WorldWideScience

Sample records for select bloodborne pathogens

  1. Exposure Control--OSHA's Bloodborne Pathogens Standard.

    Science.gov (United States)

    Granville, Mark F.

    1993-01-01

    Explains schools' responsibilities in complying with the Occupational Safety and Health Administration's (OSHA) Bloodborne Pathogens Standard. Describes exposure determination plan, protective equipment, housekeeping practices, labeling of waste, training employees, hepatitis B vaccinations, postexposure evaluation and medical follow-up, and…

  2. OSHA Bloodborne Pathogens Standards Exposure Control Plan

    Science.gov (United States)

    Luhrs, Caro Elise; Teitelbaum, Rita

    1993-01-01

    The Hummer Associates Exposure Control Plan is designed to reduce significant occupational exposure to bloodborne pathogens and infectious materials for Hummer Associates health care personnel. Under universal precautions, all patients and all body fluids are considered potentially infectious for bloodborne pathogens. Medical personnel need not be at increased risk if universal precautions are correctly understood and followed. This program covers all employees who could reasonably anticipate contact with blood or other potentially infectious materials during the performance of their job responsibilities. Although HIV and hepatitis B are mentioned most often, this program applies to all bloodborne diseases. The two main components needed to implement this program are universal precautions and engineering/work practice controls. This program covers all employees who may have occupational exposure to blood or other potentially infectious materials. Other aspects of this program are discussed.

  3. Planning for compliance: OSHA's bloodborne pathogen rule.

    Science.gov (United States)

    Bednar, B; Duke, M C

    1990-11-01

    Overall, the bloodborne pathogen rule constitutes a reasonable response to a significant threat to workplace safety. The risks to dialysis workers from HBV and HIV must be minimized or eliminated and the rule is generally consistent with the consensus approach. Unfortunately for dialysis providers, the rule is not exempt from the law of unintended consequences: government regulation will always have impact beyond its object. Promulgation of the final rule will immediately increase the expenses of dialysis providers. Additionally, the enormity of the HBV and HIV problem coupled with the open-ended nature of the rule's key provisions will almost certainly bring additional costs. So long as dialysis reimbursement remains flat, the unintended consequence of the bloodborne pathogen rule may be to quicken the pace of consolidation in the dialysis service market. The added burden of compliance may be too much for small independent facilities. Only large chains may have the resources to comply and survive. To forestall this effect and to provide employees with maximum protection, all dialysis providers should plan now for compliance.

  4. Protecting Adults and Children from Blood-Borne Pathogens.

    Science.gov (United States)

    Freeman, Nancy K.; Corning, Lisa L.

    2000-01-01

    Recommends universal precautions policies and procedures to minimize for children and adults in early childhood settings the risk of infection from exposure to blood-borne pathogens such as hepatitis B or HIV. Outlines symptoms of hepatitis B and HIV/AIDS. Discusses legal and ethical implications related to inclusion. Lists resources for teachers…

  5. Risk of bloodborne pathogen exposure among Zambian healthcare workers

    Directory of Open Access Journals (Sweden)

    Elayne Kornblatt Phillips

    2012-06-01

    Full Text Available Purpose: Understanding the risks of bloodborne pathogen transmission is fundamental to prioritizing interventions when resources are limited. This study investigated the risks to healthcare workers in Zambia. Design: A survey was completed anonymously by a convenience sample of workers in three hospitals and two clinics in Zambia. Respondents provided information regarding job category, injuries with contaminated sharps, hepatitis B vaccination status and the availability of HIV post-exposure prophylaxis (PEP. Results: Nurses reported the largest number of injuries. The average annual sharps injury rate was 1.3 injuries per worker, and service workers (housekeepers, laundry, ward assistants had the highest rate of these injuries, 1.9 per year. Injuries were often related to inadequate disposal methods. Syringe needles accounted for the largest proportion of injuries (60%, and 15% of these injuries were related to procedures with a higher-than-average risk for infection. Most workers (88% reported the availability of PEP, and only 8% were fully vaccinated against hepatitis B. Conclusions: The injury risks identified among Zambian workers are serious and are exacerbated by the high prevalence of bloodborne pathogens in the population. This suggests that there is a high risk of occupationally acquired bloodborne pathogen infection. The findings also highlight the need for a hepatitis B vaccination program focused on healthcare workers. The risks associated with bloodborne pathogens threaten to further diminish an already scarce resource in Zambia – trained healthcare workers. To decrease these risks, we suggest the use of low-cost disposal alternatives, the implementation of cost-sensitive protective strategies and the re-allocation of some treatment resources to primary prevention. Keywords: Healthcare worker safety, Zambian healthcare workers, Bloodborne pathogen transmission, Sharps injury prevention, Infectious diseases

  6. 75 FR 27237 - Regulatory Flexibility Act Review of the Bloodborne Pathogens Standard

    Science.gov (United States)

    2010-05-14

    ... shown that occupational exposure to bloodborne pathogens constituted a significant risk and that the... infectious substances on them) is prohibited; Employers must make HBV vaccinations available to employees... needlestick prevention; Effectiveness of needlestick prevention programs; New, emerging health risks from...

  7. Bloodborne Viral Pathogen Contamination in the Era of Laboratory Automation.

    Science.gov (United States)

    Bryan, Andrew; Cook, Linda; Atienza, Ederlyn E; Kuypers, Jane; Cent, Anne; Baird, Geoffrey S; Coombs, Robert W; Jerome, Keith R; Wener, Mark H; Butler-Wu, Susan M

    2016-07-01

    The CDC states that laboratory testing for persons under investigation for Ebola virus disease can be safely performed using automated laboratory instruments by adhering to bloodborne pathogen practices. We therefore sought to investigate the levels of viral contamination of a total laboratory automation (TLA) system to guide risk mitigation strategies for handling infectious agents. Environmental swabs followed by PCR for hepatitis B (HBV) and hepatitis C (HCV) viruses were taken from a chemistry TLA system during routine clinical use and after running a small number of high-titer HCV samples. Control experiments were performed to ensure the recovery of DNA and RNA viruses by swabs from a representative nonporous surface. Of 79 baseline swabs for nucleic acids performed on the TLA system, 10 were positive for HBV and 8 for HCV. Viral nucleic acid was consistently detected from swabs taken from the distal inside surface of the decapper discharge chute, with areas adjacent to the decapper instrument and the centrifuge rotor also positive for HBV or HCV nucleic acid. Contamination was occasionally detected on exposed surfaces in areas without protective barriers between samples and personnel. After running known HCV-positive samples, at least one additional site of contamination was detected on an exposed area of the line. A low level of viral contamination of automated clinical laboratory equipment occurs in clinical use. Given the risks associated with highly infectious agents, there is a need for risk-mitigation procedures when handling all samples. © 2016 American Association for Clinical Chemistry.

  8. 76 FR 67478 - Bloodborne Pathogens Standard; Extension of the Office of Management and Budget's (OMB) Approval...

    Science.gov (United States)

    2011-11-01

    ... Pathogens Standard provide employers and workers with means to provide protection from adverse health... protection from the adverse health effects associated with occupational exposure to bloodborne pathogens. As... DEPARTMENT OF LABOR Occupational Safety and Health Administration [Docket No. OSHA-2010-0047...

  9. Protecting workers from pathogens. Employers must act now to comply with OSHA's new standard on bloodborne pathogens.

    Science.gov (United States)

    White, C L

    1992-04-01

    A new standard set forth by the Occupational Safety and Health Administration (OSHA) requires healthcare employers to implement sweeping new controls in areas such as record keeping, engineering, hazard prevention, and work practice. Through the bloodborne pathogen standard, which went into effect on March 6, OSHA acknowledges that healthcare workers face significant health risks as a result of occupational exposure to blood and other infectious materials. Although most prudent healthcare providers already adhere to the Centers for Disease Control's universal precautions, the OSHA regulations include several additional mandatory measures that are more specific and stringent. The additional measures include the development of an exposure control plan, procedures for responding to an employee's exposure to bloodborne pathogens, the implementation of certain engineering and work practice controls to eliminate or minimize on-the-job exposure risks, and the provision of personal protective equipment and information and training programs. OSHA estimates that the greatest cost component of implementing procedures to bring a facility into compliance is attributable to the purchase of personal protective equipment. Although the costs of compliance are substantial, OSHA has estimated that these costs represent less than 1 percent of the healthcare industry's annual revenues. Violation of the bloodborne pathogen standard may result in penalties of up to $70,000, depending on the severity of the infraction. Criminal penalties are also possible for willful violations that result in worker death.

  10. Bloodborne pathogens

    Science.gov (United States)

    ... baby in the womb). More About Hepatitis and HIV infections HEPATITIS Symptoms of hepatitis B and hepatitis C may be ... contact with the virus. Sometimes, there are no symptoms. Hepatitis B ... liver damage. HIV After someone is infected with HIV, the virus ...

  11. Are your employees protected from blood-borne pathogens? OSHA standards charge textile rental companies with responsibility for worker safety.

    Science.gov (United States)

    Weller, S C

    1991-11-01

    Congress is putting pressure on OSHA to finalize its Universal Precaution standards by December. When the standards go into effect, textile rental companies that serve medical, dental, and outpatient care facilities--including private physician and dentist offices--must take steps to protect employees from blood-borne pathogens. Soiled linens, towels, gowns, and other items from any customer in risk categories link a textile rental facility and/or commercial laundry with the OSHA regulations. Read and heed this information.

  12. Fibrinolysis and proliferative endarteritis: two related processes in chronic infections? The model of the blood-borne pathogen Dirofilaria immitis.

    Directory of Open Access Journals (Sweden)

    Javier González-Miguel

    Full Text Available The interaction between blood-borne pathogens and fibrinolysis is one of the most important mechanisms that mediate invasion and the establishment of infectious agents in their hosts. However, overproduction of plasmin (final product of the route has been related in other contexts to proliferation and migration of the arterial wall cells and degradation of the extracellular matrix. We have recently identified fibrinolysis-activating antigens from Dirofilaria immitis, a blood-borne parasite whose key pathological event (proliferative endarteritis is produced by similar mechanisms to those indicated above. The objective of this work is to study how two of this antigens [actin (ACT and fructose-bisphosphate aldolase (FBAL] highly conserved in pathogens, activate fibrinolysis and to establish a relationship between this activation and the development of proliferative endarteritis during cardiopulmonary dirofilariasis. We demonstrate that both proteins bind plasminogen, enhance plasmin generation, stimulate the expression of the fibrinolytic activators tPA and uPA in endothelial cell cultures and are located on the surface of the worm in contact with the host's blood. ELISA, western blot and immunofluorescence techniques were employed for this purpose. Additionally, the implication of lysine residues in this interaction was analyzed by bioinformatics. The involvement of plasmin generated by the ACT/FBAL and plasminogen binding in cell proliferation and migration, and degradation of the extracellular matrix were shown in an "in vitro" model of endothelial and smooth muscle cells in culture. The obtained results indicate that ACT and FBAL from D. immitis activate fibrinolysis, which could be used by the parasite like a survival mechanism to avoid the clot formation. However, long-term overproduction of plasmin can trigger pathological events similar to those described in the emergence of proliferative endarteritis. Due to the high degree of

  13. Occupational blood exposures in health care workers: incidence, characteristics, and transmission of bloodborne pathogens in South Korea

    Directory of Open Access Journals (Sweden)

    Ju Hyun Lee

    2017-10-01

    Full Text Available Abstract Background Health care workers (HCWs are at high risk for occupational blood exposures (OBEs and transmission of bloodborne pathogens. This study elucidated the incidence rate and epidemiological characteristics of OBEs among HCWs and investigated the pathogen transmission rate for hepatitis B virus (HBV, hepatitis C virus (HCV, and human immunodeficiency virus (HIV. Methods Self-reported OBEs from January 1, 2011 to December 31, 2015 were obtained from the electronic recording system. OBE incidence densities per 100 person-years and per 100 bed-years were calculated with a 5-year trend analysis. OBE characteristics and pathogen transmission rates were evaluated. Results Among 10,452 HCWs and 1072 average yearly beds, 1076 OBEs were reported. OBE incidence rate was 5.6 cases per 100 person (full-time equivalent-years and 20.3 per 100 bed-years. Incidence rate decreased and was significantly associated with a decrease of beds served per HCW. Housekeeping showed the highest OBE rate (14.8% followed by doctors (8.5% and nurses (6.2%. OBEs occurred in wards, emergency rooms, and operating rooms (38.1%, 13.3% and 12.2%, respectively via percutaneous (86.7% and mucocutaneous exposures (13.2%. Of OBEs associated with HBV (n = 133, HCV (n = 126, and HIV (n = 25, only one led to an infection (HCV; transmission rate of 0.8%. Neither HBV nor HIV infection occurred. Conclusions OBE incidence rate in a Korean university hospital was 5.6 cases per 100 person-years and 20.3 per 100 bed-years and was related to HCW workload and work proficiency. Though the actual bloodborne pathogen transmission rate was low, efforts to prevent OBE should be made for hospital safety.

  14. Non-hospital based registered nurses and the risk of bloodborne pathogen exposure.

    Science.gov (United States)

    Gershon, Robyn R M; Qureshi, Kristine A; Pogorzelska, Monika; Rosen, Jonathan; Gebbie, Kristine M; Brandt-Rauf, Paul W; Sherman, Martin F

    2007-10-01

    The aim of this study was to assess the risk of blood and body fluid exposure among non-hospital based registered nurses (RNs) employed in New York State. The study population was mainly unionized public sector workers, employed in state institutions. A self-administered questionnaire was completed by a random stratified sample of members of the New York State Nurses Association and registered nurse members of the New York State Public Employees Federation. Results were reviewed by participatory action research (PAR) teams to identify opportunities for improvement. Nine percent of respondents reported at least one needlestick injury in the 12-month period prior to the study. The percutaneous injury (PI) rate was 13.8 per 100 person years. Under-reporting was common; 49% of all PIs were never formally reported and 70% never received any post-exposure care. Primary reasons for not reporting included: time constraints, fear, and lack of information on reporting. Significant correlates of needlestick injuries included tenure, patient load, hours worked, lack of compliance with standard precautions, handling needles and other sharps, poor safety climate, and inadequate training and availability of safety devices (prisk reduction strategies, with an emphasis on safety devices. Non-hospital based RNs are at risk for bloodborne exposure at rates comparable to hospital based RNs; underreporting is an important obstacle to infection prevention, and primary and secondary risk management strategies appeared to be poorly implemented. Intervention research is warranted to evaluate improved risk reduction practices tailored to this population of RNs.

  15. HIV and selected blood-borne and sexually transmitted infections in a predominantly Roma (Gypsy) neighbourhood in Budapest, Hungary

    Science.gov (United States)

    Gyarmathy, V. Anna; Ujhelyi, Eszter; Neaigus, Alan

    2008-01-01

    We assessed the prevalence of HIV and selected blood-borne and sexually transmitted infections among a convenience sample of 64 residents of Dzsumbuj, a predominantly Roma (Gypsy) neighbourhood in Budapest, Hungary. No cases of HIV were detected, while the prevalence of Hepatitis B infection (anti-HBc) was 27% and syphilis prevalence was 2%. Romas (n=50) were significantly more likely than non-Romas (n=14) to have HAV antibodies (80% vs. 43%) and less likely to be HBV immunized (anti-HBs only; 6% vs. 29%). Current drug injectors (n=13) were more likely than non-injectors (n=51) to have antibodies against HAV (85% vs. 69%) and HCV (85% vs. 8%). While HIV has not been introduced in this population, risk conditions for a potentially explosive HIV epidemic are present. Health care policies should focus on expanding coverage for HAV and HBV immunizations, and access to HIV preventive services needs to be extended to marginalized, mostly minority populations, such as the Roma in Europe. PMID:18935777

  16. Bloodborne Pathogens and Needlestick Prevention

    Science.gov (United States)

    ... Safety and Health Program Recommendations It's the Law Poster REGULATIONS Law and Regulations Standard Interpretations Training Requirements ... page requires that javascript be enabled for some elements to function correctly. Please contact the OSHA Directorate ...

  17. 29 CFR 1910.1030 - Bloodborne pathogens.

    Science.gov (United States)

    2010-07-01

    ... during handling; contaminated sharps; and pathological and microbiological wastes containing blood or...—(1) Effective Date. The standard shall become effective on March 6, 1992. (2) The Exposure Control...

  18. Reducing Blood-borne Exposure in Interventional Radiology: What the IR Should Know

    Energy Technology Data Exchange (ETDEWEB)

    Tso, David K. [University of British Columbia, Department of Radiology (Canada); Athreya, Sriharsha, E-mail: sathreya@stjoes.ca [St. Joseph' s Healthcare Hamilton, Department of Diagnostic Imaging (Canada)

    2013-08-01

    Interventional radiologists are at risk of exposure to blood-borne pathogens in their day-to-day practice. Percutaneous exposure from unsafe sharps handling, mucocutaneous exposure from body fluid splashes, and glove perforation from excessive wear can expose the radiologist to potentially infectious material. The increasing prevalence of blood-borne pathogens, including hepatitis B and C, and human immunodeficiency virus, puts nurses, residents, fellows, and interventional radiologists at risk for occupational exposure. This review outlines suggestions to establish a culture of safety in the interventional suite.

  19. Pathogen-mediated selection for MHC variability in wild zebrafish

    Czech Academy of Sciences Publication Activity Database

    Smith, C.; Ondračková, Markéta; Spence, R.; Adams, S.; Betts, D. S.; Mallon, E.

    2011-01-01

    Roč. 13, č. 6 (2011), s. 589-605 ISSN 1522-0613 Institutional support: RVO:68081766 Keywords : digenean * frequency-dependent selection * heterozygote advantage * major histocompatibility complex * metazoan parasite * pathogen-driven selection Subject RIV: EG - Zoology Impact factor: 1.029, year: 2011

  20. The pathogen transmission avoidance theory of sexual selection

    Energy Technology Data Exchange (ETDEWEB)

    Loehle, C.

    1997-08-01

    The current theory that sexual selection results from female preference for males with good genes suffers from several problems. An alternative explanation, the pathogen transmission avoidance hypothesis, argues that the primary function of showy traits is to provide a reliable signal of current disease status, so that sick individuals can be avoided during mating. This study shows that a significant risk of pathogen transmission occurs during mating and that showy traits are reliable indicators of current disease status. The origin of female choosiness is argued to lie in a general tendency to avoid sick individuals, even in the absence of showy traits, which originate as exaggerations of normal traits that are indicative of good health (bright feathers, vigorous movement, large size). Thus, in this new model the origins of both showy traits and female choosiness are not problematic and there is no threshold effect. This model predicts that when the possession of male showy traits does not help to reduce disease in the female, showy traits are unlikely to occur. This case corresponds to thorough exposure of every animal to all group pathogens, on average, in large groups. Such species are shown with a large data set on birds to be less likely to exhibit showy traits. The good-genes model does not make this prediction. The pathogen transmission avoidance model can also lead to the evolution of showy traits even when selection is not effective against a given pathogen (e.g., when there is no heritable variation for resistance), but can result in selection for resistance if such genes are present. Monogamy is argued to reduce selection pressures for showy traits; data show monogamous species to be both less parasitized and less showy. In the context of reduction of pathogen transmission rates in showy populations, selection pressure becomes inversely frequency-dependent, which makes showy traits likely to be self-limiting rather than runaway.

  1. Sexual selection as a consequence of pathogen avoidance behaviors

    Energy Technology Data Exchange (ETDEWEB)

    Loehle, C. [Argonne National Lab., IL (United States); Logofet, D.O. [Russian Academy of Sciences, Moscow (Russian Federation). Laboratory of Mathematical Ecology

    1997-08-01

    The current theory that sexual selection results from female choice for good genes suffers from several problems. An alternative explanation is proposed. The pathogen avoidance hypothesis argues that the primary function of showy traits is to provide a reliable signal of current disease status so that sick individuals may be avoided during mating. Our studies shown that a significant risk of pathogen transmission occurs during mating and that showy traits are reliable indicators of current disease status. The origin of female choosiness is argued to lie in a general tendency to avoid sick individuals, even in the absence of showy traits. The showy traits are argued to originate as simple exaggerations of normal traits that are indicative of good health (bright feathers; vigorous movement; large size). Thus the origins of both showy traits and female choosiness are not problematic in this theory. A game theory analysis is employed to formalize the theory. Results of the game theory model support the theory. In particular, when the possession of male showy traits does not help reduce disease in the female, then showy traits are unlikely to occur. This case corresponds to the situation in large flocks or herds in which every animal is thoroughly exposed to all group pathogens on average. Such species do not exhibit showy traits. The good genes model does not make this prediction. The pathogen avoidance model can also lead to the evolution of showy traits even when selection is not effective against a given pathogen (e.g., when there is no heritable variation for resistance) but will lead to selection for resistance if such genes are present. Overall, the pathogen avoidance hypothesis provides a complete alternative to the good genes theory.

  2. Prevalence of transfusion-transmitted viral pathogens among health-care workers and risk mitigation programme in a paediatric tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Charu Nayyar

    2017-01-01

    Full Text Available The health-care workers (HCWs are at an occupational risk of exposure to blood-borne pathogens, mainly, HIV, hepatitis B virus (HBV and hepatitis C virus. HBV is currently the only blood-borne virus for which a vaccine is available. All health-care institutions must encourage the HCWs to undergo screening for blood-borne pathogens.

  3. Selection of pathogen-resistant mutants in rapeseed

    International Nuclear Information System (INIS)

    Spanier, A.; Roebbelen, G.

    1990-01-01

    Full text: Significant yield reductions are due to Phoma lingam and Alternaria brassicae. Toxin containing culture filtrates of the pathogens as well as concentrated toxins of Phoma (Sirodesmins) are used for resistance selections in in-vitro cultures of haploid rapeseed materials. A few days after transfer of the in-vitro materials to the selective media the inhibitory effect of both the culture filtrates as well as the Sirodesmins was apparent. Clones were obtained, surviving several transfers onto toxin containing media. Further experiments shall clarify whether the toxin tolerance, selected in vitro at the cell level, is expressed in the differentiated plant in the greenhouse and finally in the field. (author)

  4. Patients' Fear of Contracting the Blood-Borne Infections from Dentists

    Directory of Open Access Journals (Sweden)

    Fatemah Ayatollahi

    2007-01-01

    Full Text Available Introduction: There has been no recent assessment of public attitudes and opinions concerning risk of blood-borne pathogen transmission during health care. To assess public attitudes and opinions towards dentists infected with blood-borne viruses, this study was carried out.Materials and Methods: Six items in this cross-sectional survey were used to assess current attitudes and opinions about dentists infected with Human Immunodeficiency Virus (HIV, Hepatitis B and CViruses, and the risk of blood-borne virus transmission during health care in a sample of 500 cases, in Yazd. Data were analyzed by SPSS (version 13 and chi-square tests were used, when appropriate.Results: Of 500 respondents, 94% agreed that they want to know whether their dentist is infectedwith HIV, HBV or HCV; 93.8% agreed that disclosure of HIV, HBV or HCV infection in a provider should be mandatory. However, 15.8% did not believe that HIV-infected dentists were more likely to infect patients than those dentists infected with HBV or HCV. Opinions were divided on whether HIV-infected providers should be able to care for patients as long as they use good infection control:only 41.6% thought that infected providers should be allowed to provide patient care.Conclusion: These findings suggest that improved public education and risk communication on health care-associated blood-borne infections is needed.

  5. Pathogen-driven selection in the human genome.

    Science.gov (United States)

    Cagliani, Rachele; Sironi, Manuela

    2013-01-01

    Infectious diseases and epidemics have always accompanied and characterized human history, representing one of the main causes of death. Even today, despite progress in sanitation and medical research, infections are estimated to account for about 15% of deaths. The hypothesis whereby infectious diseases have been acting as a powerful selective pressure was formulated long ago, but it was not until the availability of large-scale genetic data and the development of novel methods to study molecular evolution that we could assess how pervasively infectious agents have shaped human genetic diversity. Indeed, recent evidences indicated that among the diverse environmental factors that acted as selective pressures during the evolution of our species, pathogen load had the strongest influence. Beside the textbook example of the major histocompatibility complex, selection signatures left by pathogen-exerted pressure can be identified at several human loci, including genes not directly involved in immune response. In the future, high-throughput technologies and the availability of genetic data from different populations are likely to provide novel insights into the evolutionary relationships between the human host and its pathogens. Hopefully, this will help identify the genetic determinants modulating the susceptibility to infectious diseases and will translate into new treatment strategies.

  6. Aggressive chemotherapy and the selection of drug resistant pathogens.

    Directory of Open Access Journals (Sweden)

    Silvie Huijben

    2013-09-01

    Full Text Available Drug resistant pathogens are one of the key public health challenges of the 21st century. There is a widespread belief that resistance is best managed by using drugs to rapidly eliminate target pathogens from patients so as to minimize the probability that pathogens acquire resistance de novo. Yet strong drug pressure imposes intense selection in favor of resistance through alleviation of competition with wild-type populations. Aggressive chemotherapy thus generates opposing evolutionary forces which together determine the rate of drug resistance emergence. Identifying treatment regimens which best retard resistance evolution while maximizing health gains and minimizing disease transmission requires empirical analysis of resistance evolution in vivo in conjunction with measures of clinical outcomes and infectiousness. Using rodent malaria in laboratory mice, we found that less aggressive chemotherapeutic regimens substantially reduced the probability of onward transmission of resistance (by >150-fold, without compromising health outcomes. Our experiments suggest that there may be cases where resistance evolution can be managed more effectively with treatment regimens other than those which reduce pathogen burdens as fast as possible.

  7. Association between selected oral pathogens and gastric precancerous lesions.

    Directory of Open Access Journals (Sweden)

    Christian R Salazar

    Full Text Available We examined whether colonization of selected oral pathogens is associated with gastric precancerous lesions in a cross-sectional study. A total of 119 participants were included, of which 37 were cases of chronic atrophic gastritis, intestinal metaplasia, or dysplasia. An oral examination was performed to measure periodontal indices. Plaque and saliva samples were tested with real-time quantitative PCR for DNA levels of pathogens related to periodontal disease (Porphyromonas gingivalis, Tannerella forsythensis, Treponema denticola, Actinobacillus actinomycetemcomitans and dental caries (Streptococcus mutans and S. sobrinus. There were no consistent associations between DNA levels of selected bacterial species and gastric precancerous lesions, although an elevated but non-significant odds ratio (OR for gastric precancerous lesions was observed in relation to increasing colonization of A. actinomycetemcomitans (OR = 1.36 for one standard deviation increase, 95% Confidence Interval = 0.87-2.12, P. gingivalis (OR = 1.12, 0.67-1.88 and T. denticola (OR = 1.34, 0.83-2.12 measured in plaque. To assess the influence of specific long-term infection, stratified analyses by levels of periodontal indices were conducted. A. actinomycetemcomitans was significantly associated with gastric precancerous lesions (OR = 2.51, 1.13-5.56 among those with ≥ median of percent tooth sites with PD ≥ 3 mm, compared with no association among those below the median (OR = 0.86, 0.43-1.72. A significantly stronger relationship was observed between the cumulative bacterial burden score of periodontal disease-related pathogens and gastric precancerous lesions among those with higher versus lower levels of periodontal disease indices (p-values for interactions: 0.03-0.06. Among individuals with periodontal disease, high levels of colonization of periodontal pathogens are associated with an increased risk of gastric precancerous lesions.

  8. Surface adhesins and exopolymers of selected foodborne pathogens

    DEFF Research Database (Denmark)

    Jaglic, Zoran; Desvaux, Mickaël; Weiss, Agnes

    2014-01-01

    The ability of bacteria to bind different compounds and to adhere to biotic and abiotic surfaces provides them with a range of advantages, such as colonization of various tissues, internalisation, avoidance of an immune response and survival and persistence in the environment. A variety of bacter......The ability of bacteria to bind different compounds and to adhere to biotic and abiotic surfaces provides them with a range of advantages, such as colonization of various tissues, internalisation, avoidance of an immune response and survival and persistence in the environment. A variety...... of bacterial surface structures are involved in this process and these promote bacterial adhesion in a more or less specific manner. In this review, we will focus on those surface adhesins and exopolymers in selected foodborne pathogens that are involved mainly in primary adhesion. Their role in biofilm...

  9. Encourage Your Workers to Report Bloodborne Pathogen Exposures

    Science.gov (United States)

    ... 6, 2014 Content source: National Institute for Occupational Safety and Health Education and Information Division Email Recommend Tweet YouTube Instagram Listen Watch RSS ABOUT About CDC Jobs Funding LEGAL Policies Privacy FOIA No Fear Act OIG 1600 Clifton Road Atlanta , GA 30329-4027 USA 800-CDC-INFO ( ...

  10. OSHA's bloodborne pathogens rule an opportunity/threat.

    Science.gov (United States)

    Weller, S C

    1992-02-01

    If you supply healthcare linen, OSHA's new ruling comes with a price tag, but it may be a marketing boon as well. The costs of compliance are high--about $1.19 million annually. One of the most costly and important parts of the ruling is the required employer-paid hepatitis B vaccination of employees. But behind the costs, there's good news for the textile rental industry. The opportunity to serve small medical facilities and nursing homes as well as hospitals with reusable healthcare garments could create a revenue source estimated to be at least $177 million a year.

  11. Psychosocial Factors at Work and Blood-Borne Exposure among Nurses

    Directory of Open Access Journals (Sweden)

    R Mehrdad

    2014-01-01

    Full Text Available Background: Exposure to human blood and body fluids is a common risk for nurses. Many factors can affect the prevalence and incidence of this occupational hazard. Psychosocial factors at work may be a risk factor for the exposure. Objective: To assess needle stick, sharp injury and mucus exposure to blood-borne pathogens among nurses in Iran and to determine the association between these exposures and psychosocial factors at work. Methods: A cross-sectional study was conducted on nurses in a public hospital, Tehran, Iran. 364 nurses received and 339 completed and returned a self-reported questionnaire containing demographic data, history of exposure to blood-borne pathogens at work during previous year and the General Nordic questionnaire for psychological and social factors at work (QPS Nordic 34+ Questionnaire. Results: Of 339 participants, 197 (58.1% reported needle-stick injury, 186 (54.6% reported another type of sharp injury, and 112 (33% reported a mucous membrane exposure during the previous year. More than half of the participants who had history of exposure, had not reported it. Those with middle or high level of stress had higher crude and adjusted odds than those with lower stress for all kinds of exposure. Adjusted odds ratios for high stress group (ranging from 2.8 to 4.4 were statistically different from 1. Conclusion: There is a high prevalence of needle-stick and sharp injury and mucous membrane exposure to patients' blood or body fluids among studied nurses. There is a significant association between increasing psychosocial factors at work and exposure to blood-borne pathogens among this group of nurses.

  12. Priority setting of foodborne pathogens: disease burden and costs of selected enteric pathogens

    NARCIS (Netherlands)

    Kemmeren JM; Mangen MJJ; Duynhoven YTHP van; Havelaar AH; MGB

    2006-01-01

    Toxoplasmosis causes the highest disease burden among seven evaluated foodborne pathogens. This is the preliminary conclusion of a major study of the disease burden and related costs of foodborne pathogens. The other micro-organisms that were studied are Campylobacter spp., Salmonella spp.,

  13. Impact of electromagnetic field on the pathogenicity of selected ...

    African Journals Online (AJOL)

    Rhipicephalus decoloratus) to variable intensities of electromagnetic field for different periods of time was examined on their pathogenicity on tick. Some bacterial isolates from the macerate of tick cadavers were used in the infection of healthy engorged ...

  14. insect vectors of pathogens in selected undisposed refuse dumps

    African Journals Online (AJOL)

    Administrator

    2012-06-23

    Jun 23, 2012 ... pathogens, habitat for pests such as rats, flies and mosquitoes, reduction of usable ... The generation of urban solid wastes in Nigeria is on the increase ..... utilize the slime on the side of bathroom and kitchen drains, sewage ...

  15. Development of a Selective Medium for the Fungal Pathogen Fusarium graminearum Using Toxoflavin Produced by the Bacterial Pathogen Burkholderia glumae

    Directory of Open Access Journals (Sweden)

    Boknam Jung

    2013-12-01

    Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.

  16. Serosurvey for selected pathogens in Iberian roe deer

    Directory of Open Access Journals (Sweden)

    Oleaga Álvaro

    2010-11-01

    Full Text Available Abstract Background The roe deer is the most abundant and widespread wild Eurasian cervid. Its populations are expanding and increasingly in contact with livestock. This may affect the distribution of infectious diseases shared with other wild and domestic ungulates. Methods We investigated the antibody seroprevalence against Pestivirus, Herpesvirus, Bluetongue (BT virus, M. avium paratuberculosis (MAP, and Brucella sp. in 519 roe deer from different regions in Spain, south-western Europe. Results No antibodies were detected against BT and Brucella sp. However, antibodies were detected against Pestivirus (1.5%, Herpesvirus (0.2% and MAP (9.2%. MAP antibodies were detected in seven of the eight populations (range 5-16.4%. Conclusions The detection of MAP antibodies in samples from most roe deer populations suggests that contact with MAP is widespread in this wildlife species. The highest prevalence was detected in sites with abundant dairy cattle and frequent use of liquid manure on pastures. Considering the results obtained regarding exposure to different pathogens, we suggest that antibody prevalences in this non-gregarious browser are largely determined by environmental factors, potentially modulating vector populations or pathogen survival in the environment.

  17. Bloodborne transmission of Hiv/Aids in Africa: Challenges and ...

    African Journals Online (AJOL)

    HIV-2, has been described mainly in West Africa. HIV can be transmitted both in cellular and plasma components of blood. Bloodborne transmission, accounts for 3-5% of the mode of transmission worldwide.Figures for other modes of transmission are 5-10% for intravenous drug use, 5 to 10 % for the homosexual route , 70 ...

  18. Exposure to selected Pathogens in to selected pathogens in Geoffroy's cats and domestic carnivores from central Argentina.

    Science.gov (United States)

    Uhart, Marcela M; Rago, M Virginia; Marull, Carolina A; Ferreyra, Hebe del Valle; Pereira, Javier A

    2012-10-01

    Wild carnivores share a high percentage of parasites and viruses with closely related domestic carnivores. Because of increased overlap and potential contact with domestic species, we conducted a retrospective serosurvey for 11 common carnivore pathogens in 40 Geoffroy's cats (Leopardus geoffroyi) sampled between 2000 and 2008 within or near two protected areas in central Argentina (Lihué Calel National Park, La Pampa, and Campos del Tuyú National Park, Buenos Aires), as well as five domestic cats and 11 domestic dogs from catde ranches adjacent to Lihué Calel Park. Geoffroy's cats had detectable antibody to canine distemper virus (CDV), feline calicivirus (FCV), feline coronavirus, feline panleukopenia virus (FPV), Toxoplasma gondii, Leptospira interrogans (serovars Ictero/Icter and Ballum), and Dirofilaria immitis. None of the wild cats had antibodies to feline herpesvirus, feline immunodeficiency virus (FIV), feline leukemia virus, or rabies virus. Domestic dogs had antibodies to CDV, canine adenovirus, canine herpesvirus, and canine parvovirus. Antibodies to FPV, FCV, FIV, and T. gondii were found in domestic cats. We provide the first data on exposure of free-ranging Geoffroy's cats to pathogens at two sites within the core area of the species distribution range, including the first report of antibodies to CDV in this species. We encourage continued monitoring for diseases in wild and domestic carnivores as well as preventive health care for domestic animals, particularly in park buffer zones where overlap is greatest.

  19. High temperature and bacteriophages can indirectly select for bacterial pathogenicity in environmental reservoirs.

    Directory of Open Access Journals (Sweden)

    Ville-Petri Friman

    2011-03-01

    Full Text Available The coincidental evolution hypothesis predicts that traits connected to bacterial pathogenicity could be indirectly selected outside the host as a correlated response to abiotic environmental conditions or different biotic species interactions. To investigate this, an opportunistic bacterial pathogen, Serratia marcescens, was cultured in the absence and presence of the lytic bacteriophage PPV (Podoviridae at 25°C and 37°C for four weeks (N = 5. At the end, we measured changes in bacterial phage-resistance and potential virulence traits, and determined the pathogenicity of all bacterial selection lines in the Parasemia plantaginis insect model in vivo. Selection at 37°C increased bacterial motility and pathogenicity but only in the absence of phages. Exposure to phages increased the phage-resistance of bacteria, and this was costly in terms of decreased maximum population size in the absence of phages. However, this small-magnitude growth cost was not greater with bacteria that had evolved in high temperature regime, and no trade-off was found between phage-resistance and growth rate. As a result, phages constrained the evolution of a temperature-mediated increase in bacterial pathogenicity presumably by preferably infecting the highly motile and virulent bacteria. In more general perspective, our results suggest that the traits connected to bacterial pathogenicity could be indirectly selected as a correlated response by abiotic and biotic factors in environmental reservoirs.

  20. Antagonistic Activity of Lactobacillus reuteri Strains on the Adhesion Characteristics of Selected Pathogens.

    Science.gov (United States)

    Singh, Tejinder P; Kaur, Gurpreet; Kapila, Suman; Malik, Ravinder K

    2017-01-01

    Adhesion ability of probiotics is the key factor that decides their colonization in the gastrointestinal tract and potential to inhibit pathogens. Therefore, adhesion ability can be considered as a key determinant for probiotic efficacy. Presents study documents the antagonistic activity of viable/untreated, Lithium chloride (LiCl) treated or heat-killed forms of eight probiotic Lactobacillus reuteri strains on the adhesion characteristics of selected pathogens. All strains investigated were able to adhere to Caco-2 cells. L. reuteri strains tested were able to inhibit and displace ( P strain L. reuteri LR6 showed the strongest adhesion and pathogen inhibition ability among the eight L. reuteri strains tested. In addition, the abilities to inhibit and to displace adhered pathogens depended on both the probiotic and the pathogen strains tested suggesting the involvement of various mechanisms. The adhesion and antagonistic potential of the probiotic strains were significantly decreased upon exposure to 5 M LiCl, showing that surface molecules, proteinaceous in nature, are involved. The heat-killed forms of the probiotic L. reuteri strains also inhibited the attachment of selected pathogens to Caco-2 cells. In conclusion, in vitro assays showed that L. reuteri strains, as viable or heat-killed forms, are adherent to Caco-2 cells and are highly antagonistic to pathogens tested in which surface associated proteins play an important role.

  1. Antagonistic Activity of Lactobacillus reuteri Strains on the Adhesion Characteristics of Selected Pathogens

    OpenAIRE

    Singh, Tejinder P.; Kaur, Gurpreet; Kapila, Suman; Malik, Ravinder K.

    2017-01-01

    Adhesion ability of probiotics is the key factor that decides their colonization in the gastrointestinal tract and potential to inhibit pathogens. Therefore, adhesion ability can be considered as a key determinant for probiotic efficacy. Presents study documents the antagonistic activity of viable/untreated, Lithium chloride (LiCl) treated or heat-killed forms of eight probiotic Lactobacillus reuteri strains on the adhesion characteristics of selected pathogens. All strains investigated were ...

  2. Systematic detection of positive selection in the human-pathogen interactome and lasting effects on infectious disease susceptibility.

    Directory of Open Access Journals (Sweden)

    Erik Corona

    Full Text Available Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS, providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.

  3. Genes under positive selection in a model plant pathogenic fungus, Botrytis.

    Science.gov (United States)

    Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian

    2012-07-01

    The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Signatures of environmental genetic adaptation pinpoint pathogens as the main selective pressure through human evolution.

    Directory of Open Access Journals (Sweden)

    Matteo Fumagalli

    2011-11-01

    Full Text Available Previous genome-wide scans of positive natural selection in humans have identified a number of non-neutrally evolving genes that play important roles in skin pigmentation, metabolism, or immune function. Recent studies have also shown that a genome-wide pattern of local adaptation can be detected by identifying correlations between patterns of allele frequencies and environmental variables. Despite these observations, the degree to which natural selection is primarily driven by adaptation to local environments, and the role of pathogens or other ecological factors as selective agents, is still under debate. To address this issue, we correlated the spatial allele frequency distribution of a large sample of SNPs from 55 distinct human populations to a set of environmental factors that describe local geographical features such as climate, diet regimes, and pathogen loads. In concordance with previous studies, we detected a significant enrichment of genic SNPs, and particularly non-synonymous SNPs associated with local adaptation. Furthermore, we show that the diversity of the local pathogenic environment is the predominant driver of local adaptation, and that climate, at least as measured here, only plays a relatively minor role. While background demography by far makes the strongest contribution in explaining the genetic variance among populations, we detected about 100 genes which show an unexpectedly strong correlation between allele frequencies and pathogenic environment, after correcting for demography. Conversely, for diet regimes and climatic conditions, no genes show a similar correlation between the environmental factor and allele frequencies. This result is validated using low-coverage sequencing data for multiple populations. Among the loci targeted by pathogen-driven selection, we found an enrichment of genes associated to autoimmune diseases, such as celiac disease, type 1 diabetes, and multiples sclerosis, which lends credence to the

  5. Economic values and expected effect of selection index for pathogen-specific mastitis under Danish conditions

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Mark, Thomas; Sørensen, M.K.

    2010-01-01

    The objectives of this study were 1) to estimate costs related to 5 different pathogen-specific mastitis traits (susceptibility to different pathogens causing mastitis in dairy cattle) and unspecific mastitis, and 2) to compare selection differentials for an udder health index consisting of 5...... different pathogen-specific mastitis traits and lactation average somatic cell count from 5 to 170 d after first calving (LASCC170) with another index consisting of 1 unspecific mastitis trait and LASCC170. Economic values were estimated for mastitis caused by Staphylococcus aureus, Streptococcus...... dysgalactiae, Escherichia coli, coagulase-negative staphylococci, and Streptococcus uberis using a stochastic simulation model (SimHerd IV). Mastitis incidences for SimHerd IV were from incidences of mastitis treatments in primiparous Danish Holstein cows calving in 2007. Estimated costs ranged from 149 euro...

  6. PCR-based identification of selected pathogens associated with endodontic infections in deciduous and permanent teeth.

    Science.gov (United States)

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Eronat, Cemal

    2008-09-01

    The aim of the present study was to evaluate the presence of the selected pathogens in samples from deciduous and permanent tooth root canals by using PCR method and to determine the association of these organisms with clinical symptoms. A total of 145 children, 5 to 13 years old, were involved in this study. The presence of selected pathogens (Actinomyces israelii, Candida albicans, Enterococcus faecalis, Fusobacterium nucleatum, Porphyromonas endodontalis, Porphyromonas gingivalis, Prevotella intermedia, Streptococcus intermedius, Treponema denticola, Parvimonas micra, Tannerella forsythensis, Enterococcus faecium, Prevotella melaninogenica) in infected root canals was studied using PCR. T. denticola (P = .012, .02) and E. faecalis (P = .012, .04) were highly associated with periapical radiolucency and previous pain, while P. gingivalis was associated with tenderness to percussion in both deciduous and permanent teeth (P = .01, .015). The results of the present study confirm that certain species of microorganisms are associated with clinical signs and symptoms of endodontic disease in both deciduous and permanent teeth.

  7. PCR evaluation of selected vector-borne pathogens in dogs with pericardial effusion.

    Science.gov (United States)

    Tabar, M-D; Movilla, R; Serrano, L; Altet, L; Francino, O; Roura, X

    2018-04-01

    To investigate evidence for selected vector-borne pathogen infections in dogs with pericardial effusion living in a Mediterranean area in which several canine vector-borne diseases are endemic. Archived EDTA blood (n=68) and pericardial fluid samples (n=58) from dogs with pericardial effusion (n=68) were included. Dogs without pericardial effusion examined for other reasons were included as controls (n=60). Pericardial effusion was classified as neoplastic in 40 dogs, idiopathic in 23 dogs and of unknown aetiology in 5 dogs. Real-time PCR was performed for Leishmania infantum, Ehrlichia/Anaplasma species, Hepatozoon canis, Babesia species, Rickettsia species and Bartonella species, and sequencing of PCR products from positive samples was used to confirm species specificity. Vector-borne pathogens were found in 18 dogs: 16 of 68 dogs with pericardial effusion (23·5%) and two of 60 control dogs (3·3%). Positive dogs demonstrated DNA of Leishmania infantum (n=7), Anaplasma platys (n=2, one dog coinfected with Leishmania infantum), Babesia canis (n=5), Babesia gibsoni (n=3) and Hepatozoon canis (n=2). Vector-borne pathogens were more commonly detected among dogs with pericardial effusion than controls (P=0·001). There was no relationship between aetiology of the pericardial effusion and evidence of vector-borne pathogens (P=0·932). Vector-borne pathogens are often detected in dogs with pericardial effusion and require further investigation, especially in dogs with idiopathic pericardial effusion. PCR can provide additional information about the potential role of vector-borne pathogens in dogs with pericardial effusion living in endemic areas. © 2018 British Small Animal Veterinary Association.

  8. Effect of phenolic compounds on the growth of selected probiotic and pathogenic bacteria.

    Science.gov (United States)

    Pacheco-Ordaz, R; Wall-Medrano, A; Goñi, M G; Ramos-Clamont-Montfort, G; Ayala-Zavala, J F; González-Aguilar, G A

    2018-01-01

    Fruit extracts from different tissues (pulp, seed and peel) have shown antimicrobial and prebiotic activities related to their phenolic profile, although structure-specific evaluations have not been reported yet. The effect of five phenolic compounds (catechin and gallic, vanillic, ferulic and protocatechuic acids) identified in different fruits, particularly in mango, was evaluated on the growth of two probiotic (Lactobacillus rhamnosusGG ATCC 53103 and Lactobacillus acidophilusNRRLB 4495) and two pathogenic (Escherichia coli 0157:H7 ATCC 43890 and Salmonella enterica serovar Typhimurium ATCC 14028) bacteria. The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of phenolic acids ranged from 15-20 mmol l -1 and 20-30 mmol l -1 against E. coli and S. Typhimurium, respectively. For catechin, the MIC and MBC were 35 mmol l -1 and >35 mmol l -1 against E. coli and S. Typhimurium, respectively. The presence of catechin and gallic, protocatechuic and vanillic acids in MRS broth without dextrose allowed the growth of lactobacilli. Catechin combined with protocatechuic or vanillic acid mildly allowed the growth of both probiotics. In conclusion, phenolic compounds can selectively inhibit the growth of pathogenic bacteria without affecting the viability of probiotics. This study provides relevant information about the effects of phenolic compounds commonly present in fruit and vegetables on the growth of probiotic and pathogenic bacteria. The compounds selectively allowed the growth of probiotic lactobacilli (Lactobacillus rhamnosus GG and Lactobacillus acidophilus) and inhibited pathogenic bacteria (Escherichia coli and Salmonella Typhimurium) at the same concentration (20 mmol l -1 ). These findings can contribute to the formulation of nutraceutical products, such as synbiotics, that can restore or maintain an optimal composition of human microbiota, potentially improving the overall health of the consumer. © 2017 The

  9. Mycelial growth rate and toxin production in the seed pathogen Pyrenophora semeniperda: Resource trade-offs and temporally varying selection

    Science.gov (United States)

    S. E. Meyer; M. Masi; S. Clement; T. L. Davis; J. Beckstead

    2015-01-01

    Pyrenophora semeniperda, an important pathogen in Bromus tectorum seed banks in semi-arid western North America, exhibits >4-fold variation in mycelial growth rate. Host seeds exhibit seasonal changes in dormancy that affect the risk of pathogen-caused mortality. The hypothesis tested is that contrasting seed dormancy phenotypes select for contrasting strategies...

  10. Factors related to occurrence and distribution of selected bacterial and protozoan pathogens in Pennsylvania streams

    Science.gov (United States)

    Duris, Joseph W.; Reif, Andrew G.; Donna A. Crouse,; Isaacs, Natasha M.

    2013-01-01

    , stx1, and rfbO157 genes, but no genes were related exclusively to an individual MST marker. The human source pharmaceuticals (HSPs) acetaminophen and caffeine were correlated with Giardia, and the presence of HSPs proved to be more useful than MST markers in distinguishing the occurrence of Giardia. The HSPs caffeine and carbamazepine were correlated with the sum total of pathogen genes detected in a sample, demonstrating the value of using HSPs as an indicator of fecally derived pathogens. Sites influenced by urban land use with less forest were more likely to have greater FIB and Giardia densities and sum of the array of pathogen genes. Sites dominated by shallow carbonate bedrock in the upstream catchment were likely to have greater FIB densities and higher sum totals of pathogen genes but no correlation with Giardia detection. Our study provides a range of specific environmental, chemical, geologic, and land-use variables related to occurrence and distribution of FIB and selected bacterial and protozoan pathogens in Pennsylvania streams. The information presented could be useful for resource managers in understanding bacterial and protozoan pathogen occurrence and their relation to fecal indicator bacteria in similar settings.

  11. [Detection of biofilm formation by selected pathogens relevant to the food industry].

    Science.gov (United States)

    Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

    2015-09-01

    Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

  12. Anthropogenic impacts on an oyster metapopulation: Pathogen introduction, climate change and responses to natural selection

    Directory of Open Access Journals (Sweden)

    David Bushek

    2016-08-01

    Full Text Available Abstract Humans rely on marine ecosystems for a variety of services but often impact these ecosystems directly or indirectly limiting their capacity to provide such services. One growing impact is the emergence of marine disease. We present results from a unique case study examining how oysters, a dominant organism in many coastal bays and estuaries that is often harvested for food, have responded to pathogens influenced by human activities, namely the introduction of novel pathogens. Climate change has enabled a northward spread and establishment of Dermo disease in oysters along the eastern seaboard of North America and human activities inadvertently introduced MSX disease along this same coast. Oysters in Delaware Bay have responded differently to each pathogen, and uniquely to MSX disease by developing a highly resistant baywide population not documented in any other bay. Offspring were produced using parents collected from low or high disease (MSX and Dermo regions of Delaware Bay and exposed in a common garden experiment along with a naïve population from Maine. Results indicated widespread resistance to MSX disease, but not to Dermo disease, across Delaware Bay. One striking result was the demonstration of resilience in the population through its capacity to spread, presumably through larval transport, resistance to MSX disease into portions of the population that have experienced little to no MSX disease pressure themselves. Related studies indicated that larval transport mechanisms allowed widespread dispersal such that the entire metapopulation could acquire a high level of resistance over time if disease resistance is sufficiently heritable. The findings have implications for restoration, management and recovery of diseased populations. Namely, that if left to their own devices, natural selection may find a solution that enables populations to recover from introduced pathogens.

  13. Comparative Genomics of Smut Pathogens: Insights From Orphans and Positively Selected Genes Into Host Specialization

    Directory of Open Access Journals (Sweden)

    Juliana Benevenuto

    2018-04-01

    Full Text Available Host specialization is a key evolutionary process for the diversification and emergence of new pathogens. However, the molecular determinants of host range are poorly understood. Smut fungi are biotrophic pathogens that have distinct and narrow host ranges based on largely unknown genetic determinants. Hence, we aimed to expand comparative genomics analyses of smut fungi by including more species infecting different hosts and to define orphans and positively selected genes to gain further insights into the genetics basis of host specialization. We analyzed nine lineages of smut fungi isolated from eight crop and non-crop hosts: maize, barley, sugarcane, wheat, oats, Zizania latifolia (Manchurian rice, Echinochloa colona (a wild grass, and Persicaria sp. (a wild dicot plant. We assembled two new genomes: Ustilago hordei (strain Uhor01 isolated from oats and U. tritici (strain CBS 119.19 isolated from wheat. The smut genomes were of small sizes, ranging from 18.38 to 24.63 Mb. U. hordei species experienced genome expansions due to the proliferation of transposable elements and the amount of these elements varied among the two strains. Phylogenetic analysis confirmed that Ustilago is not a monophyletic genus and, furthermore, detected misclassification of the U. tritici specimen. The comparison between smut pathogens of crop and non-crop hosts did not reveal distinct signatures, suggesting that host domestication did not play a dominant role in shaping the evolution of smuts. We found that host specialization in smut fungi likely has a complex genetic basis: different functional categories were enriched in orphans and lineage-specific selected genes. The diversification and gain/loss of effector genes are probably the most important determinants of host specificity.

  14. Antibacterial effects of hydrogen peroxide and silver composition on selected pathogenic enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Mojtaba Davoudi

    2012-01-01

    Full Text Available Aims: Antibacterial effects of hydrogen peroxide and silver composition on selected pathogenic enterobacteriaceae was investigated in this study. Materials and Methods: The efficacy of 30 ppb silver in 0.3% hydrogen peroxide solution for inactivation of selected Enterobacteriaceae, including Escherichia coli, Proteus mirabilis, and Klebsiella pneumoniae was assessed for 72 hours in a designated nutrient broth medium and steel surface. The bactericidal growth ability was determined for each bacterium genus by the conventional colony count method and turbidimetry via an optical density (OD assay at 450 nm in a time interval of 24 hours. Results: Suspensions of K.pneumoniae, and P.mirabilis showed a significant OD reduction at three 24-hour intervals (CI = 0.95; P < 0.05, for both, along with blocked growth in a designated broth medium during 24 to 48 hours of exposure. The disinfectant was also significantly efficient for inactivating of the mentioned bacteria on steel surfaces after a 15-minute time exposure (CI = 0.95; P < 0.05. For E.coli, the OD decreased slightly during the initial exposure time, but increased after 24 hours. Viable E.coli cells were proved by colonies grown on the plate. A qualitative surface decontamination test showed that three pathogenic bacteria were inactivated significantly after disinfectant exposure (CI = 0.95, P < 0.05. Conclusions: In conclusion, a combination of hydrogen peroxide and silver ions was proposed as a strong disinfecting agent both in suspensions and on the surfaces against these three important human pathogens.

  15. Pathogenic and Saprophytic Leptospira Species in Water and Soils from Selected Urban Sites in Peninsular Malaysia

    Science.gov (United States)

    Benacer, Douadi; Woh, Pei Yee; Mohd Zain, Siti Nursheena; Amran, Fairuz; Thong, Kwai Lin

    2013-01-01

    Leptospira species were studied in water and soils from selected urban sites in Malaysia. A total of 151 water (n=121) and soil (n=30) samples were collected from 12 recreational lakes and wet markets. All samples were filtered and inoculated into semi-solid Ellinghausen and McCullough modified by Johnson and Harris (EMJH) media supplemented with additional 5-fluorouracil. The cultures were then incubated at 30°C and observed under a dark field microscope with intervals of 10 days. A PCR assay targeting the rrs gene was used to confirm the genus Leptospira among the isolates. Subsequently, the pathogenic status of the isolates was determined using primer sets G1/G2 and Sapro1/Sapro2, which target the secY and rrs genes, respectively. The isolates were identified at serogroup level using the microscopic agglutination test (MAT) while their genetic diversity was assessed by pulsed field gel electrophoresis (PFGE). Based on dark field microscopy, 23.1% (28/121) water and 23.3% (7/30) soil cultures were positive for Leptospira spp. Of the 35 positive cultures, only 8 were pure and confirmed as Leptospira genus by PCR assay. Two out of 8 isolates were confirmed as pathogenic, 5 were saprophytic and one was intermediate. These 8 isolates were negative for the 25 reference hyperimmune rabbit sera tested in the MAT. PFGE showed that all 8 of these environmental Leptospira spp. were genetically diverse. In conclusion, the presence of pathogenic Leptospira spp. in the urban Malaysian environment may indicate and highlight the importance of water screening, especially in recreational lakes, in order to minimize any chance of Leptospira infection. PMID:23363618

  16. Detection of pathogenic Leptospira from selected environment in Kelantan and Terengganu, Malaysia.

    Science.gov (United States)

    Ridzlan, F R; Bahaman, A R; Khairani-Bejo, S; Mutalib, A R

    2010-12-01

    Leptospirosis is recognized as one of the important zoonotic diseases in the world including Malaysia. A total of 145 soil and water samples were collected from selected National Service Training Centres (NSTC) in Kelantan and Terengganu. The samples were inoculated into modified semisolid Ellinghausen McCullough Johnson Harris (EMJH) medium, incubated at room temperature for 1 month and examined under the dark-field microscope. Positive growth of the leptospiral isolates were then confirmed with 8-Azaguanine Test, Polymerase Chain Reaction (PCR) assay and Microscopic Agglutination Test (MAT). Fifteen cultures (10.34%) exhibited positive growths which were seen under dark field microscope whilst only 20% (3/15) were confirmed as pathogenic species. based on 8-Azaguanine Test and PCR. Serological identification of the isolates with MAT showed that hebdomadis was the dominant serovar in Terengganu. Pathogenic leptospires can be detected in Malaysian environment and this has the potential to cause an outbreak. Therefore, precautionary steps against leptospirosis should be taken by camp authorities to ensure the safety of trainees.

  17. Antimicrobial activity of methanolic extracts of selected marine macroalgae against some pathogenic microorganisms

    Directory of Open Access Journals (Sweden)

    Ehab Omer Abdalla

    2016-05-01

    Full Text Available Objective: To evaluate the antimicrobial activity of methanolic extracts of six marine macroalgae belonging to green algae (Chlorophyceae, brown algae (Phaeophyceae and the red algae (Rhodophyceae collected from the intertidal area of the Sudanese Red Sea coast near Port Sudan. Methods: Methanol was used for extracting the active principles of the algae and the disc diffusion method was performed to examine the activity and the minimum inhibitory concentration of the samples against four pathogenic bacteria and two fungi. Results: All tested algal extracts exhibited considerable bioactivity and inhibited the growth of all pathogenic microorganisms under investigation. The green alga Caulerpa racemosa produced the maximum inhibition zone (21 mm against Candida albicans while the red alga Laurencia papillosa showed low antimicrobial activity with the minimum inhibition zone of 10 mm against Pseudomonas aeruginosa. The tested algal extracts did not show any special antimicrobial influence on the selected microorganisms when they were considered as Grampositive and Gram-negative bacteria and fungi but the most efficient methanolic extracts in inhibiting microbial growth were those of green macroalgae followed by the brown and the red macroalgae respectively. Conclusions: The study demonstrated that the tested marine macroalgae from Sudanese Red Sea coast may represent a potential and alternative source for secondary metabolites with antimicrobial activity.

  18. Selection and identification of non-pathogenic bacteria isolated from fermented pickles with antagonistic properties against two shrimp pathogens.

    Science.gov (United States)

    Zokaeifar, Hadi; Balcázar, José Luis; Kamarudin, Mohd Salleh; Sijam, Kamaruzaman; Arshad, Aziz; Saad, Che Roos

    2012-06-01

    In this study, potential probiotic strains were isolated from fermented pickles based on antagonistic activity against two shrimp pathogens (Vibrio harveyi and Vibrio parahaemolyticus). Two strains L10 and G1 were identified by biochemical tests, followed by16S ribosomal RNA gene sequence analysis as Bacillus subtilis, and characterized by PCR amplification of repetitive bacterial DNA elements (Rep-PCR). Subsequently, B. subtilis L10 and G1 strains were tested for antibacterial activity under different physical conditions, including culture medium, salinity, pH and temperature using the agar well diffusion assay. Among the different culture media, LB broth was the most suitable medium for antibacterial production. Both strains showed the highest level of antibacterial activity against two pathogens at 30 °C and 1.0% NaCl. Under the pH conditions, strain G1 showed the greatest activity against V. harveyi at pH 7.3-8.0 and against V. parahaemolyticus at pH 6.0-8.0, whereas strain L10 showed the greatest activity against two pathogens at pH 7.3. The cell-free supernatants of both strains were treated with four different enzymes in order to characterize the antibacterial substances against V. harveyi. The result showed considerable reduction of antibacterial activity for both strains, indicating the proteinaceous nature of the antibacterial substances. A wide range of tolerance to NaCl, pH and temperature was also recorded for both strains. In addition, both strains showed no virulence effect in juvenile shrimp Litopenaeus vannamei. On the basis of these results and safety of strains to L. vannamei, they may be considered for future challenge experiments in shrimp as a very promising alternative to the use of antibiotics.

  19. Simultaneous Identification of Potential Pathogenicity Factors of Mycoplasma agalactiae in the Natural Ovine Host by Negative Selection

    OpenAIRE

    Hegde, Shivanand; Hegde, Shrilakshmi; Zimmermann, Martina; Flöck, Martina; Spergser, Joachim; Rosengarten, Renate; Chopra-Dewasthaly, Rohini

    2015-01-01

    Mycoplasmas possess complex pathogenicity determinants that are largely unknown at the molecular level. Mycoplasma agalactiae serves as a useful model to study the molecular basis of mycoplasma pathogenicity. The generation and in vivo screening of a transposon mutant library of M. agalactiae were employed to unravel its host colonization factors. Tn4001mod mutants were sequenced using a novel sequencing method, and functionally heterogeneous pools containing 15 to 19 selected mutants were sc...

  20. Balancing Selection at the Tomato RCR3 Guardee Gene Family Maintains Variation in Strength of Pathogen Defense

    Science.gov (United States)

    Hörger, Anja C.; Ilyas, Muhammad; Stephan, Wolfgang; Tellier, Aurélien; van der Hoorn, Renier A. L.; Rose, Laura E.

    2012-01-01

    Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors) and host resistance genes such as the major histocompatibility complex (MHC) in mammals or resistance (R) genes in plants. In plant–pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the “Guard-Hypothesis,” R proteins (the “guards”) can sense modification of target molecules in the host (the “guardees”) by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3) and its guard (Cf-2). We conclude that, in addition to coevolution at the “guardee-effector” interface for pathogen recognition, natural selection acts on the “guard-guardee” interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto

  1. Balancing selection at the tomato RCR3 Guardee gene family maintains variation in strength of pathogen defense.

    Directory of Open Access Journals (Sweden)

    Anja C Hörger

    Full Text Available Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors and host resistance genes such as the major histocompatibility complex (MHC in mammals or resistance (R genes in plants. In plant-pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the "Guard-Hypothesis," R proteins (the "guards" can sense modification of target molecules in the host (the "guardees" by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3 and its guard (Cf-2. We conclude that, in addition to coevolution at the "guardee-effector" interface for pathogen recognition, natural selection acts on the "guard-guardee" interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto-immune responses in

  2. Prevalence Survey of Selected Bovine Pathogens in Water Buffaloes in the North Region of Brazil

    Directory of Open Access Journals (Sweden)

    Jenevaldo Barbosa da Silva

    2014-01-01

    Full Text Available Although the largest buffalo herd in the occident is in the north region of Brazil, few studies have been conducted to assess the prevalence of selected parasitic diseases in buffalo herd. The present study was therefore conducted to investigate the epidemiological of Toxoplasma gondii, Neospora caninum, Anaplasma marginale, Babesia bigemina, and Babesia bovis in water buffaloes in the north region of Brazil. A total of 4796 buffalo blood samples were randomly collected from five provinces and simultaneously analyzed by the IFAT and ELISA. The serological prevalence of T. gondii and N. caninum was 41.3% and 55.5% in ELISA and 35.7% and 48.8% in IFAT, respectively. The overall prevalence of A. marginale, B. bovis, and B. bigemina was 63%, 25%, and 21% by ELISA and 50.0%, 22.5%, and 18.8% by IFAT, respectively. This study shows valuable information regarding the serological survey of selected bovine pathogens in water buffaloes in the north region of Brazil which will likely be very beneficial for the management and control programs of this disease.

  3. The plant pathogen Pseudomonas syringae pv. tomato is genetically monomorphic and under strong selection to evade tomato immunity.

    Directory of Open Access Journals (Sweden)

    Rongman Cai

    2011-08-01

    Full Text Available Recently, genome sequencing of many isolates of genetically monomorphic bacterial human pathogens has given new insights into pathogen microevolution and phylogeography. Here, we report a genome-based micro-evolutionary study of a bacterial plant pathogen, Pseudomonas syringae pv. tomato. Only 267 mutations were identified between five sequenced isolates in 3,543,009 nt of analyzed genome sequence, which suggests a recent evolutionary origin of this pathogen. Further analysis with genome-derived markers of 89 world-wide isolates showed that several genotypes exist in North America and in Europe indicating frequent pathogen movement between these world regions. Genome-derived markers and molecular analyses of key pathogen loci important for virulence and motility both suggest ongoing adaptation to the tomato host. A mutational hotspot was found in the type III-secreted effector gene hopM1. These mutations abolish the cell death triggering activity of the full-length protein indicating strong selection for loss of function of this effector, which was previously considered a virulence factor. Two non-synonymous mutations in the flagellin-encoding gene fliC allowed identifying a new microbe associated molecular pattern (MAMP in a region distinct from the known MAMP flg22. Interestingly, the ancestral allele of this MAMP induces a stronger tomato immune response than the derived alleles. The ancestral allele has largely disappeared from today's Pto populations suggesting that flagellin-triggered immunity limits pathogen fitness even in highly virulent pathogens. An additional non-synonymous mutation was identified in flg22 in South American isolates. Therefore, MAMPs are more variable than expected differing even between otherwise almost identical isolates of the same pathogen strain.

  4. Disease Risk Assessments Involving Companion Animals: an Overview for 15 Selected Pathogens Taking a European Perspective.

    Science.gov (United States)

    Rijks, J M; Cito, F; Cunningham, A A; Rantsios, A T; Giovannini, A

    2016-07-01

    Prioritization of companion animal transmissible diseases was performed by the Companion Animals multisectoriaL interprofessionaL Interdisciplinary Strategic Think tank On zoonoses (CALLISTO) project. The project considered diseases occurring in domesticated species commonly kept as pets, such as dogs and cats, but also included diseases occurring in captive wild animals and production animal species. The prioritization process led to the selection of 15 diseases of prime public health relevance, agricultural economic importance, or both. An analysis was made of the current knowledge on the risk of occurrence and transmission of these diseases among companion animals, and from companion animals to man (zoonoses) or to livestock. The literature was scanned for risk assessments for these diseases. Studies were classified as import risk assessments (IRAs) or risk factor analyses (RFAs) in endemic areas. For those pathogens that are absent from Europe, only IRAs were considered; for pathogens present throughout Europe, only RFAs were considered. IRAs were identified for seven of the eight diseases totally or partially absent from Europe. IRAs for classical rabies and alveolar echinococcosis found an increased risk for introduction of the pathogen into officially disease-free areas as a consequence of abandoning national rules and adopting the harmonized EU rules for pet travel. IRAs for leishmaniosis focused on risk associated with the presence of persistently infected dogs in new geographical areas, taking into consideration the risk of disease establishment should a competent vector arise. IRAs for Crimean-Congo haemorrhagic fever and West Nile fever indicated that the likelihood of introduction via companion animals was low. IRAs for bluetongue paid no attention to the risk of introduction via companion animals, which was also the case for IRAs for foot-and-mouth disease, the only disease considered to be absent from Europe. RFAs dealing with the risk factors for

  5. Selection of media for antimicrobial susceptibility testing of fish pathogenic bacteria

    DEFF Research Database (Denmark)

    Dalsgaard, Inger

    2001-01-01

    3, Diagnostic Sensitivity Test Agar) have been used in addition to media (Brain Heart Infusion Agar, Heart Infusion Agar, Columbia Blood Agar) normally utilized for cultivating fastidious bacteria. When testing marine pathogens, sodium chloride or seawater has been included in the media. Media...... pattern in fish pathogenic bacteria. The American guideline from The National Committee for Clinical Laboratory Standards (NCCLS) recommends Mueller-Hinton Agar for susceptibility testing of human pathogens and this validated medium appears to be adequate for the rapidly growing fish pathogens. Following......The available data concerning antimicrobial susceptibility testing of fish pathogens showed that there is no consensus to the basal medium currently being employed. Different media recommended for susceptibility testing of human pathogens (Mueller-Hinton Agar, Tryptone Soya Agar, Antibiotic Medium...

  6. High Yield of Pathogenic Germline Mutations Causative or Likely Causative of the Cancer Phenotype in Selected Children with Cancer

    NARCIS (Netherlands)

    Diets, Illja J.; Waanders, Esme; Ligtenberg, Marjolijn J.; van Bladel, Diede A. G.; Kamping, Eveline J.; Hoogerbrugge, Peter M.; Hopman, Saskia; Olderode-Berends, Maran J.; Gerkes, Erica H.; Koolen, David A.; Marcelis, Carlo; Santen, Gijs W.; van Belzen, Martine J.; Mordaunt, Dylan; McGregor, Lesley; Thompson, Elizabeth; Kattamis, Antonis; Pastorczak, Agata; Mlynarski, Wojciech; Ilencikova, Denisa; Vulto-van Silfhout, Anneke; Gardeitchik, Thatjana; de Bont, Eveline S.; Loeffen, Jan; Wagner, Anja; Mensenkamp, Arjen R.; Kuiper, Roland P.; Hoogerbrugge, Nicoline; Jongmans, Marjolijn C.

    2018-01-01

    Purpose: In many children with cancer and characteristics suggestive of a genetic predisposition syndrome, the genetic cause is still unknown. We studied the yield of pathogenic mutations by applying whole-exome sequencing on a selected cohort of children with cancer. Experimental Design: To

  7. High Yield of Pathogenic Germline Mutations Causative or Likely Causative of the Cancer Phenotype in Selected Children with Cancer

    NARCIS (Netherlands)

    Diets, I.J.; Waanders, E.; Ligtenberg, M.J.L.; Bladel, D.A.G. van; Kamping, E.J.; Hoogerbrugge, P.M.; Hopman, S.; Olderode-Berends, M.J.; Gerkes, E.H.; Koolen, D.A.; Marcelis, C.L.; Santen, G.W.E.; Belzen, M.J. van; Mordaunt, D.; McGregor, L.; Thompson, E.; Kattamis, A.; Pastorczak, A.; Mlynarski, W.; Ilencikova, D.; Vulto-van Silfhout, A.T.; Gardeitchik, T.; Bont, E.S. de; Loeffen, J.; Wagner, A.; Mensenkamp, A.R.; Kuiper, R.P.; Hoogerbrugge, N.; Jongmans, M.C.

    2018-01-01

    Purpose: In many children with cancer and characteristics suggestive of a genetic predisposition syndrome, the genetic cause is still unknown. We studied the yield of pathogenic mutations by applying whole-exome sequencing on a selected cohort of children with cancer.Experimental Design: To identify

  8. A field survey on parasites and antibodies against selected pathogens in owned dogs in Lilongwe, Malawi

    Directory of Open Access Journals (Sweden)

    Karin Alvåsen

    2016-07-01

    Full Text Available The aim of this study was to screen for selected parasites and antibody levels against vectorborne pathogens in owned dogs in Lilongwe, Malawi. The study population consisted of 100 dogs; 80 participating in vaccination–spaying campaigns and 20 visiting a veterinary clinic as paying clients. All dogs went through a general physical examination including visual examination for signs of ectoparasites. A total of 100 blood samples were analysed using commercial snap tests and 40 faecal samples by egg flotation in saturated sodium chloride. The sampled dogs had a seroprevalence of 12% for Anaplasma spp., 22% for Ehrlichia spp., 4% for Dirofilaria immitis and 1% for Leishmania spp. Eggs from Ancylostoma spp. were found in 80% of the faecal samples, whereas eggs of Trichuris vulpis, Toxocara canis and Toxascaris leonina were only present in 3%, 8% and 13% of the samples, respectively. Ectoparasites such as Ctenocephalides sp., Trichodectes sp. and ticks were present on 98%, 25% and 11%, respectively, of the campaign dogs. Among client dogs, 35% had Ctenocephalides fleas, 10% had Trichodectes lice and none had ticks. Public education and prophylactic treatment could be used to improve the animal welfare of dogs; this would most likely also have positive impact on public health.

  9. Serologic survey for selected arboviruses and other potential pathogens in wildlife from Mexico.

    Science.gov (United States)

    Aguirre, A A; McLean, R G; Cook, R S; Quan, T J

    1992-07-01

    During 1988 and 1989, a serologic survey of wildlife was conducted in northeastern Mexico to determine the presence, prevalence, and distribution of arboviruses and other selected disease agents. Eighty mammal specimens were tested. Antibodies to vesicular stomatitis-Indiana, Venezuelan equine encephalitis-Mena II, Rio Grande virus, and vesicular stomatitis-New Jersey were detected predominantly in small mammals. Deer and mouflon (Ovis musimon) had antibodies to bluetongue and epizootic hemorrhagic disease. Two species had serologic evidence of recent exposure to Francisella tularensis. A white-tailed deer (Odocoileus virginianus) had antibodies to Anaplasma marginale. All specimens tested for antibodies against Yersinia pestis and Brucella abortus were negative. Sera from 315 birds were tested for antibody against five equine encephalitis viruses and six avian pathogens. During 1988, antibodies to Venezuelan equine encephalitis-Mena II, Venezuelan equine encephalitis-TC83, St. Louis encephalitis, eastern equine encephalitis, and western equine encephalitis were detected in birds of several species. Antibodies to Pasteurella multocida and Newcastle disease virus were also detected. Birds from five species presented antibodies to Mycoplasma meleagridis. Specimens tested for M. gallisepticum, M. synoviae, and Chlamydia psittaci were negative. To the best of our knowledge, this survey represents the first serologic evidence of bluetongue, Cache Valley virus, epizootic hemorrhagic disease, Jamestown Canyon virus, vesicular stomatitis-Indiana, vesicular stomatitis-New Jersey, Rio Grande virus, and tularemia reported among wildlife in Mexico.

  10. Selected medicinal plants used in herbal industries; their toxicity against pathogenic microorganisms

    International Nuclear Information System (INIS)

    Fazal, H.; Ahmad, M.; Abbasi, B.H.

    2012-01-01

    Multi-drug resistant strains of fungi and bacteria are imposing the need for new drugs. Reliable natural sources with minor side effects are needed to control anti-human pathogenic invaders specially bacteria. Given the demands for natural products that are inherently safe and environmentally compatible, the advancement in antimicrobial potential has provided a better alternative to synthetic resistance antibiotics. In the present investigation such types of medicinal plants were selected for analyses that are used by local herbal practioners for multiple diseases. Thirty three extracts of Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina and Vetiveria zizanioides in chloroform, ethanol and hexane were investigated for their antimicrobial potential. These extracts were tested against eight microorganisms including four gram negative bacterial strains viz., Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae and Salmonella typhi, three gram positive bacterial strains Staphylococcus aureus, Bacillus subtilis and Bacillus cereus and a fungal strain viz., Candida albicans. Majority of the extracts showed marked antimicrobial potential against the tested microorganisms. (author)

  11. A transversal study on antibodies against selected pathogens in dromedary camels in the Canary Islands, Spain.

    Science.gov (United States)

    Mentaberre, Gregorio; Gutiérrez, Carlos; Rodríguez, Noé F; Joseph, Sunitha; González-Barrio, David; Cabezón, Oscar; de la Fuente, José; Gortazar, Christian; Boadella, Mariana

    2013-12-27

    The Canary Islands contain the most important dromedary camel (Camelus dromedarius) population in the European Union and are the main export point of dromedaries to continental Europe and Latin America. We investigated the presence of antibodies against relevant disease agents in 100 Canarian camel sera. Selected blood samples of the same animals were also tested by PCR. Sera were tested for antibodies against Bluetongue virus (BTV; 0%), Bovine Viral Diarrhoea virus (BVDV; 0%), Camelpox virus (CPV; 8% by serum neutralization, 16% by ELISA), Peste des Petits Ruminants virus (PPRV, 0%), Rift Valley Fever virus (RVFV; 0%) and West Nile Fever virus (WNV; 3%), the bacterial pathogens Anaplasma sp. (3%), Brucella sp. (1%), Coxiella burnetii (19%), Mycobacterium avium paratuberculosis (MAP; 22%), Mycobacterium tuberculosis complex (MTC; 10%) and Rickettsia sp. (83%), and the parasites Toxoplasma gondii (36%) and Neospora caninum (86%). The most remarkable findings were the detection of antibodies against CPV and the high antibody prevalence against C. burnetii, Rickettsia sp., T. gondii and N. caninum. By PCR, we found no C. burnetii, N. caninum and Anaplasma sp. DNA in the tested samples. However, Rickettsia sp. DNA was detected in six antibody positive tested samples. These results should be taken into consideration in order to implement adequate control measures and avoid a potential dissemination of infections to other territories. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. The absorbed dose to blood from blood-borne activity

    International Nuclear Information System (INIS)

    Hänscheid, H; Fernández, M; Lassmann, M

    2015-01-01

    The radiation absorbed dose to blood and organs from activity in the blood is relevant for nuclear medicine dosimetry and for research in biodosimetry. The present study provides coefficients for the average absorbed dose rates to the blood from blood-borne activity for radionuclides frequently used in targeted radiotherapy and in PET diagnostics. The results were deduced from published data for vessel radius-dependent dose rate coefficients and reasonable assumptions on the blood-volume distribution as a function of the vessel radius. Different parts of the circulatory system were analyzed separately. Vessel size information for heart chambers, aorta, vena cava, pulmonary artery, and capillaries was taken from published results of morphometric measurements. The remaining blood not contained in the mentioned vessels was assumed to reside in fractal-like vascular trees, the smallest branches of which are the arterioles or venules. The applied vessel size distribution is consistent with recommendations of the ICRP on the blood-volume distribution in the human. The resulting average absorbed dose rates to the blood per nuclear disintegration per milliliter (ml) of blood are (in 10 −11  Gy·s −1 ·Bq −1 ·ml) Y-90: 5.58, I-131: 2.49, Lu-177: 1.72, Sm-153: 2.97, Tc-99m: 0.366, C-11: 4.56, F-18: 3.61, Ga-68: 5.94, I-124: 2.55. Photon radiation contributes 1.1–1.2·10 −11  Gy·s −1 ·Bq −1 ·ml to the total dose rate for positron emitters but significantly less for the other nuclides. Blood self-absorption of the energy emitted by ß-particles in the whole blood ranges from 37% for Y-90 to 80% for Tc-99m. The correspondent values in vascular trees, which are important for the absorbed dose to organs, range from 30% for Y-90 to 82% for Tc-99m. (paper)

  13. INFLUENCE OF INCUBATION TIME, GAMMA RAYS AND ELECTRON BEAM ON RADIATION RESISTANCE OF SOME SELECTED PATHOGENS

    International Nuclear Information System (INIS)

    EL-HIFNAWI, H.N.; EL-TABLAWY, S.Y.

    2009-01-01

    The effect of different growth phases on the radiation resistance, antibiotic susceptibility and pathogenicity of certain selected pathogens (Escherichia coli, Candida albicans and Staphylococcus aureus) was studied in mice. The obtained results showed that Escherichia coli was slightly more resistant to gamma radiation in 18 h than 24 h or 48 h but it was relatively more resistant to electron beam in 24 h and 48 h than 18 h. Candida albicans showed radiation resistance nearly the same in all incubation times in the case of gamma radiation while for electron beam, its radiation resistance was slightly more in 24 h and 48 h than in 18 h. On the other hand, Staphylococcus aureus recorded much more resistance to gamma radiation in the 48 h than in 24 h or 18 h whereas in the case of electron beam, it was slightly more resistant in 18 h than in 24 h and 48 h.The antibiotic susceptibility of Escherichia coli reported that the exposure to gamma radiation at 3 kGy and electron beam at 6 kGy increase the susceptibility to the nalidixic acid and nitrofurantoin. When Candida albicans was exposed to 3 kGy gamma radiation and 6 kGy electron beam, the same sensitivity to nystatin was observed in comparison with the unexposed one while the sensitivity of Staphylococcus aureus to some antibiotics (amoxicillin, nitrofurantoin and tetracycline) was decreased after exposure to gamma radiation at 0.75 and 2 kGy and electron beam at 6 kGy, but for other antibiotics (trimethoprim/ sulfamethoxazole), the sensitivity was increased at 6 kGy electron beam.The lethality percent recorded after the oral ingestion of the mice with the unexposed Escherichia coli and Candida albicans were 25% and 100%, respectively, and for 6 kGy exposure to electron beam was 0% . The cotaneous disease and abscesses caused by the intradermal injection of the mice with unexposed Staphylococcus aureus was 75% and for 6 kGy exposure to electron beam was 25%.

  14. Comparative Genomics of Smut Pathogens: Insights From Orphans and Positively Selected Genes Into Host Specialization

    NARCIS (Netherlands)

    Benevenuto, J.; Texeira-Silva, N.S.; Kuramae, E.E.; Croll, D.; Vitorello, C.B.M.

    2018-01-01

    Host specialization is a key evolutionary process for the diversification and emergence of new pathogens. However, the molecular determinants of host range are poorly understood. Smut fungi are biotrophic pathogens that have distinct and narrow host ranges based on largely unknown genetic

  15. Microbial antagonism as a potential solution for controlling selected root pathogens of crops

    Science.gov (United States)

    Cooper, Sarah; Agnew, Linda; Pereg, Lily

    2016-04-01

    Root pathogens of crops can cause large reduction in yield, however, there is a limited range of effective methods to control such pathogens. Soilborne pathogens that infect roots often need to survive in the rhizosphere, where there is high competition from other organisms. In such hot spots of microbial activity and growth, supported by root exudates, microbes have evolved antagonistic mechanisms that give them competitive advantages in winning the limited resources. Among these mechanisms is antibiosis, with production of some significant antifungal compounds including, antibiotics, volatile organic compounds, hydrogen cyanide and lytic enzymes. Some of these mechanisms may suppress disease through controlling the growth of root pathogens. In this project we isolated various fungi and bacteria that suppress the growth of cotton pathogens in vitro. The pathogen-suppressive microbes were isolated from cotton production soils that are under different management strategies, with and without the use of organic amendments. The potential of pathogen-suppressing microbes for controlling the black root rot disease, caused by the soilborne pathogen Thielaviopsis basicola, was confirmed using soil assays. We identified isolates with potential use as inoculant for cotton production in Australia. Having isolated a diverse group of antagonistic microbes enhances the probability that some would survive well in the soil and provide an alternative approach to address the problem of root disease affecting agricultural crops.

  16. Potent and selective inhibition of pathogenic viruses by engineered ubiquitin variants.

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    2017-05-01

    Full Text Available The recent Middle East respiratory syndrome coronavirus (MERS-CoV, Ebola and Zika virus outbreaks exemplify the continued threat of (re-emerging viruses to human health, and our inability to rapidly develop effective therapeutic countermeasures. Many viruses, including MERS-CoV and the Crimean-Congo hemorrhagic fever virus (CCHFV encode deubiquitinating (DUB enzymes that are critical for viral replication and pathogenicity. They bind and remove ubiquitin (Ub and interferon stimulated gene 15 (ISG15 from cellular proteins to suppress host antiviral innate immune responses. A variety of viral DUBs (vDUBs, including the MERS-CoV papain-like protease, are responsible for cleaving the viral replicase polyproteins during replication, and are thereby critical components of the viral replication cycle. Together, this makes vDUBs highly attractive antiviral drug targets. However, structural similarity between the catalytic cores of vDUBs and human DUBs complicates the development of selective small molecule vDUB inhibitors. We have thus developed an alternative strategy to target the vDUB activity through a rational protein design approach. Here, we report the use of phage-displayed ubiquitin variant (UbV libraries to rapidly identify potent and highly selective protein-based inhibitors targeting the DUB domains of MERS-CoV and CCHFV. UbVs bound the vDUBs with high affinity and specificity to inhibit deubiquitination, deISGylation and in the case of MERS-CoV also viral replicative polyprotein processing. Co-crystallization studies further revealed critical molecular interactions between UbVs and MERS-CoV or CCHFV vDUBs, accounting for the observed binding specificity and high affinity. Finally, expression of UbVs during MERS-CoV infection reduced infectious progeny titers by more than four orders of magnitude, demonstrating the remarkable potency of UbVs as antiviral agents. Our results thereby establish a strategy to produce protein-based inhibitors

  17. The antimicrobial spectra of selected Penicillia against some pathogenic bacteria and yeasts

    Directory of Open Access Journals (Sweden)

    Shashi Chauhan

    2014-08-01

    Full Text Available The antagonista activity of eight isolaies of penicillia bas been studied against 13 pathogenic organisms, which included 6 Gram-positive bacteria, 4 Gram-negative bacteria and 3 yeasts.

  18. Selection of media for antimicrobial susceptibility testing of fish pathogenic bacteria

    DEFF Research Database (Denmark)

    Dalsgaard, Inger

    2001-01-01

    The available data concerning antimicrobial susceptibility testing of fish pathogens showed that there is no consensus to the basal medium currently being employed. Different media recommended for susceptibility testing of human pathogens (Mueller-Hinton Agar, Tryptone Soya Agar, Antibiotic Medium...... 3, Diagnostic Sensitivity Test Agar) have been used in addition to media (Brain Heart Infusion Agar, Heart Infusion Agar, Columbia Blood Agar) normally utilized for cultivating fastidious bacteria. When testing marine pathogens, sodium chloride or seawater has been included in the media. Media...... normally used for cultivation of pathogens with specific growth requirements like Flavobacterium species and Renibacterium salmoninarum have been used for susceptibility testing. The Mueller-Hinton Agar and different modifications of this medium was used most frequently in published studies on resistant...

  19. Selective Photonic Disinfection; A ray of hope in the war against pathogens

    Science.gov (United States)

    Tsen, Shaw-Wei D.; Tsen, Kong-Thon

    2016-06-01

    Pathogens such as viruses and bacteria are among the greatest threats to human health worldwide. In today's era of population growth and international travel, new technologies are desperately needed to combat the spread of known and emerging pathogens. This book presents a new concept for pathogen inactivation called selective photonic disinfection (SEPHODIS). The SEPHODIS technology inactivates pathogens by mechanical means, a total paradigm shift from traditional chemical and physical methods. The unique strength of SEPHODIS resides in its capability to inactivate pathogens while preserving desirable materials such as human cells and proteins. The technology also avoids the need to use chemicals, drastically reducing the risk of side effects. These properties make SEPHODIS ideal for important biomedical applications such as safeguarding blood products and therapeutics against pathogens, as well as producing effective and safe vaccines to combat infectious disease. Written in a style that is both technically informative and easy to comprehend for the layman reader, this book illustrates the story of SEPHODIS from its initial discovery and bench studies to its real-world applications. 1 citation publication-type="journal"> Epstein J S Vostal J G 2003 FDA approach to evaluation of pathogen reduction technology Transfusion 43 1347 1349 1347-9 10.1046/j.1537-2995.2003.00584.x citation> 2 citation publication-type="journal"> Salunkhe V van der Meer P F de Korte D Seghatchian J Gutierrez L 2015 Development of blood transfusion product pathogen reduction treatments: a review of methods, current applications and demands Transfus. Apher. Sci. 52 19 34 19-34 10.1016/j.transci.2014.12.016 citation> 3 citation publication-type="book"> Sanders B Koldijk M Schuitemaker H 2015 Inactivated viral vaccines Vaccine Analysis: Strategies, Principles, and Control Nunnally B K Turula V E Sitrin RD R D Berlin Springer pp 45 80 45-80 citation> 4 citation publication

  20. Antibacterial activity of essential oils extracted from Satureja hortensis against selected clinical pathogens

    Science.gov (United States)

    Görmez, Arzu; Yanmiş, Derya; Bozari, Sedat; Gürkök, Sumeyra

    2017-04-01

    The antibiotic resistance of pathogenic microorganisms has become a worldwide concern to public health. To overcome the current resistance problem, new antimicrobial agents are extremely needed. The aim of the present study was to evaluate the antibacterial activity of Satureja hortensis essential oils against seven clinical pathogens. Chemical compositions of hydro distillated essential oils from S. hortensis were analyzed by GS-MS. The antibacterial activity was investigated against Corynebacterium diphtheria, Salmonella typhimurium, Serratia plymuthica Yersinia enterocolitica, Y. frederiksenii, Y. pseudotuberculosis and Vibrio cholerae by the use of disc diffusion method and broth micro dilution method. The minimum inhibitory concentration (MIC) values of essential oils were found as low as 7.81 µg/mL. Notably, essential oils of S. hortensis exhibited remarkable antimicrobial activities against the tested clinical pathogens. The results indicate that these essential oils can be used in treatment of different infectious diseases.

  1. Serosurvey for selected pathogens in free-ranging American black bears (Ursus americanus) in Maryland, USA.

    Science.gov (United States)

    Bronson, Ellen; Spiker, Harry; Driscoll, Cindy P

    2014-10-01

    American black bears (Ursus americanus) in Maryland, USA, live in forested areas in close proximity to humans and their domestic pets. From 1999 to 2011, we collected 84 serum samples from 63 black bears (18 males; 45 females) in five Maryland counties and tested them for exposure to infectious, including zoonotic, pathogens. A large portion of the bears had antibody to canine distemper virus and Toxoplasma gondii, many at high titers. Prevalences of antibodies to zoonotic agents such as rabies virus and to infectious agents of carnivores including canine adenovirus and canine parvovirus were lower. Bears also had antibodies to vector-borne pathogens common to bears and humans such as West Nile virus, Borrelia burgdorferi, Rickettsia rickettsii, and Anaplasma phagocytophilum. Antibodies were detected to Leptospira interrogans serovars Pomona, Icterohaemorrhagiae, Canicola, Grippotyphosa, and Bratislava. We did not detect antibodies to Brucella canis or Ehrlichia canis. Although this population of Maryland black bears demonstrated exposure to multiple pathogens of concern for humans and domesticated animals, the low levels of clinical disease in this and other free-ranging black bear populations indicate the black bear is likely a spillover host for the majority of pathogens studied. Nevertheless, bear populations living at the human-domestic-wildlife interface with increasing human and domestic animal exposure should continue to be monitored because this population likely serves as a useful sentinel of ecosystem health.

  2. Simultaneous Identification of Potential Pathogenicity Factors of Mycoplasma agalactiae in the Natural Ovine Host by Negative Selection.

    Science.gov (United States)

    Hegde, Shivanand; Hegde, Shrilakshmi; Zimmermann, Martina; Flöck, Martina; Spergser, Joachim; Rosengarten, Renate; Chopra-Dewasthaly, Rohini

    2015-07-01

    Mycoplasmas possess complex pathogenicity determinants that are largely unknown at the molecular level. Mycoplasma agalactiae serves as a useful model to study the molecular basis of mycoplasma pathogenicity. The generation and in vivo screening of a transposon mutant library of M. agalactiae were employed to unravel its host colonization factors. Tn4001mod mutants were sequenced using a novel sequencing method, and functionally heterogeneous pools containing 15 to 19 selected mutants were screened simultaneously through two successive cycles of sheep intramammary infections. A PCR-based negative selection method was employed to identify mutants that failed to colonize the udders and draining lymph nodes in the animals. A total of 14 different mutants found to be absent from ≥ 95% of samples were identified and subsequently verified via a second round of stringent confirmatory screening where 100% absence was considered attenuation. Using this criterion, seven mutants with insertions in genes MAG1050, MAG2540, MAG3390, uhpT, eutD, adhT, and MAG4460 were not recovered from any of the infected animals. Among the attenuated mutants, many contain disruptions in hypothetical genes, implying their previously unknown role in M. agalactiae pathogenicity. These data indicate the putative role of functionally different genes, including hypothetical ones, in the pathogenesis of M. agalactiae. Defining the precise functions of the identified genes is anticipated to increase our understanding of M. agalactiae infections and to develop successful intervention strategies against it. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Impact of selected antagonistic fungi on Fusarium species – toxigenic cereal pathogens

    Directory of Open Access Journals (Sweden)

    Delfina Popiel

    2013-12-01

    Full Text Available Fusarium-ear blight is a destructive disease in various cereal-growing regions and leads to significant yield and quality losses for farmers and to contamination of cereal grains with mycotoxins, mainly deoxynivalenol and derivatives, zearalenone and moniliformin. Fusarium pathogens grow well and produce significant inoculum on crop resiudues. Reduction of mycotoxins production and pathogen sporulation may be influenced by saprophytic fungi, exhibiting antagonistic effect. Dual culture bioassays were used to examine the impact of 92 isolates (belonging to 29 fungal species against three toxigenic species, i.e. Fusarium avenaceum (Corda Saccardo, F. culmorum (W.G.Smith Saccardo and F. graminearum Schwabe. Both F.culmorum and F. graminearum isolates produce trichothecene mycotoxins and mycohormone zearalenone and are considered to be the most important cereal pathogens worldwide. Infection with those pathogens leads to accumulation of mycotoxins: deoxynivalenol (DON and zearalenone (ZEA in grains. Fusarium avenaceum isolates are producers of moniliformin (MON and enniatins. Isolates of Trichoderma sp. were found to be the most effective ones to control the growth of examined Fusarium species. The response of Fusarium isolates to antagonistic activity of Trichoderma isolates varied and also the isolates of Trichoderma differed in their antagonistic activity against Fusarium isolates. The production of MON by two isolates of F. avenaceum in dual culture on rice was reduced by 95% to 100% by T. atroviride isolate AN 35. The same antagonist reduced the amount of moniliformin from 100 μg/g to 6.5 μg/g when inoculated to rice culture contaminated with MON, which suggests the possible decomposition of this mycotoxin.

  4. Selection of aggressive pathogenic and solopathogenic strains of Ustilago maydis to improve Huitlacoche production

    Directory of Open Access Journals (Sweden)

    Porfirio Raúl Galicia-García

    Full Text Available ABSTRACT Ustilago maydis is a basidiomycete known as the causative agent of 'common smut', worldwide disease of maize that is recognized by the galls it forms, which have considerable potential as a gourmet food. Results of infection are quite variable, even under optimal greenhouse conditions. In order to find pathogenic strains able to be used as a highly infective and stable inoculum for the successful production of galls either in greenhouses or in the field, ears with gall symptoms containing teliospores were recovered from maize plants. The teliospores were suspended in water and plated on nutrient-rich medium. Twenty-six colonies developed, containing three types of yeast-like colonies: saprotrophic, pathogenic, and solopathogenic. DAPI staining confirmed the presence of solopathogenic strains with diploid sporidia. Groups of different mating types were found when pairs of the 26 strains were arranged resembling partial-diallel combinations. Amplification of the partial b locus revealed that the strains found harbor the alleles b3 and b4, allowing the formation in dikaryotic strains of heterodimeric regulatory proteins associated with fungal development and pathogenicity. In this study, we isolated compatible haploid and solopathogenic diploid strains for their high capacity for inducing smut.

  5. Pathogenic waterborne free-living amoebae: An update from selected Southeast Asian countries

    Science.gov (United States)

    Abdul Majid, Mohamad Azlan; Mahboob, Tooba; Mong, Brandon G. J.; Jaturas, Narong; Richard, Reena Leeba; Tian-Chye, Tan; Phimphila, Anusorn; Mahaphonh, Panomphanh; Aye, Kyaw Nyein; Aung, Wai Lynn; Chuah, Joon; Ziegler, Alan D.; Yasiri, Atipat; Sawangjaroen, Nongyao; Lim, Yvonne A. L.; Nissapatorn, Veeranoot

    2017-01-01

    Data on the distribution of free-living amoebae is still lacking especially in Southeast Asian region. The aquatic environment revealed a high occurrence of free-living amoebae (FLA) due to its suitable condition and availability of food source, which subsequently causes infection to humans. A total of 94 water samples consisted of both treated and untreated from Laos (31), Myanmar (42), and Singapore (21) were investigated for the presence of pathogenic FLA. Each water sample was filtered and cultured onto non-nutrient agar seeded with live suspension of Escherichia coli and incubated at room temperature. Morphological identification was conducted for both trophozoites and cysts via microscopic stains (Giemsa and immunofluorescence). The presence of Naegleria-like structures was the most frequently encountered in both treated and untreated water samples, followed by Acanthamoeba-like and Vermamoeba-like features. To identify the pathogenic isolates, species-specific primer sets were applied for molecular identification of Acanthamoeba, Naegleria, and Vermamoeba. The pathogenic species of Acanthamoeba lenticulata and A. triangularis were detected from untreated water samples, while Vermamoeba vermiformis was found in both treated and untreated water samples. Our results suggested that poor water quality as well as inadequate maintenance and treatment might be the cause of this alarming problem since chlorine disinfection is ineffective in eradicating these amoebas in treated water samples. Regular monitoring and examination of water qualities are necessary in order to control the growth, hence, further preventing the widespread of FLA infections among the public. PMID:28212409

  6. The location of splenic NKT cells favours their rapid activation by blood-borne antigen.

    Science.gov (United States)

    Barral, Patricia; Sánchez-Niño, María Dolores; van Rooijen, Nico; Cerundolo, Vincenzo; Batista, Facundo D

    2012-05-16

    Natural killer T (NKT) cells play an important role in mounting protective responses to blood-borne infections. However, though the spleen is the largest blood filter in the body, the distribution and dynamics of NKT cells within this organ are not well characterized. Here we show that the majority of NKT cells patrol around the marginal zone (MZ) and red pulp (RP) of the spleen. In response to lipid antigen, these NKT cells become arrested and rapidly produce cytokines, while the small proportion of NKT cells located in the white pulp (WP) exhibit limited activation. Importantly, disruption of the splenic MZ by chemical or genetic approaches results in a severe reduction in NKT cell activation indicating the need of cooperation between both MZ macrophages and dendritic cells for efficient NKT cell responses. Thus, the location of splenic NKT cells in the MZ and RP facilitates their access to blood-borne antigen and enables the rapid initiation of protective immune responses.

  7. A multicentre molecular analysis of hepatitis B and blood-borne virus coinfections in Viet Nam.

    Science.gov (United States)

    Dunford, Linda; Carr, Michael J; Dean, Jonathan; Nguyen, Linh Thuy; Ta Thi, Thu Hong; Nguyen, Binh Thanh; Connell, Jeff; Coughlan, Suzie; Nguyen, Hien Tran; Hall, William W; Thi, Lan Anh Nguyen

    2012-01-01

    Hepatitis B (HBV) infection is endemic in Viet Nam, with up to 8.4 million individuals estimated to be chronically infected. We describe results of a large, multicentre seroepidemiological and molecular study of the prevalence of HBV infection and blood-borne viral coinfections in Viet Nam. Individuals with varying risk factors for infection (n = 8654) were recruited from five centres; Ha Noi, Hai Phong, Da Nang, Khanh Hoa and Can Tho. A mean prevalence rate of 10.7% was observed and levels of HBsAg were significantly higher in injecting drug users (IDUs) (17.4%, n = 174/1000) and dialysis patients (14.3%, n = 82/575) than in lower-risk groups (9.4%; pViet Nam and also highlights the significant levels of blood-borne virus coinfections, which have important implications for hepatitis-related morbidity and development of effective management strategies.

  8. Prevalence of foodborne pathogens in food from selected African countries - A meta-analysis.

    Science.gov (United States)

    Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph; Matsheka, Maitshwarelo Ignatius; Sekwati-Monang, Bonno; Amoa-Awua, Wisdom; Atter, Amy; Ackah, Nina Bernice; Mbugua, Samuel; Asagbra, Agnes; Abdelgadir, Warda; Nakavuma, Jesca; Jakobsen, Mogens; Fang, Weihuan

    2017-05-16

    Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews the prevalence of foodborne pathogens in seven African countries (Benin, Botswana, Ghana, Kenya, Nigeria, Sudan and Uganda) from papers in regional or international journals published between January 2000 and December 2015. One hundred and sixteen publications that dealt with food microbiology were reviewed for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78/116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella, Staphylococcus aureus and Listeria monocytogenes were the most frequently reported organisms in those studies. Although the data were highly heterogeneous, a striking feature is high prevalence of the major pathogens in RTE foods, almost as high as in raw foods. E. coli averaged at 37.6% in raw foods and 31.6% in RTE foods. The corresponding prevalence for Salmonella was 19.9% vs 21.7%; S. aureus, 27.8% vs 25.1% and L. monocytogenes, 19.5% vs 6.7%. The average prevalence of foodborne pathogens in these countries was 34.2% (29.0-39.3%). Differences in food types as well as non-uniform protocols for sampling and identification might have contributed to high heterogeneity (I 2 >97%) although some high prevalence data could be factual with extensive varieties of raw and RTE foods

  9. Burden of Disease Attributed to Waterborne Transmission of Selected Enteric Pathogens, Australia, 2010.

    Science.gov (United States)

    Gibney, Katherine B; O'Toole, Joanne; Sinclair, Martha; Leder, Karin

    2017-06-01

    AbstractUniversal access to safe drinking water is a global priority. To estimate the annual disease burden of campylobacteriosis, nontyphoidal salmonellosis, cryptosporidiosis, giardiasis, and norovirus attributable to waterborne transmission in Australia, we multiplied regional World Health Organization (WHO) estimates of the proportion of cases attributable to waterborne transmission by estimates of all-source disease burden for each study pathogen. Norovirus was attributed as causing the most waterborne disease cases (479,632; 95% uncertainty interval [UI]: 0-1,111,874) followed by giardiasis and campylobacteriosis. The estimated waterborne disability-adjusted life year (DALY) burden for campylobacteriosis (2,004; 95% UI: 0-5,831) was 7-fold greater than other study pathogens and exceeded the WHO guidelines for drinking water quality (1 × 10 -6 DALY per person per year) by 90-fold. However, these estimates include disease transmitted via either drinking or recreational water exposure. More precise country-specific and drinking water-specific attribution estimates would better define the health burden from drinking water and inform changes to treatment requirements.

  10. Surveillance for zoonotic and selected pathogens in harbor seals Phoca vitulina from central California

    Science.gov (United States)

    Greig, Denise J.; Ip, Hon S.; Gulland, Frances M. D.; Miller, Woutrina A.; Conrad, Patricia A.; Field, Cara L.; Fleetwood, Michelle; Harvey, James T.; Jang, Spencer; Packham, Andrea; Wheeler, Elizabeth; Hall, Ailsa J.

    2014-01-01

    The infection status of harbor seals Phoca vitulina in central California, USA, was evaluated through broad surveillance for pathogens in stranded and wild-caught animals from 2001 to 2008, with most samples collected in 2007 and 2008. Stranded animals from Mendocino County to San Luis Obispo County were sampled at a rehabilitation facility: The Marine Mammal Center (TMMC, n = 175); wild-caught animals were sampled at 2 locations: San Francisco Bay (SF, n = 78) and Tomales Bay (TB, n = 97), that differed in degree of urbanization. Low prevalences of Salmonella, Campylobacter, Giardia, and Cryptosporidium were detected in the feces of stranded and wild-caught seals. Clostridium perfringens and Escherichia coli were more prevalent in the feces of stranded (58% [78 out of 135] and 76% [102 out of 135]) than wild-caught (42% [45 out of 106] and 66% [68 out of 106]) seals, whereas Vibrio spp. were 16 times more likely to be cultured from the feces of seals from SF than TB or TMMC (p neurona, and type A influenza was only detected in the wild-caught harbor seals (post-weaning age classes), whereas antibody titers to Leptospira spp. were detected in stranded and wild-caught seals. No stranded (n = 109) or wild-caught (n = 217) harbor seals had antibodies to phocine distemper virus, although a single low titer to canine distemper virus was detected. These results highlight the role of harbor seals as sentinel species for zoonotic and terrestrial pathogens in the marine environment.

  11. The occurrence and pathogenicity of Phoma exigua Desm. var. exigua for selected species of herbs

    Directory of Open Access Journals (Sweden)

    Zofia Machowicz-Stefaniak

    2012-12-01

    Full Text Available P. exigua var. exigua was isolated from underground and aboveground organs of different herb plant species in the years 1998-2006. Pathogenicity tests of three randomly chosen isolates of the fungus T 299, T 261 and T 277 for thyme and of three isolates M 1657, M 1193 and M 1635 for lemon balm were carried out. The effect of water suspension of fungus spores on the germination ability of schizocarps and of infected soil on sprouting and seedling health was studied. The study of microscopic structures of the fungus developing on plants, isolation of the fungus on artificial media and macro- and microscopic analysis on standard media are essential for the correct identification of P. exigua var. exigua. The polyphagous nature of the fungus is confirmed by the obtained results. The tested isolates were found to be occasional pathogens of thyme and lemon balm in the studied conditions. The harmfulness of the tested isolates pointed to inhibition of schizocarp germination, sprouting of plants and the ability to cause necrosis of germs, roots and epicotyl.

  12. Blood-Borne Markers of Fatigue in Competitive Athletes - Results from Simulated Training Camps.

    Directory of Open Access Journals (Sweden)

    Anne Hecksteden

    Full Text Available Assessing current fatigue of athletes to fine-tune training prescriptions is a critical task in competitive sports. Blood-borne surrogate markers are widely used despite the scarcity of validation trials with representative subjects and interventions. Moreover, differences between training modes and disciplines (e.g. due to differences in eccentric force production or calorie turnover have rarely been studied within a consistent design. Therefore, we investigated blood-borne fatigue markers during and after discipline-specific simulated training camps. A comprehensive panel of blood-born indicators was measured in 73 competitive athletes (28 cyclists, 22 team sports, 23 strength at 3 time-points: after a run-in resting phase (d 1, after a 6-day induction of fatigue (d 8 and following a subsequent 2-day recovery period (d 11. Venous blood samples were collected between 8 and 10 a.m. Courses of blood-borne indicators are considered as fatigue dependent if a significant deviation from baseline is present at day 8 (Δfatigue which significantly regresses towards baseline until day 11 (Δrecovery. With cycling, a fatigue dependent course was observed for creatine kinase (CK; Δfatigue 54±84 U/l; Δrecovery -60±83 U/l, urea (Δfatigue 11±9 mg/dl; Δrecovery -10±10 mg/dl, free testosterone (Δfatigue -1.3±2.1 pg/ml; Δrecovery 0.8±1.5 pg/ml and insulin linke growth factor 1 (IGF-1; Δfatigue -56±28 ng/ml; Δrecovery 53±29 ng/ml. For urea and IGF-1 95% confidence intervals for days 1 and 11 did not overlap with day 8. With strength and high-intensity interval training, respectively, fatigue-dependent courses and separated 95% confidence intervals were present for CK (strength: Δfatigue 582±649 U/l; Δrecovery -618±419 U/l; HIIT: Δfatigue 863±952 U/l; Δrecovery -741±842 U/l only. These results indicate that, within a comprehensive panel of blood-borne markers, changes in fatigue are most accurately reflected by urea and IGF-1 for cycling

  13. Blood-Borne Markers of Fatigue in Competitive Athletes – Results from Simulated Training Camps

    Science.gov (United States)

    Hecksteden, Anne; Skorski, Sabrina; Schwindling, Sascha; Hammes, Daniel; Pfeiffer, Mark; Kellmann, Michael; Ferrauti, Alexander; Meyer, Tim

    2016-01-01

    Assessing current fatigue of athletes to fine-tune training prescriptions is a critical task in competitive sports. Blood-borne surrogate markers are widely used despite the scarcity of validation trials with representative subjects and interventions. Moreover, differences between training modes and disciplines (e.g. due to differences in eccentric force production or calorie turnover) have rarely been studied within a consistent design. Therefore, we investigated blood-borne fatigue markers during and after discipline-specific simulated training camps. A comprehensive panel of blood-born indicators was measured in 73 competitive athletes (28 cyclists, 22 team sports, 23 strength) at 3 time-points: after a run-in resting phase (d 1), after a 6-day induction of fatigue (d 8) and following a subsequent 2-day recovery period (d 11). Venous blood samples were collected between 8 and 10 a.m. Courses of blood-borne indicators are considered as fatigue dependent if a significant deviation from baseline is present at day 8 (Δfatigue) which significantly regresses towards baseline until day 11 (Δrecovery). With cycling, a fatigue dependent course was observed for creatine kinase (CK; Δfatigue 54±84 U/l; Δrecovery -60±83 U/l), urea (Δfatigue 11±9 mg/dl; Δrecovery -10±10 mg/dl), free testosterone (Δfatigue -1.3±2.1 pg/ml; Δrecovery 0.8±1.5 pg/ml) and insulin linke growth factor 1 (IGF-1; Δfatigue -56±28 ng/ml; Δrecovery 53±29 ng/ml). For urea and IGF-1 95% confidence intervals for days 1 and 11 did not overlap with day 8. With strength and high-intensity interval training, respectively, fatigue-dependent courses and separated 95% confidence intervals were present for CK (strength: Δfatigue 582±649 U/l; Δrecovery -618±419 U/l; HIIT: Δfatigue 863±952 U/l; Δrecovery -741±842 U/l) only. These results indicate that, within a comprehensive panel of blood-borne markers, changes in fatigue are most accurately reflected by urea and IGF-1 for cycling and by CK

  14. Comparison of the in vitro activities of several new fluoroquinolones against respiratory pathogens and their abilities to select fluoroquinolone resistance.

    Science.gov (United States)

    Boswell, F J; Andrews, J M; Jevons, G; Wise, R

    2002-10-01

    In this study the in vitro activities and pharmacodynamic properties of moxifloxacin, levofloxacin, gatifloxacin and gemifloxacin were compared on recently isolated respiratory pathogens and strains of Streptococcus pneumoniae with known mechanisms of fluoroquinolone resistance. In addition, the resistance selection frequencies of moxifloxacin and levofloxacin on three recently isolated respiratory pathogens and four strains of S. pneumoniae with known mechanisms of fluoroquinolone resistance were investigated. The four fluoroquinolones had similar activities against both Moraxella catarrhalis (MIC(90)s 0.015-0.06 mg/L) and Haemophilus influenzae (MIC(90)s 0.008-0.03 mg/L). More marked differences in activity were noted with S. pneumoniae, with MIC(90)s of 0.25, 1, 0.5 and 0.03 mg/L for moxifloxacin, levofloxacin, gatifloxacin and gemifloxacin, respectively. With the S. pneumoniae strains, the four fluoroquinolones exhibited similar concentration-dependent time-kill kinetics. The resistance selection frequencies of levofloxacin were higher than those of moxifloxacin at concentrations equivalent to those at the end of the dosing interval. Therefore moxifloxacin may have less of an impact on the development of resistance than levofloxacin.

  15. Effects of mutation and some environmental factors on the physiology and pathogenicity of selected bacteria

    Science.gov (United States)

    Decicco, B. T.

    1974-01-01

    Studies with mutants of Staphylococcus aureus lacking some virulence factors suggest that the presence of deoxyribonuclease correlates with mouse pathogenicity of S. aureus, while the ability to ferment mannitol or the possession of coagulases are not required for virulence. Autotrophy investigations on mycobacteria demonstrate a complete correlation between the ability to grow with hydrogen and the species of scotochromogenic mycobacterium tested. All tested strains of M. gordonae, a saprophyte, could grow autotrophically while none of the tested strains of M. scrofulaceum, a clinically important species, possessed this ability. A series of heat tolerant mutants of Pseudomonas fluorescences were obtained which can grow at temperatures up to 54 C, in contrast to a maximum growth temperature of 37 C for the wild type.

  16. Antibacterial Effect of Carvacrol and Coconut Oil on Selected Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Božik M.

    2018-03-01

    Full Text Available Essential oils play a prominent role as flavouring agents and fragrances in the food and perfume industries. Carvacrol is a major component of various essential oils, such as oregano and thyme oils, and is responsible for their antimicrobial activity. Lauric acid is a medium-chain fatty acid (MCFA with a high antibacterial potential. Both carvacrol and MCFAs have been used empirically as antimicrobial agents. Here, we tested the inhibitory properties of carvacrol and coconut (Cocos nucifera L. oil containing a high percentage of MCFAs against 5 harmful bacterial pathogens: Escherichia coli, Salmonella Enteritidis, Staphylococcus aureus, Listeria monocytogenes, and Enterococcus cecorum. Gas chromatography (GC-FID analysis of coconut oil showed a high concentration of lauric acid (41%. Microdilution antimicrobial assays showed that the combination of carvacrol and coconut oil had a stronger antibacterial effect against all tested bacteria than both agents separately. We conclude that carvacrol could significantly improve the antibacterial effect of coconut oil.

  17. Prevalence of foodborne pathogens in food from selected African countries – a meta-analysis

    DEFF Research Database (Denmark)

    Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph

    2017-01-01

    for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78....../116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella......Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews...

  18. Effectiveness of sanitizing products on controlling selected pathogen surrogates on retail deli slicers.

    Science.gov (United States)

    Yeater, Michael C; Kirsch, Katie R; Taylor, T Matthew; Mitchell, Jeff; Osburn, Wesley N

    2015-04-01

    The objectives of this study were (i) to assess the efficacy of quaternary ammonium chloride-based wet foam (WF) and dry foam (DF) sanitizer systems (600 ppm) for reducing Listeria innocua (a nonpathogenic surrogate of Listeria monocytogenes) or a 100.0 μg/ml rifampin-resistant Salmonella Typhimurium LT2 (a nonpathogenic surrogate of Salmonella enterica serovar Typhimurium) on niche and transfer point areas of an unwashed retail deli slicer as compared with traditional chlorine (Cl(-)) treatment (200 ppm) and (ii) to compare sanitizer surface contact times (10 and 15 min) for pathogen surrogate control. Turkey frankfurter slurries inoculated with L. innocua or Salmonella Typhimurium were used to inoculate seven high-risk sites on a commercial slicer. After 30 min of bacterial attachment, slicers were dry wiped to remove excess food matter, followed by a randomly assigned sanitizer treatment. Surviving pathogen surrogate cells were enumerated on modified Oxford's agar not containing antimicrobic supplement (L. innocua) or on tryptic soy agar supplemented with 100 μg/ml rifampin (Salmonella Typhimurium LT2). Replicate-specific L. innocua and Salmonella Typhimurium reductions were calculated as log CFU per square centimeter of control minus log CFU per square centimeter of enumerated survivors for each site. For both organisms, all sanitizer treatments differed from each other, with Cl(-) producing the least reduction and WF the greatest reduction. A significant (P < 0.05) site-by-treatment interaction was observed. The results of the study indicate that quaternary ammonium chloride sanitizers (600 ppm) applied by both WF and DF were more effective at reducing L. innocua and Salmonella Typhimurium than a traditional Cl sanitizer (200 ppm) on unwashed slicer surfaces.

  19. Antifungal Activities of Extracts from Selected Lebanese Wild Plants against Plant Pathogenic Fungi

    Directory of Open Access Journals (Sweden)

    Y. Abou-Jawdah

    2004-12-01

    Full Text Available Extracts of nine plant species growing wild in Lebanon were tested for their efficacy against seven plant pathogenic fungi: Botrytis cinerea, Alternaria solani, Penicillium sp., Cladosporium sp., Fusarium oxysporum f. sp. melonis, Rhizoctonia solani and Sphaerotheca cucurbitae. Extracts of three of the plants, Origanum syriacum, Micromeria nervosa and Plumbago maritima, showed the highest levels of in vitro activity against spore germination and mycelial growth of the fungi tested. Inula viscosa showed high activity against spore germination but only moderate activity against mycelial growth. The other five plant species tested Calamintha origanifolia, Micromeria juliana, Ruta sp., Sideritis pullulans and Urginea maritima showed only moderate to low activity against these fungi. Preventive sprays with extracts of O. syriacum, M. nervosa, P. maritima and I. viscosa, applied at concentrations ranging between 4 and 8% to squash and cucumber seedlings, gave efficient protection against gray mold caused by B. cinerea and powdery mildew caused by S. cucurbitae. However, these extracts did not control green mold of citrus fruits caused by Penicillium sp. Thin layer chromatography revealed three inhibitory bands in extracts of O. syriacum, two in I. viscosa and only one in each of the other plants tested: M. nervosa, P. maritima, C. origanifolia and Ruta sp.

  20. New perspective of dendrobium crumenatum orchid for antimicrobial activity against selected pathogenic bacteria

    International Nuclear Information System (INIS)

    Sandrasagaran, U.M.; Murugaiyah, V.

    2014-01-01

    The present study was undertaken to investigate the potential anti-microbial activity from different parts of Dendrobium crumenatum (leaf, stem, root and pseudo-bulb) against 8 pathogenic bacteria. The antimicrobial activities were determined by using disc diffusion assay, microdilution test for determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The methanolic extracts of stem, root and pseudo-bulb displayed antimicrobial activity comparable to that of the standard antibiotics. Stem extract of D. crumenatum had the most potent antimicrobial activity against Staphylococcus aureus, Klebsiella pneumoniae and Enterobacter aerogenes with MIC values of 0.39, 0.195 and 0.195 mg/mL, respectively. Root and stem extracts were found to be active against Streptococcus pneumoniae, Shigella dysentriae and Saccharomyces cerevisiae with MIC values of 0.78 mg/ml compared to 0.00312 mg/mL, 0.025 mg/mL and 0.0125 mg/mL of standard antibiotics of amoxcillin, chloramphenicol and kanamycin. Stem and root extracts yield MBC values in the range of 0.78 mg/mL to 6.25 mg/mL against Staphylococcus aureus, Enterobacter aerogenes, Klebsiella pneumoniae and Saccharomyces cerevisiae. The present study showed that D. crumenatum exhibited potential antimicrobial activity which could be due to the presence of alkaloid and flavonoid compounds and this is a first report on South East Asia region's wild orchid. (author)

  1. Subboiling Moist Heat Favors the Selection of Enteric Pathogen Clostridium difficile PCR Ribotype 078 Spores in Food

    Directory of Open Access Journals (Sweden)

    Alexander Rodriguez-Palacios

    2016-01-01

    Full Text Available Emerging enteric pathogens could have not only more antibiotic resistance or virulence traits; they could also have increased resistance to heat. We quantified the effects of minimum recommended cooking and higher temperatures, individually on a collection of C. difficile isolates and on the survival probability of a mixture of emerging C. difficile strains. While minimum recommended cooking time/temperature combinations (63–71°C allowed concurrently tested strains to survive, higher subboiling temperatures reproducibly favored the selection of newly emerging C. difficile PCR ribotype 078. Survival ratios for “ribotypes 078” :  “other ribotypes” (n=49 : 45 isolates from the mid-2000s increased from 1 : 1 and 0.7 : 1 at 85°C (for 5 and 10 minutes, resp. to 2.3 : 1 and 3 : 1 with heating at 96°C (for 5 and 10 minutes, resp. indicating an interaction effect between the heating temperature and survival of C. difficile genotypes. In multistrain heating experiments, with PCR ribotypes 027 and 078 from 2004 and reference type strain ATCC 9689 banked in the 1970s, multinomial logistic regression (P<0.01 revealed PCR ribotype 078 was the most resistant to increasing lethal heat treatments. Thermal processes (during cooking or disinfection may contribute to the selection of emergent specific virulent strains of C. difficile. Despite growing understanding of the role of cooking on human evolution, little is known about the role of cooking temperatures on the selection and evolution of enteric pathogens, especially spore-forming bacteria.

  2. Somatic mitochondrial DNA mutations in cancer escape purifying selection and high pathogenicity mutations lead to the oncocytic phenotype: pathogenicity analysis of reported somatic mtDNA mutations in tumors

    International Nuclear Information System (INIS)

    Pereira, Luísa; Soares, Pedro; Máximo, Valdemar; Samuels, David C

    2012-01-01

    The presence of somatic mitochondrial DNA (mtDNA) mutations in cancer cells has been interpreted in controversial ways, ranging from random neutral accumulation of mutations, to positive selection for high pathogenicity, or conversely to purifying selection against high pathogenicity variants as occurs at the population level. Here we evaluated the predicted pathogenicity of somatic mtDNA mutations described in cancer and compare these to the distribution of variations observed in the global human population and all possible protein variations that could occur in human mtDNA. We focus on oncocytic tumors, which are clearly associated with mitochondrial dysfunction. The protein variant pathogenicity was predicted using two computational methods, MutPred and SNPs&GO. The pathogenicity score of the somatic mtDNA variants were significantly higher in oncocytic tumors compared to non-oncocytic tumors. Variations in subunits of Complex I of the electron transfer chain were significantly more common in tumors with the oncocytic phenotype, while variations in Complex V subunits were significantly more common in non-oncocytic tumors. Our results show that the somatic mtDNA mutations reported over all tumors are indistinguishable from a random selection from the set of all possible amino acid variations, and have therefore escaped the effects of purifying selection that act strongly at the population level. We show that the pathogenicity of somatic mtDNA mutations is a determining factor for the oncocytic phenotype. The opposite associations of the Complex I and Complex V variants with the oncocytic and non-oncocytic tumors implies that low mitochondrial membrane potential may play an important role in determining the oncocytic phenotype

  3. Molecular marker-assisted selection for resistance to pathogens in tomato

    International Nuclear Information System (INIS)

    Barone, A.; Frusciante, L.

    2007-01-01

    Since the 1980s, the use of molecular markers has been suggested to improve the efficiency of releasing resistant varieties, thus overcoming difficulties met with classical breeding. For tomato, a high-density molecular map is available in which more than 40 resistance genes are localized. Markers linked to these genes can be used to speed up gene transfer and pyramiding. Suitable PCR markers targeting resistance genes were constructed directly on the sequences of resistance genes or on restriction fragment length polymorphisms (RFLPs) tightly linked to them, and used to select resistant genotypes in backcross schemes. In some cases, the BC 5 generation was reached, and genotypes that cumulated two homozygous resistant genes were also obtained. These results supported the feasibility of using marker-assisted selection (MAS) in tomato and reinforcing the potential of this approach for other genes, which is today also driven by the development of new techniques and increasing knowledge about the tomato genome. (author)

  4. Antimicrobial susceptibility survey of pathogens isolated from selected patients in Northern Italy

    Directory of Open Access Journals (Sweden)

    Elisabetta Maioli

    2005-03-01

    Full Text Available The Clinical Microbiology Laboratory of the University of Genoa participated, during the year 2003, in an international antimicrobial surveillance program.The collection of isolates was done according to the site of infection and/or type of patient. Four hundred twenty (420 clinical isolates were analyzed during this year and the frequencies of the different pathogens were investigated. A reference centre carried out susceptibility tests. Oxacillin-resistant Staphylococcus aureus represented 47.6% of all S. aureus isolates from blood stream infections and 33.3% of all S. aureus isolated from skin and soft tissue infections in hospitalised patients.These strains showed resistance to most of the antimicrobial agents evaluated, except vancomycin, teicoplanin, quinupristin/dalfopristin and linezolid which registered 100% of susceptibility. Some isolates from blood stream infections such as E. coli demonstrated resistance to ciprofloxacin (23.3%, levofloxacin (20%, and gatifloxacin (16.6%, and Klebsiella pneumoniae was resistant (18% to all fluoroquinolones tested. Pseudomonas aeruginosa manifested resistance to ciprofloxacin (16.6%, while 27.7% of these strains were resistant both to levofloxacin and gatifloxacin. All the Enterobacter cloacae isolated from blood were susceptible to ciprofloxacin, levofloxacin and gatifloxacin. Haemophilus influenzae and Moraxella catarrhalis collected from community-acquired respiratory tract infections were all inhibited by ciprofloxacin, levofloxacin and gatifloxacin. E. coli isolated from urinary tract infections in hospitalised patients were resistant to ciprofloxacin, levofloxacin and gatifloxacin (2.7%. All Salmonella spp. collected from samples of patients affected by infections of the gastro-intestinal tract were susceptible to all fluoroquinolones. Penicillin resistance in Streptococcus pneumoniae was found in 21.4% of isolates from patients with respiratory tract infections. Fluoroquinolone resistance was

  5. Rearing Water Treatment Induces Microbial Selection Influencing the Microbiota and Pathogen Associated Transcripts of Cod (Gadus morhua Larvae

    Directory of Open Access Journals (Sweden)

    Ragnhild I. Vestrum

    2018-05-01

    Full Text Available We have previously shown that K-selection and microbial stability in the rearing water increases survival and growth of Atlantic cod (Gadus morhua larvae, and that recirculating aquaculture systems (RAS are compatible with this. Here, we have assessed how water treatment influenced the larval microbiota and host responses at the gene expression level. Cod larvae were reared with two different rearing water systems: a RAS and a flow-through system (FTS. The water microbiota was examined using a 16S rDNA PCR/DGGE strategy. RNA extracted from larvae at 8, 13, and 17 days post hatching was used for microbiota and microarray gene expression analysis. Bacterial cDNA was synthesized and used for 16S rRNA amplicon 454 pyrosequencing of larval microbiota. Both water and larval microbiota differed significantly between the systems, and the larval microbiota appeared to become more dissimilar between systems with time. In total 4 phyla were identified for all larvae: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. The most profound difference in larval microbiota was a high abundance of Arcobacter (Epsilonproteobacteria in FTS larvae (34 ± 9% of total reads. Arcobacter includes several species that are known pathogens for humans and animals. Cod larval transcriptome responses were investigated using an oligonucleotide gene expression microarray covering approximately 24,000 genes. Interestingly, FTS larvae transcriptional profiles revealed an overrepresentation of upregulated transcripts associated with responses to pathogens and infections, such as c1ql3-like, pglyrp-2-like and zg16, compared to RAS larvae. In conclusion, distinct water treatment systems induced differences in the larval microbiota. FTS larvae showed up-regulation of transcripts associated with responses to microbial stress. These results are consistent with the hypothesis that RAS promotes K-selection and microbial stability by maintaining a microbial load close to the

  6. Iatrogenic blood-borne viral infections in refugee children from war and transition zones.

    Science.gov (United States)

    Goldwater, Paul N

    2013-06-01

    Pediatric infectious disease clinicians in industrialized countries may encounter iatrogenically transmitted HIV, hepatitis B virus, and hepatitis C virus infections in refugee children from Central Asia, Southeast Asia, and sub-Saharan Africa. The consequences of political collapse and/or civil war-work migration, prostitution, intravenous drug use, defective public health resources, and poor access to good medical care-all contribute to the spread of blood-borne viruses. Inadequate infection control practices by medical establishments can lead to iatrogenic infection of children. Summaries of 4 cases in refugee children in Australia are a salient reminder of this problem.

  7. Selectable genes for transformation of the fungal plant pathogen Glomerella cingulata f. sp. phaseoli (Colletotrichum lindemuthianum).

    Science.gov (United States)

    Rodriguez, R J; Yoder, O C

    1987-01-01

    Glomerella cingulata f. sp. phaseoli (Gcp) was transformed using either of two selectable markers: the amdS + gene of Aspergillus nidulans, which encodes acetamidase and permits growth on acetamide as the sole nitrogen source and the hygBR gene of Escherichia coli which encodes hygromycin B (Hy) phosphotransferase and permits growth in the presence of the antibiotic Hy. The amdS+ gene functioned in Gcp under control of A. nidulans regulatory signals and hygBR was expressed after fusion to a promoter from Cochliobolus heterostrophus, another filamentous ascomycete. Protoplasts to be transformed were generated with the digestive enzyme complex Novozym 234 and then were exposed to plasmid DNA in the presence of 10 mM CaCl2 and polyethylene glycol. Transformation occurred by integration of single or multiple copies of either the amdS+ or hygBR plasmid into the fungal genome. There was no evidence of autonomous plasmid replication. Transformants were mitotically stable on selective and nonselective media. However, transforming DNA in hygBR transformants was observed to occasionally rearrange during nonselective growth, resulting in fewer copies of the plasmid per genome. These transformants were capable of infecting bean (Phaseolus vulgaris), the Gcp host plant, and after recovery from infected tissue were found to have retained both the transforming DNA unrearranged in their genomes and the Hy resistance phenotype. All single-conidial cultures derived from both amdS+ and hygBR transformants had the transplanted phenotype, suggesting that transformants were homokaryons.

  8. In-vitro selection of plants resistant or tolerant to pathogenic fungi

    International Nuclear Information System (INIS)

    Dutrecq, A.J.E.

    1977-01-01

    A technique was developed to test the inhibition of germination of barley seeds by culture filtrates of Helminthosporium sativum P., K and B. Seeds were soaked for 24h in toxin preparations, and then placed for 48h in wet sand. Using a log-probit scale, a quasilinear relationship was found between seed germination and toxin concentration. The toxic effect was markedly affected by the pH of culture filtrates, being maximum at pH 2.0. Control pH 2.0 filtrates of uninoculated medium did not affect the germination of barley seeds under similar condition. Culture filtrates of H. sativum were also tested as inhibitors of multiplication of barley cells in suspensions. The purified toxin helminthosporal isolated from culture filtrates of H. sativum inhibited rhizogenesis in wheat calluses obtained from tissue culture. The techniques described are being used for the selection of cereals tolerant to H. sativum toxin. (author)

  9. Selection of unadapted, pathogenic SHIVs encoding newly transmitted HIV-1 envelope proteins.

    Science.gov (United States)

    Del Prete, Gregory Q; Ailers, Braiden; Moldt, Brian; Keele, Brandon F; Estes, Jacob D; Rodriguez, Anthony; Sampias, Marissa; Oswald, Kelli; Fast, Randy; Trubey, Charles M; Chertova, Elena; Smedley, Jeremy; LaBranche, Celia C; Montefiori, David C; Burton, Dennis R; Shaw, George M; Markowitz, Marty; Piatak, Michael; KewalRamani, Vineet N; Bieniasz, Paul D; Lifson, Jeffrey D; Hatziioannou, Theodora

    2014-09-10

    Infection of macaques with chimeric viruses based on SIVMAC but expressing the HIV-1 envelope (Env) glycoproteins (SHIVs) remains the most powerful model for evaluating prevention and therapeutic strategies against AIDS. Unfortunately, only a few SHIVs are currently available. Furthermore, their generation has required extensive adaptation of the HIV-1 Env sequences in macaques so they may not accurately represent HIV-1 Env proteins circulating in humans, potentially limiting their translational utility. We developed a strategy for generating large numbers of SHIV constructs expressing Env proteins from newly transmitted HIV-1 strains. By inoculating macaques with cocktails of multiple SHIV variants, we selected SHIVs that can replicate and cause AIDS-like disease in immunologically intact rhesus macaques without requiring animal-to-animal passage. One of these SHIVs could be transmitted mucosally. We demonstrate the utility of the SHIVs generated by this method for evaluating neutralizing antibody administration as a protection against mucosal SHIV challenge. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. The location of splenic NKT cells favours their rapid activation by blood-borne antigen

    Science.gov (United States)

    Barral, Patricia; Sánchez-Niño, María Dolores; van Rooijen, Nico; Cerundolo, Vincenzo; Batista, Facundo D

    2012-01-01

    Natural killer T (NKT) cells play an important role in mounting protective responses to blood-borne infections. However, though the spleen is the largest blood filter in the body, the distribution and dynamics of NKT cells within this organ are not well characterized. Here we show that the majority of NKT cells patrol around the marginal zone (MZ) and red pulp (RP) of the spleen. In response to lipid antigen, these NKT cells become arrested and rapidly produce cytokines, while the small proportion of NKT cells located in the white pulp (WP) exhibit limited activation. Importantly, disruption of the splenic MZ by chemical or genetic approaches results in a severe reduction in NKT cell activation indicating the need of cooperation between both MZ macrophages and dendritic cells for efficient NKT cell responses. Thus, the location of splenic NKT cells in the MZ and RP facilitates their access to blood-borne antigen and enables the rapid initiation of protective immune responses. PMID:22505026

  11. Heparin induced alterations in clearance and distribution of blood-borne microparticles following operative trauma.

    Science.gov (United States)

    Saba, T M; Antikatzides, T G

    1979-04-01

    The influence of systemic heparin administration on the vascular clearance and tissue distribution of blood-borne microparticles was evaluated in normal rats and rats after operation (laparotomy plus intestinal manipulation) utilizing an (131)I- colloid which is phagocytized by the reticuloendothelial system (RES). Intravenous heparin administration (100 USP/100g body weight) into normal animals three minutes prior to colloid injection (50 mg/lOOg) induced a significant increase in pulmonary localization of the microparticles as compared to nonheparinized control rats, while hepatic and splenic uptake were decreased. Surgical trauma decreased hepatic RE uptake and increased pulmonary localization of the microparticles when injected systemically at 60 minutes postsurgery. Heparin administration 60 minutes after surgery and three minutes prior to colloid injection, magnified the increased pulmonary localization response with an associated further depression of the RES. The ability of heparin to alter both RE clearance function and lung localization of microparticles was dose dependent and a function of the interval between heparin administration and systemic particulate infusion. Thus, low dose heparin administration was capable of stimulating RE activity while heparin in doses of excess of 50 USP units/lOOg body weight decreased RE function. These findings suggest that the functional state of the hepatic RE system can be greatly affected in a dose-dependent manner by systemic heparin administration which may influence distribution of blood-borne microparticles.

  12. Soil eukaryotic microorganism succession as affected by continuous cropping of peanut--pathogenic and beneficial fungi were selected.

    Directory of Open Access Journals (Sweden)

    Mingna Chen

    Full Text Available Peanut is an important oil crop worldwide and shows considerable adaptability but growth and yield are negatively affected by continuous cropping. Soil micro-organisms are efficient bio-indicators of soil quality and plant health and are critical to the sustainability of soil-based ecosystem function and to successful plant growth. In this study, 18S rRNA gene clone library analyses were employed to study the succession progress of soil eukaryotic micro-organisms under continuous peanut cultivation. Eight libraries were constructed for peanut over three continuous cropping cycles and its representative growth stages. Cluster analyses indicated that soil micro-eukaryotic assemblages obtained from the same peanut cropping cycle were similar, regardless of growth period. Six eukaryotic groups were found and fungi predominated in all libraries. The fungal populations showed significant dynamic change and overall diversity increased over time under continuous peanut cropping. The abundance and/or diversity of clones affiliated with Eurotiales, Hypocreales, Glomerales, Orbiliales, Mucorales and Tremellales showed an increasing trend with continuous cropping but clones affiliated with Agaricales, Cantharellales, Pezizales and Pyxidiophorales decreased in abundance and/or diversity over time. The current data, along with data from previous studies, demonstrated that the soil microbial community was affected by continuous cropping, in particular, the pathogenic and beneficial fungi that were positively selected over time, which is commonplace in agro-ecosystems. The trend towards an increase in fungal pathogens and simplification of the beneficial fungal community could be important factors contributing to the decline in peanut growth and yield over many years of continuous cropping.

  13. Survey of selected pathogens and blood parameters of northern yellowstone elk: Wolf sanitation effect implications

    Science.gov (United States)

    Barber-Meyer, S. M.; White, P.J.; Mech, L.D.

    2007-01-01

    The restoration or conservation of predators could reduce seroprevalences of certain diseases in prey if predation selectively removes animals exhibiting clinical signs. We assessed disease seroprevalences and blood parameters of 115 adult female elk (Cervus elaphus) wintering on the northern range of Yellowstone National Park [YNP] during 2000-2005 and compared them to data collected prior to wolf (Canis lupus) restoration (WR) in 1995 and to two other herds in Montana to assess this prediction. Blood parameters were generally within two standard deviations of the means observed in other Montana herds (Gravelly-Snowcrest [GS] and Garnet Mountain [GM]), but Yellowstone elk had higher seroprevalences of parainfluenza-3 virus (95% CI YNP = 61.1-78.6, GS = 30.3-46.5) and bovine-virus-diarrhea virus type 1 (95% CI YNP = 15.9-31.9, GM = 0). In comparisons between pre-wolf restoration [pre-WR] (i.e., prior to 1995) seroprevalences with those post-wolf restoration [post-WR] in Yellowstone, we found lower seroprevalences for some disease-causing agents post-wolf restoration (e.g., bovine-virus-diarrhea virus type-1 [95% CI pre-WR = 73.1-86.3, post-WR = 15.9-31.9] and bovine-respiratory syncytial virus [95% CI pre-WR = 70.0-83.8, post-WR = 0]), but similar (e.g., Brucella abortus [95% CI pre-WR = 0-4.45, post-WR = 0-4.74] and epizootic hemorrhagic disease virus [95% CI pre-WR = 0, post-WR = 0]) or higher for others (e.g., Anaplasma marginale [95% CI pre-WR = 0, post-WR = 18.5-38.7] and Leptospira spp. [95% CI pre-WR = 0.5-6.5, post-WR = 9.5-23.5]). Though we did not detect an overall strong predation effect through reduced disease seroprevalence using retrospective comparisons with sparse data, our reference values will facilitate future assessments of this issue.

  14. Blood-borne biomarkers of mortality risk: systematic review of cohort studies.

    Directory of Open Access Journals (Sweden)

    Evelyn Barron

    Full Text Available Lifespan and the proportion of older people in the population are increasing, with far reaching consequences for the social, political and economic landscape. Unless accompanied by an increase in health span, increases in age-related diseases will increase the burden on health care resources. Intervention studies to enhance healthy ageing need appropriate outcome measures, such as blood-borne biomarkers, which are easily obtainable, cost-effective, and widely accepted. To date there have been no systematic reviews of blood-borne biomarkers of mortality.To conduct a systematic review to identify available blood-borne biomarkers of mortality that can be used to predict healthy ageing post-retirement.Four databases (Medline, Embase, Scopus, Web of Science were searched. We included prospective cohort studies with a minimum of two years follow up and data available for participants with a mean age of 50 to 75 years at baseline.From a total of 11,555 studies identified in initial searches, 23 fulfilled the inclusion criteria. Fifty-one blood borne biomarkers potentially predictive of mortality risk were identified. In total, 20 biomarkers were associated with mortality risk. Meta-analyses of mortality risk showed significant associations with C-reactive protein (Hazard ratios for all-cause mortality 1.42, p<0.001; Cancer-mortality 1.62, p<0.009; CVD-mortality 1.31, p = 0.033, N Terminal-pro brain natriuretic peptide (Hazard ratios for all-cause mortality 1.43, p<0.001; CHD-mortality 1.58, p<0.001; CVD-mortality 1.67, p<0.001 and white blood cell count (Hazard ratios for all-cause mortality 1.36, p = 0.001. There was also evidence that brain natriuretic peptide, cholesterol fractions, erythrocyte sedimentation rate, fibrinogen, granulocytes, homocysteine, intercellular adhesion molecule-1, neutrophils, osteoprotegerin, procollagen type III aminoterminal peptide, serum uric acid, soluble urokinase plasminogen activator receptor, tissue inhibitor of

  15. A rapid method for selecting suitable animal species for studying pathogen interactions with plasma protein ligands in vivo.

    Science.gov (United States)

    Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel

    2017-05-01

    Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  16. Antimicrobial activity of Piper nigrum L. and Cassia didymobotyra L. leaf extract on selected food borne pathogens

    Directory of Open Access Journals (Sweden)

    Mohd. Sayeed Akthar

    2014-09-01

    Full Text Available Objective: To investigate the antimicrobial activity of leaf extract of Piper nigrum (P. nigrum and Cassia didymobotyra (C. didymobotyra (aqueous, methanol, ethanol and petroleum ether against the food borne pathogenic bacteria [Staphylococcus aureus (S. aureus, Escherichia coli (E. coli, Salmonella typhimurium and Pseudomonas aeruginosa] and fungi [Aspergillus spp. and Candida albicans (C. albicans] and also to investigate the presence of various phytochemicals in the leaf extracts of tested plants. Methods: The antimicrobial activity was determined by disc diffusion method. Minimum inhibitory concentration (MIC, minimum bactericidal and fungicidal concentration were determined by serial dilution method. Results: Methanol leaf extract of test plants exhibited greater antimicrobial activity against the selected bacterial and fungal strains. The MIC results showed that ethanol, methanol and petroleum ether leaf extract of P. nigrum inhibited the growth of S. aureus and E. coli at concentration of 12.5 mg/mL. While, ethanol and methanol leaf extracts of C. didymobotyra inhibited the growth of S. aureus at concentration of 6.25 mg/mL. The MIC values for ethanol, methanol and petroleum ether leaf extract of P. nigrum inhibited the growth of C. albicans at concentration of 25.0 mg/mL. While, it was reported that at concentration of 12.5 mg/mL methanol leaf extract of P. nigrum was against the Aspergillus spp. The MIC values of methanol leaf extract of C. didymobotyra inhibited the growth of C. albicans and Aspergillus spp. at concentration of 12.5 mg/mL and 6.25 mg/mL, respectively. The minimum bactericidal concentration of ethanol, methanol leaf extract of P. nigrum for E. coli and ethanol, methanol leaf extract of C. didymobotyra for S. aureus was recorded at concentration 12.5 mg/mL. The minimum fungicidal concentration of ethanol and methanol leaf extract of P. nigrum and C. didymobotyra on C. albicans was recorded at concentration of 25.0 mg

  17. Psychometric properties of the Blood-borne Virus Transmission Risk Assessment Questionnaire (BBV-TRAQ).

    Science.gov (United States)

    Fry, Craig L; Lintzeris, Nick

    2003-02-01

    To develop a standard measure of blood-borne virus transmission risk behaviour, and examine the underlying psychometric properties. The Blood-borne Virus Transmission Risk Assessment Questionnaire (BBV-TRAQ) was developed over three consecutive phases of the original BBV-TRAQ study in adherence to classical scale development procedures, culminating in the recruitment of a development sample of current injecting drug users via convenience and snowball sampling. Needle and syringe programmes (NSPs), medical clinics, alcohol/drug agencies, peer-based and outreach organizations across inner and outer metropolitan Melbourne. Two hundred and nine current injecting drug users. The mean age was 27 years, 68% were male, 65% unemployed, 36% with prison history and 25% in methadone maintenance. BBV-TRAQ items cover specific injecting, sexual and skin penetration risk practices. BBV-TRAQ characteristics were assessed via measures of internal and test-retest reliability; collateral validation; and principal components analyses. The BBV-TRAQ has satisfactory psychometric properties. Internal (a=0.87), test-retest (r=0.84) and inter-observer reliability results were high, suggesting that the instrument provides a reliable measure of BBV risk behaviour and is reliable over time and across interviewers. A principal components analysis with varimax rotation produced a parsimonious factor solution despite modest communality, and indicated that three factors (injecting, sex and skin penetration/hygiene risks) are required to describe BBV risk behaviour. The BBV-TRAQ is reliable and represents the first risk assessment tool to incorporate sufficient coverage of injecting, sex and other skin penetration risk practices to be considered truly content valid. The questionnaire is indicated for use in addictions research, clinical, peer education and BBV risk behaviour surveillance settings.

  18. Harmonizing methods for wildlife abundance estimation and pathogen detection in Europe-a questionnaire survey on three selected host-pathogen combinations

    DEFF Research Database (Denmark)

    Schulz, Jana; Ryser-Degiorgis, Marie-Pierre; Kuiken, Thijs

    2017-01-01

    Background: The need for wildlife health surveillance as part of disease control in wildlife, domestic animals and humans on the global level is widely recognized. However, the objectives, methods and intensity of existing wildlife health surveillance programs vary greatly among European countries......, resulting in a patchwork of data that are difficult to merge and compare. This survey aimed at evaluating the need and potential for data harmonization in wildlife health in Europe. The specific objective was to collect information on methods currently used to estimate host abundance and pathogen prevalence...... estimation, there is an urgent need to develop tools for the routine collection of host abundance data in a harmonized way. Wildlife health experts are encouraged to apply the harmonized APHAEA protocols in epidemiological studies in wildlife and to increase cooperation....

  19. In-Vitro Activity of Saponins of Bauhinia Purpurea Madhuca Longifolia Celastrus Paniculatus and Semecarpus Anacardium on Selected Oral Pathogens

    Directory of Open Access Journals (Sweden)

    K. S. Jyothi

    2012-01-01

    Full Text Available Objective: Dental caries, periodontitis and other mucosal diseases are caused by a complex community of microorganisms. This study aimed to investigate the antimicrobial properties of saponins of four important oil yielding medicinal plant extracts on selected oral pathogens that are involved in such diseases.Materials and Methods: Saponins were extracted from Bauhinia purpurea, Madhuca longifolia, Celastrus paniculatus and Semecarpus anacardium and purified. Antimicrobial properties of these saponins against Streptococcus mutans, Streptococcus mitis, Streptococcus salivarius, Staphylococcus aureus and Lactobacillus acidophilus were determined using well diffusion method. The minimum inhibitory concentration (MIC was determined as the lowest concentration of saponins inhibiting bacterial growth after 14 h of incubation at 37°C. The bactericidal activity was evaluated using the viable cell count method.Results: The minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC of Madhuca longifolia saponin on Streptococcus mutans MTCC 890, Streptococcus mitis and Staphylococcus aureus was 18.3 ± 0.15/34.4 ± 0.24 µg/ml, 19.0 ± 0.05/32.2 ± 0.0 µg/ml and 21.2 ± 0.35/39.0 ± 0.30 µg/ml, respectively and Bauhinia purpurea saponin on Streptococcus mutans MTCC 890, Staphylococcus aureus and Lactobacillus acidophilus was 26.4 ± 0.20/43.0 ± 0.40 µg/ml, 29.0 ± 0.30/39.6 ± 0.12 µg/ml and 20.2 ± 0.05/36.8 ± 0.23 µg/ml, respectively.Conclusion: The strong antimicrobial activity of Madhuca longifolia and Bauhinia purpurea may be due to the presence of complex triterpenoid saponins, oleanane type triterpenoid glycosides or atypical pentacyclic triterpenoid saponin. Hence, these extracted saponins may be used in food and oral products to prevent and control oral diseases.

  20. In-Vitro Activity of Saponins of Bauhinia Purpurea, Madhuca Longifolia, Celastrus Paniculatus and Semecarpus Anacardium on Selected Oral Pathogens

    Science.gov (United States)

    Jyothi, K. S.; Seshagiri, M.

    2012-01-01

    Objective: Dental caries, periodontitis and other mucosal diseases are caused by a complex community of microorganisms. This study aimed to investigate the antimicrobial properties of saponins of four important oil yielding medicinal plant extracts on selected oral pathogens that are involved in such diseases. Materials and Methods: Saponins were extracted from Bauhinia purpurea, Madhuca longifolia, Celastrus paniculatus and Semecarpus anacardium and purified. Antimicrobial properties of these saponins against Streptococcus mutans, Streptococcus mitis, Streptococcus salivarius, Staphylococcus aureus and Lactobacillus acidophilus were determined using well diffusion method. The minimum inhibitory concentration (MIC) was determined as the lowest concentration of saponins inhibiting bacterial growth after 14 h of incubation at 37°C. The bactericidal activity was evaluated using the viable cell count method. Results: The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of Madhuca longifolia saponin on Streptococcus mutans MTCC 890, Streptococcus mitis and Staphylococcus aureus was 18.3 ± 0.15/34.4 ± 0.24 μg/ml, 19.0 ± 0.05/32.2 ± 0.0 μg/ml and 21.2 ± 0.35/39.0 ± 0.30 μg/ml, respectively and Bauhinia purpurea saponin on Streptococcus mutans MTCC 890, Staphylococcus aureus and Lactobacillus acidophilus was 26.4 ± 0.20/43.0 ± 0.40 μg/ml, 29.0 ± 0.30/39.6 ± 0.12 μg/ml and 20.2 ± 0.05/36.8 ± 0.23 μg/ml, respectively. Conclusion: The strong antimicrobial activity of Madhuca longifolia and Bauhinia purpurea may be due to the presence of complex triterpenoid saponins, oleanane type triterpenoid glycosides or atypical pentacyclic triterpenoid saponin. Hence, these extracted saponins may be used in food and oral products to prevent and control oral diseases. PMID:23323183

  1. Diversifying Selection in the Wheat Stem Rust Fungus Acts Predominantly on Pathogen-Associated Gene Families and Reveals Candidate Effectors

    Directory of Open Access Journals (Sweden)

    Jana eSperschneider

    2014-09-01

    Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  2. IFN-γ fails to overcome inhibition of selected macrophage activation events in response to pathogenic mycobacteria.

    Directory of Open Access Journals (Sweden)

    Shyamala Thirunavukkarasu

    Full Text Available According to most models of mycobacterial infection, inhibition of the pro-inflammatory macrophage immune responses contributes to the persistence of bacteria. Mycobacterium avium subsp. paratuberculosis (MAP is a highly successful pathogen in cattle and sheep and is also implicated as the causative agent of Crohn's disease in humans. Pathogenic mycobacteria such as MAP have developed multiple strategies to evade host defence mechanisms including interfering with the macrophages' capacity to respond to IFN-γ, a feature which might be lacking in non-pathogenic mycobacteria such as M. smegmatis. We hypothesized that pre-sensitisation of macrophages with the pro-inflammatory cytokine IFN-γ would help in overcoming the inhibitory effect of MAP or its antigens on macrophage inflammatory responses. Herein we have compared a series of macrophage activation parameters in response to MAP and M. smegmatis as well as mycobacterial antigens. While IFN-γ did overcome the inhibition in immune suppressive mechanisms in response to MAP antigen as well as M. smegmatis, we could not find a clear role for IFN-γ in overcoming the inhibition of macrophage inflammatory responses to the pathogenic mycobacterium, MAP. We demonstrate that suppression of macrophage defence mechanisms by pathogenic mycobacteria is unlikely to be overcome by prior sensitization with IFN-γ alone. This indicates that IFN-γ signaling pathway-independent mechanisms may exist for overcoming inhibition of macrophage effector functions in response to pathogenic mycobacteria. These findings have important implications in understanding the survival mechanisms of pathogenic mycobacteria directed towards finding better therapeutics and vaccination strategies.

  3. The HLA-B landscape of Africa: Signatures of pathogen-driven selection and molecular identification of candidate alleles to malaria protection

    Czech Academy of Sciences Publication Activity Database

    Sanchez-Mazas, A.; Černý, V.; Di, D.; Buhler, S.; Podgorná, Eliška; Chevallier, E.; Brunet, L.; Weber, S.; Kervaire, B.; Testi, M.; Andreani, M.; Tiercy, J.-M.; Villard, J.; Nunes, J. M.

    2017-01-01

    Roč. 26, č. 22 (2017), s. 6238-6252 ISSN 0962-1083 R&D Projects: GA ČR GA13-37998S Institutional support: RVO:67985912 Keywords : African populations * geographic patterns * HLA polymorphism and disease associations * human population genetics * malaria protection * pathogen-driven selection Subject RIV: AC - Archeology, Anthropology, Ethnology OBOR OECD: Archaeology Impact factor: 6.086, year: 2016

  4. Individual Patterns in Blood-Borne Indicators of Fatigue-Trait or Chance.

    Science.gov (United States)

    Julian, Ross; Meyer, Tim; Fullagar, Hugh H K; Skorski, Sabrina; Pfeiffer, Mark; Kellmann, Michael; Ferrauti, Alexander; Hecksteden, Anne

    2017-03-01

    Julian, R, Meyer, T, Fullagar, HHK, Skorski, S, Pfeiffer, M, Kellmann, M, Ferrauti, A, and Hecksteden, A. Individual patterns in blood-borne indicators of fatigue-trait or chance. J Strength Cond Res 31(3): 608-619, 2017-Blood-borne markers of fatigue such as creatine kinase (CK) and urea (U) are widely used to fine-tune training recommendations. However, predictive accuracy is low. A possible explanation for this dissatisfactory characteristic is the propensity of athletes to react to different patterns of fatigue indicators (e.g., predominantly muscular [CK] or metabolic [U]). The aim of the present trial was to explore this hypothesis by using repetitive fatigue-recovery cycles. A total of 22 elite junior swimmers and triathletes (18 ± 3 years) were monitored for 9 weeks throughout 2 training phases (low-intensity, high-volume [LIHV] and high-intensity, low-volume [HILV] phases). Blood samples were collected each Monday (recovered) and Friday (fatigued) morning. From measured values of CK, U, free-testosterone (FT), and cortisol (C) as determined in the rested and fatigued state, respectively, Monday-Friday differences (Δ) were calculated and classified by magnitude before calculation of ratios (ΔCK/ΔU and ΔFT/ΔC). Coefficient of variation (CV) was calculated as group-based estimates of reproducibility. Linear mixed modeling was used to differentiate inter- and intraindividual variability. Consistency of patterns was analyzed by comparing with threshold values (1.1 for all weeks). Reproducibility was very low for fatigue-induced changes (CV ≥ 100%) with interindividual variation accounting for 45-60% of overall variability. Case-wise analysis indicated consistent ΔCK/ΔU patterns for 7 individuals in LIHV and 7 in HILV; 5 responded consistently throughout. For ΔFT/ΔC the number of consistent patterns was 2 in LIHV and 3 in HILV. These findings highlight the potential value of an individualized and multivariate approach in the assessment of fatigue.

  5. A multicentre molecular analysis of hepatitis B and blood-borne virus coinfections in Viet Nam.

    Directory of Open Access Journals (Sweden)

    Linda Dunford

    Full Text Available Hepatitis B (HBV infection is endemic in Viet Nam, with up to 8.4 million individuals estimated to be chronically infected. We describe results of a large, multicentre seroepidemiological and molecular study of the prevalence of HBV infection and blood-borne viral coinfections in Viet Nam. Individuals with varying risk factors for infection (n = 8654 were recruited from five centres; Ha Noi, Hai Phong, Da Nang, Khanh Hoa and Can Tho. A mean prevalence rate of 10.7% was observed and levels of HBsAg were significantly higher in injecting drug users (IDUs (17.4%, n = 174/1000 and dialysis patients (14.3%, n = 82/575 than in lower-risk groups (9.4%; p<0.001. Coinfection with HIV was seen in 28% of HBV-infected IDUs (n = 49/174 and 15.2% of commercial sex workers (CSWs; n = 15/99. HCV infection was present in 89.8% of the HBV-HIV coinfected IDUs (n = 44/49 and 40% of HBV-HIV coinfected CSWs (n = 16/40. Anti-HDV was detected in 10.7% (n = 34/318 of HBsAg positive individuals. Phylogenetic analysis of HBV S gene (n = 187 showed a predominance of genotype B4 (82.6%; genotypes C1 (14.6%, B2 (2.7% and C5 (0.5% were also identified. The precore mutation G1896A was identified in 35% of all specimens, and was more frequently observed in genotype B (41% than genotype C (3%; p<0.0001. In the immunodominant 'a' region of the surface gene, point mutations were identified in 31% (n = 58/187 of sequences, and 2.2% (n = 4/187 and 5.3% (n = 10/187 specimens contained the major vaccine escape mutations G145A/R and P120L/Q/S/T, respectively. 368 HBsAg positive individuals were genotyped for the IL28B SNP rs12979860 and no significant association between the IL28B SNP and clearance of HBsAg, HBV viral load or HBeAg was observed. This study confirms the high prevalence of HBV infection in Viet Nam and also highlights the significant levels of blood-borne virus coinfections, which have important implications for hepatitis-related morbidity and development of effective

  6. Survey of bumble bee (Bombus) pathogens and parasites in Illinois and selected areas of northern California and southern Oregon.

    Science.gov (United States)

    Kissinger, Christina N; Cameron, Sydney A; Thorp, Robbin W; White, Brendan; Solter, Leellen F

    2011-07-01

    Pathogens have been implicated as potential factors in the recent decline of some North American bumble bee (Bombus) species, but little information has been reported about the natural enemy complex of bumble bees in the United States. We targeted bumble bee populations in a state-wide survey in Illinois and several sites in California and Oregon where declines have been reported to determine presence and prevalence of natural enemies. Based on our observations, most parasites and pathogens appear to be widespread generalists among bumble bee species, but susceptibility to some natural enemies appeared to vary. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Environmental E.coli isolate characterization and selection as improved indicators for pathogens associated with produce contamination

    Science.gov (United States)

    Contamination of food and water by pathogens is a substantial public health issue in the United States. According to the Centers for Disease Control and Prevention, 49% of foodborne illness is caused by produce, and despite efforts to reduce produce contamination, these issues persist. Escherichia c...

  8. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

    2015-01-01

    with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...

  9. United Kingdom newsprint media reporting on sexual health and blood-borne viruses in 2010.

    Science.gov (United States)

    Martin, Susan; Hilton, Shona; McDaid, Lisa M

    2013-12-01

    Improving sexual health and blood-borne virus (BBV) outcomes continue to be of high priority within the United Kingdom (UK) and it is evident that the media can and do impact the public health agenda. This paper presents the first large-scale exploration of UK national newsprint media representations of sexual health and BBVs. Using keyword searches in electronic databases, 677 articles published during 2010 were identified from 12 national (UK-wide and Scottish) newspapers. Content analysis was used to identify manifest content and to examine the tone of articles. Although there was a mixed picture overall in terms of tone, negatively toned articles, which focussed on failures or blame, were common, particularly within HIV/AIDS, hepatitis B and C, and other sexually transmissible infection coverage (41% were assessed as containing negative content; 46% had negative headlines). Differences were found by newspaper genre, with 'serious' newspaper articles appearing more positive and informative than 'midmarket' newspapers or 'tabloids'. Across the sample, particular individuals, behaviours and risk groups were focussed on, not always accurately, and there was little mention of deprivation and inequalities (9%). A gender imbalance was evident, particularly within reproductive health articles (71% focussed on women; 23% on men), raising questions concerning gender stereotyping. There is a need to challenge the role that media messages have in the reinforcement of a negative culture around sexual health in the UK and for a strong collective advocacy voice to ensure that future media coverage is positively portrayed.

  10. Imaging tumor hypoxia: Blood-borne delivery of imaging agents is fundamentally different in hypoxia subtypes

    Directory of Open Access Journals (Sweden)

    Peter Vaupel

    2014-03-01

    Full Text Available Hypoxic tissue subvolumes are a hallmark feature of solid malignant tumors, relevant for cancer therapy and patient outcome because they increase both the intrinsic aggressiveness of tumor cells and their resistance to several commonly used anticancer strategies. Pathogenetic mechanisms leading to hypoxia are diverse, may coexist within the same tumor and are commonly grouped according to the duration of their effects. Chronic hypoxia is mainly caused by diffusion limitations resulting from enlarged intercapillary distances and adverse diffusion geometries and — to a lesser extent — by hypoxemia, compromised perfusion or long-lasting microregional flow stops. Conversely, acute hypoxia preferentially results from transient disruptions in perfusion. While each of these features of the tumor microenvironment can contribute to a critical reduction of oxygen availability, the delivery of imaging agents (as well as nutrients and anticancer agents may be compromised or remain unaffected. Thus, a critical appraisal of the effects of the various mechanisms leading to hypoxia with regard to the blood-borne delivery of imaging agents is necessary to judge their ability to correctly represent the hypoxic phenotype of solid malignancies.

  11. Loss and gain of function in SERPINB11: an example of a gene under selection on standing variation, with implications for host-pathogen interactions.

    Directory of Open Access Journals (Sweden)

    Susana Seixas

    Full Text Available Serine protease inhibitors (SERPINs are crucial in the regulation of diverse biological processes including inflammation and immune response. SERPINB11, located in the 18q21 gene cluster, is a polymorphic gene/pseudogene coding for a non-inhibitory SERPIN. In a genome-wide scan for recent selection, SERPINB11 was identified as a potential candidate gene for adaptive evolution in Yoruba. The present study sought a better understanding of the evolutionary history of SERPINB11, with special focus on evaluating its selective signature. Through the resequencing of coding and noncoding regions of SERPINB11 in 20 Yorubans and analyzing primate orthologous sequences, we identified a full-length SERPINB11 variant encoding a non-inhibitory SERPIN as the putative candidate of selection--probably driven to higher frequencies by an adaptive response using preexisting variation. In addition, we detected contrasting evolutionary features of SERPINB11 in primates: While primate phylogeny as a whole is under purifying selection, the human lineage shows evidence of positive selection in a few codons, all associated with the active SERPINB11. Comparative modeling studies suggest that positively selected codons reduce SERPINB11's ability to undergo the conformational changes typical of inhibitory SERPINs--suggesting that it is evolving towards a new non-inhibitory function in humans. Significant correlations between SERPINB11 variants and the environmental variables, pastoralism and pathogen richness, have led us to propose a selective advantage through host-pathogen interactions, possibly linked to an adaptive response combating the emergence of infectious diseases in recent human evolution. This work represents the first description of a resurrected gene in humans, and may well exemplify selection on standing variation triggered by drastic ecological shifts.

  12. Repression of fungal plant pathogens and fungal-related contaminants: Selected ecosystem services by soil fauna communities in agroecosystems

    Science.gov (United States)

    Meyer-Wolfarth, Friederike; Schrader, Stefan; Oldenburg, Elisabeth; Brunotte, Joachim; Weinert, Joachim

    2017-04-01

    In agroecosystems soil-borne fungal plant diseases are major yield-limiting factors which are difficult to control. Fungal plant pathogens, like Fusarium species, survive as a saprophyte in infected tissue like crop residues and endanger the health of the following crop by increasing the infection risk for specific plant diseases. In infected plant organs, these pathogens are able to produce mycotoxins. Mycotoxins like deoxynivalenol (DON) persist during storage, are heat resistant and of major concern for human and animal health after consumption of contaminated food and feed, respectively. Among fungivorous soil organisms, there are representatives of the soil fauna which are obviously antagonistic to a Fusarium infection and the contamination with mycotoxins. Specific members of the soil macro-, meso-, and microfauna provide a wide range of ecosystem services including the stimulation of decomposition processes which may result in the regulation of plant pathogens and the degradation of environmental contaminants. Investigations under laboratory conditions and in field were conducted to assess the functional linkage between soil faunal communities and plant pathogenic fungi (Fusarium culmorum). The aim was to examine if Fusarium biomass and the content of its mycotoxin DON decrease substantially in the presence of soil fauna (earthworms: Lumbricus terrestris, collembolans: Folsomia candida and nematodes: Aphelenchoides saprophilus) in a commercial cropping system managed with conservation tillage located in Northern Germany. The results of our investigations pointed out that the degradation performance of the introduced soil fauna must be considered as an important contribution to the biodegradation of fungal plant diseases and fungal-related contaminants. Different size classes within functional groups and the traits of keystone species appear to be significant for soil function and the provision of ecosystem services as in particular L. terrestris revealed to

  13. Codon and amino acid usage in two major human pathogens of genus Bartonella--optimization between replicational-transcriptional selection, translational control and cost minimization.

    Science.gov (United States)

    Das, Sabyasachi; Paul, Sandip; Chatterjee, Sanjib; Dutta, Chitra

    2005-01-01

    Intra-genomic variation in synonymous codon and amino acid usage in two human pathogens Bartonella henselae and B. quintana has been carried out through multivariate analysis. Asymmetric mutational bias, coupled with replicational-transcriptional selection, has been identified as the prime selection force behind synonymous codon selection--a characteristic of the genus Bartonella, not exhibited by any other alpha-proteobacterial genome. Distinct codon usage patterns and low synonymous divergence values between orthologous sequences of highly expressed genes from the two Bartonella species indicate that there exists a residual intra-strand synonymous codon bias in the highly expressed genes, possibly operating at the level of translation. In the case of amino acid usage, the mean hydropathy level and aromaticity are the major sources of variation, both having nearly equal impact, while strand-specific mutational pressure and gene expressivity strongly influence the inter-strand variations. In both species under study, the highly expressed gene products tend not to contain heavy and/or aromatic residues, following the cost-minimization hypothesis in spite of their intracellular lifestyle. The codon and amino acid usage in these two human pathogens are, therefore, consequences of a complex balance between replicational-transcriptional selection, translational control, protein hydropathy and cost minimization.

  14. The ability of selected plant essential oils to enhance the action of recommended antibiotics against pathogenic wound bacteria.

    Science.gov (United States)

    Sienkiewicz, Monika; Łysakowska, Monika; Kowalczyk, Edward; Szymańska, Grażyna; Kochan, Ewa; Krukowska, Jolanta; Olszewski, Jurek; Zielińska-Bliźniewska, Hanna

    2017-03-01

    The aim of this work was to characterize the ability of essential oils to support antibiotics against pathogenic bacteria in wounds. Gram-positive and Gram-negative bacteria obtained from wound infections were identified according to standard microbiological methods. Essential oils were analysed by GC-FID-MS. The susceptibility of bacteria to antibiotics, essential oils and their combination was assessed using the disc-diffusion method. The Minimal Inhibitory Concentration and Minimum Bactericidal Concentration of the essential oils were established by the micro-dilution broth method. Although cinnamon, clove, thyme and lavender essential oils were found to have the greatest antibacterial activity when used alone, the greatest additive and synergistic effects against pathogenic wound bacteria in combination with recommended antibiotics were demonstrated by basil, clary sage and rosemary oils. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  15. Efficient uptake of blood-borne BK and JC polyomavirus-like particles in endothelial cells of liver sinusoids and renal vasa recta.

    Directory of Open Access Journals (Sweden)

    Jaione Simon-Santamaria

    Full Text Available Liver sinusoidal endothelial cells (LSECs are specialized scavenger cells that mediate high-capacity clearance of soluble waste macromolecules and colloid material, including blood-borne adenovirus. To explore if LSECs function as a sink for other viruses in blood, we studied the fate of virus-like particles (VLPs of two ubiquitous human DNA viruses, BK and JC polyomavirus, in mice. Like complete virions, VLPs specifically bind to receptors and enter cells, but unlike complete virions, they cannot replicate. 125I-labeled VLPs were used to assess blood decay, organ-, and hepatocellular distribution of ligand, and non-labeled VLPs to examine cellular uptake by immunohisto- and -cytochemistry. BK- and JC-VLPs rapidly distributed to liver, with lesser uptake in kidney and spleen. Liver uptake was predominantly in LSECs. Blood half-life (∼1 min, and tissue distribution of JC-VLPs and two JC-VLP-mutants (L55F and S269F that lack sialic acid binding affinity, were similar, indicating involvement of non-sialic acid receptors in cellular uptake. Liver uptake was not mediated by scavenger receptors. In spleen, the VLPs localized to the red pulp marginal zone reticuloendothelium, and in kidney to the endothelial lining of vasa recta segments, and the transitional epithelium of renal pelvis. Most VLP-positive vessels in renal medulla did not express PV-1/Meca 32, suggesting location to the non-fenestrated part of vasa recta. The endothelial cells of these vessels also efficiently endocytosed a scavenger receptor ligand, formaldehyde-denatured albumin, suggesting high endocytic activity compared to other renal endothelia. We conclude that LSECs very effectively cleared a large fraction of blood-borne BK- and JC-VLPs, indicating a central role of these cells in early removal of polyomavirus from the circulation. In addition, we report the novel finding that a subpopulation of endothelial cells in kidney, the main organ of polyomavirus persistence, showed

  16. Immune escape mutants of Highly Pathogenic Avian Influenza H5N1 selected using polyclonal sera: identification of key amino acids in the HA protein.

    Directory of Open Access Journals (Sweden)

    Ioannis Sitaras

    Full Text Available Evolution of Avian Influenza (AI viruses--especially of the Highly Pathogenic Avian Influenza (HPAI H5N1 subtype--is a major issue for the poultry industry. HPAI H5N1 epidemics are associated with huge economic losses and are sometimes connected to human morbidity and mortality. Vaccination (either as a preventive measure or as a means to control outbreaks is an approach that splits the scientific community, due to the risk of it being a potential driving force in HPAI evolution through the selection of mutants able to escape vaccination-induced immunity. It is therefore essential to study how mutations are selected due to immune pressure. To this effect, we performed an in vitro selection of mutants from HPAI A/turkey/Turkey/1/05 (H5N1, using immune pressure from homologous polyclonal sera. After 42 rounds of selection, we identified 5 amino acid substitutions in the Haemagglutinin (HA protein, most of which were located in areas of antigenic importance and suspected to be prone to selection pressure. We report that most of the mutations took place early in the selection process. Finally, our antigenic cartography studies showed that the antigenic distance between the selected isolates and their parent strain increased with passage number.

  17. Evaluation of biochemical and haematological parameters and prevalence of selected pathogens in feral cats from urban and rural habitats in South Korea.

    Science.gov (United States)

    Hwang, Jusun; Gottdenker, Nicole; Min, Mi-Sook; Lee, Hang; Chun, Myung-Sun

    2016-06-01

    In this study, we evaluated the potential association between the habitat types of feral cats and the prevalence of selected infectious pathogens and health status based on a set of blood parameters. We live-trapped 72 feral cats from two different habitat types: an urban area (n = 48) and a rural agricultural area (n = 24). We compared blood values and the prevalence of feline immunodeficiency virus (FIV), feline leukaemia virus (FeLV) and haemotropic Mycoplasma infection in feral cats from the two contrasting habitats. Significant differences were observed in several blood values (haematocrit, red blood cells, blood urea nitrogen, creatinine) depending on the habitat type and/or sex of the cat. Two individuals from the urban area were seropositive for FIV (3.0%), and eight (12.1%) were positive for FeLV infection (five from an urban habitat and three from a rural habitat). Haemoplasma infection was more common. Based on molecular analysis, 38 cats (54.3%) were positive for haemoplasma, with a significantly higher infection rate in cats from rural habitats (70.8%) compared with urban cats (47.8%). Our study recorded haematological and serum biochemical values, and prevalence of selected pathogens in feral cat populations from two different habitat types. A subset of important laboratory parameters from rural cats showed values under or above the corresponding reference intervals for healthy domestic cats, suggesting potential differences in the health status of feral cats depending on the habitat type. Our findings provide information about the association between 1) blood values (haematological and serum biochemistry parameters) and 2) prevalence of selected pathogen infections and different habitat types; this may be important for veterinarians who work with feral and/or stray cats and for overall cat welfare management. © ISFM and AAFP 2015.

  18. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  19. Pattern of Bacterial Pathogens and Their Susceptibility Isolated from Surgical Site Infections at Selected Referral Hospitals, Addis Ababa, Ethiopia

    Directory of Open Access Journals (Sweden)

    Walelign Dessie

    2016-01-01

    Full Text Available Background. The emergence of multidrug resistant bacterial pathogens in hospitals is becoming a challenge for surgeons to treat hospital acquired infections. Objective. To determine bacterial pathogens and drug susceptibility isolated from surgical site infections at St. Paul Specialized Hospital Millennium Medical College and Yekatit 12 Referral Hospital Medical College, Addis Ababa, Ethiopia. Methods. A cross-sectional study was conducted between October 2013 and March 2014 on 107 surgical site infected patients. Wound specimens were collected using sterile cotton swab and processed as per standard operative procedures in appropriate culture media; and susceptibility testing was done using Kirby-Bauer disc diffusion technique. The data were analyzed by using SPSS version 20. Result. From a total of 107 swabs collected, 90 (84.1% were culture positive and 104 organisms were isolated. E. coli (24 (23.1% was the most common organism isolated followed by multidrug resistant Acinetobacter species (23 (22.1%. More than 58 (75% of the Gram negative isolates showed multiple antibiotic resistance (resistance ≥ 5 drugs. Pan-antibiotic resistance was noted among 8 (34.8% Acinetobacter species and 3 (12.5% E. coli. This calls for abstinence from antibiotic abuse. Conclusion. Gram negative bacteria were the most important isolates accounting for 76 (73.1%. Ampicillin, amoxicillin, penicillin, cephazoline, and tetracycline showed resistance while gentamicin and ciprofloxacin were relatively effective antimicrobials.

  20. Blood-borne virus transmission in healthcare settings in Ireland: review of patient notification exercises 1997-2011.

    LENUS (Irish Health Repository)

    Donohue, S

    2012-01-21

    A review of patient notification exercises (PNEs) carried out in Ireland between 1997 and 2011 to investigate potential exposure to blood-borne viruses (BBVs) in healthcare settings was undertaken to inform future policy and practice. A questionnaire was sent to key informants in the health services to identify all relevant PNEs. Structured interviews were conducted with key investigators, and available documentation was examined. Ten BBV-related PNEs were identified. Despite testing over 2000 patients, only one case of transmission was found. However, in-depth local investigations before undertaking the PNEs identified six cases of healthcare-associated transmission.

  1. Serologic Survey for Selected Viral and Bacterial Swine Pathogens in Colombian Collared Peccaries ( Pecari tajacu) and Feral Pigs ( Sus scrofa).

    Science.gov (United States)

    Montenegro, Olga L; Roncancio, Nestor; Soler-Tovar, Diego; Cortés-Duque, Jimena; Contreras-Herrera, Jorge; Sabogal, Sandra; Acevedo, Luz Dary; Navas-Suárez, Pedro Enrique

    2018-06-14

    In South America, wild populations of peccaries coexist with domestic and feral pigs, with poorly understood consequences. We captured 58 collared peccaries ( Pecari tajacu) and 15 feral pigs ( Sus scrofa) in locations of Colombia where coexistence of these species is known. Blood samples were tested for antibodies against four viral agents, classical swine fever virus (CSFV), Aujeszky's disease virus (ADV), porcine circovirus (PCV-2), and vesicular stomatitis virus (New Jersey and Indiana subtypes) and two bacterial agents, Brucella spp. and six serovars of Leptospira interrogans. The prevalence of CSFV was 5% (3/58) in collared peccaries and 7% (1/15) in feral pigs. The prevalence of PCV-2 was 7% (1/15) in collared peccaries and 67% (2/3) in feral pigs. Vesicular stomatitis prevalence was 33% (8/24) in collared peccaries and 67% (4/6) in feral pigs. Leptospira prevalence was 78% (39/50) in collared peccary and 100% (8/8) in feral pigs; bratislava, grippotyphosa, icterohaemorrhagiae, and pomona were the most frequent serovars. Also, the only white-lipped peccary ( Tayassu pecari) sampled was positive for L. interrogans serovar bratislava and for vesicular stomatitis virus, New Jersey strain. No samples were positive for ADV or Brucella. The seroprevalence of antibodies against L. interrogans was similar to that observed in other studies. Icterohaemorrhagiae appears to be a common serovar among in situ and ex situ peccary populations. Positive antibodies against PVC-2 represent a novel report of exposure to this pathogen in Colombian peccaries. Our results indicate the possible transmission of various pathogens, important for pig farms, in the studied pig and peccaries.

  2. The Black Yeast Exophiala dermatitidis and Other Selected Opportunistic Human Fungal Pathogens Spread from Dishwashers to Kitchens.

    Directory of Open Access Journals (Sweden)

    Jerneja Zupančič

    Full Text Available We investigated the diversity and distribution of fungi in nine different sites inside 30 residential dishwashers. In total, 503 fungal strains were isolated, which belong to 10 genera and 84 species. Irrespective of the sampled site, 83% of the dishwashers were positive for fungi. The most frequent opportunistic pathogenic species were Exophiala dermatitidis, Candida parapsilosis sensu stricto, Exophiala phaeomuriformis, Fusarium dimerum, and the Saprochaete/Magnusiomyces clade. The black yeast E. dermatitidis was detected in 47% of the dishwashers, primarily at the dishwasher rubber seals, at up to 106 CFU/cm2; the other fungi detected were in the range of 102 to 105 CFU/cm2. The other most heavily contaminated dishwasher sites were side nozzles, doors and drains. Only F. dimerum was isolated from washed dishes, while dishwasher waste water contained E. dermatitidis, Exophiala oligosperma and Sarocladium killiense. Plumbing systems supplying water to household appliances represent the most probable route for contamination of dishwashers, as the fungi that represented the core dishwasher mycobiota were also detected in the tap water. Hot aerosols from dishwashers contained the human opportunistic yeast C. parapsilosis, Rhodotorula mucilaginosa and E. dermatitidis (as well as common air-borne genera such as Aspergillus, Penicillium, Trichoderma and Cladosporium. Comparison of fungal contamination of kitchens without and with dishwashers revealed that virtually all were contaminated with fungi. In both cases, the most contaminated sites were the kitchen drain and the dish drying rack. The most important difference was higher prevalence of black yeasts (E. dermatitidis in particular in kitchens with dishwashers. In kitchens without dishwashers, C. parapsilosis strongly prevailed with negligible occurrence of E. dermatitidis. F. dimerum was isolated only from kitchens with dishwashers, while Saprochaete/Magnusiomyces isolates were only found within

  3. Co-Selection of Resistance to Antibiotics, Biocides and Heavy Metals, and Its Relevance to Foodborne Pathogens

    OpenAIRE

    Wales, Andrew; Davies, RH

    2015-01-01

    Concerns have been raised in recent years regarding co-selection for antibiotic resistance among bacteria exposed to biocides used as disinfectants, antiseptics and preservatives, and to heavy metals (particularly copper and zinc) used as growth promoters and therapeutic agents for some livestock species. There is indeed experimental and observational evidence that exposure to these non-antibiotic antimicrobial agents can induce or select for bacterial adaptations that result in decreased sus...

  4. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.

  5. Co-Selection of Resistance to Antibiotics, Biocides and Heavy Metals, and Its Relevance to Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Andrew D. Wales

    2015-11-01

    Full Text Available Concerns have been raised in recent years regarding co-selection for antibiotic resistance among bacteria exposed to biocides used as disinfectants, antiseptics and preservatives, and to heavy metals (particularly copper and zinc used as growth promoters and therapeutic agents for some livestock species. There is indeed experimental and observational evidence that exposure to these non-antibiotic antimicrobial agents can induce or select for bacterial adaptations that result in decreased susceptibility to one or more antibiotics. This may occur via cellular mechanisms that are protective across multiple classes of antimicrobial agents or by selection of genetic determinants for resistance to non-antibiotic agents that are linked to genes for antibiotic resistance. There may also be relevant effects of these antimicrobial agents on bacterial community structure and via non-specific mechanisms such as mobilization of genetic elements or mutagenesis. Notably, some co-selective adaptations have adverse effects on fitness in the absence of a continued selective pressure. The present review examines the evidence for the significance of these phenomena, particularly in respect of bacterial zoonotic agents that commonly occur in livestock and that may be transmitted, directly or via the food chain, to human populations.

  6. "Grant us eyes, grant us eyes! Plant eyes on our brains, to cleanse our beastly idiocy!": FromSoftware's Bloodborne, and the New Frontier of the Gothic

    Directory of Open Access Journals (Sweden)

    Oliver Langmead

    2017-06-01

    Full Text Available This article will consider the ways that Bloodborne (FromSoftware, 2015 plays on a broad range of Gothic themes and conventions, utilising unusual narrative techniques and gameplay mechanics which offer the player a means by which they might experience a Gothic narrative in ways that the traditional novel format does not allow for. It will argue that Bloodborne showcases the genre's potential new frontier: converting conventions into interesting new gameplay mechanics, and letting the player experience the genre through player-led narrative and agency.

  7. Characterization of HIV-Specific CD4+T Cell Responses against Peptides Selected with Broad Population and Pathogen Coverage

    DEFF Research Database (Denmark)

    Buggert, Marcus; Norstrom, Melissa M.; Czarnecki, Chris

    2012-01-01

    for the identification of HIV-specific CD4+ T cells targeting broadly reactive epitopes in populations with diverse ethnic background stems from the vast genomic variation of HIV and the diversity of the host cellular immune system. Here, we describe a novel epitope selection strategy, PopCover, that aims to resolve...... this challenge, and identify a set of potential HLA class II-restricted HIV epitopes that in concert will provide optimal viral and host coverage. Using this selection strategy, we identified 64 putative epitopes (peptides) located in the Gag, Nef, Env, Pol and Tat protein regions of HIV. In total, 73...... II-restricted epitopes. All together, selection strategies, such as PopCover, might with success be used for the evaluation of antigen-specific CD4+ T cell responses and design of future vaccines....

  8. Nanomolar oligomerization and selective co-aggregation of α-synuclein pathogenic mutants revealed by single-molecule fluorescence

    Science.gov (United States)

    Sierecki, Emma; Giles, Nichole; Bowden, Quill; Polinkovsky, Mark E.; Steinbeck, Janina; Arrioti, Nicholas; Rahman, Diya; Bhumkar, Akshay; Nicovich, Philip R.; Ross, Ian; Parton, Robert G.; Böcking, Till; Gambin, Yann

    2016-01-01

    Protein aggregation is a hallmark of many neurodegenerative diseases, notably Alzheimer’s and Parkinson’s disease. Parkinson’s disease is characterized by the presence of Lewy bodies, abnormal aggregates mainly composed of α-synuclein. Moreover, cases of familial Parkinson’s disease have been linked to mutations in α-synuclein. In this study, we compared the behavior of wild-type (WT) α-synuclein and five of its pathological mutants (A30P, E46K, H50Q, G51D and A53T). To this end, single-molecule fluorescence detection was coupled to cell-free protein expression to measure precisely the oligomerization of proteins without purification, denaturation or labelling steps. In these conditions, we could detect the formation of oligomeric and pre-fibrillar species at very short time scale and low micromolar concentrations. The pathogenic mutants surprisingly segregated into two classes: one group forming large aggregates and fibrils while the other tending to form mostly oligomers. Strikingly, co-expression experiments reveal that members from the different groups do not generally interact with each other, both at the fibril and monomer levels. Together, this data paints a completely different picture of α-synuclein aggregation, with two possible pathways leading to the development of fibrils. PMID:27892477

  9. Synergistic effects of sodium hypochlorite and ultraviolet radiation in reducing the levels of selected foodborne pathogenic bacteria.

    Science.gov (United States)

    Ha, Ji-Hyoung; Ha, Sang-Do

    2011-05-01

    The purpose of this study was to determine whether combined treatment would produce synergistic effects to facilitate the sterilization of food products during production relative to single treatment. To assess this hypothesis, we investigated the bactericidal effects of ultraviolet (UV) irradiation and a commercial chemical disinfectant, sodium hypochlorite (NaClO), on Bacillus cereus F4810/72, Cronobacter sakazakii KCTC 2949, Staphylococcus aureus ATCC 35556, Escherichia coli ATCC 10536, and Salmonella Typhimurium novobiocin/nalidixic acid in vitro. Various concentrations of NaClO (20, 60, 100, and 200 ppm NaClO) were tested along with exposure to UV radiation at various doses (6, 96, 216, 360, and 504 mW s/cm(2)). The combined NaClO/UV treatments resulted in greater reductions in bacterial counts than either treatment alone. The synergy values against B. cereus, C. sakazakii, S. aureus, Salmonella Typhimurium, and E. coli were 0.25-1.17, 0.33-1.97, 0.42-1.72, 0.02-1.44, and 0.01-0.85 log(10) CFU/mL, respectively. The results of this study suggest that a significant synergistic benefit results from combined NaClO/UV processing against food-borne pathogenic bacteria in vitro.

  10. Chemical Composition and Antibacterial Activity of Essential Oils of Tagetes minuta (Asteraceae) against Selected Plant Pathogenic Bacteria

    Science.gov (United States)

    Wagacha, John M.; Dossaji, Saifuddin F.

    2016-01-01

    The objective of this study was to determine the chemical composition and antibacterial activity of essential oils (EOs) of Tagetes minuta against three phytopathogenic bacteria Pseudomonas savastanoi pv. phaseolicola, Xanthomonas axonopodis pv. phaseoli, and Xanthomonas axonopodis pv. manihotis. The essential oils were extracted using steam distillation method in a modified Clevenger-type apparatus while antibacterial activity of the EOs was evaluated by disc diffusion method. Gas chromatography coupled to mass spectrometry (GC/MS) was used for analysis of the chemical profile of the EOs. Twenty compounds corresponding to 96% of the total essential oils were identified with 70% and 30% of the identified components being monoterpenes and sesquiterpenes, respectively. The essential oils of T. minuta revealed promising antibacterial activities against the test pathogens with Pseudomonas savastanoi pv. phaseolicola being the most susceptible with mean inhibition zone diameters of 41.83 and 44.83 mm after 24 and 48 hours, respectively. The minimum inhibitory concentrations and minimum bactericidal concentrations of the EOs on the test bacteria were in the ranges of 24–48 mg/mL and 95–190 mg/mL, respectively. These findings provide a scientific basis for the use of T. minuta essential oils as a botanical pesticide for management of phytopathogenic bacteria. PMID:27721831

  11. Antimicrobial Effect of Filipendula ulmaria Plant Extract Against Selected Foodborne Pathogenic and Spoilage Bacteria in Laboratory Media, Fish Flesh and Fish Roe Product

    Directory of Open Access Journals (Sweden)

    Charalampos Proestos

    2011-01-01

    Full Text Available Water-methanol extract from Filipendula ulmaria contains a variety of phenolic compounds, such as caffeic, p-coumaric and vanillic acid, myricetin, etc, which demonstrate antibacterial activity. Monitoring this activity in the broth using absorbance measurements showed that species of the Enterobacteriaceae family were more resistant than other Gram-negative and Gram-positive bacteria tested. Acidic environment enhanced the antibacterial activity of Filipendula ulmaria extract when it was tested against Salmonella Enteritidis PT4 and Listeria monocytogenes Scott A. The efficacy of Filipendula ulmaria extract against selected foodborne psychrotrophic bacteria was also tested using solid laboratory media and low incubation temperatures for better simulation of food preservation conditions. Higher concentrations of the extract, compared to minimum inhibitory concentration determined in the broth, were needed for satisfactory inhibition of spoilage bacteria. Potential use of Filipendula ulmaria extract as natural food preservative was also examined against natural spoilage flora and inoculated pathogenic bacteria on fish flesh and fish roe product (tarama salad. No significant differences of viable populations of spoilage or pathogenic bacteria were found between the treated samples and controls. Further trials of Filipendula ulmaria extract should be carried out in acidic foods with low fat and protein content, supplemented with additional adjuncts, in order to explore its potential as effective natural food antimicrobial agent.

  12. Albinism and disease causing pathogens in Tanzania: are alleles that are associated with OCA2 being maintained by balancing selection?

    Science.gov (United States)

    Tuli, Abbas M; Valenzuela, Robert K; Kamugisha, Erasmus; Brilliant, Murray H

    2012-12-01

    Oculocutaneous albinism type 2 (OCA2) is present at significantly higher frequencies in sub-Saharan African populations compared to populations in other regions of the world. In Tanzania and other sub-Saharan countries, most OCA2 is associated with a common 2.7kb deletion allele. Leprosy is also in high prevalence in sub-Saharan African populations. The infectious agent of leprosy, Mycobacterium leprae, contains a gene, 38L, that is similar to OCA2. Hypopigmented patches of skin are early symptoms that present with infection of leprosy. In consideration of both the genetic similarity of OCA2 and the 38L gene of M. leprae and the involvement of pigmentation in both disorders, we hypothesized that the high rates of OCA2 may be due to heterozygote advantage. Hence, we hypothesized that carriers of the 2.7kb deletion allele of OCA2 may provide a protective advantage from infection with leprosy. We tested this hypothesis by determining the carrier frequency of the 2.7kb deletion allele from a sample of 240 individuals with leprosy from Tanzania. The results were inconclusive due to the small sample size; however, they enabled us to rule out a large protective effect, but perhaps not a small advantage. Mycobacterium tuberculosis is another infectious organism prevalent in sub-Saharan Africa that contains a gene, arsenic-transport integral membrane protein that is also similar to OCA2. Interestingly, chromosomal region 15q11-13, which also contains OCA2, was reported to be linked to tuberculosis susceptibility. Although variants within OCA2 were tested for association, the 2.7kb deletion allele of OCA2 was not tested. This led us to hypothesize that the deletion allele may confer resistance to susceptibility. Confirmation of our hypothesis would enable development of novel pharmocogenetic therapies for the treatment of tuberculosis, which in turn, may enable development of drugs that target other pathogens that utilize a similar infection mechanism as M. tuberculosis

  13. No evidence for involvement of plasma proteins or blood-borne cells in amyloid plaque formation in scrapie-affected mice. An immunohistoperoxidase study

    NARCIS (Netherlands)

    Eikelenboom, P.; Scott, J. R.; McBride, P. A.; Rozemuller, J. M.; Bruce, M. E.; Fraser, H.

    1987-01-01

    The present study was designed to investigate blood-brain permeability and the possible involvement of plasma proteins and blood-borne cells in amyloid plaque formation in scrapie-affected mice. No abnormal extravasation of intravenously injected horseradish peroxidase (HRP) was found and with

  14. Chemiluminescent labels released from long spacer arm-functionalized magnetic particles: a novel strategy for ultrasensitive and highly selective detection of pathogen infections.

    Science.gov (United States)

    Yang, Haowen; Liang, Wenbiao; He, Nongyue; Deng, Yan; Li, Zhiyang

    2015-01-14

    Previously, the unique advantages provided by chemiluminescence (CL) and magnetic particles (MPs) have resulted in the development of many useful nucleic acid detection methods. CL is highly sensitive, but when applied to MPs, its intensity is limited by the inner filter-like effect arising from excess dark MPs. Herein, we describe a modified strategy whereby CL labels are released from MPs to eliminate this negative effect. This approach relies on (1) the magnetic capture of target molecules on long spacer arm-functionalized magnetic particles (LSA-MPs), (2) the conjugation of streptavidin-alkaline phosphatase (SA-AP) to biotinylated amplicons of target pathogens, (3) the release of CL labels (specifically, AP tags), and (4) the detection of the released labels. CL labels were released from LSA-MPs through LSA ultrasonication or DNA enzymolysis, which proved to be the superior method. In contrast to conventional MPs, LSA-MPs exhibited significantly improved CL detection, because of the introduction of LSA, which was made of water-soluble carboxymethylated β-1,3-glucan. Detection of hepatitis B virus with this technique revealed a low detection limit of 50 fM, high selectivity, and excellent reproducibility. Thus, this approach may hold great potential for early stage clinical diagnosis of infectious diseases.

  15. Invitro Evaluation Of Antibacterial Activity Of Lactic Acid Bacteria Isolated From Ergo And Qotchqotcha Ethiopian Traditional Fermented Foods Against Some Selected Food Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Lamenew Fenta

    2017-09-01

    Full Text Available The prevention of pathogenic bacteria by lactic acid bacteria LAB isolated directly from foods is an innovative approach. With the aim of determining the anti-bacterial activity of Lactic acid bacteria isolated from ergo and qotchqotcha Ethiopian fermented food 12 samples of each were taken from the 4 different kebeles of Assosa town. Isolation of LAB from the selected samples were carried out using MRS media. The different set of isolates were characterized using primary biochemical tests. Isolates which were gram positive catalase negative and KOH negative were considered to be presumptive LAB and further characterized by using different biochemical tests for further identification. 16 isolates from ergo samples were isolated. Based on Bergeys manual of determinative bacteriology the 16 isolates belonged to four 4 LAB species namely Lactobacillus acidophilus 18.75 Lactobacillus casei 31.25 Streptococcus thermophiles 25 and Lactobacillus bulgaricus 25. Likewise 5 isolates were isolated from Qotchqotcha and the five isolates were found to be Lactobacillus acidophilus 80 and Pediococcus acidilactici 20. Cell free solution from MRS broth culture of theses LAB was prepared and tested against Escherichia coli O157H7 and Staphylococcus aureus using agar-well diffusion method. Of the 16 isolates isolated from ergo 9 of them show antimicrobial activity against E. coli O157H7 with a largest inhibition zone measured about 7.331.20mm by EK0101 and 12 of them show antimicrobial activity against S. aureus with a largest inhibition zone measured about 11.66 0.88mm by EK0201. On the basis of morphological and biochemical test done EK0101 was found to be presumptive Lactobacillus acidophilus and EK0201 to be Streptococcus thermophiles. All of the isolates isolated from Qotchqotcha showed antimicrobial activity against the tested organisms though there was a significant difference in their activity P0.05. The isolate QK0201 showed an inhibition zone of about 6

  16. A multi-pathogen selective enrichment broth for simultaneous growth of Salmonella enteria, Escherichia coli O157:H7 and Shigella flexneri

    Science.gov (United States)

    Salmonella, Shigella, and Escherichia coli O157:H7 contaminate similar types of food and all three can cause foodborne disease. Traditional microbiological enrichment broths to detect these pathogens are different in terms of their composition, which limits the application of multi-pathogen detectio...

  17. Association of ABO and Rh Blood Groups to Blood-Borne Infections among Blood Donors in Tehran-Iran.

    Science.gov (United States)

    Mohammadali, Fatemeh; Pourfathollah, Aliakbar

    2014-07-01

    The aim of this study was to investigate the prevalence of hepatitis B, hepatitis C, HIV and syphilis infections in blood donors referred to Tehran Blood Transfusion Center (TBTC), and determine any association between blood groups and blood- borne infections between the years of 2005 and 2011. This was a retrospective study conducted at TBTC. All of the donor serum samples were screened for HBV, HCV, HIV and syphilis by using third generation ELISA kits and RPR test. Initial reactive samples were tested in duplicate. Confirmatory tests were performed on all repeatedly reactive donations. Blood group was determined by forward and reverse blood grouping. The results were subjected to chi square analysis for determination of statistical difference between the values among different categories according to SPSS program. Overall, 2031451 donor serum samples were collected in 2005-2011. Totally, 10451 were positive test for HBV, HCV, HIV and syphilis. The overall seroprevalence of HBV, HCV, HIV, and syphilis was 0.39%, 0.11%, 0.005%, and 0.010%, respectively. Hepatitis B and HIV infections were significantly associated with blood group of donors (P blood group "A" and percentage of HBs Ag was lower in donors who had blood group O. There was no significant association between Hepatitis C and syphilis infections with ABO and Rh blood groups (P>0.05). Compared with neighboring countries and the international standards, prevalence of blood-borne infections is relatively low.

  18. Families Living with Blood-Borne Viruses: The Case for Extending the Concept of “Serodiscordance”

    Directory of Open Access Journals (Sweden)

    Asha Persson

    2017-01-01

    Full Text Available The concept of “serodiscordance” (mixed infection status is primarily associated with epidemiological concerns about HIV transmission risk in couples. We make the case for extending this concept to include families with mixed HIV and viral hepatitis status. Social research on couples with mixed HIV and hepatitis C status has laid an important foundation for illuminating how experiences of serodiscordance within intimate partnerships are much broader than concerns about risk. This body of work attests to serodiscordance holding promise as a valuable concept for understanding viral infections as socially situated and intensely relational phenomena. However, serodiscordance is still limited as a concept because of its near universal focus on couples. It is rarely applied to wider relationships, including family networks beyond the couple. Despite evidence in the literature that families are affected by blood-borne viruses in multiple social, emotional, financial, and generational ways, the concept of serodiscordance does not capture these broader dynamics. Making serodiscordance more inclusive is an important step in recognising the diverse ways families’ everyday lives, relationships, and futures can be entangled with HIV, hepatitis C, and hepatitis B, and for understanding how today’s era of effective treatment options might shape the “family life” of viral infections.

  19. A physiological model of the interaction between tissue bubbles and the formation of blood-borne bubbles under decompression

    International Nuclear Information System (INIS)

    Chappell, M A; Payne, S J

    2006-01-01

    Under decompression, bubbles can form in the human body, and these can be found both within the body tissues and the bloodstream. Mathematical models for the growth of both types of bubbles have previously been presented, but they have not been coupled together. This work thus explores the interaction between the growth of tissue and blood-borne bubbles under decompression, specifically looking at the extent to which they compete for the common resource of inert gas held in solution in the tissues. The influence of tissue bubbles is found to be significant for densities as low as 10 ml -1 for tissues which are poorly perfused. However, the effects of formation of bubbles in the blood are not found until the density of bubble production sites reaches 10 6 ml -1 . From comparison of the model predictions with experimental evidence for bubbles produced in animals and man under decompression, it is concluded that the density of tissue bubbles is likely to have a significant effect on the number of bubbles produced in the blood. However, the density of nucleation sites in the blood is unlikely to be sufficiently high in humans for the formation of bubbles in the blood to have a significant impact on the growth of the bubbles in the tissue

  20. Pathogen intelligence

    Directory of Open Access Journals (Sweden)

    Michael eSteinert

    2014-01-01

    Full Text Available Different species inhabit different sensory worlds and thus have evolved diverse means of processing information, learning and memory. In the escalated arms race with host defense, each pathogenic bacterium not only has evolved its individual cellular sensing and behaviour, but also collective sensing, interbacterial communication, distributed information processing, joint decision making, dissociative behaviour, and the phenotypic and genotypic heterogeneity necessary for epidemiologic success. Moreover, pathogenic populations take advantage of dormancy strategies and rapid evolutionary speed, which allow them to save co-generated intelligent traits in a collective genomic memory. This review discusses how these mechanisms add further levels of complexity to bacterial pathogenicity and transmission, and how mining for these mechanisms could help to develop new anti-infective strategies.

  1. Physiological functions and pathogenic potential of uric acid: A review.

    Science.gov (United States)

    El Ridi, Rashika; Tallima, Hatem

    2017-09-01

    Uric acid is synthesized mainly in the liver, intestines and the vascular endothelium as the end product of an exogenous pool of purines, and endogenously from damaged, dying and dead cells, whereby nucleic acids, adenine and guanine, are degraded into uric acid. Mentioning uric acid generates dread because it is the established etiological agent of the severe, acute and chronic inflammatory arthritis, gout and is implicated in the initiation and progress of the metabolic syndrome. Yet, uric acid is the predominant anti-oxidant molecule in plasma and is necessary and sufficient for induction of type 2 immune responses. These properties may explain its protective potential in neurological and infectious diseases, mainly schistosomiasis. The pivotal protective potential of uric acid against blood-borne pathogens and neurological and autoimmune diseases is yet to be established.

  2. Blood-borne HIV: Risks and Prevention | Ramlagan | SAHARA-J ...

    African Journals Online (AJOL)

    The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more information about how to print, save, and work with PDFs, Highwire Press provides a helpful Frequently Asked Questions about PDFs.

  3. Prevalence of Sexually Transmitted Diseases and Blood-Borne Transmitted Infections among Male Patients with Antisocial Personality Disorder

    Directory of Open Access Journals (Sweden)

    Hamza Yıldız

    2015-03-01

    Full Text Available Objective: The aim of this study was to compare the patients who have antisocial personality disorder (ASPD and the healthy individuals in terms of sexually transmitted diseases (STDs and Blood-Borne Transmitted Infections (BTIs prevalences. Methods: This study is a prospective, single-center, open-label, non-randomized controlled clinical study. There were two groups in the study. The patient group consistsed of 100 males who were diagnosed as ASPD with a clinical interview form. The control group consisted of 98 healthy males who did not have any psychiatric disorder. Dermatologic examination was performed, and clinical findings were recorded. Results: The mean age of the patient group was 21.96±2.40 (range 20-37 years. The mean age of the control group was 24.20±2.88 (21-36 years. The most common disease was gonorrhea (25% followed by genital wart (11%, molluskum contagiosum (5%, HBsAg (4%, and HSV-2 seropositivity (4% in the patients group. In the control group, HSV-2 seropositivity (4.08%, genital wart (3.06%, molluskum contagiosum (3.06%, and gonorrhe (1.02% were commonly seen in the control group. STDs and/or BVTIs were found more common in the patients group (82% than that in the control group (45.91% (X2=30.62, p=0.000. Conclusions: The patients with ASPD are at greater risk than normal population to catch a STDs or BTIs because of their lower educational levels and riskier behaviors. This condition entertains a risk in the general population and the patients themselves.

  4. Transient virulence of emerging pathogens.

    Science.gov (United States)

    Bolker, Benjamin M; Nanda, Arjun; Shah, Dharmini

    2010-05-06

    Should emerging pathogens be unusually virulent? If so, why? Existing theories of virulence evolution based on a tradeoff between high transmission rates and long infectious periods imply that epidemic growth conditions will select for higher virulence, possibly leading to a transient peak in virulence near the beginning of an epidemic. This transient selection could lead to high virulence in emerging pathogens. Using a simple model of the epidemiological and evolutionary dynamics of emerging pathogens, along with rough estimates of parameters for pathogens such as severe acute respiratory syndrome, West Nile virus and myxomatosis, we estimated the potential magnitude and timing of such transient virulence peaks. Pathogens that are moderately evolvable, highly transmissible, and highly virulent at equilibrium could briefly double their virulence during an epidemic; thus, epidemic-phase selection could contribute significantly to the virulence of emerging pathogens. In order to further assess the potential significance of this mechanism, we bring together data from the literature for the shapes of tradeoff curves for several pathogens (myxomatosis, HIV, and a parasite of Daphnia) and the level of genetic variation for virulence for one (myxomatosis). We discuss the need for better data on tradeoff curves and genetic variance in order to evaluate the plausibility of various scenarios of virulence evolution.

  5. Antibacterial Mode of Action of the Essential Oil Obtained from Chamaecyparis obtusa Sawdust on the Membrane Integrity of Selected Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Vivek K. Bajpai

    2014-01-01

    Full Text Available The present study examines the possible antibacterial mechanism of action of the essential oil obtained from Chamaecyparis obtusa (COEO sawdust against foodborne pathogenic bacteria. The COEO was obtained by microwave-assisted hydrodistillation of C. obtusa sawdust. The minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of COEO against the tested foodborne pathogens including Bacillus cereus ATCC 13061, Listeria monocytogenes ATCC 7644, Staphylococcus aureus ATCC 12600, Salmonella Typhimurium ATCC 43174 and Escherichia coli ATCC 43889 were found in the range from 62.5 to 500 μg/mL and from 125 to 1000 μg/mL, respectively. At the MIC concentrations, the COEO had potential inhibitory effect on the cell viability of the tested bacteria. In addition, the scanning electron microscopic analysis confirmed the inhibitory effect of COEO by revealing significant morphological alterations or rupture of the cell membranes of B. cereus ATCC 13061 and E. coli ATCC 43889. Moreover, the mode of action of COEO on the cell membrane of both Gram-positive B. cereus ATCC 13061 and Gram-negative E. coli ATCC 43889 bacteria was confirmed by marked release of extracellular adenosine 5’-triphosphate (ATP and cellular material that absorbs at 260 nm, and by efflux of potassium ions. These findings suggest that COEO holds a broad-spectrum antibacterial efficacy, confirming its influence on the membrane integrity and morphological characteristics of tested foodborne pathogens.

  6. Prevalence of Blood-Borne Viruses in Health Care Workers of a Northern District in Pakistan: Risk Factors and Preventive Behaviors

    Directory of Open Access Journals (Sweden)

    Muhammad Zuhaib Khan

    2016-01-01

    Full Text Available Background. Blood-borne viral infections like viral hepatitis are highly prevalent in Pakistan. There is also a potential threat of human immunodeficiency virus (HIV spread in the country. Health care workers (HCWs are a high risk population for acquiring such viral infections and potential spread to the patients. This study aimed to determine the frequency of three blood-borne viruses: HCV, HBV, and HIV in HCWs of district Malakand in northern Khyber Pakhtunkhwa (KPK province of Pakistan. Moreover, risk factors and preventive behaviors among HCWs were investigated in detail. Materials and Methods. Prevalence was investigated using serological assays followed by real time polymerase chain reaction (RT-PCR based characterization. A total of 626 health care workers working at 17 different health care units, belonging to 6 different job categories, were included in this study. Results. HIV was not detected in the HCWs while rate of prevalence of HCV and HBV was far less (0.8 % and 0.64 %, resp. as compared to general population (4.7%–38%. The majority of HCWs were aware of the mode of spread of these viruses and associated risk factors. Needle stick injury was found to be the most important risk factor for possible acquisition of these infections.

  7. Isolation and antimicrobial drug susceptibility pattern of bacterial pathogens from pediatric patients with otitis media in selected health institutions, Addis Ababa, Ethiopia: a prospective cross-sectional study.

    Science.gov (United States)

    Hailegiyorgis, Tewodros Tesfa; Sarhie, Wondemagegn Demsiss; Workie, Hailemariam Mekonnen

    2018-01-01

    Otitis media is inflammation of the middle ear and tympanic membrane, which often occurs after an acute upper respiratory tract infection. It is the most common episode of infection in children and the second most important cause of hearing loss affecting 1.23 billion people, thus ranked fifth global burden of disease with a higher incidence in sub-Saharan Africa. Thus, the aim of this study was to determine the isolation rate of bacterial pathogens from pediatric patients with otitis media. Institutional based cross-sectional study was conducted from January 2013-June 2014 in Addis Ababa among 210 pediatrics patients. Demographic, clinical and associated factors data was obtained in face to face interview with guardians/parents by 5 trained nurse data collectors using structured questionnaire. Middle ear drainage swab was collected following all aseptic procedures and transported to the microbiology laboratory. Culture and Antimicrobial sensitivity test were performed according to the standards. The data quality was assured by questionnaire translation, retranslation and pretesting. Reference strains were used as a positive and negative control for biochemical tests, and culture results were cross checked. Data was checked for completeness, consistency and then entered into Epi Info v3.5.1 and analyzed by SPSS v20. Data interpretation was made using graphs, tables, and result statements. A total of 196 middle ear drainage swab samples were analyzed from pediatric patients and of those 95 (48.5%) samples were positive for pathogenic organisms. The major isolate was S. aureus (15.8%) followed by P. aeruginosa (10.9%), Viridians streptococcus (9.9%), S. pneumoniae (8.9%) and S. pyogenes (7.9%). Upper respiratory tract infection history and living in the rural area have shown significant association with the isolation of pathogenic organism, ( p-value = 0.035) and ( p-value = 0.003) respectively. Most of the isolates show a high level of resistance to

  8. Variation in the annual unsatisfactory rates of selected pathogens and indicators in ready-to-eat food sampled from the point of sale or service in Wales, United Kingdom.

    Science.gov (United States)

    Meldrum, R J; Garside, J; Mannion, P; Charles, D; Ellis, P

    2012-12-01

    The Welsh Food Microbiological Forum "shopping basket" survey is a long running, structured surveillance program examining ready-to-eat food randomly sampled from the point of sale or service in Wales, United Kingdom. The annual unsatisfactory rates for selected indicators and pathogens for 1998 through 2008 were examined. All the annual unsatisfactory rates for the selected pathogens were <0.5%, and no pattern with the annual rate was observed. There was also no discernible trend observed for the annual rates of Listeria spp. (not moncytogenes), with all rates <0.5%. However, there was a trend observed for Esherichia coli, with a decrease in rate between 1998 and 2003, rapid in the first few years, and then a gradual increase in rate up to 2008. It was concluded that there was no discernible pattern to the annual unsatisfactory rates for Listeria spp. (not monocytogenes), L. monocytogenes, Staphylococcus aureus, and Bacillus cereus, but that a definite trend had been observed for E. coli.

  9. CHROMagar COL-APSE: a selective bacterial culture medium for the isolation and differentiation of colistin-resistant Gram-negative pathogens

    DEFF Research Database (Denmark)

    Abdul Momin, Muhd Haziq F; Bean, David C; Hendriksen, Rene S.

    2017-01-01

    Purpose. A selective chromogenic culture medium for the laboratory isolation and differentiation of colistin resistant Acinetobacter, Pseudomonas, Stenotrophomonas and Enterobacteriaceae spp. (CHROMagar COL-APSE) was developed, evaluated and compared to an existing selective bacterial culture......-resistant non-fermentative bacteria (Acinetobacter, Pseudomonas and Stenotrophomonas). CHROMagar COL-APSE was also more sensitive in supporting the growth of Enterobacteriaceae with COL resistance associated with the carriage of mcr-1. Conclusion. CHROMagar COL-APSE is a sensitive and specific medium...

  10. Ecological niche of plant pathogens

    Directory of Open Access Journals (Sweden)

    Ecaterina Fodor

    2011-06-01

    Full Text Available Disease ecology is a new approach to the understanding of the spread and dynamics of pathogens in natural and man-made environments. Defining and describing the ecological niche of the pathogens is one of the major tasks for ecological theory, as well as for practitioners preoccupied with the control and forecasting of established and emerging diseases. Niche theory has been periodically revised, not including in an explicit way the pathogens. However, many progresses have been achieved in niche modeling of disease spread, but few attempts were made to construct a theoretical frame for the ecological niche of pathogens. The paper is a review of the knowledge accumulated during last decades in the niche theory of pathogens and proposes an ecological approach in research. It quest for new control methods in what concerns forest plant pathogens, with a special emphasis on fungi like organisms of the genus Phytophthora. Species of Phytophthora are the most successful plant pathogens of the moment, affecting forest and agricultural systems worldwide, many of them being invasive alien organisms in many ecosystems. The hyperspace of their ecological niche is defined by hosts, environment and human interference, as main axes. To select most important variables within the hyperspace, is important the understanding of the complex role of pathogens in the ecosystems as well as for control programs. Biotic relationships within ecosystem of host-pathogen couple are depicted by ecological network and specific metrics attached to this. The star shaped network is characterized by few high degree nodes, by short path lengths and relatively low connectivity, premises for a rapid disturbance spread. 

  11. Ecological niche of plant pathogens

    Directory of Open Access Journals (Sweden)

    Ecaterina Fodor

    2011-02-01

    Full Text Available Disease ecology is a new approach to the understanding of the spread and dynamics of pathogens in natural and man-made environments. Defining and describing the ecological niche of the pathogens is one of the major tasks for ecological theory, as well as for practitioners preoccupied with the control and forecasting of established and emerging diseases. Niche theory has been periodically revised, not including in an explicit way the pathogens. However, many progresses have been achieved in niche modeling of disease spread, but few attempts were made to construct a theoretical frame for the ecological niche of pathogens. The paper is a review of the knowledge accumulated during last decades in the niche theory of pathogens and proposes an ecological approach in research. It quest for new control methods in what concerns forest plant pathogens, with a special emphasis on fungi like organisms of the genus Phytophthora. Species of Phytophthora are the most successful plant pathogens of the moment, affecting forest and agricultural systems worldwide, many of them being invasive alien organisms in many ecosystems. The hyperspace of their ecological niche is defined by hosts, environment and human interference, as main axes. To select most important variables within the hyperspace, is important for the understanding of the complex role of pathogens in the ecosystems as well as for control programs. Biotic relationships within ecosystem of host-pathogen couple are depicted by ecological network and specific metrics attached to this. The star shaped network is characterized by few high degree nodes, by short path lengths and relatively low connectivity, premises for a rapid disturbance spread.

  12. Effect of gamma rays in embryogenic callus of agave tequilana weber var. blue and in vitro selection for resistance to pathogens

    International Nuclear Information System (INIS)

    Rubluo, A.; Brunner, I.; Rodriguez-Garay, B.; Rodriguez-Dominguez, J.M.; Santacruz-Ruvalcava, F.; De la Cruz, E.; Gonzalez, J.

    1999-01-01

    Agave tequilana from which tequila is done, suffers genetic erosion leaving the plant susceptible to pathogens. Recently, a pest invades the tequilana fields. To face this problem we designed experiments to induce mutations for disease resistance. Our aims were: to analyse the in vitro responses of embryogenic callus exposed to gamma rays, to determine the LD50 and challenge surviving embryos to crude bacterial extracts (CBE). Axillary buds were cultured in vitro. Leaves from the former plant lets were used as explants to induce embryogenic callus. Samples of 1g embryogenic callus were irradiated from 5 to 40 Gy of CO 60 gamma rays. Effects were recorded at 15, 30 and 45 days after irradiation. The CBE was obtained from isolated bacteria collected from sick field plants. Embryogenic calli were irradiated at 0, 15, 25 and 40 Gy and challenged with the CBE at 0, 10 and 20 % v/v. Embryo expression (globular, white and green cucumber shaped) were affected as a function of the dose. However at low doses (5-15 Gy) globular forms increased its production. On the contrary , green cucumber shaped embryos were severely affected. However, even at high doses (30, 35 and 40 Gy) healthy green forms were recorded. When the embryogenic callus was challenged to the CBE, high mortality was recorded, although, some green forms survived at high radiation doses and high CBE concentrations. Because of the unicellular origin of the somatic embryos, solid mutants can be expected

  13. Biogenic nanosilver incorporated reverse osmosis membrane for antibacterial and antifungal activities against selected pathogenic strains: an enhanced eco-friendly water disinfection approach.

    Science.gov (United States)

    Manjumeena, R; Duraibabu, D; Sudha, J; Kalaichelvan, P T

    2014-01-01

    Reverse osmosis (RO) membranes have been used extensively in water desalination plants, waste water treatment in industries, agricultural farms and drinking water production applications. The objective of this work is to impart antibacterial and antifungal activities to commercially available RO membrane used in water purification systems by incorporating biogenic silver nanoparticles(AgNPs) synthesized using Rosa indica wichuriana hybrid leaf extract. The morphology and surface topography of uncoated and AgNPs-coated RO membrane were studied using Scanning Electron Microscopy (SEM) and Atomic Force Microscopy (AFM). Elemental composition of the AgNPs-coated RO membrane was analyzed by energy-dispersive X-ray spectroscopy (EDAX). The functional groups were identified by Fourier Transform Infrared spectroscopy (FT-IR). Hydrophilicity of the uncoated and AgNPs-coated RO membrane was analyzed using water contact angle measurements. The thermal properties were studied by thermogravimetric analysis (TGA). The AgNPs incorporated RO membrane exhibited good antibacterial and antifungal activities against pathogenic bacterial strains such as E. coli, S. aureus, M. luteus, K. pneumoniae, and P. aeruginosa and fungal strains such as Candida tropicalis, C. krusei, C. glabrata, and C. albicans.

  14. Growth inhibition of pathogenic bacteria and some yeasts by selected essential oils and survival of L. monocytogenes and C. albicans in apple-carrot juice.

    Science.gov (United States)

    Irkin, Reyhan; Korukluoglu, Mihriban

    2009-04-01

    Food safety is a fundamental concern of both consumers and the food industry. The increasing incidence of foodborne diseases increases the demand of using antimicrobials in foods. Spices and plants are rich in essential oils and show inhibition activity against microorganisms, which are composed of many compounds. In this research, effects of garlic, bay, black pepper, origanum, orange, thyme, tea tree, mint, clove, and cumin essential oils on Listeria monocytogenes AUFE 39237, Escherichia coli ATCC 25922, Salmonella enteritidis ATCC 13076, Proteus mirabilis AUFE 43566, Bacillus cereus AUFE 81154, Saccharomyces uvarum UUFE 16732, Kloeckera apiculata UUFE 10628, Candida albicans ATCC 10231, Candida oleophila UUPP 94365, and Metschnikowia fructicola UUPP 23067 and effects of thyme oil at a concentration of 0.5% on L. monocytogenes and C. albicans in apple-carrot juice during +4 degrees C storage (first to fifth day) were investigated. Strong antibacterial and antifungal activities of some essential oils were found. Thyme, origanum, clove, and orange essential oils were the most inhibitory against bacteria and yeasts. Cumin, tea tree, and mint oils inhibited the yeasts actively. It is concluded that some essential oils could be used as potential biopreservatives capable of controlling foodborne pathogens and food spoilage yeasts.

  15. [Public health, damage containment and the prevention of blood-borne and sexually transmitted infections: a review of the core concepts and their implementation in Brazil].

    Science.gov (United States)

    Elias, Lucília de Almeida; Bastos, Francisco Inacio

    2011-12-01

    This article assesses the historical context and the conceptual frame of setting up damage containment programs in the field of public health, with special emphasis on the Brazilian experience. The survey seeks to assess the relevance of such programs in the ongoing efforts to curb the spread of blood-borne and sexually transmitted infections, especially AIDS and hepatitis C. Findings from both the Brazilian and the international literature demonstrate that practical damage containment initiatives tend to be more effective when integrated with other public health measures based on common goals. Damage containment initiatives, aligned with the basic principles of public health do not limit themselves to a priori models or health care per se. They encompass a variety of pragmatic measures based on public policies and should be in line with the demands of the communities since the moment of their inception and implemented in the context of full partnership with such communities.

  16. Emerging Pathogens Initiative (EPI)

    Data.gov (United States)

    Department of Veterans Affairs — The Emerging Pathogens Initiative (EPI) database contains emerging pathogens information from the local Veterans Affairs Medical Centers (VAMCs). The EPI software...

  17. Strong positive selection and recombination drive the antigenic variation of the PilE protein of the human pathogen Neisseria meningitidis.

    Science.gov (United States)

    Andrews, T Daniel; Gojobori, Takashi

    2004-01-01

    The PilE protein is the major component of the Neisseria meningitidis pilus, which is encoded by the pilE/pilS locus that includes an expressed gene and eight homologous silent fragments. The silent gene fragments have been shown to recombine through gene conversion with the expressed gene and thereby provide a means by which novel antigenic variants of the PilE protein can be generated. We have analyzed the evolutionary rate of the pilE gene using the nucleotide sequence of two complete pilE/pilS loci. The very high rate of evolution displayed by the PilE protein appears driven by both recombination and positive selection. Within the semivariable region of the pilE and pilS genes, recombination appears to occur within multiple small sequence blocks that lie between conserved sequence elements. Within the hypervariable region, positive selection was identified from comparison of the silent and expressed genes. The unusual gene conversion mechanism that operates at the pilE/pilS locus is a strategy employed by N. meningitidis to enhance mutation of certain regions of the PilE protein. The silent copies of the gene effectively allow "parallelized" evolution of pilE, thus enabling the encoded protein to rapidly explore a large area of sequence space in an effort to find novel antigenic variants.

  18. Applied Genomics of Foodborne Pathogens

    DEFF Research Database (Denmark)

    and customized source of information designed for and accessible to microbiologists interested in applying cutting-edge genomics in food safety and public health research. This book fills this void with a well-selected collection of topics, case studies, and bioinformatics tools contributed by experts......This book provides a timely and thorough snapshot into the emerging and fast evolving area of applied genomics of foodborne pathogens. Driven by the drastic advance of whole genome shot gun sequencing (WGS) technologies, genomics applications are becoming increasingly valuable and even essential...... at the forefront of foodborne pathogen genomics research....

  19. Determination of antimicrobial resistance to extended-spectrum cephalosporin, quinolones, and vancomycin in selected human enteric pathogens from Prince Edward Island, Canada.

    Science.gov (United States)

    Awosile, Babafela; German, Gregory; Rodriguez-Lecompte, Juan Carlos; Saab, Matthew E; Heider, Luke C; McClure, J Trenton

    2018-04-05

    The aim of this study was to determine the frequency of fecal carriage of vancomycin-resistant Enterococcus spp. and Escherichia coli with reduced susceptibilities to extended-spectrum cephalosporins (ESCs) and quinolones in humans on Prince Edward Island, Canada. Convenience fecal samples from individuals on Prince Edward Island were screened phenotypically using selective culture and genotypically using multiplex polymerase chain reactions to detect E. coli and Enterococcus spp. resistant to critically important antimicrobials. Twenty-six (5.3%) of 489 individuals had E. coli with reduced susceptibility to ESCs. Twenty-five (96.2%) of the 26 isolates harbored bla TEM , 18 (69.2%) harbored bla CMY-2 , 16 (61.5%) harbored bla CTX-M groups, 2 (7.7%) harbored bla SHV genes. None of the ESC-resistant E. coli was positive for carbapenem resistance. Twenty-one (8.3%) of 253 individuals had E. coli isolates with reduced quinolone susceptibility. All 21 isolates were positive for at least 1 qnr gene, with 3 (14.3%) isolates positive for qnrB, 5 (23.8%) positive for qnrS, and 13 (61.9%) positive for both qnrB and qnrS genes. All the enterococci isolates were vancomycin-susceptible. Higher susceptibility to the critically important antimicrobials was found in this study. This study can serve as a baseline for future antimicrobial resistance surveillance within this region.

  20. Quantitative real-time PCR combined with propidium monoazide for the selective quantification of viable periodontal pathogens in an in vitro subgingival biofilm model.

    Science.gov (United States)

    Sánchez, M C; Marín, M J; Figuero, E; Llama-Palacios, A; León, R; Blanc, V; Herrera, D; Sanz, M

    2014-02-01

    Differentiation of live and dead cells is an important challenge when using molecular diagnosis for microbial identification. This is particularly relevant when bacteria have been exposed to antimicrobial agents. The objective of this study was to test a method using quantitative real-time polymerase chain reaction (qPCR) combined with propidium monoazide (PMA), developed for the selective quantification of viable P. gingivalis, A. actinomycetemcomitans, F. nucleatum and total bacteria in an in vitro biofilm model after antimicrobial treatment. PMA-qPCR method was tested in an in vitro biofilm model, using isopropyl alcohol as the antimicrobial agent. Matured biofilms were exposed for 1, 5, 10 and 30 min to isopropyl alcohol by immersion. Biofilms were disrupted and PMA added (final concentration of 100 μm). After DNA isolation, qPCR was carried out using specific primers and probes for the target bacteria. The differentiation of live and dead cells was tested by analysis of variance. When PMA was used in the presence of viable target bacterial cells, no statistically significant inhibition of qPCR amplification was detected (p > 0.05 in all cases). Conversely, after immersion in isopropyl alcohol of the biofilm, PMA resulted in a significant total reduction of qPCR amplification of about 4 log10 . P. gingivalis showed a vitality reduction in the biofilm of 3 log10 , while A. actinomycetemcomitans and F. nucleatum showed a 2 log10 reduction. These results demonstrate the efficiency of PMA for differentiating viable and dead P. gingivalis, A. actinomycetemcomitans and F. nucleatum cells, as well as total bacteria, in an in vitro biofilm model, after being exposed to an antimicrobial agent. Hence, this PMA-qPCR method may be useful for studying the effect of antimicrobial agents aimed at oral biofilms. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. AMPK in Pathogens

    OpenAIRE

    Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal

    2016-01-01

    During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...

  2. HIV, Other Blood-Borne Viruses and Sexually Transmitted Infections amongst Expatriates and Travellers to Low- and Middle-Income Countries: A Systematic Review

    Science.gov (United States)

    Crawford, Gemma; Lobo, Roanna; Brown, Graham; Macri, Chloe; Smith, Hannah; Maycock, Bruce

    2016-01-01

    In some high-income countries, a proportion of human immunodeficiency virus (HIV), other blood-borne virus (BBV) or sexually transmitted infection (STI) diagnoses have been reported as acquired overseas in low- and middle-income countries. A review was conducted to explore HIV, other BBV or STI related knowledge, risk behavior and acquisition amongst expatriates and travelers, particularly males, travelling from high to low- and middle-income countries. Seven academic databases were searched for 26 peer reviewed articles that met inclusion criteria. Significant variability in the studies was noted, in age, travel duration and frequency and outcomes/risk factors measured and reported on. Risk factors described included longer duration of stay; being single; travel for romance or sex; alcohol and other drug use; lack of travel advice; being male; higher number of sexual partners; and inconsistent condom use. Vaccination, pre-travel health advice, and having fewer sexual partners were described as protective. Studies are needed focusing on the social context in which risk-taking occurs. Better collaboration is essential to deliver comprehensive health promotion interventions alongside more consistent pre- and post- travel testing and advice. Policy measures are crucial, including consistent evaluation indicators to assess impacts of HIV, other BBVs or STIs in the context of mobility. Risks and responses for these epidemics are shared globally. PMID:27999275

  3. Deceased Organ Donors With a History of Increased Risk Behavior for the Transmission of Blood-Borne Viral Infection: The UK Experience.

    Science.gov (United States)

    Trotter, Patrick B; Summers, Dominic M; Robb, Matthew; Hulme, William; Ushiro-Lumb, Ines; Watson, Christopher J E; Neuberger, James; Bradley, J Andrew

    2017-07-01

    Deceased organ donors are routinely screened for behaviors that increase the risk of transmissible blood-borne viral (BBV) infection, but the impact of this information on organ donation and transplant outcome is not well documented. Our aim was to establish the impact of such behavior on organ donation and utilization, as well transplant recipient outcomes. We identified all UK deceased organ donors from 2003 to 2015 with a disclosed history of increased risk behavior (IRB) including intravenous drug use (IVDU), imprisonment and increased risk sexual behavior. Of 17 262 potential donors, 659 (3.8%) had IRB for BBV and 285 (1.7%) were seropositive for BBV, of whom half had a history of IRB (mostly IVDU [78.5%]). Of actual donors with IRB, 393 were seronegative for viral markers at time of donation. A history of recent IVDU was associated with fewer potential donors proceeding to become actual organ donors (64% vs 75%, P = 0.007). Donors with IRB provided 1091 organs for transplantation (624 kidneys and 467 other organs). Transplant outcome was similar in recipients of organs from donors with and without IRB. There were 3 cases of unexpected hepatitis C virus transmission, all from an active IVDU donor who was hepatitis C virus seronegative at time of donation, but was found to be viremic on retrospective testing. Donors with a history of IRB provide a valuable source of organs for transplantation with good transplant outcomes and there is scope for increasing the use of organs from such donors.

  4. Evaluation of mericon E. coli O157 Screen Plus and mericon E. coli STEC O-Type Pathogen Detection Assays in Select Foods: Collaborative Study, First Action 2017.05.

    Science.gov (United States)

    Bird, Patrick; Benzinger, M Joseph; Bastin, Benjamin; Crowley, Erin; Agin, James; Goins, David; Armstrong, Marcia

    2018-05-01

    QIAGEN mericon Escherichia coli O157 Screen Plus and mericon E. coli Shiga toxin-producing E. coli (STEC) O-Type Pathogen Detection Assays use Real-Time PCR technology for the rapid, accurate detection of E. coli O157 and the "big six" (O26, O45, O103, O111, O121, O145) (non-O157 STEC) in select food types. Using a paired study design, the assays were compared with the U.S. Department of Agriculture, Food Safety Inspection Service Microbiology Laboratory Guidebook Chapter 5.09 reference method for the detection of E. coli O157:H7 in raw ground beef. Both mericon assays were evaluated using the manual and an automated DNA extraction method. Thirteen technicians from five laboratories located within the continental United States participated in the collaborative study. Three levels of contamination were evaluated. Statistical analysis was conducted according to the probability of detection (POD) statistical model. Results obtained for the low-inoculum level test portions produced a difference between laboratories POD (dLPOD) value with a 95% confidence interval of 0.00 (-0.12, 0.12) for the mericon E. coli O157 Screen Plus with manual and automated extraction and mericon E. coli STEC O-Type with manual extraction and -0.01 (-0.13, 0.10) for the mericon E. coli STEC O-Type with automated extraction. The dLPOD results indicate equivalence between the candidate methods and the reference method.

  5. The making of a new pathogen

    DEFF Research Database (Denmark)

    Stukenbrock, Eva; Bataillon, Thomas; Dutheil, Julien

    2011-01-01

    that gene-rich regions or regions with low recombination experience stronger effects of natural selection on neutral diversity. Emergence of a new agricultural host selected a highly specialized and fast-evolving pathogen with unique evolutionary patterns compared with its wild relatives. The strong impact...

  6. Evaluation of an e-learning package to improve understanding of blood-borne viruses amongst prison staff in Wales, UK.

    Science.gov (United States)

    Ellen Perrett, Stephanie; Erricker, Mark; Lyons, Marion

    2014-01-01

    The purpose of this paper is to provide education on blood-borne viruses (BBVs) to prison staff to help reduce stigma within the prisons, improve the care prisoners receive and reduce the risk of occupational transmission. An e-module was used to improve staff understanding of hepatitis B (HBV), hepatitis C (HCV) and HIV at a prison in Wales, UK. An assessment was used to gather data on prison staff understanding of BBVs prior to undertaking the e-module. In total, 530/697 (76 per cent) prison staff completed the BBV e-module. Average pre- and post-course assessment scores were 8.6/11 and 10.85/11, respectively. Most staff understood the modes of hepatitis transmission, however, gaps in understanding were highlighted. In total, 22 per cent of staff believed HBV and HCV were airborne, 9 per cent believed transmission occurred through sharing cutlery. In total, 31 per cent of staff believed prisoners with hepatitis should declare their status to the prison. Practical implications: The e-module significantly improved staff understanding of BBVs and should be incorporated into future prison training packages. Future education should include how BBVs are not transmitted with an emphasis on casual contact. Medical confidentiality in prisons should also be addressed. Improving understanding will help reduce the stigma of BBVs within prison and improve the multidisciplinary care the prisoner receives. To the authors knowledge this is the first published evaluation of a BBV learning package for custodial staff. Evaluation of this educational package demonstrates a unique and valuable insight into the general understanding of BBVs by prison staff in Wales, UK.

  7. Blood-borne interleukin-1β acts on the subfornical organ to upregulate the sympathoexcitatory milieu of the hypothalamic paraventricular nucleus.

    Science.gov (United States)

    Wei, Shun-Guang; Yu, Yang; Felder, Robert B

    2018-03-01

    We previously reported that microinjection of the proinflammatory cytokine interleukin-1β (IL-1β) into the subfornical organ (SFO) elicits a pressor response accompanied by increases in inflammation and renin-angiotensin system (RAS) activity in the SFO and hypothalamic paraventricular nucleus (PVN). The present study sought to determine whether blood-borne IL-1β induces similar neurochemical changes in the SFO and PVN and, if so, whether increased inflammation and RAS activity at the SFO level orchestrate the sympathoexcitatory response to circulating IL-1β. In urethane-anesthetized male Sprague-Dawley rats, intravenous injection of IL-1β (500 ng) increased blood pressure, heart rate, renal sympathetic nerve activity, and mRNA for angiotensin-converting enzyme, angiotensin II type 1a receptor, cyclooxygenase-2, tumor necrosis factor-α, and IL-1β, as well as the tumor necrosis factor-α p55 receptor and the IL-1 receptor, in the SFO and PVN. Pretreatment with SFO microinjections of the angiotensin II type 1a receptor blocker losartan (1 µg), the angiotensin-converting enzyme inhibitor captopril (1 µg), or the cyclooxygenase-2 inhibitor NS-398 (2 µg) attenuated expression of these excitatory mediators in the SFO and downstream in the PVN and the IL-1β-induced pressor responses. An SFO lesion minimized the IL-1β-induced expression of inflammatory and RAS components as well as c-Fos, an indicator of neuronal excitation, in the PVN. These studies demonstrate that circulating IL-1β, which increases in cardiovascular disorders such as hypertension and heart failure, acts on the SFO to increase inflammation and RAS activity in the SFO and PVN and that intervening in these neurochemical processes in the SFO can significantly reduce the sympathetic response.

  8. AMPK in Pathogens.

    Science.gov (United States)

    Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo

    2016-01-01

    During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.

  9. Potatoes, pathogens and pests

    NARCIS (Netherlands)

    Lazebnik, Jenny

    2017-01-01

    Currently, fungicides are necessary to protect potato crops against late blight, Phytophthora infestans, one of the world’s most damaging crop pathogens. The introgression of plant resistance genes from wild potato species targeted specifically to the late blight pathogen into

  10. Food-borne pathogens

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1985-01-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process

  11. Pathogen inactivation techniques.

    Science.gov (United States)

    Pelletier, J P R; Transue, S; Snyder, E L

    2006-01-01

    The desire to rid the blood supply of pathogens of all types has led to the development of many technologies aimed at the same goal--eradication of the pathogen(s) without harming the blood cells or generating toxic chemical agents. This is a very ambitious goal, and one that has yet to be achieved. One approach is to shun the 'one size fits all' concept and to target pathogen-reduction agents at the Individual component types. This permits the development of technologies that might be compatible with, for example, plasma products but that would be cytocidal and thus incompatible with platelet concentrates or red blood cell units. The technologies to be discussed include solvent detergent and methylene blue treatments--designed to inactivate plasma components and derivatives; psoralens (S-59--amotosalen) designed to pathogen-reduce units of platelets; and two products aimed at red blood cells, S-303 (a Frale--frangible anchor-linker effector compound) and Inactine (a binary ethyleneimine). A final pathogen-reduction material that might actually allow one material to inactivate all three blood components--riboflavin (vitamin B2)--is also under development. The sites of action of the amotosalen (S-59), the S-303 Frale, Inactine, and riboflavin are all localized in the nucleic acid part of the pathogen. Solvent detergent materials act by dissolving the plasma envelope, thus compromising the integrity of the pathogen membrane and rendering it non-infectious. By disrupting the pathogen's ability to replicate or survive, its infectivity is removed. The degree to which bacteria and viruses are affected by a particular pathogen-reducing technology relates to its Gram-positive or Gram-negative status, to the sporulation characteristics for bacteria, and the presence of lipid or protein envelopes for viruses. Concerns related to photoproducts and other breakdown products of these technologies remain, and the toxicology of pathogen-reduction treatments is a major ongoing area

  12. Processes for managing pathogens.

    Science.gov (United States)

    Godfree, Alan; Farrell, Joseph

    2005-01-01

    Wastewater contains human, animal, and plant pathogens capable of causing viral, bacterial, or parasitic infections. There are several routes whereby sewage pathogens may affect human health, including direct contact, contamination of food crops, zoonoses, and vectors. The range and numbers of pathogens in municipal wastewater vary with the level of endemic disease in the community, discharges from commercial activities, and seasonal factors. Regulations to control pathogen risk in the United States and Europe arising from land application of biosolids are based on the concept of multiple barriers to the prevention of transmission. The barriers are (i) treatment to reduce pathogen content and vector attraction, (ii) restrictions on crops grown on land to which biosolids have been applied, and (iii) minimum intervals following application and grazing or harvesting. Wastewater treatment reduces number of pathogens in the wastewater by concentrating them with the solids in the sludge. Although some treatment processes are designed specifically to inactivate pathogens, many are not, and the actual mechanisms of microbial inactivation are not fully understood for all processes. Vector attraction is reduced by stabilization (reduction of readily biodegradable material) and/or incorporation immediately following application. Concerns about health risks have renewed interest in the effects of treatment (on pathogens) and advanced treatment methods, and work performed in the United States suggests that Class A pathogen reduction can be achieved less expensively than previously thought. Effective pathogen risk management requires control to the complete chain of sludge treatment, biosolids handling and application, and post-application activities. This may be achieved by adherence to quality management systems based on hazard analysis critical control point (HACCP) principles.

  13. Cross sectional study of factors associated to self-reported blood-borne infections among drug users.

    Science.gov (United States)

    Reyes-Urueña, Juliana; Brugal, M Teresa; Majo, Xavier; Domingo-Salvany, Antonia; Caylà, Joan A

    2015-11-13

    The study's aim was to estimate the self-reported prevalence of Human Immunodeficiency Virus (HIV) and Hepatitis C Virus (HCV), and to describe their associated risk factors in a population of users of illicit drugs recruited in Catalonia- Spain, during 2012. Cross-sectional study. People with illicit drugs use were selected in three different types of healthcare centres. The questionnaire was a piloted, structured ad hoc instrument. An analysis was made to identify factors associated to self-reported HCV, HIV and co-infection. Correlates of reported infections were determined using univariate and multivariate Poisson regression (with robust variance). Among 512 participants, 39.65% self-reported positive serostatus for HCV and 14.84% for HIV, co-infection was reported by 13.48%. Among the 224 injecting drug users (IDUs), 187 (83.48%), 68 (30.36%) and 66 (29.46%) reported being positive for HCV, HIV and co-infection, respectively. A higher proportion of HIV-infected cases was observed among women, (18.33% vs. 13.78% in men). Prevalence of HCV, HIV and co-infection were higher among participants with early onset of drug consumption, long periods of drug injection or who were unemployed. A positive serostatus was self-reported by 21(7.34%) participants who did not report any injection; among them 16 and eight, reported being positive for HCV and HIV, respectively; three reported co-infection. Only two people declared exchanging sex for money. For those that reported a negative test, the median time since the last HIV test was 11.41 months (inter-quartile range (IQR) 4-12) and for the HCV test was 4.5 months (IQR 2-7). Among drug users in Catalonia, HIV, HCV and co-infection prevalence are still a big issue especially among IDUs. Women and drug users who have never injected drugs are groups with a significant risk of infection; this might be related to their high-risk behaviours and to being unaware of their serological status.

  14. Overexpression of Differentially Expressed Genes Identified in Non-pathogenic and Pathogenic Entamoeba histolytica Clones Allow Identification of New Pathogenicity Factors Involved in Amoebic Liver Abscess Formation.

    Directory of Open Access Journals (Sweden)

    Martin Meyer

    2016-08-01

    Full Text Available We here compared pathogenic (p and non-pathogenic (np isolates of Entamoeba histolytica to identify molecules involved in the ability of this parasite to induce amoebic liver abscess (ALA-like lesions in two rodent models for the disease. We performed a comprehensive analysis of 12 clones (A1-A12 derived from a non-pathogenic isolate HM-1:IMSS-A and 12 clones (B1-B12 derived from a pathogenic isolate HM-1:IMSS-B. "Non-pathogenicity" included the induction of small and quickly resolved lesions while "pathogenicity" comprised larger abscess development that overstayed day 7 post infection. All A-clones were designated as non-pathogenic, whereas 4 out of 12 B-clones lost their ability to induce ALAs in gerbils. No correlation between ALA formation and cysteine peptidase (CP activity, haemolytic activity, erythrophagocytosis, motility or cytopathic activity was found. To identify the molecular framework underlying different pathogenic phenotypes, three clones were selected for in-depth transcriptome analyses. Comparison of a non-pathogenic clone A1np with pathogenic clone B2p revealed 76 differentially expressed genes, whereas comparison of a non-pathogenic clone B8np with B2p revealed only 19 differentially expressed genes. Only six genes were found to be similarly regulated in the two non-pathogenic clones A1np and B8np in comparison with the pathogenic clone B2p. Based on these analyses, we chose 20 candidate genes and evaluated their roles in ALA formation using the respective gene-overexpressing transfectants. We conclude that different mechanisms lead to loss of pathogenicity. In total, we identified eight proteins, comprising a metallopeptidase, C2 domain proteins, alcohol dehydrogenases and hypothetical proteins, that affect the pathogenicity of E. histolytica.

  15. Overexpression of Differentially Expressed Genes Identified in Non-pathogenic and Pathogenic Entamoeba histolytica Clones Allow Identification of New Pathogenicity Factors Involved in Amoebic Liver Abscess Formation.

    Science.gov (United States)

    Meyer, Martin; Fehling, Helena; Matthiesen, Jenny; Lorenzen, Stephan; Schuldt, Kathrin; Bernin, Hannah; Zaruba, Mareen; Lender, Corinna; Ernst, Thomas; Ittrich, Harald; Roeder, Thomas; Tannich, Egbert; Lotter, Hannelore; Bruchhaus, Iris

    2016-08-01

    We here compared pathogenic (p) and non-pathogenic (np) isolates of Entamoeba histolytica to identify molecules involved in the ability of this parasite to induce amoebic liver abscess (ALA)-like lesions in two rodent models for the disease. We performed a comprehensive analysis of 12 clones (A1-A12) derived from a non-pathogenic isolate HM-1:IMSS-A and 12 clones (B1-B12) derived from a pathogenic isolate HM-1:IMSS-B. "Non-pathogenicity" included the induction of small and quickly resolved lesions while "pathogenicity" comprised larger abscess development that overstayed day 7 post infection. All A-clones were designated as non-pathogenic, whereas 4 out of 12 B-clones lost their ability to induce ALAs in gerbils. No correlation between ALA formation and cysteine peptidase (CP) activity, haemolytic activity, erythrophagocytosis, motility or cytopathic activity was found. To identify the molecular framework underlying different pathogenic phenotypes, three clones were selected for in-depth transcriptome analyses. Comparison of a non-pathogenic clone A1np with pathogenic clone B2p revealed 76 differentially expressed genes, whereas comparison of a non-pathogenic clone B8np with B2p revealed only 19 differentially expressed genes. Only six genes were found to be similarly regulated in the two non-pathogenic clones A1np and B8np in comparison with the pathogenic clone B2p. Based on these analyses, we chose 20 candidate genes and evaluated their roles in ALA formation using the respective gene-overexpressing transfectants. We conclude that different mechanisms lead to loss of pathogenicity. In total, we identified eight proteins, comprising a metallopeptidase, C2 domain proteins, alcohol dehydrogenases and hypothetical proteins, that affect the pathogenicity of E. histolytica.

  16. Towards Clinical Applications of Blood-Borne miRNA Signatures: The Influence of the Anticoagulant EDTA on miRNA Abundance.

    Directory of Open Access Journals (Sweden)

    Petra Leidinger

    Full Text Available Circulating microRNAs (miRNAs from blood are increasingly recognized as biomarker candidates for human diseases. Clinical routine settings frequently include blood sampling in tubes with EDTA as anticoagulant without considering the influence of phlebotomy on the overall miRNA expression pattern. We collected blood samples from six healthy individuals each in an EDTA blood collection tube. Subsequently, the blood was transferred into PAXgeneTM tubes at three different time points, i.e. directly (0 min, 10 min, and 2 h after phlebotomy. As control blood was also directly collected in PAXgeneTM blood RNA tubes that contain a reagent to directly lyse blood cells and stabilize their content. For all six blood donors at the four conditions (24 samples we analyzed the abundance of 1,205 miRNAs by human Agilent miRNA V16 microarrays.While we found generally a homogenous pattern of the miRNA abundance in all 24 samples, the duration of the EDTA treatment appears to influence the miRNA abundance of specific miRNAs. The most significant changes are observed after longer EDTA exposition. Overall, the impact of the different blood sample conditions on the miRNA pattern was substantially lower than intra-individual variations. While samples belonging to one of the six individuals mostly cluster together, there was no comparable clustering for any of the four tested blood sampling conditions. The most affected miRNA was miR-769-3p that was not detected in any of the six PAXgene blood samples, but in all EDTA 2h samples. Accordingly, hsa-miR-769-3p was also the only miRNA that showed a significantly different abundance between the 4 blood sample conditions by an ANOVA analysis (Benjamini-Hochberg adjusted p-value of 0.003. Validation by qRT-PCR confirmed this finding.The pattern of blood-borne miRNA abundance is rather homogenous between the four tested blood sample conditions of six blood donors. There was a clustering between the miRNA profiles that belong

  17. Extracts against Various Pathogens

    Directory of Open Access Journals (Sweden)

    Ritika Chauhan

    2013-07-01

    The present study shows that tested lichen Parmotrema sp. extracts demonstrated a strong antimicrobial effect. That suggests the active components from methanol extracts of the investigated lichen Parmotrema sp. can be used as natural antimicrobial agent against pathogens.

  18. Evolution of microbial pathogens

    National Research Council Canada - National Science Library

    DiRita, Victor J; Seifert, H. Steven

    2006-01-01

    ... A. Hogan vvi ■ CONTENTS 8. Evolution of Pathogens in Soil Rachel Muir and Man-Wah Tan / 131 9. Experimental Models of Symbiotic Host-Microbial Relationships: Understanding the Underpinnings of ...

  19. Indicators for waterborne pathogens

    National Research Council Canada - National Science Library

    Committee on Indicators for Waterborne Pathogens, National Research Council

    2004-01-01

    ... not practical or feasible to monitor for the complete spectrum of microorganisms that may occur in water, and many known pathogens are difficult to detect directly and reliably in water samples.Â...

  20. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  1. SILAC-based comparative analysis of pathogenic Escherichia coli secretomes

    DEFF Research Database (Denmark)

    Boysen, Anders; Borch, Jonas; Krogh, Thøger Jensen

    2015-01-01

    Comparative studies of pathogenic bacteria and their non-pathogenic counterparts has led to the discovery of important virulence factors thereby generating insight into mechanisms of pathogenesis. Protein-based antigens for vaccine development are primarily selected among unique virulence...... experimental approach. In addition we find proteins that are not unique to the pathogenic strains but expressed at levels different from the commensal strain, including the colonization factor YghJ and the surface adhesin antigen 43, which is involved in pathogenesis of other Gram-negative bacteria......-related factors produced by the pathogen of interest. However, recent work indicates that proteins that are not unique to the pathogen but instead selectively expressed compared to its non-pathogenic counterpart could also be vaccine candidates or targets for drug development. Modern methods in quantitative...

  2. Social barriers to pathogen transmission in wild animal populations

    Energy Technology Data Exchange (ETDEWEB)

    Loehle, C.

    1995-03-01

    Diseases and pathogens are receiving increasing recognition as sources of mortality in animal populations. Immune system strength is clearly important in fending off pathogen attack. Physical barriers to pathogen entry are also important. Various individual behaviors are efficacious in reducing contact with diseases and pests. This paper focuses on a fourth mode of defense: social barriers to transmission. Various social behaviors have pathogen transmission consequences. Selective pressures on these social behaviors may therefore exist. Effects on pathogen transmission of mating strategies, social avoidance, group size, group isolation, and other behaviors are explored. It is concluded that many of these behaviors may have been affected by selection pressures to reduce transmission of pathogens. 84 refs., 1 tab.

  3. Plastic Transcriptomes Stabilize Immunity to Pathogen Diversity

    DEFF Research Database (Denmark)

    Zhang, Wei; Corwin, Jason A; Copeland, Daniel

    2017-01-01

    To respond to pathogen attack, selection and associated evolution has led to the creation of plant immune system that are a highly effective and inducible defense system. Central to this system are the plant defense hormones jasmonic acid (JA) and salicylic acid (SA) and crosstalk between the two...

  4. Host-pathogen interactions during apoptosis

    Indian Academy of Sciences (India)

    Unknown

    349. Keywords. Antioxidant; baculovirus; host-pathogen; eIF2α-kinase; P35; PKR .... conferring a selective advantage to the virus, the capacity to prevent apoptosis is ..... totic extracts were found to cleave purified PKR in vitro. These findings ...

  5. Plastic transcriptomes stabilize immunity to pathogen diversity

    DEFF Research Database (Denmark)

    Zhang, Wei; Corwin, Jason A.; Copeland, Daniel

    2017-01-01

    To respond to pathogen attack, selection and associated evolution has led to the creation of plant immune system that are a highly effective and inducible defense system. Central to this system are the plant defense hormones jasmonic acid (JA) and salicylic acid (SA) and crosstalk between the two...

  6. Adaptive value of sex in microbial pathogens.

    Science.gov (United States)

    Michod, Richard E; Bernstein, Harris; Nedelcu, Aurora M

    2008-05-01

    Explaining the adaptive value of sex is one of the great outstanding problems in biology. The challenge comes from the difficulty in identifying the benefits provided by sex, which must outweigh the substantial costs of sex. Here, we consider the adaptive value of sex in viruses, bacteria and fungi, and particularly the information available on the adaptive role of sex in pathogenic microorganisms. Our general theme is that the varied aspects of sex in pathogens illustrate the varied issues surrounding the evolution of sex generally. These include, the benefits of sex (in the short- and long-term), as well as the costs of sex (both to the host and to the pathogen). For the benefits of sex (that is, its adaptive value), we consider three hypotheses: (i) sex provides for effective and efficient recombinational repair of DNA damages, (ii) sex provides DNA for food, and (iii) sex produces variation and reduces genetic associations among alleles under selection. Although the evolution of sex in microbial pathogens illustrates these general issues, our paper is not a general review of theories for the evolution of sex in all organisms. Rather, we focus on the adaptive value of sex in microbial pathogens and conclude that in terms of short-term benefits, the DNA repair hypothesis has the most support and is the most generally applicable hypothesis in this group. In particular, recombinational repair of DNA damages may substantially benefit pathogens when challenged by the oxidative defenses of the host. However, in the long-term, sex may help get rid of mutations, increase the rate of adaptation of the population, and, in pathogens, may infrequently create new infective strains. An additional general issue about sex illustrated by pathogens is that some of the most interesting consequences of sex are not necessarily the reasons for which sex evolved. For example, antibiotic resistance may be transferred by bacterial sex, but this transfer is probably not the reason sex

  7. The Shared Antibiotic Resistome of Soil Bacteria and Human Pathogens

    DEFF Research Database (Denmark)

    Forsberg, Kevin J.; Reyes, Alejandro; Wang, Bin

    2012-01-01

    protocol to assemble short-read sequence data after antibiotic selection experiments, using 12 different drugs in all antibiotic classes, and compared antibiotic resistance gene sequences between soil bacteria and clinically occurring pathogens. Sixteen sequences, representing seven gene products, were...... discovered in farmland soil bacteria within long stretches of perfect nucleotide identity with pathogenic proteobacteria....

  8. Viral pathogen discovery

    Science.gov (United States)

    Chiu, Charles Y

    2015-01-01

    Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672

  9. Highly pathogenic avian influenza.

    Science.gov (United States)

    Swayne, D E; Suarez, D L

    2000-08-01

    Highly pathogenic (HP) avian influenza (AI) (HPAI) is an extremely contagious, multi-organ systemic disease of poultry leading to high mortality, and caused by some H5 and H7 subtypes of type A influenza virus, family Orthomyxoviridae. However, most AI virus strains are mildly pathogenic (MP) and produce either subclinical infections or respiratory and/or reproductive diseases in a variety of domestic and wild bird species. Highly pathogenic avian influenza is a List A disease of the Office International des Epizooties, while MPAI is neither a List A nor List B disease. Eighteen outbreaks of HPAI have been documented since the identification of AI virus as the cause of fowl plague in 1955. Mildly pathogenic avian influenza viruses are maintained in wild aquatic bird reservoirs, occasionally crossing over to domestic poultry and causing outbreaks of mild disease. Highly pathogenic avian influenza viruses do not have a recognised wild bird reservoir, but can occasionally be isolated from wild birds during outbreaks in domestic poultry. Highly pathogenic avian influenza viruses have been documented to arise from MPAI viruses through mutations in the haemagglutinin surface protein. Prevention of exposure to the virus and eradication are the accepted methods for dealing with HPAI. Control programmes, which imply allowing a low incidence of infection, are not an acceptable method for managing HPAI, but have been used during some outbreaks of MPAI. The components of a strategy to deal with MPAI or HPAI include surveillance and diagnosis, biosecurity, education, quarantine and depopulation. Vaccination has been used in some control and eradication programmes for AI.

  10. Seleção de isolados de Beauveria bassiana patogênicos ao bicudo-do-algodoeiro Selection of isolates of Beauveria bassiana pathogenic to cotton boll weevil

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Domingues da Silva

    2001-02-01

    Full Text Available Objetivou-se selecionar isolados de Beauveria bassiana (Balsamo Vüillemin provenientes de diferentes hospedeiros e regiões geográficas, patogênicos ao Anthonomus grandis, o bicudo-do-algodoeiro. Foram analisados 12 isolados em condições de laboratório. Os isolados obtidos originalmente de A. grandis foram pouco virulentos a essa praga. A mortalidade do bicudo teve início no segundo dia após a inoculação das suspensões fúngicas, variando de 15% a 83%, com TL50 entre 5,30 a 11,06 dias. Os isolados apresentaram variabilidade quanto à germinação dos conídios em meio de cultura artificial, e esta não se correlacionou com a patogenicidade. O isolado CG138 de B. bassiana destacou-se como um dos mais virulentos ao bicudo-do-algodoeiro.The objective of this work was to screen pathogenic isolates of Beauveria bassiana (Balsamo Vüillemin from different hosts and geographic regions, pathogenic to the cotton boll weevil. Twelve isolates were evaluated. Isolates originally obtained from boll weevil showed low pathogenicity against this host. Insect mortality began on the second day after inoculation by fungal suspension, ranging from 15% to 83%, with a TL50 of 5.30 to 11.06 days. Variability among isolates concerning conidial germination in artificial culture medium was verified, and TG50 did not correlate with pathogenicity. One of the most virulent isolates of B. bassiana against cotton boll weevil is CG138.

  11. Models of Caenorhabditis elegans infection by bacterial and fungal pathogens.

    Science.gov (United States)

    Powell, Jennifer R; Ausubel, Frederick M

    2008-01-01

    The nematode Caenorhabditis elegans is a simple model host for studying the relationship between the animal innate immune system and a variety of bacterial and fungal pathogens. Extensive genetic and molecular tools are available in C. elegans, facilitating an in-depth analysis of host defense factors and pathogen virulence factors. Many of these factors are conserved in insects and mammals, indicating the relevance of the nematode model to the vertebrate innate immune response. Here, we describe pathogen assays for a selection of the most commonly studied bacterial and fungal pathogens using the C. elegans model system.

  12. Safety and Waste Management for SAM Pathogen Methods

    Science.gov (United States)

    The General Safety and Waste Management page offers section-specific safety and waste management details for the pathogens included in EPA's Selected Analytical Methods for Environmental Remediation and Recovery (SAM).

  13. Sensitizing pathogens to antibiotics using the CRISPR-Cas system.

    Science.gov (United States)

    Goren, Moran; Yosef, Ido; Qimron, Udi

    2017-01-01

    The extensive use of antibiotics over the last century has resulted in a significant artificial selection pressure for antibiotic-resistant pathogens to evolve. Various strategies to fight these pathogens have been introduced including new antibiotics, naturally-derived enzymes/peptides that specifically target pathogens and bacteriophages that lyse these pathogens. A new tool has recently been introduced in the fight against drug-resistant pathogens-the prokaryotic defense mechanism-clustered regularly interspaced short palindromic repeats-CRISPR associated (CRISPR-Cas) system. The CRISPR-Cas system acts as a nuclease that can be guided to cleave any target DNA, allowing sophisticated, yet feasible, manipulations of pathogens. Here, we review pioneering studies that use the CRISPR-Cas system to specifically edit bacterial populations, eliminate their resistance genes and combine these two strategies in order to produce an artificial selection pressure for antibiotic-sensitive pathogens. We suggest that intelligent design of this system, along with efficient delivery tools into pathogens, may significantly reduce the threat of antibiotic-resistant pathogens. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Human pathogen avoidance adaptations

    NARCIS (Netherlands)

    Tybur, J.M.; Lieberman, D.

    2016-01-01

    Over the past few decades, researchers have become increasingly interested in the adaptations guiding the avoidance of disease-causing organisms. Here we discuss the latest developments in this area, including a recently developed information-processing model of the adaptations underlying pathogen

  15. Autophagy in plant pathogenic fungi.

    Science.gov (United States)

    Liu, Xiao-Hong; Xu, Fei; Snyder, John Hugh; Shi, Huan-Bin; Lu, Jian-Ping; Lin, Fu-Cheng

    2016-09-01

    Autophagy is a conserved cellular process that degrades cytoplasmic constituents in vacuoles. Plant pathogenic fungi develop special infection structures and/or secrete a range of enzymes to invade their plant hosts. It has been demonstrated that monitoring autophagy processes can be extremely useful in visualizing the sequence of events leading to pathogenicity of plant pathogenic fungi. In this review, we introduce the molecular mechanisms involved in autophagy. In addition, we explore the relationship between autophagy and pathogenicity in plant pathogenic fungi. Finally, we discuss the various experimental strategies available for use in the study of autophagy in plant pathogenic fungi. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. The physician's role in selecting a factor replacement therapy.

    Science.gov (United States)

    Pipe, S W

    2006-03-01

    Over the past 20 years, transmissions of human immunodeficiency virus (HIV), hepatitis B virus or hepatitis C virus have been virtually eliminated from plasma-derived or recombinant therapy in the USA, a record that can be largely attributed to the use of effective screening and inactivation technologies for known pathogens. The next significant threat will likely come from the emergence of a new, blood-borne infectious disease, perhaps one transmitted by a non-lipid-enveloped virus or prion, for which current inactivation methods are ineffective. Following the HIV crisis of the 1980s, government, patient advocacy groups, medical and scientific communities and the manufacturers of clotting therapies can learn from the past and approach potential threats from emerging pathogens in a proactive and productive manner. For clinicians, this includes actively engaging patients in a dialogue about all the factors that may influence their choice of clotting factor therapies, including emerging pathogens, patient convenience, consistency and reliability of supply, relative cost/benefit ratios, reimbursement issues (where applicable), patient preference and brand loyalty. It is our obligation as healthcare providers to understand potential risks and help make proactive decisions with our patients, decisions that often must be made in an environment of scientific uncertainty. Threats from infectious agents that were once deemed theoretical can, and often do, ultimately become real, with serious implications for morbidity and mortality.

  17. Social and behavioral barriers to pathogen transmission in wild animal populations

    Energy Technology Data Exchange (ETDEWEB)

    Loehle, C.S.

    1988-12-31

    Disease and pathogens have been studied as regulators of animal populations but not really as selective forces. The authors propose that pathogens can be major selective forces influencing social behaviors when these are successful at reducing disease transmission. The behaviors whose evolution could have been influenced by pathogen effects include group size, group isolation, mixed species flocking, migration, seasonal sociality, social avoidance, and dominance behaviors. Mate choice, mating system, and sexual selection are put in a new light when examined in terms of disease transmission. It is concluded that pathogen avoidance is a more powerful selective force than has heretofore been recognized.

  18. Evolution of microbial pathogens.

    OpenAIRE

    Morschhäuser, J; Köhler, G; Ziebuhr, W; Blum-Oehler, G; Dobrindt, U; Hacker, J

    2000-01-01

    Various genetic mechanisms including point mutations, genetic rearrangements and lateral gene transfer processes contribute to the evolution of microbes. Long-term processes leading to the development of new species or subspecies are termed macroevolution, and short-term developments, which occur during days or weeks, are considered as microevolution. Both processes, macro- and microevolution need horizontal gene transfer, which is particularly important for the development of pathogenic micr...

  19. Electrochemical Methodologies for the Detection of Pathogens.

    Science.gov (United States)

    Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine

    2018-05-25

    electrochemical-based microorganism recognition approaches and putting them into context of other sensing devices for pathogens such as culturing the microorganism on agar plates and the polymer chain reaction (PCR) method, able to identify the DNA of the microorganism. Recent breakthroughs will be highlighted, including the utilization of microfluidic devices and immunomagnetic separation for multiple pathogen analysis in a single device. We will conclude with some perspectives and outlooks to better understand shortcomings. Indeed, there is currently no adequate solution that allows the selective and sensitive binding to a specific microorganism, that is fast in detection and screening, cheap to implement, and able to be conceptualized for a wide range of biologically relevant targets.

  20. Pathogenic mechanism in lung fibrosis

    International Nuclear Information System (INIS)

    Witschi, H.; Haschek, W.M.; Meyer, K.R.; Ullrich, R.L.; Dalbey, W.E.

    1979-01-01

    The purpose of the study was to examine whether an interaction between two agents causing alveolar epithelial damage would produce lung fibrosis. In mouse lung, intraperitoneal injection of the antioxidant butylated hydroxytoluene causes diffuse alveolar type I cell necrosis, followed by proliferation of type II alveolar cells. In animals exposed to 70% O 2 or 100-200 rad x rays during the phase of type II cell proliferation following BHT, diffuse interstitial lung fibrosis developed within 2 weeks. Quantitative analysis of the lungs for hydroxyproline showed that the interaction between BHT and O 2 or x rays was synergistic. If exposure to O 2 or x rays was delayed until epithelial recovery was complete, no fibrosis was seen. Abnormally high levels of lung collagen persisted up to 6 months after one single treatment with BHT and 100 rad x rays. A commonly seen form of chronic lung damage may thus be caused by an acute interaction between a bloodborne agent which damages the alveolar cell and a toxic inhalant or x rays, provided a critically ordered sequence of exposure is observed

  1. Pathogen Inactivated Plasma Concentrated: Preparation and Uses

    Science.gov (United States)

    2004-09-01

    of decontamination, porcine parvovirus (PPV) was selected as a model virus; B19 is the form that infects humans. PPV is an interesting pathogen...ultrasound to cold plasma. The ultrasound generates pure ice crystals, which are then removed to leave concentrated plasma. Testing: Porcine parvovirus ...energy to “burn” any proteins that they encounter. Furthermore, as they react, they also produce multiple other reactive oxygen species (ROS) that are

  2. Photoinactivation of major bacterial pathogens in aquaculture

    Directory of Open Access Journals (Sweden)

    Heyong Jin Roh

    2016-08-01

    Full Text Available Abstract Background Significant increases in the bacterial resistance to various antibiotics have been found in fish farms. Non-antibiotic therapies for infectious diseases in aquaculture are needed. In recent years, light-emitting diode technology has been applied to the inactivation of pathogens, especially those affecting humans. The purpose of this study was to assess the effect of blue light (wavelengths 405 and 465 nm on seven major bacterial pathogens that affect fish and shellfish important in aquaculture. Results We successfully demonstrate inactivation activity of a 405/465-nm LED on selected bacterial pathogens. Although some bacteria were not fully inactivated by the 465-nm light, the 405-nm light had a bactericidal effect against all seven pathogens, indicating that blue light can be effective without the addition of a photosensitizer. Photobacterium damselae, Vibrio anguillarum, and Edwardsiella tarda were the most susceptible to the 405-nm light (36.1, 41.2, and 68.4 J cm−2, respectively, produced one log reduction in the bacterial populations, whereas Streptococcus parauberis was the least susceptible (153.8 J cm−2 per one log reduction. In general, optical density (OD values indicated that higher bacterial densities were associated with lower inactivating efficacy, with the exception of P. damselae and Vibrio harveyi. In conclusion, growth of the bacterial fish and shellfish pathogens evaluated in this study was inactivated by exposure to either the 405- or 465-nm light. In addition, inactivation was dependent on exposure time. Conclusions This study presents that blue LED has potentially alternative therapy for treating fish and shellfish bacterial pathogens. It has great advantages in aspect of eco-friendly treating methods differed from antimicrobial methods.

  3. The Role of Pathogenic Autoantibodies in Autoimmunity

    Directory of Open Access Journals (Sweden)

    Merrill J. Rowley

    2015-11-01

    Full Text Available The serological presence of autoantibodies is diagnostic of autoimmunity, and these autoantibodies may be present for many years before the presentation of autoimmune disease (AID. Although a pathogenic role has been demonstrated for various autoantibodies reactive with cell surface and extracellular autoantigens, studies using monoclonal antibodies (mAb show not all antibodies in the polyclonal response are pathogenic. Differences depend on Fab-mediated diversity in epitope specificity, Fc-mediated effects based on immunoglobulin (Ig class and subclass, activation of complement, and the milieu in which the reaction occurs. These autoantibodies often occur in organ-specific AID and this review illustrates their pathogenic and highly specific effects. The role of autoantibodies associated with intracellular antigens is less clear. In vitro they may inhibit or adversely affect well-defined intracellular biochemical pathways, yet, in vivo they are separated from their autoantigens by multiple cellular barriers. Recent evidence that Ig can traverse cell membranes, interact with intracellular proteins, and induce apoptosis has provided new evidence for a pathogenic role for such autoantibodies. An understanding of how autoantibodies behave in the polyclonal response and their role in pathogenesis of AID may help identify populations of culprit B-cells and selection of treatments that suppress or eliminate them.

  4. Paleogene radiation of a plant pathogenic mushroom.

    Directory of Open Access Journals (Sweden)

    Martin P A Coetzee

    Full Text Available The global movement and speciation of fungal plant pathogens is important, especially because of the economic losses they cause and the ease with which they are able to spread across large areas. Understanding the biogeography and origin of these plant pathogens can provide insights regarding their dispersal and current day distribution. We tested the hypothesis of a Gondwanan origin of the plant pathogenic mushroom genus Armillaria and the currently accepted premise that vicariance accounts for the extant distribution of the species.The phylogeny of a selection of Armillaria species was reconstructed based on Maximum Parsimony (MP, Maximum Likelihood (ML and Bayesian Inference (BI. A timeline was then placed on the divergence of lineages using a Bayesian relaxed molecular clock approach.Phylogenetic analyses of sequenced data for three combined nuclear regions provided strong support for three major geographically defined clades: Holarctic, South American-Australasian and African. Molecular dating placed the initial radiation of the genus at 54 million years ago within the Early Paleogene, postdating the tectonic break-up of Gondwana.The distribution of extant Armillaria species is the result of ancient long-distance dispersal rather than vicariance due to continental drift. As these finding are contrary to most prior vicariance hypotheses for fungi, our results highlight the important role of long-distance dispersal in the radiation of fungal pathogens from the Southern Hemisphere.

  5. Genome-Wide Analysis in Three Fusarium Pathogens Identifies Rapidly Evolving Chromosomes and Genes Associated with Pathogenicity

    Science.gov (United States)

    Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

    2015-01-01

    Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930

  6. Microbiome studies in the biological control of plant pathogens

    Science.gov (United States)

    Biological control of plant pathogens, although it has been a successful alternative that has allowed to select microorganisms for the generation of bioproducts and to understand multiple biological mechanisms, cannot be considered as a strategy defined only from the selection of a range of cultiva...

  7. Long-term monitoring of P. ramorum inoculum identifies spatio-temporal patterns of pathogen sporulation and proves that selective California bay laurel removal reduces risk of oak infection

    Science.gov (United States)

    M. Garbelotto; S. Swain; D. Schmidt

    2013-01-01

    In 2005, eight 50 x 50 m plots, all with a significant component of California bay laurel (Umbellularia californica (Hook. & Arn.) Nutt.), were selected in the Soquel Demonstration State Forest, Santa Cruz County, California. Each plot contained a 5 m buffer zone around the edges and sixteen 10 x 10 m squares. A bucket was placed at the center...

  8. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  9. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  10. Pathogenic mycoflora on carrot seeds

    Directory of Open Access Journals (Sweden)

    Bogdan Nowicki

    2013-12-01

    Full Text Available Altogether 300 seed samples were collected during 9 years in 8 regions of Poland and the fungi Were isolated and their pathogenicity to carrot seedlings was examined. Alternaria rudicina provcd to be the most important pathogen although. A. alternata was more common. The other important pathogens were Fusarium spp., Phoma spp. and Botrytis cinerea. The infection of carrot seeds by A. radicina should be used as an important criterium in seed quality evaluation.

  11. Bacteriophages for detection of bacterial pathogens

    International Nuclear Information System (INIS)

    Kutateladze, M.

    2009-01-01

    The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

  12. The glycoprotein TRP36 of Ehrlichia sp. UFMG-EV and related cattle pathogen Ehrlichia sp. UFMT-BV evolved from a highly variable clade of E. canis under adaptive diversifying selection

    Czech Academy of Sciences Publication Activity Database

    Cabezas-Cruz, A.; Valdés, James J.; de la Fuente, J.

    2014-01-01

    Roč. 7, DEC 10 2014 (2014), s. 584 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Ehrlichia sp. UFMG-EV * Ehrlichia sp. UFMT-BV * E. mineirensis * Host-shift * Diversifying episodic selection Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.430, year: 2014

  13. Molecular Diagnostics for Soilborne Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    E.J. Paplomatas

    2004-08-01

    Full Text Available Several classical approaches have been developed to detect and identify soil fungal inhabitants through the years. Selective media have been devised to exclude the large number of soil organisms and allow growth of target fungi. However the advent of molecular biology has offered a number of revolutionary insights into the detection and enumeration of soilborne fungal pathogens and also has started to provide information on the identification of unknown species from DNA sequences. This review paper focuses on the application of various molecular techniques in the detection, identification, characterization and quantification of soilborne fungal plant pathogens. This is based on information from the literature and is combined with personal research findings of the author.

  14. Pathogenic agents in freshwater resources

    Science.gov (United States)

    Geldreich, Edwin E.

    1996-02-01

    Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.

  15. Comparative proteomic analysis of pathogenic and non-pathogenic strains from the swine pathogen Mycoplasma hyopneumoniae

    Directory of Open Access Journals (Sweden)

    Klein Cátia S

    2009-12-01

    Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.

  16. Host pathogen relations: exploring animal models for fungal pathogens.

    Science.gov (United States)

    Harwood, Catherine G; Rao, Reeta P

    2014-06-30

    Pathogenic fungi cause superficial infections but pose a significant public health risk when infections spread to deeper tissues, such as the lung. Within the last three decades, fungi have been identified as the leading cause of nosocomial infections making them the focus of research. This review outlines the model systems such as the mouse, zebrafish larvae, flies, and nematodes, as well as ex vivo and in vitro systems available to study common fungal pathogens.

  17. Host Pathogen Relations: Exploring Animal Models for Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Catherine G. Harwood

    2014-06-01

    Full Text Available Pathogenic fungi cause superficial infections but pose a significant public health risk when infections spread to deeper tissues, such as the lung. Within the last three decades, fungi have been identified as the leading cause of nosocomial infections making them the focus of research. This review outlines the model systems such as the mouse, zebrafish larvae, flies, and nematodes, as well as ex vivo and in vitro systems available to study common fungal pathogens.

  18. Assessment of bacterial pathogens in fresh rainwater and airborne particulate matter using Real-Time PCR

    Science.gov (United States)

    Kaushik, Rajni; Balasubramanian, Rajasekhar

    2012-01-01

    Bacterial pathogens in airborne particulate matter (PM) and in rainwater (RW) were detected using a robust and sensitive Real-Time PCR method. Both RW and PM were collected simultaneously in the tropical atmosphere of Singapore, which were then subjected to analysis for the presence of selected bacterial pathogens and potential pathogen of health concern ( Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and Aeromonas hydrophila). These pathogens were found to be prevalent in both PM and RW samples with E. coli being the most prevalent potential pathogen in both types of samples. The temporal distribution of these pathogens in PM and RW was found to be similar to each other. Using the proposed microbiological technique, the atmospheric deposition (dry and wet deposition) of bacterial pathogens to lakes and reservoirs can be studied in view of growing concerns about the outbreak of waterborne diseases.

  19. Tropism and pathogenicity of rickettsiae

    Directory of Open Access Journals (Sweden)

    Tsuneo eUchiyama

    2012-06-01

    Full Text Available Rickettsiae are obligate intracellular parasitic bacteria that cause febrile exanthematous illnesses such as Rocky Mountain spotted fever, Mediterranean spotted fever, epidemic and murine typhus, etc. Although the vector ranges of each Rickettsia species are rather restricted; i.e., ticks belonging to Arachnida and lice and fleas belonging to Insecta usually act as vectors for spotted fever group and typhus group rickettsiae, respectively, it would be interesting to elucidate the mechanisms controlling the vector tropism of rickettsiae. This review discusses the factors determining the vector tropism of rickettsiae. In brief, the vector tropism of rickettsiae species is basically consistent with their tropism towards cultured tick and insect cells. The mechanisms responsible for rickettsiae pathogenicity are also described. Recently, genomic analyses of rickettsiae have revealed that they possess several genes that are homologous to those affecting the pathogenicity of other bacteria. Analyses comparing the genomes of pathogenic and nonpathogenic strains of rickettsiae have detected many factors that are related to rickettsial pathogenicity. It is also known that a reduction in the rickettsial genome has occurred during the course of its evolution. Interestingly, Rickettsia species with small genomes, such as Rickettsia prowazekii, are more pathogenic to humans than those with larger genomes. This review also examines the growth kinetics of pathogenic and nonpathogenic species of spotted fever group rickettsiae in mammalian cells. The growth of nonpathogenic species is restricted in these cells, which is mediated, at least in part, by autophagy. The superinfection of nonpathogenic rickettsiae-infected cells with pathogenic rickettsiae results in an elevated yield of the nonpathogenic rickettsiae and the growth of the pathogenic rickettsiae. Autophagy is restricted in these cells. These results are discussed in this review.

  20. Pathogen avoidance by insect predators

    OpenAIRE

    Meyling, Nicolai V.; Ormond, Emma; Roy, Helen E.; Pell, Judith K.

    2008-01-01

    Insects can detect cues related to the risk of attack by their natural enemies. Pathogens are among the natural enemies of insects and entomopathogenic fungi attack a wide array of host species. Evidence documents that social insects in particular have adapted behavioural mechanisms to avoid infection by fungal pathogens. These mechanisms are referred to as 'behavioural resistance'. However, there is little evidence for similar adaptations in non-social insects. We have conducted experime...

  1. Antibiotic Resistance in Foodborne Pathogens

    OpenAIRE

    Walsh, Ciara; Duffy, Geraldine

    2013-01-01

    Wide-spread antibiotic resistance among bacterial pathogens is now a serious public health issue and multi-antibiotic resistance has been reported in many foodborne pathogens including Salmonella and E. coli. A study to determine antibiotic resistance profiles of a range of Salmonella and Verocytotoxigenic E.coli (VTEC) isolated from Irish foods revealed significant levels of antibiotic resistance in the strains. S. typhimurium DT104 were multiantibiotic resistant with 97% resistant to 7 anti...

  2. Molecular detection of human bacterial pathogens

    National Research Council Canada - National Science Library

    Liu, Dongyou

    2011-01-01

    .... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...

  3. Pathogen Security-Help or Hindrance?

    Directory of Open Access Journals (Sweden)

    Stephen Allen Morse

    2015-01-01

    Full Text Available Events over the past 15 years have resulted in the promulgation of regulations in the United States to enhance biosecurity by restricting the access of pathogens and toxins (i.e., biological select agents and toxins [BSAT], which pose a severe threat to human, animal or plant health or to animal or plant products, to qualified institutions, laboratories, and scientists. These regulations also reduce biosafety concerns by imposing specific requirements on laboratories working with BSATs. Furthermore, they provide a legal framework for prosecuting someone who possesses a BSAT illegally. With the implementation of these regulations has come a discussion in the scientific community about the potential of these regulations to affect the cost of doing BSAT research and international collaborations, or whether it would stop someone with a microbiological background from isolating many of the select agents from nature.

  4. Pathogen security-help or hindrance?

    Science.gov (United States)

    Morse, Stephen A

    2014-01-01

    Events over the past 15 years have resulted in the promulgation of regulations in the United States to enhance biosecurity by restricting the access to pathogens and toxins (i.e., biological select agents and toxins [BSATs]), which pose a severe threat to human being, animal, or plant health or to animal or plant products, to qualified institutions, laboratories, and scientists. These regulations also reduce biosafety concerns by imposing specific requirements on laboratories working with BSATs. Furthermore, they provide a legal framework for prosecuting someone who possesses a BSAT illegally. With the implementation of these regulations has come discussion in the scientific community about the potential of these regulations to affect the cost of doing BSAT research, hamper research and international collaborations, or whether it would stop someone with a microbiological background from isolating many of the select agents from nature.

  5. Online interventions to address HIV and other sexually transmitted and blood-borne infections among young gay, bisexual and other men who have sex with men: a systematic review.

    Science.gov (United States)

    Knight, Rod; Karamouzian, Mohammad; Salway, Travis; Gilbert, Mark; Shoveller, Jean

    2017-11-01

    Globally, young gay, bisexual and other men who have sex with men (gbMSM) continue to experience disproportionately high rates of HIV and other sexually transmitted and blood-borne infections (STBBIs). As such, there are strong public health imperatives to evaluate innovative prevention, treatment and care interventions, including online interventions. This study reviewed and assessed the status of published research (e.g. effectiveness; acceptability; differential effects across subgroups) involving online interventions that address HIV/STBBIs among young gbMSM. We searched Medline, Embase, PsycINFO, CINAHL, and Google Scholar to identify relevant English-language publications from inception to November 2016. Studies that assessed an online intervention regarding the prevention, care, or treatment of HIV/STBBIs were included. Studies with gay and bisexual men; four studies did not assess sexual identity. Two studies reported including both HIV+ and HIV- participants, and all but one study included one or more measure of socio-economic status. Few studies reported on the differential intervention effects by socio-economic status, sexual identity, race or serostatus. While online interventions show promise at addressing HIV/STBBI among young gbMSM, to date, little emphasis has been placed on assessing: (i) potential differential effects of interventions across subgroups of young gbMSM; (ii) effectiveness studies of interventions in the dissemination phase; and (iii) on some "key" populations of young gbMSM (e.g. those who are: transgender, from low-income settings and/or HIV positive). Future research that unpacks the potentially distinctive experiences of particular subgroups with "real world" interventions is needed. © 2017 The Authors. Journal of the International AIDS Society published by John Wiley & sons Ltd on behalf of the International AIDS Society.

  6. Rapid and preferential distribution of blood-borne αCD3εAb to the liver is followed by local stimulation of T cells and natural killer T cells

    Science.gov (United States)

    Wingender, Gerhard; Schumak, Beatrix; Schurich, Anna; Gessner, J Engelbert; Endl, Elmar; Limmer, Andreas; Knolle, Percy A

    2006-01-01

    Dissemination of soluble molecules or antigens via the blood stream is considered to lead to a uniform distribution in the various organs of the body, but organ-specific microarchitecture and vascularization may influence this. Following intravenous injection of αCD3ε antibody (αCD3εAb) we observed clear differences in antibody binding to Fcγ receptor (FcγR)+ antigen-presenting cells (APCs) or T lymphocytes in different organs. Significant binding of blood-borne αCD3εAb was only detected in the spleen and liver and not in the thymus or lymph node. In the spleen, only 10% of dendritic cells/macrophages and 40% of T-cell receptor (TCR)-β+ cells were positive for αCD3εAb, and, dependent on FcγR-mediated cross-linking of αCD3εAb, a similar percentage of splenic TCR-β+ cells were stimulated and became CD69+. Stimulation of TCR-β+ cells in the liver was at least as efficient as in the spleen, but almost all T cells and all scavenger liver sinusoidal endothelial cells bound αCD3εAb. In contrast to CD69 up-regulation, only CD4+ natural killer T (NKT) cells and CD11ahigh CD8+ T cells were activated by αCD3εAb and expressed interferon (IFN)-γ. Again, IFN-γ release from NKT/T cells was at least as efficient in the liver as in the spleen. Taken together, our results support the notion that the combination of extensive hepatic vascularization and very high scavenger activity allows the liver to fulfill its metabolic tasks and to promote stimulation of the large but widely distributed hepatic population of NKT/T cells. PMID:16423047

  7. Biosensors for plant pathogen detection.

    Science.gov (United States)

    Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben

    2017-07-15

    Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Annotating pathogenic non-coding variants in genic regions.

    Science.gov (United States)

    Gelfman, Sahar; Wang, Quanli; McSweeney, K Melodi; Ren, Zhong; La Carpia, Francesca; Halvorsen, Matt; Schoch, Kelly; Ratzon, Fanni; Heinzen, Erin L; Boland, Michael J; Petrovski, Slavé; Goldstein, David B

    2017-08-09

    Identifying the underlying causes of disease requires accurate interpretation of genetic variants. Current methods ineffectively capture pathogenic non-coding variants in genic regions, resulting in overlooking synonymous and intronic variants when searching for disease risk. Here we present the Transcript-inferred Pathogenicity (TraP) score, which uses sequence context alterations to reliably identify non-coding variation that causes disease. High TraP scores single out extremely rare variants with lower minor allele frequencies than missense variants. TraP accurately distinguishes known pathogenic and benign variants in synonymous (AUC = 0.88) and intronic (AUC = 0.83) public datasets, dismissing benign variants with exceptionally high specificity. TraP analysis of 843 exomes from epilepsy family trios identifies synonymous variants in known epilepsy genes, thus pinpointing risk factors of disease from non-coding sequence data. TraP outperforms leading methods in identifying non-coding variants that are pathogenic and is therefore a valuable tool for use in gene discovery and the interpretation of personal genomes.While non-coding synonymous and intronic variants are often not under strong selective constraint, they can be pathogenic through affecting splicing or transcription. Here, the authors develop a score that uses sequence context alterations to predict pathogenicity of synonymous and non-coding genetic variants, and provide a web server of pre-computed scores.

  9. Host-induced aneuploidy and phenotypic diversification in the Sudden Oak Death pathogen Phytophthora ramorum

    Science.gov (United States)

    Aneuploidy can result in significant phenotypic changes, which can sometimes be selectively advantageous. For example, aneuploidy confers resistance to antifungal drugs in human pathogenic fungi. Aneuploidy has also been observed in invasive fungal and oomycete plant pathogens in the field. Environm...

  10. Molecular genetic analysis of the pathogenicity of the potato cyst nematode Globodera rostochiensis

    NARCIS (Netherlands)

    Qin, L.

    2001-01-01

    A new strategy to identify pathogenicity factors from the potato cyst nematode Globodera rostochiensis is developed. cDNA-AFLP technology and in situ hybridization allowed us to efficiently select putative pathogenicity factors among thousands of

  11. Population genomics of Fusarium graminearum reveals signatures of divergent evolution within a major cereal pathogen

    Science.gov (United States)

    The cereal pathogen Fusarium graminearum is the primary cause of Fusarium head blight (FHB) and a significant threat to food safety and crop production. To elucidate population structure and identify genomic targets of selection within major FHB pathogen populations in North America we sequenced the...

  12. Natural selection promotes antigenic evolvability

    NARCIS (Netherlands)

    Graves, C.J.; Ros, V.I.D.; Stevenson, B.; Sniegowski, P.D.; Brisson, D.

    2013-01-01

    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide

  13. Presença de substâncias fisològicamente ativas em culturas de E. Coli isolados das fezes de pacientes alérgicos pela técnica de Heist-Cohen Presence of substances with physiological activity in cultures of E. Coli isolated from stools in allergic patients by the Heist-Cohen pathogen selective method

    Directory of Open Access Journals (Sweden)

    João Canali Corrêa F.º

    1955-12-01

    Full Text Available Four patients with several allergic symptoms have been studied. Heist-Cohen pathogen selective method was positive in feces of all these patients for E. coli. Other causes that could be responsible for the allergic symptoms were discarded. Samplets after seeding in a medium physiologically inactive have been tested in guinea pig illea following Cohnheim-Magnus technique. It was demonstrated that all samples isolated by the Heist-Cohen technique were physiologically active.(Fig.1. Ten other strains of E. coli taken at random from the collection of I.O.C. and tried according similar technique, brought evidence that only three samples possessed such activity. This confirms the works of KOESSLER-HANKE (1922. In order to obtain a quick relief from allergic symptoms, one of us had employed in some others, identical cases an antibiotic (Teramycin, Chas Pfeizer before the specific disesitization was done (Figs. 2, 3, 4, 5. Such method were choice since LABORDE, PARROT, and URQUIA (1953 have demonstrated the importance of production of histamine, from components of the bowel's flora in the production of allergic symptoms.

  14. Priority setting of foodborne pathogens: disease burden and costs of selected enteric pathogens

    NARCIS (Netherlands)

    Kemmeren JM; Mangen MJJ; van Duynhoven YTHP; Havelaar AH; MGB

    2006-01-01

    Toxoplasmose veroorzaakt van zeven onderzochte voedseloverdraagbare micro-organismen de hoogste ziektelast. Dit is een voorlopige conclusie in een groot onderzoek naar ziektelast van door voedseloverdraagbare micro-organismen en de daaraan gerelateerde kosten. De andere onderzochte

  15. Efficacy of Sakacin on Selected Food Pathogenic Microorganisms ...

    African Journals Online (AJOL)

    USER

    technique and was characterized based on it colony, cell morphology and some ... De Man Rogosa Sharpe (MRS) broth for bacteriocin (sakacin) production. ... tremendous attention as potential bio preservatives in the food and dairy industries. .... positive result,-: Negative result, A : Acid production ,G :Gas production,.

  16. Serosurvey for selected pathogens in Iberian roe deer

    OpenAIRE

    Boadella, Mariana; Carta, Tania; Oleaga, ?lvaro; Pajares, Gerardo; Mu?oz, Marta; Gort?zar, Christian

    2010-01-01

    Abstract Background The roe deer is the most abundant and widespread wild Eurasian cervid. Its populations are expanding and increasingly in contact with livestock. This may affect the distribution of infectious diseases shared with other wild and domestic ungulates. Methods We investigated the antibody seroprevalence against Pestivirus, Herpesvirus, Bluetongue (BT) virus, M. avium paratuberculosis (MAP), and Brucella sp. in 519 roe deer from different regions in Spain, south-western Europe. ...

  17. Surveillance of bacterial pathogens of diarrhoea in two selected sub ...

    African Journals Online (AJOL)

    GAR) have witnessed several episodes of cholera outbreaks, with some deaths. Compared to previous epidemics, which usually followed heavy rains, recent outbreaks show no seasonality. Objectives: To investigate infective bacterial diseases ...

  18. Seroprevalence of Selected Avian Pathogens of Backyard Poultry in ...

    African Journals Online (AJOL)

    A serological survey for Newcastle (ND), avian influenza (AI), Gumboro (IBD) and Infectious bronchitis (IB) viruses was conducted in 310 serum samples in village chickens in Sinar State, Sudan. The studied chickens had no history of previous vaccination and showed no clinical signs. Results of indirect enzyme-linked ...

  19. Pathogenicity of highly pathogenic avian influenza virus in mammals

    NARCIS (Netherlands)

    de Wit, Emmie; Kawaoka, Yoshihiro; de Jong, Menno D.; Fouchier, Ron A. M.

    2008-01-01

    In recent years, there has been an increase in outbreaks of highly pathogenic avian influenza (HPAI) in poultry. Occasionally, these outbreaks have resulted in transmission of influenza viruses to humans and other mammals, with symptoms ranging from conjunctivitis to pneumonia and death. Here, the

  20. 21 CFR 866.2360 - Selective culture medium.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2360 Selective culture... solid biological materials intended for medical purposes to cultivate and identify certain pathogenic...

  1. New trends in emerging pathogens.

    Science.gov (United States)

    Skovgaard, Niels

    2007-12-15

    The emergence of pathogens is the result of a number of impact in all parts of the food chain. The emerging technologies in food production explain how new pathogens can establish themselves in the food chain and compromise food safety. The impact of the food technology is analysed for several bacteria, such as Yersinia, Campylobacter, Arcobacter, Helicobacter pullorum, Enterobacter sakazakii, Mycobacterium avium spp. paratuberculosis, prions related to vCJD and others. The importance of the ability of many microbes to form VBNC forms is elaborated on. Research on culture independent methods may address this outstanding issue to the better understanding of emerging pathogens. The "demerging" of pathogens also occur, and examples of this are explained. The reaction of bacteria to stresses and sublethal treatments, and how exposure to one stress factor can confer resistance to other stresses, literally speaking causing contagious resistance, are explained. The implication of this e.g. in modern approaches of food preservation, such as Minimally processed Foods, is considerable. Intestinal colonization of EHEC may be regulated by Quorum sensing, and this ability of microbes plays an important role in the colonization of microbes in food and on food processing equipment, an important factor in the emergence of pathogens. The emergence of Saccharomyces cerevisiae, as an opportunistic human pathogen, used for centuries for food and production of alcoholic beverages, calls for research in molecular tools to distinguish between probiotic and clinical strains. Cyclospora cayetanensis and Norovirus outbreaks can no longer be designated as emerging pathogens, they share however one characteristic in the epidemiology of emerging nature, the importance of the hygiene in the primary production stage, including supply of potable water, and the application of GMP and the HACCP principles in the beginning of the food chain. Hepatitis E virus is a potential emerging food borne

  2. Continuous-Flow Detector for Rapid Pathogen Identification

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, Louise M. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Skulan, Andrew J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Singh, Anup K. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Cummings, Eric B. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Fiechtner, Gregory J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics

    2006-09-01

    This report describes the continued development of a low-power, portable detector for the rapid identification of pathogens such as B. anthracis and smallpox. Based on our successful demonstration of the continuous filter/concentrator inlet, we believe strongly that the inlet section will enable differentiation between viable and non-viable populations, between types of cells, and between pathogens and background contamination. Selective, continuous focusing of particles in a microstream enables highly selective and sensitive identification using fluorescently labeled antibodies and other receptors such as peptides, aptamers, or small ligands to minimize false positives. Processes such as mixing and lysing will also benefit from the highly localized particle streams. The concentrator is based on faceted prisms to contract microfluidic flows while maintaining uniform flowfields. The resulting interfaces, capable of high throughput, serve as high-, low-, and band-pass filters to direct selected bioparticles to a rapid, affinity-based detection system. The proposed device is superior to existing array-based detectors as antibody-pathogen binding can be accomplished in seconds rather than tens of minutes or even hours. The system is being designed to interface with aerosol collectors under development by the National Laboratories or commercial systems. The focused stream is designed to be interrogated using diode lasers to differentiate pathogens by light scattering. Identification of particles is done using fluorescently labeled antibodies to tag the particles, followed by multiplexed laser-induced fluorescence (LIF) detection (achieved by labeling each antibody with a different dye).

  3. Pathogen disgust and interpersonal personality

    NARCIS (Netherlands)

    Kupfer, Tom R.; Tybur, Joshua M.

    2017-01-01

    The behavioral immune system includes motivational systems for avoiding contact with pathogens, including those transmitted by other people. Motivations to avoid others may depend not only on the perceived risk of infection but also on perceived benefits of social interaction. Based on this idea, we

  4. Lectins in human pathogenic fungi.

    Science.gov (United States)

    Gallegos, Belém; Martínez, Ruth; Pérez, Laura; Del Socorro Pina, María; Perez, Eduardo; Hernández, Pedro

    2014-01-01

    Lectins are carbohydrate-binding proteins widely distributed in nature. They constitute a highly diverse group of proteins consisting of many different protein families that are, in general, structurally unrelated. In the last few years, mushroom and other fungal lectins have attracted wide attention due to their antitumour, antiproliferative and immunomodulatory activities. The present mini-review provides concise information about recent developments in understanding lectins from human pathogenic fungi. A bibliographic search was performed in the Science Direct and PubMed databases, using the following keywords "lectin", "fungi", "human" and "pathogenic". Lectins present in fungi have been classified; however, the role played by lectins derived from human pathogenic fungi in infectious processes remains uncertain; thus, this is a scientific field requiring more research. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  5. Pathogenicity of Shigella in chickens.

    Science.gov (United States)

    Shi, Run; Yang, Xia; Chen, Lu; Chang, Hong-tao; Liu, Hong-ying; Zhao, Jun; Wang, Xin-wei; Wang, Chuan-qing

    2014-01-01

    Shigellosis in chickens was first reported in 2004. This study aimed to determine the pathogenicity of Shigella in chickens and the possibility of cross-infection between humans and chickens. The pathogenicity of Shigella in chickens was examined via infection of three-day-old SPF chickens with Shigella strain ZD02 isolated from a human patient. The virulence and invasiveness were examined by infection of the chicken intestines and primary chicken intestinal epithelial cells. The results showed Shigella can cause death via intraperitoneal injection in SPF chickens, but only induce depression via crop injection. Immunohistochemistry and transmission electron microscopy revealed the Shigella can invade the intestinal epithelia. Immunohistochemistry of the primary chicken intestinal epithelial cells infected with Shigella showed the bacteria were internalized into the epithelial cells. Electron microscopy also confirmed that Shigella invaded primary chicken intestinal epithelia and was encapsulated by phagosome-like membranes. Our data demonstrate that Shigella can invade primary chicken intestinal epithelial cells in vitro and chicken intestinal mucosa in vivo, resulting in pathogenicity and even death. The findings suggest Shigella isolated from human or chicken share similar pathogenicity as well as the possibility of human-poultry cross-infection, which is of public health significance.

  6. Convergent evolution and mimicry of protein linear motifs in host-pathogen interactions.

    Science.gov (United States)

    Chemes, Lucía Beatriz; de Prat-Gay, Gonzalo; Sánchez, Ignacio Enrique

    2015-06-01

    Pathogen linear motif mimics are highly evolvable elements that facilitate rewiring of host protein interaction networks. Host linear motifs and pathogen mimics differ in sequence, leading to thermodynamic and structural differences in the resulting protein-protein interactions. Moreover, the functional output of a mimic depends on the motif and domain repertoire of the pathogen protein. Regulatory evolution mediated by linear motifs can be understood by measuring evolutionary rates, quantifying positive and negative selection and performing phylogenetic reconstructions of linear motif natural history. Convergent evolution of linear motif mimics is widespread among unrelated proteins from viral, prokaryotic and eukaryotic pathogens and can also take place within individual protein phylogenies. Statistics, biochemistry and laboratory models of infection link pathogen linear motifs to phenotypic traits such as tropism, virulence and oncogenicity. In vitro evolution experiments and analysis of natural sequences suggest that changes in linear motif composition underlie pathogen adaptation to a changing environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Role of commercial probiotic strains against human pathogen adhesion to intestinal mucus.

    Science.gov (United States)

    Collado, M C; Meriluoto, J; Salminen, S

    2007-10-01

    The aims of this study present were to assess and to evaluate in vitro the abilities of commercial probiotic strains derived from fermented milk products and related sources currently marketed in European countries, to inhibit, compete and displace the adhesion of selected potential pathogens to immobilized human mucus. The adhesion was assessed by measuring the radioactivity of bacteria adhered to the human mucus. We tested 12 probiotic strains against eight selected pathogens. All strains tested were able to adhere to mucus. All probiotic strains tested were able to inhibit and displace (P<0.05) the adhesion of Bacteroides, Clostridium, Staphylococcus and Enterobacter. In addition, the abilities to inhibit and to displace adhered pathogens depended on both the probiotic and the pathogen strains tested suggesting that several complementary mechanisms are implied in the processes. Our results indicate the need for a case-by-case assessment in order to select strains with the ability to inhibit or displace a specific pathogen. Probiotics could be useful to correct deviations observed in intestinal microbiota associated with specific diseases and also, to prevent pathogen infections. The competitive exclusion properties of probiotics as well as their ability to displace and inhibit pathogens are the most importance for therapeutic manipulation of the enteric microbiota. The application of such strategies could contribute to expand the beneficial properties on human health against pathogen infection.

  8. Sexual reproduction and the evolution of microbial pathogens.

    Science.gov (United States)

    Heitman, Joseph

    2006-09-05

    Three common systemic human fungal pathogens--Cryptococcus neoformans, Candida albicans and Aspergillus fumigatus--have retained all the machinery to engage in sexual reproduction, and yet their populations are often clonal with limited evidence for recombination. Striking parallels have emerged with four protozoan parasites that infect humans: Toxoplasma gondii, Trypanosoma brucei, Trypanosoma cruzi and Plasmodium falciparum. Limiting sexual reproduction appears to be a common virulence strategy, enabling generation of clonal populations well adapted to host and environmental niches, yet retaining the ability to engage in sexual or parasexual reproduction and respond to selective pressure. Continued investigation of the sexual nature of microbial pathogens should facilitate both laboratory investigation and an understanding of the complex interplay between pathogens, hosts, vectors, and their environments.

  9. Ecosystem screening approach for pathogen-associated microorganisms affecting host disease.

    Science.gov (United States)

    Galiana, Eric; Marais, Antoine; Mura, Catherine; Industri, Benoît; Arbiol, Gilles; Ponchet, Michel

    2011-09-01

    The microbial community in which a pathogen evolves is fundamental to disease outcome. Species interacting with a pathogen on the host surface shape the distribution, density, and genetic diversity of the inoculum, but the role of these species is rarely determined. The screening method developed here can be used to characterize pathogen-associated species affecting disease. This strategy involves three steps: (i) constitution of the microbial community, using the pathogen as a trap; (ii) community selection, using extracts from the pathogen as the sole nutrient source; and (iii) molecular identification and the screening of isolates focusing on their effects on the growth of the pathogen in vitro and host disease. This approach was applied to a soilborne plant pathogen, Phytophthora parasitica, structured in a biofilm, for screening the microbial community from the rhizosphere of Nicotiana tabacum (the host). Two of the characterized eukaryotes interfered with the oomycete cycle and may affect the host disease. A Vorticella species acted through a mutualistic interaction with P. parasitica, disseminating pathogenic material by leaving the biofilm. A Phoma species established an amensal interaction with P. parasitica, strongly suppressing disease by inhibiting P. parasitica germination. This screening method is appropriate for all nonobligate pathogens. It allows the definition of microbial species as promoters or suppressors of a disease for a given biotope. It should also help to identify important microbial relationships for ecology and evolution of pathogens.

  10. Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis

    Science.gov (United States)

    Rohmer, Laurence; Hocquet, Didier; Miller, Samuel I.

    2011-01-01

    It is interesting to speculate that the evolutionary drive of microbes to develop pathogenic characteristics was to access the nutrient resources that animals provided. Environments in animals that pathogens colonize have also driven the evolution of new bacterial characteristics to maximize these new nutritional opportunities. This review focuses on genomic and functional aspects of pathogen metabolism that allow efficient utilization of nutrient resources provided by animals. Similar to genes encoding specific virulence traits, some genes encoding metabolic functions have been horizontally acquired by pathogens to provide a selective advantage in host tissues. Selective advantage in host tissues can also be gained in some circumstances by loss of function due to mutations that alter metabolic capabilities. Greater understanding of bacterial metabolism within host tissues should be important for increased understanding of host-pathogen interactions and the development of future therapeutic strategies. PMID:21600774

  11. The community ecology of pathogens: coinfection, coexistence and community composition.

    Science.gov (United States)

    Seabloom, Eric W; Borer, Elizabeth T; Gross, Kevin; Kendig, Amy E; Lacroix, Christelle; Mitchell, Charles E; Mordecai, Erin A; Power, Alison G

    2015-04-01

    Disease and community ecology share conceptual and theoretical lineages, and there has been a resurgence of interest in strengthening links between these fields. Building on recent syntheses focused on the effects of host community composition on single pathogen systems, we examine pathogen (microparasite) communities using a stochastic metacommunity model as a starting point to bridge community and disease ecology perspectives. Such models incorporate the effects of core community processes, such as ecological drift, selection and dispersal, but have not been extended to incorporate host-pathogen interactions, such as immunosuppression or synergistic mortality, that are central to disease ecology. We use a two-pathogen susceptible-infected (SI) model to fill these gaps in the metacommunity approach; however, SI models can be intractable for examining species-diverse, spatially structured systems. By placing disease into a framework developed for community ecology, our synthesis highlights areas ripe for progress, including a theoretical framework that incorporates host dynamics, spatial structuring and evolutionary processes, as well as the data needed to test the predictions of such a model. Our synthesis points the way for this framework and demonstrates that a deeper understanding of pathogen community dynamics will emerge from approaches working at the interface of disease and community ecology. © 2015 John Wiley & Sons Ltd/CNRS.

  12. Pathogen reduction of blood components.

    Science.gov (United States)

    Solheim, Bjarte G

    2008-08-01

    Thanks to many blood safety interventions introduced in developed countries the risk of transfusion transmitted infections has become exceedingly small in these countries. However, emerging pathogens still represent a serious challenge, as demonstrated by West Nile virus in the US and more recently by Chikungunya virus in the Indian Ocean. In addition bacterial contamination, particularly in platelets, and protozoa transmitted by blood components still represent sizeable risks in developed countries. In developing countries the risk of all transfusion transmitted infections is still high due to insufficient funding and organisation of the health service. Pathogen reduction of pooled plasma products has virtually eliminated the risk of transfusion transmitted infections, without compromising the quality of the products significantly. Pathogen reduction of blood components has been much more challenging. Solvent detergent treatment which has been so successfully applied for plasma products dissolves cell membranes, and can, therefore, only be applied for plasma and not for cellular blood components. Targeting of nucleic acids has been another method for pathogen inactivation of plasma and the only approach possible for cellular blood products. As documented in more than 15 year's track record, solvent detergent treatment of pooled plasma can yield high quality plasma. The increased risk for contamination by unknown viruses due to pooling is out weighed by elimination of TRALI, significant reduction in allergic reactions and standardisation of the product. Recently, a promising method for solvent detergent treatment of single donor plasma units has been published. Methylene blue light treatment of single donor plasma units has a similar long track record as pooled solvent detergent treated plasma; but the method is less well documented and affects coagulation factor activity more. Psoralen light treated plasma has only recently been introduced (CE marked in Europe

  13. Neuroepigenetic Regulation of Pathogenic Memories.

    Science.gov (United States)

    Sillivan, Stephanie E; Vaissière, Thomas; Miller, Courtney A

    2015-01-01

    Our unique collection of memories determines our individuality and shapes our future interactions with the world. Remarkable advances into the neurobiological basis of memory have identified key epigenetic mechanisms that support the stability of memory. Various forms of epigenetic regulation at the levels of DNA methylation, histone modification, and non-coding RNAs (ncRNAs) can modulate transcriptional and translational events required for memory processes. By changing the cellular profile in the brain's emotional, reward, and memory circuits, these epigenetic modifications have also been linked to perseverant, pathogenic memories. In this review, we will delve into the relevance of epigenetic dysregulation to pathogenic memory mechanisms by focusing on two neuropsychiatric disorders perpetuated by aberrant memory associations: substance use disorder (SUD) and post-traumatic stress disorder (PTSD). As our understanding improves, neuroepigenetic mechanisms may someday be harnessed to develop novel therapeutic targets for the treatment of these chronic, relapsing disorders.

  14. Neuroepigenetic regulation of pathogenic memories

    Directory of Open Access Journals (Sweden)

    Stephanie E. Sillivan

    2015-01-01

    Full Text Available Our unique collection of memories determines our individuality and shapes our future interactions with the world. Remarkable advances into the neurobiological basis of memory have identified key epigenetic mechanisms that support the stability of memory. Various forms of epigenetic regulation at the levels of DNA methylation, histone modification, and noncoding RNAs can modulate transcriptional and translational events required for memory processes. By changing the cellular profile in the brain’s emotional, reward, and memory circuits, these epigenetic modifications have also been linked to perseverant, pathogenic memories. In this review, we will delve into the relevance of epigenetic dysregulation to pathogenic memory mechanisms by focusing on 2 neuropsychiatric disorders perpetuated by aberrant memory associations: substance use disorder and post-traumatic stress disorder. As our understanding improves, neuroepigenetic mechanisms may someday be harnessed to develop novel therapeutic targets for the treatment of these chronic, relapsing disorders.

  15. Antimicrobial resistance of mastitis pathogens.

    Science.gov (United States)

    Oliver, Stephen P; Murinda, Shelton E

    2012-07-01

    Antibiotics are used extensively in the dairy industry to combat disease and to improve animal performance. Antibiotics such as penicillin, cephalosporin, streptomycin, and tetracycline are used for the treatment and prevention of diseases affecting dairy cows caused by a variety of gram-positive and gram-negative bacteria. Antibiotics are often administrated routinely to entire herds to prevent mastitis during the dry period. An increase in the incidence of disease in a herd generally results in increased use of antimicrobials, which in turn increases the potential for antibiotic residues in milk and the potential for increased bacterial resistance to antimicrobials. Continued use of antibiotics in the treatment and prevention of diseases of dairy cows will continue to be scrutinized. It is clear that strategies employing the prudent use of antimicrobials are needed. This clearly illustrates the importance of effective herd disease prevention and control programs. Based on studies published to date, scientific evidence does not support widespread, emerging resistance among mastitis pathogens to antibacterial drugs even though many of these antibiotics have been used in the dairy industry for treatment and prevention of disease for several decades. However, it is clear that use of antibiotics in dairy cows can contribute to increased antimicrobial resistance. While antimicrobial resistance does occur, we are of the opinion that the advantages of using antibiotics for the treatment of mastitis far outweigh the disadvantages. The clinical consequences of antimicrobial resistance of dairy pathogens affecting humans appear small. Antimicrobial resistance among dairy pathogens, particularly those found in milk, is likely not a human health concern as long as the milk is pasteurized. However, there are an increasing number of people who choose to consume raw milk. Transmission of an antimicrobial-resistant mastitis pathogen and/or foodborne pathogen to humans could occur

  16. Evolutionary biology of bacterial and fungal pathogens

    National Research Council Canada - National Science Library

    Baquero, F

    2008-01-01

    ... and Evolutionary Dynamics of Pathogens * 21 Keith A. Crandall and Marcos Pérez-Losada II. Evolutionary Genetics of Microbial Pathogens 4. Environmental and Social Influences on Infectious Disea...

  17. Plant Pathogenicity in Spaceflight Environments

    OpenAIRE

    Bishop, Deborah L.; Levine, Howard G.; Anderson, Anne J.

    1996-01-01

    Plants grown in microgravity are subject to many environmental stresses, which may promote microbial growth and result in pathogenicity to the plant. Recent plant experiments with super dwarf wheat aboard the NASA Space Shuttle and NASA/Russian Mir Space Station returned from the mission with severe degrees of fungal contamination. Understanding the cause of such microbial contamination and methods to eliminate it are necessary prerequisites for continued plant growth and development studies ...

  18. Proteomics of Plant Pathogenic Fungi

    Directory of Open Access Journals (Sweden)

    Raquel González-Fernández

    2010-01-01

    Full Text Available Plant pathogenic fungi cause important yield losses in crops. In order to develop efficient and environmental friendly crop protection strategies, molecular studies of the fungal biological cycle, virulence factors, and interaction with its host are necessary. For that reason, several approaches have been performed using both classical genetic, cell biology, and biochemistry and the modern, holistic, and high-throughput, omic techniques. This work briefly overviews the tools available for studying Plant Pathogenic Fungi and is amply focused on MS-based Proteomics analysis, based on original papers published up to December 2009. At a methodological level, different steps in a proteomic workflow experiment are discussed. Separate sections are devoted to fungal descriptive (intracellular, subcellular, extracellular and differential expression proteomics and interactomics. From the work published we can conclude that Proteomics, in combination with other techniques, constitutes a powerful tool for providing important information about pathogenicity and virulence factors, thus opening up new possibilities for crop disease diagnosis and crop protection.

  19. Minisequencing mitochondrial DNA pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Carracedo Ángel

    2008-04-01

    Full Text Available Abstract Background There are a number of well-known mutations responsible of common mitochondrial DNA (mtDNA diseases. In order to overcome technical problems related to the analysis of complete mtDNA genomes, a variety of different techniques have been proposed that allow the screening of coding region pathogenic mutations. Methods We here propose a minisequencing assay for the analysis of mtDNA mutations. In a single reaction, we interrogate a total of 25 pathogenic mutations distributed all around the whole mtDNA genome in a sample of patients suspected for mtDNA disease. Results We have detected 11 causal homoplasmic mutations in patients suspected for Leber disease, which were further confirmed by standard automatic sequencing. Mutations m.11778G>A and m.14484T>C occur at higher frequency than expected by change in the Galician (northwest Spain patients carrying haplogroup J lineages (Fisher's Exact test, P-value Conclusion We here developed a minisequencing genotyping method for the screening of the most common pathogenic mtDNA mutations which is simple, fast, and low-cost. The technique is robust and reproducible and can easily be implemented in standard clinical laboratories.

  20. Molecular Mechanisms of Bacterial Pathogenicity

    Science.gov (United States)

    Fuchs, Thilo Martin

    Cautious optimism has arisen over recent decades with respect to the long struggle against bacteria, viruses, and parasites. This has been offset, however, by a fatal complacency stemming from previous successes such as the development of antimicrobial drugs, the eradication of smallpox, and global immunization programs. Infectious diseases nevertheless remain the world's leading cause of death, killing at least 17 million persons annually [61]. Diarrheal diseases caused by Vibrio cholerae or Shigella dysenteriae kill about 3 million persons every year, most of them young children: Another 4 million die of tuberculosis or tetanus. Outbreaks of diphtheria in Eastern Europe threatens the population with a disease that had previously seemed to be overcome. Efforts to control infectious diseases more comprehensively are undermined not only by socioeconomic conditions but also by the nature of the pathogenic organisms itself; some isolates of Staphylococcus aureus and Enterobacter have become so resistant to drugs by horizontal gene transfer that they are almost untreatable. In addition, the mechanism of genetic variability helps pathogens to evade the human immune system, thus compromising the development of powerful vaccines. Therefore detailed knowledge of the molecular mechanisms of microbial pathogenicity is absolutely necessary to develop new strategies against infectious diseases and thus to lower their impact on human health and social development.

  1. Plant innate immunity against human bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Maeli eMelotto

    2014-08-01

    Full Text Available Certain human bacterial pathogens such as the enterohemorrhagic Escherichia coli and Salmonella enterica are not proven to be plant pathogens yet. Nonetheless, under certain conditions they can survive on, penetrate into, and colonize internal plant tissues causing serious food borne disease outbreaks. In this review, we highlight current understanding on the molecular mechanisms of plant responses against human bacterial pathogens and discuss salient common and contrasting themes of plant interactions with phytopathogens or human pathogens.

  2. Effectiveness of irradiation in killing pathogens

    International Nuclear Information System (INIS)

    Yeager, J.G.; Ward, R.L.

    1980-01-01

    United States Environmental Protection Agency regulations include gamma ray irradiation of sludge as an approved Process to Further Reduce Pathogens (PFRP) prior to land application. Research at Sandia National Laboratories on pathogen inactivation in sludge by gamma irradiation has demonstrated that the 1 Mrad PFRP dose is capable, by itself, of eliminating bacterial, fungal, and parasitic pathogens from sludge. Gamma irradiation of sludge in conjunction with the required Processes to Significantly Reduce Pathogens (PSRP) should also eliminate the viral hazard from wastewater sludges

  3. Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

    Energy Technology Data Exchange (ETDEWEB)

    Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham; Wilhelm, Larry J.; Goodwin, Stephen B.; Berlin, Aaron M.; Figueroa, Melania; Freitag, Michael; Hane, James K.; Henrissat, Bernard; Holman, Wade H.; Kodira, Chinnappa D.; Martin, Joel; Oliver, Richard P.; Robbertse, Barbara; Schackwitz, Wendy; Schwartz, David C.; Spatafora, Joseph W.; Turgeon, B. Gillian; Yandava, Chandri; Young, Sarah; Zhou, Shiguo; Zeng, Qiandong; Grigoriev, Igor V.; Ma, Li-Jun; Ciuffetti, Lynda M.

    2012-08-16

    Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11 chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes.

  4. 76 FR 24793 - Highly Pathogenic Avian Influenza

    Science.gov (United States)

    2011-05-03

    .... APHIS-2006-0074] RIN 0579-AC36 Highly Pathogenic Avian Influenza AGENCY: Animal and Plant Health... any subtype of highly pathogenic avian influenza is considered to exist. The interim rule also imposed... avian influenza, or that have moved through regions where any subtype of highly pathogenic avian...

  5. Host Resistance and Temperature-Dependent Evolution of Aggressiveness in the Plant Pathogen Zymoseptoria tritici

    Directory of Open Access Journals (Sweden)

    Fengping Chen

    2017-06-01

    Full Text Available Understanding how habitat heterogeneity may affect the evolution of plant pathogens is essential to effectively predict new epidemiological landscapes and manage genetic diversity under changing global climatic conditions. In this study, we explore the effects of habitat heterogeneity, as determined by variation in host resistance and local temperature, on the evolution of Zymoseptoria tritici by comparing the aggressiveness development of five Z. tritici populations originated from different parts of the world on two wheat cultivars varying in resistance to the pathogen. Our results show that host resistance plays an important role in the evolution of Z. tritici. The pathogen was under weak, constraining selection on a host with quantitative resistance but under a stronger, directional selection on a susceptible host. This difference is consistent with theoretical expectations that suggest that quantitative resistance may slow down the evolution of pathogens and therefore be more durable. Our results also show that local temperature interacts with host resistance in influencing the evolution of the pathogen. When infecting a susceptible host, aggressiveness development of Z. tritici was negatively correlated to temperatures of the original collection sites, suggesting a trade-off between the pathogen’s abilities of adapting to higher temperature and causing disease and global warming may have a negative effect on the evolution of pathogens. The finding that no such relationship was detected when the pathogen infected the partially resistant cultivars indicates the evolution of pathogens in quantitatively resistant hosts is less influenced by environments than in susceptible hosts.

  6. Machine learning for the meta-analyses of microbial pathogens' volatile signatures.

    Science.gov (United States)

    Palma, Susana I C J; Traguedo, Ana P; Porteira, Ana R; Frias, Maria J; Gamboa, Hugo; Roque, Ana C A

    2018-02-20

    Non-invasive and fast diagnostic tools based on volatolomics hold great promise in the control of infectious diseases. However, the tools to identify microbial volatile organic compounds (VOCs) discriminating between human pathogens are still missing. Artificial intelligence is increasingly recognised as an essential tool in health sciences. Machine learning algorithms based in support vector machines and features selection tools were here applied to find sets of microbial VOCs with pathogen-discrimination power. Studies reporting VOCs emitted by human microbial pathogens published between 1977 and 2016 were used as source data. A set of 18 VOCs is sufficient to predict the identity of 11 microbial pathogens with high accuracy (77%), and precision (62-100%). There is one set of VOCs associated with each of the 11 pathogens which can predict the presence of that pathogen in a sample with high accuracy and precision (86-90%). The implemented pathogen classification methodology supports future database updates to include new pathogen-VOC data, which will enrich the classifiers. The sets of VOCs identified potentiate the improvement of the selectivity of non-invasive infection diagnostics using artificial olfaction devices.

  7. Evidence for acquisition of virulence effectors in pathogenic chytrids

    Directory of Open Access Journals (Sweden)

    Summers Kyle

    2011-07-01

    Full Text Available Abstract Background The decline in amphibian populations across the world is frequently linked to the infection of the chytrid fungus Batrachochytrium dendrobatidis (Bd. This is particularly perplexing because Bd was only recently discovered in 1999 and no chytrid fungus had previously been identified as a vertebrate pathogen. Results In this study, we show that two large families of known virulence effector genes, crinkler (CRN proteins and serine peptidases, were acquired by Bd from oomycete pathogens and bacteria, respectively. These two families have been duplicated after their acquisition by Bd. Additional selection analyses indicate that both families evolved under strong positive selection, suggesting that they are involved in the adaptation of Bd to its hosts. Conclusions We propose that the acquisition of virulence effectors, in combination with habitat disruption and climate change, may have driven the Bd epidemics and the decline in amphibian populations. This finding provides a starting point for biochemical investigations of chytridiomycosis.

  8. Epigenetic control of effectors in plant pathogens

    Directory of Open Access Journals (Sweden)

    Mark eGijzen

    2014-11-01

    Full Text Available Plant pathogens display impressive versatility in adapting to host immune systems. Pathogen effector proteins facilitate disease but can become avirulence (Avr factors when the host acquires discrete recognition capabilities that trigger immunity. The mechanisms that lead to changes to pathogen Avr factors that enable escape from host immunity are diverse, and include epigenetic switches that allow for reuse or recycling of effectors. This perspective outlines possibilities of how epigenetic control of Avr effector gene expression may have arisen and persisted in plant pathogens, and how it presents special problems for diagnosis and detection of specific pathogen strains or pathotypes.

  9. Reduced Set of Virulence Genes Allows High Accuracy Prediction of Bacterial Pathogenicity in Humans

    Science.gov (United States)

    Iraola, Gregorio; Vazquez, Gustavo; Spangenberg, Lucía; Naya, Hugo

    2012-01-01

    Although there have been great advances in understanding bacterial pathogenesis, there is still a lack of integrative information about what makes a bacterium a human pathogen. The advent of high-throughput sequencing technologies has dramatically increased the amount of completed bacterial genomes, for both known human pathogenic and non-pathogenic strains; this information is now available to investigate genetic features that determine pathogenic phenotypes in bacteria. In this work we determined presence/absence patterns of different virulence-related genes among more than finished bacterial genomes from both human pathogenic and non-pathogenic strains, belonging to different taxonomic groups (i.e: Actinobacteria, Gammaproteobacteria, Firmicutes, etc.). An accuracy of 95% using a cross-fold validation scheme with in-fold feature selection is obtained when classifying human pathogens and non-pathogens. A reduced subset of highly informative genes () is presented and applied to an external validation set. The statistical model was implemented in the BacFier v1.0 software (freely available at ), that displays not only the prediction (pathogen/non-pathogen) and an associated probability for pathogenicity, but also the presence/absence vector for the analyzed genes, so it is possible to decipher the subset of virulence genes responsible for the classification on the analyzed genome. Furthermore, we discuss the biological relevance for bacterial pathogenesis of the core set of genes, corresponding to eight functional categories, all with evident and documented association with the phenotypes of interest. Also, we analyze which functional categories of virulence genes were more distinctive for pathogenicity in each taxonomic group, which seems to be a completely new kind of information and could lead to important evolutionary conclusions. PMID:22916122

  10. Future research needs involving pathogens in groundwater

    Science.gov (United States)

    Bradford, Scott A.; Harvey, Ronald W.

    2017-01-01

    Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

  11. Future research needs involving pathogens in groundwater

    Science.gov (United States)

    Bradford, Scott A.; Harvey, Ronald W.

    2017-06-01

    Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

  12. Pathogen recognition in the innate immune response.

    Science.gov (United States)

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  13. Contamination of water resources by pathogenic bacteria

    Science.gov (United States)

    2014-01-01

    Water-borne pathogen contamination in water resources and related diseases are a major water quality concern throughout the world. Increasing interest in controlling water-borne pathogens in water resources evidenced by a large number of recent publications clearly attests to the need for studies that synthesize knowledge from multiple fields covering comparative aspects of pathogen contamination, and unify them in a single place in order to present and address the problem as a whole. Providing a broader perceptive of pathogen contamination in freshwater (rivers, lakes, reservoirs, groundwater) and saline water (estuaries and coastal waters) resources, this review paper attempts to develop the first comprehensive single source of existing information on pathogen contamination in multiple types of water resources. In addition, a comprehensive discussion describes the challenges associated with using indicator organisms. Potential impacts of water resources development on pathogen contamination as well as challenges that lie ahead for addressing pathogen contamination are also discussed. PMID:25006540

  14. Complement Evasion by Pathogenic Leptospira.

    Science.gov (United States)

    Fraga, Tatiana Rodrigues; Isaac, Lourdes; Barbosa, Angela Silva

    2016-01-01

    Leptospirosis is a neglected infectious disease caused by spirochetes from the genus Leptospira . Pathogenic microorganisms, notably those which reach the blood circulation such as Leptospira , have evolved multiple strategies to escape the host complement system, which is important for innate and acquired immunity. Leptospira avoid complement-mediated killing through: (i) recruitment of host complement regulators; (ii) acquisition of host proteases that cleave complement proteins on the bacterial surface; and, (iii) secretion of proteases that inactivate complement proteins in the Leptospira surroundings. The recruitment of host soluble complement regulatory proteins includes the acquisition of Factor H (FH) and FH-like-1 (alternative pathway), C4b-binding protein (C4BP) (classical and lectin pathways), and vitronectin (Vn) (terminal pathway). Once bound to the leptospiral surface, FH and C4BP retain cofactor activity of Factor I in the cleavage of C3b and C4b, respectively. Vn acquisition by leptospires may result in terminal pathway inhibition by blocking C9 polymerization. The second evasion mechanism lies in plasminogen (PLG) binding to the leptospiral surface. In the presence of host activators, PLG is converted to enzymatically active plasmin, which is able to degrade C3b, C4b, and C5 at the surface of the pathogen. A third strategy used by leptospires to escape from complement system is the active secretion of proteases. Pathogenic, but not saprophytic leptospires, are able to secrete metalloproteases that cleave C3 (central complement molecule), Factor B (alternative pathway), and C4 and C2 (classical and lectin pathways). The purpose of this review is to fully explore these complement evasion mechanisms, which act together to favor Leptospira survival and multiplication in the host.

  15. Icu Pathogens: A Continuous Challenge

    International Nuclear Information System (INIS)

    Hafeez, A.; Munir, T.; Najeeb, S.; Rehman, S.; Gilani, M.

    2016-01-01

    Objective: To determine the frequency and antibiogram of pathogens in an intensive care unit (ICU). Study Design: Cross-sectional, observational study. Place and Duration of Study: Department of Microbiology, Army Medical College, National University of Science and Technology, Islamabad, from January 2013 to January 2014. Methodology: Clinical samples, received from patients admitted in ICU, were inoculated on various medias like blood agar, chocolate agar, MacConkey agar and urine samples on CLED. These were then incubated at 37 degree C for 24 hours. Isolates were identified by colony morphology, Gram reaction, catalase test, oxidase test. Species identification in case of Gram Negative Rods was done by using API 20E (BioMerieux). Antibiotic susceptibility was done by using modified KirbyBauer disc diffusion technique. Bacterial isolates were prepared and inoculated on Mueller-Hinton agar plates followed by application of various antibiotic disc (Oxoid, UK) as per manufacturer's instructions. The plates were then incubated at 37 degree C aerobically for 18 - 24 hours. Zone diameters were measured and interpreted as sensitive and resistant, according to Clinical and Laboratory Standards Institute (CLSI) guidelines. Results: Out of the 367 positive cultures, 116 (31.08 percent) were Acinetobacter baumanniisusceptible to minocycline and tigecycline followed by Klebsiella pneumoniae (n=71, 16 percent) susceptible to tigecycline and meropenem. Others were Pseudomonas aeruginosa, Escherichia coli Coagulase Negative Staphylococcus, Staphylococcus aureus, Enterococcus spp., Streptococcus spp., Klebsiella oxytoca, Stenotrophomonas maltophilia, and Candida spp. Conclusion: Acinetobacter baumannii was the most frequently isolated pathogen. Most of the cultures yielding pathogens were from respiratory tract samples. Gram negative isolates were multidrug resistant but most were tigecycline and susceptible to meropenem. (author)

  16. COXIELLA BURNETII PATHOGENICITY MOLECULAR BASIS

    Directory of Open Access Journals (Sweden)

    Yu. A. Panferova

    2016-01-01

    Full Text Available Coxiella burnetii is an obligate intracellular gram-negative bacterial pathogen, an ethiological agent of Q-fever, a zoonotic disease, elapsing as an acute (mostly atypical pneumonia or a chronic (mostly endocarditis form. The host range is represented by wide range of mammal, avian and arthropod species, but the main source of human infection are farm animals. The main route of infection is aerosolic. In case of contact with organism pathogen binds with phagocytal monocytic-macrophagal cell line. C. burnetii promotes maturation of specific phagolysosome-like compartment in host cell, called coxiella-containing vacuole, within this vacuole pathogen becames metabolically activated and actively replicates. Coxiella persists as metabolically inactive spore-like form in environment. Internalisation of C. burnetii occurs using actin-mediated phagocytosis and zipper mechanism. After internalization of bacteria maturation of phagolysosome-like compartment and large coxiella-containing vacuole formation occure, and vacuole can occupy nearly the whole cytoplasm of the host cell. Survivance of infected cells is important for chronic infection with C. burnetii. C. burnetii elongate the viability of host cell by two ways: it actively inhibits apoptotic signal cascades and induce pro-survival factors. Exceptthat C. burnetii involves autophagic pathway during coxiella-containing vacuole formation, and induction of autophagy promotes pathogen replication. During infection C. burnetii translocates effector substrates from bacterial cytosole to euca ryotic host cell cytosole using type IV secretion system, where effectors modulate host cell proteins. Overall approximately 130 secreted effectors of type IV transport system, but function of most of them remains unknown to date. Specific sec reted proteins for variety of strains and isolates were identified, confirmed that certain pathotypes of C. burnetii can exist. Identification and

  17. Understanding the Pathogenicity of Burkholderia contaminans, an Emerging Pathogen in Cystic Fibrosis.

    Science.gov (United States)

    Nunvar, Jaroslav; Kalferstova, Lucie; Bloodworth, Ruhi A M; Kolar, Michal; Degrossi, Jose; Lubovich, Silvina; Cardona, Silvia T; Drevinek, Pavel

    2016-01-01

    Several bacterial species from the Burkholderia cepacia complex (Bcc) are feared opportunistic pathogens that lead to debilitating lung infections with a high risk of developing fatal septicemia in cystic fibrosis (CF) patients. However, the pathogenic potential of other Bcc species is yet unknown. To elucidate clinical relevance of Burkholderia contaminans, a species frequently isolated from CF respiratory samples in Ibero-American countries, we aimed to identify its key virulence factors possibly linked with an unfavorable clinical outcome. We performed a genome-wide comparative analysis of two isolates of B. contaminans ST872 from sputum and blood culture of a female CF patient in Argentina. RNA-seq data showed significant changes in expression for quorum sensing-regulated virulence factors and motility and chemotaxis. Furthermore, we detected expression changes in a recently described low-oxygen-activated (lxa) locus which encodes stress-related proteins, and for two clusters responsible for the biosynthesis of antifungal and hemolytic compounds pyrrolnitrin and occidiofungin. Based on phenotypic assays that confirmed changes in motility and in proteolytic, hemolytic and antifungal activities, we were able to distinguish two phenotypes of B. contaminans that coexisted in the host and entered her bloodstream. Whole genome sequencing revealed that the sputum and bloodstream isolates (each representing a distinct phenotype) differed by over 1,400 mutations as a result of a mismatch repair-deficient hypermutable state of the sputum isolate. The inferred lack of purifying selection against nonsynonymous mutations and the high rate of pseudogenization in the derived isolate indicated limited evolutionary pressure during evolution in the nutrient-rich, stable CF sputum environment. The present study is the first to examine the genomic and transcriptomic differences between longitudinal isolates of B. contaminans. Detected activity of a number of putative virulence

  18. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  19. Streptococcus agalactiae: a vaginal pathogen?

    Science.gov (United States)

    Maniatis, A N; Palermos, J; Kantzanou, M; Maniatis, N A; Christodoulou, C; Legakis, N J

    1996-03-01

    The significance of Streptococcus agalactiae as an aetiological agent in vaginitis was evaluated. A total of 6226 samples from women who presented with vaginal symptoms was examined. The presence of >10 leucocytes/high-power field (h.p.f.) was taken to be the criterion of active infection. S. agalactiae was isolated from 10.1% of these samples. The isolation rates of other common pathogens such as Candida spp., Gardnerella vaginalis and Trichomonas spp. were 54.1%, 27.2% and 4.2%, respectively, in the same group of patients. In contrast, the isolation rates of these micro-organisms in the group of patients who had no infection (S. agalactiae was isolated, it was the sole pathogen isolated (83%) and its presence was associated with an inflammatory response in 80% of patients. Furthermore, the relative risk of vaginal infection with S. agalactiae (2.38) in patients with purulent vaginal discharge was greater than that of Candida spp. infection (1.41) and lower than that of Trichomonas spp. infection (8.32). These data suggest that S. agalactiae in symptomatic women with microscopic evidence of inflammation should be considered a causative agent of vaginitis.

  20. Bioactive Metabolites from Pathogenic and Endophytic Fungi of Forest Trees.

    Science.gov (United States)

    Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Scanu, Bruno; Evidente, Antonio; Cimmino, Alessio

    2018-01-01

    Fungi play an important role in terrestrial ecosystems interacting positively or negatively with plants. These interactions are complex and the outcomes are different depending on the fungal lifestyles, saprotrophic, mutualistic or pathogenic. Furthermore, fungi are well known for producing secondary metabolites, originating from different biosynthetic pathways, which possess biological properties of considerable biotechnological interest. Among the terrestrial ecosystems, temperate forests represent an enormous reservoir of fungal diversity. This review will highlight the goldmine of secondary metabolites produced by pathogenic and endophytic fungi of forest trees with focus on their biological activities. A structured search of bibliographic databases for peer-reviewed research literature was undertaken using a research discovery application providing access to a large and authoritative source of references. The papers selected were examined and the main results were reported and discussed. Two hundred forthy-one papers were included in the review, outlined a large number of secondary metabolites produced by pathogenic and endophiltic fungi and their biological activities, including phytotoxic, antifungal, antioomycetes, antibacterial, brine shrimp lethality, mosquito biting deterrence and larvicidal, cytotoxic, antiproliferative and many other bioactivities. The findings of this review confirm the importance of secondary metabolites produced by pathogenic and endophytic fungi from forest plants growing in temperate regions as an excellent prospects to discover compounds with new bioactivities and mode of actions. In addition, the potential of some metabolites as a source of new drugs and biopesticides is underlined. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  1. Insect immunity shows specificity in protection upon secondary pathogen exposure.

    Science.gov (United States)

    Sadd, Ben M; Schmid-Hempel, Paul

    2006-06-20

    Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.

  2. Interaction of pathogens with host cholesterol metabolism.

    Science.gov (United States)

    Sviridov, Dmitri; Bukrinsky, Michael

    2014-10-01

    Pathogens of different taxa, from prions to protozoa, target cellular cholesterol metabolism to advance their own development and to impair host immune responses, but also causing metabolic complications, for example, atherosclerosis. This review describes recent findings of how pathogens do it. A common theme in interaction between pathogens and host cholesterol metabolism is pathogens targeting lipid rafts of the host plasma membrane. Many intracellular pathogens use rafts as an entry gate, taking advantage of the endocytic machinery and high abundance of outward-looking molecules that can be used as receptors. At the same time, disruption of the rafts' functional capacity, achieved by the pathogens through a number of various means, impairs the ability of the host to generate immune response, thus helping pathogen to thrive. Pathogens cannot synthesize cholesterol, and salvaging host cholesterol helps pathogens build advanced cholesterol-containing membranes and assembly platforms. Impact on cholesterol metabolism is not limited to the infected cells; proteins and microRNAs secreted by infected cells affect lipid metabolism systemically. Given an essential role that host cholesterol metabolism plays in pathogen development, targeting this interaction may be a viable strategy to fight infections, as well as metabolic complications of the infections.

  3. Potentially pathogenic, pathogenic, and allergenic moulds in the urban soils

    Directory of Open Access Journals (Sweden)

    Đukić Dragutin A.

    2011-01-01

    Full Text Available The dynamics of soil mould populations that can compromise the human immune system was evaluated in experimental plots located at different distances (100, 300, 500, 700 and 900 m from the main source of pollution - the Podgorica Aluminum Plant. Soil samples were collected in July and October 2008 from three different plot zones at a depth of 0-10 cm. The count of potentially pathogenic, keratinolytic and allergenic (melaninogenic moulds was assessed, which can significantly contribute to both diagnosis and prophylaxis. The count of medically important moulds was higher in the urban soil than in the unpolluted (control soil. Their count decreased with increasing distance from the main pollution source (PAP. Their abundance in the soil was considerably higher in autumn than in spring.

  4. Genetic characteristics and pathogenic mechanisms of periodontal pathogens.

    Science.gov (United States)

    Amano, A; Chen, C; Honma, K; Li, C; Settem, R P; Sharma, A

    2014-05-01

    Periodontal disease is caused by a group of bacteria that utilize a variety of strategies and molecular mechanisms to evade or overcome host defenses. Recent research has uncovered new evidence illuminating interesting aspects of the virulence of these bacteria and their genomic variability. This paper summarizes some of the strategies utilized by the major species - Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Treponema denticola, and Porphyromonas gingivalis - implicated in the pathogenesis of periodontal disease. Whole-genome sequencing of 14 diverse A. actinomycetemcomitans strains has revealed variations in their genetic content (ranging between 0.4% and 19.5%) and organization. Strikingly, isolates from human periodontal sites showed no genomic changes during persistent colonization. T. forsythia manipulates the cytokine responses of macrophages and monocytes through its surface glycosylation. Studies have revealed that bacterial surface-expressed O-linked glycans modulate T-cell responses during periodontal inflammation. Periodontal pathogens belonging to the "red complex" consortium express neuraminidases, which enables them to scavenge sialic acid from host glycoconjugates. Analysis of recent data has demonstrated that the cleaved sialic acid acts as an important nutrient for bacterial growth and a molecule for the decoration of bacteria surfaces to help evade the host immune attack. In addition, bacterial entry into host cells is also an important prerequisite for the lifestyle of periodontal pathogens such as P. gingivalis. Studies have shown that, after its entry into the cell, this bacterium uses multiple sorting pathways destined for autophagy, lysosomes, or recycling pathways. In addition, P. gingivalis releases outer membrane vesicles which enter cells via endocytosis and cause cellular functional impairment.

  5. Pathogen burden, co-infection and major histocompatibility complex variability in the European badger (Meles meles)

    NARCIS (Netherlands)

    Sin, Yung Wa; Annavi, Geetha; Dugdale, Hannah L.; Newman, Chris; Burke, Terry; MacDonald, David W.

    2014-01-01

    Pathogen-mediated selection is thought to maintain the extreme diversity in the major histocompatibility complex (MHC) genes, operating through the heterozygote advantage, rare-allele advantage and fluctuating selection mechanisms. Heterozygote advantage (i.e. recognizing and binding a wider range

  6. Pathogen group specific risk factors at herd, heifer and quarter levels for intramammary infections in early lactating dairy heifers

    NARCIS (Netherlands)

    Piepers, S.; Peeters, K.; Opsomer, G.; Barkema, H.W.; Frankena, K.; Vliegher, de S.

    2011-01-01

    Risk factors for intramammary infections caused by coagulase-negative staphylococci, contagious major pathogens and environmental major pathogens in early lactating heifers were evaluated at the herd, heifer and quarter levels. In total, 764 quarters of 191 dairy heifers in 20 randomly selected

  7. Transcriptomic insight into pathogenicity-associated factors of Conidiobolus obscurus, an obligate aphid-pathogenic fungus belonging to Entomopthoromycota.

    Science.gov (United States)

    Wang, Jianghong; Zhou, Xiang; Guo, Kai; Zhang, Xinqi; Lin, Haiping; Montalva, Cristian

    2018-01-16

    Conidiobolus obscurus is a widespread fungal entomopathogen with aphid biocontrol potential. This study focused on a de novo transcriptomic analysis of C. obscurus. A number of pathogenicity-associated factors were annotated for the first time from the assembled 17 231 fungal unigenes, including those encoding subtilisin-like proteolytic enzymes (Pr1s), trypsin-like proteases, metalloproteases, carboxypeptidases and endochitinases. Many of these genes were transcriptionally up-regulated by at least twofold in mycotized cadavers compared with the in vitro fungal cultures. The resultant transcriptomic database was validated by the transcript levels of three selected pathogenicity-related genes quantified from different in vivo and in vitro material in real-time quantitative polymerase chain reaction (PCR). The involvement of multiple Pr1 proteases in the first stage of fungal infection was also suggested. Interestingly, a unique cytolytic (Cyt)-like δ-endotoxin gene was highly expressed in both mycotized cadavers and fungal cultures, and was more or less distinct from its homologues in bacteria and other fungi. Our findings provide the first global insight into various pathogenicity-related genes in this obligate aphid pathogen and may help to develop novel biocontrol strategy against aphid pests. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  8. Mucosal immunity to pathogenic intestinal bacteria.

    Science.gov (United States)

    Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela

    2016-03-01

    The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.

  9. Occurrence and antibacterial susceptibility pattern of bacterial pathogens isolated from diarrheal patients in Pakistan

    OpenAIRE

    Rasool, Muhammad H.; Siddique, Abu B.; Saqalein, Muhammad; Asghar, Muhammad J.; Zahoor, Muhammad A.; Aslam, Bilal; Shafiq, Humerah B.; Nisar, Muhammad A.

    2016-01-01

    Objective: To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. Methods: This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural character...

  10. Pathogen prevalence predicts human cross-cultural variability in individualism/collectivism

    OpenAIRE

    Fincher, Corey L; Thornhill, Randy; Murray, Damian R; Schaller, Mark

    2008-01-01

    Pathogenic diseases impose selection pressures on the social behaviour of host populations. In humans (Homo sapiens), many psychological phenomena appear to serve an antipathogen defence function. One broad implication is the existence of cross-cultural differences in human cognition and behaviour contingent upon the relative presence of pathogens in the local ecology. We focus specifically on one fundamental cultural variable: differences in individualistic versus collectivist values. We sug...

  11. Assessment of pathogen survival potential during managed aquifer recharge with diffusion chambers.

    Science.gov (United States)

    Sidhu, J P S; Toze, S

    2012-09-01

    To evaluate the efficacy of using in situ diffusion chambers for pathogen decay studies in the aquifer. A comparative microbial inactivation study was carried out in groundwater by seeding selected pathogens and indicators in laboratory microcosms and Teflon diffusion chambers (in situ) fitted with 0.010- and 0.025-μm pore-size membranes. The results have shown that there is a difference in the decay rates obtained from the laboratory microcosms and in situ diffusion chambers for several pathogens. The results suggest that the use of laboratory microcosms to determine pathogen decay during the Managed Aquifer Recharge (MAR) may lead to underestimation of decay of adenovirus and Cryptosporidium and subsequent inaccurate assessment of the required residence time in the aquifer for pathogens to be removed from the recharged water. The decay rate of two indicator bacteria, Salmonella enterica and adenovirus, was found to be significantly slower (t-test, P aquifers. Reliable assessment of potential public health risks from the presence of pathogens in groundwater is essential for proper management of the MAR schemes. The results of this study suggest that in situ assessment of pathogen survival potential in diffusion chambers provided more reliable data for pathogen risk assessment and subsequent risk mitigation plans for MAR schemes. © 2012 The Authors Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  12. Heme Synthesis and Acquisition in Bacterial Pathogens

    OpenAIRE

    Choby, Jacob E.; Skaar, Eric P.

    2016-01-01

    Bacterial pathogens require the iron-containing cofactor heme to cause disease. Heme is essential to the function of hemoproteins, which are involved in energy generation by the electron transport chain, detoxification of host immune effectors, and other processes. During infection, bacterial pathogens must synthesize heme or acquire heme from the host; however, host heme is sequestered in high-affinity hemoproteins. Pathogens have evolved elaborate strategies to acquire heme from host source...

  13. The Candida Pathogenic Species Complex

    Science.gov (United States)

    Turner, Siobhán A.; Butler, Geraldine

    2014-01-01

    Candida species are the most common causes of fungal infection. Approximately 90% of infections are caused by five species: Candida albicans, Candida glabrata, Candida tropicalis, Candida parapsilosis, and Candida krusei. Three (C. albicans, C. tropicalis, and C. parapsilosis) belong to the CTG clade, in which the CTG codon is translated as serine and not leucine. C. albicans remains the most commonly isolated but is decreasing relative to the other species. The increasing incidence of C. glabrata is related to its reduced susceptibility to azole drugs. Genome analysis suggests that virulence in the CTG clade is associated with expansion of gene families, particularly of cell wall genes. Similar independent processes took place in the C. glabrata species group. Gene loss and expansion in an ancestor of C. glabrata may have resulted in preadaptations that enabled pathogenicity. PMID:25183855

  14. Land application of sewage sludge: Pathogen issues

    International Nuclear Information System (INIS)

    Chang, A.C.

    1997-01-01

    Diseases transmitted via the faecal-oral exposure route cause severe gastroenteric disorders, and large numbers of causative organisms are discharged with the faecal matter of infected individuals. For this reason, pathogenic bacteria, viruses, protozoa, or helminths, are always found in sewage sludge. If not properly treated for use in agriculture, sludge can be a source of pathogenic contamination. Radiation is an attractive method to reduce the numbers of microorganisms in sewage sludge. Routine examination for pathogens is not practised nor recommended because complicated and costly procedures are involved. Instead, an indicator organism is usually assayed and enumerated. In this paper, methods are discussed for the investigation of pathogens in sewage sludge. (author)

  15. Multiple infections of rodents with zoonotic pathogens in Austria.

    Science.gov (United States)

    Schmidt, Sabrina; Essbauer, Sandra S; Mayer-Scholl, Anne; Poppert, Sven; Schmidt-Chanasit, Jonas; Klempa, Boris; Henning, Klaus; Schares, Gereon; Groschup, Martin H; Spitzenberger, Friederike; Richter, Dania; Heckel, Gerald; Ulrich, Rainer G

    2014-07-01

    Rodents are important reservoirs for a large number of zoonotic pathogens. We examined the occurrence of 11 viral, bacterial, and parasitic agents in rodent populations in Austria, including three different hantaviruses, lymphocytic choriomeningitis virus, orthopox virus, Leptospira spp., Borrelia spp., Rickettsia spp., Bartonella spp., Coxiella burnetii, and Toxoplasma gondii. In 2008, 110 rodents of four species (40 Clethrionomys glareolus, 29 Apodemus flavicollis, 26 Apodemus sylvaticus, and 15 Microtus arvalis) were trapped at two rural sites in Lower Austria. Chest cavity fluid and samples of lung, spleen, kidney, liver, brain, and ear pinna skin were collected. We screened selected tissue samples for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, Leptospira, Borrelia, Rickettsia, Bartonella spp., C. burnetii, and T. gondii by RT-PCR/PCR and detected nucleic acids of Tula hantavirus, Leptospira spp., Borrelia afzelii, Rickettsia spp., and different Bartonella species. Serological investigations were performed for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, and Rickettsia spp. Here, Dobrava-Belgrade hantavirus-, Tula hantavirus-, lymphocytic choriomeningitis virus-, orthopox virus-, and rickettsia-specific antibodies were demonstrated. Puumala hantavirus, C. burnetii, and T. gondii were neither detected by RT-PCR/PCR nor by serological methods. In addition, multiple infections with up to three pathogens were shown in nine animals of three rodent species from different trapping sites. In conclusion, these results show that rodents in Austria may host multiple zoonotic pathogens. Our observation raises important questions regarding the interactions of different pathogens in the host, the countermeasures of the host's immune system, the impact of the host-pathogen interaction on the fitness of the host, and the spread of infectious agents among wild rodents and from those to other animals or humans.

  16. Natural soil reservoirs for human pathogenic and fecal indicator bacteria

    Science.gov (United States)

    Boschiroli, Maria L; Falkinham, Joseph; Favre-Bonte, Sabine; Nazaret, Sylvie; Piveteau, Pascal; Sadowsky, Michael J.; Byappanahalli, Muruleedhara; Delaquis, Pascal; Hartmann, Alain

    2016-01-01

    Soils receive inputs of human pathogenic and indicator bacteria through land application of animal manures or sewage sludge, and inputs by wildlife. Soil is an extremely heterogeneous substrate and contains meso- and macrofauna that may be reservoirs for bacteria of human health concern. The ability to detect and quantify bacteria of human health concern is important in risk assessments and in evaluating the efficacy of agricultural soil management practices that are protective of crop quality and protective of adjacent water resources. The present chapter describes the distribution of selected Gram-positive and Gram-negative bacteria in soils. Methods for detecting and quantifying soilborne bacteria including extraction, enrichment using immunomagnetic capture, culturing, molecular detection and deep sequencing of metagenomic DNA to detect pathogens are overviewed. Methods for strain phenotypic and genotypic characterization are presented, as well as how comparison with clinical isolates can inform the potential for human health risk.

  17. Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle

    OpenAIRE

    Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul

    2014-01-01

    Background The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is reg...

  18. Development of a transformation system for Mycosphaerella pathogens of banana: a tool for the study of host/pathogen interactions.

    Science.gov (United States)

    Balint-Kurti, P J; May, G D; Churchill, A C

    2001-02-05

    A genetic transformation system has been developed for three Mycosphaerella pathogens of banana and plantain (Musa spp.). Mycosphaerella fijiensis and Mycosphaerella musicola, the causal agents of black and yellow Sigatoka, respectively, and Mycosphaerella eumusae, which causes Septoria leaf spot of banana, were transformed with a construct carrying a synthetic gene encoding green fluorescent protein (GFP). Most single-spored transformants that expressed GFP constitutively were mitotically stable in the absence of selection for hygromycin B resistance. Transformants of all three species were pathogenic on the susceptible banana cultivar Grand Nain, and growth in planta was comparable to wild-type strains. GFP expression by transformants allowed us to observe extensive fungal growth within leaf tissue that eventually turned necrotic, at which point the fungi grew saprophytically on the dead tissue. Leaf chlorosis and necrosis were often observed in advance of saprophytic growth of the mycelium on necrotic tissue, which supports previous reports suggesting secretion of a phytotoxin.

  19. Ecological genetics of the Bromus tectorum (Poaceae) - Ustilago Bullata (Ustilaginaceae): A role for frequency dependent selection?

    Science.gov (United States)

    Susan E. Meyer; David L. Nelson; Suzette Clement; Alisa Ramakrishnan

    2010-01-01

    Evolutionary processes that maintain genetic diversity in plants are likely to include selection imposed by pathogens. Negative frequency-dependent selection is a mechanism for maintenance of resistance polymorphism in plant - pathogen interactions. We explored whether such selection operates in the Bromus tectorum - Ustilago bullata pathosystem. Gene-for-gene...

  20. Targeting of the hydrophobic metabolome by pathogens.

    Science.gov (United States)

    Helms, J Bernd; Kaloyanova, Dora V; Strating, Jeroen R P; van Hellemond, Jaap J; van der Schaar, Hilde M; Tielens, Aloysius G M; van Kuppeveld, Frank J M; Brouwers, Jos F

    2015-05-01

    The hydrophobic molecules of the metabolome - also named the lipidome - constitute a major part of the entire metabolome. Novel technologies show the existence of a staggering number of individual lipid species, the biological functions of which are, with the exception of only a few lipid species, unknown. Much can be learned from pathogens that have evolved to take advantage of the complexity of the lipidome to escape the immune system of the host organism and to allow their survival and replication. Different types of pathogens target different lipids as shown in interaction maps, allowing visualization of differences between different types of pathogens. Bacterial and viral pathogens target predominantly structural and signaling lipids to alter the cellular phenotype of the host cell. Fungal and parasitic pathogens have complex lipidomes themselves and target predominantly the release of polyunsaturated fatty acids from the host cell lipidome, resulting in the generation of eicosanoids by either the host cell or the pathogen. Thus, whereas viruses and bacteria induce predominantly alterations in lipid metabolites at the host cell level, eukaryotic pathogens focus on interference with lipid metabolites affecting systemic inflammatory reactions that are part of the immune system. A better understanding of the interplay between host-pathogen interactions will not only help elucidate the fundamental role of lipid species in cellular physiology, but will also aid in the generation of novel therapeutic drugs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Population genomics of fungal and oomycete pathogens

    Science.gov (United States)

    We are entering a new era in plant pathology where whole-genome sequences of many individuals of a pathogen species are becoming readily available. This era of pathogen population genomics will provide new opportunities and challenges, requiring new computational and analytical tools. Population gen...

  2. Immunity to plant pathogens and iron homeostasis.

    Science.gov (United States)

    Aznar, Aude; Chen, Nicolas W G; Thomine, Sebastien; Dellagi, Alia

    2015-11-01

    Iron is essential for metabolic processes in most living organisms. Pathogens and their hosts often compete for the acquisition of this nutrient. However, iron can catalyze the formation of deleterious reactive oxygen species. Hosts may use iron to increase local oxidative stress in defense responses against pathogens. Due to this duality, iron plays a complex role in plant-pathogen interactions. Plant defenses against pathogens and plant response to iron deficiency share several features, such as secretion of phenolic compounds, and use common hormone signaling pathways. Moreover, fine tuning of iron localization during infection involves genes coding iron transport and iron storage proteins, which have been shown to contribute to immunity. The influence of the plant iron status on the outcome of a given pathogen attack is strongly dependent on the nature of the pathogen infection strategy and on the host species. Microbial siderophores emerged as important factors as they have the ability to trigger plant defense responses. Depending on the plant species, siderophore perception can be mediated by their strong iron scavenging capacity or possibly via specific recognition as pathogen associated molecular patterns. This review highlights that iron has a key role in several plant-pathogen interactions by modulating immunity. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Bacterial reproductive pathogens of cats and dogs.

    Science.gov (United States)

    Graham, Elizabeth M; Taylor, David J

    2012-05-01

    With the notable exception of Brucella canis, exogenous bacterial pathogens are uncommon causes of reproductive disease in cats and dogs. Most bacterial reproductive infections are endogenous, and predisposing factors for infection are important. This article reviews the etiology, pathogenesis, clinical presentation, diagnosis, treatment, and public health significance of bacterial reproductive pathogens in cats and dogs.

  4. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  5. Occurrence of root parsley pathogens inhabiting seeds

    Directory of Open Access Journals (Sweden)

    Bogdan Nowicki

    2013-12-01

    Full Text Available The studies on root parsley pathogens inhabiting seeds were conducted during 1981-1988 and in 1993. Filter paper method with prefreezing and keeping under light was used. Each test sample comprised 500 seeds. Pathogenicity of collected fungal isolates was tested following two laboratory methods. 238 seed samples were studied. 18 fungal species were found but only 7 proved to be important pathogens of root parsley. The most common inhabitants of root parsley seeds were Alternaria spp. A.allernata occurred on 74,8% of seeds but only a few isolates showed to be slightly pathogenic while A.petroselini and A.radicina were higly pathogenic and inhabited 11,4 and 4,2% of seeds, respectively. The second group of important pathogens were species of Fusarium found on 3,9% of seeds. F.avenaceum dominated as it comprised 48% of Fusarium isolates, the next were as follow: F.culmorum - 20%, F.equiseti - 15%, F.solani - 8%, F.oxysporum - 7% and F.dimerum -2%. Some fungi like Botrytis cinerea, Septoria petroselini and Phoma spp. inhabited low number of seeds, respectively O,4; 0,5 and 0,8%, but they were highly pathogenic to root parsley. The fungi: Bipolaris sorokiniana, Drechslera biseptata, Stemphylium botryosum and Ulocludium consortiale showed slight pathogenicity. They were isolated from 3,8% of seeds.

  6. 77 FR 34783 - Highly Pathogenic Avian Influenza

    Science.gov (United States)

    2012-06-12

    ... [Docket No. APHIS-2006-0074] RIN 0579-AC36 Highly Pathogenic Avian Influenza AGENCY: Animal and Plant... regions where any subtype of highly pathogenic avian influenza (HPAI) is considered to exist. The interim... avian influenza (HPAI). On January 24, 2011, we published in the Federal Register (76 FR 4046-4056...

  7. THE OCCURRENCE, GROWTH AND CONTROL OF PATHOGENS ...

    African Journals Online (AJOL)

    Fermented foods have many advantageous attributes such as improved nutritional value and safety against bacterial pathogens. These foods are also important for weaning purposes and hence play a role in protecting infants against foodborne diseases. However, pathogens have been isolated from some fermented foods ...

  8. Tracing pathogens in the food chain

    NARCIS (Netherlands)

    Brul, S.; Fratamico, P.M.; McMeekin, T.A.

    2010-01-01

    Successful methods for the detection and investigation of outbreaks of foodborne disease are essential for ensuring consumer safety. Increased understanding of the transmission of pathogens in food chains will also assist efforts to safeguard public health. Tracing pathogens in the food chain

  9. Arthropods vector grapevine trunk disease pathogens.

    Science.gov (United States)

    Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F

    2014-10-01

    Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.

  10. Pathogens' toolbox to manipulate human complement.

    Science.gov (United States)

    Fernández, Francisco J; Gómez, Sara; Vega, M Cristina

    2017-12-14

    The surveillance and pathogen fighting functions of the complement system have evolved to protect mammals from life-threatening infections. In turn, pathogens have developed complex molecular mechanisms to subvert, divert and evade the effector functions of the complement. The study of complement immunoevasion by pathogens sheds light on their infection drivers, knowledge that is essential to implement therapies. At the same time, complement evasion also acts as a discovery ground that reveals important aspects of how complement works under physiological conditions. In recent years, complex interrelationships between infection insults and the onset of autoimmune and complement dysregulation diseases have led to propose that encounters with pathogens can act as triggering factors for disease. The correct management of these diseases involves the recognition of their triggering factors and the development and administration of complement-associated molecular therapies. Even more recently, unsuspected proteins from pathogens have been shown to possess moonlighting functions as virulence factors, raising the possibility that behind the first line of virulence factors there be many more pathogen proteins playing secondary, helping and supporting roles for the pathogen to successfully establish infections. In an era where antibiotics have a progressively reduced effect on the management and control of infectious diseases worldwide, knowledge on the mechanisms of pathogenic invasion and evasion look more necessary and pressing than ever. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Smoking and periodontal disease: discrimination of antibody responses to pathogenic and commensal oral bacteria.

    Science.gov (United States)

    Hayman, L; Steffen, M J; Stevens, J; Badger, E; Tempro, P; Fuller, B; McGuire, A; Al-Sabbagh, Mohanad; Thomas, M V; Ebersole, J L

    2011-04-01

    Smoking is an independent risk factor for the initiation, extent and severity of periodontal disease. This study examined the ability of the host immune system to discriminate commensal oral bacteria from pathogens at mucosal surfaces, i.e. oral cavity. Serum immunoglobulin (Ig)G antibody reactive with three pathogenic and five commensal oral bacteria in 301 current smokers (age range 21-66 years) were examined by enzyme-linked immunosorbent assay. Clinical features of periodontal health were used as measures of periodontitis. Antibody to the pathogens and salivary cotinine levels were related positively to disease severity; however, the antibody levels were best described by the clinical disease unrelated to the amount of smoking. The data showed a greater immune response to pathogens than commensals that was related specifically to disease extent, and most noted in black males. Significant correlations in individual patient responses to the pathogens and commensals were lost with an increasing extent of periodontitis and serum antibody to the pathogens. Antibody to Porphyromonas gingivalis was particularly distinct with respect to the discriminatory nature of the immune responses in recognizing the pathogens. Antibody responses to selected pathogenic and commensal oral microorganisms differed among racial groups and genders. The antibody response to the pathogens was related to disease severity. The level of antibody to the pathogens, and in particular P. gingivalis, was correlated with disease severity in black and male subsets of patients. The amount of smoking did not appear to impact directly serum antibody levels to these oral bacteria. © 2011 The Authors. Clinical and Experimental Immunology © 2011 British Society for Immunology.

  12. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis

    Science.gov (United States)

    Khan, Raees; Roy, Nazish; Choi, Kihyuck

    2018-01-01

    The substantial use of triclosan (TCS) has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231) and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG) database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17), and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79%) and soil-borne plant pathogenic bacteria (98%). These included a variety of enoyl-acyl carrier protein reductase (ENRs) homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously presumed

  13. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis.

    Directory of Open Access Journals (Sweden)

    Raees Khan

    Full Text Available The substantial use of triclosan (TCS has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231 and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17, and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79% and soil-borne plant pathogenic bacteria (98%. These included a variety of enoyl-acyl carrier protein reductase (ENRs homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously

  14. Heme Synthesis and Acquisition in Bacterial Pathogens.

    Science.gov (United States)

    Choby, Jacob E; Skaar, Eric P

    2016-08-28

    Bacterial pathogens require the iron-containing cofactor heme to cause disease. Heme is essential to the function of hemoproteins, which are involved in energy generation by the electron transport chain, detoxification of host immune effectors, and other processes. During infection, bacterial pathogens must synthesize heme or acquire heme from the host; however, host heme is sequestered in high-affinity hemoproteins. Pathogens have evolved elaborate strategies to acquire heme from host sources, particularly hemoglobin, and both heme acquisition and synthesis are important for pathogenesis. Paradoxically, excess heme is toxic to bacteria and pathogens must rely on heme detoxification strategies. Heme is a key nutrient in the struggle for survival between host and pathogen, and its study has offered significant insight into the molecular mechanisms of bacterial pathogenesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Pathogenic mechanisms of intracellular bacteria.

    Science.gov (United States)

    Niller, Hans Helmut; Masa, Roland; Venkei, Annamária; Mészáros, Sándor; Minarovits, Janos

    2017-06-01

    We wished to overview recent data on a subset of epigenetic changes elicited by intracellular bacteria in human cells. Reprogramming the gene expression pattern of various host cells may facilitate bacterial growth, survival, and spread. DNA-(cytosine C5)-methyltransferases of Mycoplasma hyorhinis targeting cytosine-phosphate-guanine (CpG) dinucleotides and a Mycobacterium tuberculosis methyltransferase targeting non-CpG sites methylated the host cell DNA and altered the pattern of gene expression. Gene silencing by CpG methylation and histone deacetylation, mediated by cellular enzymes, also occurred in M. tuberculosis-infected macrophages. M. tuberculosis elicited cell type-specific epigenetic changes: it caused increased DNA methylation in macrophages, but induced demethylation, deposition of euchromatic histone marks and activation of immune-related genes in dendritic cells. A secreted transposase of Acinetobacter baumannii silenced a cellular gene, whereas Mycobacterium leprae altered the epigenotype, phenotype, and fate of infected Schwann cells. The 'keystone pathogen' oral bacterium Porphyromonas gingivalis induced local DNA methylation and increased the level of histone acetylation in host cells. These epigenetic changes at the biofilm-gingiva interface may contribute to the development of periodontitis. Epigenetic regulators produced by intracellular bacteria alter the epigenotype and gene expression pattern of host cells and play an important role in pathogenesis.

  16. The evolution of pathogenic trypanosomes

    Directory of Open Access Journals (Sweden)

    Jamie R. Stevens

    Full Text Available In the absence of a fossil record, the evolution of protozoa has until recently largely remained a matter for speculation. However, advances in molecular methods and phylogenetic analysis are now allowing interpretation of the "history written in the genes". This review focuses on recent progress in reconstruction of trypanosome phylogeny based on molecular data from ribosomal RNA, the miniexon and protein-coding genes. Sufficient data have now been gathered to demonstrate unequivocally that trypanosomes are monophyletic; the phylogenetic trees derived can serve as a framework to reinterpret the biology, taxonomy and present day distribution of trypanosome species, providing insights into the coevolution of trypanosomes with their vertebrate hosts and vectors. Different methods of dating the divergence of trypanosome lineages give rise to radically different evolutionary scenarios and these are reviewed. In particular, the use of one such biogeographically based approach provides new insights into the coevolution of the pathogens, Trypanosoma brucei and Trypanosoma cruzi, with their human hosts and the history of the diseases with which they are associated.

  17. Quorum Sensing of Periodontal Pathogens

    Directory of Open Access Journals (Sweden)

    Darije Plančak

    2015-01-01

    Full Text Available The term ‘quorum sensing’ describes intercellular bacterial communication which regulates bacterial gene expression according to population cell density. Bacteria produce and secrete small molecules, named autoinducers, into the intercellular space. The concentration of these molecules increases as a function of population cell density. Once the concentration of the stimulatory threshold is reached, alteration in gene expression occurs. Gram-positive and Gram-negative bacteria possess different types of quorum sensing systems. Canonical LuxI/R-type/acyl homoserine lactone mediated quorum sensing system is the best studied quorum sensing circuit and is described in Gram-negative bacteria which employ it for inter-species communication mostly. Grampositive bacteria possess a peptide-mediated quorum sensing system. Bacteria can communicate within their own species (intra-species but also between species (inter-species, for which they employ an autoinducer-2 quorum sensing system which is called the universal language of the bacteria. Periodontal pathogenic bacteria possess AI-2 quorum sensing systems. It is known that they use it for regulation of biofilm formation, iron uptake, stress response and virulence factor expression. A better understanding of bacterial communication mechanisms will allow the targeting of quorum sensing with quorum sensing inhibitors to prevent and control disease.

  18. Algae as reservoirs for coral pathogens.

    Directory of Open Access Journals (Sweden)

    Michael J Sweet

    Full Text Available Benthic algae are associated with coral death in the form of stress and disease. It's been proposed that they release exudates, which facilitate invasion of potentially pathogenic microbes at the coral-algal interface, resulting in coral disease. However, the original source of these pathogens remains unknown. This study examined the ability of benthic algae to act as reservoirs of coral pathogens by characterizing surface associated microbes associated with major Caribbean and Indo-Pacific algal species/types and by comparing them to potential pathogens of two dominant coral diseases: White Syndrome (WS in the Indo-Pacific and Yellow Band Disease (YBD in the Caribbean. Coral and algal sampling was conducted simultaneously at the same sites to avoid spatial effects. Potential pathogens were defined as those absent or rare in healthy corals, increasing in abundance in healthy tissues adjacent to a disease lesion, and dominant in disease lesions. Potentially pathogenic bacteria were detected in both WS and YBD and were also present within the majority of algal species/types (54 and 100% for WS and YBD respectively. Pathogenic ciliates were associated only with WS and not YBD lesions and these were also present in 36% of the Indo-Pacific algal species. Although potential pathogens were associated with many algal species, their presence was inconsistent among replicate algal samples and detection rates were relatively low, suggestive of low density and occurrence. At the community level, coral-associated microbes irrespective of the health of their host differed from algal-associated microbes, supporting that algae and corals have distinctive microbial communities associated with their tissue. We conclude that benthic algae are common reservoirs for a variety of different potential coral pathogens. However, algal-associated microbes alone are unlikely to cause coral death. Initial damage or stress to the coral via other competitive mechanisms is

  19. Conformational Flexibility Determines Selectivity and Antibacterial, Antiplasmodial, and Anticancer Potency of Cationic α-Helical Peptides*

    OpenAIRE

    Vermeer, Louic S.; Lan, Yun; Abbate, Vincenzo; Ruh, Emrah; Bui, Tam T.; Wilkinson, Louise J.; Kanno, Tokuwa; Jumagulova, Elmira; Kozlowska, Justyna; Patel, Jayneil; McIntyre, Caitlin A.; Yam, W. C.; Siu, Gilman; Atkinson, R. Andrew; Lam, Jenny K. W.

    2012-01-01

    Background: Antimicrobial peptides (AMPs) have the potential to act against multiple pathogenic targets. Results: AMPs that maintain conformational flexibility are more potent against multiple pathogens and less hemolytic. Conclusion: Antimicrobial action and hemolysis proceed via differing mechanisms. Significance: The potency, selectivity, and ability of AMPs to reach intracellular pathogens can be modulated using general principles.

  20. [Evolution of pathogenic micro-organisms as a challenge for medicine].

    Science.gov (United States)

    Vaara, Martti

    2009-01-01

    Successful parasitic micro-organisms are able to adapt to the circumstances of the host's organ system, and it is usually not expedient for them to kill their host. Under selection pressure, the evolution of micro-organisms is vastly quicker that that of man. The selection pressure brought about by rapid ecological changes and alterations associated with human action provides for the development of new, dangerous pathogens and transformation of familiar pathogens to become more dangerous. Progress in molecular biology has thus far not yielded as many new tools for the treatment of infectious diseases as the hopes were in the early 2000's.

  1. Ecological and evolutionary dynamics of a model facultative pathogen: Agrobacterium and crown gall disease of plants.

    Science.gov (United States)

    Barton, Ian S; Fuqua, Clay; Platt, Thomas G

    2018-01-01

    Many important pathogens maintain significant populations in highly disparate disease and non-disease environments. The consequences of this environmental heterogeneity in shaping the ecological and evolutionary dynamics of these facultative pathogens are incompletely understood. Agrobacterium tumefaciens, the causative agent for crown gall disease of plants has proven a productive model for many aspects of interactions between pathogens and their hosts and with other microbes. In this review, we highlight how this past work provides valuable context for the use of this system to examine how heterogeneity and transitions between disease and non-disease environments influence the ecology and evolution of facultative pathogens. We focus on several features common among facultative pathogens, such as the physiological remodelling required to colonize hosts from environmental reservoirs and the consequences of competition with host and non-host associated microbiota. In addition, we discuss how the life history of facultative pathogens likely often results in ecological tradeoffs associated with performance in disease and non-disease environments. These pathogens may therefore have different competitive dynamics in disease and non-disease environments and are subject to shifting selective pressures that can result in pathoadaptation or the within-host spread of avirulent phenotypes. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle.

    Science.gov (United States)

    Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul

    2014-05-22

    The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is regulated with a zero tolerance in tomato seed. Their misidentification as pathogenic Cmm hampers a clear judgment on the seed quality and health. To get more insight in the genetic features linked to the lifestyle of these bacteria, a whole-genome sequence of the tomato seed-borne non-pathogenic Clavibacter LMG 26808 was determined. To gain a better understanding of the molecular determinants of pathogenicity, the genome sequence of LMG 26808 was compared with that of the pathogenic Cmm strain (NCPPB 382). The comparative analysis revealed that LMG 26808 does not contain plasmids pCM1 and pCM2 and also lacks the majority of important virulence factors described so far for pathogenic Cmm. This explains its apparent non-pathogenic nature in tomato plants. Moreover, the genome analysis of LMG 26808 detected sequences from a plasmid originating from a member of Enterobacteriaceae/Klebsiella relative. Genes received that way and coding for antibiotic resistance may provide a competitive advantage for survival of LMG 26808 in its ecological niche. Genetically, LMG 26808 was the most similar to the pathogenic Cmm NCPPB 382 but contained more mobile genetic elements. The genome of this non-pathogenic Clavibacter strain contained also a high number of transporters and regulatory genes. The genome sequence of the non-pathogenic Clavibacter strain LMG 26808 and the comparative analyses with other pathogenic Clavibacter strains provided a better understanding of the genetic bases of virulence and

  3. Efferocytosis of Pathogen-Infected Cells

    Directory of Open Access Journals (Sweden)

    Niloofar Karaji

    2017-12-01

    Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.

  4. Waterborne Pathogens: Detection Methods and Challenges

    Directory of Open Access Journals (Sweden)

    Flor Yazmín Ramírez-Castillo

    2015-05-01

    Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.

  5. [Modes of action of agrochemicals against plant pathogenic organisms].

    Science.gov (United States)

    Leroux, Pierre

    2003-01-01

    The chemical control of plant pathogens concerns mainly fungal diseases of crops. Most of the available fungicides act directly on essential fungal functions such as respiration, sterol biosynthesis or cell division. Consequently, these compounds can exhibit undesirable toxicological and environmental effects and sometimes select fungal resistant strains. Plant activators are expected to provide sustainable disease management in several crops because the development of resistance is not expected. Considering the future, the discovery of novel antifungal molecules will reap advantage from throughput screening methodologies and functional genomics.

  6. Disinfection and removal of human pathogenic bacteria in arctic waste stabilization ponds

    DEFF Research Database (Denmark)

    Huang, Yannan; Hansen, Lisbeth Truelstrup; Ragush, Colin M.

    2017-01-01

    Wastewater stabilization ponds (WSPs) are commonly used to treat municipal wastewater in Arctic Canada. The biological treatment in the WSPs is strongly influenced by climatic conditions. Currently, there is limited information about the removal of fecal and pathogenic bacteria during the short...... cool summer treatment season. With relevance to public health, the objectives of this paper were to determine if treatment in arctic WSPs resulted in the disinfection (i.e., removal of fecal indicator bacteria, Escherichia coli) and removal of selected human bacterial pathogens from the treated...... treatment of the wastewater with a 2–3 Log removal of generic indicator E. coli. The bacterial pathogens Salmonella spp., pathogenic E. coli, and Listeria monocytogenes, but not Campylobacter spp. and Helicobacter pylori, were detected in the untreated and treated wastewater, indicating that human...

  7. Fecundity compensation and tolerance to a sterilizing pathogen in Daphnia.

    Science.gov (United States)

    Vale, P F; Little, T J

    2012-09-01

    Hosts are armed with several lines of defence in the battle against parasites: they may prevent the establishment of infection, reduce parasite growth once infected or persevere through mechanisms that reduce the damage caused by infection, called tolerance. Studies on tolerance in animals have focused on mortality, and sterility tolerance has not been investigated experimentally. Here, we tested for genetic variation in the multiple steps of defence when the invertebrate Daphnia magna is infected with the sterilizing bacterial pathogen Pasteuria ramosa: anti-infection resistance, anti-growth resistance and the ability to tolerate sterilization once infected. When exposed to nine doses of a genetically diverse pathogen inoculum, six host genotypes varied in their average susceptibility to infection and in their parasite loads once infected. How host fecundity changed with increasing parasite loads did not vary between genotypes, indicating that there was no genetic variation for this measure of fecundity tolerance. However, genotypes differed in their level of fecundity compensation under infection, and we discuss how, by increasing host fitness without targeting parasite densities, fecundity compensation is consistent with the functional definition of tolerance. Such infection-induced life-history shifts are not traditionally considered to be part of the immune response, but may crucially reduce harm (in terms of fitness loss) caused by disease, and are a distinct source of selection on pathogens. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  8. Occurrence of mastitis pathogens in relation to somatic cells

    Directory of Open Access Journals (Sweden)

    Marcela Vyletělová Klimešová

    2013-01-01

    Full Text Available There were examined 161 cows from 4 farms in total. The suspect animals were selected according to viscosity test results, clinical symptoms and somatic cell count (SCC. Milk samples were examined for the presence of pathogens and for SCC. 55 mastitis pathogens were identified. The most frequently isolated species was Enterococcus faecalis (n = 20, followed by Staphylococcus aureus (n = 6 and Streptococcus uberis (n = 5. The SCC ranged from 9 to 24 204 ths.ml−1. There was positive occurrence of bacteria genus Staphylococcus and Enterococcus at lower SCC (50 ths.ml−1 and at higher SCC numbers (> 300 ths. ml−1 bacteria genus Streptococcus, Enterobacter and Escherichia coli. Differences in SCC were significant (P < 0.001 in negative samples xg 131 SCC versus 491 for positive, 611 for staphylococci and 464 ths.ml−1 for other positive. SCC discrimination limit for practical likelihood of pathogen occurrence estimation in infectious sample groups was calculated. This limit for suspicion of infection is 159 for positive group, 113 for staphylococci and 174 ths.ml−1 for other positive. This could be possible to recommend the value 174 ths.ml−1 for practical use with target to apply preventive or curative measures.

  9. In vitro photoinactivation of bovine mastitis related pathogens.

    Science.gov (United States)

    Sellera, Fábio Parra; Sabino, Caetano Padial; Ribeiro, Martha Simões; Gargano, Ronaldo Gomes; Benites, Nilson Roberti; Melville, Priscilla Anne; Pogliani, Fabio Celidonio

    2016-03-01

    Bovine mastitis is considered the most important disease of worldwide dairy industry. Treatment of this disease is based on the application intramammary antibiotic, which favors an increase in the number of resistant bacteria in the last decade. Photodynamic inactivation (PDI) has been investigated in different areas of Health Sciences, and has shown great potential for inactivating different pathogens, without any selection of resistant microorganisms. The objective of this study was to investigate the efficacy of PDI in the inactivation of pathogens associated with bovine mastitis. We tested the effectiveness of PDI against antibiotic resistant strains, isolated from bovine mastitis, from the following species: Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae, Corynebacterium bovis, and the alga Prototheca zopfii. Nine experimental groups were evaluated: control, no treatment; light only, irradiation of a red light-emitting diode (λ=662 (20) nm) for 180 s; exposure to 50 μM methylene blue alone for 5 min; and PDI for 5, 10, 30, 60, 120 and 180 s. S. dysgalactiae, S. aureus, and C. bovis were inactivated after 30s of irradiation, whereas S. agalactiae was inactivated after 120 s and P. zopfii at 180 s of irradiation. These results show that PDI can be an interesting tool for inactivating pathogens for bovine mastitis. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Amixicile, a novel strategy for targeting oral anaerobic pathogens.

    Science.gov (United States)

    Hutcherson, Justin A; Sinclair, Kathryn M; Belvin, Benjamin R; Gui, Qin; Hoffman, Paul S; Lewis, Janina P

    2017-09-05

    The oral microflora is composed of both health-promoting as well as disease-initiating bacteria. Many of the disease-initiating bacteria are anaerobic and include organisms such as Porphyromonas gingivalis, Prevotella intermedia, Fusobacterium nucleatum, and Tannerella forsythia. Here we investigated a novel therapeutic, amixicile, that targets pyruvate:ferredoxin oxidoreductase (PFOR), a major metabolic enzyme involved in energy generation through oxidative decarboxylation of pyruvate. PFOR is present in these anaerobic pathogenic bacteria and thus we hypothesized that amixicile would effectively inhibit their growth. In general, PFOR is present in all obligate anaerobic bacteria, while oral commensal aerobes, including aerotolerant ones, such as Streptococcus gordonii, use pyruvate dehydrogenase to decarboxylate pyruvate. Accordingly, we observed that growth of the PFOR-containing anaerobic periodontal pathogens, grown in both monospecies as well as multispecies broth cultures was inhibited in a dose-dependent manner while that of S. gordonii was unaffected. Furthermore, we also show that amixicile is effective against these pathogens grown as monospecies and multispecies biofilms. Finally, amixicile is the first selective therapeutic agent active against bacteria internalized by host cells. Together, the results show that amixicile is an effective inhibitor of oral anaerobic bacteria and as such, is a good candidate for treatment of periodontal diseases.

  11. Selection on resilience improves disease resistance and tolerance to infections

    NARCIS (Netherlands)

    Mulder, H.A.; Rashidi, H.

    2017-01-01

    Response to infection in animals has 2 main mechanisms: resistance (ability to control pathogen burden) and tolerance (ability to maintain performance given the pathogen burden). Selection on disease resistance and tolerance to infections seems a promising avenue to increase productivity of animals

  12. Laser inactivation of pathogenic viruses in water

    Science.gov (United States)

    Grishkanich, Alexander; Zhevlakov, Alexander; Kascheev, Sergey; Sidorov, Igor; Ruzankina, Julia; Yakovlev, Alexey; Mak, Andrey

    2016-03-01

    Currently there is a situation that makes it difficult to provide the population with quality drinking water for the sanitary-hygienic requirements. One of the urgent problems is the need for water disinfection. Since the emergence of microorganisms that are pathogens transmitted through water such as typhoid, cholera, etc. requires constant cleansing of waters against pathogenic bacteria. In the water treatment process is destroyed up to 98% of germs, but among the remaining can be pathogenic viruses, the destruction of which requires special handling. As a result, the conducted research the following methods have been proposed for combating harmful microorganisms: sterilization of water by laser radiation and using a UV lamp.

  13. Some South African Rubiaceae Tree Leaf Extracts Have Antimycobacterial Activity Against Pathogenic and Non-pathogenic Mycobacterium Species.

    Science.gov (United States)

    Aro, Abimbola O; Dzoyem, Jean P; Hlokwe, Tiny M; Madoroba, Evelyn; Eloff, Jacobus N; McGaw, Lyndy J

    2015-07-01

    Tuberculosis (TB) caused by Mycobacterium tuberculosis remains an ongoing threat to human health. Many plant species contain antimycobacterial compounds, which may serve as template molecules for new anti-TB drugs. The Rubiaceae family is the largest family of trees in southern Africa, and preliminary evidence revealed antimycobacterial activity in several species of the genus, motivating further studies. Leaf extracts of 15 tree species from the Rubiaceae family were screened for antimycobacterial activity against pathogenic M. tuberculosis and non-pathogenic Mycobacterium smegmatis, Mycobacterium aurum and Mycobacterium bovis BCG (Bacillus Calmette-Guérin) using a twofold serial microdilution assay. Cytotoxicity was determined using a tetrazolium-based colorimetric assay against C3A liver cells and Vero kidney cells. Minimum inhibitory concentration values as low as 0.04 mg/mL against M. smegmatis and M. tuberculosis were recorded. Activity against M. aurum was the best predictor of activity against pathogenic M. tuberculosis (correlation coefficient = 0.9). Bioautography indicated at least 40 different antimycobacterial compounds in the extracts. Cytotoxicity of the extracts varied, and Oxyanthus speciosus had the most promising selectivity index values. Copyright © 2015 John Wiley & Sons, Ltd.

  14. Pathogens associated with persistent diarrhoea in children in low and middle income countries: systematic review

    Directory of Open Access Journals (Sweden)

    Hart C Anthony

    2009-06-01

    Full Text Available Abstract Background Persistent diarrhoea in children is a common problem in low and middle income countries. To help target appropriate treatment for specific pathogens in the absence of diagnostic tests, we systematically reviewed pathogens most commonly associated with persistent diarrhoea in children. Methods We sought all descriptive studies of pathogens in the stool of children with diarrhoea of over 14 days duration in low and middle income countries with a comprehensive search of the MEDLINE, EMBASE, LILACS and WEB OF SCIENCE databases. We described the study designs and populations, assessed the quality of the laboratory tests, and extracted and summarised data on pathogens. For Escherichia coli, we calculated high and low prevalence estimates of all enteropathic types combined. Results across studies were compared for geographical patterns. Results Nineteen studies were included. Some used episodes of diarrhoea as the unit of analysis, others used children. The quality of reporting of laboratory procedures varied, and pathogens (particularly E. coli types were classified in different ways. As there were no apparent regional differences in pathogen prevalence, we aggregated data between studies to give a guide to overall prevalence. Enteropathic E. coli types were commonly found in children with persistent diarrhoea (up to 63%. Various other organisms, including viruses, bacteria and parasites, were detected but across all studies their prevalence was under 10%. However, these pathogens were also found in similar frequencies in children without diarrhoea. Conclusion A number of pathogens are commonly associated with persistent diarrhoea in children, but in children without diarrhoea the pathogens are found with similar frequencies. New research with carefully selected controls and standardised laboratory investigations across countries will help map causes and help explore effective options for presumptive treatment.

  15. A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

    Science.gov (United States)

    Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

    2015-04-24

    Leptospirosis is a worldwide, deadly zoonotic disease. Pathogenic Leptospira causes leptospirosis. The rapid and accurate identification of pathogenic and non-pathogenic Leptospira strains is essential for appropriate therapeutic management and timely intervention for infection control. The molecular fingerprint is a simple and rapid alternative tool for microorganisms identification, which is based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In this study, molecular fingerprint was performed to identify pathogenic strains of Leptospira. Phylogenetic analysis based on 16S rRNA gene sequences was used as the reference method. In addition, a label-free technique was used to reveal the different proteins of pathogenic or non-pathogenic Leptospira. A reference database was constructed using 30 Leptospira strains, including 16 pathogenic strains and 14 non-pathogenic strains. Two super reference spectra that were associated with pathogenicity were established. Overall, 33 Leptospira strains were used for validation, and 32 of 33 Leptospira strains could be identified on the species level and all the 33 could be classified as pathogenic or non-pathogenic. The super reference spectra and the major spectra projection (MSP) dendrogram correctly categorized the Leptospira strains into pathogenic and non-pathogenic groups, which was consistent with the 16S rRNA reference methods. Between the pathogenic and non-pathogenic strains, 108 proteins were differentially expressed. molecular fingerprint is an alternative to conventional molecular identification and can rapidly distinguish between pathogenic and non-pathogenic Leptospira strains. Therefore, molecular fingerprint may play an important role in the clinical diagnosis, treatment, surveillance, and tracking of epidemic outbreaks of leptospirosis. Leptospirosis is a worldwide zoonosis that is caused by spirochetes of the genus Leptospira. Leptospirosis is a serious zoonotic

  16. Pathogen reduction in sludges by irradiation

    International Nuclear Information System (INIS)

    Brandon, J.R.

    1978-01-01

    This paper presents results of pathogen inactivation programs being conducted in Belgium, Czechoslovakia, France, East Germany, West Germany, Hungary, Italy, The Netherlands, Poland, Spain, Sweden, Switzerland, the United Kingdom, and the United States

  17. Land application of sewage sludge: Pathogen issues

    Energy Technology Data Exchange (ETDEWEB)

    Chang, A C [Department of Soil and Environmental Sciences, Univ. of California at Riverside, Riverside, CA (United States)

    1997-10-01

    Diseases transmitted via the faecal-oral exposure route cause severe gastroenteric disorders, and large numbers of causative organisms are discharged with the faecal matter of infected individuals. For this reason, pathogenic bacteria, viruses, protozoa, or helminths, are always found in sewage sludge. If not properly treated for use in agriculture, sludge can be a source of pathogenic contamination. Radiation is an attractive method to reduce the numbers of microorganisms in sewage sludge. Routine examination for pathogens is not practised nor recommended because complicated and costly procedures are involved. Instead, an indicator organism is usually assayed and enumerated. In this paper, methods are discussed for the investigation of pathogens in sewage sludge. (author). 8 refs, 3 tabs.

  18. Genomes of foodborne and waterborne pathogens

    National Research Council Canada - National Science Library

    Fratamico, Pina M; Liu, Yanhong; Kathariou, Sophia

    2011-01-01

    ... of Pathogenic Vibrio cholerae * 85 Salvador Almagro-Moreno, Ronan A. Murphy, and E. Fidelma Boyd 8. Genomics of the Enteropathogenic Yersiniae * 101 Alan McNally, Nicholas R. Thomson, and Brendan W. ...

  19. Antibiotic resistance and pathogenicity factors in Staphylococcus ...

    Indian Academy of Sciences (India)

    know which endemic strains of S. aureus in dairy cattle ... Antibiotic resistance; cattle; mastitis; MRSA; pathogenic genes ... recommended by Clinical and Laboratory Standards Institute ...... fnbA, eno, hla and nuc, did not show any relation to.

  20. Persistence and drug tolerance in pathogenic yeast

    DEFF Research Database (Denmark)

    Bojsen, Rasmus Kenneth; Regenberg, Birgitte; Folkesson, Sven Anders

    2017-01-01

    In this review, we briefly summarize the current understanding of how fungal pathogens can persist antifungal treatment without heritable resistance mutations by forming tolerant persister cells. Fungal infections tolerant to antifungal treatment have become a major medical problem. One mechanism...

  1. Promotion and inhibition of mutation in pathogens

    Directory of Open Access Journals (Sweden)

    Maurice Samuel Devaraj

    2014-03-01

    Findings from this research may be used to prevent development of drug resistance, whether epigenetic or arising due to deoxyribonucleic acid (DNA modification, in several pathogens, especially Mycobacterium tuberculosis through the co-administration of adenosine along with antibiotic treatment.

  2. Modulation of pathogen recognition by autophagy

    Directory of Open Access Journals (Sweden)

    Ji Eun eOh

    2012-03-01

    Full Text Available Autophagy is an ancient biological process for maintaining cellular homeostasis by degradation of long-lived cytosolic proteins and organelles. Recent studies demonstrated that autophagy is availed by immune cells to regulate innate immunity. On the one hand, cells exert direct effector function by degrading intracellular pathogens; on the other hand, autophagy modulates pathogen recognition and downstream signaling for innate immune responses. Pathogen recognition via pattern recognition receptors induces autophagy. The function of phagocytic cells is enhanced by recruitment of autophagy-related proteins. Moreover, autophagy acts as a delivery system for viral replication complexes to migrate to the endosomal compartments where virus sensing occurs. In another case, key molecules of the autophagic pathway have been found to negatively regulate immune signaling, thus preventing aberrant activation of cytokine production and consequent immune responses. In this review, we focus on the recent advances in the role of autophagy in pathogen recognition and modulation of innate immune responses.

  3. 大黄鱼三种病原弧菌外膜蛋白交叉保护性抗原筛选%Selection of cross-protective antigens from outer membrane proteins of three pathogenic vibrios isolated from infected large yellow croaker (Pseudosciaena crocea)

    Institute of Scientific and Technical Information of China (English)

    张崇文; 毛芝娟; 于涟

    2012-01-01

    弧菌是海水养殖环境中常见的条件性致病菌,弧菌病的暴发给水产养殖业造成了严重损失.鉴于水生动物尤其是鱼类弧菌病的发生常常是多种(血清型或亚种)弧菌的混合感染,筛选具有潜在的交叉保护性蛋白抗原,作为制备多价疫苗或联合疫苗的侯选成分具有重要意义.文中从患病大黄鱼中分离到8株弧菌,经生理生化和分子生物学鉴定分别为6株哈维氏弧菌Vibrio harveyi,1株溶藻弧菌Vibrio alginolyticus和1株副溶血弧菌Vibrio parahaemolyticus.选择典型的不同种的弧菌为代表,提取其外膜蛋白,经SDS-PAGE和Western blotting分析,确定它们大约在45 kDa、35 kDa、22 kDa处出现了3条共同的免疫印迹条带,表明它们很有可能含有共同的能够彼此交叉保护的抗原.利用双向电泳和免疫印迹相结合的方法,借助于MALDI-TOF-MS质谱分析技术,发现溶藻弧菌V.alginolyticus的一种功能未知的孔蛋白(Porin,GenBank Accession No.ZP_01260407)和副溶血弧菌V.parahaemolyticus的一种麦芽糖孔蛋白的前体蛋白(Maltoporin precursor,GenBank Accession No.NP_801154)能够和哈维氏弧菌V.harveyi全菌多抗产生免疫反应,表明这两种蛋白可以作为3种弧菌的交叉保护性抗原,以此制备的疫苗可望对3种弧菌的感染产生交叉保护作用.%Vibrios are universal conditioned-pathogenic bacteria in marine culture environment, and the outbreak of vibrio disease resulted in a serious damage to aquaculture. Considering that vibrio disease in aquatic species, especially fishes, usually originated from mixed infection of different species (serotypes or subspecies) of vibrios, it is important to select the potential cross-protective protein antigens as candidates of polyvalent or combined vaccines. In present research, several strains of vibrios were isolated from infected large yellow croaker (Pseudosciaena crocea) and subsequently identified as six strains of V. harveyi, one V

  4. Pathogen Causing Disease of Diagnosis PCR Tecnology

    OpenAIRE

    SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel

    2013-01-01

    Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...

  5. Identification of periodontal pathogens in atherosclerotic vessels

    DEFF Research Database (Denmark)

    Fiehn, Nils-Erik; Larsen, Tove; Christiansen, Natalia

    2005-01-01

    Epidemiological studies have shown that periodontitis may be associated with presence of atherosclerosis. DNA from periodontal pathogens has been detected in atherosclerotic lesions, but viable oral bacteria have not yet been isolated from atherosclerotic plaques. The purpose of the present study...... was to determine if viable oral bacteria could be isolated from atherosclerotic lesions and if DNA from periodontal pathogens could be detected by use of polymerase chain reaction (PCR) techniques....

  6. The cuticle and plant defense to pathogens

    Directory of Open Access Journals (Sweden)

    Jean-Pierre eMetraux

    2014-06-01

    Full Text Available The cuticle provides a physical barrier against water loss and protects against irradiation, xenobiotics and pathogens. Components of the cuticle are perceived by invading fungi and activate developmental processes during pathogenesis. In addition, cuticle alterations of various types induce a syndrome of reactions that often results in resistance to necrotrophs. This article reviews the current knowledge on the role of the cuticle in relation to the perception of pathogens and activation of defenses.

  7. Paramecium species ingest and kill the cells of the human pathogenic fungus Cryptococcus neoformans.

    Science.gov (United States)

    Frager, Shalom Z; Chrisman, Cara J; Shakked, Rachel; Casadevall, Arturo

    2010-08-01

    A fundamental question in the field of medical mycology is the origin of virulence in those fungal pathogens acquired directly from the environment. In recent years, it was proposed that the virulence of certain environmental animal-pathogenic microbes, such as Cryptococcus neoformans, originated from selection pressures caused by species-specific predation. In this study, we analyzed the interaction of C. neoformans with three Paramecium spp., all of which are ciliated mobile protists. In contrast to the interaction with amoebae, some Paramecium spp. rapidly ingested C. neoformans and killed the fungus. This study establishes yet another type of protist-fungal interaction supporting the notion that animal-pathogenic fungi in the environment are under constant selection by predation.

  8. Adenoid Reservoir for Pathogenic Biofilm Bacteria▿

    Science.gov (United States)

    Nistico, L.; Kreft, R.; Gieseke, A.; Coticchia, J. M.; Burrows, A.; Khampang, P.; Liu, Y.; Kerschner, J. E.; Post, J. C.; Lonergan, S.; Sampath, R.; Hu, F. Z.; Ehrlich, G. D.; Stoodley, P.; Hall-Stoodley, L.

    2011-01-01

    Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that adenoidectomy is effective in the treatment of COM, suggesting that the adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the adenoid, samples were obtained from 35 children undergoing adenoidectomy for chronic OM or obstructive sleep apnea. We used a novel, culture-independent molecular diagnostic methodology, followed by confocal microscopy, to investigate the in situ distribution and organization of pathogens in the adenoids to determine whether pathogenic bacteria exhibited criteria characteristic of biofilms. The Ibis T5000 Universal Biosensor System was used to interrogate the extent of the microbial diversity within adenoid biopsy specimens. Using a suite of 16 broad-range bacterial primers, we demonstrated that adenoids from both diagnostic groups were colonized with polymicrobial biofilms. Haemophilus influenzae was present in more adenoids from the COM group (P = 0.005), but there was no significant difference between the two patient groups for Streptococcus pneumoniae or Staphylococcus aureus. Fluorescence in situ hybridization, lectin binding, and the use of antibodies specific for host epithelial cells demonstrated that pathogens were aggregated, surrounded by a carbohydrate matrix, and localized on and within the epithelial cell surface, which is consistent with criteria for bacterial biofilms. PMID:21307211

  9. Regulatory T cells and immunity to pathogens.

    Science.gov (United States)

    Rouse, Barry T; Suvas, Susmit

    2007-09-01

    Immune responses to pathogens are modulated by one or more types of cells that perform a regulatory function. Some cells with this function, such as CD4+ Foxp3+ natural regulatory T cells (nTreg), pre-exist prior to infections whereas others may be induced as a consequence of infection (adaptive Treg). With pathogens that have a complex pathogenesis, multiple types of regulatory cells could influence the outcome. One major property of Treg is to help minimize collateral tissue damage that can occur during immune reactions to a chronic infection. The consequence is less damage to the host but in such situations the pathogen is likely to establish persistence. In some cases, a fine balance is established between Treg responses, effector components of immunity and the pathogen. Treg responses to pathogens may also act to hamper the efficacy of immune control. This review discusses these issues as well as the likely mechanisms by which various pathogens can signal the participation of Treg during infection.

  10. Sexual Reproduction of Human Fungal Pathogens

    Science.gov (United States)

    Heitman, Joseph; Carter, Dee A.; Dyer, Paul S.; Soll, David R.

    2014-01-01

    We review here recent advances in our understanding of sexual reproduction in fungal pathogens that commonly infect humans, including Candida albicans, Cryptococcus neoformans/gattii, and Aspergillus fumigatus. Where appropriate or relevant, we introduce findings on other species associated with human infections. In particular, we focus on rapid advances involving genetic, genomic, and population genetic approaches that have reshaped our view of how fungal pathogens evolve. Rather than being asexual, mitotic, and largely clonal, as was thought to be prevalent as recently as a decade ago, we now appreciate that the vast majority of pathogenic fungi have retained extant sexual, or parasexual, cycles. In some examples, sexual and parasexual unions of pathogenic fungi involve closely related individuals, generating diversity in the population but with more restricted recombination than expected from fertile, sexual, outcrossing and recombining populations. In other cases, species and isolates participate in global outcrossing populations with the capacity for considerable levels of gene flow. These findings illustrate general principles of eukaryotic pathogen emergence with relevance for other fungi, parasitic eukaryotic pathogens, and both unicellular and multicellular eukaryotic organisms. PMID:25085958

  11. Pathogenicity of Human ST23 Streptococcus agalactiae to Fish and Genomic Comparison of Pathogenic and Non-pathogenic Isolates

    Directory of Open Access Journals (Sweden)

    Rui Wang

    2017-10-01

    Full Text Available Streptococcus agalactiae, or Group B Streptococcus (GBS, is a major pathogen causing neonatal sepsis and meningitis, bovine mastitis, and fish meningoencephalitis. CC23, including its namesake ST23, is not only the predominant GBS strain derived from human and cattle, but also can infect a variety of homeothermic and poikilothermic species. However, it has never been characterized in fish. This study aimed to determine the pathogenicity of ST23 GBS to fish and explore the mechanisms causing the difference in the pathogenicity of ST23 GBS based on the genome analysis. Infection of tilapia with 10 human-derived ST23 GBS isolates caused tissue damage and the distribution of pathogens within tissues. The mortality rate of infection was ranged from 76 to 100%, and it was shown that the mortality rate caused by only three human isolates had statistically significant difference compared with fish-derived ST7 strain (P < 0.05, whereas the mortality caused by other seven human isolates did not show significant difference compared with fish-derived ST7 strain. The genome comparison and prophage analysis showed that the major genome difference between virulent and non-virulent ST23 GBS was attributed to the different prophage sequences. The prophage in the P1 region contained about 43% GC and encoded 28–39 proteins, which can mediate the acquisition of YafQ/DinJ structure for GBS by phage recombination. YafQ/DinJ belongs to one of the bacterial toxin–antitoxin (TA systems and allows cells to cope with stress. The ST23 GBS strains carrying this prophage were not pathogenic to tilapia, but the strains without the prophage or carrying the pophage that had gene mutation or deletion, especially the deletion of YafQ/DinJ structure, were highly pathogenic to tilapia. In conclusion, human ST23 GBS is highly pathogenic to fish, which may be related to the phage recombination.

  12. Pathogenicity and Host Range of Pathogen Causing Black Raspberry (Rubus coreanus) Anthracnose in Korea

    OpenAIRE

    Uh Seong Jeong; Ju Hee Kim; Ki Kwon Lee; Seong Soo Cheong; Wang Hyu Lee

    2013-01-01

    The strains of Colletotrichum gloeosporioides, C. coccodes, C. acutatum isolated from black raspberry werepathogenic to apple and strawberry after dropping inoculation, but showed weak pathogenicity in hot-pepperand tomato. The anthracnose pathogens of C. gloeosporioides, C. orbiculare, C. acutatum isolated from apple,hot-pepper and pumpkin showed pathogenicity in black raspberry. Moreover, the anthracnose pathogensisolated from apple caused disease symptoms in non-wounded inoculation.

  13. Effects of selective digestive decontamination (SDD) on the gut resistome

    NARCIS (Netherlands)

    Buelow, E.; Bello Gonzalez, T.D.G.; Versluis, D.; Oostdijk, E.A.N.; Ogilvie, L.A.; Mourik, van M.S.M.; Oosterink, L.; Passel, van M.W.J.; Smidt, H.; D’Andrea, M.M.; Been, de M.; Jones, B.V.; Willems, R.J.L.; Bonten, M.J.M.; Schaik, W.

    2014-01-01

    Objectives Selective digestive decontamination (SDD) is an infection prevention measure for critically ill patients in intensive care units (ICUs) that aims to eradicate opportunistic pathogens from the oropharynx and intestines, while sparing the anaerobic flora, by the application of

  14. Molecular detection of salmonella species from selected vegetables ...

    African Journals Online (AJOL)

    Molecular detection of salmonella species from selected vegetables sold in a north-central ... African Journal of Clinical and Experimental Microbiology ... of the pure isolates testing positive as being pathogenic after biochemical analysis.

  15. Circumscription of the anthracnose pathogens Colletotrichum lindemuthianum and C. nigrum.

    Science.gov (United States)

    Liu, Fang; Cai, Lei; Crous, Pedro W; Damm, Ulrike

    2013-01-01

    The anthracnose pathogen of common bean (Phaseolus vulgaris) is usually identified as Colletotrichum lindemuthianum, while anthracnose of potato (Solanum tuberosum), peppers (Capsicum annuum), tomato (S. lycopersicum) and several other crop plants is often attributed to C. coccodes. In order to study the phylogenetic relationships of these important pathogens, we conducted a multigene analysis (ITS, ACT, TUB2, CHS-1, GAPDH) of strains previously identified as C. lindemuthianum, C. coccodes and other related species, as well as representative species of the major Colletotrichum species complexes. Strains of C. lindemuthianum belonged to a single clade; we selected an authentic specimen as lectotype, and an appropriate specimen and culture from the CBS collection to serve as epitype. Two clades were resolved within C. coccodes s. lat. One clade included the ex-neotype strain of C. coccodes on Solanum, while an epitype was selected for C. nigrum, which represents the oldest name of the second clade, which occurs on Capsicum, Solanum, as well as several other host plants. Furthermore, we recognized C. lycopersici as a synonym of C. nigrum, and C. biologicum as a synonym of C. coccodes.

  16. Development of recombinant antibody technology for application in plant pathogen diagnosis

    NARCIS (Netherlands)

    Griep, R.

    1999-01-01

    This thesis describes the applicability of the novel phage display technique to select plant-pathogen-specific monoclonal antibodies (MAbs) from combinatorial antibody libraries. The retrieved MAbs are so specific that they can be used as diagnostic tools in sensitive immunoassays for the

  17. Evaluation of isolation methods for pathogenic Yersinia enterocolitica from pig intestinal content.

    Science.gov (United States)

    Laukkanen, R; Hakkinen, M; Lundén, J; Fredriksson-Ahomaa, M; Johansson, T; Korkeala, H

    2010-03-01

    The aim of this study was to evaluate the efficiency of four isolation methods for the detection of pathogenic Yersinia enterocolitica from pig intestinal content. The four methods comprised of 15 isolation steps using selective enrichments (irgasan-ticarcillin-potassium chlorate and modified Rappaport broth) and mildly selective enrichments at 4 or 25 degrees C. Salmonella-Shigella-desoxycholate-calcium chloride agar, cefsulodin-irgasan-novobiocin agar were used as plating media. The most sensitive method detected 78% (53/68) of the positive samples. Individual isolation steps using cold enrichment as the only enrichment or as a pre-enrichment step with further selective enrichment showed the highest sensitivities (55-66%). All isolation methods resulted in high numbers of suspected colonies not confirmed as pathogenic Y. enterocolitica. Cold enrichment should be used in the detection of pathogenic Y. enterocolitica from pig intestinal contents. In addition, more than one parallel isolation step is needed. The study shows that depending on the isolation method used for Y. enterocolitica, the detected prevalence of Y. enterocolitica in pig intestinal contents varies greatly. More selective and sensitive isolation methods need to be developed for pathogenic Y. enterocolitica.

  18. Photobacterium damselae subsp damselae, an emerging pathogen in Danish rainbow trout, Oncorhynchus mykiss (Walbaum), mariculture

    DEFF Research Database (Denmark)

    Pedersen, Karl; Skall, Helle Frank; Lassen-Nielsen, Anne Marie

    2009-01-01

    A selection of 16 field isolates of Photobacterium damselae from marine rainbow trout farms in Denmark was subjected to phenotypic and genotypic characterization and pathogenicity to fish. All isolates belonged to the subspecies damselae, being positive for haemolysis, motility and urease...

  19. Microbial pathogens in source and treated waters from drinking water treatment plants in the US

    Science.gov (United States)

    An occurrence survey was conducted on selected pathogens in source and treated drinking water collected from 25 drinking water treatment plants (DWTPs) in the United States. Water samples were analyzed for the protozoa Giardia and Cryptosporidium (EPA Method 1623); the fungi Asp...

  20. Resistance to Root Galling Caused by the Powdery Scab Pathogen Spongospora subterranea in Potato

    Science.gov (United States)

    Potato selections (clones and commercial cultivars) were examined for resistance to root galling, caused by the powdery scab pathogen Spongospora subterranea in 7 field trials conducted between 2003 and 2007 in the states of Washington (WA) and Idaho (ID). In 2003, Shepody demonstrated the highest l...

  1. Somaclonal variation of sugar beet resistant to pathogenic root rot Fusarium oxysporum var. orthoceras

    Directory of Open Access Journals (Sweden)

    Urazaliev Kairat

    2013-01-01

    Full Text Available Sugar beet (Beta vulgaris L. - one of the most important crop in the world. In Kazakhstan, it is a traditional and major source of domestic sugar. The industry of cultivation and production of sugar beet is one of the priority areas of agricultural development of the country. In this paper, we studied the regeneration ability of different genotypes of sugar beet explants on selective media with the culture filtrate of the pathogen fungus F. oxysporum var. orthoceras. From the roots and shoots of sugar beet the pathogen Fusarium root rot was isolated. Was obtained pure cultures of the isolated pathogen. As a result, of morphological and cultural descriptions, as well as microbiological analysis it was revealed that the isolated pathogen is Fusarium Oxysporum. The results showed the pathogenicity of the fungus. For regeneration in vitro of the sugar beet genotypes resistant to the pathogen the culture media was optimized to the culture filtrate of the fungus F. oxysporum var. orthoceras. The frequency of shoot regeneration, depending on the genotype, was 1,0-12,5 %. On these explants the multiple shoot formations were observed.

  2. Removal of pathogenic bacteria from sewage-treated effluent and biosolids for agricultural purposes

    Science.gov (United States)

    Al-Gheethi, A. A.; Efaq, A. N.; Bala, J. D.; Norli, I.; Abdel-Monem, M. O.; Ab. Kadir, M. O.

    2018-05-01

    The reuse of treated sewage for irrigation is considered as an important alternative water source in the new water management strategy of the countries that face a severe deficiency of water resources such as the Middle East countries. The organic material and fertilizing elements contained in biosolids are essential for maintaining soil fertility. However, both treated sewage and biosolids contain a large diversity of pathogens that would be transmitted to the environment and infect human directly or indirectly. Therefore, those pathogens should be reduced from the treated sewage and biosolids before the reuse in the agriculture. This paper reviews the considerations for reuse of treated sewage and biosolids in agriculture and further treatments used for reduction of pathogenic bacteria. The treatment methods used for the reduction of pathogens in these wastes have reviewed. It appeared that the main concern associated with the reduction of pathogenic bacteria lies in their ability to regrow in the treated sewage and biosolids. Therefore, the effective treatment method is that it has the potential to destruct pathogens cells and remove the nutrients to prevent the regrowth or recontamination from the surrounded environment. The removal of nutrients might be applicable in the sewage but not in the biosolids due to high nutrient contents. However, the reduction of health risk in the biosolids might be carried out by regulating the biosolid utilization and selecting the plant species grown in the fertilized soil with biosolids.

  3. Pathogen prevalence predicts human cross-cultural variability in individualism/collectivism.

    Science.gov (United States)

    Fincher, Corey L; Thornhill, Randy; Murray, Damian R; Schaller, Mark

    2008-06-07

    Pathogenic diseases impose selection pressures on the social behaviour of host populations. In humans (Homo sapiens), many psychological phenomena appear to serve an antipathogen defence function. One broad implication is the existence of cross-cultural differences in human cognition and behaviour contingent upon the relative presence of pathogens in the local ecology. We focus specifically on one fundamental cultural variable: differences in individualistic versus collectivist values. We suggest that specific behavioural manifestations of collectivism (e.g. ethnocentrism, conformity) can inhibit the transmission of pathogens; and so we hypothesize that collectivism (compared with individualism) will more often characterize cultures in regions that have historically had higher prevalence of pathogens. Drawing on epidemiological data and the findings of worldwide cross-national surveys of individualism/collectivism, our results support this hypothesis: the regional prevalence of pathogens has a strong positive correlation with cultural indicators of collectivism and a strong negative correlation with individualism. The correlations remain significant even when controlling for potential confounding variables. These results help to explain the origin of a paradigmatic cross-cultural difference, and reveal previously undocumented consequences of pathogenic diseases on the variable nature of human societies.

  4. Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies

    Directory of Open Access Journals (Sweden)

    Arianne Brown Jordan

    2018-01-01

    Full Text Available Backyard poultry farms in Trinidad and Tobago (T&T play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA. Antibodies were detected in 65% (CI 95%: 50–78% of the sampled birds for Infectious bronchitis virus (IBV, 67.5% (CI 95%: 52–80% for Infectious bursal disease virus (IBDV, 10% (CI 95%: 4–23% for Newcastle disease virus (NDV, 0% (CI 95%: 0–0% for Avian influenza virus (AIV, 0% (CI 95%: 0–0% for West Nile virus (WNV, 31.7% (CI 95%: 20–47% for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0–0% for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.

  5. Prevalence of plant beneficial and human pathogenic bacteria isolated from salad vegetables in India.

    Science.gov (United States)

    Nithya, Angamuthu; Babu, Subramanian

    2017-03-14

    The study aimed at enumerating, identifying and categorizing the endophytic cultivable bacterial community in selected salad vegetables (carrot, cucumber, tomato and onion). Vegetable samples were collected from markets of two vegetable hot spot growing areas, during two different crop harvest seasons. Crude and diluted vegetable extracts were plated and the population of endophytic bacteria was assessed based on morphologically distinguishable colonies. The bacterial isolates were identified by growth in selective media, biochemical tests and 16S rRNA gene sequencing. The endophytic population was found to be comparably higher in cucumber and tomato in both of the sampling locations, whereas lower in carrot and onion. Bacterial isolates belonged to 5 classes covering 46 distinct species belonging to 19 genera. Human opportunistic pathogens were predominant in carrot and onion, whereas plant beneficial bacteria dominated in cucumber and tomato. Out of the 104 isolates, 16.25% are human pathogens and 26.5% are human opportunistic pathogens. Existence of a high population of plant beneficial bacteria was found to have suppressed the population of plant and human pathogens. There is a greater potential to study the native endophytic plant beneficial bacteria for developing them as biocontrol agents against human pathogens that are harboured by plants.

  6. Evolutionary dynamics of interactions between plants and their enemies: comparison of herbivorous insects and pathogens.

    Science.gov (United States)

    Wininger, Kerry; Rank, Nathan

    2017-11-01

    Plants colonized land over 400 million years ago. Shortly thereafter, organisms began to consume terrestrial plant tissue as a nutritional resource. Most plant enemies are plant pathogens or herbivores, and they impose natural selection for plants to evolve defenses. These traits generate selection pressures on enemies. Coevolution between terrestrial plants and their enemies is an important element of the evolutionary history of both groups. However, coevolutionary studies of plant-pathogen interactions have tended to focus on different research topics than plant-herbivore interactions. Specifically, studies of plant-pathogen interactions often adopt a "gene-for-gene" conceptual framework. In contrast, studies of plants and herbivores often investigate escalation or elaboration of plant defense and herbivore adaptations to overcome it. The main exceptions to the general pattern are studies that focus on small, sessile herbivores that share many features with plant pathogens, studies that incorporate both herbivores and pathogens into a single investigation, and studies that test aspects of Thompson's geographic mosaic theory for coevolution. We discuss the implications of these findings for future research. © 2017 New York Academy of Sciences.

  7. Pathogenicity island mobility and gene content.

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Kelly Porter

    2013-10-01

    Key goals towards national biosecurity include methods for analyzing pathogens, predicting their emergence, and developing countermeasures. These goals are served by studying bacterial genes that promote pathogenicity and the pathogenicity islands that mobilize them. Cyberinfrastructure promoting an island database advances this field and enables deeper bioinformatic analysis that may identify novel pathogenicity genes. New automated methods and rich visualizations were developed for identifying pathogenicity islands, based on the principle that islands occur sporadically among closely related strains. The chromosomally-ordered pan-genome organizes all genes from a clade of strains; gaps in this visualization indicate islands, and decorations of the gene matrix facilitate exploration of island gene functions. A %E2%80%9Clearned phyloblocks%E2%80%9D method was developed for automated island identification, that trains on the phylogenetic patterns of islands identified by other methods. Learned phyloblocks better defined termini of previously identified islands in multidrug-resistant Klebsiella pneumoniae ATCC BAA-2146, and found its only antibiotic resistance island.

  8. Deconstructing host-pathogen interactions in Drosophila

    Directory of Open Access Journals (Sweden)

    Ethan Bier

    2012-01-01

    Full Text Available Many of the cellular mechanisms underlying host responses to pathogens have been well conserved during evolution. As a result, Drosophila can be used to deconstruct many of the key events in host-pathogen interactions by using a wealth of well-developed molecular and genetic tools. In this review, we aim to emphasize the great leverage provided by the suite of genomic and classical genetic approaches available in flies for decoding details of host-pathogen interactions; these findings can then be applied to studies in higher organisms. We first briefly summarize the general strategies by which Drosophila resists and responds to pathogens. We then focus on how recently developed genome-wide RNA interference (RNAi screens conducted in cells and flies, combined with classical genetic methods, have provided molecular insight into host-pathogen interactions, covering examples of bacteria, fungi and viruses. Finally, we discuss novel strategies for how flies can be used as a tool to examine how specific isolated virulence factors act on an intact host.

  9. PIML: the Pathogen Information Markup Language.

    Science.gov (United States)

    He, Yongqun; Vines, Richard R; Wattam, Alice R; Abramochkin, Georgiy V; Dickerman, Allan W; Eckart, J Dana; Sobral, Bruno W S

    2005-01-01

    A vast amount of information about human, animal and plant pathogens has been acquired, stored and displayed in varied formats through different resources, both electronically and otherwise. However, there is no community standard format for organizing this information or agreement on machine-readable format(s) for data exchange, thereby hampering interoperation efforts across information systems harboring such infectious disease data. The Pathogen Information Markup Language (PIML) is a free, open, XML-based format for representing pathogen information. XSLT-based visual presentations of valid PIML documents were developed and can be accessed through the PathInfo website or as part of the interoperable web services federation known as ToolBus/PathPort. Currently, detailed PIML documents are available for 21 pathogens deemed of high priority with regard to public health and national biological defense. A dynamic query system allows simple queries as well as comparisons among these pathogens. Continuing efforts are being taken to include other groups' supporting PIML and to develop more PIML documents. All the PIML-related information is accessible from http://www.vbi.vt.edu/pathport/pathinfo/

  10. Susceptibility of pathogenic and nonpathogenic Naegleria ssp

    International Nuclear Information System (INIS)

    Whiteman, L.Y.

    1988-01-01

    The susceptibility of four species of Naegleria amoebae to complement-mediated lysis was determined. The amoebicidal activity of normal human serum (NHS) and normal guinea pig serum (NGPS) for Naegleria amoebae was measured by an in vitro cytotoxicity assay. Release of radioactivity from amoebae labeled with 3 H-uridine and visual observation with a compound microscope were used as indices of lysis. Susceptibility or resistance to complement-mediated lysis in vitro correlated with the in vivo pathogenic potential. Nonpathogenic Naegleria amoebae were lysed at a faster rate and at higher cell concentrations than were pathogenic amoebae. Electrophoretic analysis of NHS incubated with pathogenic or nonpathogenic Naegleria spp. demonstrated that amoebae activate the complement cascade resulting in the production of C3 and C5 complement cleavage products. Treatment with papain or trypsin for 1 h, but not with sialidase, increase the susceptibility of highly pathogenic, mouse-passaged N. fowleri to lysis. Treatment with actinomycin D, cycloheximide or various protease inhibitors for 4 h did not increase susceptibility to lysis. Neither a repair process involving de novo protein synthesis nor a complement-inactivating protease appear to account for the increase resistance of N. fowleri amoebae to complement-mediated lysis. A binding study with 125 I radiolabeled C9 indicated that the terminal complement component does not remain stably bound to the membrane of pathogenic amoebae

  11. Regulatory Proteolysis in Arabidopsis-Pathogen Interactions.

    Science.gov (United States)

    Pogány, Miklós; Dankó, Tamás; Kámán-Tóth, Evelin; Schwarczinger, Ildikó; Bozsó, Zoltán

    2015-09-24

    Approximately two and a half percent of protein coding genes in Arabidopsis encode enzymes with known or putative proteolytic activity. Proteases possess not only common housekeeping functions by recycling nonfunctional proteins. By irreversibly cleaving other proteins, they regulate crucial developmental processes and control responses to environmental changes. Regulatory proteolysis is also indispensable in interactions between plants and their microbial pathogens. Proteolytic cleavage is simultaneously used both by plant cells, to recognize and inactivate invading pathogens, and by microbes, to overcome the immune system of the plant and successfully colonize host cells. In this review, we present available results on the group of proteases in the model plant Arabidopsis thaliana whose functions in microbial pathogenesis were confirmed. Pathogen-derived proteolytic factors are also discussed when they are involved in the cleavage of host metabolites. Considering the wealth of review papers available in the field of the ubiquitin-26S proteasome system results on the ubiquitin cascade are not presented. Arabidopsis and its pathogens are conferred with abundant sets of proteases. This review compiles a list of those that are apparently involved in an interaction between the plant and its pathogens, also presenting their molecular partners when available.

  12. Effective but costly, evolved mechanisms of defense against a virulent opportunistic pathogen in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Yixin H Ye

    2009-04-01

    Full Text Available Drosophila harbor substantial genetic variation for antibacterial defense, and investment in immunity is thought to involve a costly trade-off with life history traits, including development, life span, and reproduction. To understand the way in which insects invest in fighting bacterial infection, we selected for survival following systemic infection with the opportunistic pathogen Pseudomonas aeruginosa in wild-caught Drosophila melanogaster over 10 generations. We then examined genome-wide changes in expression in the selected flies relative to unselected controls, both of which had been infected with the pathogen. This powerful combination of techniques allowed us to specifically identify the genetic basis of the evolved immune response. In response to selection, population-level survivorship to infection increased from 15% to 70%. The evolved capacity for defense was costly, however, as evidenced by reduced longevity and larval viability and a rapid loss of the trait once selection pressure was removed. Counter to expectation, we observed more rapid developmental rates in the selected flies. Selection-associated changes in expression of genes with dual involvement in developmental and immune pathways suggest pleiotropy as a possible mechanism for the positive correlation. We also found that both the Toll and the Imd pathways work synergistically to limit infectivity and that cellular immunity plays a more critical role in overcoming P. aeruginosa infection than previously reported. This work reveals novel pathways by which Drosophila can survive infection with a virulent pathogen that may be rare in wild populations, however, due to their cost.

  13. Immune Evasion Strategies of Pathogens in Macrophages: the Potential for Limiting Pathogen Transmission.

    Science.gov (United States)

    Ren, Yuwei; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Zhang, Shujun

    2017-01-01

    Preventing pathogen transmission to a new host is of major interest to the immunologist and could benefit from a detailed investigation of pathogen immune evasion strategies. The first line of defense against pathogen invasion is provided by macrophages. When they sense pathogens, macrophages initiate signals to inflammatory and pro-inflammatory cytokines through pattern recognition receptors (PRRs) subsequently mediating phagocytosis and inflammation. The macrophage immune machinery classically includes two subsets: the activated M1 and the activated M2 that respond accordingly in diverse immune challenges. The lipid and glycogen metabolic pathways work together with the lysosome to help the mature phagosome to degrade and eliminate intracellular pathogens in macrophages. The viral evasion strategies are even more complex due to the interplay between autophagy and apoptosis. However, pathogens evolve several strategies to camouflage themselves against immune responses in order to ensure their survival, replication and transmission. These strategies include the muting of PRRs initiated inflammatory responses, attenuation of M1 and/or induction of M2 macrophages, suppression of autophago-lysosomal formation, interference with lipid and glycogen metabolism, and viral mediation of autophagy and apoptosis cross-talk to enhance viral replication. This review focuses on pathogen immune evasion methods and on the strategies used by the host against camouflaged pathogens.

  14. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  15. Host-pathogen interactions and genome evolution in two generalist and specialist microsporidian pathogens of mosquitoes

    Science.gov (United States)

    The adaptation of two distantly related microsporidia to their mosquito hosts was investigated. Edhazardia aedis is a specialist pathogen that infects Aedes aegypti, the main vector of dengue and yellow fever arboviruses. Vavraia culicis is a generalist pathogen of several insects including Anophele...

  16. Comparative Radiosensitivity of Pathogenic Bacteria and Viruses

    International Nuclear Information System (INIS)

    Ghys, R.; Vandergoten, R.; Paquette, J.-C.; Fredette, V.; Plante, C.; Pavilanis, V.; Gilker, J.-C.

    1967-01-01

    The authors exposed to gamma rays from a MCo source (''Gammacell 220'' from Atomic Energy of Canada, Ltd.) various pathogenic micro-organisms: a slow-growing aerobic bacterium (Mycobacterium tuberculosis, 10 varieties of the strain B. C. G.), a fast-growing anaerobic bacterium (Clostridium perfringens, strain SWG-121) and 4 strains of influenza virus (2 from group A and 2 from group B). In the case of B. C. G., an LD 90 of 29 ± 1 kR is reported for bacilli irradiated immediately before subculture and subsequently cultivated for at most 14 days. If the microbes are cultivated for 28 days, the yield from cultures after exposures of up to 50 kR is at least equal to that of control specimens; it then decreases rapidly, and a dose of 140 kR inhibits bacterial growth completely. It is reported that the LD 90 of the strain of Cl. perfringens used in the study is very much dependent on die culture conditions and die conditions under which die microbe growth measurements are made; 24 h after irradiation it is at least 1 MR. Although no spores are seen in the microscope, this would seem to demonstrate the presence in the cultures of extremely radioresistant sporulated individuals. Group A influenza viruses are found to be more radioresistant than those of group B. The LD 90 of relatively low radiation doses varies between 75 and 100 kR, and is higher if irradiation is performed at -78.5°C. It is very difficult to inactivate the last virus particles; multiplicity reactivation seems to occur in certain experimental conditions. Haemagglutinant activity does not vary, even after die highest exposures used (4 MR). Two important practical conclusions are drawn: (1) The use of a single dose (e. g. 2.5 Mrad) for radiosterilization gives an exposure which is unnecessarily high in some cases and insufficient in others, and (2) Selective radiosterilization is sometimes possible: the viability of a micro-organism used, for example, to produce a vaccine may not be

  17. Insight of Genus Corynebacterium: Ascertaining the Role of Pathogenic and Non-pathogenic Species.

    Science.gov (United States)

    Oliveira, Alberto; Oliveira, Leticia C; Aburjaile, Flavia; Benevides, Leandro; Tiwari, Sandeep; Jamal, Syed B; Silva, Arthur; Figueiredo, Henrique C P; Ghosh, Preetam; Portela, Ricardo W; De Carvalho Azevedo, Vasco A; Wattam, Alice R

    2017-01-01

    This review gathers recent information about genomic and transcriptomic studies in the Corynebacterium genus, exploring, for example, prediction of pathogenicity islands and stress response in different pathogenic and non-pathogenic species. In addition, is described several phylogeny studies to Corynebacterium , exploring since the identification of species until biological speciation in one species belonging to the genus Corynebacterium . Important concepts associated with virulence highlighting the role of Pld protein and Tox gene. The adhesion, characteristic of virulence factor, was described using the sortase mechanism that is associated to anchorage to the cell wall. In addition, survival inside the host cell and some diseases, were too addressed for pathogenic corynebacteria, while important biochemical pathways and biotechnological applications retain the focus of this review for non-pathogenic corynebacteria. Concluding, this review broadly explores characteristics in genus Corynebacterium showing to have strong relevance inside the medical, veterinary, and biotechnology field.

  18. [Selective mutism].

    Science.gov (United States)

    Ytzhak, A; Doron, Y; Lahat, E; Livne, A

    2012-10-01

    Selective mutism is an uncommon disorder in young children, in which they selectively don't speak in certain social situations, while being capable of speaking easily in other social situations. Many etiologies were proposed for selective mutism including psychodynamic, behavioral and familial etc. A developmental etiology that includes insights from all the above is gaining support. Accordingly, mild language impairment in a child with an anxiety trait may be at the root of developing selective mutism. The behavior will be reinforced by an avoidant pattern in the family. Early treatment and followup for children with selective mutism is important. The treatment includes non-pharmacological therapy (psychodynamic, behavioral and familial) and pharmacologic therapy--mainly selective serotonin reuptake inhibitors (SSRI).

  19. Serpin functions in host-pathogen interactions

    Directory of Open Access Journals (Sweden)

    Jialing Bao

    2018-04-01

    Full Text Available Serpins are a broadly distributed superfamily of protease inhibitors that are present in all kingdoms of life. The acronym, serpin, is derived from their function as potent serine proteases inhibitors. Early studies of serpins focused on their functions in haemostasis since modulating serine proteases activities are essential for coagulation. Additional research has revealed that serpins function in infection and inflammation, by modulating serine and cysteine proteases activities. The aim of this review is to summarize the accumulating findings and current understanding of the functions of serpins in host-pathogen interactions, serving as host defense proteins as well as pathogenic factors. We also discuss the potential crosstalk between host and pathogen serpins. We anticipate that future research will elucidate the therapeutic value of this novel target.

  20. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin.......Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms......, conidia are produced and discharged when humidity gets high—usually during night. In an earlier secretome study of field-collected grain aphids (Sitobion avenae) infected with entomophthoralean fungi, a number of pathogenesis-related, secreted enzymes were discovered (Fungal Genetics and Biology 2011, vol...

  1. Threats and opportunities of plant pathogenic bacteria.

    Science.gov (United States)

    Tarkowski, Petr; Vereecke, Danny

    2014-01-01

    Plant pathogenic bacteria can have devastating effects on plant productivity and yield. Nevertheless, because these often soil-dwelling bacteria have evolved to interact with eukaryotes, they generally exhibit a strong adaptivity, a versatile metabolism, and ingenious mechanisms tailored to modify the development of their hosts. Consequently, besides being a threat for agricultural practices, phytopathogens may also represent opportunities for plant production or be useful for specific biotechnological applications. Here, we illustrate this idea by reviewing the pathogenic strategies and the (potential) uses of five very different (hemi)biotrophic plant pathogenic bacteria: Agrobacterium tumefaciens, A. rhizogenes, Rhodococcus fascians, scab-inducing Streptomyces spp., and Pseudomonas syringae. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Histone Acetylation in Fungal Pathogens of Plants

    Directory of Open Access Journals (Sweden)

    Junhyun Jeon

    2014-03-01

    Full Text Available Acetylation of histone lysine residues occurs in different organisms ranging from yeast to plants and mammals for the regulation of diverse cellular processes. With the identification of enzymes that create or reverse this modification, our understanding on histone acetylation has expanded at an amazing pace during the last two decades. In fungal pathogens of plants, however, the importance of such modification has only just begun to be appreciated in the recent years and there is a dearth of information on how histone acetylation is implicated in fungal pathogenesis. This review covers the current status of research related to histone acetylation in plant pathogenic fungi and considers relevant findings in the interaction between fungal pathogens and host plants. We first describe the families of histone acetyltransferases and deacetylases. Then we provide the cases where histone acetylation was investigated in the context of fungal pathogenesis. Finally, future directions and perspectives in epigenetics of fungal pathogenesis are discussed.

  3. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  4. Natural selection promotes antigenic evolvability.

    Science.gov (United States)

    Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin

    2013-01-01

    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.

  5. Natural selection promotes antigenic evolvability.

    Directory of Open Access Journals (Sweden)

    Christopher J Graves

    Full Text Available The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish

  6. Differentiation between a pathogenic and a non-pathogenic form of Gyrodactylus salaris using PCR-RFLP

    DEFF Research Database (Denmark)

    Kania, Per Walther; Jørgensen, Thomas Rohde; Buchmann, Kurt

    2007-01-01

    A new method based on PCR-RFLP is presented. It is able to differentiate between the Danish non-pathogenic form of Gyrodactylus salaris and the Norwegian pathogenic form.......A new method based on PCR-RFLP is presented. It is able to differentiate between the Danish non-pathogenic form of Gyrodactylus salaris and the Norwegian pathogenic form....

  7. Molecular techniques for characterisation of pathogens

    DEFF Research Database (Denmark)

    Kampmann, Marie-Louise

    Pathogens have always had a major interest to humans due to their central role in sickness and death. Influenza A annually kills at least 250,000 humans, and has been the cause of millions of further deaths during pandemic years in the past. Plague (Yersinia pestis) has been the cause of the Black...... capture for the detection of Y. pestis in samples from the Justinian plague (600 AD) as an attempt to detect this pathogen as a cause of death in the victims....

  8. Whole-genome sequencing of veterinary pathogens

    DEFF Research Database (Denmark)

    Ronco, Troels

    -electrophoresis and single-locus sequencing has been widely used to characterize such types of veterinary pathogens. However, DNA sequencing techniques have become fast and cost effective in recent years and whole-genome sequencing data provide a much higher discriminative power and reproducibility than any...... genetic background. This indicates that dairy cows can be natural carriers of S. aureus subtypes that in certain cases lead to CM. A group of isolates that mostly belonged to ST151 carried three pathogenicity islands that were primarily found in this group. The prevalence of resistance genes was generally...

  9. Molecular Tracing of Viral Pathogen in Aquaculture (MOLTRAQ): a new EMIDA project

    DEFF Research Database (Denmark)

    Jensen, B. Bang; Aldrin, M.; Avarre, M. C.

    2012-01-01

    a generic approach to viral disease control by using information on epidemiological and phylogenetic attributes from several important aquatic animal viruses. The project will i) generate and use spatio-temporal epidemiological data, phylogeographic data and gene expression data for important host......-viral pathogen systems to identify important factors affecting the spread of diseases in aquaculture, and ii) integrate these in scenario simulation models to assess effects of various control strategies for selected host-pathogen systems. The project consists of six workpackages: WP 1: Project co...

  10. Genetics of Resistance and Pathogenicity in the Maize/Setosphaeria turcica Pathosystem and Implications for Breeding

    Directory of Open Access Journals (Sweden)

    Ana L. Galiano-Carneiro

    2017-08-01

    Full Text Available Northern corn leaf blight (NCLB, the most devastating leaf pathogen in maize (Zea mays L., is caused by the heterothallic ascomycete Setosphaeria turcica. The pathogen population shows an extremely high genetic diversity in tropical and subtropical regions. Varietal resistance is the most efficient technique to control NCLB. Host resistance can be qualitative based on race-specific Ht genes or quantitative controlled by many genes with small effects. Quantitative resistance is moderately to highly effective and should be more durable combatting all races of the pathogen. Quantitative resistance must, however, be analyzed in many environments (= location × year combinations to select stable resistances. In the tropical and subtropical environments, quantitative resistance is the preferred option to manage NCLB epidemics. Resistance level can be increased in practical breeding programs by several recurrent selection cycles based on disease severity rating and/or by genomic selection. This review aims to address two important aspects of the NCLB pathosystem: the genetics of the fungus S. turcica and the modes of inheritance of the host plant maize, including successful breeding strategies regarding NCLB resistance. Both drivers of this pathosystem, pathogen, and host, must be taken into account to result in more durable resistance.

  11. Genome-Enhanced Detection and Identification (GEDI of plant pathogens

    Directory of Open Access Journals (Sweden)

    Nicolas Feau

    2018-02-01

    Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.

  12. Multidrug-resistant pathogens in the food supply.

    Science.gov (United States)

    Doyle, Marjorie E

    2015-04-01

    Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

  13. Food-borne pathogens, health and role of dietary phytochemicals.

    Science.gov (United States)

    Shetty, K; Labbe, R G

    1998-12-01

    Infectious diseases transmitted by food have become a major public health concern in recent years. In the USA alone, there are an estimated 6-33 million cases each year. The list of responsible agents continues to grow. In the past 20 years some dozen new pathogens that are primarily food-borne have been identified. Fruits and vegetables, often from the global food market, have been added to the traditional vehicles of food-borne illness; that is, undercooked meat, poultry, seafood, or unpasteurized milk. Such products are minimally processed and have fewer barriers to microbial growth such as salt, sugar or preservatives. The evolution of the epidemiology of food-borne illness requires a rethinking of traditional, though still valid, solutions for their prevention. Among various strategies to prevent food-borne pathogens, use of dietary phytochemicals is promising. The major obstacle in the use of dietary phytochemical is the consistency of phytochemicals in different foods due to their natural genetic variation. We have developed a novel tissue-culture-based selection strategy to isolate elite phenolic phytochemical-producing clonal lines of species belonging to the family Lamiaceae. Among several species we have targeted elite clonal lines of thyme (Thymus vulgaris) and oregano (Origanum vulgare) against Escherichia coli and Clostridium perfrigens in fresh and processed meats. We are also evaluating high phenolic profile-containing clonal lines of basil (Ocimum basilicum) to inhibit gastric ulcer-causing Helicobacter pylori. Other elite lines of the members of the family Lamiaceae, rosemary (Rosmarinus officinalis) and salvia (Salvia officinalis) also hold promise against a wide range of food pathogens such as Salmonella species in poultry products and Vibrio species in seafood.

  14. Site selection

    CERN Multimedia

    CERN PhotoLab

    1968-01-01

    To help resolve the problem of site selection for the proposed 300 GeV machine, the Council selected "three wise men" (left to right, J H Bannier of the Netherlands, A Chavanne of Switzerland and L K Boggild of Denmark).

  15. Benchmark selection

    DEFF Research Database (Denmark)

    Hougaard, Jens Leth; Tvede, Mich

    2002-01-01

    Within a production theoretic framework, this paper considers an axiomatic approach to benchmark selection. It is shown that two simple and weak axioms; efficiency and comprehensive monotonicity characterize a natural family of benchmarks which typically becomes unique. Further axioms are added...... in order to obtain a unique selection...

  16. The Tick Microbiome: Why Non-pathogenic Microorganisms Matter in Tick Biology and Pathogen Transmission

    Directory of Open Access Journals (Sweden)

    Sarah I. Bonnet

    2017-06-01

    Full Text Available Ticks are among the most important vectors of pathogens affecting humans and other animals worldwide. They do not only carry pathogens however, as a diverse group of commensal and symbiotic microorganisms are also present in ticks. Unlike pathogens, their biology and their effect on ticks remain largely unexplored, and are in fact often neglected. Nonetheless, they can confer multiple detrimental, neutral, or beneficial effects to their tick hosts, and can play various roles in fitness, nutritional adaptation, development, reproduction, defense against environmental stress, and immunity. Non-pathogenic microorganisms may also play a role in driving transmission of tick-borne pathogens (TBP, with many potential implications for both human and animal health. In addition, the genetic proximity of some pathogens to mutualistic symbionts hosted by ticks is evident when studying phylogenies of several bacterial genera. The best examples are found within members of the Rickettsia, Francisella, and Coxiella genera: while in medical and veterinary research these bacteria are traditionally recognized as highly virulent vertebrate pathogens, it is now clear to evolutionary ecologists that many (if not most Coxiella, Francisella, and Rickettsia bacteria are actually non-pathogenic microorganisms exhibiting alternative lifestyles as mutualistic ticks symbionts. Consequently, ticks represent a compelling yet challenging system in which to study microbiomes and microbial interactions, and to investigate the composition, functional, and ecological implications of bacterial communities. Ultimately, deciphering the relationships between tick microorganisms as well as tick symbiont interactions will garner invaluable information, which may aid in the future development of arthropod pest and vector-borne pathogen transmission control strategies.

  17. Chronological aging in conidia of pathogenic Aspergillus: Comparison between species.

    Science.gov (United States)

    Oliveira, Manuela; Pereira, Clara; Bessa, Cláudia; Araujo, Ricardo; Saraiva, Lucília

    2015-11-01

    Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus and Aspergillus niger are common airborne fungi, and the most frequent causative agents of human fungal infections. However, the resistance and lifetime persistence of these fungi in the atmosphere, and the mechanism of aging of Aspergillus conidia are unknown.With this work, we intended to study the processes underlying conidial aging of these four relevant and pathogenic Aspergillus species. Chronological aging was therefore evaluated in A. fumigatus, A. flavus, A. terreus and A. niger conidia exposed to environmental and human body temperatures. The results showed that the aging process in Aspergillus conidia involves apoptosis,with metacaspase activation, DNA fragmentation, and reactive oxygen species production, associated with secondary necrosis. Distinct results were observed for the selected pathogenic species. At environmental conditions, A. niger was the species with the highest resistance to aging, indicating a higher adaption to environmental conditions, whereas A. flavus followed by A. terreus were the most sensitive species. At higher temperatures (37 °C), A. fumigatus presented the longest lifespan, in accordance with its good adaptation to the human body temperature. Altogether,with this work new insights regarding conidia aging are provided, which may be useful when designing treatments for aspergillosis.

  18. Host-pathogen interactions in typhoid fever

    NARCIS (Netherlands)

    de Jong, H.K.

    2015-01-01

    This thesis focuses on host-pathogen interactions in Salmonella Typhi and Burkholderia pseudomallei infections and explores the interplay between these bacteria and the innate immune system. Typhoid fever is one of the most common causes of bacterial infection in low-income countries. With adequate

  19. Current situation on highly pathogenic avian influenza

    Science.gov (United States)

    Avian influenza is one of the most important diseases affecting the poultry industry worldwide. Avian influenza viruses can cause a range of clinical disease in poultry. Viruses that cause severe disease and mortality are referred to as highly pathogenic avian influenza (HPAI) viruses. The Asian ...

  20. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  1. Low-Incidence, High-Consequence Pathogens

    Centers for Disease Control (CDC) Podcasts

    2014-02-21

    Dr. Stephan Monroe, a deputy director at CDC, discusses the impact of low-incidence, high-consequence pathogens globally.  Created: 2/21/2014 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 2/26/2014.

  2. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

  3. Quantitative multiplex detection of pathogen biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

    2016-02-09

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  4. Pathogen Pressure Puts Immune Defense into Perspective

    NARCIS (Netherlands)

    Horrocks, Nicholas P. C.; Matson, Kevin D.; Tieleman, B. Irene

    2011-01-01

    The extent to which organisms can protect themselves from disease depends on both the immune defenses they maintain and the pathogens they face. At the same time, immune systems are shaped by the antigens they encounter, both over ecological and evolutionary time. Ecological immunologists often

  5. Control of indigenous pathogenic bacteria in seafood

    DEFF Research Database (Denmark)

    Huss, Hans Henrik

    1997-01-01

    The pathogenic bacteria indigenous to the aquatic and general environment are listed. Their distribution in nature, prevalence in seafood and the possibilities for growth of these organisms in various types of products are outlined These data, combined with what is known regarding the epidemiology...

  6. EPCOT, NASA and plant pathogens in space.

    Science.gov (United States)

    White, R

    1996-01-01

    Cooperative work between NASA and Walt Disney World's EPCOT Land Pavilion is described. Joint efforts include research about allelopathy in multi-species plant cropping in CELSS, LEDs as light sources in hydroponic systems, and the growth of plant pathogens in space.

  7. Quantitative multiplex detection of pathogen biomarkers

    Science.gov (United States)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

    2014-10-14

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  8. Cultural, morphological, pathogenic and molecular characterization ...

    African Journals Online (AJOL)

    Alternaria blotch (Alternaria mali) causes severe foliar damage to apple trees in Kashmir. Twenty one (21) isolates of A. mali were collected from different locations and characterized for cultural, morphological, pathogenic and molecular variations. A. mali colonies varied in their cultural behaviour ranging from velvety to ...

  9. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2009-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  10. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2010-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  11. PATHOGENIC POTENTIALS OF ESCHERICHIA COLI ISOLATED ...

    African Journals Online (AJOL)

    Electrolyte and haematological parameters in rabbits infected with pathogenic isolates of Escherichia coli from rural water supplies in Rivers State, Nigeria, where monitored. Rabbits were orally infected with suspension containing 3x107 cfu /ml of Escherichia coli to induce diarrhoea, and the electrolyte (sodium, potassium ...

  12. Microbial minimalism: genome reduction in bacterial pathogens.

    Science.gov (United States)

    Moran, Nancy A

    2002-03-08

    When bacterial lineages make the transition from free-living or facultatively parasitic life cycles to permanent associations with hosts, they undergo a major loss of genes and DNA. Complete genome sequences are providing an understanding of how extreme genome reduction affects evolutionary directions and metabolic capabilities of obligate pathogens and symbionts.

  13. Pathogenic human viruses in coastal waters

    Science.gov (United States)

    Griffin, Dale W.; Donaldson, Kim A.; Paul, J.H.; Rose, Joan B.

    2003-01-01

    This review addresses both historical and recent investigations into viral contamination of marine waters. With the relatively recent emergence of molecular biology-based assays, a number of investigations have shown that pathogenic viruses are prevalent in marine waters being impacted by sewage. Research has shown that this group of fecal-oral viral pathogens (enteroviruses, hepatitis A viruses, Norwalk viruses, reoviruses, adenoviruses, rotaviruses, etc.) can cause a broad range of asymptomatic to severe gastrointestinal, respiratory, and eye, nose, ear, and skin infections in people exposed through recreational use of the water. The viruses and the nucleic acid signature survive for an extended period in the marine environment. One of the primary concerns of public health officials is the relationship between the presence of pathogens and the recreational risk to human health in polluted marine environments. While a number of studies have attempted to address this issue, the relationship is still poorly understood. A contributing factor to our lack of progress in the field has been the lack of sensitive methods to detect the broad range of both bacterial and viral pathogens. The application of new and advanced molecular methods will continue to contribute to our current state of knowledge in this emerging and

  14. Campylobacter jejuni & Inflammation : Grilling the pathogen

    NARCIS (Netherlands)

    Bouwman, L.I.

    2016-01-01

    Campylobacter jejuni is the most common cause of bacterial foodborne disease. Yet, little is known about how this pathogen causes intestinal inflammation. The clinical pathology during human infection points to invasive bacterial behavior accompanied by the induction of potent pro-inflammatory

  15. Home Air Purifiers Eradicate Harmful Pathogens

    Science.gov (United States)

    2014-01-01

    Marshall Space Flight Center funded the University of Madison-Wisconsin to develop ethylene scrubbers to keep produce fresh in space. Akida Holdings of Jacksonville, Florida, licensed the technology and developed Airocide, an air purifier that can kill airborne pathogens. Previously designed for industrial spaces, there is now a specially designed unit for home use.

  16. Carp erythrodermatitis : host defense-pathogen interaction

    NARCIS (Netherlands)

    Pourreau, C.N.

    1990-01-01

    The outcome of a bacterial infection depends on the interaction between pathogen and host. The ability of the microbe to survive in the host depends on its invasive potential (i.e. spreading and multiplication), and its ability to obtain essential nutrients and to resist the

  17. Antibiotic susceptibility profiles of oral pathogens

    NARCIS (Netherlands)

    Veloo, A. C. M.; Seme, K.; Raangs, Gerwin; Rurenga, P.; Singadji, Z.; Wekema - Mulder, G.; van Winkelhoff, A. J.

    2012-01-01

    Periodontitis is a bacterial disease that can be treated with systemic antibiotics. The aim of this study was to establish the antibiotic susceptibility profiles of five periodontal pathogens to six commonly used antibiotics in periodontics. A total of 247 periodontal bacterial isolates were tested

  18. Morphological, cultural, pathogenic and molecular variability ...

    African Journals Online (AJOL)

    Alternaria blight (Alternaria brassicae) causes severe foliar damage to Indian mustard in Uttarakhand. Ten (10) isolates of A. brassicae were collected from different hosts and characterized for cultural, morphological, pathogenic and molecular variations. A. brassicae colonies varied in their cultural behaviour ranging from ...

  19. Ewingella Americana: An Emerging True Pathogen

    Directory of Open Access Journals (Sweden)

    Syed Hassan

    2012-01-01

    Full Text Available Infections caused by Ewingella americana have been rarely reported in the literature. Most of the cases that have been reported were among the immunocompromised patients. We report a case of E. americana causing osteomyelitis and septic arthritis of the shoulder joint in a previous intravenous drug abuser. The causative pathogen was identified by synovial fluid analysis and culture.

  20. Arginase activity in pathogenic and non-pathogenic species of Leishmania parasites.

    Science.gov (United States)

    Badirzadeh, Alireza; Taheri, Tahereh; Taslimi, Yasaman; Abdossamadi, Zahra; Heidari-Kharaji, Maryam; Gholami, Elham; Sedaghat, Baharehsadat; Niyyati, Maryam; Rafati, Sima

    2017-07-01

    Proliferation of Leishmania (L.) parasites depends on polyamine availability, which can be generated by the L-arginine catabolism and the enzymatic activity of arginase (ARG) of the parasites and of the mammalian hosts. In the present study, we characterized and compared the arginase (arg) genes from pathogenic L. major and L. tropica and from non-pathogenic L. tarentolae. We quantified the level of the ARG activity in promastigotes and macrophages infected with pathogenic L. major and L. tropica and non-pathogenic L. tarentolae amastigotes. The ARG's amino acid sequences of the pathogenic and non-pathogenic Leishmania demonstrated virtually 98.6% and 88% identities with the reference L. major Friedlin ARG. Higher ARG activity was observed in all pathogenic promastigotes as compared to non-pathogenic L. tarentolae. In vitro infection of human macrophage cell line (THP1) with pathogenic and non-pathogenic Leishmania spp. resulted in increased ARG activities in the infected macrophages. The ARG activities present in vivo were assessed in susceptible BALB/c and resistant C57BL/6 mice infected with L. major, L. tropica and L. tarentolae. We demonstrated that during the development of the infection, ARG is induced in both strains of mice infected with pathogenic Leishmania. However, in L. major infected BALB/c mice, the induction of ARG and parasite load increased simultaneously according to the time course of infection, whereas in C57BL/6 mice, the enzyme is upregulated solely during the period of footpad swelling. In L. tropica infected mice, the footpads' swellings were slow to develop and demonstrated minimal cutaneous pathology and ARG activity. In contrast, ARG activity was undetectable in mice inoculated with the non-pathogenic L. tarentolae. Our data suggest that infection by Leishmania parasites can increase ARG activity of the host and provides essential polyamines for parasite salvage and its replication. Moreover, the ARG of Leishmania is vital for parasite

  1. The sunflower downy mildew pathogen Plasmopara halstedii.

    Science.gov (United States)

    Gascuel, Quentin; Martinez, Yves; Boniface, Marie-Claude; Vear, Felicity; Pichon, Magalie; Godiard, Laurence

    2015-02-01

    Downy mildew of sunflower is caused by Plasmopara halstedii (Farlow) Berlese & de Toni. Plasmopara halstedii is an obligate biotrophic oomycete pathogen that attacks annual Helianthus species and cultivated sunflower, Helianthus annuus. Depending on the sunflower developmental stage at which infection occurs, the characteristic symptoms range from young seedling death, plant dwarfing, leaf bleaching and sporulation to the production of infertile flowers. Downy mildew attacks can have a great economic impact on sunflower crops, and several Pl resistance genes are present in cultivars to protect them against the disease. Nevertheless, some of these resistances have been overcome by the occurrence of novel isolates of the pathogen showing increased virulence. A better characterization of P. halstedii infection and dissemination mechanisms, and the identification of the molecular basis of the interaction with sunflower, is a prerequisite to efficiently fight this pathogen. This review summarizes what is currently known about P. halstedii, provides new insights into its infection cycle on resistant and susceptible sunflower lines using scanning electron and light microscopy imaging, and sheds light on the pathogenicity factors of P. halstedii obtained from recent molecular data. Kingdom Stramenopila; Phylum Oomycota; Class Oomycetes; Order Peronosporales; Family Peronosporaceae; Genus Plasmopara; Species Plasmopara halstedii. Sunflower seedling damping off, dwarfing of the plant, bleaching of leaves, starting from veins, and visible white sporulation, initially on the lower side of cotyledons and leaves. Plasmopara halstedii infection may severely impact sunflower seed yield. In spring, germination of overwintered sexual oospores leads to sunflower root infection. Intercellular hyphae are responsible for systemic plant colonization and the induction of disease symptoms. Under humid and fresh conditions, dissemination structures are produced by the pathogen on all

  2. Selective mutism.

    Science.gov (United States)

    Hua, Alexandra; Major, Nili

    2016-02-01

    Selective mutism is a disorder in which an individual fails to speak in certain social situations though speaks normally in other settings. Most commonly, this disorder initially manifests when children fail to speak in school. Selective mutism results in significant social and academic impairment in those affected by it. This review will summarize the current understanding of selective mutism with regard to diagnosis, epidemiology, cause, prognosis, and treatment. Studies over the past 20 years have consistently demonstrated a strong relationship between selective mutism and anxiety, most notably social phobia. These findings have led to the recent reclassification of selective mutism as an anxiety disorder in the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition. In addition to anxiety, several other factors have been implicated in the development of selective mutism, including communication delays and immigration/bilingualism, adding to the complexity of the disorder. In the past few years, several randomized studies have supported the efficacy of psychosocial interventions based on a graduated exposure to situations requiring verbal communication. Less data are available regarding the use of pharmacologic treatment, though there are some studies that suggest a potential benefit. Selective mutism is a disorder that typically emerges in early childhood and is currently conceptualized as an anxiety disorder. The development of selective mutism appears to result from the interplay of a variety of genetic, temperamental, environmental, and developmental factors. Although little has been published about selective mutism in the general pediatric literature, pediatric clinicians are in a position to play an important role in the early diagnosis and treatment of this debilitating condition.

  3. Oligo-DNA custom macroarray for monitoring major pathogenic and non-pathogenic fungi and bacteria in the phyllosphere of apple trees.

    Science.gov (United States)

    He, Ying-Hong; Isono, Sayaka; Shibuya, Makoto; Tsuji, Masaharu; Adkar Purushothama, Charith-Raj; Tanaka, Kazuaki; Sano, Teruo

    2012-01-01

    To monitor the richness in microbial inhabitants in the phyllosphere of apple trees cultivated under various cultural and environmental conditions, we developed an oligo-DNA macroarray for major pathogenic and non-pathogenic fungi and bacteria inhabiting the phyllosphere of apple trees. First, we isolated culturable fungi and bacteria from apple orchards by an agar-plate culture method, and detected 32 fungal and 34 bacterial species. Alternaria, Aureobasidium, Cladosporium, Rhodotorula, Cystofilobasidium, and Epicoccum genera were predominant among the fungi, and Bacillus, Pseudomonas, Sphingomonas, Methylobacterium, and Pantoea genera were predominant among the bacteria. Based on the data, we selected 29 major non-pathogenic and 12 phytopathogenic fungi and bacteria as the targets of macroarray. Forty-one species-specific 40-base pair long oligo-DNA sequences were selected from the nucleotide sequences of rDNA-internal transcribed spacer region for fungi and 16S rDNA for bacteria. The oligo-DNAs were fixed on nylon membrane and hybridized with digoxigenin-labeled cRNA probes prepared for each species. All arrays except those for Alternaria, Bacillus, and their related species, were specifically hybridized. The array was sensitive enough to detect 10(3) CFU for Aureobasidium pullulans and Bacillus cereus. Nucleotide sequencing of 100 each of independent fungal rDNA-ITS and bacterial 16S-rDNA sequences from apple tree was in agreement with the macroarray data obtained using the same sample. Finally, we analyzed the richness in the microbial inhabitants in the samples collected from apple trees in four orchards. Major apple pathogens that cause scab, Alternaria blotch, and Marssonina blotch were detected along with several non-phytopathogenic fungal and bacterial inhabitants. The macroarray technique presented here is a strong tool to monitor the major microbial species and the community structures in the phyllosphere of apple trees and identify key species

  4. Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population.

    Science.gov (United States)

    Schindler, Emily I; Nylen, Erik L; Ko, Audrey C; Affatigato, Louisa M; Heggen, Andrew C; Wang, Kai; Sheffield, Val C; Stone, Edwin M

    2010-10-01

    Accurate prediction of the pathogenic effects of specific genotypes is important for the design and execution of clinical trials as well as for meaningful counseling of individual patients. However, for many autosomal recessive diseases, it can be difficult to deduce the relative pathogenic contribution of individual alleles because relatively few affected individuals share the same two disease-causing variations. In this study, we used multiple regression analysis to estimate the pathogenicity of specific alleles of ABCA4 in patients with retinal phenotypes ranging from Stargardt disease to retinitis pigmentosa. This analysis revealed quantitative allelic effects on two aspects of the visual phenotype, visual acuity (P disease and will also aid in the optimal selection of subjects for clinical trials of new therapies.

  5. Prevalence and Geographic Distribution of Vector-Borne Pathogens in Apparently Healthy Dogs in Croatia.

    Science.gov (United States)

    Mrljak, Vladimir; Kuleš, Josipa; Mihaljević, Željko; Torti, Marin; Gotić, Jelena; Crnogaj, Martina; Živičnjak, Tatjana; Mayer, Iva; Šmit, Iva; Bhide, Mangesh; Barić Rafaj, Renata

    2017-06-01

    Vector-borne pathogens (VBPs) are a group of globally extended and quickly spreading pathogens that are transmitted by various arthropod vectors. The aim of the present study was to investigate the seroprevalence against Babesia canis, Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Leishmania infantum, Dirofilaria immitis, and Ehrlichia canis in dogs in Croatia. We investigated 435 randomly selected apparently healthy dogs in 13 different locations of Croatia for antibodies to B. canis by indirect immunofluorescence using a commercial IFA IgG Antibody Kit. All samples were also tested for qualitative detection of D. immitis antigen and for antibodies to A. phagocytophilum, B. burgdorferi sensu lato, L. infantum, and E. canis with two point-of-care assays. Overall, 112 dogs (25.74%, 95% confidence interval [CI] 21.70-30.12) were serologically positive for one or more of the pathogens. B. canis was the most prevalent pathogen (20.00%, 95% CI 16.34-24.07), followed by A. phagocytophilum (6.21%, 95% CI 4.12-8.90), L. infantum, (1.38%, 95% CI 0.51-2.97), and B. burgdorferi sensu lato (0.69%, 95% CI 0.01-2.00). The lowest seroprevalence was for D. immitis and E. canis (0.46%, 95% CI 0.01-1.65). Coinfection was determined in 12 dogs (2.76%, 95% CI 1.43-4.77), of which 10 were positive to two pathogens (7 with B. canis and A. phagocytophilum and 1 B. canis with B. burgdorferi sensu lato or L. infantum or E. canis). One dog was positive to three pathogens and another dog to four pathogens. Seroprevalence for babesia was age, breed, and lifestyle/use dependent. Purebred dogs had almost half the chance of developing disease than crossbred (OR = 0.58, p Croatia. Some of these VBPs are zoonotic and represent a potential risk to public health.

  6. Proximal Sensing of Plant-Pathogen Interactions in Spring Barley with Three Fluorescence Techniques

    Directory of Open Access Journals (Sweden)

    Georg Leufen

    2014-06-01

    Full Text Available In the last years fluorescence spectroscopy has come to be viewed as an essential approach in key research fields of applied plant sciences. However, the quantity and particularly the quality of information produced by different equipment might vary considerably. In this study we investigate the potential of three optical devices for the proximal sensing of plant-pathogen interactions in four genotypes of spring barley. For this purpose, the fluorescence lifetime, the image-resolved multispectral fluorescence and selected indices of a portable multiparametric fluorescence device were recorded at 3, 6, and 9 days after inoculation (dai from healthy leaves as well as from leaves inoculated with powdery mildew (Blumeria graminis or leaf rust (Puccinia hordei. Genotype-specific responses to pathogen infections were revealed already at 3 dai by higher fluorescence mean lifetimes in the spectral range from 410 to 560 nm in the less susceptible varieties. Noticeable pathogen-induced modifications were also revealed by the ‘Blue-to-Far-Red Fluorescence Ratio’ and the ‘Simple Fluorescence Ratio’. Particularly in the susceptible varieties the differences became more evident in the time-course of the experiment i.e., following the pathogen development. The relevance of the blue and green fluorescence to exploit the plant-pathogen interaction was demonstrated by the multispectral fluorescence imaging system. As shown, mildewed leaves were characterized by exceptionally high blue fluorescence, contrasting the values observed in rust inoculated leaves. Further, we confirm that the intensity of green fluorescence depends on the pathogen infection and the stage of disease development; this information might allow a differentiation of both diseases. Moreover, our results demonstrate that the detection area might influence the quality of the information, although it had a minor impact only in the current study. Finally, we highlight the relevance of

  7. Task 1.5 Genomic Shift and Drift Trends of Emerging Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Borucki, M

    2010-01-05

    The Lawrence Livermore National Laboratory (LLNL) Bioinformatics group has recently taken on a role in DTRA's Transformation Medical Technologies Initiative (TMTI). The high-level goal of TMTI is to accelerate the development of broad-spectrum countermeasures. To achieve those goals, TMTI has a near term need to conduct analyses of genomic shift and drift trends of emerging pathogens, with a focused eye on select agent pathogens, as well as antibiotic and virulence markers. Most emerging human pathogens are zoonotic viruses with a genome composed of RNA. The high mutation rate of the replication enzymes of RNA viruses contributes to sequence drift and provides one mechanism for these viruses to adapt to diverse hosts (interspecies transmission events) and cause new human and zoonotic diseases. Additionally, new viral pathogens frequently emerge due to genetic shift (recombination and segment reassortment) which allows for dramatic genotypic and phenotypic changes to occur rapidly. Bacterial pathogens also evolve via genetic drift and shift, although sequence drift generally occurs at a much slower rate for bacteria as compared to RNA viruses. However, genetic shift such as lateral gene transfer and inter- and intragenomic recombination enables bacteria to rapidly acquire new mechanisms of survival and antibiotic resistance. New technologies such as rapid whole genome sequencing of bacterial genomes, ultra-deep sequencing of RNA virus populations, metagenomic studies of environments rich in antibiotic resistance genes, and the use of microarrays for the detection and characterization of emerging pathogens provide mechanisms to address the challenges posed by the rapid emergence of pathogens. Bioinformatic algorithms that enable efficient analysis of the massive amounts of data generated by these technologies as well computational modeling of protein structures and evolutionary processes need to be developed to allow the technology to fulfill its potential.

  8. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal

    Science.gov (United States)

    Coy, Monique R.; Stelinski, Lukasz L.; Pelz-Stelinski, Kirsten S.

    2015-01-01

    The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas) affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama). CLas is the putative causal agent of huanglongbing (HLB), which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies. PMID:26083763

  9. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal.

    Directory of Open Access Journals (Sweden)

    Xavier Martini

    Full Text Available The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama. CLas is the putative causal agent of huanglongbing (HLB, which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies.

  10. Comparative innate immune interactions of human and bovine secretory IgA with pathogenic and non-pathogenic bacteria.

    Science.gov (United States)

    Hodgkinson, Alison J; Cakebread, Julie; Callaghan, Megan; Harris, Paul; Brunt, Rachel; Anderson, Rachel C; Armstrong, Kelly M; Haigh, Brendan

    2017-03-01

    Secretory IgA (SIgA) from milk contributes to early colonization and maintenance of commensal/symbiotic bacteria in the gut, as well as providing defence against pathogens. SIgA binds bacteria using specific antigenic sites or non-specifically via its glycans attached to α-heavy-chain and secretory component. In our study, we tested the hypothesis that human and bovine SIgA have similar innate-binding activity for bacteria. SIgAs, isolated from human and bovine milk, were incubated with a selection of commensal, pathogenic and probiotic bacteria. Using flow cytometry, we measured numbers of bacteria binding SIgA and their level of SIgA binding. The percentage of bacteria bound by human and bovine SIgA varied from 30 to 90% depending on bacterial species and strains, but was remarkably consistent between human and bovine SIgA. The level of SIgA binding per bacterial cell was lower for those bacteria that had a higher percentage of SIgA-bound bacteria, and higher for those bacteria that had lower percentage of SIgA-bound bacteria. Overall, human and bovine SIgA interacted with bacteria in a comparable way. This contributes to longer term research about the potential benefits of bovine SIgA for human consumers. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Appraisal of Microbial Evolution to Commensalism and Pathogenicity in Humans

    Directory of Open Access Journals (Sweden)

    Asit Ranjan Ghosh

    2013-01-01

    Full Text Available The human body is host to a number of microbes occurring in various forms of host-microbe associations, such as commensals, mutualists, pathogens and opportunistic symbionts. While this association with microbes in certain cases is beneficial to the host, in many other cases it seems to offer no evident benefit or motive. The emergence and re-emergence of newer varieties of infectious diseases with causative agents being strains that were once living in the human system makes it necessary to study the environment and the dynamics under which this host microbe relationship thrives. The present discussion examines this interaction while tracing the origins of this association, and attempts to hypothesize a possible framework of selective pressures that could have lead microbes to inhabit mammalian host systems.

  12. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

  13. 生防细菌K2-1对大菱鲆病原菌的抑制作用及其抗菌特性分析%Antimicrobial activity of a biocontrol bacterium strain K2-1 against selected pathogens ofScophthalmus maximus and its antimicrobial property analysis

    Institute of Scientific and Technical Information of China (English)

    方卫东; 唐旭; 刘源森; 林凌; 黄仕新; 徐长安

    2015-01-01

    In order to study the possibility of using biocontrol bacterium for control and prevention of aquatic dis-eases caused by bacterial pathogens, a bacterium strain K2-1, identified asBacillus cereus, was screened out from the mud of Haicang harbor, Xiamen, China. Antibacterial test was conducted using an agar diffusion method, and the result showed that the supernatant of strain K2-1 could inhibit the growth of some common pathogens related withScophthalmus maximus diseases during farming includingVibrio parahaemolyticus,Edwardsiella,Vibrio har-veyi,Aeromonas hydrophilaand Vibrio alginolyticus. Further study of its antibacterial substance property was im-plemented, and it revealed that the bioactive substance produced by strain K2-1 was a protein (peptide). This anti-bacterial protein was thermal stable, and it kept high antimicrobial activity under temperature ranging from 40℃ to 70℃, and it was also of high acid and alkali tolerance, with its antibacterial activity decreasing less than 15% in the rang of pH 3.0 to 9.0. Enzymatic treatment test showed that this antibacterial protein was resistant to most pro-tease including trypsase, pepsase and papain, but it was sensitive to protease K. All the these results showed that the strain K2-1 had high development and application values in the future.%为探讨生防细菌应用于水产养殖动物细菌病防治的可行性,作者从厦门市海沧港口污泥中筛选到一株蜡状芽孢杆菌(Bacillus cereus)K2-1,利用琼脂扩散法发现其发酵上清对大菱鲆(Scophthalmus maximus)养殖常见致病菌——副溶血弧菌(Vibrio parahaemolyticus)、爱德华氏菌(Edwardsiella)、哈维氏弧菌(Vibrio harveyi)、嗜水气单胞菌(Aeromonas hydrophila)、溶藻弧菌(Vibrio alginolyticus))有较强拮抗作用。进一步分析抗菌物质的部分特性,结果显示,蜡状芽孢杆菌(Bacillus cereus)K2-1发酵产生的抗菌物质含有蛋白(肽)类成分,该抗菌物质具有

  14. Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.

    Science.gov (United States)

    Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G

    2018-03-01

    Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  15. Ecological theory as a foundation to control pathogenic invasion in aquaculture

    Science.gov (United States)

    De Schryver, Peter; Vadstein, Olav

    2014-01-01

    Detrimental host–pathogen interactions are a normal phenomenon in aquaculture animal production, and have been counteracted by prophylactic use of antibiotics. Especially, the youngest life stages of cultivated aquatic animals are susceptible to pathogen invasion, resulting in disease and mortality. To establish a more sustainable aquatic food production, there is a need for new microbial management strategies that focus on ‘join them' and not the traditional ‘beat them' approaches. We argue that ecological theory could serve as a foundation for developing sustainable microbial management methods that prevent pathogenic disease in larviculture. Management of the water microbiota in aquaculture systems according to ecological selection principles has been shown to decrease opportunistic pathogen pressure and to result in an improved performance of the cultured animals. We hypothesize that manipulation of the biodiversity of the gut microbiota can increase the host's resistance against pathogenic invasion and infection. However, substantial barriers need to be overcome before active management of the intestinal microbiota can effectively be applied in larviculture. PMID:24892581

  16. Fusarium proliferatum isolated from garlic in Spain: identification, toxigenic potential and pathogenicity on related Allium species

    Directory of Open Access Journals (Sweden)

    Daniel PALMERO

    2012-05-01

    Full Text Available Fusarium proliferatum has been reported on garlic in the Northwest USA, Spain and Serbia, causing water-soaked tan-colored lesions on cloves. In this work, Fusarium proliferatum was isolated from 300 symptomatic garlic bulbs. Morphological identification of Fusarium was confirmed using species-specific PCR assays and EF-1α sequencing. Confirmation of pathogenicity was conducted with eighteen isolates. Six randomly selected F. proliferatum isolates from garlic were tested for specific pathogenicity and screened for fusaric acid production. Additionally, pathogenicity of each F. proliferatum isolate was tested on healthy seedlings of onion (Allium cepa, leek (A. porrum, scallions (A. fistulosum, chives (A. schoenoprasum and garlic (A. sativum. A disease severity index (DSI was calculated as the mean severity on three plants of each species with four test replicates. Symptoms on onion and garlic plants were observed three weeks after inoculation. All isolates tested produced symptoms on all varieties inoculated. Inoculation of F. proliferatum isolates from diseased garlic onto other Allium species provided new information on host range and pathogenicity. The results demonstrated differences in susceptibility with respect to host species and cultivar. The F. proliferatum isolates tested all produced fusaric acid (FA; correlations between FA production and isolate pathogenicity are discussed. Additionally, all isolates showed the presence of the FUM1 gene suggesting the ability of Spanish isolates to produce fumonisins.

  17. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

    Science.gov (United States)

    Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

    2017-12-22

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

  18. Generation of Reactive Oxygen Species via NOXa Is Important for Development and Pathogenicity of Mycosphaerella graminicola.

    Science.gov (United States)

    Choi, Yoon-E; Lee, Changsu; Goodwin, Stephen B

    2016-03-01

    The ascomycete fungus Mycosphaerella graminicola (synonym Zymoseptoria tritici) is an important pathogen of wheat causing economically significant losses. The primary nutritional mode of this fungus is thought to be hemibiotrophic. This pathogenic lifestyle is associated with an early biotrophic stage of nutrient uptake followed by a necrotrophic stage aided possibly by production of a toxin or reactive oxygen species (ROS). In many other fungi, the genes CREA and AREA are important during the biotrophic stage of infection, while the NOXa gene product is important during necrotrophic growth. To test the hypothesis that these genes are important for pathogenicity of M. graminicola, we employed an over-expression strategy for the selected target genes CREA, AREA, and NOXa, which might function as regulators of nutrient acquisition or ROS generation. Increased expressions of CREA, AREA, and NOXa in M. graminicola were confirmed via quantitative real-time PCR and strains were subsequently assayed for pathogenicity. Among them, the NOXa over-expression strain, NO2, resulted in significantly increased virulence. Moreover, instead of the usual filamentous growth, we observed a predominance of yeast-like growth of NO2 which was correlated with ROS production. Our data indicate that ROS generation via NOXa is important to pathogenicity as well as development in M. graminicola.

  19. A fungal pathogen of amphibians, Batrachochytrium dendrobatidis, attenuates in pathogenicity with in vitro passages.

    Science.gov (United States)

    Langhammer, Penny F; Lips, Karen R; Burrowes, Patricia A; Tunstall, Tate; Palmer, Crystal M; Collins, James P

    2013-01-01

    Laboratory investigations into the amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd), have accelerated recently, given the pathogen's role in causing the global decline and extinction of amphibians. Studies in which host animals were exposed to Bd have largely assumed that lab-maintained pathogen cultures retained the infective and pathogenic properties of wild isolates. Attenuated pathogenicity is common in artificially maintained cultures of other pathogenic fungi, but to date, it is unknown whether, and to what degree, Bd might change in culture. We compared zoospore production over time in two samples of a single Bd isolate having different passage histories: one maintained in artificial media for more than six years (JEL427-P39), and one recently thawed from cryopreserved stock (JEL427-P9). In a common garden experiment, we then exposed two different amphibian species, Eleutherodactylus coqui and Atelopus zeteki, to both cultures to test whether Bd attenuates in pathogenicity with in vitro passages. The culture with the shorter passage history, JEL427-P9, had significantly greater zoospore densities over time compared to JEL427-P39. This difference in zoospore production was associated with a difference in pathogenicity for a susceptible amphibian species, indicating that fecundity may be an important virulence factor for Bd. In the 130-day experiment, Atelopus zeteki frogs exposed to the JEL427-P9 culture experienced higher average infection intensity and 100% mortality, compared with 60% mortality for frogs exposed to JEL427-P39. This effect was not observed with Eleutherodactylus coqui, which was able to clear infection. We hypothesize that the differences in phenotypic performance observed with Atelopus zeteki are rooted in changes of the Bd genome. Future investigations enabled by this study will focus on the underlying mechanisms of Bd pathogenicity.

  20. A fungal pathogen of amphibians, Batrachochytrium dendrobatidis, attenuates in pathogenicity with in vitro passages.

    Directory of Open Access Journals (Sweden)

    Penny F Langhammer

    Full Text Available Laboratory investigations into the amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd, have accelerated recently, given the pathogen's role in causing the global decline and extinction of amphibians. Studies in which host animals were exposed to Bd have largely assumed that lab-maintained pathogen cultures retained the infective and pathogenic properties of wild isolates. Attenuated pathogenicity is common in artificially maintained cultures of other pathogenic fungi, but to date, it is unknown whether, and to what degree, Bd might change in culture. We compared zoospore production over time in two samples of a single Bd isolate having different passage histories: one maintained in artificial media for more than six years (JEL427-P39, and one recently thawed from cryopreserved stock (JEL427-P9. In a common garden experiment, we then exposed two different amphibian species, Eleutherodactylus coqui and Atelopus zeteki, to both cultures to test whether Bd attenuates in pathogenicity with in vitro passages. The culture with the shorter passage history, JEL427-P9, had significantly greater zoospore densities over time compared to JEL427-P39. This difference in zoospore production was associated with a difference in pathogenicity for a susceptible amphibian species, indicating that fecundity may be an important virulence factor for Bd. In the 130-day experiment, Atelopus zeteki frogs exposed to the JEL427-P9 culture experienced higher average infection intensity and 100% mortality, compared with 60% mortality for frogs exposed to JEL427-P39. This effect was not observed with Eleutherodactylus coqui, which was able to clear infection. We hypothesize that the differences in phenotypic performance observed with Atelopus zeteki are rooted in changes of the Bd genome. Future investigations enabled by this study will focus on the underlying mechanisms of Bd pathogenicity.

  1. Lipids in host-pathogen interactions: pathogens exploit the complexity of the host cell lipidome.

    Science.gov (United States)

    van der Meer-Janssen, Ynske P M; van Galen, Josse; Batenburg, Joseph J; Helms, J Bernd

    2010-01-01

    Lipids were long believed to have a structural role in biomembranes and a role in energy storage utilizing cellular lipid droplets and plasma lipoproteins. Research over the last decades has identified an additional role of lipids in cellular signaling, membrane microdomain organization and dynamics, and membrane trafficking. These properties make lipids an attractive target for pathogens to modulate host cell processes in order to allow their survival and replication. In this review we will summarize the often ingenious strategies of pathogens to modify the lipid homeostasis of host cells, allowing them to divert cellular processes. To this end pathogens take full advantage of the complexity of the lipidome. The examples are categorized in generalized and emerging principles describing the involvement of lipids in host-pathogen interactions. Several pathogens are described that simultaneously induce multiple changes in the host cell signaling and trafficking mechanisms. Elucidation of these pathogen-induced changes may have important implications for drug development. The emergence of high-throughput lipidomic techniques will allow the description of changes of the host cell lipidome at the level of individual molecular lipid species and the identification of lipid biomarkers.

  2. A New Selectable Marker System for Genetic Studies of Bacteria: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Parsons, D; Tolmasky, M; Chain, P; Segelke, B W

    2011-03-18

    Genetic manipulations in bacteria currently rely on the introduction of antibiotic resistance genes into a bacterial strain; for those organisms that will be used for commercial or industrial applications, the genetic cassette encoding the antibiotic resistance is sometimes removed after selection. it is clear that if alternative technologies could obviate the need to introduce antibiotic resistance into bacteria, they would most certainly become a standard tool in molecular micriobiology for commercial, industrial as well as research applications. Here, they present the development of a novel genetic engineering technology based on toxin-antitoxin systems to modify bacterial genomes without the use of antibiotic resistance in the mutagenesis process. The primary goal is to develop antibiotic-free selection for genetically altered select agent pathogens. They are adapting the toxinc-antitoxin system to enable gene replacement in select agent pathogens since the NIH restrictions introducing antibiotic resistance into select agent pathogens have hindered research with select agent pathogens.

  3. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff.

    Science.gov (United States)

    Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A

    2010-01-01

    Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.

  4. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff

    Science.gov (United States)

    Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.

    2009-01-01

    Although protected for nearly a century, California’s sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009

  5. High throughput sequencing and proteomics to identify immunogenic proteins of a new pathogen: the dirty genome approach.

    Science.gov (United States)

    Greub, Gilbert; Kebbi-Beghdadi, Carole; Bertelli, Claire; Collyn, François; Riederer, Beat M; Yersin, Camille; Croxatto, Antony; Raoult, Didier

    2009-12-23

    With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.

  6. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  7. Bacteriophage interactions with marine pathogenic Vibrios

    DEFF Research Database (Denmark)

    Kalatzis, Panagiotis

    development and spreading of antibiotic resistant bacteria in the environment. Bacteriophage therapy, constitutes a potent alternative not only for treatment but also for prevention of vibriosis in aquaculture and the current thesis addresses the potential and challenges of using phages to control Vibrio...... pathogens. The combinatory administration of virulent bacteriophages φSt2 and φGrn1, isolated against Vibrio alginolyticus significantly reduced the Vibrio load in cultures of Artemia salina live prey, decreasing subsequently the risk of a vibriosis outbreak in the marine hatchery. During infection...... therapy applications. Lytic phage vB_VspP_pVa5 that has been isolated against the rapidly emerging pathogen V. splendidus is also a promising candidate for phage therapy application according to its gene content and in vitro performance against its host. The genetic features of vB_VspP_pVa5 provide also...

  8. Susceptibility of Postharvest Pathogens to Esential Oils

    Directory of Open Access Journals (Sweden)

    Božik M.

    2017-09-01

    Full Text Available Antimicrobial volatile substances from plants represent alternatives to synthetic pesticides and food preservatives. In this study, the compositions of some essential oils were determined by gas chromatography with mass spectrometry, and the inhibitory properties of the essential oils and their components against the bacterial postharvest pathogens Pectobacterium carotovorum subsp. carotovorum (CCM 1008, Pseudomonas syringae (CCM 7018, Xanthomonas campestris (CCM 22 were determined by the microdilution method. Essential oils from oregano, cinnamon, lemongrass, lavender, clove, rosemary, tea tree, eucalyptus, garlic, and ginger and their components cinnamaldehyde, eugenol, thymol, and carvacrol were used in the tests. The essential oil components exhibited strong antibacterial activity against all tested bacteria. The oregano and cinnamon essential oils were most effective. The rosemary, lavender, tea tree, eucalyptus, garlic, and ginger oils were not effective at the tested concentrations. In conclusion, certain essential oils, particularly their components, are highly effective and could be used for the control of postharvest bacterial pathogens.

  9. Actinobaculum schaalii: A truly emerging pathogen?

    Science.gov (United States)

    Prigent, G.; Perillaud, C.; Amara, M.; Coutard, A.; Blanc, C.; Pangon, B.

    2016-01-01

    Actinobaculum schaalii is a Gram-positive facultative anaerobe bacillus. It is a commensal organism of the genitourinary tract. Its morphology is nonspecific. Aerobic culture is tedious, and identification techniques have long been inadequate. Thus, A. schaalii has often been considered as a nonpathogen bacterium or a contaminant. Its pathogenicity is now well described in urinary tract infections, and infections in other sites have been reported. This pathogen is considered as an emerging one following the growing use of mass spectrometry identification. In this context, the aim of our study was to evaluate the number of isolations of A. schaalii before and after the introduction of mass spectrometry in our hospital and to study the clinical circumstances in which isolates were found. PMID:27014462

  10. Main Concerns of Pathogenic Microorganisms in Meat

    Science.gov (United States)

    Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

    Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

  11. Plant pathology: monitoring a pathogen-targeted host protein.

    Science.gov (United States)

    Ellis, Jeff; Dodds, Peter

    2003-05-13

    A plant protein RIN4 is targeted and modified by bacterial pathogens as part of the disease process. At least two host resistance proteins monitor this pathogen interference and trigger the plant's defence responses.

  12. PHIDIAS- Pathogen Host Interaction Data Integration and Analysis

    Indian Academy of Sciences (India)

    PHIDIAS- Pathogen Host Interaction Data Integration and Analysis- allows searching of integrated genome sequences, conserved domains and gene expressions data related to pathogen host interactions in high priority agents for public health and security ...

  13. Isolation of antibiotic-resistant pathogenic and potentially ...

    African Journals Online (AJOL)

    2010-09-13

    Sep 13, 2010 ... The aim of the present study is to determine the pathogenic and potentially ... Keywords: pathogenic bacteria; antibiotic resistance; carpets; mosques; Tripoli; Libya .... During the process of praying, a Muslim is obliged to go.

  14. In vitro inhibition of pathogenic Verticillium dahliae, causal agent of ...

    African Journals Online (AJOL)

    SAM

    2014-08-13

    Aug 13, 2014 ... In addition, plant pathogens directly affected through antibiosis and ... Trichoderma strains for antagonistic activity on the fungal pathogen V. ... Five soil sub samples were taken from the area around the healthy potato roots ...

  15. Biocontrol interventions for inactivation of foodborne pathogens on produce

    Science.gov (United States)

    Post-harvest interventions for control of foodborne pathogens on minimally processed foods are crucial for food safety. Biocontrol interventions have the primary objective of developing novel antagonists in combinations with physical and chemical interventions to inactivate pathogenic microbes. Ther...

  16. Childhood urinary tract infection in Benin City: pathogens and ...

    African Journals Online (AJOL)

    Childhood urinary tract infection in Benin City: pathogens and antimicrobial ... of bacterial isolates implicated in urinary tract infection (UTI) amongst children was ... There is also an emerging resistance of common pathogens to azithromycin ...

  17. Swainsonine biosynthesis genes in diverse symbiotic and pathogenic fungi

    Science.gov (United States)

    Swainsonine, a cytotoxic fungal alkaloid and a potential cancer therapy drug, is produced by the insect pathogen and plant symbiont, Metarhizium robertsii, the clover pathogen Slafractonia leguminicola, locoweed symbionts belonging to Alternaria sect. Undifilum, and a recently discovered morning glo...

  18. Potential for Combined Biocontrol Activity against Fungal Fish and Plant Pathogens by Bacterial Isolates from a Model Aquaponic System

    Directory of Open Access Journals (Sweden)

    Ivaylo Sirakov

    2016-11-01

    Full Text Available One of the main challenges in aquaponics is disease control. One possible solution for this is biological control with organisms exerting inhibitory effects on fish and plant pathogens. The aim of this study was to examine the potential of isolating microorganisms that exert an inhibitory effect on both plant and fish pathogens from an established aquaponic system. We obtained 924 isolates on selective King’s B agar and 101 isolates on MRS agar from different compartments of a model aquaponic system and tested them for antagonism against the plant pathogen Pythium ultimum and fish pathogen Saprolegnia parasitica. Overall, 42 isolates were able to inhibit both fungi. Although not yet tested in vivo, these findings open new options for the implementation of biological control of diseases in aquaponics, where plants and fish are cultivated in the same water recirculating system.

  19. Carp erythrodermatitis : host defense-pathogen interaction

    OpenAIRE

    Pourreau, C.N.

    1990-01-01

    The outcome of a bacterial infection depends on the interaction between pathogen and host. The ability of the microbe to survive in the host depends on its invasive potential (i.e. spreading and multiplication), and its ability to obtain essential nutrients and to resist the host's defense system. On the other hand, the host's resistance to a bacterial attack depends on its physiological state, the intensity of the bacterial attack and the efficacy of the defense system to ...

  20. Occurrence of antimicrobial resistance among bacterial pathogens

    OpenAIRE

    Hendriksen, Rene S.; Mevius, Dik J.; Schroeter, Andreas; Teale, Christopher; Jouy, Eric; Butaye, Patrick; Franco, Alessia; Utinane, Andra; Amado, Alice; Moreno, Miguel; Greko, Christina; Stärk, Katharina D.C.; Berghold, Christian; Myllyniemi, Anna-Liisa; Hoszowski, Andrzej

    2008-01-01

    Background: The project "Antibiotic resistance in bacteria of animal origin – II" (ARBAO-II) was funded by the European Union (FAIR5-QLK2-2002-01146) for the period 2003–05. The aim of this project was to establish a program for the continuous monitoring of antimicrobial susceptibility of pathogenic and indicator bacteria from food animals using validated and harmonised methodologies. In this report the first data on the occurrence of antimicrobial resistance among bacteria cau...

  1. Pathogenic and opportunistic microorganisms in caves

    Directory of Open Access Journals (Sweden)

    Sanchez-Moral Sergio

    2010-01-01

    Full Text Available With today’s leisure tourism, the frequency of visits to many caves makes it necessary to know about possible potentially pathogenic microorganisms in caves, determine their reservoirs, and inform the public about the consequences of such visits. Our data reveal that caves could be a potential danger to visitors because of the presence of opportunistic microorganisms, whose existence and possible development in humans is currently unknown.

  2. Swiss Army Pathogen: The Salmonella Entry Toolkit

    Directory of Open Access Journals (Sweden)

    Peter J. Hume

    2017-08-01

    Full Text Available Salmonella causes disease in humans and animals ranging from mild self-limiting gastroenteritis to potentially life-threatening typhoid fever. Salmonellosis remains a considerable cause of morbidity and mortality globally, and hence imposes a huge socio-economic burden worldwide. A key property of all pathogenic Salmonella strains is the ability to invade non-phagocytic host cells. The major determinant of this invasiveness is a Type 3 Secretion System (T3SS, a molecular syringe that injects virulence effector proteins directly into target host cells. These effectors cooperatively manipulate multiple host cell signaling pathways to drive pathogen internalization. Salmonella does not only rely on these injected effectors, but also uses several other T3SS-independent mechanisms to gain entry into host cells. This review summarizes our current understanding of the methods used by Salmonella for cell invasion, with a focus on the host signaling networks that must be coordinately exploited for the pathogen to achieve its goal.

  3. Clostridium difficile is an autotrophic bacterial pathogen.

    Directory of Open Access Journals (Sweden)

    Michael Köpke

    Full Text Available During the last decade, Clostridium difficile infection showed a dramatic increase in incidence and virulence in the Northern hemisphere. This incessantly challenging disease is the leading cause of antibiotic-associated and nosocomial infectious diarrhea and became life-threatening especially among elderly people. It is generally assumed that all human bacterial pathogens are heterotrophic organisms, being either saccharolytic or proteolytic. So far, this has not been questioned as colonization of the human gut gives access to an environment, rich in organic nutrients. Here, we present data that C. difficile (both clinical and rumen isolates is also able to grow on CO2+H2 as sole carbon and energy source, thus representing the first identified autotrophic bacterial pathogen. Comparison of several different strains revealed high conservation of genes for autotrophic growth and showed that the ability to use gas mixtures for growth decreases or is lost upon prolonged culturing under heterotrophic conditions. The metabolic flexibility of C. difficile (heterotrophic growth on various substrates as well as autotrophy could allow the organism in the gut to avoid competition by niche differentiation and contribute to its survival when stressed or in unfavorable conditions that cause death to other bacteria. This may be an important trait for the pathogenicity of C. difficile.

  4. Host-pathogen interplay of Haemophilus ducreyi.

    Science.gov (United States)

    Janowicz, Diane M; Li, Wei; Bauer, Margaret E

    2010-02-01

    Haemophilus ducreyi, the causative agent of the sexually transmitted infection chancroid, is primarily a pathogen of human skin. During infection, H. ducreyi thrives extracellularly in a milieu of professional phagocytes and other antibacterial components of the innate and adaptive immune responses. This review summarizes our understanding of the interplay between this pathogen and its host that leads to development and persistence of disease. H. ducreyi expresses key virulence mechanisms to resist host defenses. The secreted LspA proteins are tyrosine-phosphorylated by host kinases, which may contribute to their antiphagocytic effector function. The serum resistance and adherence functions of DsrA map to separate domains of this multifunctional virulence factor. An influx transporter protects H. ducreyi from killing by the antimicrobial peptide LL37. Regulatory genes have been identified that may coordinate virulence factor expression during disease. Dendritic cells and natural killer cells respond to H. ducreyi and may be involved in determining the differential outcomes of infection observed in humans. A human model of H. ducreyi infection has provided insights into virulence mechanisms that allow this human-specific pathogen to survive immune pressures. Components of the human innate immune system may also determine the ultimate fate of H. ducreyi infection by driving either clearance of the organism or an ineffective response that allows disease progression.

  5. Combinatorial stresses kill pathogenic Candida species

    Science.gov (United States)

    Kaloriti, Despoina; Tillmann, Anna; Cook, Emily; Jacobsen, Mette; You, Tao; Lenardon, Megan; Ames, Lauren; Barahona, Mauricio; Chandrasekaran, Komelapriya; Coghill, George; Goodman, Daniel; Gow, Neil A. R.; Grebogi, Celso; Ho, Hsueh-Lui; Ingram, Piers; McDonagh, Andrew; De Moura, Alessandro P. S.; Pang, Wei; Puttnam, Melanie; Radmaneshfar, Elahe; Romano, Maria Carmen; Silk, Daniel; Stark, Jaroslav; Stumpf, Michael; Thiel, Marco; Thorne, Thomas; Usher, Jane; Yin, Zhikang; Haynes, Ken; Brown, Alistair J. P.

    2012-01-01

    Pathogenic microbes exist in dynamic niches and have evolved robust adaptive responses to promote survival in their hosts. The major fungal pathogens of humans, Candida albicans and Candida glabrata, are exposed to a range of environmental stresses in their hosts including osmotic, oxidative and nitrosative stresses. Significant efforts have been devoted to the characterization of the adaptive responses to each of these stresses. In the wild, cells are frequently exposed simultaneously to combinations of these stresses and yet the effects of such combinatorial stresses have not been explored. We have developed a common experimental platform to facilitate the comparison of combinatorial stress responses in C. glabrata and C. albicans. This platform is based on the growth of cells in buffered rich medium at 30°C, and was used to define relatively low, medium and high doses of osmotic (NaCl), oxidative (H 2O2) and nitrosative stresses (e.g., dipropylenetriamine (DPTA)-NONOate). The effects of combinatorial stresses were compared with the corresponding individual stresses under these growth conditions. We show for the first time that certain combinations of combinatorial stress are especially potent in terms of their ability to kill C. albicans and C. glabrata and/or inhibit their growth. This was the case for combinations of osmotic plus oxidative stress and for oxidative plus nitrosative stress. We predict that combinatorial stresses may be highly signif cant in host defences against these pathogenic yeasts. PMID:22463109

  6. The Venturia Apple Pathosystem: Pathogenicity Mechanisms and Plant Defense Responses

    Directory of Open Access Journals (Sweden)

    Gopaljee Jha

    2009-01-01

    Full Text Available Venturia inaequalis is the causal agent of apple scab, a devastating disease of apple. We outline several unique features of this pathogen which are useful for molecular genetics studies intended to understand plant-pathogen interactions. The pathogenicity mechanisms of the pathogen and overview of apple defense responses, monogenic and polygenic resistance, and their utilization in scab resistance breeding programs are also reviewed.

  7. Phosphorylation and proteome dynamics in pathogen-resistant tomato plants

    OpenAIRE

    Stulemeijer, I.J.E.

    2008-01-01

    Microbial plant pathogens impose a continuous threat on global food production. Similar to disease resistance in mammals, an innate immune system allows plants to recognise pathogens and swiftly activate defence. For the work described in this thesis, the interaction between tomato and the extracellular fungal pathogen Cladosporium fulvum serves as a model system to study host resistance and susceptibility in plant-pathogen interactions. Resistance to C. fulvum in tomato plants follows the ge...

  8. Host-pathogen interactions: A cholera surveillance system

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Aaron T.

    2016-02-22

    Bacterial pathogen-secreted proteases may play a key role in inhibiting a potentially widespread host-pathogen interaction. Activity-based protein profiling enabled the identification of a major Vibrio cholerae serine protease that limits the ability of a host-derived intestinal lectin to bind to the bacterial pathogen in vivo.

  9. Comparison of procedures to evaluate the pathogenicity of ...

    African Journals Online (AJOL)

    Ceratocystis fimbriata sensu lato(s.l.) is an important pathogen of Eucalyptus. Pathogenicity of isolates has typically been evaluated by inoculating seedlings under greenhouse conditions. It is, however, not clear how accurately this reflects pathogenicity under field conditions. In this study, five techniques to potentially ...

  10. Selective oxidation

    International Nuclear Information System (INIS)

    Cortes Henao, Luis F.; Castro F, Carlos A.

    2000-01-01

    It is presented a revision and discussion about the characteristics and factors that relate activity and selectivity in the catalytic and not catalytic partial oxidation of methane and the effect of variables as the temperature, pressure and others in the methane conversion to methanol. It thinks about the zeolites use modified for the catalytic oxidation of natural gas

  11. Selective gossip

    NARCIS (Netherlands)

    Üstebay, D.; Castro, R.M.; Rabbat, M.

    2009-01-01

    Motivated by applications in compression and distributed transform coding, we propose a new gossip algorithm called Selective Gossip to efficiently compute sparse approximations of network data. We consider running parallel gossip algorithms on the elements of a vector of transform coefficients.

  12. In vitro studies on medicinal plants used against bacterial diabetic foot ulcer (BDFU) and urinary tract infected (UTI) causing pathogens.

    Science.gov (United States)

    Subbu Lakshmi, S; Chelladurai, G; Suresh, B

    2016-09-01

    The pus samples from diabetic foot ulcer patients and urine samples from urinary tract infected patients were collected and inoculated in nutrient agar plates. The colonies showing different morphologies were streaked on selective agar plates. The antibacterial assay of selected commercial antibiotics was tested against the foot ulcer and urinary tract isolates. The result revealed that most of the organisms were found to be resistant against the antibiotics. Screening of antibacterial activity of selected plants, methanol extracts of plants were prepared and tested against foot ulcer pathogens. Among the plants used, the methanolic extract Tragia involucrata was very effective against the foot ulcer pathogens and to separate the compounds present in the methanolic extract of T. involucrata, when it was subjected to column chromatography. The fractions obtained were further checked for their antibacterial property and fraction 1 which inhibited the pathogens, were subjected to thin layer chromatography and the structure of the particular phytochemical compound was elucidated by NMR study. The spices were tested for their antibacterial property against the urinary tract pathogens. Among the spices tested; Allium sativum inhibited the growth of the pathogens isolated from urinary tract infection. It can be concluded that the plants extract can be used to discover natural products that may serve as lead for the development of new pharmaceuticals addressing the major therapeutic needs.

  13. Intervention strategies for control of foodborne pathogens

    Science.gov (United States)

    Juneja, Vijay K.

    2004-03-01

    The increasing numbers of illnesses associated with foodborne pathogens such as Listeria monocytogenes and Escherichia coli O157:H7, has renewed concerns about food safety because of consumer preferences for minimally processed foods that offer convenience in availability and preparation. Accordingly, the need for better control of foodborne pathogens has been paramount in recent years. Mechanical removal of microorganisms from food can be accomplished by centrifugation, filtration, trimming and washing. Cleaning and sanitation strategies can be used for minimizing the access of microorganisms in foods from various sources. Other strategies for control of foodborne pathogens include established physical microbiocidal treatments such as ionizing radiation and heating. Research has continued to demonstrate that food irradiation is a suitable process to control and possibly eliminate foodborne pathogens, for example Listeria monocytogenes and Escherichia coli O157:H7, from a number of raw and cooked meat and poultry products. Heat treatment is the most common method in use today for the inactivation of microorganisms. Microorganisms can also be destroyed by nonthermal treatments, such as application of high hydrostatic pressure, pulsed electric fields, oscillating magnetic fields or a combination of physical processes such as heat-irradiation, or heat-high hydrostatic pressure, etc. Each of the non-thermal technologies has specific applications in terms of the types of food that can be processed. Both conventional and newly developed physical treatments can be used in combination for controlling foodborne pathogens and enhancing the safety and shelf life of foods. Recent research has focused on combining traditional preservation factors with emerging intervention technologies. However, many key issues still need to be addressed for combination preservation factors or technologies to be useful in the food industry to meet public demands for foods with enhanced safety

  14. Computational analyses of an evolutionary arms race between mammalian immunity mediated by immunoglobulin A and its subversion by bacterial pathogens.

    Directory of Open Access Journals (Sweden)

    Ana Pinheiro

    Full Text Available IgA is the predominant immunoglobulin isotype in mucosal tissues and external secretions, playing important roles both in defense against pathogens and in maintenance of commensal microbiota. Considering the complexity of its interactions with the surrounding environment, IgA is a likely target for diversifying or positive selection. To investigate this possibility, the action of natural selection on IgA was examined in depth with six different methods: CODEML from the PAML package and the SLAC, FEL, REL, MEME and FUBAR methods implemented in the Datamonkey webserver. In considering just primate IgA, these analyses show that diversifying selection targeted five positions of the Cα1 and Cα2 domains of IgA. Extending the analysis to include other mammals identified 18 positively selected sites: ten in Cα1, five in Cα2 and three in Cα3. All but one of these positions display variation in polarity and charge. Their structural locations suggest they indirectly influence the conformation of sites on IgA that are critical for interaction with host IgA receptors and also with proteins produced by mucosal pathogens that prevent their elimination by IgA-mediated effector mechanisms. Demonstrating the plasticity of IgA in the evolution of different groups of mammals, only two of the eighteen selected positions in all mammals are included in the five selected positions in primates. That IgA residues subject to positive selection impact sites targeted both by host receptors and subversive pathogen ligands highlights the evolutionary arms race playing out between mammals and pathogens, and further emphasizes the importance of IgA in protection against mucosal pathogens.

  15. Mycological assessment of sediments in Ligurian beaches in the Northwestern Mediterranean: pathogens and opportunistic pathogens.

    Science.gov (United States)

    Salvo, Vanessa-Sarah; Fabiano, Mauro

    2007-05-01

    Sediments of five Ligurian beaches in compliance with European Union bathing water regulations were studied based on the characteristics of the fungal assemblage during the tourism season. Among the 179 taxa of filamentous fungi isolated, 120 were opportunistic pathogens, such as Acremonium sp., and the genus Penicillium was also present as the pathogenic species P. citrinum. Furthermore, 5% of the total filamentous fungi belonged to the dermatophyte genus Microsporum, whose species can cause mycoses. Beach sediments showed elevated densities of opportunistic pathogens, of pathogenic filamentous fungi, and of yeasts during the tourism season. Although monitoring of beach sediments for microbiological contamination is not mandatory, and disease transmission from sediments has not yet been demonstrated, our study suggests that beach sediments may act as a reservoir of potential pathogens, including fungi. In addition, the mycoflora displayed high sensitivity to critical environmental situations in the beaches studied. Therefore, the fungal community can be a useful tool for assessing the quality of sandy beaches in terms of sanitary and environmental quality.

  16. Phylogeographic Diversity of Pathogenic and Non-Pathogenic Hantaviruses in Slovenia

    Science.gov (United States)

    Korva, Miša; Knap, Nataša; Resman Rus, Katarina; Fajs, Luka; Grubelnik, Gašper; Bremec, Matejka; Knapič, Tea; Trilar, Tomi; Avšič Županc, Tatjana

    2013-01-01

    Slovenia is a very diverse country from a natural geography point of view, with many different habitats within a relatively small area, in addition to major geological and climatic differences. It is therefore not surprising that several small mammal species have been confirmed to harbour hantaviruses: A. flavicollis (Dobrava virus), A. agrarius (Dobrava virus–Kurkino), M. glareolus (Puumala virus), S. areanus (Seewis virus), M. agrestis, M. arvalis and M. subterraneus (Tula virus). Three of the viruses, namely the Dobrava, Dobrava–Kurkino and Puumala viruses, cause disease in humans, with significant differences in the severity of symptoms. Due to changes in haemorrhagic fever with renal syndrome cases (HFRS) epidemiology, a detailed study on phylogenetic diversity and molecular epidemiology of pathogenic and non-pathogenic hantaviruses circulating in ecologically diverse endemic regions was performed. The study presents one of the largest collections of hantavirus L, M and S sequences obtained from hosts and patients within a single country. Several genetic lineages were determined for each hantavirus species, with higher diversity among non-pathogenic compared to pathogenic viruses. For pathogenic hantaviruses, a significant geographic clustering of human- and rodent-derived sequences was confirmed. Several geographic and ecological factors were recognized as influencing and limiting the formation of endemic areas. PMID:24335778

  17. Effective but costly, evolved mechanisms of defense against a virulent opportunistic pathogen in Drosophila melanogaster.

    OpenAIRE

    Yixin H Ye; Stephen F Chenoweth; Elizabeth A McGraw

    2009-01-01

    Drosophila harbor substantial genetic variation for antibacterial defense, and investment in immunity is thought to involve a costly trade-off with life history traits, including development, life span, and reproduction. To understand the way in which insects invest in fighting bacterial infection, we selected for survival following systemic infection with the opportunistic pathogen Pseudomonas aeruginosa in wild-caught Drosophila melanogaster over 10 generations. We then examined genome-wide...

  18. The effect of pathogens and pests on honey bee gene expression

    OpenAIRE

    Navajas Navarro, Maria; Martin, Jean-François; Le Conte, Yves; Queen's University Belfast

    2008-01-01

    The effect of pathogens and pests on honey bee gene expression is a fascinating area of research in itself and can lead to new molecular tools for diagnostics and selection in beekeeping. In this framework, we first investigated Varroa-bee interactions by using a combination of nuc1ear and mitochondrial DNA markers of Varroa destructor to trace the parasite invasion of Apis mellifera since it shifted from A. cerana. The extremely low worldwide mite genetic diversity found on A. ...

  19. Occurrence and antibacterial susceptibility pattern of bacterial pathogens isolated from diarrheal patients in Pakistan

    Directory of Open Access Journals (Sweden)

    Muhammad H. Rasool

    2016-03-01

    Full Text Available Objective: To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. Methods: This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural characteristics, microscopy, and biochemical tests. Disc diffusion assay was carried out using Muller Hinton agar medium, and minimum inhibitory concentration was determined using broth dilution method against isolated pathogens. Results: One hundred and forty-one (100% samples were positive for some bacteria. Frequency of occurrence was Bacillus cereus (B. cereus (66%, Escherichia coli (E. coli (48.5%, Salmonella typhi (S. Typhi (27.7%, Pseudomonas aeruginosa (P. aeruginosa (8.5%, and Staphylococcus aureus (S. aureus (4.3%. Single pathogen was detected in 20 (14.2% samples whereas combinations were found in 121 (85.8% samples. Bacillus cereus and E. coli were the most frequently detected pathogens followed by the S. Typhi, P. aeruginosa, and Staph. aureus. The percentage occurrence of isolated pathogens was 31% in B. cereus, 31% in E. coli, 18% in S. Typhi, 5% in P. aeruginosa, and 3% in Staph. aureus. Conclusion: Pseudomonas aeruginosa showed resistance against Amoxicillin and Cefotaxime, whereas S. aureus was found resistant against Cefotaxime. Statistical analysis using one way Analysis of Variance revealed that Ofloxacin and Gentamicin had significant (p<0.05 differences against all isolates as compared with other antibiotics used in this study.

  20. The Impact of Recombination Hotspots on Genome Evolution of a Fungal Plant Pathogen.

    Science.gov (United States)

    Croll, Daniel; Lendenmann, Mark H; Stewart, Ethan; McDonald, Bruce A

    2015-11-01

    Recombination has an impact on genome evolution by maintaining chromosomal integrity, affecting the efficacy of selection, and increasing genetic variability in populations. Recombination rates are a key determinant of the coevolutionary dynamics between hosts and their pathogens. Historic recombination events created devastating new pathogens, but the impact of ongoing recombination in sexual pathogens is poorly understood. Many fungal pathogens of plants undergo regular sexual cycles, and sex is considered to be a major factor contributing to virulence. We generated a recombination map at kilobase-scale resolution for the haploid plant pathogenic fungus Zymoseptoria tritici. To account for intraspecific variation in recombination rates, we constructed genetic maps from two independent crosses. We localized a total of 10,287 crossover events in 441 progeny and found that recombination rates were highly heterogeneous within and among chromosomes. Recombination rates on large chromosomes were inversely correlated with chromosome length. Short accessory chromosomes often lacked evidence for crossovers between parental chromosomes. Recombination was concentrated in narrow hotspots that were preferentially located close to telomeres. Hotspots were only partially conserved between the two crosses, suggesting that hotspots are short-lived and may vary according to genomic background. Genes located in hotspot regions were enriched in genes encoding secreted proteins. Population resequencing showed that chromosomal regions with high recombination rates were strongly correlated with regions of low linkage disequilibrium. Hence, genes in pathogen recombination hotspots are likely to evolve faster in natural populations and may represent a greater threat to the host. Copyright © 2015 by the Genetics Society of America.