjacent forested areas. The leopard had been vaccinated once against CDV with the use of a recombinant canarypox-vectored live vaccine during a routine wellness examination 12 wk prior to death. Serial serum neutralization titers performed on banked serum collected between vaccination and death showed poor serologic response to the vaccine. This case demonstrates a probable failure of protection against naturally occurring CDV.
Canine distemper virus infection in fennec fox (Vulpes zerda).
Woo, Gye-Hyeong; Jho, Yeon-Sook; Bak, Eun-Jung
2010-08-01
Fifteen 8-month-old fennec foxes imported from Sudan showed fever, mucopurulent ocular discharge, diarrhea, severe emaciation, seizures, and generalized ataxia, and died. Three of the 15 animals were presented for diagnostic investigation. Severe dehydration, brain congestion, and gastric ulcers were observed in all animals. In one animal, the lungs had failed to collapse and were multifocally dark red in appearance. Histopathologically, there were lymphohistiocytic meningoencephalitis with malacia, mild interstitial pneumonia, lymphoid depletion of lymphoid tissues and organs, and intestinal villous atrophy with intralesional coccidia. There were many intracytoplasmic and/or intranuclear inclusion bodies in the epithelial cells of the medullary velum, lungs, liver, kidneys, trachea, pancreas, stomach, gall bladder, urinary bladder, and ureters, and in macrophages of malacia foci and lymphocytes and macrophages of lymphoid organs. Additionally, intestinal coccidia were confirmed to be Isospora species by a fecal test. To our knowledge, this is the first report of canine distemper with intestinal coccidiosis in fennec fox.
Relationship between analytic values and canine obesity.
Peña, C; Suárez, L; Bautista, I; Montoya, J A; Juste, M C
2008-06-01
The objective of this study was to assess the relationship between canine body condition and metabolic parameters like serum lipids, blood glucose and alanine aminotransferase (ALT) concentrations. We selected 127 dogs (42 males and 85 females) that were taken to our veterinary medicine service during routine visits. The mean age was 6.67 +/- 5.24 years. Body condition (BC) was measured by Laflamme scale and dogs were considered as obese when BC score was over 6. The following variables were collected: total cholesterol, high-density lipoprotein cholesterol, triglycerides, basal glucose and ALT. 66.1% of the dog cohort were obese. Total cholesterol and triglycerides were found to be higher (p obese dogs with respect to normal weight dogs. In conclusion, obesity in dogs is associated with higher serum lipid levels.
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Moisala, Mona; Salmela, Viljami; Salo, Emma; Carlson, Synnove; Vuontela, Virve; Salonen, Oili; Alho, Kimmo
2015-01-01
Using functional magnetic resonance imaging (fMRI), we measured brain activity of human participants while they performed a sentence congruence judgment task in either the visual or auditory modality separately, or in both modalities simultaneously. Significant performance decrements were observed when attention was divided between the two modalities compared with when one modality was selectively attended. Compared with selective attention (i.e., single tasking), divided attention (i.e., dua...
Quantitative Magnetization Transfer Imaging in Human Brain at 3 T via Selective Inversion Recovery
Dortch, Richard D.; Li, Ke; Gochberg, Daniel F.; Welch, E. Brian; Dula, Adrienne N.; Tamhane, Ashish A.; Gore, John C.; Smith, Seth A.
2011-01-01
Quantitative magnetization transfer imaging yields indices describing the interactions between free water protons and immobile, macromolecular protons—including the macromolecular to free pool size ratio (PSR) and the rate of magnetization transfer between pools kmf. This study describes the first implementation of the selective inversion recovery quantitative magnetization transfer method on a clinical 3.0-T scanner in human brain in vivo. Selective inversion recovery data were acquired at 1...
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus
Directory of Open Access Journals (Sweden)
Lourdes M. B. Pessoa
2016-01-01
Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)
Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de
2016-01-01
The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
de Vasconcelos, Tassia Cristina Bello; Furtado, Marina Carvalho; Belo, Vínicus Silva; Morgado, Fernanda Nazaré; Figueiredo, Fabiano Borges
2017-10-05
Dogs have different susceptibility degrees to leishmaniasis; however, genetic research on this theme is scarce, manly on visceral form. The aims of this systematic review were to describe and discuss the existing scientific findings on genetic susceptibility to canine leishmaniasis, as well as to show the gaps of the existing knowledge. Twelve articles were selected, including breed immunological studies, genome wide associations or other gene polymorphism or gene sequencing studies, and transcription approaches. As main results of literature, there was a suggestion of genetic clinical resistance background for Ibizan Hound dogs, and alleles associated with protection or susceptibility to visceral leishmaniasis in Boxer dogs. Genetic markers can explain phenotypic variance in both pro- and anti-inflammatory cytokines and in cellular immune responses, including antigen presentation. Many gene segments are involved in canine visceral leishmaniasis phenotype, with Natural Resistance Associated Macrophage Protein 1 (NRAMP1) as the most studied. This was related to both protection and susceptibility. In comparison with murine and human genetic approaches, lack of knowledge in dogs is notorious, with many possibilities for new studies, revealing a wide field to be assessed on canine leishmaniasis susceptibility research. Copyright © 2017 Elsevier B.V. All rights reserved.
Automated selection of brain regions for real-time fMRI brain-computer interfaces
Lührs, Michael; Sorger, Bettina; Goebel, Rainer; Esposito, Fabrizio
2017-02-01
Objective. Brain-computer interfaces (BCIs) implemented with real-time functional magnetic resonance imaging (rt-fMRI) use fMRI time-courses from predefined regions of interest (ROIs). To reach best performances, localizer experiments and on-site expert supervision are required for ROI definition. To automate this step, we developed two unsupervised computational techniques based on the general linear model (GLM) and independent component analysis (ICA) of rt-fMRI data, and compared their performances on a communication BCI. Approach. 3 T fMRI data of six volunteers were re-analyzed in simulated real-time. During a localizer run, participants performed three mental tasks following visual cues. During two communication runs, a letter-spelling display guided the subjects to freely encode letters by performing one of the mental tasks with a specific timing. GLM- and ICA-based procedures were used to decode each letter, respectively using compact ROIs and whole-brain distributed spatio-temporal patterns of fMRI activity, automatically defined from subject-specific or group-level maps. Main results. Letter-decoding performances were comparable to supervised methods. In combination with a similarity-based criterion, GLM- and ICA-based approaches successfully decoded more than 80% (average) of the letters. Subject-specific maps yielded optimal performances. Significance. Automated solutions for ROI selection may help accelerating the translation of rt-fMRI BCIs from research to clinical applications.
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
Automatic motor task selection via a bandit algorithm for a brain-controlled button
Fruitet, Joan; Carpentier, Alexandra; Munos, Rémi; Clerc, Maureen
2013-02-01
Objective. Brain-computer interfaces (BCIs) based on sensorimotor rhythms use a variety of motor tasks, such as imagining moving the right or left hand, the feet or the tongue. Finding the tasks that yield best performance, specifically to each user, is a time-consuming preliminary phase to a BCI experiment. This study presents a new adaptive procedure to automatically select (online) the most promising motor task for an asynchronous brain-controlled button. Approach. We develop for this purpose an adaptive algorithm UCB-classif based on the stochastic bandit theory and design an EEG experiment to test our method. We compare (offline) the adaptive algorithm to a naïve selection strategy which uses uniformly distributed samples from each task. We also run the adaptive algorithm online to fully validate the approach. Main results. By not wasting time on inefficient tasks, and focusing on the most promising ones, this algorithm results in a faster task selection and a more efficient use of the BCI training session. More precisely, the offline analysis reveals that the use of this algorithm can reduce the time needed to select the most appropriate task by almost half without loss in precision, or alternatively, allow us to investigate twice the number of tasks within a similar time span. Online tests confirm that the method leads to an optimal task selection. Significance. This study is the first one to optimize the task selection phase by an adaptive procedure. By increasing the number of tasks that can be tested in a given time span, the proposed method could contribute to reducing ‘BCI illiteracy’.
International Nuclear Information System (INIS)
Kuge, Yuji; Kawashima, Hidefumi; Hashimoto, Tadatoshi
2000-01-01
Octanoate is taken up into the brain and is converted in astrocytes to glutamine through the tricarboxylic acid (TCA) cycle after β-oxidation. We speculate that [1- 11 C]octanoate may be used as a tracer for astroglial functions and/or fatty acid metabolism in the brain and may be useful for studying cerebral ischemia. In the present study we investigated brain distribution of [1- 11 C]octanoate and compared it with cerebral blood flow (CBF) by using rat and canine models of middle cerebral artery (MCA) occlusion and a high resolution PET. In rats brain distribution of [ 15 O]H 2 O measured 1-2 h and 5-6 h after insult was compared with that of [1- 11 C]octanoate measured 3-4 h after insult. Radioactivity ratios of lesioned to normal hemispheres determined with [ 15 O]H 2 O were lower than those determined with [1- 11 C]octanoate. These results were confirmed by a study on a canine model of MCA-occlusion. Twenty-four hours after insult, CBF decreased in the MCA-territory of the occluded hemisphere, whereas normal or higher accumulation of [1- 11 C]octanoate was observed in the ischemic regions. The uptake of [1- 11 C]octanoate-derived radioactivity therefore increased relative to CBF in the ischemic regions, indicating that [1- 11 C]octanoate provides functional information different from CBF. In conclusion, we found that [1- 11 C]octanoate is a potential radiopharmaceutical for studying the pathophysiology of cerebral ischemia. (author)
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
Moisala, Mona; Salmela, Viljami; Salo, Emma; Carlson, Synnöve; Vuontela, Virve; Salonen, Oili; Alho, Kimmo
2015-01-01
Using functional magnetic resonance imaging (fMRI), we measured brain activity of human participants while they performed a sentence congruence judgment task in either the visual or auditory modality separately, or in both modalities simultaneously. Significant performance decrements were observed when attention was divided between the two modalities compared with when one modality was selectively attended. Compared with selective attention (i.e., single tasking), divided attention (i.e., dual-tasking) did not recruit additional cortical regions, but resulted in increased activity in medial and lateral frontal regions which were also activated by the component tasks when performed separately. Areas involved in semantic language processing were revealed predominantly in the left lateral prefrontal cortex by contrasting incongruent with congruent sentences. These areas also showed significant activity increases during divided attention in relation to selective attention. In the sensory cortices, no crossmodal inhibition was observed during divided attention when compared with selective attention to one modality. Our results suggest that the observed performance decrements during dual-tasking are due to interference of the two tasks because they utilize the same part of the cortex. Moreover, semantic dual-tasking did not appear to recruit additional brain areas in comparison with single tasking, and no crossmodal inhibition was observed during intermodal divided attention.
Moisala, Mona; Salmela, Viljami; Salo, Emma; Carlson, Synnöve; Vuontela, Virve; Salonen, Oili; Alho, Kimmo
2015-01-01
Using functional magnetic resonance imaging (fMRI), we measured brain activity of human participants while they performed a sentence congruence judgment task in either the visual or auditory modality separately, or in both modalities simultaneously. Significant performance decrements were observed when attention was divided between the two modalities compared with when one modality was selectively attended. Compared with selective attention (i.e., single tasking), divided attention (i.e., dual-tasking) did not recruit additional cortical regions, but resulted in increased activity in medial and lateral frontal regions which were also activated by the component tasks when performed separately. Areas involved in semantic language processing were revealed predominantly in the left lateral prefrontal cortex by contrasting incongruent with congruent sentences. These areas also showed significant activity increases during divided attention in relation to selective attention. In the sensory cortices, no crossmodal inhibition was observed during divided attention when compared with selective attention to one modality. Our results suggest that the observed performance decrements during dual-tasking are due to interference of the two tasks because they utilize the same part of the cortex. Moreover, semantic dual-tasking did not appear to recruit additional brain areas in comparison with single tasking, and no crossmodal inhibition was observed during intermodal divided attention. PMID:25745395
Cellular endocytic compartment localization of expressed canine CD1 molecules
DEFF Research Database (Denmark)
Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.
2016-01-01
CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....
Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.
Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna
2015-01-01
Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Hirvonen, J; Goodwin, RS; Li, C-T; Terry, GE; Zoghbi, SS; Morse, C; Pike, VW; Volkow, ND; Huestis, MA; Innis, RB
2011-01-01
Chronic cannabis (marijuana, hashish) smoking can result in dependence. Rodent studies show reversible downregulation of brain cannabinoid CB1 (cannabinoid receptor type 1) receptors after chronic exposure to cannabis. However, whether downregulation occurs in humans who chronically smoke cannabis is unknown. Here we show, using positron emission tomography imaging, reversible and regionally selective downregulation of brain cannabinoid CB1 receptors in human subjects who chronically smoke ca...
Orthodontic management of bilaterally impacted mandibular canines in a growing patient
Directory of Open Access Journals (Sweden)
Rajaganesh J Gautam
2016-01-01
Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.
McMaster, G K; Tratschin, J D; Siegl, G
1981-01-01
The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.
Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus
Directory of Open Access Journals (Sweden)
Sudarisman
2006-03-01
Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.
Comparative photoelastic study of dental and skeletal anchorages in the canine retraction
Directory of Open Access Journals (Sweden)
Cristiane Aparecida de Assis Claro
2014-01-01
Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.
Sajnani, Anand K
2015-02-01
The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.
An HPLC tracing of the enhancer regulation in selected discrete brain areas of food-deprived rats.
Miklya, I; Knoll, B; Knoll, J
2003-05-09
The recent discovery of the enhancer regulation in the mammalian brain brought a different perspective to the brain-organized realization of goal-oriented behavior, which is the quintessence of plastic behavioral descriptions such as drive or motivation. According to this new approach, 'drive' means that special endogenous enhancer substances enhance the impulse-propagation-mediated release of transmitters in a proper population of enhancer-sensitive neurons, and keep these neurons in the state of enhanced excitability until the goal is reached. However, to reach any goal needs the participation of the catecholaminergic machinery, the engine of the brain. We developed a method to detect the specific enhancer effect of synthetic enhancer substances [(-)-deprenyl, (-)-PPAP, (-)-BPAP] by measuring the release of transmitters from freshly isolated selected discrete brain areas (striatum, substantia nigra, tuberculum olfactorium, locus coeruleus, raphe) by the aid of HPLC with electrochemical detection. To test the validity of the working hypothesis that in any form of goal-seeking behavior the catecholaminergic and serotonergic neurons work on a higher activity level, we compared the amount of norepinephrine, dopamine, and serotonin released from selected discrete brain areas isolated from the brain of sated and food-deprived rats. Rats were deprived of food for 48 and 72 hours, respectively, and the state of excitability of their catecholaminergic and serotonergic neurons in comparison to that of sated rats was measured. We tested the orienting-searching reflex activity of the rats in a special open field, isolated thereafter selected discrete brain areas and measured the release of norepinephrine, dopamine, and serotonin from the proper tissue samples into the organ bath. The orienting-searching reflex activity of the rats increased proportionally to the time elapsed from the last feed and the amount of dopamine released from the striatum, substantia nigra and
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
How far is the root apex of a unilateral impacted canine from the root apices' arch form?
Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il
2017-02-01
The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American
A New Method of Selective, Rapid Cooling of the Brain: An Experimental Study
International Nuclear Information System (INIS)
Allers, Mats; Boris-Moeller, Fredrik; Lunderquist, Anders; Wieloch, Tadeusz
2006-01-01
Purpose. To determine whether retrograde perfusion of cooled blood into one internal jugular vein (IJV) in the pig can selectively reduce the brain temperature without affecting the core body temperature (CBT). Methods. In 7 domestic pigs, the left IJV was catheterized on one side and a catheter placed with the tip immediately below the rete mirabile. Thermistors were placed in both brain hemispheres and the brain temperature continuously registered. Thermistors placed in the rectum registered the CBT. From a catheter in the right femoral vein blood was aspirated with the aid of a roller pump, passed through a cooling device, and infused into the catheter in the left IJV at an initial rate of 200 ml/min. Results. Immediately after the start of the infusion of cooled blood (13.8 deg. C) into the IJV, the right brain temperature started to drop from its initial 37.9 deg. C and reached 32 deg. C within 5 min. By increasing the temperature of the perfusate a further drop in the brain temperature was avoided and the brain temperature could be kept around 32 deg. C during the experiment. In 4 of the animals a heating blanket was sufficient to compensate for the slight drop in CBT during the cooling period. Conclusions. We conclude that brain temperature can be reduced in the pig by retrograde perfusion of the internal jugular vein with cooled blood and that the core body temperature can be maintained with the aid of a heating blanket
Directory of Open Access Journals (Sweden)
Szilvia Veszelka
2018-05-01
Full Text Available Cell culture-based blood-brain barrier (BBB models are useful tools for screening of CNS drug candidates. Cell sources for BBB models include primary brain endothelial cells or immortalized brain endothelial cell lines. Despite their well-known differences, epithelial cell lines are also used as surrogate models for testing neuropharmaceuticals. The aim of the present study was to compare the expression of selected BBB related genes including tight junction proteins, solute carriers (SLC, ABC transporters, metabolic enzymes and to describe the paracellular properties of nine different culture models. To establish a primary BBB model rat brain capillary endothelial cells were co-cultured with rat pericytes and astrocytes (EPA. As other BBB and surrogate models four brain endothelial cells lines, rat GP8 and RBE4 cells, and human hCMEC/D3 cells with or without lithium treatment (D3 and D3L, and four epithelial cell lines, native human intestinal Caco-2 and high P-glycoprotein expressing vinblastine-selected VB-Caco-2 cells, native MDCK and MDR1 transfected MDCK canine kidney cells were used. To test transporter functionality, the permeability of 12 molecules, glucopyranose, valproate, baclofen, gabapentin, probenecid, salicylate, rosuvastatin, pravastatin, atorvastatin, tacrine, donepezil, was also measured in the EPA and epithelial models. Among the junctional protein genes, the expression level of occludin was high in all models except the GP8 and RBE4 cells, and each model expressed a unique claudin pattern. Major BBB efflux (P-glycoprotein or ABCB1 and influx transporters (GLUT-1, LAT-1 were present in all models at mRNA levels. The transcript of BCRP (ABCG2 was not expressed in MDCK, GP8 and RBE4 cells. The absence of gene expression of important BBB efflux and influx transporters BCRP, MRP6, -9, MCT6, -8, PHT2, OATPs in one or both types of epithelial models suggests that Caco-2 or MDCK models are not suitable to test drug candidates which
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Automated tru-cut imaging-guided core needle biopsy of canine ...
African Journals Online (AJOL)
The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Expression of canine distemper virus receptor nectin-4 in the central nervous system of dogs.
Pratakpiriya, Watanyoo; Ping Teh, Angeline Ping; Radtanakatikanon, Araya; Pirarat, Nopadon; Thi Lan, Nguyen; Takeda, Makoto; Techangamsuwan, Somporn; Yamaguchi, Ryoji
2017-03-23
Canine distemper virus (CDV) exhibits lymphotropic, epitheliotropic, and neurotropic nature, and causes a severe systemic infection in susceptible animals. Initially, signaling lymphocyte activation molecule (SLAM) expressed on immune cells has been identified as a crucial cellular receptor for CDV. Currently, nectin-4 expressed in epithelia has been shown to be another receptor for CDV. Our previous study demonstrated that neurons express nectin-4 and are infected with CDV. In this study, we investigated the distribution pattern of nectin-4 in various cell types in the canine central nervous system and showed its relation to CDV infection to further clarify the pathology of disease. Histopathological, immunohistochemical and immunofluorescent analyses were done using formalin-fixed paraffin-embedded tissues of CDV-infected dogs. Dual staining of nectin-4 and CDV antigen or nectin-4 and brain cell markers was performed. Nectin-4 was detected in ependymal cells, epithelia of choroid plexus, meningeal cells, neurons, granular cells, and Purkinje's cells. CDV antigens were detected in these nectin-4-positive cells, further suggesting contribution of nectin-4 for the CDV neurovirulence. On the other hand, astrocytes did not express nectin-4, although they were frequently infected with CDV. Since astrocytes are negative for SLAM expression, they must express an unidentified CDV receptor, which also contributes to CDV neurovirulence.
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
DEFF Research Database (Denmark)
Goldeman, Charlotte; Saaby, Lasse; Brodin, Birger
Cultures of primary bovine brain endothelial cells (BECs) grown, often together with astrocytes, on permeable supports in two-compartment culture systems are commonly used as an in vitro model of the blood-brain barrier (BBB). While trans-endothelial electrical resistance, restriction...... the in vivo gene expression of brain capillary endothelial cells. Primary bovine endothelial cells and rat astrocytes were cultured in different culture configurations and the mRNA expression of selected genes (vWF, Glut-1, P-gp, claudin-1,-5, occludin, JAM-1, LAT-1, SLC16A1, MRP-1,-4, BCRP, ZO-1, AP, TPA...
Langedijk, Johannes P. M.; Janda, Jozef; Origgi, Francesco C.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe
2011-01-01
The morbilliviruses measles virus (MeV) and canine distemper virus (CDV) both rely on two surface glycoproteins, the attachment (H) and fusion proteins, to promote fusion activity for viral cell entry. Growing evidence suggests that morbilliviruses infect multiple cell types by binding to distinct host cell surface receptors. Currently, the only known in vivo receptor used by morbilliviruses is CD150/SLAM, a molecule expressed in certain immune cells. Here we investigated the usage of multiple receptors by the highly virulent and demyelinating CDV strain A75/17. We based our study on the assumption that CDV-H may interact with receptors similar to those for MeV, and we conducted systematic alanine-scanning mutagenesis on CDV-H throughout one side of the β-propeller documented in MeV-H to contain multiple receptor-binding sites. Functional and biochemical assays performed with SLAM-expressing cells and primary canine epithelial keratinocytes identified 11 residues mutation of which selectively abrogated fusion in keratinocytes. Among these, four were identical to amino acids identified in MeV-H as residues contacting a putative receptor expressed in polarized epithelial cells. Strikingly, when mapped on a CDV-H structural model, all residues clustered in or around a recessed groove located on one side of CDV-H. In contrast, reported CDV-H mutants with SLAM-dependent fusion deficiencies were characterized by additional impairments to the promotion of fusion in keratinocytes. Furthermore, upon transfer of residues that selectively impaired fusion induction in keratinocytes into the CDV-H of the vaccine strain, fusion remained largely unaltered. Taken together, our results suggest that a restricted region on one side of CDV-H contains distinct and overlapping sites that control functional interaction with multiple receptors. PMID:21849439
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
Towards 1H-MRSI of the human brain at 7T with slice-selective adiabatic refocusing pulses.
Scheenen, T.W.J.; Heerschap, A.; Klomp, D.W.J.
2008-01-01
OBJECTIVE: To explore the possibilities of proton spectroscopic imaging (1H-MRSI) of the human brain at 7 Tesla with adiabatic refocusing pulses. MATERIALS AND METHODS: A combination of conventional slice selective excitation and two pairs of slice selective adiabatic refocusing pulses (semi-LASER)
Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Compensatory canine angulation in angle Class II and III patients
Directory of Open Access Journals (Sweden)
Mauro Carlos Agner Busato
2009-09-01
Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Sidhu, Deepinder S; Ruth, Jeffrey D; Lambert, Gregory; Rossmeisl, John H
2017-07-01
To develop and validate a three-dimensional (3D) brain phantom that can be incorporated into existing stereotactic headframes to simulate stereotactic brain biopsy (SBB) and train veterinary surgeons. Experimental study. Canine brain phantoms were fabricated from osteological skull specimens, agarose brain parenchyma, and cheddar and mozzarella cheese molds (simulating meningiomas and gliomas). The neuroradiologic and viscoelastic properties of phantoms were quantified with computed tomography (CT) and oscillatory compression tests, respectively. Phantoms were validated by experienced and novice operators performing SBB on phantoms containing randomly placed, focal targets. Target yield and needle placement error (NPE) were compared between operators. Phantoms were produced in brain parenchyma, and contrast-enhancing tumors of meningeal and glial origin, respectively. The complex moduli of the agarose and cheeses were comparable to the viscoelastic properties of in vivo brain tissues and brain tumors. The overall diagnostic yield of SBB was 88%. Although NPE did not differ between novice (median 3.68 mm; range, 1.46-14.54 mm) and experienced surgeons (median 1.17 mm, range, 0.78-1.58 mm), our results support the relevance of the learning curve associated with the SBB procedure. This 3D phantom replicates anatomical, CT, and tactile features of brain tissues and tumors and can be used to develop the technical skills required to perform SBB. © 2017 The American College of Veterinary Surgeons.
Antitumor effects of celecoxib in COX-2 expressing and non-expressing canine melanoma cell lines.
Seo, Kyoung-Won; Coh, Ye-Rin; Rebhun, Robert B; Ahn, Jin-Ok; Han, Sei-Myung; Lee, Hee-Woo; Youn, Hwa-Young
2014-06-01
Cyclooxygenase-2 (COX-2) is a potential target for chemoprevention and cancer therapy. Celecoxib, a selective COX-2 inhibitor, inhibits cell growth of various types of human cancer including malignant melanoma. In dogs, oral malignant melanoma represents the most common oral tumor and is often a fatal disease. Therefore, there is a desperate need to develop additional therapeutic strategies. The purpose of this study was to investigate the anticancer effects of celecoxib on canine malignant melanoma cell lines that express varying levels of COX-2. Celecoxib induced a significant anti-proliferative effect in both LMeC and CMeC-1 cells. In the CMeC cells, treatment of 50 μM celecoxib caused an increase in cells in the G0/G1 and a decreased proportion of cells in G-2 phase. In the LMeC cells, 50 μM of celecoxib led to an increase in the percentage of cells in the sub-G1 phase and a significant activation of caspase-3 when compared to CMeC-1 cells. In conclusion, these results demonstrate that celecoxib exhibits antitumor effects on canine melanoma LMeC and CMeC-1 cells by induction of G1-S cell cycle arrest and apoptosis. Our data suggest that celecoxib might be effective as a chemotherapeutic agent against canine malignant melanoma. Copyright © 2014. Published by Elsevier Ltd.
de Carvalho, Otávio Valério; Félix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, Márcia Rogéria; Bressan, Gustavo Costa; Pena, Lindomar José; Silva-Júnior, Abelardo
2017-06-26
Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic strategies synergizing with vaccine programs for effectively controlling canine distemper. 6-methylmercaptopurine riboside (6MMPr) is a modified thiopurine nucleoside with known antiviral properties against certain RNA viruses. We tested the inhibitory effects of 6MMPr against a wild-type CDV strain infection in cell culture. We measured infectious particle production and viral RNA levels in treated and untreated CDV-infected cells. Ribavirin (RIB) was used as a positive control. Here, we report for the first time the antiviral effects of 6MMPr against canine distemper virus (CDV) in vitro. 6MMPr was able to reduce viral RNA levels and to inhibit the production of infectious CDV particles. The therapeutic selectivity of 6MMPr was approximately six times higher than that of ribavirin. Our results indicate that 6MMPr has high anti-CDV potential and warrants further testing against other paramyxoviruses, as well as clinical testing of the compound against CDV.
International Nuclear Information System (INIS)
Llorens, C.; Malfroy, B.; Schwartz, J.C.; Gacel, G.; Roques, B.P.; Roy, J.; Morgat, J.L.; Javoy-Agid, F.; Agid, Y.
1982-01-01
The compound [ 3 H-Tyr 1 ,D-Ala 2 ,Leu-OH 5 ]enkephalin has been synthesised as a potentially selective substrate for enkephalin dipeptidyl carboxypeptidase (enkephalinase) activity in brain. Incubations in the presence of homogenates and particulate fractions from rodent and human brain result in the formation of [ 3 H]Tyr-D-Ala-Gly, which can be conveniently isolated by polystyrene bead column chromatography. The enzyme activity responsible for the hydrolysis of the Gly 3 -Phe 4 amide bond of this substrate displays close resemblance to that hydrolysing the natural enkephalins at the same level. In addition, enkephalinase activity characterised in postmortem human brain is closely similar to that in rodent brain, with regard to optimal pH and apparent affinities of various substrates and inhibitors, including the potent compound thiorphan. Enkephalinase activity is distributed in a highly heterogeneous fashion among regions of human brain, the highest levels being found in globus pallidus and pars reticulata of the substantia nigra. This distribution is poorly correlated with that of opiate receptor binding sites but displays some resemblance to that of reported Met 5 -enkephalin levels. (author)
Gossellin, J; Wren, J A; Sunderland, S J
2007-08-01
Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.
Peracute Infectious Canine Hepatitis
Directory of Open Access Journals (Sweden)
A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam
2012-05-01
Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Surgical innovations in canine gonadectomy
Van Goethem, Bart
2016-01-01
In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated
Chen, Zhaoxue; Yu, Haizhong; Chen, Hao
2013-12-01
To solve the problem of traditional K-means clustering in which initial clustering centers are selected randomly, we proposed a new K-means segmentation algorithm based on robustly selecting 'peaks' standing for White Matter, Gray Matter and Cerebrospinal Fluid in multi-peaks gray histogram of MRI brain image. The new algorithm takes gray value of selected histogram 'peaks' as the initial K-means clustering center and can segment the MRI brain image into three parts of tissue more effectively, accurately, steadily and successfully. Massive experiments have proved that the proposed algorithm can overcome many shortcomings caused by traditional K-means clustering method such as low efficiency, veracity, robustness and time consuming. The histogram 'peak' selecting idea of the proposed segmentootion method is of more universal availability.
Stahl, Franka; Grabowski, Rosemarie
2003-05-01
The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Directory of Open Access Journals (Sweden)
Muhamad Furkam Fadilah
2015-08-01
Full Text Available This study aim was to determine the distribution of inflammatory cells in canine distemper in terms of the level of inflammation in the spleen, brain and lungs. The sample used 20 infected dogs wihich from the spleens, brains, and lungs of the dogs were collected. These organs were processed for histophatological observation using harris hematoxilyn-eosyn stain. The inflammation of the organs examined by using binocular microscope with 200X magnification. the results showed that inflammation was observed in the spleens: 9 samples (45% showed the presence of lymphoidcells that experienced a mild inflammation 7 (35% moderate inflammation, and 4 (20% severe inflammation in brain, 3 samples (15% did not show observe inflammation, 12 (60% mild, 5(25% moderate inflammation, and not observed any severe inflammation in brain, pulmonary: 6(30% mild inflammation, 11 (55% moderate inflammation, and 3 (15% severe inflammation. It can be concluded that the inflammation was observed microscopically in the spleen, brain and lungin the dog that infected with canine distemper virus
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY
HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ
1993-01-01
A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of
Laparoscopic radical prostatectomy in the canine model.
Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M
1996-12-01
The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.
Selective Audiovisual Semantic Integration Enabled by Feature-Selective Attention.
Li, Yuanqing; Long, Jinyi; Huang, Biao; Yu, Tianyou; Wu, Wei; Li, Peijun; Fang, Fang; Sun, Pei
2016-01-13
An audiovisual object may contain multiple semantic features, such as the gender and emotional features of the speaker. Feature-selective attention and audiovisual semantic integration are two brain functions involved in the recognition of audiovisual objects. Humans often selectively attend to one or several features while ignoring the other features of an audiovisual object. Meanwhile, the human brain integrates semantic information from the visual and auditory modalities. However, how these two brain functions correlate with each other remains to be elucidated. In this functional magnetic resonance imaging (fMRI) study, we explored the neural mechanism by which feature-selective attention modulates audiovisual semantic integration. During the fMRI experiment, the subjects were presented with visual-only, auditory-only, or audiovisual dynamical facial stimuli and performed several feature-selective attention tasks. Our results revealed that a distribution of areas, including heteromodal areas and brain areas encoding attended features, may be involved in audiovisual semantic integration. Through feature-selective attention, the human brain may selectively integrate audiovisual semantic information from attended features by enhancing functional connectivity and thus regulating information flows from heteromodal areas to brain areas encoding the attended features.
Diagnostic value of creatine kinase activity in canine cerebrospinal fluid.
Ferreira, Alexandra
2016-10-01
This study aimed to determine whether creatine kinase (CK) activity in cerebrospinal fluid (CSF) has diagnostic value for various groups of neurological conditions or for different anatomical areas of the nervous system (NS). The age, breed, results of CSF analysis, and diagnosis of 578 canine patients presenting with various neurological conditions between January 2009 and February 2015 were retrospectively collected. The cases were divided according to anatomical areas of the nervous system, i.e., brain, spinal cord, and peripheral nervous system, and into groups according to the nature of the condition diagnosed: vascular, immune/inflammatory/infectious, traumatic, toxic, anomalous, metabolic, idiopathic, neoplastic, and degenerative. Statistical analysis showed that CSF-CK alone cannot be used as a diagnostic tool and that total proteins in the CSF and red blood cells (RBCs) do not have a significant relationship with the CSF-CK activity. CSF-CK did not have a diagnostic value for different disease groups or anatomical areas of the nervous system.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Tomita, Nozomi; Imai, Shoji; Kanayama, Yusuke; Kawashima, Issaku; Kumano, Hiroaki
2017-06-01
While dichotic listening (DL) was originally intended to measure bottom-up selective attention, it has also become a tool for measuring top-down selective attention. This study investigated the brain regions related to top-down selective and divided attention DL tasks and a 2-back task using alphanumeric and Japanese numeric sounds. Thirty-six healthy participants underwent near-infrared spectroscopy scanning while performing a top-down selective attentional DL task, a top-down divided attentional DL task, and a 2-back task. Pearson's correlations were calculated to show relationships between oxy-Hb concentration in each brain region and the score of each cognitive task. Different brain regions were activated during the DL and 2-back tasks. Brain regions activated in the top-down selective attention DL task were the left inferior prefrontal gyrus and left pars opercularis. The left temporopolar area was activated in the top-down divided attention DL task, and the left frontopolar area and left dorsolateral prefrontal cortex were activated in the 2-back task. As further evidence for the finding that each task measured different cognitive and brain area functions, neither the percentages of correct answers for the three tasks nor the response times for the selective attentional task and the divided attentional task were correlated to one another. Thus, the DL and 2-back tasks used in this study can assess multiple areas of cognitive, brain-related dysfunction to explore their relationship to different psychiatric and neurodevelopmental disorders.
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Directory of Open Access Journals (Sweden)
Stefania Piersanti
Full Text Available Several studies have demonstrated the potential for vector-mediated gene transfer to the brain. Helper-dependent (HD human (HAd and canine (CAV-2 adenovirus, and VSV-G-pseudotyped self-inactivating HIV-1 vectors (LV effectively transduce human brain cells and their toxicity has been partly analysed. However, their effect on the brain homeostasis is far from fully defined, especially because of the complexity of the central nervous system (CNS. With the goal of dissecting the toxicogenomic signatures of the three vectors for human neurons, we transduced a bona fide human neuronal system with HD-HAd, HD-CAV-2 and LV. We analysed the transcriptional response of more than 47,000 transcripts using gene chips. Chip data showed that HD-CAV-2 and LV vectors activated the innate arm of the immune response, including Toll-like receptors and hyaluronan circuits. LV vector also induced an IFN response. Moreover, HD-CAV-2 and LV vectors affected DNA damage pathways--but in opposite directions--suggesting a differential response of the p53 and ATM pathways to the vector genomes. As a general response to the vectors, human neurons activated pro-survival genes and neuron morphogenesis, presumably with the goal of re-establishing homeostasis. These data are complementary to in vivo studies on brain vector toxicity and allow a better understanding of the impact of viral vectors on human neurons, and mechanistic approaches to improve the therapeutic impact of brain-directed gene transfer.
Visual encoding and fixation target selection in free viewing: presaccadic brain potentials
Directory of Open Access Journals (Sweden)
Andrey R Nikolaev
2013-06-01
Full Text Available In scrutinizing a scene, the eyes alternate between fixations and saccades. During a fixation, two component processes can be distinguished: visual encoding and selection of the next fixation target. We aimed to distinguish the neural correlates of these processes in the electrical brain activity prior to a saccade onset. Participants viewed color photographs of natural scenes, in preparation for a change detection task. Then, for each participant and each scene we computed an image heat map, with temperature representing the duration and density of fixations. The temperature difference between the start and end points of saccades was taken as a measure of the expected task-relevance of the information concentrated in specific regions of a scene. Visual encoding was evaluated according to whether subsequent change was correctly detected. Saccades with larger temperature difference were more likely to be followed by correct detection than ones with smaller temperature differences. The amplitude of presaccadic activity over anterior brain areas was larger for correct detection than for detection failure. This difference was observed for short scrutinizing but not for long explorative saccades, suggesting that presaccadic activity reflects top-down saccade guidance. Thus, successful encoding requires local scanning of scene regions which are expected to be task-relevant. Next, we evaluated fixation target selection. Saccades moving up in temperature were preceded by presaccadic activity of higher amplitude than those moving down. This finding suggests that presaccadic activity reflects attention deployed to the following fixation location. Our findings illustrate how presaccadic activity can elucidate concurrent brain processes related to the immediate goal of planning the next saccade and the larger-scale goal of constructing a robust representation of the visual scene.
Determination of selenium status using the nail biologic monitor in a canine model
International Nuclear Information System (INIS)
Steven Morris, J.; Spate, V.L.; Ruth Ann Ngwenyama; Waters, D.J.
2012-01-01
Toenails and fingernails are routinely used to estimate selenium status in epidemiological studies; however, literature validating nail selenium concentration as a surrogate for critical organs is limited. In this study diets of intact male dogs were selenium supplemented at two physiological levels (3 and 6 μg/kg/day) in two different forms, selenomethionine and selenium-enriched bioformed yeast. The selenium-adequate basal diet consumed by the treatment and control groups during the 4-week run-in period and throughout the trial contained 0.3 ppm selenium. After 7 months the dogs in the two treatment groups and the control group were euthanized. Representative tissue samples from prostate, brain, liver, heart and skeletal muscle were collected, rinsed and frozen. Toenail clippings from multiple toes were also collected. Selenium was determined by neutron activation analysis using Se77m (half life = 17.4 s) at the University of Missouri Research Reactor Center. NIST SRM 1577, Bovine Liver was analyzed as a quality control. The analysts were blinded to control and treatment group assignments. As expected, tissue selenium levels increased proportionally with supplementation. A slightly greater increase in tissue selenium was observed for the purified selenomethionine compared to the bioformed yeast; however this trend was significant only for brain tissue. Toenail selenium concentrations and tissue selenium were highly correlated (p < 0.003) with Pearson coefficients of 0.759 (skeletal muscle), 0.745 (heart), 0.729 (brain), 0.723 (prostate), and 0.632 (liver). The toenail biologic monitor accurately assesses selenium status in skeletal muscle, heart, brain, prostate, and liver in the canine model. (author)
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
Momeni, Saba; Pourghassem, Hossein
2014-08-01
Recently image fusion has prominent role in medical image processing and is useful to diagnose and treat many diseases. Digital subtraction angiography is one of the most applicable imaging to diagnose brain vascular diseases and radiosurgery of brain. This paper proposes an automatic fuzzy-based multi-temporal fusion algorithm for 2-D digital subtraction angiography images. In this algorithm, for blood vessel map extraction, the valuable frames of brain angiography video are automatically determined to form the digital subtraction angiography images based on a novel definition of vessel dispersion generated by injected contrast material. Our proposed fusion scheme contains different fusion methods for high and low frequency contents based on the coefficient characteristic of wrapping second generation of curvelet transform and a novel content selection strategy. Our proposed content selection strategy is defined based on sample correlation of the curvelet transform coefficients. In our proposed fuzzy-based fusion scheme, the selection of curvelet coefficients are optimized by applying weighted averaging and maximum selection rules for the high frequency coefficients. For low frequency coefficients, the maximum selection rule based on local energy criterion is applied to better visual perception. Our proposed fusion algorithm is evaluated on a perfect brain angiography image dataset consisting of one hundred 2-D internal carotid rotational angiography videos. The obtained results demonstrate the effectiveness and efficiency of our proposed fusion algorithm in comparison with common and basic fusion algorithms.
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
Orthodontic treatment of a stubborn palatally ectopic canine: a case report.
Al-Musfir, Tumadher M; Morris, David O
2014-03-01
This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.
Successful experimental challenge of dogs with canine parvovirus-2.
Carman, S; Povey, C
1982-01-01
Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...
An independent brain-computer interface using covert non-spatial visual selective attention
Zhang, Dan; Maye, Alexander; Gao, Xiaorong; Hong, Bo; Engel, Andreas K.; Gao, Shangkai
2010-02-01
In this paper, a novel independent brain-computer interface (BCI) system based on covert non-spatial visual selective attention of two superimposed illusory surfaces is described. Perception of two superimposed surfaces was induced by two sets of dots with different colors rotating in opposite directions. The surfaces flickered at different frequencies and elicited distinguishable steady-state visual evoked potentials (SSVEPs) over parietal and occipital areas of the brain. By selectively attending to one of the two surfaces, the SSVEP amplitude at the corresponding frequency was enhanced. An online BCI system utilizing the attentional modulation of SSVEP was implemented and a 3-day online training program with healthy subjects was carried out. The study was conducted with Chinese subjects at Tsinghua University, and German subjects at University Medical Center Hamburg-Eppendorf (UKE) using identical stimulation software and equivalent technical setup. A general improvement of control accuracy with training was observed in 8 out of 18 subjects. An averaged online classification accuracy of 72.6 ± 16.1% was achieved on the last training day. The system renders SSVEP-based BCI paradigms possible for paralyzed patients with substantial head or ocular motor impairments by employing covert attention shifts instead of changing gaze direction.
Design and in vivo evaluation of more efficient and selective deep brain stimulation electrodes
Howell, Bryan; Huynh, Brian; Grill, Warren M.
2015-08-01
Objective. Deep brain stimulation (DBS) is an effective treatment for movement disorders and a promising therapy for treating epilepsy and psychiatric disorders. Despite its clinical success, the efficiency and selectivity of DBS can be improved. Our objective was to design electrode geometries that increased the efficiency and selectivity of DBS. Approach. We coupled computational models of electrodes in brain tissue with cable models of axons of passage (AOPs), terminating axons (TAs), and local neurons (LNs); we used engineering optimization to design electrodes for stimulating these neural elements; and the model predictions were tested in vivo. Main results. Compared with the standard electrode used in the Medtronic Model 3387 and 3389 arrays, model-optimized electrodes consumed 45-84% less power. Similar gains in selectivity were evident with the optimized electrodes: 50% of parallel AOPs could be activated while reducing activation of perpendicular AOPs from 44 to 48% with the standard electrode to 0-14% with bipolar designs; 50% of perpendicular AOPs could be activated while reducing activation of parallel AOPs from 53 to 55% with the standard electrode to 1-5% with an array of cathodes; and, 50% of TAs could be activated while reducing activation of AOPs from 43 to 100% with the standard electrode to 2-15% with a distal anode. In vivo, both the geometry and polarity of the electrode had a profound impact on the efficiency and selectivity of stimulation. Significance. Model-based design is a powerful tool that can be used to improve the efficiency and selectivity of DBS electrodes.
Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan
2014-01-01
Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...
Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.
Kemoli, Arthur Musakulu; Junior, Thomas Munyao
2017-01-01
Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Wavreille, Vincent; Adin, Christopher A; Arango, Johnattan; Ham, Kathleen L; Byron, Julie K; McLoughlin, Mary A
2015-01-01
To describe a suture-free technique for canine ureteral resection-anastomosis using a microvascular anastomotic system (MAS) and to compare surgical time and burst pressure of hand-sewn (HS) ureteral end-to-end anastomosis with the MAS technique. Experimental ex vivo study. Canine cadavers (n = 8). For each cadaver, 1 ureter was randomly assigned to undergo HS anastomosis and the contralateral ureter had MAS anastomosis. The first 3 cadavers (6 ureters) were used to refine the MAS technique. In the other 5 dogs, surgical time and ureteral burst pressure were compared between groups (n = 5 ureters/group). Preliminary procedures showed that selective impaling of the mucosa and submucosa (without muscularis and adventitia) is necessary to allow complete mechanical interlock of the anastomotic rings for the MAS technique. Median anastomotic time was significantly shorter for MAS (7.6 min) than HS (16.6 min; p = .029) and burst pressure higher for MAS (393 cm H2 O) than HS (180 cm H2 O; p = .012). This study demonstrated the feasibility of a suture-free technique of canine ureteral resection-anastomosis using a commercially available MAS. The MAS anastomosis was faster and had higher burst strength compared with the HS anastomosis. © Copyright 2014 by The American College of Veterinary Surgeons.
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.
Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K
2017-07-01
This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.
Directory of Open Access Journals (Sweden)
Citro Gennaro
2008-11-01
Full Text Available Abstract Sticker's sarcoma (also known as transmissible venereal tumor is a horizontally transmitted neoplasm of the dog, that is passed with coitus. It is a locally aggressive tumor with a low tendency to metastatic spread. The most common locations are the genitals, the nose, the perianal area. Standard treatment consists with chemotherapy with vincristine, however other therapies such as, cryotherapy, immunotherapy or, in selected cases, radiation therapy, have been reported. In this article we describe the outcome of a small cohort of canine patients, with chemotherapy resistant transmissible venereal tumor (TVT, treated with bleomycin selectively driven by trains of biphasic pulses (electrochemotherapy. Three canine patients, with refractory TVT, entered the study and received two sessions of ECT under sedation. The pets had local injection of bleomycin at the concentration of 1.5 mg/ml and five minutes after the chemotherapy, trains of 8 biphasic electric pulses lasting 50 + 50 μs each, with 1 ms interpulse intervals, were delivered by means of modified caliper or, for difficult districts, through paired needle electrode. All the patients responded to the treatment and are still in remission at different times. Electrochemotherapy appears as a safe and efficacious modality for the treatment of TVT and warrants further investigations.
Impacted canines: Etiology, diagnosis, and orthodontic management
Directory of Open Access Journals (Sweden)
Ranjit Manne
2012-01-01
Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.
Leigh, S R; Jungers, W L
1994-12-01
A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.
Kipli, Kuryati; Kouzani, Abbas Z
2015-07-01
Accurate detection of depression at an individual level using structural magnetic resonance imaging (sMRI) remains a challenge. Brain volumetric changes at a structural level appear to have importance in depression biomarkers studies. An automated algorithm is developed to select brain sMRI volumetric features for the detection of depression. A feature selection (FS) algorithm called degree of contribution (DoC) is developed for selection of sMRI volumetric features. This algorithm uses an ensemble approach to determine the degree of contribution in detection of major depressive disorder. The DoC is the score of feature importance used for feature ranking. The algorithm involves four stages: feature ranking, subset generation, subset evaluation, and DoC analysis. The performance of DoC is evaluated on the Duke University Multi-site Imaging Research in the Analysis of Depression sMRI dataset. The dataset consists of 115 brain sMRI scans of 88 healthy controls and 27 depressed subjects. Forty-four sMRI volumetric features are used in the evaluation. The DoC score of forty-four features was determined as the accuracy threshold (Acc_Thresh) was varied. The DoC performance was compared with that of four existing FS algorithms. At all defined Acc_Threshs, DoC outperformed the four examined FS algorithms for the average classification score and the maximum classification score. DoC has a good ability to generate reduced-size subsets of important features that could yield high classification accuracy. Based on the DoC score, the most discriminant volumetric features are those from the left-brain region.
Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.
Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P
2014-01-21
The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population
Directory of Open Access Journals (Sweden)
Fouad Ayoub
2014-01-01
Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers
van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.
2012-01-01
In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Directory of Open Access Journals (Sweden)
Kimon C. Kanelakis
2009-01-01
Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.
Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S
2016-06-01
The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.
Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A
2011-12-01
To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.
Bilateral second premolars agenesia together with a unilateral canine radiculomegaly
Directory of Open Access Journals (Sweden)
Arthur Musakulu Kemoli
2017-01-01
Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
In vitro development of canine somatic cell nuclear transfer embryos in different culture media.
Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea
2015-01-01
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.
Genetic mapping of canine fear and aggression.
Zapata, Isain; Serpell, James A; Alvarez, Carlos E
2016-08-08
Fear/anxiety and anger/aggression greatly influence health, quality of life and social interactions. They are a huge burden to wellbeing, and personal and public economics. However, while much is known about the physiology and neuroanatomy of such emotions, little is known about their genetics - most importantly, why some individuals are more susceptible to pathology under stress. We conducted genomewide association (GWA) mapping of breed stereotypes for many fear and aggression traits across several hundred dogs from diverse breeds. We confirmed those findings using GWA in a second cohort of partially overlapping breeds. Lastly, we used the validated loci to create a model that effectively predicted fear and aggression stereotypes in a third group of dog breeds that were not involved in the mapping studies. We found that i) known IGF1 and HMGA2 loci variants for small body size are associated with separation anxiety, touch-sensitivity, owner directed aggression and dog rivalry; and ii) two loci, between GNAT3 and CD36 on chr18, and near IGSF1 on chrX, are associated with several traits, including touch-sensitivity, non-social fear, and fear and aggression that are directed toward unfamiliar dogs and humans. All four genome loci are among the most highly evolutionarily-selected in dogs, and each of those was previously shown to be associated with morphological traits. We propose that the IGF1 and HMGA2 loci are candidates for identical variation being associated with both behavior and morphology. In contrast, we show that the GNAT3-CD36 locus has distinct variants for behavior and morphology. The chrX region is a special case due to its extensive linkage disequilibrium (LD). Our evidence strongly suggests that sociability (which we propose is associated with HS6ST2) and fear/aggression are two distinct GWA loci within this LD block on chrX, but there is almost perfect LD between the peaks for fear/aggression and animal size. We have mapped many canine fear and
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Pivetta, Mauro; De Risio, Luisa; Newton, Richard; Dennis, Ruth
2013-01-01
Asymmetry of the cerebral lateral ventricles is a common finding in cross-sectional imaging of otherwise normal canine brains and has been assumed to be incidental. The purpose of this retrospective study was to compare the prevalence of ventricular asymmetry in brain MRI studies of normal dogs and dogs with idiopathic epilepsy. Brain MRI archives were searched for 100 neurologically normal dogs (Group 1) and 100 dogs with idiopathic epilepsy (Group 2). For each dog, asymmetry of the lateral ventricles was subjectively classified as absent, mild, moderate, and severe based on a consensus of two observers who were unaware of group status. Ventricular areas were measured from transverse T1W images at the level of the interthalamic adhesion. An asymmetry ratio was calculated as the ratio of the larger to smaller ventricular transverse area. There was excellent agreement between subjective assessments of ventricular asymmetry and quantitative assessments using asymmetry ratios (k = 0.995). The prevalence of asymmetry was 38% in Group 1 dogs and 44% in Group 2 dogs. Assymmetry was scored as mild in the majority of Group 2 dogs. There was no significant association between presence/absence and degree of ventricular asymmetry vs. dog group, age, gender, or skull conformation. Findings from the current study supported previously published assumptions that asymmetry of the lateral cerebral ventricles is an incidental finding in MRI studies of the canine brain. © 2013 Veterinary Radiology & Ultrasound.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Kumar, Sachin; Pattanaik, Ashok K.; Sharma, Shalini; Gupta, Reema; Jadhav, Sunil E.; Dutta, Narayan
2017-01-01
The present experiment was undertaken to validate a probiotic of canine origin for its potential use in dogs. A total of fifteen adult female Labrador dogs were allocated to three equal groups and fed a basal diet without probiotic (control) or with probiotic of either canine (Lactobacillus johnsonii CPN23; cPRO) or dairy (L. acidophilus NCDC 15; dPRO) origin for 9 weeks. The digestibility of most macronutrients remained similar among the groups; however, fibre digestibility was improved (P =...
Collett, A R; Fletcher, B
2000-12-01
A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing
2014-06-01
The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
International Nuclear Information System (INIS)
Marsh, James C.; Ziel, Ellis G; Diaz, Aidnag Z; Turian, Julius V; Wendt, Julie A.; Gobole, Rohit
2013-01-01
We compared integral dose with uninvolved brain (ID brain ) during partial brain radiotherapy (PBRT) for high-grade glioma patients using helical tomotherapy (HT) and seven field traditional inverse-planned intensity-modulated radiotherapy (IMRT) with and without selective sparing (SPA) of contralateral hippocampus, neural stem cell compartment (NSC) and limbic circuit. We prepared four PBRT treatment plans for four patients with high-grade gliomas (60Gy in 30 fractions delivered to planning treatment volume (PTV60Gy)). For all plans, a structure denoted 'uninvolved brain' was created, which included all brain tissue not part of PTV or standard (STD) organs at risk (OAR). No dosimetric constraints were included for uninvolved brain. Selective SPA plans were prepared with IMRT and HT; contralateral hippocampus, NSC and limbic circuit were contoured; and dosimetric constraints were entered for these structures without compromising dose to PTV or STD OAR. We compared V100 and D95 for PTV46Gy and PTV60Gy, and ID brain for all plans. There were no significant differences in V100 and D95 for PTV46Gy and PTV60Gy. ID brain was lower in traditional IMRT versus HT plans for STD and SPA plans (mean ID brain 23.64Gy vs. 28Gy and 18.7Gy vs. 24.5Gy, respectively) and in SPA versus STD plans both with IMRT and HT (18.7Gy vs. 23.64Gy and 24.5Gy vs. 28Gy, respectively). n the setting of PBRT for high-grade gliomas, IMRT reduces ID brain compared with HT with or without selective SPA of contralateral hippocampus, limbic circuit and NSC, and the use of selective SPA reduces ID brain compared with STD PBRT delivered with either traditional IMRT or HT.
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.
Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H
2009-09-01
Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.
Smid, HGOM; Jakob, A; Heinze, HJ
What cognitive processes underlie event-related brain potential (ERP) effects related to visual multidimensional selective attention and how are these processes organized? We recorded ERPs when participants attended to one conjunction of color, global shape and local shape and ignored other
Johansen, Cornelia; Mariani, Claire; Mueller, Ralf S
2017-10-01
Adverse food reaction (AFR) is an important differential diagnosis for the pruritic dog. It is usually diagnosed by feeding an elimination diet with a novel protein and carbohydrate source for eight weeks followed by subsequent food provocation. A previous study demonstrated that patch testing dogs with foods had a high sensitivity and negative predictability for selection of elimination diet ingredients. The aim of this study was to investigate patch testing with proteins, carbohydrates and dry commercial dog food in dogs to determine whether there was value in patch testing to aid the diagnosis of canine adverse food reaction. Twenty five privately owned dogs, with confirmed AFR, underwent provocation trials with selected food antigens and patch testing. For proteins, carbohydrates and dry dog food the sensitivity of patch testing was 100%, 70% and 22.2%, respectively; the negative predictive values of patch testing were 100%, 79% and 72%. The positive predictive values of patch testing for proteins and carbohydrates were 75% and 74%, respectively. This study confirmed that patch testing may be useful for the selection of a suitable protein source for an elimination diet in dogs with suspected AFR, but not as a diagnostic tool for canine AFR. Results for proteins are more reliable than for carbohydrates and the majority of positive patch test reactions were observed with raw protein. Patch testing with commercial dog food does not seem to be useful. © 2017 ESVD and ACVD.
Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model
International Nuclear Information System (INIS)
Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na
2009-01-01
Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
Genetic diversity of canine olfactory receptors
Directory of Open Access Journals (Sweden)
Hitte Christophe
2009-01-01
Full Text Available Abstract Background Evolution has resulted in large repertoires of olfactory receptor (OR genes, forming the largest gene families in mammalian genomes. Knowledge of the genetic diversity of olfactory receptors is essential if we are to understand the differences in olfactory sensory capability between individuals. Canine breeds constitute an attractive model system for such investigations. Results We sequenced 109 OR genes considered representative of the whole OR canine repertoire, which consists of more than 800 genes, in a cohort of 48 dogs of six different breeds. SNP frequency showed the overall level of polymorphism to be high. However, the distribution of SNP was highly heterogeneous among OR genes. More than 50% of OR genes were found to harbour a large number of SNP, whereas the rest were devoid of SNP or only slightly polymorphic. Heterogeneity was also observed across breeds, with 25% of the SNP breed-specific. Linkage disequilibrium within OR genes and OR clusters suggested a gene conversion process, consistent with a mean level of polymorphism higher than that observed for introns and intergenic sequences. A large proportion (47% of SNP induced amino-acid changes and the Ka/Ks ratio calculated for all alleles with a complete ORF indicated a low selective constraint with respect to the high level of redundancy of the olfactory combinatory code and an ongoing pseudogenisation process, which affects dog breeds differently. Conclusion Our demonstration of a high overall level of polymorphism, likely to modify the ligand-binding capacity of receptors distributed differently within the six breeds tested, is the first step towards understanding why Labrador Retrievers and German Shepherd Dogs have a much greater potential for use as sniffer dogs than Pekingese dogs or Greyhounds. Furthermore, the heterogeneity in OR polymorphism observed raises questions as to why, in a context in which most OR genes are highly polymorphic, a subset of
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
The usefulness of dermoscopy in canine pattern alopecia: a descriptive study.
Zanna, Giordana; Roccabianca, Paola; Zini, Eric; Legnani, Sara; Scarampella, Fabia; Arrighi, Silvana; Tosti, Antonella
2017-02-01
Dermoscopic studies evaluating noninflammatory, nonpruritic progressive alopecia attributable to pattern alopecia are currently unavailable. To evaluate the dermoscopic features observed in healthy skin of short coated dogs and compare these findings with those observed in dogs affected by pattern alopecia diagnosed by clinical and dermatopathological examination. Thirty male and female, healthy, breed matched, young adult, short coated dogs (controls) and 30 male and female, young adult, short coated dogs affected by pattern alopecia. Dermoscopy was performed with a Fotofinder II videodermoscope equipped with software that allowed the measurement of structures visualized in magnified images (20×-40×-70×). Skin biopsy samples were obtained from the thorax and evaluated dermoscopically for dermoscopic-histological correlation in affected dogs. Dermoscopic findings in canine pattern alopecia were hair shaft thinning, circle hairs and follicular keratin plugs; in the affected sun exposed areas there was a honeycomb-like pattern of pigmentation. Arborizing red lines reflecting vascularization were classified as a nonspecific finding because they were also common in healthy dogs. Dermoscopic features correlated with histology for selected hair follicle abnormalities. Although canine pattern alopecia is a visually striking disease, this study supports the value of dermoscopy for clinical examination and also opens promising perspectives for the identification of diagnostic dermoscopic patterns that may be useful for other skin disorders. © 2016 ESVD and ACVD.
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
3D enamel thickness in Neandertal and modern human permanent canines.
Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano
2017-12-01
Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Selective binding of 2-[125I]iodo-nisoxetine to norepinephrine transporters in the brain
International Nuclear Information System (INIS)
Kung, M.-P.; Choi, Seok-Rye; Hou, Catherine; Zhuang, Z.-P.; Foulon, Catherine; Kung, Hank F.
2004-01-01
A radioiodinated ligand, (R)-N-methyl-(2-[ 125 I]iodo-phenoxy)-3-phenylpropylamine, [ 125 I]2-INXT, targeting norepinephrine transporters (NET), was successfully prepared. A no-carrier-added product, [ 125 I]2-INXT, displayed a saturable binding with a high affinity (K d =0.06 nM) in the homogenates prepared from rat cortical tissues as well as from LLC-PK 1 cells expressing NET. A relatively low number of binding sties (B max =55 fmol/mg protein) measured with [ 125 I]2-INXT in rat cortical homogenates is consistent with the value reported for a known NET ligand, [ 3 H]nisoxetine. Competition studies with various compounds on [ 125 I]2-INXT binding clearly confirmed the pharmacological specificity and selectivity for NET binding sites. Following a tail-vein injection of [ 125 I]2-INXT in rats, a good initial brain uptake was observed (0.56% dose at 2 min) followed by a slow washout from the brain (0.2% remained at 3 hours post-injection). The hypothalamus (a NET-rich region) to striatum (a region devoid of NET) ratio was 1.5 at 3 hours post-i.v. injection. Pretreatment of rats with nisoxetine significantly inhibited the uptake of [ 125 I]2-INXT (70-100% inhibition) in locus coeruleus, hypothalamus and raphe nuclei, regions known to have a high density of NET; whereas escitalopram, a serotonin transporter ligand, did not show a similar effect. Ex vivo autoradiography of rat brain sections of [ 125 I]2-INXT (at 3 hours after an i.v. injection) displayed an excellent regional brain localization pattern corroborated to the specific NET distribution in the brain. The specific brain localization was significantly reduced by a dose of nisoxetine pretreatment. Taken together, the data suggest that [ 123 I]2-INXT may be useful for mapping NET binding sites in the brain
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Emerging insights into the genetic basis of canine hip dysplasia
Directory of Open Access Journals (Sweden)
Ginja M
2015-05-01
Full Text Available Mário Ginja,1 Ana Rita Gaspar,1 Catarina Ginja,2,3 1Department of Veterinary Sciences-CITAB, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal; 2Ce3C – Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, Lisboa, Portugal; 3CIBIO-InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Vairão, Portugal Abstract: Canine hip dysplasia (CHD is the most common inherited polygenic orthopedic trait in dogs with the phenotype influenced also by environmental factors. This trait was described in the dog in 1935 and leads to a debilitating secondary hip osteoarthritis. The diagnosis is confirmed radiographically by evaluating signs of degenerative joint disease, incongruence, and/or passive hip joint laxity. There is no ideal medical or surgical treatment so prevention based on controlled breeding is the optimal approach. The definitive CHD diagnosis based on radiographic examination involves the exposure to ionizing radiation under general anesthesia or heavy sedation but the image does not reveal the underlying genetic quality of the dog. Phenotypic expression of CHD is modified by environmental factors and dogs with a normal phenotype can be carriers of some mutations and transmit these genes to their offspring. Programs based on selection of dogs with better individual phenotypes for breeding are effective when strictly applied but remain inferior to the selection of dogs based on estimation of breeding values. Molecular studies for dissecting the genetic basis of CHD are ongoing, but progress has been slow. In the future, the recommended method to improve hip quality in controlled breeding schemes, which will allow higher selection pressure, would be based on the estimation of the genomic breeding value. Since 2012, a commercial DNA test has been available for Labrador Retrievers using a blood sample and provides a probability for
Radioiodinated fenetylline (captagon) - a new radiopharmaceutical for brain imaging
International Nuclear Information System (INIS)
Biersack, H.J.; Zschachlitz, L.; Breuel, H.P.; Reske, S.N.; Oehr, P.; Winkler, C.
1984-01-01
The purpose of this study was to evaluate radioiodinated fenetylline as a potential brain imaging agent. Thirty Wistar rats were injected with 125 I-N-isopropylamphetamine (IMP) and 131 I-fenetylline each simultaneously. The animals were sacrificed 5, 10, 15, 30, 60, and 120 min. p. i. The radioactivity content of tissue specimens of different organs was measured in a well counter (% dose/g tissue). After 5/10 min. p. i. fenetylline-uptake in the brain of rats was 1.0/1.3% compared to 1.3/1.9% (IMP). A fast decrease of cerebral fenetylline concentration was established after 30(0.2%) and 60 (0.5%) min. In 2 dogs sequential scintigraphy was performed following the injection of 131 I-fenetylline. Three patients underwent brain SPECT after injection of 123 I-fenetylline. The canine and human sequential scintigraphy revealed a rapid cerebral uptake suggesting that fenetylline is concentrated in the brain as a function of cerebral blood flow. From our first clinical findings it appears to be likely that the combined use of 123 I labeled IMP and fenetylline for SPECT may lead to a more differentiated evaluation of cerebral blood flow and metabolism. (orig.) [de
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.
Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O
2018-01-01
Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA
Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O
2018-01-01
Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647
Canine Detection of Illict Drugs: Sensory Apparatus Technology
National Research Council Canada - National Science Library
Morrison, Edward
2000-01-01
This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...
Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang
2016-01-01
Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
A four-dimensional virtual hand brain-machine interface using active dimension selection.
Rouse, Adam G
2016-06-01
Brain-machine interfaces (BMI) traditionally rely on a fixed, linear transformation from neural signals to an output state-space. In this study, the assumption that a BMI must control a fixed, orthogonal basis set was challenged and a novel active dimension selection (ADS) decoder was explored. ADS utilizes a two stage decoder by using neural signals to both (i) select an active dimension being controlled and (ii) control the velocity along the selected dimension. ADS decoding was tested in a monkey using 16 single units from premotor and primary motor cortex to successfully control a virtual hand avatar to move to eight different postures. Following training with the ADS decoder to control 2, 3, and then 4 dimensions, each emulating a grasp shape of the hand, performance reached 93% correct with a bit rate of 2.4 bits s(-1) for eight targets. Selection of eight targets using ADS control was more efficient, as measured by bit rate, than either full four-dimensional control or computer assisted one-dimensional control. ADS decoding allows a user to quickly and efficiently select different hand postures. This novel decoding scheme represents a potential method to reduce the complexity of high-dimension BMI control of the hand.
Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A
2006-01-01
The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.
Goal selection versus process control while learning to use a brain-computer interface
Royer, Audrey S.; Rose, Minn L.; He, Bin
2011-06-01
A brain-computer interface (BCI) can be used to accomplish a task without requiring motor output. Two major control strategies used by BCIs during task completion are process control and goal selection. In process control, the user exerts continuous control and independently executes the given task. In goal selection, the user communicates their goal to the BCI and then receives assistance executing the task. A previous study has shown that goal selection is more accurate and faster in use. An unanswered question is, which control strategy is easier to learn? This study directly compares goal selection and process control while learning to use a sensorimotor rhythm-based BCI. Twenty young healthy human subjects were randomly assigned either to a goal selection or a process control-based paradigm for eight sessions. At the end of the study, the best user from each paradigm completed two additional sessions using all paradigms randomly mixed. The results of this study were that goal selection required a shorter training period for increased speed, accuracy, and information transfer over process control. These results held for the best subjects as well as in the general subject population. The demonstrated characteristics of goal selection make it a promising option to increase the utility of BCIs intended for both disabled and able-bodied users.
Directory of Open Access Journals (Sweden)
D S Kothavade
2012-01-01
Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.
Cathepsin K expression and activity in canine osteosarcoma.
Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M
2012-01-01
Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
Canine trypanosomosis: Clinical observations and morphological ...
African Journals Online (AJOL)
Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...
The effect of two packaging systems on the post-thaw characteristics of canine sperm.
Strzeżek, R; Polakiewicz, P; Kordan, W
2015-01-01
The aim of this study was to compare the effect of different packaging systems on some parameters of cryopreserved canine spermatozoa. The experimental material consisted of the sperm-rich fractions of ejaculates collected from four Beagle dogs. Semen samples for cryopreservation were stored in 0.25 ml plastic straws and two aluminum tubes with a total volume of 5.0 ml. Semen was frozen in static nitrogen vapor for 10 minutes (0.25 ml straws) or 15 and 20 minutes (aluminum tubes). Post-thaw assessments involved the determination of sperm motility parameters using a computer assisted sperm analyzer (CASA), sperm plasma membrane integrity (SPMI), mitochondrial membrane potential (MMP) and acrosome integrity (normal apical ridge, NAR). Regardless of the packaging system applied, no significant differences in total sperm motility (TMOT) or selected kinematic parameters were observed after freezing-thawing. However, spermatozoa frozen in 0.25 mL straws were characterized by improved functionality, in particular mitochondrial function, after thawing. The results indicate that large quantities of canine semen can be frozen in aluminum tubes. Further studies are required, however, to evaluate different freezing and thawing rates of aluminum tubes.
Directory of Open Access Journals (Sweden)
Hubert Cecotti
2014-09-01
Full Text Available The authors wish to make the following correction to this paper (Cecotti, H.; Rivet, B. Subject Combination and Electrode Selection in Cooperative Brain-Computer Interface Based on Event Related Potentials. Brain Sci. 2014, 4, 335–355: Due to an internal error, the reference numbers in the original published paper were not shown, and the error was not due to the authors. The former main text should be replaced as below.
The unerupted maxillary canine - a post-surgical review.
LENUS (Irish Health Repository)
O'Dowling, Ian
2009-10-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The unerupted maxillary canine--a post-surgical review.
O'Dowling, Ian
2009-01-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The advent of canine performance science: offering a sustainable future for working dogs.
Cobb, Mia; Branson, Nick; McGreevy, Paul; Lill, Alan; Bennett, Pauleen
2015-01-01
Working and sporting dogs provide an essential contribution to many industries worldwide. The common development, maintenance and disposal of working and sporting dogs can be considered in the same way as other animal production systems. The process of 'production' involves genetic selection, puppy rearing, recruitment and assessment, training, housing and handling, handler education, health and working life end-point management. At present, inefficiencies throughout the production process result in a high failure rate of dogs attaining operational status. This level of wastage would be condemned in other animal production industries for economic reasons and has significant implications for dog welfare, as well as public perceptions of dog-based industries. Standards of acceptable animal use are changing and some historically common uses of animals are no longer publicly acceptable, especially where harm is caused for purposes deemed trivial, or where alternatives exist. Public scrutiny of animal use appears likely to increase and extend to all roles of animals, including working and sporting dogs. Production system processes therefore need to be transparent, traceable and ethically acceptable for animal use to be sustainable into the future. Evidence-based approaches already inform best practice in fields as diverse as agriculture and human athletic performance. This article introduces the nascent discipline of canine performance science, which aims to facilitate optimal product quality and production efficiency, while also assuring evidence-based increments in dog welfare through a process of research and development. Our thesis is that the model of canine performance science offers an objective, transparent and traceable opportunity for industry development in line with community expectations and underpins a sustainable future for working dogs. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction
Directory of Open Access Journals (Sweden)
Anísio Bueno de Carvalho
2012-12-01
Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
A comparative study between mixed-type tumours from human salivary and canine mammary glands
International Nuclear Information System (INIS)
Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D
2007-01-01
In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations
Smid, H G; Jakob, A; Heinze, H J
1999-03-01
What cognitive processes underlie event-related brain potential (ERP) effects related to visual multidimensional selective attention and how are these processes organized? We recorded ERPs when participants attended to one conjunction of color, global shape and local shape and ignored other conjunctions of these attributes in three discriminability conditions. Attending to color and shape produced three ERP effects: frontal selection positivity (FSP), central negativity (N2b), and posterior selection negativity (SN). The results suggested that the processes underlying SN and N2b perform independent within-dimension selections, whereas the process underlying the FSP performs hierarchical between-dimension selections. At posterior electrodes, manipulation of discriminability changed the ERPs to the relevant but not to the irrelevant stimuli, suggesting that the SN does not concern the selection process itself but rather a cognitive process initiated after selection is finished. Other findings suggested that selection of multiple visual attributes occurs in parallel.
Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F
2013-09-01
The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.
Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T
1995-06-01
For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
Role of one N-linked oligosaccharide chain on canine herpesvirus gD in its biological activity.
Maeda, K; Yokoyama, N; Fujita, K; Xuan, X; Mikami, T
1997-12-01
The YP11mu strain of a plaque-selected canine herpesvirus (CHV) encoded a smaller molecular weight (MW) of gD than those of other strains including YP2 strain (Xuan et al., 1990). When nucleotide sequence of the mutated gD of YP11mu strain (gD(YP11mu)) was compared with that of gDs of other CHV strains, gD(YP11mu) lacked 12 nucleotides encoding 4 amino acids, NKTI, including one predicted potential N-linked glycosylation site and no other change was found in other regions. When the gD(YP11mu) and gD of YP2 strain (gD(YP2)) expressed in COS-7 and insect (Spodoptera frugiperda; Sf9) cells were compared each other, both gDs reacted with a panel of monoclonal antibodies (MAbs) against CHV gD by indirect immunofluorescence analysis and the gD(YP11mu) possessed an MW of approximately 47-51 and 39-44 kDa in COS-7 and Sf9 cells, respectively, which were smaller than the expressed gD(YP2) (approximately 51-55 and 41-46 kDa, respectively) by immunoblot analysis. After treatment with tunicamycin, the MW of both gDs in Sf9 cells became approximately 37 kDa. When hemagglutination (HA) test using canine red blood cells (RBC) were carried out, lysates of Sf9 cells expressing CHV gDs agglutinated canine RBC. Serum from mice inoculated with lysates of Sf9 cells expressing the gDs possessed a high titer of virus-neutralizing (VN) activities against CHV. These results indicated that the deletion of 4 amino acids possessing approximately 4 kDa of glyco-chain from gD of CHV in mammalian cells does not affect HA activity and VN antibody-inducing activity and that this deletion of gD(YP11mu) might be a good selective marker for development of recombinant viruses as a live vaccine.
Transperineal in vivo fluence-rate dosimetry in the canine prostate during SnET2-mediated PDT
International Nuclear Information System (INIS)
Lilge, Lothar; Pomerleau-Dalcourt, Natalie; Douplik, Alexander; Selman, Steven H; Keck, Rick W; Szkudlarek, Maria; Pestka, Maciej; Jankun, Jerzy
2004-01-01
Advances in photodynamic therapy (PDT) treatment for prostate cancer can be achieved either by improving selectivity of the photosensitizer towards prostate gland tissue or improving the dosimetry by means of individualized treatment planning using currently available photosensitizers. The latter approach requires the ability to measure, among other parameters, the fluence rate at different positions within the prostate and the ability to derive the tissue optical properties. Here fibre optic probes are presented capable of measuring the fluence rate throughout large tissue volumes and a method to derive the tissue optical properties for different volumes of the prostate. The responsivity of the sensors is sufficient to detect a fluence rate of 0.1 mW cm -2 . The effective attenuation coefficient in the canine prostate at 660 nm is higher at the capsule (2.15 ± 0.19 cm -1 ) than in proximity of the urethra (1.84 ± 0.36 cm -1 ). Significant spatial and temporal intra- and inter-canine variability in the tissue optical properties was noted, highlighting the need for individualized monitoring of the fluence rate for improved dosimetry
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro
Directory of Open Access Journals (Sweden)
Cintia Xavier de Mello
2014-12-01
Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.
Directory of Open Access Journals (Sweden)
Adina Coșarcă
2014-02-01
Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated
Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs
McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel
1985-01-01
Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...