OSHA Bloodborne Pathogens Standards Exposure Control Plan
Luhrs, Caro Elise; Teitelbaum, Rita
1993-01-01
The Hummer Associates Exposure Control Plan is designed to reduce significant occupational exposure to bloodborne pathogens and infectious materials for Hummer Associates health care personnel. Under universal precautions, all patients and all body fluids are considered potentially infectious for bloodborne pathogens. Medical personnel need not be at increased risk if universal precautions are correctly understood and followed. This program covers all employees who could reasonably anticipate contact with blood or other potentially infectious materials during the performance of their job responsibilities. Although HIV and hepatitis B are mentioned most often, this program applies to all bloodborne diseases. The two main components needed to implement this program are universal precautions and engineering/work practice controls. This program covers all employees who may have occupational exposure to blood or other potentially infectious materials. Other aspects of this program are discussed.
Exposure Control--OSHA's Bloodborne Pathogens Standard.
Granville, Mark F.
1993-01-01
Explains schools' responsibilities in complying with the Occupational Safety and Health Administration's (OSHA) Bloodborne Pathogens Standard. Describes exposure determination plan, protective equipment, housekeeping practices, labeling of waste, training employees, hepatitis B vaccinations, postexposure evaluation and medical follow-up, and…
Risk of bloodborne pathogen exposure among Zambian healthcare workers
Directory of Open Access Journals (Sweden)
Elayne Kornblatt Phillips
2012-06-01
Full Text Available Purpose: Understanding the risks of bloodborne pathogen transmission is fundamental to prioritizing interventions when resources are limited. This study investigated the risks to healthcare workers in Zambia. Design: A survey was completed anonymously by a convenience sample of workers in three hospitals and two clinics in Zambia. Respondents provided information regarding job category, injuries with contaminated sharps, hepatitis B vaccination status and the availability of HIV post-exposure prophylaxis (PEP. Results: Nurses reported the largest number of injuries. The average annual sharps injury rate was 1.3 injuries per worker, and service workers (housekeepers, laundry, ward assistants had the highest rate of these injuries, 1.9 per year. Injuries were often related to inadequate disposal methods. Syringe needles accounted for the largest proportion of injuries (60%, and 15% of these injuries were related to procedures with a higher-than-average risk for infection. Most workers (88% reported the availability of PEP, and only 8% were fully vaccinated against hepatitis B. Conclusions: The injury risks identified among Zambian workers are serious and are exacerbated by the high prevalence of bloodborne pathogens in the population. This suggests that there is a high risk of occupationally acquired bloodborne pathogen infection. The findings also highlight the need for a hepatitis B vaccination program focused on healthcare workers. The risks associated with bloodborne pathogens threaten to further diminish an already scarce resource in Zambia – trained healthcare workers. To decrease these risks, we suggest the use of low-cost disposal alternatives, the implementation of cost-sensitive protective strategies and the re-allocation of some treatment resources to primary prevention. Keywords: Healthcare worker safety, Zambian healthcare workers, Bloodborne pathogen transmission, Sharps injury prevention, Infectious diseases
Planning for compliance: OSHA's bloodborne pathogen rule.
Bednar, B; Duke, M C
1990-11-01
Overall, the bloodborne pathogen rule constitutes a reasonable response to a significant threat to workplace safety. The risks to dialysis workers from HBV and HIV must be minimized or eliminated and the rule is generally consistent with the consensus approach. Unfortunately for dialysis providers, the rule is not exempt from the law of unintended consequences: government regulation will always have impact beyond its object. Promulgation of the final rule will immediately increase the expenses of dialysis providers. Additionally, the enormity of the HBV and HIV problem coupled with the open-ended nature of the rule's key provisions will almost certainly bring additional costs. So long as dialysis reimbursement remains flat, the unintended consequence of the bloodborne pathogen rule may be to quicken the pace of consolidation in the dialysis service market. The added burden of compliance may be too much for small independent facilities. Only large chains may have the resources to comply and survive. To forestall this effect and to provide employees with maximum protection, all dialysis providers should plan now for compliance.
Protecting Adults and Children from Blood-Borne Pathogens.
Freeman, Nancy K.; Corning, Lisa L.
2000-01-01
Recommends universal precautions policies and procedures to minimize for children and adults in early childhood settings the risk of infection from exposure to blood-borne pathogens such as hepatitis B or HIV. Outlines symptoms of hepatitis B and HIV/AIDS. Discusses legal and ethical implications related to inclusion. Lists resources for teachers…
White, C L
1992-04-01
A new standard set forth by the Occupational Safety and Health Administration (OSHA) requires healthcare employers to implement sweeping new controls in areas such as record keeping, engineering, hazard prevention, and work practice. Through the bloodborne pathogen standard, which went into effect on March 6, OSHA acknowledges that healthcare workers face significant health risks as a result of occupational exposure to blood and other infectious materials. Although most prudent healthcare providers already adhere to the Centers for Disease Control's universal precautions, the OSHA regulations include several additional mandatory measures that are more specific and stringent. The additional measures include the development of an exposure control plan, procedures for responding to an employee's exposure to bloodborne pathogens, the implementation of certain engineering and work practice controls to eliminate or minimize on-the-job exposure risks, and the provision of personal protective equipment and information and training programs. OSHA estimates that the greatest cost component of implementing procedures to bring a facility into compliance is attributable to the purchase of personal protective equipment. Although the costs of compliance are substantial, OSHA has estimated that these costs represent less than 1 percent of the healthcare industry's annual revenues. Violation of the bloodborne pathogen standard may result in penalties of up to $70,000, depending on the severity of the infraction. Criminal penalties are also possible for willful violations that result in worker death.
75 FR 27237 - Regulatory Flexibility Act Review of the Bloodborne Pathogens Standard
2010-05-14
... shown that occupational exposure to bloodborne pathogens constituted a significant risk and that the... infectious substances on them) is prohibited; Employers must make HBV vaccinations available to employees... needlestick prevention; Effectiveness of needlestick prevention programs; New, emerging health risks from...
2011-11-01
... Pathogens Standard provide employers and workers with means to provide protection from adverse health... protection from the adverse health effects associated with occupational exposure to bloodborne pathogens. As... DEPARTMENT OF LABOR Occupational Safety and Health Administration [Docket No. OSHA-2010-0047...
Directory of Open Access Journals (Sweden)
Javier González-Miguel
Full Text Available The interaction between blood-borne pathogens and fibrinolysis is one of the most important mechanisms that mediate invasion and the establishment of infectious agents in their hosts. However, overproduction of plasmin (final product of the route has been related in other contexts to proliferation and migration of the arterial wall cells and degradation of the extracellular matrix. We have recently identified fibrinolysis-activating antigens from Dirofilaria immitis, a blood-borne parasite whose key pathological event (proliferative endarteritis is produced by similar mechanisms to those indicated above. The objective of this work is to study how two of this antigens [actin (ACT and fructose-bisphosphate aldolase (FBAL] highly conserved in pathogens, activate fibrinolysis and to establish a relationship between this activation and the development of proliferative endarteritis during cardiopulmonary dirofilariasis. We demonstrate that both proteins bind plasminogen, enhance plasmin generation, stimulate the expression of the fibrinolytic activators tPA and uPA in endothelial cell cultures and are located on the surface of the worm in contact with the host's blood. ELISA, western blot and immunofluorescence techniques were employed for this purpose. Additionally, the implication of lysine residues in this interaction was analyzed by bioinformatics. The involvement of plasmin generated by the ACT/FBAL and plasminogen binding in cell proliferation and migration, and degradation of the extracellular matrix were shown in an "in vitro" model of endothelial and smooth muscle cells in culture. The obtained results indicate that ACT and FBAL from D. immitis activate fibrinolysis, which could be used by the parasite like a survival mechanism to avoid the clot formation. However, long-term overproduction of plasmin can trigger pathological events similar to those described in the emergence of proliferative endarteritis. Due to the high degree of
Directory of Open Access Journals (Sweden)
Ju Hyun Lee
2017-10-01
Full Text Available Abstract Background Health care workers (HCWs are at high risk for occupational blood exposures (OBEs and transmission of bloodborne pathogens. This study elucidated the incidence rate and epidemiological characteristics of OBEs among HCWs and investigated the pathogen transmission rate for hepatitis B virus (HBV, hepatitis C virus (HCV, and human immunodeficiency virus (HIV. Methods Self-reported OBEs from January 1, 2011 to December 31, 2015 were obtained from the electronic recording system. OBE incidence densities per 100 person-years and per 100 bed-years were calculated with a 5-year trend analysis. OBE characteristics and pathogen transmission rates were evaluated. Results Among 10,452 HCWs and 1072 average yearly beds, 1076 OBEs were reported. OBE incidence rate was 5.6 cases per 100 person (full-time equivalent-years and 20.3 per 100 bed-years. Incidence rate decreased and was significantly associated with a decrease of beds served per HCW. Housekeeping showed the highest OBE rate (14.8% followed by doctors (8.5% and nurses (6.2%. OBEs occurred in wards, emergency rooms, and operating rooms (38.1%, 13.3% and 12.2%, respectively via percutaneous (86.7% and mucocutaneous exposures (13.2%. Of OBEs associated with HBV (n = 133, HCV (n = 126, and HIV (n = 25, only one led to an infection (HCV; transmission rate of 0.8%. Neither HBV nor HIV infection occurred. Conclusions OBE incidence rate in a Korean university hospital was 5.6 cases per 100 person-years and 20.3 per 100 bed-years and was related to HCW workload and work proficiency. Though the actual bloodborne pathogen transmission rate was low, efforts to prevent OBE should be made for hospital safety.
Reducing Blood-borne Exposure in Interventional Radiology: What the IR Should Know
Energy Technology Data Exchange (ETDEWEB)
Tso, David K. [University of British Columbia, Department of Radiology (Canada); Athreya, Sriharsha, E-mail: sathreya@stjoes.ca [St. Joseph' s Healthcare Hamilton, Department of Diagnostic Imaging (Canada)
2013-08-01
Interventional radiologists are at risk of exposure to blood-borne pathogens in their day-to-day practice. Percutaneous exposure from unsafe sharps handling, mucocutaneous exposure from body fluid splashes, and glove perforation from excessive wear can expose the radiologist to potentially infectious material. The increasing prevalence of blood-borne pathogens, including hepatitis B and C, and human immunodeficiency virus, puts nurses, residents, fellows, and interventional radiologists at risk for occupational exposure. This review outlines suggestions to establish a culture of safety in the interventional suite.
Weller, S C
1991-11-01
Congress is putting pressure on OSHA to finalize its Universal Precaution standards by December. When the standards go into effect, textile rental companies that serve medical, dental, and outpatient care facilities--including private physician and dentist offices--must take steps to protect employees from blood-borne pathogens. Soiled linens, towels, gowns, and other items from any customer in risk categories link a textile rental facility and/or commercial laundry with the OSHA regulations. Read and heed this information.
Psychosocial Factors at Work and Blood-Borne Exposure among Nurses
Directory of Open Access Journals (Sweden)
R Mehrdad
2014-01-01
Full Text Available Background: Exposure to human blood and body fluids is a common risk for nurses. Many factors can affect the prevalence and incidence of this occupational hazard. Psychosocial factors at work may be a risk factor for the exposure. Objective: To assess needle stick, sharp injury and mucus exposure to blood-borne pathogens among nurses in Iran and to determine the association between these exposures and psychosocial factors at work. Methods: A cross-sectional study was conducted on nurses in a public hospital, Tehran, Iran. 364 nurses received and 339 completed and returned a self-reported questionnaire containing demographic data, history of exposure to blood-borne pathogens at work during previous year and the General Nordic questionnaire for psychological and social factors at work (QPS Nordic 34+ Questionnaire. Results: Of 339 participants, 197 (58.1% reported needle-stick injury, 186 (54.6% reported another type of sharp injury, and 112 (33% reported a mucous membrane exposure during the previous year. More than half of the participants who had history of exposure, had not reported it. Those with middle or high level of stress had higher crude and adjusted odds than those with lower stress for all kinds of exposure. Adjusted odds ratios for high stress group (ranging from 2.8 to 4.4 were statistically different from 1. Conclusion: There is a high prevalence of needle-stick and sharp injury and mucous membrane exposure to patients' blood or body fluids among studied nurses. There is a significant association between increasing psychosocial factors at work and exposure to blood-borne pathogens among this group of nurses.
Patients' Fear of Contracting the Blood-Borne Infections from Dentists
Directory of Open Access Journals (Sweden)
Fatemah Ayatollahi
2007-01-01
Full Text Available Introduction: There has been no recent assessment of public attitudes and opinions concerning risk of blood-borne pathogen transmission during health care. To assess public attitudes and opinions towards dentists infected with blood-borne viruses, this study was carried out.Materials and Methods: Six items in this cross-sectional survey were used to assess current attitudes and opinions about dentists infected with Human Immunodeficiency Virus (HIV, Hepatitis B and CViruses, and the risk of blood-borne virus transmission during health care in a sample of 500 cases, in Yazd. Data were analyzed by SPSS (version 13 and chi-square tests were used, when appropriate.Results: Of 500 respondents, 94% agreed that they want to know whether their dentist is infectedwith HIV, HBV or HCV; 93.8% agreed that disclosure of HIV, HBV or HCV infection in a provider should be mandatory. However, 15.8% did not believe that HIV-infected dentists were more likely to infect patients than those dentists infected with HBV or HCV. Opinions were divided on whether HIV-infected providers should be able to care for patients as long as they use good infection control:only 41.6% thought that infected providers should be allowed to provide patient care.Conclusion: These findings suggest that improved public education and risk communication on health care-associated blood-borne infections is needed.
Bloodborne Viral Pathogen Contamination in the Era of Laboratory Automation.
Bryan, Andrew; Cook, Linda; Atienza, Ederlyn E; Kuypers, Jane; Cent, Anne; Baird, Geoffrey S; Coombs, Robert W; Jerome, Keith R; Wener, Mark H; Butler-Wu, Susan M
2016-07-01
The CDC states that laboratory testing for persons under investigation for Ebola virus disease can be safely performed using automated laboratory instruments by adhering to bloodborne pathogen practices. We therefore sought to investigate the levels of viral contamination of a total laboratory automation (TLA) system to guide risk mitigation strategies for handling infectious agents. Environmental swabs followed by PCR for hepatitis B (HBV) and hepatitis C (HCV) viruses were taken from a chemistry TLA system during routine clinical use and after running a small number of high-titer HCV samples. Control experiments were performed to ensure the recovery of DNA and RNA viruses by swabs from a representative nonporous surface. Of 79 baseline swabs for nucleic acids performed on the TLA system, 10 were positive for HBV and 8 for HCV. Viral nucleic acid was consistently detected from swabs taken from the distal inside surface of the decapper discharge chute, with areas adjacent to the decapper instrument and the centrifuge rotor also positive for HBV or HCV nucleic acid. Contamination was occasionally detected on exposed surfaces in areas without protective barriers between samples and personnel. After running known HCV-positive samples, at least one additional site of contamination was detected on an exposed area of the line. A low level of viral contamination of automated clinical laboratory equipment occurs in clinical use. Given the risks associated with highly infectious agents, there is a need for risk-mitigation procedures when handling all samples. © 2016 American Association for Clinical Chemistry.
Directory of Open Access Journals (Sweden)
Charu Nayyar
2017-01-01
Full Text Available The health-care workers (HCWs are at an occupational risk of exposure to blood-borne pathogens, mainly, HIV, hepatitis B virus (HBV and hepatitis C virus. HBV is currently the only blood-borne virus for which a vaccine is available. All health-care institutions must encourage the HCWs to undergo screening for blood-borne pathogens.
Gyarmathy, V. Anna; Ujhelyi, Eszter; Neaigus, Alan
2008-01-01
We assessed the prevalence of HIV and selected blood-borne and sexually transmitted infections among a convenience sample of 64 residents of Dzsumbuj, a predominantly Roma (Gypsy) neighbourhood in Budapest, Hungary. No cases of HIV were detected, while the prevalence of Hepatitis B infection (anti-HBc) was 27% and syphilis prevalence was 2%. Romas (n=50) were significantly more likely than non-Romas (n=14) to have HAV antibodies (80% vs. 43%) and less likely to be HBV immunized (anti-HBs only; 6% vs. 29%). Current drug injectors (n=13) were more likely than non-injectors (n=51) to have antibodies against HAV (85% vs. 69%) and HCV (85% vs. 8%). While HIV has not been introduced in this population, risk conditions for a potentially explosive HIV epidemic are present. Health care policies should focus on expanding coverage for HAV and HBV immunizations, and access to HIV preventive services needs to be extended to marginalized, mostly minority populations, such as the Roma in Europe. PMID:18935777
... baby in the womb). More About Hepatitis and HIV infections HEPATITIS Symptoms of hepatitis B and hepatitis C may be ... contact with the virus. Sometimes, there are no symptoms. Hepatitis B ... liver damage. HIV After someone is infected with HIV, the virus ...
Non-hospital based registered nurses and the risk of bloodborne pathogen exposure.
Gershon, Robyn R M; Qureshi, Kristine A; Pogorzelska, Monika; Rosen, Jonathan; Gebbie, Kristine M; Brandt-Rauf, Paul W; Sherman, Martin F
2007-10-01
The aim of this study was to assess the risk of blood and body fluid exposure among non-hospital based registered nurses (RNs) employed in New York State. The study population was mainly unionized public sector workers, employed in state institutions. A self-administered questionnaire was completed by a random stratified sample of members of the New York State Nurses Association and registered nurse members of the New York State Public Employees Federation. Results were reviewed by participatory action research (PAR) teams to identify opportunities for improvement. Nine percent of respondents reported at least one needlestick injury in the 12-month period prior to the study. The percutaneous injury (PI) rate was 13.8 per 100 person years. Under-reporting was common; 49% of all PIs were never formally reported and 70% never received any post-exposure care. Primary reasons for not reporting included: time constraints, fear, and lack of information on reporting. Significant correlates of needlestick injuries included tenure, patient load, hours worked, lack of compliance with standard precautions, handling needles and other sharps, poor safety climate, and inadequate training and availability of safety devices (prisk reduction strategies, with an emphasis on safety devices. Non-hospital based RNs are at risk for bloodborne exposure at rates comparable to hospital based RNs; underreporting is an important obstacle to infection prevention, and primary and secondary risk management strategies appeared to be poorly implemented. Intervention research is warranted to evaluate improved risk reduction practices tailored to this population of RNs.
Bloodborne transmission of Hiv/Aids in Africa: Challenges and ...
African Journals Online (AJOL)
HIV-2, has been described mainly in West Africa. HIV can be transmitted both in cellular and plasma components of blood. Bloodborne transmission, accounts for 3-5% of the mode of transmission worldwide.Figures for other modes of transmission are 5-10% for intravenous drug use, 5 to 10 % for the homosexual route , 70 ...
Blood-Borne Markers of Fatigue in Competitive Athletes - Results from Simulated Training Camps.
Directory of Open Access Journals (Sweden)
Anne Hecksteden
Full Text Available Assessing current fatigue of athletes to fine-tune training prescriptions is a critical task in competitive sports. Blood-borne surrogate markers are widely used despite the scarcity of validation trials with representative subjects and interventions. Moreover, differences between training modes and disciplines (e.g. due to differences in eccentric force production or calorie turnover have rarely been studied within a consistent design. Therefore, we investigated blood-borne fatigue markers during and after discipline-specific simulated training camps. A comprehensive panel of blood-born indicators was measured in 73 competitive athletes (28 cyclists, 22 team sports, 23 strength at 3 time-points: after a run-in resting phase (d 1, after a 6-day induction of fatigue (d 8 and following a subsequent 2-day recovery period (d 11. Venous blood samples were collected between 8 and 10 a.m. Courses of blood-borne indicators are considered as fatigue dependent if a significant deviation from baseline is present at day 8 (Δfatigue which significantly regresses towards baseline until day 11 (Δrecovery. With cycling, a fatigue dependent course was observed for creatine kinase (CK; Δfatigue 54±84 U/l; Δrecovery -60±83 U/l, urea (Δfatigue 11±9 mg/dl; Δrecovery -10±10 mg/dl, free testosterone (Δfatigue -1.3±2.1 pg/ml; Δrecovery 0.8±1.5 pg/ml and insulin linke growth factor 1 (IGF-1; Δfatigue -56±28 ng/ml; Δrecovery 53±29 ng/ml. For urea and IGF-1 95% confidence intervals for days 1 and 11 did not overlap with day 8. With strength and high-intensity interval training, respectively, fatigue-dependent courses and separated 95% confidence intervals were present for CK (strength: Δfatigue 582±649 U/l; Δrecovery -618±419 U/l; HIIT: Δfatigue 863±952 U/l; Δrecovery -741±842 U/l only. These results indicate that, within a comprehensive panel of blood-borne markers, changes in fatigue are most accurately reflected by urea and IGF-1 for cycling
The pathogen transmission avoidance theory of sexual selection
Energy Technology Data Exchange (ETDEWEB)
Loehle, C.
1997-08-01
The current theory that sexual selection results from female preference for males with good genes suffers from several problems. An alternative explanation, the pathogen transmission avoidance hypothesis, argues that the primary function of showy traits is to provide a reliable signal of current disease status, so that sick individuals can be avoided during mating. This study shows that a significant risk of pathogen transmission occurs during mating and that showy traits are reliable indicators of current disease status. The origin of female choosiness is argued to lie in a general tendency to avoid sick individuals, even in the absence of showy traits, which originate as exaggerations of normal traits that are indicative of good health (bright feathers, vigorous movement, large size). Thus, in this new model the origins of both showy traits and female choosiness are not problematic and there is no threshold effect. This model predicts that when the possession of male showy traits does not help to reduce disease in the female, showy traits are unlikely to occur. This case corresponds to thorough exposure of every animal to all group pathogens, on average, in large groups. Such species are shown with a large data set on birds to be less likely to exhibit showy traits. The good-genes model does not make this prediction. The pathogen transmission avoidance model can also lead to the evolution of showy traits even when selection is not effective against a given pathogen (e.g., when there is no heritable variation for resistance), but can result in selection for resistance if such genes are present. Monogamy is argued to reduce selection pressures for showy traits; data show monogamous species to be both less parasitized and less showy. In the context of reduction of pathogen transmission rates in showy populations, selection pressure becomes inversely frequency-dependent, which makes showy traits likely to be self-limiting rather than runaway.
Blood-Borne Markers of Fatigue in Competitive Athletes – Results from Simulated Training Camps
Hecksteden, Anne; Skorski, Sabrina; Schwindling, Sascha; Hammes, Daniel; Pfeiffer, Mark; Kellmann, Michael; Ferrauti, Alexander; Meyer, Tim
2016-01-01
Assessing current fatigue of athletes to fine-tune training prescriptions is a critical task in competitive sports. Blood-borne surrogate markers are widely used despite the scarcity of validation trials with representative subjects and interventions. Moreover, differences between training modes and disciplines (e.g. due to differences in eccentric force production or calorie turnover) have rarely been studied within a consistent design. Therefore, we investigated blood-borne fatigue markers during and after discipline-specific simulated training camps. A comprehensive panel of blood-born indicators was measured in 73 competitive athletes (28 cyclists, 22 team sports, 23 strength) at 3 time-points: after a run-in resting phase (d 1), after a 6-day induction of fatigue (d 8) and following a subsequent 2-day recovery period (d 11). Venous blood samples were collected between 8 and 10 a.m. Courses of blood-borne indicators are considered as fatigue dependent if a significant deviation from baseline is present at day 8 (Δfatigue) which significantly regresses towards baseline until day 11 (Δrecovery). With cycling, a fatigue dependent course was observed for creatine kinase (CK; Δfatigue 54±84 U/l; Δrecovery -60±83 U/l), urea (Δfatigue 11±9 mg/dl; Δrecovery -10±10 mg/dl), free testosterone (Δfatigue -1.3±2.1 pg/ml; Δrecovery 0.8±1.5 pg/ml) and insulin linke growth factor 1 (IGF-1; Δfatigue -56±28 ng/ml; Δrecovery 53±29 ng/ml). For urea and IGF-1 95% confidence intervals for days 1 and 11 did not overlap with day 8. With strength and high-intensity interval training, respectively, fatigue-dependent courses and separated 95% confidence intervals were present for CK (strength: Δfatigue 582±649 U/l; Δrecovery -618±419 U/l; HIIT: Δfatigue 863±952 U/l; Δrecovery -741±842 U/l) only. These results indicate that, within a comprehensive panel of blood-borne markers, changes in fatigue are most accurately reflected by urea and IGF-1 for cycling and by CK
Pathogen-driven selection in the human genome.
Cagliani, Rachele; Sironi, Manuela
2013-01-01
Infectious diseases and epidemics have always accompanied and characterized human history, representing one of the main causes of death. Even today, despite progress in sanitation and medical research, infections are estimated to account for about 15% of deaths. The hypothesis whereby infectious diseases have been acting as a powerful selective pressure was formulated long ago, but it was not until the availability of large-scale genetic data and the development of novel methods to study molecular evolution that we could assess how pervasively infectious agents have shaped human genetic diversity. Indeed, recent evidences indicated that among the diverse environmental factors that acted as selective pressures during the evolution of our species, pathogen load had the strongest influence. Beside the textbook example of the major histocompatibility complex, selection signatures left by pathogen-exerted pressure can be identified at several human loci, including genes not directly involved in immune response. In the future, high-throughput technologies and the availability of genetic data from different populations are likely to provide novel insights into the evolutionary relationships between the human host and its pathogens. Hopefully, this will help identify the genetic determinants modulating the susceptibility to infectious diseases and will translate into new treatment strategies.
Sexual selection as a consequence of pathogen avoidance behaviors
Energy Technology Data Exchange (ETDEWEB)
Loehle, C. [Argonne National Lab., IL (United States); Logofet, D.O. [Russian Academy of Sciences, Moscow (Russian Federation). Laboratory of Mathematical Ecology
1997-08-01
The current theory that sexual selection results from female choice for good genes suffers from several problems. An alternative explanation is proposed. The pathogen avoidance hypothesis argues that the primary function of showy traits is to provide a reliable signal of current disease status so that sick individuals may be avoided during mating. Our studies shown that a significant risk of pathogen transmission occurs during mating and that showy traits are reliable indicators of current disease status. The origin of female choosiness is argued to lie in a general tendency to avoid sick individuals, even in the absence of showy traits. The showy traits are argued to originate as simple exaggerations of normal traits that are indicative of good health (bright feathers; vigorous movement; large size). Thus the origins of both showy traits and female choosiness are not problematic in this theory. A game theory analysis is employed to formalize the theory. Results of the game theory model support the theory. In particular, when the possession of male showy traits does not help reduce disease in the female, then showy traits are unlikely to occur. This case corresponds to the situation in large flocks or herds in which every animal is thoroughly exposed to all group pathogens on average. Such species do not exhibit showy traits. The good genes model does not make this prediction. The pathogen avoidance model can also lead to the evolution of showy traits even when selection is not effective against a given pathogen (e.g., when there is no heritable variation for resistance) but will lead to selection for resistance if such genes are present. Overall, the pathogen avoidance hypothesis provides a complete alternative to the good genes theory.
Pathogen-mediated selection for MHC variability in wild zebrafish
Czech Academy of Sciences Publication Activity Database
Smith, C.; Ondračková, Markéta; Spence, R.; Adams, S.; Betts, D. S.; Mallon, E.
2011-01-01
Roč. 13, č. 6 (2011), s. 589-605 ISSN 1522-0613 Institutional support: RVO:68081766 Keywords : digenean * frequency-dependent selection * heterozygote advantage * major histocompatibility complex * metazoan parasite * pathogen-driven selection Subject RIV: EG - Zoology Impact factor: 1.029, year: 2011
Selection of pathogen-resistant mutants in rapeseed
International Nuclear Information System (INIS)
Spanier, A.; Roebbelen, G.
1990-01-01
Full text: Significant yield reductions are due to Phoma lingam and Alternaria brassicae. Toxin containing culture filtrates of the pathogens as well as concentrated toxins of Phoma (Sirodesmins) are used for resistance selections in in-vitro cultures of haploid rapeseed materials. A few days after transfer of the in-vitro materials to the selective media the inhibitory effect of both the culture filtrates as well as the Sirodesmins was apparent. Clones were obtained, surviving several transfers onto toxin containing media. Further experiments shall clarify whether the toxin tolerance, selected in vitro at the cell level, is expressed in the differentiated plant in the greenhouse and finally in the field. (author)
A multicentre molecular analysis of hepatitis B and blood-borne virus coinfections in Viet Nam.
Dunford, Linda; Carr, Michael J; Dean, Jonathan; Nguyen, Linh Thuy; Ta Thi, Thu Hong; Nguyen, Binh Thanh; Connell, Jeff; Coughlan, Suzie; Nguyen, Hien Tran; Hall, William W; Thi, Lan Anh Nguyen
2012-01-01
Hepatitis B (HBV) infection is endemic in Viet Nam, with up to 8.4 million individuals estimated to be chronically infected. We describe results of a large, multicentre seroepidemiological and molecular study of the prevalence of HBV infection and blood-borne viral coinfections in Viet Nam. Individuals with varying risk factors for infection (n = 8654) were recruited from five centres; Ha Noi, Hai Phong, Da Nang, Khanh Hoa and Can Tho. A mean prevalence rate of 10.7% was observed and levels of HBsAg were significantly higher in injecting drug users (IDUs) (17.4%, n = 174/1000) and dialysis patients (14.3%, n = 82/575) than in lower-risk groups (9.4%; pViet Nam and also highlights the significant levels of blood-borne virus coinfections, which have important implications for hepatitis-related morbidity and development of effective management strategies.
The location of splenic NKT cells favours their rapid activation by blood-borne antigen
Barral, Patricia; Sánchez-Niño, María Dolores; van Rooijen, Nico; Cerundolo, Vincenzo; Batista, Facundo D
2012-01-01
Natural killer T (NKT) cells play an important role in mounting protective responses to blood-borne infections. However, though the spleen is the largest blood filter in the body, the distribution and dynamics of NKT cells within this organ are not well characterized. Here we show that the majority of NKT cells patrol around the marginal zone (MZ) and red pulp (RP) of the spleen. In response to lipid antigen, these NKT cells become arrested and rapidly produce cytokines, while the small proportion of NKT cells located in the white pulp (WP) exhibit limited activation. Importantly, disruption of the splenic MZ by chemical or genetic approaches results in a severe reduction in NKT cell activation indicating the need of cooperation between both MZ macrophages and dendritic cells for efficient NKT cell responses. Thus, the location of splenic NKT cells in the MZ and RP facilitates their access to blood-borne antigen and enables the rapid initiation of protective immune responses. PMID:22505026
The location of splenic NKT cells favours their rapid activation by blood-borne antigen.
Barral, Patricia; Sánchez-Niño, María Dolores; van Rooijen, Nico; Cerundolo, Vincenzo; Batista, Facundo D
2012-05-16
Natural killer T (NKT) cells play an important role in mounting protective responses to blood-borne infections. However, though the spleen is the largest blood filter in the body, the distribution and dynamics of NKT cells within this organ are not well characterized. Here we show that the majority of NKT cells patrol around the marginal zone (MZ) and red pulp (RP) of the spleen. In response to lipid antigen, these NKT cells become arrested and rapidly produce cytokines, while the small proportion of NKT cells located in the white pulp (WP) exhibit limited activation. Importantly, disruption of the splenic MZ by chemical or genetic approaches results in a severe reduction in NKT cell activation indicating the need of cooperation between both MZ macrophages and dendritic cells for efficient NKT cell responses. Thus, the location of splenic NKT cells in the MZ and RP facilitates their access to blood-borne antigen and enables the rapid initiation of protective immune responses.
Directory of Open Access Journals (Sweden)
Ville-Petri Friman
2011-03-01
Full Text Available The coincidental evolution hypothesis predicts that traits connected to bacterial pathogenicity could be indirectly selected outside the host as a correlated response to abiotic environmental conditions or different biotic species interactions. To investigate this, an opportunistic bacterial pathogen, Serratia marcescens, was cultured in the absence and presence of the lytic bacteriophage PPV (Podoviridae at 25°C and 37°C for four weeks (N = 5. At the end, we measured changes in bacterial phage-resistance and potential virulence traits, and determined the pathogenicity of all bacterial selection lines in the Parasemia plantaginis insect model in vivo. Selection at 37°C increased bacterial motility and pathogenicity but only in the absence of phages. Exposure to phages increased the phage-resistance of bacteria, and this was costly in terms of decreased maximum population size in the absence of phages. However, this small-magnitude growth cost was not greater with bacteria that had evolved in high temperature regime, and no trade-off was found between phage-resistance and growth rate. As a result, phages constrained the evolution of a temperature-mediated increase in bacterial pathogenicity presumably by preferably infecting the highly motile and virulent bacteria. In more general perspective, our results suggest that the traits connected to bacterial pathogenicity could be indirectly selected as a correlated response by abiotic and biotic factors in environmental reservoirs.
Directory of Open Access Journals (Sweden)
Erik Corona
Full Text Available Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS, providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.
Aggressive chemotherapy and the selection of drug resistant pathogens.
Directory of Open Access Journals (Sweden)
Silvie Huijben
2013-09-01
Full Text Available Drug resistant pathogens are one of the key public health challenges of the 21st century. There is a widespread belief that resistance is best managed by using drugs to rapidly eliminate target pathogens from patients so as to minimize the probability that pathogens acquire resistance de novo. Yet strong drug pressure imposes intense selection in favor of resistance through alleviation of competition with wild-type populations. Aggressive chemotherapy thus generates opposing evolutionary forces which together determine the rate of drug resistance emergence. Identifying treatment regimens which best retard resistance evolution while maximizing health gains and minimizing disease transmission requires empirical analysis of resistance evolution in vivo in conjunction with measures of clinical outcomes and infectiousness. Using rodent malaria in laboratory mice, we found that less aggressive chemotherapeutic regimens substantially reduced the probability of onward transmission of resistance (by >150-fold, without compromising health outcomes. Our experiments suggest that there may be cases where resistance evolution can be managed more effectively with treatment regimens other than those which reduce pathogen burdens as fast as possible.
Genes under positive selection in a model plant pathogenic fungus, Botrytis.
Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian
2012-07-01
The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.
Bloodborne Pathogens and Needlestick Prevention
... Safety and Health Program Recommendations It's the Law Poster REGULATIONS Law and Regulations Standard Interpretations Training Requirements ... page requires that javascript be enabled for some elements to function correctly. Please contact the OSHA Directorate ...
Singh, Tejinder P; Kaur, Gurpreet; Kapila, Suman; Malik, Ravinder K
2017-01-01
Adhesion ability of probiotics is the key factor that decides their colonization in the gastrointestinal tract and potential to inhibit pathogens. Therefore, adhesion ability can be considered as a key determinant for probiotic efficacy. Presents study documents the antagonistic activity of viable/untreated, Lithium chloride (LiCl) treated or heat-killed forms of eight probiotic Lactobacillus reuteri strains on the adhesion characteristics of selected pathogens. All strains investigated were able to adhere to Caco-2 cells. L. reuteri strains tested were able to inhibit and displace ( P strain L. reuteri LR6 showed the strongest adhesion and pathogen inhibition ability among the eight L. reuteri strains tested. In addition, the abilities to inhibit and to displace adhered pathogens depended on both the probiotic and the pathogen strains tested suggesting the involvement of various mechanisms. The adhesion and antagonistic potential of the probiotic strains were significantly decreased upon exposure to 5 M LiCl, showing that surface molecules, proteinaceous in nature, are involved. The heat-killed forms of the probiotic L. reuteri strains also inhibited the attachment of selected pathogens to Caco-2 cells. In conclusion, in vitro assays showed that L. reuteri strains, as viable or heat-killed forms, are adherent to Caco-2 cells and are highly antagonistic to pathogens tested in which surface associated proteins play an important role.
Association between selected oral pathogens and gastric precancerous lesions.
Directory of Open Access Journals (Sweden)
Christian R Salazar
Full Text Available We examined whether colonization of selected oral pathogens is associated with gastric precancerous lesions in a cross-sectional study. A total of 119 participants were included, of which 37 were cases of chronic atrophic gastritis, intestinal metaplasia, or dysplasia. An oral examination was performed to measure periodontal indices. Plaque and saliva samples were tested with real-time quantitative PCR for DNA levels of pathogens related to periodontal disease (Porphyromonas gingivalis, Tannerella forsythensis, Treponema denticola, Actinobacillus actinomycetemcomitans and dental caries (Streptococcus mutans and S. sobrinus. There were no consistent associations between DNA levels of selected bacterial species and gastric precancerous lesions, although an elevated but non-significant odds ratio (OR for gastric precancerous lesions was observed in relation to increasing colonization of A. actinomycetemcomitans (OR = 1.36 for one standard deviation increase, 95% Confidence Interval = 0.87-2.12, P. gingivalis (OR = 1.12, 0.67-1.88 and T. denticola (OR = 1.34, 0.83-2.12 measured in plaque. To assess the influence of specific long-term infection, stratified analyses by levels of periodontal indices were conducted. A. actinomycetemcomitans was significantly associated with gastric precancerous lesions (OR = 2.51, 1.13-5.56 among those with ≥ median of percent tooth sites with PD ≥ 3 mm, compared with no association among those below the median (OR = 0.86, 0.43-1.72. A significantly stronger relationship was observed between the cumulative bacterial burden score of periodontal disease-related pathogens and gastric precancerous lesions among those with higher versus lower levels of periodontal disease indices (p-values for interactions: 0.03-0.06. Among individuals with periodontal disease, high levels of colonization of periodontal pathogens are associated with an increased risk of gastric precancerous lesions.
Blood-borne biomarkers of mortality risk: systematic review of cohort studies.
Directory of Open Access Journals (Sweden)
Evelyn Barron
Full Text Available Lifespan and the proportion of older people in the population are increasing, with far reaching consequences for the social, political and economic landscape. Unless accompanied by an increase in health span, increases in age-related diseases will increase the burden on health care resources. Intervention studies to enhance healthy ageing need appropriate outcome measures, such as blood-borne biomarkers, which are easily obtainable, cost-effective, and widely accepted. To date there have been no systematic reviews of blood-borne biomarkers of mortality.To conduct a systematic review to identify available blood-borne biomarkers of mortality that can be used to predict healthy ageing post-retirement.Four databases (Medline, Embase, Scopus, Web of Science were searched. We included prospective cohort studies with a minimum of two years follow up and data available for participants with a mean age of 50 to 75 years at baseline.From a total of 11,555 studies identified in initial searches, 23 fulfilled the inclusion criteria. Fifty-one blood borne biomarkers potentially predictive of mortality risk were identified. In total, 20 biomarkers were associated with mortality risk. Meta-analyses of mortality risk showed significant associations with C-reactive protein (Hazard ratios for all-cause mortality 1.42, p<0.001; Cancer-mortality 1.62, p<0.009; CVD-mortality 1.31, p = 0.033, N Terminal-pro brain natriuretic peptide (Hazard ratios for all-cause mortality 1.43, p<0.001; CHD-mortality 1.58, p<0.001; CVD-mortality 1.67, p<0.001 and white blood cell count (Hazard ratios for all-cause mortality 1.36, p = 0.001. There was also evidence that brain natriuretic peptide, cholesterol fractions, erythrocyte sedimentation rate, fibrinogen, granulocytes, homocysteine, intercellular adhesion molecule-1, neutrophils, osteoprotegerin, procollagen type III aminoterminal peptide, serum uric acid, soluble urokinase plasminogen activator receptor, tissue inhibitor of
Hasak, Jessica M; Novak, Christine B; Patterson, Jennifer Megan M; Mackinnon, Susan E
2018-02-01
Needlestick injury prevalence, protection practices, and attitudes were assessed. Current medical students were compared with 2003 data to assess any changes that occurred with engineered safety feature implementation. Risk of occupational exposure to bloodborne pathogens is elevated in the operating room particularly with surgeons in training and nurses. A cross-sectional survey was distributed to medical students (n = 358) and Department of Surgery staff (n = 247). The survey response rate was 24.8%. Needlestick injuries were reported by 38.7% of respondents (11% high risk), and the most common cause was "careless/accidental." Needlestick injury prevalence increased from medical students to residents and fellows (100%). Thirty-three percent of injured personnel had at least one unreported injury, and the most common reason was "inconvenient/too time consuming." Needlestick injury prevalence and double-glove use in medical students did not differ from 2003, and 25% of fellows reported always wearing double gloves. The true seroconversion rate for bloodborne pathogens was underestimated or unknown. The concern for contracting a bloodborne pathogen significantly decreased (65%) compared to 2003, and there were significantly less medical students with hepatitis B vaccinations (78.3%). Level of concern for contracting a bloodborne pathogen was predictive of needlestick injury. Needlestick injury and occupational exposure to bloodborne pathogens are significant hazards for surgeons and nurses. Attitudes regarding risk are changing, and the true seroconversion risk is underestimated. Educational efforts focused on needlestick injury prevalence, seroconversion rates, and double-glove perforation rates may be effective in implementing protective strategies.
Saba, T M; Antikatzides, T G
1979-04-01
The influence of systemic heparin administration on the vascular clearance and tissue distribution of blood-borne microparticles was evaluated in normal rats and rats after operation (laparotomy plus intestinal manipulation) utilizing an (131)I- colloid which is phagocytized by the reticuloendothelial system (RES). Intravenous heparin administration (100 USP/100g body weight) into normal animals three minutes prior to colloid injection (50 mg/lOOg) induced a significant increase in pulmonary localization of the microparticles as compared to nonheparinized control rats, while hepatic and splenic uptake were decreased. Surgical trauma decreased hepatic RE uptake and increased pulmonary localization of the microparticles when injected systemically at 60 minutes postsurgery. Heparin administration 60 minutes after surgery and three minutes prior to colloid injection, magnified the increased pulmonary localization response with an associated further depression of the RES. The ability of heparin to alter both RE clearance function and lung localization of microparticles was dose dependent and a function of the interval between heparin administration and systemic particulate infusion. Thus, low dose heparin administration was capable of stimulating RE activity while heparin in doses of excess of 50 USP units/lOOg body weight decreased RE function. These findings suggest that the functional state of the hepatic RE system can be greatly affected in a dose-dependent manner by systemic heparin administration which may influence distribution of blood-borne microparticles.
Directory of Open Access Journals (Sweden)
Oliver Langmead
2017-06-01
Full Text Available This article will consider the ways that Bloodborne (FromSoftware, 2015 plays on a broad range of Gothic themes and conventions, utilising unusual narrative techniques and gameplay mechanics which offer the player a means by which they might experience a Gothic narrative in ways that the traditional novel format does not allow for. It will argue that Bloodborne showcases the genre's potential new frontier: converting conventions into interesting new gameplay mechanics, and letting the player experience the genre through player-led narrative and agency.
Directory of Open Access Journals (Sweden)
Matteo Fumagalli
2011-11-01
Full Text Available Previous genome-wide scans of positive natural selection in humans have identified a number of non-neutrally evolving genes that play important roles in skin pigmentation, metabolism, or immune function. Recent studies have also shown that a genome-wide pattern of local adaptation can be detected by identifying correlations between patterns of allele frequencies and environmental variables. Despite these observations, the degree to which natural selection is primarily driven by adaptation to local environments, and the role of pathogens or other ecological factors as selective agents, is still under debate. To address this issue, we correlated the spatial allele frequency distribution of a large sample of SNPs from 55 distinct human populations to a set of environmental factors that describe local geographical features such as climate, diet regimes, and pathogen loads. In concordance with previous studies, we detected a significant enrichment of genic SNPs, and particularly non-synonymous SNPs associated with local adaptation. Furthermore, we show that the diversity of the local pathogenic environment is the predominant driver of local adaptation, and that climate, at least as measured here, only plays a relatively minor role. While background demography by far makes the strongest contribution in explaining the genetic variance among populations, we detected about 100 genes which show an unexpectedly strong correlation between allele frequencies and pathogenic environment, after correcting for demography. Conversely, for diet regimes and climatic conditions, no genes show a similar correlation between the environmental factor and allele frequencies. This result is validated using low-coverage sequencing data for multiple populations. Among the loci targeted by pathogen-driven selection, we found an enrichment of genes associated to autoimmune diseases, such as celiac disease, type 1 diabetes, and multiples sclerosis, which lends credence to the
Singh, Tejinder P.; Kaur, Gurpreet; Kapila, Suman; Malik, Ravinder K.
2017-01-01
Adhesion ability of probiotics is the key factor that decides their colonization in the gastrointestinal tract and potential to inhibit pathogens. Therefore, adhesion ability can be considered as a key determinant for probiotic efficacy. Presents study documents the antagonistic activity of viable/untreated, Lithium chloride (LiCl) treated or heat-killed forms of eight probiotic Lactobacillus reuteri strains on the adhesion characteristics of selected pathogens. All strains investigated were ...
Hörger, Anja C.; Ilyas, Muhammad; Stephan, Wolfgang; Tellier, Aurélien; van der Hoorn, Renier A. L.; Rose, Laura E.
2012-01-01
Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors) and host resistance genes such as the major histocompatibility complex (MHC) in mammals or resistance (R) genes in plants. In plant–pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the “Guard-Hypothesis,” R proteins (the “guards”) can sense modification of target molecules in the host (the “guardees”) by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3) and its guard (Cf-2). We conclude that, in addition to coevolution at the “guardee-effector” interface for pathogen recognition, natural selection acts on the “guard-guardee” interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto
Directory of Open Access Journals (Sweden)
Anja C Hörger
Full Text Available Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors and host resistance genes such as the major histocompatibility complex (MHC in mammals or resistance (R genes in plants. In plant-pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the "Guard-Hypothesis," R proteins (the "guards" can sense modification of target molecules in the host (the "guardees" by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3 and its guard (Cf-2. We conclude that, in addition to coevolution at the "guardee-effector" interface for pathogen recognition, natural selection acts on the "guard-guardee" interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto-immune responses in
Iatrogenic blood-borne viral infections in refugee children from war and transition zones.
Goldwater, Paul N
2013-06-01
Pediatric infectious disease clinicians in industrialized countries may encounter iatrogenically transmitted HIV, hepatitis B virus, and hepatitis C virus infections in refugee children from Central Asia, Southeast Asia, and sub-Saharan Africa. The consequences of political collapse and/or civil war-work migration, prostitution, intravenous drug use, defective public health resources, and poor access to good medical care-all contribute to the spread of blood-borne viruses. Inadequate infection control practices by medical establishments can lead to iatrogenic infection of children. Summaries of 4 cases in refugee children in Australia are a salient reminder of this problem.
29 CFR 1910.1030 - Bloodborne pathogens.
2010-07-01
... during handling; contaminated sharps; and pathological and microbiological wastes containing blood or...—(1) Effective Date. The standard shall become effective on March 6, 1992. (2) The Exposure Control...
Physiological functions and pathogenic potential of uric acid: A review.
El Ridi, Rashika; Tallima, Hatem
2017-09-01
Uric acid is synthesized mainly in the liver, intestines and the vascular endothelium as the end product of an exogenous pool of purines, and endogenously from damaged, dying and dead cells, whereby nucleic acids, adenine and guanine, are degraded into uric acid. Mentioning uric acid generates dread because it is the established etiological agent of the severe, acute and chronic inflammatory arthritis, gout and is implicated in the initiation and progress of the metabolic syndrome. Yet, uric acid is the predominant anti-oxidant molecule in plasma and is necessary and sufficient for induction of type 2 immune responses. These properties may explain its protective potential in neurological and infectious diseases, mainly schistosomiasis. The pivotal protective potential of uric acid against blood-borne pathogens and neurological and autoimmune diseases is yet to be established.
Individual Patterns in Blood-Borne Indicators of Fatigue-Trait or Chance.
Julian, Ross; Meyer, Tim; Fullagar, Hugh H K; Skorski, Sabrina; Pfeiffer, Mark; Kellmann, Michael; Ferrauti, Alexander; Hecksteden, Anne
2017-03-01
Julian, R, Meyer, T, Fullagar, HHK, Skorski, S, Pfeiffer, M, Kellmann, M, Ferrauti, A, and Hecksteden, A. Individual patterns in blood-borne indicators of fatigue-trait or chance. J Strength Cond Res 31(3): 608-619, 2017-Blood-borne markers of fatigue such as creatine kinase (CK) and urea (U) are widely used to fine-tune training recommendations. However, predictive accuracy is low. A possible explanation for this dissatisfactory characteristic is the propensity of athletes to react to different patterns of fatigue indicators (e.g., predominantly muscular [CK] or metabolic [U]). The aim of the present trial was to explore this hypothesis by using repetitive fatigue-recovery cycles. A total of 22 elite junior swimmers and triathletes (18 ± 3 years) were monitored for 9 weeks throughout 2 training phases (low-intensity, high-volume [LIHV] and high-intensity, low-volume [HILV] phases). Blood samples were collected each Monday (recovered) and Friday (fatigued) morning. From measured values of CK, U, free-testosterone (FT), and cortisol (C) as determined in the rested and fatigued state, respectively, Monday-Friday differences (Δ) were calculated and classified by magnitude before calculation of ratios (ΔCK/ΔU and ΔFT/ΔC). Coefficient of variation (CV) was calculated as group-based estimates of reproducibility. Linear mixed modeling was used to differentiate inter- and intraindividual variability. Consistency of patterns was analyzed by comparing with threshold values (1.1 for all weeks). Reproducibility was very low for fatigue-induced changes (CV ≥ 100%) with interindividual variation accounting for 45-60% of overall variability. Case-wise analysis indicated consistent ΔCK/ΔU patterns for 7 individuals in LIHV and 7 in HILV; 5 responded consistently throughout. For ΔFT/ΔC the number of consistent patterns was 2 in LIHV and 3 in HILV. These findings highlight the potential value of an individualized and multivariate approach in the assessment of fatigue.
Fry, Craig L; Lintzeris, Nick
2003-02-01
To develop a standard measure of blood-borne virus transmission risk behaviour, and examine the underlying psychometric properties. The Blood-borne Virus Transmission Risk Assessment Questionnaire (BBV-TRAQ) was developed over three consecutive phases of the original BBV-TRAQ study in adherence to classical scale development procedures, culminating in the recruitment of a development sample of current injecting drug users via convenience and snowball sampling. Needle and syringe programmes (NSPs), medical clinics, alcohol/drug agencies, peer-based and outreach organizations across inner and outer metropolitan Melbourne. Two hundred and nine current injecting drug users. The mean age was 27 years, 68% were male, 65% unemployed, 36% with prison history and 25% in methadone maintenance. BBV-TRAQ items cover specific injecting, sexual and skin penetration risk practices. BBV-TRAQ characteristics were assessed via measures of internal and test-retest reliability; collateral validation; and principal components analyses. The BBV-TRAQ has satisfactory psychometric properties. Internal (a=0.87), test-retest (r=0.84) and inter-observer reliability results were high, suggesting that the instrument provides a reliable measure of BBV risk behaviour and is reliable over time and across interviewers. A principal components analysis with varimax rotation produced a parsimonious factor solution despite modest communality, and indicated that three factors (injecting, sex and skin penetration/hygiene risks) are required to describe BBV risk behaviour. The BBV-TRAQ is reliable and represents the first risk assessment tool to incorporate sufficient coverage of injecting, sex and other skin penetration risk practices to be considered truly content valid. The questionnaire is indicated for use in addictions research, clinical, peer education and BBV risk behaviour surveillance settings.
International Nuclear Information System (INIS)
Pereira, Luísa; Soares, Pedro; Máximo, Valdemar; Samuels, David C
2012-01-01
The presence of somatic mitochondrial DNA (mtDNA) mutations in cancer cells has been interpreted in controversial ways, ranging from random neutral accumulation of mutations, to positive selection for high pathogenicity, or conversely to purifying selection against high pathogenicity variants as occurs at the population level. Here we evaluated the predicted pathogenicity of somatic mtDNA mutations described in cancer and compare these to the distribution of variations observed in the global human population and all possible protein variations that could occur in human mtDNA. We focus on oncocytic tumors, which are clearly associated with mitochondrial dysfunction. The protein variant pathogenicity was predicted using two computational methods, MutPred and SNPs&GO. The pathogenicity score of the somatic mtDNA variants were significantly higher in oncocytic tumors compared to non-oncocytic tumors. Variations in subunits of Complex I of the electron transfer chain were significantly more common in tumors with the oncocytic phenotype, while variations in Complex V subunits were significantly more common in non-oncocytic tumors. Our results show that the somatic mtDNA mutations reported over all tumors are indistinguishable from a random selection from the set of all possible amino acid variations, and have therefore escaped the effects of purifying selection that act strongly at the population level. We show that the pathogenicity of somatic mtDNA mutations is a determining factor for the oncocytic phenotype. The opposite associations of the Complex I and Complex V variants with the oncocytic and non-oncocytic tumors implies that low mitochondrial membrane potential may play an important role in determining the oncocytic phenotype
Directory of Open Access Journals (Sweden)
Boknam Jung
2013-12-01
Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.
Eikelenboom, P.; Scott, J. R.; McBride, P. A.; Rozemuller, J. M.; Bruce, M. E.; Fraser, H.
1987-01-01
The present study was designed to investigate blood-brain permeability and the possible involvement of plasma proteins and blood-borne cells in amyloid plaque formation in scrapie-affected mice. No abnormal extravasation of intravenously injected horseradish peroxidase (HRP) was found and with
Risk of blood splashes to the eye during surgery
African Journals Online (AJOL)
2009-02-25
Feb 25, 2009 ... The prevalence of blood-borne diseases such as hepatitis. B, hepatitis C and HIV is increasing globally. Sub-Saharan. Africa is one of the worst-affected regions. The risk of infection from these blood-borne pathogens has become a significant occupational hazard for many categories of health care workers ...
PCR evaluation of selected vector-borne pathogens in dogs with pericardial effusion.
Tabar, M-D; Movilla, R; Serrano, L; Altet, L; Francino, O; Roura, X
2018-04-01
To investigate evidence for selected vector-borne pathogen infections in dogs with pericardial effusion living in a Mediterranean area in which several canine vector-borne diseases are endemic. Archived EDTA blood (n=68) and pericardial fluid samples (n=58) from dogs with pericardial effusion (n=68) were included. Dogs without pericardial effusion examined for other reasons were included as controls (n=60). Pericardial effusion was classified as neoplastic in 40 dogs, idiopathic in 23 dogs and of unknown aetiology in 5 dogs. Real-time PCR was performed for Leishmania infantum, Ehrlichia/Anaplasma species, Hepatozoon canis, Babesia species, Rickettsia species and Bartonella species, and sequencing of PCR products from positive samples was used to confirm species specificity. Vector-borne pathogens were found in 18 dogs: 16 of 68 dogs with pericardial effusion (23·5%) and two of 60 control dogs (3·3%). Positive dogs demonstrated DNA of Leishmania infantum (n=7), Anaplasma platys (n=2, one dog coinfected with Leishmania infantum), Babesia canis (n=5), Babesia gibsoni (n=3) and Hepatozoon canis (n=2). Vector-borne pathogens were more commonly detected among dogs with pericardial effusion than controls (P=0·001). There was no relationship between aetiology of the pericardial effusion and evidence of vector-borne pathogens (P=0·932). Vector-borne pathogens are often detected in dogs with pericardial effusion and require further investigation, especially in dogs with idiopathic pericardial effusion. PCR can provide additional information about the potential role of vector-borne pathogens in dogs with pericardial effusion living in endemic areas. © 2018 British Small Animal Veterinary Association.
Directory of Open Access Journals (Sweden)
Mojtaba Davoudi
2012-01-01
Full Text Available Aims: Antibacterial effects of hydrogen peroxide and silver composition on selected pathogenic enterobacteriaceae was investigated in this study. Materials and Methods: The efficacy of 30 ppb silver in 0.3% hydrogen peroxide solution for inactivation of selected Enterobacteriaceae, including Escherichia coli, Proteus mirabilis, and Klebsiella pneumoniae was assessed for 72 hours in a designated nutrient broth medium and steel surface. The bactericidal growth ability was determined for each bacterium genus by the conventional colony count method and turbidimetry via an optical density (OD assay at 450 nm in a time interval of 24 hours. Results: Suspensions of K.pneumoniae, and P.mirabilis showed a significant OD reduction at three 24-hour intervals (CI = 0.95; P < 0.05, for both, along with blocked growth in a designated broth medium during 24 to 48 hours of exposure. The disinfectant was also significantly efficient for inactivating of the mentioned bacteria on steel surfaces after a 15-minute time exposure (CI = 0.95; P < 0.05. For E.coli, the OD decreased slightly during the initial exposure time, but increased after 24 hours. Viable E.coli cells were proved by colonies grown on the plate. A qualitative surface decontamination test showed that three pathogenic bacteria were inactivated significantly after disinfectant exposure (CI = 0.95, P < 0.05. Conclusions: In conclusion, a combination of hydrogen peroxide and silver ions was proposed as a strong disinfecting agent both in suspensions and on the surfaces against these three important human pathogens.
Priority setting of foodborne pathogens: disease burden and costs of selected enteric pathogens
Kemmeren JM; Mangen MJJ; Duynhoven YTHP van; Havelaar AH; MGB
2006-01-01
Toxoplasmosis causes the highest disease burden among seven evaluated foodborne pathogens. This is the preliminary conclusion of a major study of the disease burden and related costs of foodborne pathogens. The other micro-organisms that were studied are Campylobacter spp., Salmonella spp.,
OSHA's bloodborne pathogens rule an opportunity/threat.
Weller, S C
1992-02-01
If you supply healthcare linen, OSHA's new ruling comes with a price tag, but it may be a marketing boon as well. The costs of compliance are high--about $1.19 million annually. One of the most costly and important parts of the ruling is the required employer-paid hepatitis B vaccination of employees. But behind the costs, there's good news for the textile rental industry. The opportunity to serve small medical facilities and nursing homes as well as hospitals with reusable healthcare garments could create a revenue source estimated to be at least $177 million a year.
Effect of phenolic compounds on the growth of selected probiotic and pathogenic bacteria.
Pacheco-Ordaz, R; Wall-Medrano, A; Goñi, M G; Ramos-Clamont-Montfort, G; Ayala-Zavala, J F; González-Aguilar, G A
2018-01-01
Fruit extracts from different tissues (pulp, seed and peel) have shown antimicrobial and prebiotic activities related to their phenolic profile, although structure-specific evaluations have not been reported yet. The effect of five phenolic compounds (catechin and gallic, vanillic, ferulic and protocatechuic acids) identified in different fruits, particularly in mango, was evaluated on the growth of two probiotic (Lactobacillus rhamnosusGG ATCC 53103 and Lactobacillus acidophilusNRRLB 4495) and two pathogenic (Escherichia coli 0157:H7 ATCC 43890 and Salmonella enterica serovar Typhimurium ATCC 14028) bacteria. The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of phenolic acids ranged from 15-20 mmol l -1 and 20-30 mmol l -1 against E. coli and S. Typhimurium, respectively. For catechin, the MIC and MBC were 35 mmol l -1 and >35 mmol l -1 against E. coli and S. Typhimurium, respectively. The presence of catechin and gallic, protocatechuic and vanillic acids in MRS broth without dextrose allowed the growth of lactobacilli. Catechin combined with protocatechuic or vanillic acid mildly allowed the growth of both probiotics. In conclusion, phenolic compounds can selectively inhibit the growth of pathogenic bacteria without affecting the viability of probiotics. This study provides relevant information about the effects of phenolic compounds commonly present in fruit and vegetables on the growth of probiotic and pathogenic bacteria. The compounds selectively allowed the growth of probiotic lactobacilli (Lactobacillus rhamnosus GG and Lactobacillus acidophilus) and inhibited pathogenic bacteria (Escherichia coli and Salmonella Typhimurium) at the same concentration (20 mmol l -1 ). These findings can contribute to the formulation of nutraceutical products, such as synbiotics, that can restore or maintain an optimal composition of human microbiota, potentially improving the overall health of the consumer. © 2017 The
LENUS (Irish Health Repository)
Donohue, S
2012-01-21
A review of patient notification exercises (PNEs) carried out in Ireland between 1997 and 2011 to investigate potential exposure to blood-borne viruses (BBVs) in healthcare settings was undertaken to inform future policy and practice. A questionnaire was sent to key informants in the health services to identify all relevant PNEs. Structured interviews were conducted with key investigators, and available documentation was examined. Ten BBV-related PNEs were identified. Despite testing over 2000 patients, only one case of transmission was found. However, in-depth local investigations before undertaking the PNEs identified six cases of healthcare-associated transmission.
Directory of Open Access Journals (Sweden)
Jaione Simon-Santamaria
Full Text Available Liver sinusoidal endothelial cells (LSECs are specialized scavenger cells that mediate high-capacity clearance of soluble waste macromolecules and colloid material, including blood-borne adenovirus. To explore if LSECs function as a sink for other viruses in blood, we studied the fate of virus-like particles (VLPs of two ubiquitous human DNA viruses, BK and JC polyomavirus, in mice. Like complete virions, VLPs specifically bind to receptors and enter cells, but unlike complete virions, they cannot replicate. 125I-labeled VLPs were used to assess blood decay, organ-, and hepatocellular distribution of ligand, and non-labeled VLPs to examine cellular uptake by immunohisto- and -cytochemistry. BK- and JC-VLPs rapidly distributed to liver, with lesser uptake in kidney and spleen. Liver uptake was predominantly in LSECs. Blood half-life (∼1 min, and tissue distribution of JC-VLPs and two JC-VLP-mutants (L55F and S269F that lack sialic acid binding affinity, were similar, indicating involvement of non-sialic acid receptors in cellular uptake. Liver uptake was not mediated by scavenger receptors. In spleen, the VLPs localized to the red pulp marginal zone reticuloendothelium, and in kidney to the endothelial lining of vasa recta segments, and the transitional epithelium of renal pelvis. Most VLP-positive vessels in renal medulla did not express PV-1/Meca 32, suggesting location to the non-fenestrated part of vasa recta. The endothelial cells of these vessels also efficiently endocytosed a scavenger receptor ligand, formaldehyde-denatured albumin, suggesting high endocytic activity compared to other renal endothelia. We conclude that LSECs very effectively cleared a large fraction of blood-borne BK- and JC-VLPs, indicating a central role of these cells in early removal of polyomavirus from the circulation. In addition, we report the novel finding that a subpopulation of endothelial cells in kidney, the main organ of polyomavirus persistence, showed
Narin, I.; Gedik, H.; Voss, A.
2012-01-01
This review of last year's literature on blood-borne pathogens (= pathogenic microorganisms that are found in human blood) focuses on hepatitis B (HBV), hepatitis C (HCV), and human immunodeficiency virus (HIV) as the most common pathogens, despite the fact that other microorganisms may cause
Surface adhesins and exopolymers of selected foodborne pathogens
DEFF Research Database (Denmark)
Jaglic, Zoran; Desvaux, Mickaël; Weiss, Agnes
2014-01-01
The ability of bacteria to bind different compounds and to adhere to biotic and abiotic surfaces provides them with a range of advantages, such as colonization of various tissues, internalisation, avoidance of an immune response and survival and persistence in the environment. A variety of bacter......The ability of bacteria to bind different compounds and to adhere to biotic and abiotic surfaces provides them with a range of advantages, such as colonization of various tissues, internalisation, avoidance of an immune response and survival and persistence in the environment. A variety...... of bacterial surface structures are involved in this process and these promote bacterial adhesion in a more or less specific manner. In this review, we will focus on those surface adhesins and exopolymers in selected foodborne pathogens that are involved mainly in primary adhesion. Their role in biofilm...
DEFF Research Database (Denmark)
Sørensen, Lars Peter; Mark, Thomas; Sørensen, M.K.
2010-01-01
The objectives of this study were 1) to estimate costs related to 5 different pathogen-specific mastitis traits (susceptibility to different pathogens causing mastitis in dairy cattle) and unspecific mastitis, and 2) to compare selection differentials for an udder health index consisting of 5...... different pathogen-specific mastitis traits and lactation average somatic cell count from 5 to 170 d after first calving (LASCC170) with another index consisting of 1 unspecific mastitis trait and LASCC170. Economic values were estimated for mastitis caused by Staphylococcus aureus, Streptococcus...... dysgalactiae, Escherichia coli, coagulase-negative staphylococci, and Streptococcus uberis using a stochastic simulation model (SimHerd IV). Mastitis incidences for SimHerd IV were from incidences of mastitis treatments in primiparous Danish Holstein cows calving in 2007. Estimated costs ranged from 149 euro...
Directory of Open Access Journals (Sweden)
Muhammad Zuhaib Khan
2016-01-01
Full Text Available Background. Blood-borne viral infections like viral hepatitis are highly prevalent in Pakistan. There is also a potential threat of human immunodeficiency virus (HIV spread in the country. Health care workers (HCWs are a high risk population for acquiring such viral infections and potential spread to the patients. This study aimed to determine the frequency of three blood-borne viruses: HCV, HBV, and HIV in HCWs of district Malakand in northern Khyber Pakhtunkhwa (KPK province of Pakistan. Moreover, risk factors and preventive behaviors among HCWs were investigated in detail. Materials and Methods. Prevalence was investigated using serological assays followed by real time polymerase chain reaction (RT-PCR based characterization. A total of 626 health care workers working at 17 different health care units, belonging to 6 different job categories, were included in this study. Results. HIV was not detected in the HCWs while rate of prevalence of HCV and HBV was far less (0.8 % and 0.64 %, resp. as compared to general population (4.7%–38%. The majority of HCWs were aware of the mode of spread of these viruses and associated risk factors. Needle stick injury was found to be the most important risk factor for possible acquisition of these infections.
Backer, Ronald; Schwandt, Timo; Greuter, Mascha; Oosting, Marije; Jüngerkes, Frank; Tüting, Thomas; Boon, Louis; O’Toole, Tom; Kraal, Georg; Limmer, Andreas; den Haan, Joke M. M.
2009-01-01
The spleen is the lymphoid organ that induces immune responses toward blood-borne pathogens. Specialized macrophages in the splenic marginal zone are strategically positioned to phagocytose pathogens and cell debris, but are not known to play a role in the activation of T-cell responses. Here we demonstrate that splenic marginal metallophilic macrophages (MMM) are essential for cross-presentation of blood-borne antigens by splenic dendritic cells (DCs). Our data demonstrate that antigens targeted to MMM as well as blood-borne adenoviruses are efficiently captured by MMM and exclusively transferred to splenic CD8+ DCs for cross-presentation and for the activation of cytotoxic T lymphocytes. Depletion of macrophages in the marginal zone prevents cytotoxic T-lymphocyte activation by CD8+ DCs after antibody targeting or adenovirus infection. Moreover, we show that tumor antigen targeting to MMM is very effective as antitumor immunotherapy. Our studies point to an important role for splenic MMM in the initial steps of CD8+ T-cell immunity by capturing and concentrating blood-borne antigens and the transfer to cross-presenting DCs which can be used to design vaccination strategies to induce antitumor cytotoxic T-cell immunity. PMID:20018690
S. E. Meyer; M. Masi; S. Clement; T. L. Davis; J. Beckstead
2015-01-01
Pyrenophora semeniperda, an important pathogen in Bromus tectorum seed banks in semi-arid western North America, exhibits >4-fold variation in mycelial growth rate. Host seeds exhibit seasonal changes in dormancy that affect the risk of pathogen-caused mortality. The hypothesis tested is that contrasting seed dormancy phenotypes select for contrasting strategies...
Hegde, Shivanand; Hegde, Shrilakshmi; Zimmermann, Martina; Flöck, Martina; Spergser, Joachim; Rosengarten, Renate; Chopra-Dewasthaly, Rohini
2015-01-01
Mycoplasmas possess complex pathogenicity determinants that are largely unknown at the molecular level. Mycoplasma agalactiae serves as a useful model to study the molecular basis of mycoplasma pathogenicity. The generation and in vivo screening of a transposon mutant library of M. agalactiae were employed to unravel its host colonization factors. Tn4001mod mutants were sequenced using a novel sequencing method, and functionally heterogeneous pools containing 15 to 19 selected mutants were sc...
Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Eronat, Cemal
2008-09-01
The aim of the present study was to evaluate the presence of the selected pathogens in samples from deciduous and permanent tooth root canals by using PCR method and to determine the association of these organisms with clinical symptoms. A total of 145 children, 5 to 13 years old, were involved in this study. The presence of selected pathogens (Actinomyces israelii, Candida albicans, Enterococcus faecalis, Fusobacterium nucleatum, Porphyromonas endodontalis, Porphyromonas gingivalis, Prevotella intermedia, Streptococcus intermedius, Treponema denticola, Parvimonas micra, Tannerella forsythensis, Enterococcus faecium, Prevotella melaninogenica) in infected root canals was studied using PCR. T. denticola (P = .012, .02) and E. faecalis (P = .012, .04) were highly associated with periapical radiolucency and previous pain, while P. gingivalis was associated with tenderness to percussion in both deciduous and permanent teeth (P = .01, .015). The results of the present study confirm that certain species of microorganisms are associated with clinical signs and symptoms of endodontic disease in both deciduous and permanent teeth.
Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.
2015-01-01
Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930
Science and Technology Review January/February 2010
International Nuclear Information System (INIS)
Bearinger, J.P.
2009-01-01
This month's issue has the following articles: (1) Innovative Materials Rise to the Radiation Challenge - Commentary by Bruce Warner; (2) The Hunt for Better Radiation Detection - New materials will help radiation detectors pick up weak signals and accurately identify illicit radioactive sources; (3) Time-Critical Technology Identifies Deadly Bloodborne Pathogens - A portable device can simultaneously distinguish up to five bloodborne pathogens in just minutes; (4) Defending Computer Networks against Attack - A Laboratory effort takes a new approach to detecting increasingly sophisticated cyber attacks; and (5) Imaging Cargo's Inner Secrets - Livermore-University of California collaborators are modeling a new radiographic technique for identifying nuclear materials concealed inside cargo containers.
Transient virulence of emerging pathogens.
Bolker, Benjamin M; Nanda, Arjun; Shah, Dharmini
2010-05-06
Should emerging pathogens be unusually virulent? If so, why? Existing theories of virulence evolution based on a tradeoff between high transmission rates and long infectious periods imply that epidemic growth conditions will select for higher virulence, possibly leading to a transient peak in virulence near the beginning of an epidemic. This transient selection could lead to high virulence in emerging pathogens. Using a simple model of the epidemiological and evolutionary dynamics of emerging pathogens, along with rough estimates of parameters for pathogens such as severe acute respiratory syndrome, West Nile virus and myxomatosis, we estimated the potential magnitude and timing of such transient virulence peaks. Pathogens that are moderately evolvable, highly transmissible, and highly virulent at equilibrium could briefly double their virulence during an epidemic; thus, epidemic-phase selection could contribute significantly to the virulence of emerging pathogens. In order to further assess the potential significance of this mechanism, we bring together data from the literature for the shapes of tradeoff curves for several pathogens (myxomatosis, HIV, and a parasite of Daphnia) and the level of genetic variation for virulence for one (myxomatosis). We discuss the need for better data on tradeoff curves and genetic variance in order to evaluate the plausibility of various scenarios of virulence evolution.
Detection of pathogenic Leptospira from selected environment in Kelantan and Terengganu, Malaysia.
Ridzlan, F R; Bahaman, A R; Khairani-Bejo, S; Mutalib, A R
2010-12-01
Leptospirosis is recognized as one of the important zoonotic diseases in the world including Malaysia. A total of 145 soil and water samples were collected from selected National Service Training Centres (NSTC) in Kelantan and Terengganu. The samples were inoculated into modified semisolid Ellinghausen McCullough Johnson Harris (EMJH) medium, incubated at room temperature for 1 month and examined under the dark-field microscope. Positive growth of the leptospiral isolates were then confirmed with 8-Azaguanine Test, Polymerase Chain Reaction (PCR) assay and Microscopic Agglutination Test (MAT). Fifteen cultures (10.34%) exhibited positive growths which were seen under dark field microscope whilst only 20% (3/15) were confirmed as pathogenic species. based on 8-Azaguanine Test and PCR. Serological identification of the isolates with MAT showed that hebdomadis was the dominant serovar in Terengganu. Pathogenic leptospires can be detected in Malaysian environment and this has the potential to cause an outbreak. Therefore, precautionary steps against leptospirosis should be taken by camp authorities to ensure the safety of trainees.
Encourage Your Workers to Report Bloodborne Pathogen Exposures
... 6, 2014 Content source: National Institute for Occupational Safety and Health Education and Information Division Email Recommend Tweet YouTube Instagram Listen Watch RSS ABOUT About CDC Jobs Funding LEGAL Policies Privacy FOIA No Fear Act OIG 1600 Clifton Road Atlanta , GA 30329-4027 USA 800-CDC-INFO ( ...
Science & Technology Review January/February 2010
Energy Technology Data Exchange (ETDEWEB)
Bearinger, J P
2009-11-30
This month's issue has the following articles: (1) Innovative Materials Rise to the Radiation Challenge - Commentary by Bruce Warner; (2) The Hunt for Better Radiation Detection - New materials will help radiation detectors pick up weak signals and accurately identify illicit radioactive sources; (3) Time-Critical Technology Identifies Deadly Bloodborne Pathogens - A portable device can simultaneously distinguish up to five bloodborne pathogens in just minutes; (4) Defending Computer Networks against Attack - A Laboratory effort takes a new approach to detecting increasingly sophisticated cyber attacks; and (5) Imaging Cargo's Inner Secrets - Livermore-University of California collaborators are modeling a new radiographic technique for identifying nuclear materials concealed inside cargo containers.
Selection of media for antimicrobial susceptibility testing of fish pathogenic bacteria
DEFF Research Database (Denmark)
Dalsgaard, Inger
2001-01-01
3, Diagnostic Sensitivity Test Agar) have been used in addition to media (Brain Heart Infusion Agar, Heart Infusion Agar, Columbia Blood Agar) normally utilized for cultivating fastidious bacteria. When testing marine pathogens, sodium chloride or seawater has been included in the media. Media...... pattern in fish pathogenic bacteria. The American guideline from The National Committee for Clinical Laboratory Standards (NCCLS) recommends Mueller-Hinton Agar for susceptibility testing of human pathogens and this validated medium appears to be adequate for the rapidly growing fish pathogens. Following......The available data concerning antimicrobial susceptibility testing of fish pathogens showed that there is no consensus to the basal medium currently being employed. Different media recommended for susceptibility testing of human pathogens (Mueller-Hinton Agar, Tryptone Soya Agar, Antibiotic Medium...
The physician's role in selecting a factor replacement therapy.
Pipe, S W
2006-03-01
Over the past 20 years, transmissions of human immunodeficiency virus (HIV), hepatitis B virus or hepatitis C virus have been virtually eliminated from plasma-derived or recombinant therapy in the USA, a record that can be largely attributed to the use of effective screening and inactivation technologies for known pathogens. The next significant threat will likely come from the emergence of a new, blood-borne infectious disease, perhaps one transmitted by a non-lipid-enveloped virus or prion, for which current inactivation methods are ineffective. Following the HIV crisis of the 1980s, government, patient advocacy groups, medical and scientific communities and the manufacturers of clotting therapies can learn from the past and approach potential threats from emerging pathogens in a proactive and productive manner. For clinicians, this includes actively engaging patients in a dialogue about all the factors that may influence their choice of clotting factor therapies, including emerging pathogens, patient convenience, consistency and reliability of supply, relative cost/benefit ratios, reimbursement issues (where applicable), patient preference and brand loyalty. It is our obligation as healthcare providers to understand potential risks and help make proactive decisions with our patients, decisions that often must be made in an environment of scientific uncertainty. Threats from infectious agents that were once deemed theoretical can, and often do, ultimately become real, with serious implications for morbidity and mortality.
[Detection of biofilm formation by selected pathogens relevant to the food industry].
Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J
2015-09-01
Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.
Prevalence of injections and knowledge of safe injections among rural residents in Central China.
Yan, Y W; Yan, J; Zhang, G P; Gao, Z L; Jian, H X
2007-08-01
Abuse of the injection services, namely unnecessary injections and unsafe injections, exists extensively in developing countries. Unsafe injection practices contribute to the transmission of blood-borne pathogens. The aims of this study were to survey the prevalence of injections and knowledge of injection safety among the rural residents in Jingzhou district, Hubei, China and to provide scientific data for developing a health educational programme. A retrospective cross-sectional study was conducted in 12 villages, which were selected from the Jingzhou district by the random sampling method. 50 rural residents were interviewed per village using a questionnaire. Among the 595 residents studied, 192 had received at least one injection in the past three months, with an injection prevalence of 32.3 percent and an average of 0.93 injections. 90.3 percent of the rural residents knew that unsafe injections could transmit the following blood-borne pathogens: human immunodeficiency virus (74.4 percent), hepatitis B virus (55.8 percent) and hepatitis C virus (22.9 percent). Logistic regression analysis showed that the residents' age, educational level and residential area were important factors in influencing their knowledge about injection safety. The results indicated that the injection prevalence was high among rural residents in the study area, and their knowledge regarding injection safety should be further improved.
Directory of Open Access Journals (Sweden)
Rongman Cai
2011-08-01
Full Text Available Recently, genome sequencing of many isolates of genetically monomorphic bacterial human pathogens has given new insights into pathogen microevolution and phylogeography. Here, we report a genome-based micro-evolutionary study of a bacterial plant pathogen, Pseudomonas syringae pv. tomato. Only 267 mutations were identified between five sequenced isolates in 3,543,009 nt of analyzed genome sequence, which suggests a recent evolutionary origin of this pathogen. Further analysis with genome-derived markers of 89 world-wide isolates showed that several genotypes exist in North America and in Europe indicating frequent pathogen movement between these world regions. Genome-derived markers and molecular analyses of key pathogen loci important for virulence and motility both suggest ongoing adaptation to the tomato host. A mutational hotspot was found in the type III-secreted effector gene hopM1. These mutations abolish the cell death triggering activity of the full-length protein indicating strong selection for loss of function of this effector, which was previously considered a virulence factor. Two non-synonymous mutations in the flagellin-encoding gene fliC allowed identifying a new microbe associated molecular pattern (MAMP in a region distinct from the known MAMP flg22. Interestingly, the ancestral allele of this MAMP induces a stronger tomato immune response than the derived alleles. The ancestral allele has largely disappeared from today's Pto populations suggesting that flagellin-triggered immunity limits pathogen fitness even in highly virulent pathogens. An additional non-synonymous mutation was identified in flg22 in South American isolates. Therefore, MAMPs are more variable than expected differing even between otherwise almost identical isolates of the same pathogen strain.
A multicentre molecular analysis of hepatitis B and blood-borne virus coinfections in Viet Nam.
Directory of Open Access Journals (Sweden)
Linda Dunford
Full Text Available Hepatitis B (HBV infection is endemic in Viet Nam, with up to 8.4 million individuals estimated to be chronically infected. We describe results of a large, multicentre seroepidemiological and molecular study of the prevalence of HBV infection and blood-borne viral coinfections in Viet Nam. Individuals with varying risk factors for infection (n = 8654 were recruited from five centres; Ha Noi, Hai Phong, Da Nang, Khanh Hoa and Can Tho. A mean prevalence rate of 10.7% was observed and levels of HBsAg were significantly higher in injecting drug users (IDUs (17.4%, n = 174/1000 and dialysis patients (14.3%, n = 82/575 than in lower-risk groups (9.4%; p<0.001. Coinfection with HIV was seen in 28% of HBV-infected IDUs (n = 49/174 and 15.2% of commercial sex workers (CSWs; n = 15/99. HCV infection was present in 89.8% of the HBV-HIV coinfected IDUs (n = 44/49 and 40% of HBV-HIV coinfected CSWs (n = 16/40. Anti-HDV was detected in 10.7% (n = 34/318 of HBsAg positive individuals. Phylogenetic analysis of HBV S gene (n = 187 showed a predominance of genotype B4 (82.6%; genotypes C1 (14.6%, B2 (2.7% and C5 (0.5% were also identified. The precore mutation G1896A was identified in 35% of all specimens, and was more frequently observed in genotype B (41% than genotype C (3%; p<0.0001. In the immunodominant 'a' region of the surface gene, point mutations were identified in 31% (n = 58/187 of sequences, and 2.2% (n = 4/187 and 5.3% (n = 10/187 specimens contained the major vaccine escape mutations G145A/R and P120L/Q/S/T, respectively. 368 HBsAg positive individuals were genotyped for the IL28B SNP rs12979860 and no significant association between the IL28B SNP and clearance of HBsAg, HBV viral load or HBeAg was observed. This study confirms the high prevalence of HBV infection in Viet Nam and also highlights the significant levels of blood-borne virus coinfections, which have important implications for hepatitis-related morbidity and development of effective
Directory of Open Access Journals (Sweden)
Juliana Benevenuto
2018-04-01
Full Text Available Host specialization is a key evolutionary process for the diversification and emergence of new pathogens. However, the molecular determinants of host range are poorly understood. Smut fungi are biotrophic pathogens that have distinct and narrow host ranges based on largely unknown genetic determinants. Hence, we aimed to expand comparative genomics analyses of smut fungi by including more species infecting different hosts and to define orphans and positively selected genes to gain further insights into the genetics basis of host specialization. We analyzed nine lineages of smut fungi isolated from eight crop and non-crop hosts: maize, barley, sugarcane, wheat, oats, Zizania latifolia (Manchurian rice, Echinochloa colona (a wild grass, and Persicaria sp. (a wild dicot plant. We assembled two new genomes: Ustilago hordei (strain Uhor01 isolated from oats and U. tritici (strain CBS 119.19 isolated from wheat. The smut genomes were of small sizes, ranging from 18.38 to 24.63 Mb. U. hordei species experienced genome expansions due to the proliferation of transposable elements and the amount of these elements varied among the two strains. Phylogenetic analysis confirmed that Ustilago is not a monophyletic genus and, furthermore, detected misclassification of the U. tritici specimen. The comparison between smut pathogens of crop and non-crop hosts did not reveal distinct signatures, suggesting that host domestication did not play a dominant role in shaping the evolution of smuts. We found that host specialization in smut fungi likely has a complex genetic basis: different functional categories were enriched in orphans and lineage-specific selected genes. The diversification and gain/loss of effector genes are probably the most important determinants of host specificity.
Hegde, Shivanand; Hegde, Shrilakshmi; Zimmermann, Martina; Flöck, Martina; Spergser, Joachim; Rosengarten, Renate; Chopra-Dewasthaly, Rohini
2015-07-01
Mycoplasmas possess complex pathogenicity determinants that are largely unknown at the molecular level. Mycoplasma agalactiae serves as a useful model to study the molecular basis of mycoplasma pathogenicity. The generation and in vivo screening of a transposon mutant library of M. agalactiae were employed to unravel its host colonization factors. Tn4001mod mutants were sequenced using a novel sequencing method, and functionally heterogeneous pools containing 15 to 19 selected mutants were screened simultaneously through two successive cycles of sheep intramammary infections. A PCR-based negative selection method was employed to identify mutants that failed to colonize the udders and draining lymph nodes in the animals. A total of 14 different mutants found to be absent from ≥ 95% of samples were identified and subsequently verified via a second round of stringent confirmatory screening where 100% absence was considered attenuation. Using this criterion, seven mutants with insertions in genes MAG1050, MAG2540, MAG3390, uhpT, eutD, adhT, and MAG4460 were not recovered from any of the infected animals. Among the attenuated mutants, many contain disruptions in hypothetical genes, implying their previously unknown role in M. agalactiae pathogenicity. These data indicate the putative role of functionally different genes, including hypothetical ones, in the pathogenesis of M. agalactiae. Defining the precise functions of the identified genes is anticipated to increase our understanding of M. agalactiae infections and to develop successful intervention strategies against it. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Diets, Illja J.; Waanders, Esme; Ligtenberg, Marjolijn J.; van Bladel, Diede A. G.; Kamping, Eveline J.; Hoogerbrugge, Peter M.; Hopman, Saskia; Olderode-Berends, Maran J.; Gerkes, Erica H.; Koolen, David A.; Marcelis, Carlo; Santen, Gijs W.; van Belzen, Martine J.; Mordaunt, Dylan; McGregor, Lesley; Thompson, Elizabeth; Kattamis, Antonis; Pastorczak, Agata; Mlynarski, Wojciech; Ilencikova, Denisa; Vulto-van Silfhout, Anneke; Gardeitchik, Thatjana; de Bont, Eveline S.; Loeffen, Jan; Wagner, Anja; Mensenkamp, Arjen R.; Kuiper, Roland P.; Hoogerbrugge, Nicoline; Jongmans, Marjolijn C.
2018-01-01
Purpose: In many children with cancer and characteristics suggestive of a genetic predisposition syndrome, the genetic cause is still unknown. We studied the yield of pathogenic mutations by applying whole-exome sequencing on a selected cohort of children with cancer. Experimental Design: To
Selection of media for antimicrobial susceptibility testing of fish pathogenic bacteria
DEFF Research Database (Denmark)
Dalsgaard, Inger
2001-01-01
The available data concerning antimicrobial susceptibility testing of fish pathogens showed that there is no consensus to the basal medium currently being employed. Different media recommended for susceptibility testing of human pathogens (Mueller-Hinton Agar, Tryptone Soya Agar, Antibiotic Medium...... 3, Diagnostic Sensitivity Test Agar) have been used in addition to media (Brain Heart Infusion Agar, Heart Infusion Agar, Columbia Blood Agar) normally utilized for cultivating fastidious bacteria. When testing marine pathogens, sodium chloride or seawater has been included in the media. Media...... normally used for cultivation of pathogens with specific growth requirements like Flavobacterium species and Renibacterium salmoninarum have been used for susceptibility testing. The Mueller-Hinton Agar and different modifications of this medium was used most frequently in published studies on resistant...
Social barriers to pathogen transmission in wild animal populations
Energy Technology Data Exchange (ETDEWEB)
Loehle, C.
1995-03-01
Diseases and pathogens are receiving increasing recognition as sources of mortality in animal populations. Immune system strength is clearly important in fending off pathogen attack. Physical barriers to pathogen entry are also important. Various individual behaviors are efficacious in reducing contact with diseases and pests. This paper focuses on a fourth mode of defense: social barriers to transmission. Various social behaviors have pathogen transmission consequences. Selective pressures on these social behaviors may therefore exist. Effects on pathogen transmission of mating strategies, social avoidance, group size, group isolation, and other behaviors are explored. It is concluded that many of these behaviors may have been affected by selection pressures to reduce transmission of pathogens. 84 refs., 1 tab.
Social and behavioral barriers to pathogen transmission in wild animal populations
Energy Technology Data Exchange (ETDEWEB)
Loehle, C.S.
1988-12-31
Disease and pathogens have been studied as regulators of animal populations but not really as selective forces. The authors propose that pathogens can be major selective forces influencing social behaviors when these are successful at reducing disease transmission. The behaviors whose evolution could have been influenced by pathogen effects include group size, group isolation, mixed species flocking, migration, seasonal sociality, social avoidance, and dominance behaviors. Mate choice, mating system, and sexual selection are put in a new light when examined in terms of disease transmission. It is concluded that pathogen avoidance is a more powerful selective force than has heretofore been recognized.
Diets, I.J.; Waanders, E.; Ligtenberg, M.J.L.; Bladel, D.A.G. van; Kamping, E.J.; Hoogerbrugge, P.M.; Hopman, S.; Olderode-Berends, M.J.; Gerkes, E.H.; Koolen, D.A.; Marcelis, C.L.; Santen, G.W.E.; Belzen, M.J. van; Mordaunt, D.; McGregor, L.; Thompson, E.; Kattamis, A.; Pastorczak, A.; Mlynarski, W.; Ilencikova, D.; Vulto-van Silfhout, A.T.; Gardeitchik, T.; Bont, E.S. de; Loeffen, J.; Wagner, A.; Mensenkamp, A.R.; Kuiper, R.P.; Hoogerbrugge, N.; Jongmans, M.C.
2018-01-01
Purpose: In many children with cancer and characteristics suggestive of a genetic predisposition syndrome, the genetic cause is still unknown. We studied the yield of pathogenic mutations by applying whole-exome sequencing on a selected cohort of children with cancer.Experimental Design: To identify
Uhart, Marcela M; Rago, M Virginia; Marull, Carolina A; Ferreyra, Hebe del Valle; Pereira, Javier A
2012-10-01
Wild carnivores share a high percentage of parasites and viruses with closely related domestic carnivores. Because of increased overlap and potential contact with domestic species, we conducted a retrospective serosurvey for 11 common carnivore pathogens in 40 Geoffroy's cats (Leopardus geoffroyi) sampled between 2000 and 2008 within or near two protected areas in central Argentina (Lihué Calel National Park, La Pampa, and Campos del Tuyú National Park, Buenos Aires), as well as five domestic cats and 11 domestic dogs from catde ranches adjacent to Lihué Calel Park. Geoffroy's cats had detectable antibody to canine distemper virus (CDV), feline calicivirus (FCV), feline coronavirus, feline panleukopenia virus (FPV), Toxoplasma gondii, Leptospira interrogans (serovars Ictero/Icter and Ballum), and Dirofilaria immitis. None of the wild cats had antibodies to feline herpesvirus, feline immunodeficiency virus (FIV), feline leukemia virus, or rabies virus. Domestic dogs had antibodies to CDV, canine adenovirus, canine herpesvirus, and canine parvovirus. Antibodies to FPV, FCV, FIV, and T. gondii were found in domestic cats. We provide the first data on exposure of free-ranging Geoffroy's cats to pathogens at two sites within the core area of the species distribution range, including the first report of antibodies to CDV in this species. We encourage continued monitoring for diseases in wild and domestic carnivores as well as preventive health care for domestic animals, particularly in park buffer zones where overlap is greatest.
Duris, Joseph W.; Reif, Andrew G.; Donna A. Crouse,; Isaacs, Natasha M.
2013-01-01
, stx1, and rfbO157 genes, but no genes were related exclusively to an individual MST marker. The human source pharmaceuticals (HSPs) acetaminophen and caffeine were correlated with Giardia, and the presence of HSPs proved to be more useful than MST markers in distinguishing the occurrence of Giardia. The HSPs caffeine and carbamazepine were correlated with the sum total of pathogen genes detected in a sample, demonstrating the value of using HSPs as an indicator of fecally derived pathogens. Sites influenced by urban land use with less forest were more likely to have greater FIB and Giardia densities and sum of the array of pathogen genes. Sites dominated by shallow carbonate bedrock in the upstream catchment were likely to have greater FIB densities and higher sum totals of pathogen genes but no correlation with Giardia detection. Our study provides a range of specific environmental, chemical, geologic, and land-use variables related to occurrence and distribution of FIB and selected bacterial and protozoan pathogens in Pennsylvania streams. The information presented could be useful for resource managers in understanding bacterial and protozoan pathogen occurrence and their relation to fecal indicator bacteria in similar settings.
CSIR Research Space (South Africa)
Tesfaye, T
2018-02-01
Full Text Available Commercially processed, untreated chicken feathers are biologically hazardous due to the presence of blood-borne pathogens. Prior to valorisation, it is crucial that they are decontaminated to remove the microbial contamination. The present study...
Directory of Open Access Journals (Sweden)
Ehab Omer Abdalla
2016-05-01
Full Text Available Objective: To evaluate the antimicrobial activity of methanolic extracts of six marine macroalgae belonging to green algae (Chlorophyceae, brown algae (Phaeophyceae and the red algae (Rhodophyceae collected from the intertidal area of the Sudanese Red Sea coast near Port Sudan. Methods: Methanol was used for extracting the active principles of the algae and the disc diffusion method was performed to examine the activity and the minimum inhibitory concentration of the samples against four pathogenic bacteria and two fungi. Results: All tested algal extracts exhibited considerable bioactivity and inhibited the growth of all pathogenic microorganisms under investigation. The green alga Caulerpa racemosa produced the maximum inhibition zone (21 mm against Candida albicans while the red alga Laurencia papillosa showed low antimicrobial activity with the minimum inhibition zone of 10 mm against Pseudomonas aeruginosa. The tested algal extracts did not show any special antimicrobial influence on the selected microorganisms when they were considered as Grampositive and Gram-negative bacteria and fungi but the most efficient methanolic extracts in inhibiting microbial growth were those of green macroalgae followed by the brown and the red macroalgae respectively. Conclusions: The study demonstrated that the tested marine macroalgae from Sudanese Red Sea coast may represent a potential and alternative source for secondary metabolites with antimicrobial activity.
SILAC-based comparative analysis of pathogenic Escherichia coli secretomes
DEFF Research Database (Denmark)
Boysen, Anders; Borch, Jonas; Krogh, Thøger Jensen
2015-01-01
Comparative studies of pathogenic bacteria and their non-pathogenic counterparts has led to the discovery of important virulence factors thereby generating insight into mechanisms of pathogenesis. Protein-based antigens for vaccine development are primarily selected among unique virulence...... experimental approach. In addition we find proteins that are not unique to the pathogenic strains but expressed at levels different from the commensal strain, including the colonization factor YghJ and the surface adhesin antigen 43, which is involved in pathogenesis of other Gram-negative bacteria......-related factors produced by the pathogen of interest. However, recent work indicates that proteins that are not unique to the pathogen but instead selectively expressed compared to its non-pathogenic counterpart could also be vaccine candidates or targets for drug development. Modern methods in quantitative...
Directory of Open Access Journals (Sweden)
David Bushek
2016-08-01
Full Text Available Abstract Humans rely on marine ecosystems for a variety of services but often impact these ecosystems directly or indirectly limiting their capacity to provide such services. One growing impact is the emergence of marine disease. We present results from a unique case study examining how oysters, a dominant organism in many coastal bays and estuaries that is often harvested for food, have responded to pathogens influenced by human activities, namely the introduction of novel pathogens. Climate change has enabled a northward spread and establishment of Dermo disease in oysters along the eastern seaboard of North America and human activities inadvertently introduced MSX disease along this same coast. Oysters in Delaware Bay have responded differently to each pathogen, and uniquely to MSX disease by developing a highly resistant baywide population not documented in any other bay. Offspring were produced using parents collected from low or high disease (MSX and Dermo regions of Delaware Bay and exposed in a common garden experiment along with a naïve population from Maine. Results indicated widespread resistance to MSX disease, but not to Dermo disease, across Delaware Bay. One striking result was the demonstration of resilience in the population through its capacity to spread, presumably through larval transport, resistance to MSX disease into portions of the population that have experienced little to no MSX disease pressure themselves. Related studies indicated that larval transport mechanisms allowed widespread dispersal such that the entire metapopulation could acquire a high level of resistance over time if disease resistance is sufficiently heritable. The findings have implications for restoration, management and recovery of diseased populations. Namely, that if left to their own devices, natural selection may find a solution that enables populations to recover from introduced pathogens.
Directory of Open Access Journals (Sweden)
Peter Vaupel
2014-03-01
Full Text Available Hypoxic tissue subvolumes are a hallmark feature of solid malignant tumors, relevant for cancer therapy and patient outcome because they increase both the intrinsic aggressiveness of tumor cells and their resistance to several commonly used anticancer strategies. Pathogenetic mechanisms leading to hypoxia are diverse, may coexist within the same tumor and are commonly grouped according to the duration of their effects. Chronic hypoxia is mainly caused by diffusion limitations resulting from enlarged intercapillary distances and adverse diffusion geometries and — to a lesser extent — by hypoxemia, compromised perfusion or long-lasting microregional flow stops. Conversely, acute hypoxia preferentially results from transient disruptions in perfusion. While each of these features of the tumor microenvironment can contribute to a critical reduction of oxygen availability, the delivery of imaging agents (as well as nutrients and anticancer agents may be compromised or remain unaffected. Thus, a critical appraisal of the effects of the various mechanisms leading to hypoxia with regard to the blood-borne delivery of imaging agents is necessary to judge their ability to correctly represent the hypoxic phenotype of solid malignancies.
Sensitizing pathogens to antibiotics using the CRISPR-Cas system.
Goren, Moran; Yosef, Ido; Qimron, Udi
2017-01-01
The extensive use of antibiotics over the last century has resulted in a significant artificial selection pressure for antibiotic-resistant pathogens to evolve. Various strategies to fight these pathogens have been introduced including new antibiotics, naturally-derived enzymes/peptides that specifically target pathogens and bacteriophages that lyse these pathogens. A new tool has recently been introduced in the fight against drug-resistant pathogens-the prokaryotic defense mechanism-clustered regularly interspaced short palindromic repeats-CRISPR associated (CRISPR-Cas) system. The CRISPR-Cas system acts as a nuclease that can be guided to cleave any target DNA, allowing sophisticated, yet feasible, manipulations of pathogens. Here, we review pioneering studies that use the CRISPR-Cas system to specifically edit bacterial populations, eliminate their resistance genes and combine these two strategies in order to produce an artificial selection pressure for antibiotic-sensitive pathogens. We suggest that intelligent design of this system, along with efficient delivery tools into pathogens, may significantly reduce the threat of antibiotic-resistant pathogens. Copyright © 2016 Elsevier Ltd. All rights reserved.
Microbial antagonism as a potential solution for controlling selected root pathogens of crops
Cooper, Sarah; Agnew, Linda; Pereg, Lily
2016-04-01
Root pathogens of crops can cause large reduction in yield, however, there is a limited range of effective methods to control such pathogens. Soilborne pathogens that infect roots often need to survive in the rhizosphere, where there is high competition from other organisms. In such hot spots of microbial activity and growth, supported by root exudates, microbes have evolved antagonistic mechanisms that give them competitive advantages in winning the limited resources. Among these mechanisms is antibiosis, with production of some significant antifungal compounds including, antibiotics, volatile organic compounds, hydrogen cyanide and lytic enzymes. Some of these mechanisms may suppress disease through controlling the growth of root pathogens. In this project we isolated various fungi and bacteria that suppress the growth of cotton pathogens in vitro. The pathogen-suppressive microbes were isolated from cotton production soils that are under different management strategies, with and without the use of organic amendments. The potential of pathogen-suppressing microbes for controlling the black root rot disease, caused by the soilborne pathogen Thielaviopsis basicola, was confirmed using soil assays. We identified isolates with potential use as inoculant for cotton production in Australia. Having isolated a diverse group of antagonistic microbes enhances the probability that some would survive well in the soil and provide an alternative approach to address the problem of root disease affecting agricultural crops.
The absorbed dose to blood from blood-borne activity
International Nuclear Information System (INIS)
Hänscheid, H; Fernández, M; Lassmann, M
2015-01-01
The radiation absorbed dose to blood and organs from activity in the blood is relevant for nuclear medicine dosimetry and for research in biodosimetry. The present study provides coefficients for the average absorbed dose rates to the blood from blood-borne activity for radionuclides frequently used in targeted radiotherapy and in PET diagnostics. The results were deduced from published data for vessel radius-dependent dose rate coefficients and reasonable assumptions on the blood-volume distribution as a function of the vessel radius. Different parts of the circulatory system were analyzed separately. Vessel size information for heart chambers, aorta, vena cava, pulmonary artery, and capillaries was taken from published results of morphometric measurements. The remaining blood not contained in the mentioned vessels was assumed to reside in fractal-like vascular trees, the smallest branches of which are the arterioles or venules. The applied vessel size distribution is consistent with recommendations of the ICRP on the blood-volume distribution in the human. The resulting average absorbed dose rates to the blood per nuclear disintegration per milliliter (ml) of blood are (in 10 −11 Gy·s −1 ·Bq −1 ·ml) Y-90: 5.58, I-131: 2.49, Lu-177: 1.72, Sm-153: 2.97, Tc-99m: 0.366, C-11: 4.56, F-18: 3.61, Ga-68: 5.94, I-124: 2.55. Photon radiation contributes 1.1–1.2·10 −11 Gy·s −1 ·Bq −1 ·ml to the total dose rate for positron emitters but significantly less for the other nuclides. Blood self-absorption of the energy emitted by ß-particles in the whole blood ranges from 37% for Y-90 to 80% for Tc-99m. The correspondent values in vascular trees, which are important for the absorbed dose to organs, range from 30% for Y-90 to 82% for Tc-99m. (paper)
Wijk, P.T.L. van; Pelk-Jongen, M; Wijkmans, C.J.; Voss, A.; Timen, A.; Schneeberger, P.M.
2008-01-01
BACKGROUND: Blood exposure incidents pose a risk for transmission of bloodborne pathogens for both health care workers and public health. Despite several national and international guidelines, counsellors have often different opinions about the risks caused by these incidents. Little is known about
2016-02-01
To prevent transmission of bloodborne pathogens, it is important that health care providers adhere to standard precautions, follow fundamental infection-control principles, and use appropriate procedural techniques. All obstetrician-gynecologists who provide clinical care should receive the hepatitis B virus vaccine series. The Society for Healthcare Epidemiology of America has established guidelines for the management of health care providers who are infected with hepatitis B virus, hepatitis C virus, or human immunodeficiency virus (HIV). The guidelines categorize representative obstetric and gynecologic procedures according to level of risk of bloodborne pathogen transmission and include recommendations for health care provider clinical activities, based on these categories and viral burden. It is important to note that when no restrictions are recommended, careful supervision should be carried out as highlighted. These recommendations provide a framework within which to consider such cases; however, each case should be independently considered in context by the expert review panel.
Impact of electromagnetic field on the pathogenicity of selected ...
African Journals Online (AJOL)
Rhipicephalus decoloratus) to variable intensities of electromagnetic field for different periods of time was examined on their pathogenicity on tick. Some bacterial isolates from the macerate of tick cadavers were used in the infection of healthy engorged ...
insect vectors of pathogens in selected undisposed refuse dumps
African Journals Online (AJOL)
Administrator
2012-06-23
Jun 23, 2012 ... pathogens, habitat for pests such as rats, flies and mosquitoes, reduction of usable ... The generation of urban solid wastes in Nigeria is on the increase ..... utilize the slime on the side of bathroom and kitchen drains, sewage ...
Serosurvey for selected pathogens in Iberian roe deer
Directory of Open Access Journals (Sweden)
Oleaga Álvaro
2010-11-01
Full Text Available Abstract Background The roe deer is the most abundant and widespread wild Eurasian cervid. Its populations are expanding and increasingly in contact with livestock. This may affect the distribution of infectious diseases shared with other wild and domestic ungulates. Methods We investigated the antibody seroprevalence against Pestivirus, Herpesvirus, Bluetongue (BT virus, M. avium paratuberculosis (MAP, and Brucella sp. in 519 roe deer from different regions in Spain, south-western Europe. Results No antibodies were detected against BT and Brucella sp. However, antibodies were detected against Pestivirus (1.5%, Herpesvirus (0.2% and MAP (9.2%. MAP antibodies were detected in seven of the eight populations (range 5-16.4%. Conclusions The detection of MAP antibodies in samples from most roe deer populations suggests that contact with MAP is widespread in this wildlife species. The highest prevalence was detected in sites with abundant dairy cattle and frequent use of liquid manure on pastures. Considering the results obtained regarding exposure to different pathogens, we suggest that antibody prevalences in this non-gregarious browser are largely determined by environmental factors, potentially modulating vector populations or pathogen survival in the environment.
Directory of Open Access Journals (Sweden)
Alexander Rodriguez-Palacios
2016-01-01
Full Text Available Emerging enteric pathogens could have not only more antibiotic resistance or virulence traits; they could also have increased resistance to heat. We quantified the effects of minimum recommended cooking and higher temperatures, individually on a collection of C. difficile isolates and on the survival probability of a mixture of emerging C. difficile strains. While minimum recommended cooking time/temperature combinations (63–71°C allowed concurrently tested strains to survive, higher subboiling temperatures reproducibly favored the selection of newly emerging C. difficile PCR ribotype 078. Survival ratios for “ribotypes 078” : “other ribotypes” (n=49 : 45 isolates from the mid-2000s increased from 1 : 1 and 0.7 : 1 at 85°C (for 5 and 10 minutes, resp. to 2.3 : 1 and 3 : 1 with heating at 96°C (for 5 and 10 minutes, resp. indicating an interaction effect between the heating temperature and survival of C. difficile genotypes. In multistrain heating experiments, with PCR ribotypes 027 and 078 from 2004 and reference type strain ATCC 9689 banked in the 1970s, multinomial logistic regression (P<0.01 revealed PCR ribotype 078 was the most resistant to increasing lethal heat treatments. Thermal processes (during cooking or disinfection may contribute to the selection of emergent specific virulent strains of C. difficile. Despite growing understanding of the role of cooking on human evolution, little is known about the role of cooking temperatures on the selection and evolution of enteric pathogens, especially spore-forming bacteria.
Boswell, F J; Andrews, J M; Jevons, G; Wise, R
2002-10-01
In this study the in vitro activities and pharmacodynamic properties of moxifloxacin, levofloxacin, gatifloxacin and gemifloxacin were compared on recently isolated respiratory pathogens and strains of Streptococcus pneumoniae with known mechanisms of fluoroquinolone resistance. In addition, the resistance selection frequencies of moxifloxacin and levofloxacin on three recently isolated respiratory pathogens and four strains of S. pneumoniae with known mechanisms of fluoroquinolone resistance were investigated. The four fluoroquinolones had similar activities against both Moraxella catarrhalis (MIC(90)s 0.015-0.06 mg/L) and Haemophilus influenzae (MIC(90)s 0.008-0.03 mg/L). More marked differences in activity were noted with S. pneumoniae, with MIC(90)s of 0.25, 1, 0.5 and 0.03 mg/L for moxifloxacin, levofloxacin, gatifloxacin and gemifloxacin, respectively. With the S. pneumoniae strains, the four fluoroquinolones exhibited similar concentration-dependent time-kill kinetics. The resistance selection frequencies of levofloxacin were higher than those of moxifloxacin at concentrations equivalent to those at the end of the dosing interval. Therefore moxifloxacin may have less of an impact on the development of resistance than levofloxacin.
78 FR 52848 - Occupational Safety and Health Standards for Aircraft Cabin Crewmembers
2013-08-27
... air quality issues; food/beverage carts; and ergonomics. OSHA's noise, bloodborne pathogens, and... exposure, cabin air quality, food and beverage cart and ergonomic issues are not being considered at this... comments from the National Institute for Occupational Safety and Health that cited several studies it...
Czech Academy of Sciences Publication Activity Database
Sanchez-Mazas, A.; Černý, V.; Di, D.; Buhler, S.; Podgorná, Eliška; Chevallier, E.; Brunet, L.; Weber, S.; Kervaire, B.; Testi, M.; Andreani, M.; Tiercy, J.-M.; Villard, J.; Nunes, J. M.
2017-01-01
Roč. 26, č. 22 (2017), s. 6238-6252 ISSN 0962-1083 R&D Projects: GA ČR GA13-37998S Institutional support: RVO:67985912 Keywords : African populations * geographic patterns * HLA polymorphism and disease associations * human population genetics * malaria protection * pathogen-driven selection Subject RIV: AC - Archeology, Anthropology, Ethnology OBOR OECD: Archaeology Impact factor: 6.086, year: 2016
DEFF Research Database (Denmark)
Stukenbrock, Eva; Bataillon, Thomas; Dutheil, Julien
2011-01-01
that gene-rich regions or regions with low recombination experience stronger effects of natural selection on neutral diversity. Emergence of a new agricultural host selected a highly specialized and fast-evolving pathogen with unique evolutionary patterns compared with its wild relatives. The strong impact...
2010-10-01
... provide information and training on biosafety and security to each individual with access approval from... entity must provide information and training on biosafety and security to each individual not approved... provided under the OSHA Bloodborne Pathogen Standard set forth at 29 CFR 1910.1030. (b) Refresher training...
Directory of Open Access Journals (Sweden)
Martin Meyer
2016-08-01
Full Text Available We here compared pathogenic (p and non-pathogenic (np isolates of Entamoeba histolytica to identify molecules involved in the ability of this parasite to induce amoebic liver abscess (ALA-like lesions in two rodent models for the disease. We performed a comprehensive analysis of 12 clones (A1-A12 derived from a non-pathogenic isolate HM-1:IMSS-A and 12 clones (B1-B12 derived from a pathogenic isolate HM-1:IMSS-B. "Non-pathogenicity" included the induction of small and quickly resolved lesions while "pathogenicity" comprised larger abscess development that overstayed day 7 post infection. All A-clones were designated as non-pathogenic, whereas 4 out of 12 B-clones lost their ability to induce ALAs in gerbils. No correlation between ALA formation and cysteine peptidase (CP activity, haemolytic activity, erythrophagocytosis, motility or cytopathic activity was found. To identify the molecular framework underlying different pathogenic phenotypes, three clones were selected for in-depth transcriptome analyses. Comparison of a non-pathogenic clone A1np with pathogenic clone B2p revealed 76 differentially expressed genes, whereas comparison of a non-pathogenic clone B8np with B2p revealed only 19 differentially expressed genes. Only six genes were found to be similarly regulated in the two non-pathogenic clones A1np and B8np in comparison with the pathogenic clone B2p. Based on these analyses, we chose 20 candidate genes and evaluated their roles in ALA formation using the respective gene-overexpressing transfectants. We conclude that different mechanisms lead to loss of pathogenicity. In total, we identified eight proteins, comprising a metallopeptidase, C2 domain proteins, alcohol dehydrogenases and hypothetical proteins, that affect the pathogenicity of E. histolytica.
Meyer, Martin; Fehling, Helena; Matthiesen, Jenny; Lorenzen, Stephan; Schuldt, Kathrin; Bernin, Hannah; Zaruba, Mareen; Lender, Corinna; Ernst, Thomas; Ittrich, Harald; Roeder, Thomas; Tannich, Egbert; Lotter, Hannelore; Bruchhaus, Iris
2016-08-01
We here compared pathogenic (p) and non-pathogenic (np) isolates of Entamoeba histolytica to identify molecules involved in the ability of this parasite to induce amoebic liver abscess (ALA)-like lesions in two rodent models for the disease. We performed a comprehensive analysis of 12 clones (A1-A12) derived from a non-pathogenic isolate HM-1:IMSS-A and 12 clones (B1-B12) derived from a pathogenic isolate HM-1:IMSS-B. "Non-pathogenicity" included the induction of small and quickly resolved lesions while "pathogenicity" comprised larger abscess development that overstayed day 7 post infection. All A-clones were designated as non-pathogenic, whereas 4 out of 12 B-clones lost their ability to induce ALAs in gerbils. No correlation between ALA formation and cysteine peptidase (CP) activity, haemolytic activity, erythrophagocytosis, motility or cytopathic activity was found. To identify the molecular framework underlying different pathogenic phenotypes, three clones were selected for in-depth transcriptome analyses. Comparison of a non-pathogenic clone A1np with pathogenic clone B2p revealed 76 differentially expressed genes, whereas comparison of a non-pathogenic clone B8np with B2p revealed only 19 differentially expressed genes. Only six genes were found to be similarly regulated in the two non-pathogenic clones A1np and B8np in comparison with the pathogenic clone B2p. Based on these analyses, we chose 20 candidate genes and evaluated their roles in ALA formation using the respective gene-overexpressing transfectants. We conclude that different mechanisms lead to loss of pathogenicity. In total, we identified eight proteins, comprising a metallopeptidase, C2 domain proteins, alcohol dehydrogenases and hypothetical proteins, that affect the pathogenicity of E. histolytica.
Das, Sabyasachi; Paul, Sandip; Chatterjee, Sanjib; Dutta, Chitra
2005-01-01
Intra-genomic variation in synonymous codon and amino acid usage in two human pathogens Bartonella henselae and B. quintana has been carried out through multivariate analysis. Asymmetric mutational bias, coupled with replicational-transcriptional selection, has been identified as the prime selection force behind synonymous codon selection--a characteristic of the genus Bartonella, not exhibited by any other alpha-proteobacterial genome. Distinct codon usage patterns and low synonymous divergence values between orthologous sequences of highly expressed genes from the two Bartonella species indicate that there exists a residual intra-strand synonymous codon bias in the highly expressed genes, possibly operating at the level of translation. In the case of amino acid usage, the mean hydropathy level and aromaticity are the major sources of variation, both having nearly equal impact, while strand-specific mutational pressure and gene expressivity strongly influence the inter-strand variations. In both species under study, the highly expressed gene products tend not to contain heavy and/or aromatic residues, following the cost-minimization hypothesis in spite of their intracellular lifestyle. The codon and amino acid usage in these two human pathogens are, therefore, consequences of a complex balance between replicational-transcriptional selection, translational control, protein hydropathy and cost minimization.
Prevalence of Needle Stick Injuries among Healthcare Workers in ...
African Journals Online (AJOL)
Background: Needle stick injuries represent one of the most important occupational hazards to which health workers are exposed. These injuries result from accidental piercing of the skin and or mucous membranes by sharp objects. Needle stick injuries carry the risk of exposure to blood-borne pathogens, especially ...
Development and function of the splenic marginal zone
Mebius, Reina E.; Nolte, Martijn A.; Kraal, Georg
2004-01-01
The marginal zone of the spleen is a crucial region where blood-borne pathogens are sequestered by macrophages with unique arrays of scavenger molecules. In addition, a special population of B cells, which is capable of rapid activation, resides in this region. Marginal zone B cells and macrophages
The prevalence of malarial parasitaemia among blood donors in ...
African Journals Online (AJOL)
BACKGROUND: Blood serves as a vehicle for transmission of blood-borne pathogens and transfusion-associated malaria is a major concern in malaria endemic countries. The study was conducted to determine the prevalence of malaria parasite among blood donors in Zaria, Nigeria. METHODS: A total of 160 venous ...
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
2008-10-15
Oct 15, 2008 ... Hepatitis C is an emerging infection in India and an important pathogen causing liver disease in India. The high risk of chronicity of this blood-borne infection and its association with hepatocellular carcinoma underscores its public health importance. Blood transfusion and unsafe therapeutic interventions ...
Families Living with Blood-Borne Viruses: The Case for Extending the Concept of “Serodiscordance”
Directory of Open Access Journals (Sweden)
Asha Persson
2017-01-01
Full Text Available The concept of “serodiscordance” (mixed infection status is primarily associated with epidemiological concerns about HIV transmission risk in couples. We make the case for extending this concept to include families with mixed HIV and viral hepatitis status. Social research on couples with mixed HIV and hepatitis C status has laid an important foundation for illuminating how experiences of serodiscordance within intimate partnerships are much broader than concerns about risk. This body of work attests to serodiscordance holding promise as a valuable concept for understanding viral infections as socially situated and intensely relational phenomena. However, serodiscordance is still limited as a concept because of its near universal focus on couples. It is rarely applied to wider relationships, including family networks beyond the couple. Despite evidence in the literature that families are affected by blood-borne viruses in multiple social, emotional, financial, and generational ways, the concept of serodiscordance does not capture these broader dynamics. Making serodiscordance more inclusive is an important step in recognising the diverse ways families’ everyday lives, relationships, and futures can be entangled with HIV, hepatitis C, and hepatitis B, and for understanding how today’s era of effective treatment options might shape the “family life” of viral infections.
Prevalence Survey of Selected Bovine Pathogens in Water Buffaloes in the North Region of Brazil
Directory of Open Access Journals (Sweden)
Jenevaldo Barbosa da Silva
2014-01-01
Full Text Available Although the largest buffalo herd in the occident is in the north region of Brazil, few studies have been conducted to assess the prevalence of selected parasitic diseases in buffalo herd. The present study was therefore conducted to investigate the epidemiological of Toxoplasma gondii, Neospora caninum, Anaplasma marginale, Babesia bigemina, and Babesia bovis in water buffaloes in the north region of Brazil. A total of 4796 buffalo blood samples were randomly collected from five provinces and simultaneously analyzed by the IFAT and ELISA. The serological prevalence of T. gondii and N. caninum was 41.3% and 55.5% in ELISA and 35.7% and 48.8% in IFAT, respectively. The overall prevalence of A. marginale, B. bovis, and B. bigemina was 63%, 25%, and 21% by ELISA and 50.0%, 22.5%, and 18.8% by IFAT, respectively. This study shows valuable information regarding the serological survey of selected bovine pathogens in water buffaloes in the north region of Brazil which will likely be very beneficial for the management and control programs of this disease.
International Nuclear Information System (INIS)
Fazal, H.; Ahmad, M.; Abbasi, B.H.
2012-01-01
Multi-drug resistant strains of fungi and bacteria are imposing the need for new drugs. Reliable natural sources with minor side effects are needed to control anti-human pathogenic invaders specially bacteria. Given the demands for natural products that are inherently safe and environmentally compatible, the advancement in antimicrobial potential has provided a better alternative to synthetic resistance antibiotics. In the present investigation such types of medicinal plants were selected for analyses that are used by local herbal practioners for multiple diseases. Thirty three extracts of Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina and Vetiveria zizanioides in chloroform, ethanol and hexane were investigated for their antimicrobial potential. These extracts were tested against eight microorganisms including four gram negative bacterial strains viz., Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae and Salmonella typhi, three gram positive bacterial strains Staphylococcus aureus, Bacillus subtilis and Bacillus cereus and a fungal strain viz., Candida albicans. Majority of the extracts showed marked antimicrobial potential against the tested microorganisms. (author)
Benacer, Douadi; Woh, Pei Yee; Mohd Zain, Siti Nursheena; Amran, Fairuz; Thong, Kwai Lin
2013-01-01
Leptospira species were studied in water and soils from selected urban sites in Malaysia. A total of 151 water (n=121) and soil (n=30) samples were collected from 12 recreational lakes and wet markets. All samples were filtered and inoculated into semi-solid Ellinghausen and McCullough modified by Johnson and Harris (EMJH) media supplemented with additional 5-fluorouracil. The cultures were then incubated at 30°C and observed under a dark field microscope with intervals of 10 days. A PCR assay targeting the rrs gene was used to confirm the genus Leptospira among the isolates. Subsequently, the pathogenic status of the isolates was determined using primer sets G1/G2 and Sapro1/Sapro2, which target the secY and rrs genes, respectively. The isolates were identified at serogroup level using the microscopic agglutination test (MAT) while their genetic diversity was assessed by pulsed field gel electrophoresis (PFGE). Based on dark field microscopy, 23.1% (28/121) water and 23.3% (7/30) soil cultures were positive for Leptospira spp. Of the 35 positive cultures, only 8 were pure and confirmed as Leptospira genus by PCR assay. Two out of 8 isolates were confirmed as pathogenic, 5 were saprophytic and one was intermediate. These 8 isolates were negative for the 25 reference hyperimmune rabbit sera tested in the MAT. PFGE showed that all 8 of these environmental Leptospira spp. were genetically diverse. In conclusion, the presence of pathogenic Leptospira spp. in the urban Malaysian environment may indicate and highlight the importance of water screening, especially in recreational lakes, in order to minimize any chance of Leptospira infection. PMID:23363618
Functional Analysis and Treatment of Coprophagia
Ing, Anna D.; Roane, Henry S.; Veenstra, Rebecca A.
2011-01-01
Coprophagia, the ingestion of fecal matter, occurs among some individuals with developmental disabilities and is associated with a variety of health risks (e.g., diarrhea, intestinal parasites, blood-borne pathogens; Parry-Jones & Parry-Jones, 1992). Studies that have evaluated operant-based treatments of coprophagia have been limited by a lack of…
What we do | Page 85 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Building Capacity for Conducting HIV Prevention Trials in the Health Care Workplace. Healthcare workers are a priority group for HIV prevention trials because they constitute a large relatively healthy group at risk from blood-borne diseases (hepatitis B, HIV/AIDS), as well as tuberculosis and other pathogens. South Africa ...
Role of commercial probiotic strains against human pathogen adhesion to intestinal mucus.
Collado, M C; Meriluoto, J; Salminen, S
2007-10-01
The aims of this study present were to assess and to evaluate in vitro the abilities of commercial probiotic strains derived from fermented milk products and related sources currently marketed in European countries, to inhibit, compete and displace the adhesion of selected potential pathogens to immobilized human mucus. The adhesion was assessed by measuring the radioactivity of bacteria adhered to the human mucus. We tested 12 probiotic strains against eight selected pathogens. All strains tested were able to adhere to mucus. All probiotic strains tested were able to inhibit and displace (P<0.05) the adhesion of Bacteroides, Clostridium, Staphylococcus and Enterobacter. In addition, the abilities to inhibit and to displace adhered pathogens depended on both the probiotic and the pathogen strains tested suggesting that several complementary mechanisms are implied in the processes. Our results indicate the need for a case-by-case assessment in order to select strains with the ability to inhibit or displace a specific pathogen. Probiotics could be useful to correct deviations observed in intestinal microbiota associated with specific diseases and also, to prevent pathogen infections. The competitive exclusion properties of probiotics as well as their ability to displace and inhibit pathogens are the most importance for therapeutic manipulation of the enteric microbiota. The application of such strategies could contribute to expand the beneficial properties on human health against pathogen infection.
Machine learning for the meta-analyses of microbial pathogens' volatile signatures.
Palma, Susana I C J; Traguedo, Ana P; Porteira, Ana R; Frias, Maria J; Gamboa, Hugo; Roque, Ana C A
2018-02-20
Non-invasive and fast diagnostic tools based on volatolomics hold great promise in the control of infectious diseases. However, the tools to identify microbial volatile organic compounds (VOCs) discriminating between human pathogens are still missing. Artificial intelligence is increasingly recognised as an essential tool in health sciences. Machine learning algorithms based in support vector machines and features selection tools were here applied to find sets of microbial VOCs with pathogen-discrimination power. Studies reporting VOCs emitted by human microbial pathogens published between 1977 and 2016 were used as source data. A set of 18 VOCs is sufficient to predict the identity of 11 microbial pathogens with high accuracy (77%), and precision (62-100%). There is one set of VOCs associated with each of the 11 pathogens which can predict the presence of that pathogen in a sample with high accuracy and precision (86-90%). The implemented pathogen classification methodology supports future database updates to include new pathogen-VOC data, which will enrich the classifiers. The sets of VOCs identified potentiate the improvement of the selectivity of non-invasive infection diagnostics using artificial olfaction devices.
Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis
Rohmer, Laurence; Hocquet, Didier; Miller, Samuel I.
2011-01-01
It is interesting to speculate that the evolutionary drive of microbes to develop pathogenic characteristics was to access the nutrient resources that animals provided. Environments in animals that pathogens colonize have also driven the evolution of new bacterial characteristics to maximize these new nutritional opportunities. This review focuses on genomic and functional aspects of pathogen metabolism that allow efficient utilization of nutrient resources provided by animals. Similar to genes encoding specific virulence traits, some genes encoding metabolic functions have been horizontally acquired by pathogens to provide a selective advantage in host tissues. Selective advantage in host tissues can also be gained in some circumstances by loss of function due to mutations that alter metabolic capabilities. Greater understanding of bacterial metabolism within host tissues should be important for increased understanding of host-pathogen interactions and the development of future therapeutic strategies. PMID:21600774
Hwang, Jusun; Gottdenker, Nicole; Min, Mi-Sook; Lee, Hang; Chun, Myung-Sun
2016-06-01
In this study, we evaluated the potential association between the habitat types of feral cats and the prevalence of selected infectious pathogens and health status based on a set of blood parameters. We live-trapped 72 feral cats from two different habitat types: an urban area (n = 48) and a rural agricultural area (n = 24). We compared blood values and the prevalence of feline immunodeficiency virus (FIV), feline leukaemia virus (FeLV) and haemotropic Mycoplasma infection in feral cats from the two contrasting habitats. Significant differences were observed in several blood values (haematocrit, red blood cells, blood urea nitrogen, creatinine) depending on the habitat type and/or sex of the cat. Two individuals from the urban area were seropositive for FIV (3.0%), and eight (12.1%) were positive for FeLV infection (five from an urban habitat and three from a rural habitat). Haemoplasma infection was more common. Based on molecular analysis, 38 cats (54.3%) were positive for haemoplasma, with a significantly higher infection rate in cats from rural habitats (70.8%) compared with urban cats (47.8%). Our study recorded haematological and serum biochemical values, and prevalence of selected pathogens in feral cat populations from two different habitat types. A subset of important laboratory parameters from rural cats showed values under or above the corresponding reference intervals for healthy domestic cats, suggesting potential differences in the health status of feral cats depending on the habitat type. Our findings provide information about the association between 1) blood values (haematological and serum biochemistry parameters) and 2) prevalence of selected pathogen infections and different habitat types; this may be important for veterinarians who work with feral and/or stray cats and for overall cat welfare management. © ISFM and AAFP 2015.
Applied Genomics of Foodborne Pathogens
DEFF Research Database (Denmark)
and customized source of information designed for and accessible to microbiologists interested in applying cutting-edge genomics in food safety and public health research. This book fills this void with a well-selected collection of topics, case studies, and bioinformatics tools contributed by experts......This book provides a timely and thorough snapshot into the emerging and fast evolving area of applied genomics of foodborne pathogens. Driven by the drastic advance of whole genome shot gun sequencing (WGS) technologies, genomics applications are becoming increasingly valuable and even essential...... at the forefront of foodborne pathogen genomics research....
Continuous-Flow Detector for Rapid Pathogen Identification
Energy Technology Data Exchange (ETDEWEB)
Barrett, Louise M. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Skulan, Andrew J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Singh, Anup K. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Cummings, Eric B. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Fiechtner, Gregory J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics
2006-09-01
This report describes the continued development of a low-power, portable detector for the rapid identification of pathogens such as B. anthracis and smallpox. Based on our successful demonstration of the continuous filter/concentrator inlet, we believe strongly that the inlet section will enable differentiation between viable and non-viable populations, between types of cells, and between pathogens and background contamination. Selective, continuous focusing of particles in a microstream enables highly selective and sensitive identification using fluorescently labeled antibodies and other receptors such as peptides, aptamers, or small ligands to minimize false positives. Processes such as mixing and lysing will also benefit from the highly localized particle streams. The concentrator is based on faceted prisms to contract microfluidic flows while maintaining uniform flowfields. The resulting interfaces, capable of high throughput, serve as high-, low-, and band-pass filters to direct selected bioparticles to a rapid, affinity-based detection system. The proposed device is superior to existing array-based detectors as antibody-pathogen binding can be accomplished in seconds rather than tens of minutes or even hours. The system is being designed to interface with aerosol collectors under development by the National Laboratories or commercial systems. The focused stream is designed to be interrogated using diode lasers to differentiate pathogens by light scattering. Identification of particles is done using fluorescently labeled antibodies to tag the particles, followed by multiplexed laser-induced fluorescence (LIF) detection (achieved by labeling each antibody with a different dye).
Ecological niche of plant pathogens
Directory of Open Access Journals (Sweden)
Ecaterina Fodor
2011-06-01
Full Text Available Disease ecology is a new approach to the understanding of the spread and dynamics of pathogens in natural and man-made environments. Defining and describing the ecological niche of the pathogens is one of the major tasks for ecological theory, as well as for practitioners preoccupied with the control and forecasting of established and emerging diseases. Niche theory has been periodically revised, not including in an explicit way the pathogens. However, many progresses have been achieved in niche modeling of disease spread, but few attempts were made to construct a theoretical frame for the ecological niche of pathogens. The paper is a review of the knowledge accumulated during last decades in the niche theory of pathogens and proposes an ecological approach in research. It quest for new control methods in what concerns forest plant pathogens, with a special emphasis on fungi like organisms of the genus Phytophthora. Species of Phytophthora are the most successful plant pathogens of the moment, affecting forest and agricultural systems worldwide, many of them being invasive alien organisms in many ecosystems. The hyperspace of their ecological niche is defined by hosts, environment and human interference, as main axes. To select most important variables within the hyperspace, is important the understanding of the complex role of pathogens in the ecosystems as well as for control programs. Biotic relationships within ecosystem of host-pathogen couple are depicted by ecological network and specific metrics attached to this. The star shaped network is characterized by few high degree nodes, by short path lengths and relatively low connectivity, premises for a rapid disturbance spread.
Ecological niche of plant pathogens
Directory of Open Access Journals (Sweden)
Ecaterina Fodor
2011-02-01
Full Text Available Disease ecology is a new approach to the understanding of the spread and dynamics of pathogens in natural and man-made environments. Defining and describing the ecological niche of the pathogens is one of the major tasks for ecological theory, as well as for practitioners preoccupied with the control and forecasting of established and emerging diseases. Niche theory has been periodically revised, not including in an explicit way the pathogens. However, many progresses have been achieved in niche modeling of disease spread, but few attempts were made to construct a theoretical frame for the ecological niche of pathogens. The paper is a review of the knowledge accumulated during last decades in the niche theory of pathogens and proposes an ecological approach in research. It quest for new control methods in what concerns forest plant pathogens, with a special emphasis on fungi like organisms of the genus Phytophthora. Species of Phytophthora are the most successful plant pathogens of the moment, affecting forest and agricultural systems worldwide, many of them being invasive alien organisms in many ecosystems. The hyperspace of their ecological niche is defined by hosts, environment and human interference, as main axes. To select most important variables within the hyperspace, is important for the understanding of the complex role of pathogens in the ecosystems as well as for control programs. Biotic relationships within ecosystem of host-pathogen couple are depicted by ecological network and specific metrics attached to this. The star shaped network is characterized by few high degree nodes, by short path lengths and relatively low connectivity, premises for a rapid disturbance spread.
Host-pathogen interactions during apoptosis
Indian Academy of Sciences (India)
Unknown
349. Keywords. Antioxidant; baculovirus; host-pathogen; eIF2α-kinase; P35; PKR .... conferring a selective advantage to the virus, the capacity to prevent apoptosis is ..... totic extracts were found to cleave purified PKR in vitro. These findings ...
Directory of Open Access Journals (Sweden)
Susana Seixas
Full Text Available Serine protease inhibitors (SERPINs are crucial in the regulation of diverse biological processes including inflammation and immune response. SERPINB11, located in the 18q21 gene cluster, is a polymorphic gene/pseudogene coding for a non-inhibitory SERPIN. In a genome-wide scan for recent selection, SERPINB11 was identified as a potential candidate gene for adaptive evolution in Yoruba. The present study sought a better understanding of the evolutionary history of SERPINB11, with special focus on evaluating its selective signature. Through the resequencing of coding and noncoding regions of SERPINB11 in 20 Yorubans and analyzing primate orthologous sequences, we identified a full-length SERPINB11 variant encoding a non-inhibitory SERPIN as the putative candidate of selection--probably driven to higher frequencies by an adaptive response using preexisting variation. In addition, we detected contrasting evolutionary features of SERPINB11 in primates: While primate phylogeny as a whole is under purifying selection, the human lineage shows evidence of positive selection in a few codons, all associated with the active SERPINB11. Comparative modeling studies suggest that positively selected codons reduce SERPINB11's ability to undergo the conformational changes typical of inhibitory SERPINs--suggesting that it is evolving towards a new non-inhibitory function in humans. Significant correlations between SERPINB11 variants and the environmental variables, pastoralism and pathogen richness, have led us to propose a selective advantage through host-pathogen interactions, possibly linked to an adaptive response combating the emergence of infectious diseases in recent human evolution. This work represents the first description of a resurrected gene in humans, and may well exemplify selection on standing variation triggered by drastic ecological shifts.
Search Results | Page 19 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Results 181 - 190 of 650 ... ... Studies 223 Apply Studies filter · Papers 172 Apply Papers filter .... group at risk from blood-borne diseases (hepatitis B, HIV/AIDS), as well as tuberculosis and other pathogens. ... Improving Food Security in the Highlands of Ethiopia through ... Ethiopia suffers from a serious level of food insecurity, ...
United Kingdom newsprint media reporting on sexual health and blood-borne viruses in 2010.
Martin, Susan; Hilton, Shona; McDaid, Lisa M
2013-12-01
Improving sexual health and blood-borne virus (BBV) outcomes continue to be of high priority within the United Kingdom (UK) and it is evident that the media can and do impact the public health agenda. This paper presents the first large-scale exploration of UK national newsprint media representations of sexual health and BBVs. Using keyword searches in electronic databases, 677 articles published during 2010 were identified from 12 national (UK-wide and Scottish) newspapers. Content analysis was used to identify manifest content and to examine the tone of articles. Although there was a mixed picture overall in terms of tone, negatively toned articles, which focussed on failures or blame, were common, particularly within HIV/AIDS, hepatitis B and C, and other sexually transmissible infection coverage (41% were assessed as containing negative content; 46% had negative headlines). Differences were found by newspaper genre, with 'serious' newspaper articles appearing more positive and informative than 'midmarket' newspapers or 'tabloids'. Across the sample, particular individuals, behaviours and risk groups were focussed on, not always accurately, and there was little mention of deprivation and inequalities (9%). A gender imbalance was evident, particularly within reproductive health articles (71% focussed on women; 23% on men), raising questions concerning gender stereotyping. There is a need to challenge the role that media messages have in the reinforcement of a negative culture around sexual health in the UK and for a strong collective advocacy voice to ensure that future media coverage is positively portrayed.
Effective inactivation of a wide range of viruses by pasteurization.
Gröner, Albrecht; Broumis, Connie; Fang, Randel; Nowak, Thomas; Popp, Birgit; Schäfer, Wolfram; Roth, Nathan J
2018-01-01
Careful selection and testing of plasma reduces the risk of blood-borne viruses in the starting material for plasma-derived products. Furthermore, effective measures such as pasteurization at 60°C for 10 hours have been implemented in the manufacturing process of therapeutic plasma proteins such as human albumin, coagulation factors, immunoglobulins, and enzyme inhibitors to inactivate blood-borne viruses of concern. A comprehensive compilation of the virus reduction capacity of pasteurization is presented including the effect of stabilizers used to protect the therapeutic protein from modifications during heat treatment. The virus inactivation kinetics of pasteurization for a broad range of viruses were evaluated in the relevant intermediates from more than 15 different plasma manufacturing processes. Studies were carried out under the routine manufacturing target variables, such as temperature and product-specific stabilizer composition. Additional studies were also performed under robustness conditions, that is, outside production specifications. The data demonstrate that pasteurization inactivates a wide range of enveloped and nonenveloped viruses of diverse physicochemical characteristics. After a maximum of 6 hours' incubation, no residual infectivity could be detected for the majority of enveloped viruses. Effective inactivation of a range of nonenveloped viruses, with the exception of nonhuman parvoviruses, was documented. Pasteurization is a very robust and reliable virus inactivation method with a broad effectiveness against known blood-borne pathogens and emerging or potentially emerging viruses. Pasteurization has proven itself to be a highly effective step, in combination with other complementary safety measures, toward assuring the virus safety of final product. © 2017 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.
77 FR 7974 - Semiannual Agenda of Regulations
2012-02-13
... effects of exposure as well as quantitative risk assessment. OSHA intends to rely on these portions of the... Health Administration (OSHA) Prerule Stage 399. Bloodborne Pathogens (Section 610 Review) Legal Authority: 5 U.S.C. 533; 5 U.S.C. 610; 29 U.S.C. 655(b) Abstract: OSHA will undertake a review of the...
Impact of selected antagonistic fungi on Fusarium species – toxigenic cereal pathogens
Directory of Open Access Journals (Sweden)
Delfina Popiel
2013-12-01
Full Text Available Fusarium-ear blight is a destructive disease in various cereal-growing regions and leads to significant yield and quality losses for farmers and to contamination of cereal grains with mycotoxins, mainly deoxynivalenol and derivatives, zearalenone and moniliformin. Fusarium pathogens grow well and produce significant inoculum on crop resiudues. Reduction of mycotoxins production and pathogen sporulation may be influenced by saprophytic fungi, exhibiting antagonistic effect. Dual culture bioassays were used to examine the impact of 92 isolates (belonging to 29 fungal species against three toxigenic species, i.e. Fusarium avenaceum (Corda Saccardo, F. culmorum (W.G.Smith Saccardo and F. graminearum Schwabe. Both F.culmorum and F. graminearum isolates produce trichothecene mycotoxins and mycohormone zearalenone and are considered to be the most important cereal pathogens worldwide. Infection with those pathogens leads to accumulation of mycotoxins: deoxynivalenol (DON and zearalenone (ZEA in grains. Fusarium avenaceum isolates are producers of moniliformin (MON and enniatins. Isolates of Trichoderma sp. were found to be the most effective ones to control the growth of examined Fusarium species. The response of Fusarium isolates to antagonistic activity of Trichoderma isolates varied and also the isolates of Trichoderma differed in their antagonistic activity against Fusarium isolates. The production of MON by two isolates of F. avenaceum in dual culture on rice was reduced by 95% to 100% by T. atroviride isolate AN 35. The same antagonist reduced the amount of moniliformin from 100 μg/g to 6.5 μg/g when inoculated to rice culture contaminated with MON, which suggests the possible decomposition of this mycotoxin.
Evaluation of isolation methods for pathogenic Yersinia enterocolitica from pig intestinal content.
Laukkanen, R; Hakkinen, M; Lundén, J; Fredriksson-Ahomaa, M; Johansson, T; Korkeala, H
2010-03-01
The aim of this study was to evaluate the efficiency of four isolation methods for the detection of pathogenic Yersinia enterocolitica from pig intestinal content. The four methods comprised of 15 isolation steps using selective enrichments (irgasan-ticarcillin-potassium chlorate and modified Rappaport broth) and mildly selective enrichments at 4 or 25 degrees C. Salmonella-Shigella-desoxycholate-calcium chloride agar, cefsulodin-irgasan-novobiocin agar were used as plating media. The most sensitive method detected 78% (53/68) of the positive samples. Individual isolation steps using cold enrichment as the only enrichment or as a pre-enrichment step with further selective enrichment showed the highest sensitivities (55-66%). All isolation methods resulted in high numbers of suspected colonies not confirmed as pathogenic Y. enterocolitica. Cold enrichment should be used in the detection of pathogenic Y. enterocolitica from pig intestinal contents. In addition, more than one parallel isolation step is needed. The study shows that depending on the isolation method used for Y. enterocolitica, the detected prevalence of Y. enterocolitica in pig intestinal contents varies greatly. More selective and sensitive isolation methods need to be developed for pathogenic Y. enterocolitica.
Görmez, Arzu; Yanmiş, Derya; Bozari, Sedat; Gürkök, Sumeyra
2017-04-01
The antibiotic resistance of pathogenic microorganisms has become a worldwide concern to public health. To overcome the current resistance problem, new antimicrobial agents are extremely needed. The aim of the present study was to evaluate the antibacterial activity of Satureja hortensis essential oils against seven clinical pathogens. Chemical compositions of hydro distillated essential oils from S. hortensis were analyzed by GS-MS. The antibacterial activity was investigated against Corynebacterium diphtheria, Salmonella typhimurium, Serratia plymuthica Yersinia enterocolitica, Y. frederiksenii, Y. pseudotuberculosis and Vibrio cholerae by the use of disc diffusion method and broth micro dilution method. The minimum inhibitory concentration (MIC) values of essential oils were found as low as 7.81 µg/mL. Notably, essential oils of S. hortensis exhibited remarkable antimicrobial activities against the tested clinical pathogens. The results indicate that these essential oils can be used in treatment of different infectious diseases.
Aptamer-Based Technologies in Foodborne Pathogen Detection.
Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang
2016-01-01
Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.
Aptamer-Based Technologies in Foodborne Pathogen Detection
Directory of Open Access Journals (Sweden)
Jun Teng
2016-09-01
Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.
Potent and selective inhibition of pathogenic viruses by engineered ubiquitin variants.
Directory of Open Access Journals (Sweden)
Wei Zhang
2017-05-01
Full Text Available The recent Middle East respiratory syndrome coronavirus (MERS-CoV, Ebola and Zika virus outbreaks exemplify the continued threat of (re-emerging viruses to human health, and our inability to rapidly develop effective therapeutic countermeasures. Many viruses, including MERS-CoV and the Crimean-Congo hemorrhagic fever virus (CCHFV encode deubiquitinating (DUB enzymes that are critical for viral replication and pathogenicity. They bind and remove ubiquitin (Ub and interferon stimulated gene 15 (ISG15 from cellular proteins to suppress host antiviral innate immune responses. A variety of viral DUBs (vDUBs, including the MERS-CoV papain-like protease, are responsible for cleaving the viral replicase polyproteins during replication, and are thereby critical components of the viral replication cycle. Together, this makes vDUBs highly attractive antiviral drug targets. However, structural similarity between the catalytic cores of vDUBs and human DUBs complicates the development of selective small molecule vDUB inhibitors. We have thus developed an alternative strategy to target the vDUB activity through a rational protein design approach. Here, we report the use of phage-displayed ubiquitin variant (UbV libraries to rapidly identify potent and highly selective protein-based inhibitors targeting the DUB domains of MERS-CoV and CCHFV. UbVs bound the vDUBs with high affinity and specificity to inhibit deubiquitination, deISGylation and in the case of MERS-CoV also viral replicative polyprotein processing. Co-crystallization studies further revealed critical molecular interactions between UbVs and MERS-CoV or CCHFV vDUBs, accounting for the observed binding specificity and high affinity. Finally, expression of UbVs during MERS-CoV infection reduced infectious progeny titers by more than four orders of magnitude, demonstrating the remarkable potency of UbVs as antiviral agents. Our results thereby establish a strategy to produce protein-based inhibitors
Models of Caenorhabditis elegans infection by bacterial and fungal pathogens.
Powell, Jennifer R; Ausubel, Frederick M
2008-01-01
The nematode Caenorhabditis elegans is a simple model host for studying the relationship between the animal innate immune system and a variety of bacterial and fungal pathogens. Extensive genetic and molecular tools are available in C. elegans, facilitating an in-depth analysis of host defense factors and pathogen virulence factors. Many of these factors are conserved in insects and mammals, indicating the relevance of the nematode model to the vertebrate innate immune response. Here, we describe pathogen assays for a selection of the most commonly studied bacterial and fungal pathogens using the C. elegans model system.
Directory of Open Access Journals (Sweden)
Thomas Bintsis
2017-06-01
Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.
Benevenuto, J.; Texeira-Silva, N.S.; Kuramae, E.E.; Croll, D.; Vitorello, C.B.M.
2018-01-01
Host specialization is a key evolutionary process for the diversification and emergence of new pathogens. However, the molecular determinants of host range are poorly understood. Smut fungi are biotrophic pathogens that have distinct and narrow host ranges based on largely unknown genetic
Microbiome studies in the biological control of plant pathogens
Biological control of plant pathogens, although it has been a successful alternative that has allowed to select microorganisms for the generation of bioproducts and to understand multiple biological mechanisms, cannot be considered as a strategy defined only from the selection of a range of cultiva...
Zokaeifar, Hadi; Balcázar, José Luis; Kamarudin, Mohd Salleh; Sijam, Kamaruzaman; Arshad, Aziz; Saad, Che Roos
2012-06-01
In this study, potential probiotic strains were isolated from fermented pickles based on antagonistic activity against two shrimp pathogens (Vibrio harveyi and Vibrio parahaemolyticus). Two strains L10 and G1 were identified by biochemical tests, followed by16S ribosomal RNA gene sequence analysis as Bacillus subtilis, and characterized by PCR amplification of repetitive bacterial DNA elements (Rep-PCR). Subsequently, B. subtilis L10 and G1 strains were tested for antibacterial activity under different physical conditions, including culture medium, salinity, pH and temperature using the agar well diffusion assay. Among the different culture media, LB broth was the most suitable medium for antibacterial production. Both strains showed the highest level of antibacterial activity against two pathogens at 30 °C and 1.0% NaCl. Under the pH conditions, strain G1 showed the greatest activity against V. harveyi at pH 7.3-8.0 and against V. parahaemolyticus at pH 6.0-8.0, whereas strain L10 showed the greatest activity against two pathogens at pH 7.3. The cell-free supernatants of both strains were treated with four different enzymes in order to characterize the antibacterial substances against V. harveyi. The result showed considerable reduction of antibacterial activity for both strains, indicating the proteinaceous nature of the antibacterial substances. A wide range of tolerance to NaCl, pH and temperature was also recorded for both strains. In addition, both strains showed no virulence effect in juvenile shrimp Litopenaeus vannamei. On the basis of these results and safety of strains to L. vannamei, they may be considered for future challenge experiments in shrimp as a very promising alternative to the use of antibiotics.
The Shared Antibiotic Resistome of Soil Bacteria and Human Pathogens
DEFF Research Database (Denmark)
Forsberg, Kevin J.; Reyes, Alejandro; Wang, Bin
2012-01-01
protocol to assemble short-read sequence data after antibiotic selection experiments, using 12 different drugs in all antibiotic classes, and compared antibiotic resistance gene sequences between soil bacteria and clinically occurring pathogens. Sixteen sequences, representing seven gene products, were...... discovered in farmland soil bacteria within long stretches of perfect nucleotide identity with pathogenic proteobacteria....
The antimicrobial spectra of selected Penicillia against some pathogenic bacteria and yeasts
Directory of Open Access Journals (Sweden)
Shashi Chauhan
2014-08-01
Full Text Available The antagonista activity of eight isolaies of penicillia bas been studied against 13 pathogenic organisms, which included 6 Gram-positive bacteria, 4 Gram-negative bacteria and 3 yeasts.
Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara
2015-11-01
Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.
Directory of Open Access Journals (Sweden)
Shyamala Thirunavukkarasu
Full Text Available According to most models of mycobacterial infection, inhibition of the pro-inflammatory macrophage immune responses contributes to the persistence of bacteria. Mycobacterium avium subsp. paratuberculosis (MAP is a highly successful pathogen in cattle and sheep and is also implicated as the causative agent of Crohn's disease in humans. Pathogenic mycobacteria such as MAP have developed multiple strategies to evade host defence mechanisms including interfering with the macrophages' capacity to respond to IFN-γ, a feature which might be lacking in non-pathogenic mycobacteria such as M. smegmatis. We hypothesized that pre-sensitisation of macrophages with the pro-inflammatory cytokine IFN-γ would help in overcoming the inhibitory effect of MAP or its antigens on macrophage inflammatory responses. Herein we have compared a series of macrophage activation parameters in response to MAP and M. smegmatis as well as mycobacterial antigens. While IFN-γ did overcome the inhibition in immune suppressive mechanisms in response to MAP antigen as well as M. smegmatis, we could not find a clear role for IFN-γ in overcoming the inhibition of macrophage inflammatory responses to the pathogenic mycobacterium, MAP. We demonstrate that suppression of macrophage defence mechanisms by pathogenic mycobacteria is unlikely to be overcome by prior sensitization with IFN-γ alone. This indicates that IFN-γ signaling pathway-independent mechanisms may exist for overcoming inhibition of macrophage effector functions in response to pathogenic mycobacteria. These findings have important implications in understanding the survival mechanisms of pathogenic mycobacteria directed towards finding better therapeutics and vaccination strategies.
Safety and Waste Management for SAM Pathogen Methods
The General Safety and Waste Management page offers section-specific safety and waste management details for the pathogens included in EPA's Selected Analytical Methods for Environmental Remediation and Recovery (SAM).
[Evolution of pathogenic micro-organisms as a challenge for medicine].
Vaara, Martti
2009-01-01
Successful parasitic micro-organisms are able to adapt to the circumstances of the host's organ system, and it is usually not expedient for them to kill their host. Under selection pressure, the evolution of micro-organisms is vastly quicker that that of man. The selection pressure brought about by rapid ecological changes and alterations associated with human action provides for the development of new, dangerous pathogens and transformation of familiar pathogens to become more dangerous. Progress in molecular biology has thus far not yielded as many new tools for the treatment of infectious diseases as the hopes were in the early 2000's.
The prevalence of visible and/or occult blood on anesthesia and monitoring equipment.
Perry, S M; Monaghan, W P
2001-02-01
The Occupational Safety and Health Administration (OSHA) and the Centers for Disease Control and Prevention (CDC) have attempted to stop the spread of blood-borne pathogens by issuing several recommendations and regulations. However, unless healthcare workers comply with these standards, they are not effective. In the anesthesia care environment, the anesthetist is responsible for ensuring that the equipment is clean, and disinfected, before use. We studied the prevalence of visible and occult blood on 6 types of anesthesia and monitoring equipment identified as ready for use in 28 operating suites, in 2 facilities. The sample consisted of 336 observations of the 6 types of equipment. The equipment was inspected for visible blood and then tested for occult blood using a 3-stage phenolphthalein test. Of the 336 observations, 110 (32.7%), were positive for occult blood with only 6 showing visible blood. The presence of blood on this equipment may be in direct violation of the OSHA Blood-borne Pathogen Standard and the infection control guidelines of the American Association of Nurse Anesthetists. Furthermore, the presence of blood on this equipment may increase the risk for nosocomial and occupational exposure to viral and bacterial pathogens. Recommendations were made to decrease the risks from this contamination by redesigning equipment, increasing the use of disposable equipment, and ensuring compliance with effective infection control practices.
International Nuclear Information System (INIS)
Chappell, M A; Payne, S J
2006-01-01
Under decompression, bubbles can form in the human body, and these can be found both within the body tissues and the bloodstream. Mathematical models for the growth of both types of bubbles have previously been presented, but they have not been coupled together. This work thus explores the interaction between the growth of tissue and blood-borne bubbles under decompression, specifically looking at the extent to which they compete for the common resource of inert gas held in solution in the tissues. The influence of tissue bubbles is found to be significant for densities as low as 10 ml -1 for tissues which are poorly perfused. However, the effects of formation of bubbles in the blood are not found until the density of bubble production sites reaches 10 6 ml -1 . From comparison of the model predictions with experimental evidence for bubbles produced in animals and man under decompression, it is concluded that the density of tissue bubbles is likely to have a significant effect on the number of bubbles produced in the blood. However, the density of nucleation sites in the blood is unlikely to be sufficiently high in humans for the formation of bubbles in the blood to have a significant impact on the growth of the bubbles in the tissue
Haiduven, Donna; Applegarth, Shawn; Shroff, Miloni
2009-03-01
This study was designed to evaluate the safety of retractable intravascular devices in terms of their potential to produce blood splatter. A method for measuring this blood splatter designed by the research team was used to evaluate 3 specific intravascular devices. Scientific filters were positioned around the retraction mechanisms of the devices and weighed with an analytical scale, both before and after activation, in a simulated vein containing mock venous blood. The difference in filter mass was used as the primary unit of analysis to detect blood splatter. In addition, the filters were visually inspected for the presence or absence of blood. A paired t-test revealed significant differences in the prefilter and postfilter groups for 2 of the 3 devices tested (P blood was detected on 23% to 40% of the scientific filters for 2 of the devices. Our findings indicate a potential for bloodborne pathogen exposure with the use of intravascular devices with a retractable mechanism. This experiment may serve as a model in the design and implementation of future sharps device evaluation protocols to validate the threat of bloodborne pathogen exposure.
The Sociospatial Network: Risk and the Role of Place in the Transmission of Infectious Diseases.
Directory of Open Access Journals (Sweden)
James J Logan
Full Text Available Control of sexually transmitted infections and blood-borne pathogens is challenging due to their presence in groups exhibiting complex social interactions. In particular, sharing injection drug use equipment and selling sex (prostitution puts people at high risk. Previous work examining the involvement of risk behaviours in social networks has suggested that social and geographic distance of persons within a group contributes to these pathogens' endemicity. In this study, we examine the role of place in the connectedness of street people, selected by respondent driven sampling, in the transmission of blood-borne and sexually transmitted pathogens. A sample of 600 injection drug users, men who have sex with men, street youth and homeless people were recruited in Winnipeg, Canada from January to December, 2009. The residences of participants and those of their social connections were linked to each other and to locations where they engaged in risk activity. Survey responses identified 101 unique sites where respondents participated in injection drug use or sex transactions. Risk sites and respondents' residences were geocoded, with residence representing the individuals. The sociospatial network and estimations of geographic areas most likely to be frequented were mapped with network graphs and spatially using a Geographic Information System (GIS. The network with the most nodes connected 7.7% of respondents; consideration of the sociospatial network increased this to 49.7%. The mean distance between any two locations in the network was within 3.5 kilometres. Kernel density estimation revealed key activity spaces where the five largest networks overlapped. Here, the combination of spatial and social entities in network analysis defines the overlap of vulnerable populations in risk space, over and above the person to person links. Implications of this work are far reaching, not just for understanding transmission dynamics of sexually transmitted
The Sociospatial Network: Risk and the Role of Place in the Transmission of Infectious Diseases.
Logan, James J; Jolly, Ann M; Blanford, Justine I
2016-01-01
Control of sexually transmitted infections and blood-borne pathogens is challenging due to their presence in groups exhibiting complex social interactions. In particular, sharing injection drug use equipment and selling sex (prostitution) puts people at high risk. Previous work examining the involvement of risk behaviours in social networks has suggested that social and geographic distance of persons within a group contributes to these pathogens' endemicity. In this study, we examine the role of place in the connectedness of street people, selected by respondent driven sampling, in the transmission of blood-borne and sexually transmitted pathogens. A sample of 600 injection drug users, men who have sex with men, street youth and homeless people were recruited in Winnipeg, Canada from January to December, 2009. The residences of participants and those of their social connections were linked to each other and to locations where they engaged in risk activity. Survey responses identified 101 unique sites where respondents participated in injection drug use or sex transactions. Risk sites and respondents' residences were geocoded, with residence representing the individuals. The sociospatial network and estimations of geographic areas most likely to be frequented were mapped with network graphs and spatially using a Geographic Information System (GIS). The network with the most nodes connected 7.7% of respondents; consideration of the sociospatial network increased this to 49.7%. The mean distance between any two locations in the network was within 3.5 kilometres. Kernel density estimation revealed key activity spaces where the five largest networks overlapped. Here, the combination of spatial and social entities in network analysis defines the overlap of vulnerable populations in risk space, over and above the person to person links. Implications of this work are far reaching, not just for understanding transmission dynamics of sexually transmitted infections by
Pathogenic waterborne free-living amoebae: An update from selected Southeast Asian countries
Abdul Majid, Mohamad Azlan; Mahboob, Tooba; Mong, Brandon G. J.; Jaturas, Narong; Richard, Reena Leeba; Tian-Chye, Tan; Phimphila, Anusorn; Mahaphonh, Panomphanh; Aye, Kyaw Nyein; Aung, Wai Lynn; Chuah, Joon; Ziegler, Alan D.; Yasiri, Atipat; Sawangjaroen, Nongyao; Lim, Yvonne A. L.; Nissapatorn, Veeranoot
2017-01-01
Data on the distribution of free-living amoebae is still lacking especially in Southeast Asian region. The aquatic environment revealed a high occurrence of free-living amoebae (FLA) due to its suitable condition and availability of food source, which subsequently causes infection to humans. A total of 94 water samples consisted of both treated and untreated from Laos (31), Myanmar (42), and Singapore (21) were investigated for the presence of pathogenic FLA. Each water sample was filtered and cultured onto non-nutrient agar seeded with live suspension of Escherichia coli and incubated at room temperature. Morphological identification was conducted for both trophozoites and cysts via microscopic stains (Giemsa and immunofluorescence). The presence of Naegleria-like structures was the most frequently encountered in both treated and untreated water samples, followed by Acanthamoeba-like and Vermamoeba-like features. To identify the pathogenic isolates, species-specific primer sets were applied for molecular identification of Acanthamoeba, Naegleria, and Vermamoeba. The pathogenic species of Acanthamoeba lenticulata and A. triangularis were detected from untreated water samples, while Vermamoeba vermiformis was found in both treated and untreated water samples. Our results suggested that poor water quality as well as inadequate maintenance and treatment might be the cause of this alarming problem since chlorine disinfection is ineffective in eradicating these amoebas in treated water samples. Regular monitoring and examination of water qualities are necessary in order to control the growth, hence, further preventing the widespread of FLA infections among the public. PMID:28212409
Molecular genetic analysis of the pathogenicity of the potato cyst nematode Globodera rostochiensis
Qin, L.
2001-01-01
A new strategy to identify pathogenicity factors from the potato cyst nematode Globodera rostochiensis is developed. cDNA-AFLP technology and in situ hybridization allowed us to efficiently select putative pathogenicity factors among thousands of
Sexual reproduction and the evolution of microbial pathogens.
Heitman, Joseph
2006-09-05
Three common systemic human fungal pathogens--Cryptococcus neoformans, Candida albicans and Aspergillus fumigatus--have retained all the machinery to engage in sexual reproduction, and yet their populations are often clonal with limited evidence for recombination. Striking parallels have emerged with four protozoan parasites that infect humans: Toxoplasma gondii, Trypanosoma brucei, Trypanosoma cruzi and Plasmodium falciparum. Limiting sexual reproduction appears to be a common virulence strategy, enabling generation of clonal populations well adapted to host and environmental niches, yet retaining the ability to engage in sexual or parasexual reproduction and respond to selective pressure. Continued investigation of the sexual nature of microbial pathogens should facilitate both laboratory investigation and an understanding of the complex interplay between pathogens, hosts, vectors, and their environments.
Directory of Open Access Journals (Sweden)
Hsin-Chung Cheng
Full Text Available BACKGROUND: Although the risks of needlestick and sharps injuries (NSIs for dentists are well recognized, most papers published only described the frequency of occupational exposure to NSIs. Less has been reported assessing factors contributing to exposure to NSIs. The purpose of this study was to update the epidemiology of NSIs among dentists in Taiwan and identify factors affecting NSIs in order to find preventive strategies. METHODOLOGY/PRINCIPAL FINDINGS: A nationwide survey was conducted in dentists at 60 hospitals and 340 clinics in Taiwan. The survey included questions about factors supposedly affecting exposure to NSIs, such as dentist and facility characteristics, knowledge and attitudes about infectious diseases, and practices related to infection control. Univariate and multivariate logistic regression analyses were conducted to determine the association between risk factors and exposure to NSIs. In total, 434 (74.8% of 580 dentists returned the survey questionnaires, and 100 (23.0% reported that they had experienced more than one NSI per week. Our data showed that the risk of occupational NSIs is similarly heightened by an older age (odds ratio [OR], 3.18; 95% confidence interval [CI], 1.62-6.25, more years in practice (OR, 2.57; 95% CI, 1.41-4.69, working in clinics (OR, 1.73; 95% CI, 1.08-2.77, exhibiting less compliance with infection-control procedures (OR, 1.82; 95% CI, 1.04-3.18, having insufficient knowledge of blood-borne pathogens (OR, 1.67; 95% CI, 1.04-2.67, and being more worried about being infected by blood-borne pathogens (OR, 1.82; 95% CI, 1.05-3.13. CONCLUSIONS/SIGNIFICANCE: High rates of NSIs and low compliance with infection-control procedures highly contribute to the chance of acquiring a blood-borne pathogen infection and threaten occupational safety. This study reveals the possible affecting factors and helps in designing prevention strategies for occupational exposure to NSIs.
Molecular Diagnostics for Soilborne Fungal Pathogens
Directory of Open Access Journals (Sweden)
E.J. Paplomatas
2004-08-01
Full Text Available Several classical approaches have been developed to detect and identify soil fungal inhabitants through the years. Selective media have been devised to exclude the large number of soil organisms and allow growth of target fungi. However the advent of molecular biology has offered a number of revolutionary insights into the detection and enumeration of soilborne fungal pathogens and also has started to provide information on the identification of unknown species from DNA sequences. This review paper focuses on the application of various molecular techniques in the detection, identification, characterization and quantification of soilborne fungal plant pathogens. This is based on information from the literature and is combined with personal research findings of the author.
Meldrum, R J; Garside, J; Mannion, P; Charles, D; Ellis, P
2012-12-01
The Welsh Food Microbiological Forum "shopping basket" survey is a long running, structured surveillance program examining ready-to-eat food randomly sampled from the point of sale or service in Wales, United Kingdom. The annual unsatisfactory rates for selected indicators and pathogens for 1998 through 2008 were examined. All the annual unsatisfactory rates for the selected pathogens were <0.5%, and no pattern with the annual rate was observed. There was also no discernible trend observed for the annual rates of Listeria spp. (not moncytogenes), with all rates <0.5%. However, there was a trend observed for Esherichia coli, with a decrease in rate between 1998 and 2003, rapid in the first few years, and then a gradual increase in rate up to 2008. It was concluded that there was no discernible pattern to the annual unsatisfactory rates for Listeria spp. (not monocytogenes), L. monocytogenes, Staphylococcus aureus, and Bacillus cereus, but that a definite trend had been observed for E. coli.
Pathogen prevalence predicts human cross-cultural variability in individualism/collectivism
Fincher, Corey L; Thornhill, Randy; Murray, Damian R; Schaller, Mark
2008-01-01
Pathogenic diseases impose selection pressures on the social behaviour of host populations. In humans (Homo sapiens), many psychological phenomena appear to serve an antipathogen defence function. One broad implication is the existence of cross-cultural differences in human cognition and behaviour contingent upon the relative presence of pathogens in the local ecology. We focus specifically on one fundamental cultural variable: differences in individualistic versus collectivist values. We sug...
Plastic Transcriptomes Stabilize Immunity to Pathogen Diversity
DEFF Research Database (Denmark)
Zhang, Wei; Corwin, Jason A; Copeland, Daniel
2017-01-01
To respond to pathogen attack, selection and associated evolution has led to the creation of plant immune system that are a highly effective and inducible defense system. Central to this system are the plant defense hormones jasmonic acid (JA) and salicylic acid (SA) and crosstalk between the two...
Plastic transcriptomes stabilize immunity to pathogen diversity
DEFF Research Database (Denmark)
Zhang, Wei; Corwin, Jason A.; Copeland, Daniel
2017-01-01
To respond to pathogen attack, selection and associated evolution has led to the creation of plant immune system that are a highly effective and inducible defense system. Central to this system are the plant defense hormones jasmonic acid (JA) and salicylic acid (SA) and crosstalk between the two...
Aneuploidy can result in significant phenotypic changes, which can sometimes be selectively advantageous. For example, aneuploidy confers resistance to antifungal drugs in human pathogenic fungi. Aneuploidy has also been observed in invasive fungal and oomycete plant pathogens in the field. Environm...
Directory of Open Access Journals (Sweden)
Ragnhild I. Vestrum
2018-05-01
Full Text Available We have previously shown that K-selection and microbial stability in the rearing water increases survival and growth of Atlantic cod (Gadus morhua larvae, and that recirculating aquaculture systems (RAS are compatible with this. Here, we have assessed how water treatment influenced the larval microbiota and host responses at the gene expression level. Cod larvae were reared with two different rearing water systems: a RAS and a flow-through system (FTS. The water microbiota was examined using a 16S rDNA PCR/DGGE strategy. RNA extracted from larvae at 8, 13, and 17 days post hatching was used for microbiota and microarray gene expression analysis. Bacterial cDNA was synthesized and used for 16S rRNA amplicon 454 pyrosequencing of larval microbiota. Both water and larval microbiota differed significantly between the systems, and the larval microbiota appeared to become more dissimilar between systems with time. In total 4 phyla were identified for all larvae: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. The most profound difference in larval microbiota was a high abundance of Arcobacter (Epsilonproteobacteria in FTS larvae (34 ± 9% of total reads. Arcobacter includes several species that are known pathogens for humans and animals. Cod larval transcriptome responses were investigated using an oligonucleotide gene expression microarray covering approximately 24,000 genes. Interestingly, FTS larvae transcriptional profiles revealed an overrepresentation of upregulated transcripts associated with responses to pathogens and infections, such as c1ql3-like, pglyrp-2-like and zg16, compared to RAS larvae. In conclusion, distinct water treatment systems induced differences in the larval microbiota. FTS larvae showed up-regulation of transcripts associated with responses to microbial stress. These results are consistent with the hypothesis that RAS promotes K-selection and microbial stability by maintaining a microbial load close to the
Rijks, J M; Cito, F; Cunningham, A A; Rantsios, A T; Giovannini, A
2016-07-01
Prioritization of companion animal transmissible diseases was performed by the Companion Animals multisectoriaL interprofessionaL Interdisciplinary Strategic Think tank On zoonoses (CALLISTO) project. The project considered diseases occurring in domesticated species commonly kept as pets, such as dogs and cats, but also included diseases occurring in captive wild animals and production animal species. The prioritization process led to the selection of 15 diseases of prime public health relevance, agricultural economic importance, or both. An analysis was made of the current knowledge on the risk of occurrence and transmission of these diseases among companion animals, and from companion animals to man (zoonoses) or to livestock. The literature was scanned for risk assessments for these diseases. Studies were classified as import risk assessments (IRAs) or risk factor analyses (RFAs) in endemic areas. For those pathogens that are absent from Europe, only IRAs were considered; for pathogens present throughout Europe, only RFAs were considered. IRAs were identified for seven of the eight diseases totally or partially absent from Europe. IRAs for classical rabies and alveolar echinococcosis found an increased risk for introduction of the pathogen into officially disease-free areas as a consequence of abandoning national rules and adopting the harmonized EU rules for pet travel. IRAs for leishmaniosis focused on risk associated with the presence of persistently infected dogs in new geographical areas, taking into consideration the risk of disease establishment should a competent vector arise. IRAs for Crimean-Congo haemorrhagic fever and West Nile fever indicated that the likelihood of introduction via companion animals was low. IRAs for bluetongue paid no attention to the risk of introduction via companion animals, which was also the case for IRAs for foot-and-mouth disease, the only disease considered to be absent from Europe. RFAs dealing with the risk factors for
Wang, Jianghong; Zhou, Xiang; Guo, Kai; Zhang, Xinqi; Lin, Haiping; Montalva, Cristian
2018-01-16
Conidiobolus obscurus is a widespread fungal entomopathogen with aphid biocontrol potential. This study focused on a de novo transcriptomic analysis of C. obscurus. A number of pathogenicity-associated factors were annotated for the first time from the assembled 17 231 fungal unigenes, including those encoding subtilisin-like proteolytic enzymes (Pr1s), trypsin-like proteases, metalloproteases, carboxypeptidases and endochitinases. Many of these genes were transcriptionally up-regulated by at least twofold in mycotized cadavers compared with the in vitro fungal cultures. The resultant transcriptomic database was validated by the transcript levels of three selected pathogenicity-related genes quantified from different in vivo and in vitro material in real-time quantitative polymerase chain reaction (PCR). The involvement of multiple Pr1 proteases in the first stage of fungal infection was also suggested. Interestingly, a unique cytolytic (Cyt)-like δ-endotoxin gene was highly expressed in both mycotized cadavers and fungal cultures, and was more or less distinct from its homologues in bacteria and other fungi. Our findings provide the first global insight into various pathogenicity-related genes in this obligate aphid pathogen and may help to develop novel biocontrol strategy against aphid pests. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Klein Cátia S
2009-12-01
Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.
Directory of Open Access Journals (Sweden)
Mingna Chen
Full Text Available Peanut is an important oil crop worldwide and shows considerable adaptability but growth and yield are negatively affected by continuous cropping. Soil micro-organisms are efficient bio-indicators of soil quality and plant health and are critical to the sustainability of soil-based ecosystem function and to successful plant growth. In this study, 18S rRNA gene clone library analyses were employed to study the succession progress of soil eukaryotic micro-organisms under continuous peanut cultivation. Eight libraries were constructed for peanut over three continuous cropping cycles and its representative growth stages. Cluster analyses indicated that soil micro-eukaryotic assemblages obtained from the same peanut cropping cycle were similar, regardless of growth period. Six eukaryotic groups were found and fungi predominated in all libraries. The fungal populations showed significant dynamic change and overall diversity increased over time under continuous peanut cropping. The abundance and/or diversity of clones affiliated with Eurotiales, Hypocreales, Glomerales, Orbiliales, Mucorales and Tremellales showed an increasing trend with continuous cropping but clones affiliated with Agaricales, Cantharellales, Pezizales and Pyxidiophorales decreased in abundance and/or diversity over time. The current data, along with data from previous studies, demonstrated that the soil microbial community was affected by continuous cropping, in particular, the pathogenic and beneficial fungi that were positively selected over time, which is commonplace in agro-ecosystems. The trend towards an increase in fungal pathogens and simplification of the beneficial fungal community could be important factors contributing to the decline in peanut growth and yield over many years of continuous cropping.
Association of ABO and Rh Blood Groups to Blood-Borne Infections among Blood Donors in Tehran-Iran.
Mohammadali, Fatemeh; Pourfathollah, Aliakbar
2014-07-01
The aim of this study was to investigate the prevalence of hepatitis B, hepatitis C, HIV and syphilis infections in blood donors referred to Tehran Blood Transfusion Center (TBTC), and determine any association between blood groups and blood- borne infections between the years of 2005 and 2011. This was a retrospective study conducted at TBTC. All of the donor serum samples were screened for HBV, HCV, HIV and syphilis by using third generation ELISA kits and RPR test. Initial reactive samples were tested in duplicate. Confirmatory tests were performed on all repeatedly reactive donations. Blood group was determined by forward and reverse blood grouping. The results were subjected to chi square analysis for determination of statistical difference between the values among different categories according to SPSS program. Overall, 2031451 donor serum samples were collected in 2005-2011. Totally, 10451 were positive test for HBV, HCV, HIV and syphilis. The overall seroprevalence of HBV, HCV, HIV, and syphilis was 0.39%, 0.11%, 0.005%, and 0.010%, respectively. Hepatitis B and HIV infections were significantly associated with blood group of donors (P blood group "A" and percentage of HBs Ag was lower in donors who had blood group O. There was no significant association between Hepatitis C and syphilis infections with ABO and Rh blood groups (P>0.05). Compared with neighboring countries and the international standards, prevalence of blood-borne infections is relatively low.
Paramecium species ingest and kill the cells of the human pathogenic fungus Cryptococcus neoformans.
Frager, Shalom Z; Chrisman, Cara J; Shakked, Rachel; Casadevall, Arturo
2010-08-01
A fundamental question in the field of medical mycology is the origin of virulence in those fungal pathogens acquired directly from the environment. In recent years, it was proposed that the virulence of certain environmental animal-pathogenic microbes, such as Cryptococcus neoformans, originated from selection pressures caused by species-specific predation. In this study, we analyzed the interaction of C. neoformans with three Paramecium spp., all of which are ciliated mobile protists. In contrast to the interaction with amoebae, some Paramecium spp. rapidly ingested C. neoformans and killed the fungus. This study establishes yet another type of protist-fungal interaction supporting the notion that animal-pathogenic fungi in the environment are under constant selection by predation.
Ecosystem screening approach for pathogen-associated microorganisms affecting host disease.
Galiana, Eric; Marais, Antoine; Mura, Catherine; Industri, Benoît; Arbiol, Gilles; Ponchet, Michel
2011-09-01
The microbial community in which a pathogen evolves is fundamental to disease outcome. Species interacting with a pathogen on the host surface shape the distribution, density, and genetic diversity of the inoculum, but the role of these species is rarely determined. The screening method developed here can be used to characterize pathogen-associated species affecting disease. This strategy involves three steps: (i) constitution of the microbial community, using the pathogen as a trap; (ii) community selection, using extracts from the pathogen as the sole nutrient source; and (iii) molecular identification and the screening of isolates focusing on their effects on the growth of the pathogen in vitro and host disease. This approach was applied to a soilborne plant pathogen, Phytophthora parasitica, structured in a biofilm, for screening the microbial community from the rhizosphere of Nicotiana tabacum (the host). Two of the characterized eukaryotes interfered with the oomycete cycle and may affect the host disease. A Vorticella species acted through a mutualistic interaction with P. parasitica, disseminating pathogenic material by leaving the biofilm. A Phoma species established an amensal interaction with P. parasitica, strongly suppressing disease by inhibiting P. parasitica germination. This screening method is appropriate for all nonobligate pathogens. It allows the definition of microbial species as promoters or suppressors of a disease for a given biotope. It should also help to identify important microbial relationships for ecology and evolution of pathogens.
Annotating pathogenic non-coding variants in genic regions.
Gelfman, Sahar; Wang, Quanli; McSweeney, K Melodi; Ren, Zhong; La Carpia, Francesca; Halvorsen, Matt; Schoch, Kelly; Ratzon, Fanni; Heinzen, Erin L; Boland, Michael J; Petrovski, Slavé; Goldstein, David B
2017-08-09
Identifying the underlying causes of disease requires accurate interpretation of genetic variants. Current methods ineffectively capture pathogenic non-coding variants in genic regions, resulting in overlooking synonymous and intronic variants when searching for disease risk. Here we present the Transcript-inferred Pathogenicity (TraP) score, which uses sequence context alterations to reliably identify non-coding variation that causes disease. High TraP scores single out extremely rare variants with lower minor allele frequencies than missense variants. TraP accurately distinguishes known pathogenic and benign variants in synonymous (AUC = 0.88) and intronic (AUC = 0.83) public datasets, dismissing benign variants with exceptionally high specificity. TraP analysis of 843 exomes from epilepsy family trios identifies synonymous variants in known epilepsy genes, thus pinpointing risk factors of disease from non-coding sequence data. TraP outperforms leading methods in identifying non-coding variants that are pathogenic and is therefore a valuable tool for use in gene discovery and the interpretation of personal genomes.While non-coding synonymous and intronic variants are often not under strong selective constraint, they can be pathogenic through affecting splicing or transcription. Here, the authors develop a score that uses sequence context alterations to predict pathogenicity of synonymous and non-coding genetic variants, and provide a web server of pre-computed scores.
Bronson, Ellen; Spiker, Harry; Driscoll, Cindy P
2014-10-01
American black bears (Ursus americanus) in Maryland, USA, live in forested areas in close proximity to humans and their domestic pets. From 1999 to 2011, we collected 84 serum samples from 63 black bears (18 males; 45 females) in five Maryland counties and tested them for exposure to infectious, including zoonotic, pathogens. A large portion of the bears had antibody to canine distemper virus and Toxoplasma gondii, many at high titers. Prevalences of antibodies to zoonotic agents such as rabies virus and to infectious agents of carnivores including canine adenovirus and canine parvovirus were lower. Bears also had antibodies to vector-borne pathogens common to bears and humans such as West Nile virus, Borrelia burgdorferi, Rickettsia rickettsii, and Anaplasma phagocytophilum. Antibodies were detected to Leptospira interrogans serovars Pomona, Icterohaemorrhagiae, Canicola, Grippotyphosa, and Bratislava. We did not detect antibodies to Brucella canis or Ehrlichia canis. Although this population of Maryland black bears demonstrated exposure to multiple pathogens of concern for humans and domesticated animals, the low levels of clinical disease in this and other free-ranging black bear populations indicate the black bear is likely a spillover host for the majority of pathogens studied. Nevertheless, bear populations living at the human-domestic-wildlife interface with increasing human and domestic animal exposure should continue to be monitored because this population likely serves as a useful sentinel of ecosystem health.
Directory of Open Access Journals (Sweden)
Porfirio Raúl Galicia-García
Full Text Available ABSTRACT Ustilago maydis is a basidiomycete known as the causative agent of 'common smut', worldwide disease of maize that is recognized by the galls it forms, which have considerable potential as a gourmet food. Results of infection are quite variable, even under optimal greenhouse conditions. In order to find pathogenic strains able to be used as a highly infective and stable inoculum for the successful production of galls either in greenhouses or in the field, ears with gall symptoms containing teliospores were recovered from maize plants. The teliospores were suspended in water and plated on nutrient-rich medium. Twenty-six colonies developed, containing three types of yeast-like colonies: saprotrophic, pathogenic, and solopathogenic. DAPI staining confirmed the presence of solopathogenic strains with diploid sporidia. Groups of different mating types were found when pairs of the 26 strains were arranged resembling partial-diallel combinations. Amplification of the partial b locus revealed that the strains found harbor the alleles b3 and b4, allowing the formation in dikaryotic strains of heterodimeric regulatory proteins associated with fungal development and pathogenicity. In this study, we isolated compatible haploid and solopathogenic diploid strains for their high capacity for inducing smut.
Serologic survey for selected arboviruses and other potential pathogens in wildlife from Mexico.
Aguirre, A A; McLean, R G; Cook, R S; Quan, T J
1992-07-01
During 1988 and 1989, a serologic survey of wildlife was conducted in northeastern Mexico to determine the presence, prevalence, and distribution of arboviruses and other selected disease agents. Eighty mammal specimens were tested. Antibodies to vesicular stomatitis-Indiana, Venezuelan equine encephalitis-Mena II, Rio Grande virus, and vesicular stomatitis-New Jersey were detected predominantly in small mammals. Deer and mouflon (Ovis musimon) had antibodies to bluetongue and epizootic hemorrhagic disease. Two species had serologic evidence of recent exposure to Francisella tularensis. A white-tailed deer (Odocoileus virginianus) had antibodies to Anaplasma marginale. All specimens tested for antibodies against Yersinia pestis and Brucella abortus were negative. Sera from 315 birds were tested for antibody against five equine encephalitis viruses and six avian pathogens. During 1988, antibodies to Venezuelan equine encephalitis-Mena II, Venezuelan equine encephalitis-TC83, St. Louis encephalitis, eastern equine encephalitis, and western equine encephalitis were detected in birds of several species. Antibodies to Pasteurella multocida and Newcastle disease virus were also detected. Birds from five species presented antibodies to Mycoplasma meleagridis. Specimens tested for M. gallisepticum, M. synoviae, and Chlamydia psittaci were negative. To the best of our knowledge, this survey represents the first serologic evidence of bluetongue, Cache Valley virus, epizootic hemorrhagic disease, Jamestown Canyon virus, vesicular stomatitis-Indiana, vesicular stomatitis-New Jersey, Rio Grande virus, and tularemia reported among wildlife in Mexico.
Energy Technology Data Exchange (ETDEWEB)
Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham; Wilhelm, Larry J.; Goodwin, Stephen B.; Berlin, Aaron M.; Figueroa, Melania; Freitag, Michael; Hane, James K.; Henrissat, Bernard; Holman, Wade H.; Kodira, Chinnappa D.; Martin, Joel; Oliver, Richard P.; Robbertse, Barbara; Schackwitz, Wendy; Schwartz, David C.; Spatafora, Joseph W.; Turgeon, B. Gillian; Yandava, Chandri; Young, Sarah; Zhou, Shiguo; Zeng, Qiandong; Grigoriev, Igor V.; Ma, Li-Jun; Ciuffetti, Lynda M.
2012-08-16
Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11 chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes.
A New Selectable Marker System for Genetic Studies of Bacteria: Final Report
Energy Technology Data Exchange (ETDEWEB)
Parsons, D; Tolmasky, M; Chain, P; Segelke, B W
2011-03-18
Genetic manipulations in bacteria currently rely on the introduction of antibiotic resistance genes into a bacterial strain; for those organisms that will be used for commercial or industrial applications, the genetic cassette encoding the antibiotic resistance is sometimes removed after selection. it is clear that if alternative technologies could obviate the need to introduce antibiotic resistance into bacteria, they would most certainly become a standard tool in molecular micriobiology for commercial, industrial as well as research applications. Here, they present the development of a novel genetic engineering technology based on toxin-antitoxin systems to modify bacterial genomes without the use of antibiotic resistance in the mutagenesis process. The primary goal is to develop antibiotic-free selection for genetically altered select agent pathogens. They are adapting the toxinc-antitoxin system to enable gene replacement in select agent pathogens since the NIH restrictions introducing antibiotic resistance into select agent pathogens have hindered research with select agent pathogens.
Severns, Virginia; Branch, Darren W.; Edwards, Thayne L.; Larson, Richard S.
2013-01-01
Disasters can create situations in which blood donations can save lives. However, in emergency situations and when resources are depleted, on-site blood donations require the rapid and accurate detection of blood-borne pathogens, including human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2). Techniques such as PCR and antibody capture by an enzyme-linked immunosorbent assay (ELISA) for HIV-1 and HIV-2 are precise but time-consuming and require sophisticated equipment that is not compatible with emergency point-of-care requirements. We describe here a prototype biosensor based on piezoelectric materials functionalized with specific antibodies against HIV-1 and HIV-2. We show the rapid and accurate detection of HIV-1 and HIV-2 in both simple and complex solutions, including human serum, and in the presence of a cross-confounding virus. We report detection limits of 12 50% tissue culture infective doses (TCID50s) for HIV-1 and 87 TCID50s for HIV-2. The accuracy, precision of measurements, and operation of the prototype biosensor compared favorably to those for nucleic acid amplification. We conclude that the biosensor has significant promise as a successful point-of-care diagnostic device for use in emergency field applications requiring rapid and reliable testing for blood-borne pathogens. PMID:23515541
Prevalence of foodborne pathogens in food from selected African countries - A meta-analysis.
Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph; Matsheka, Maitshwarelo Ignatius; Sekwati-Monang, Bonno; Amoa-Awua, Wisdom; Atter, Amy; Ackah, Nina Bernice; Mbugua, Samuel; Asagbra, Agnes; Abdelgadir, Warda; Nakavuma, Jesca; Jakobsen, Mogens; Fang, Weihuan
2017-05-16
Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews the prevalence of foodborne pathogens in seven African countries (Benin, Botswana, Ghana, Kenya, Nigeria, Sudan and Uganda) from papers in regional or international journals published between January 2000 and December 2015. One hundred and sixteen publications that dealt with food microbiology were reviewed for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78/116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella, Staphylococcus aureus and Listeria monocytogenes were the most frequently reported organisms in those studies. Although the data were highly heterogeneous, a striking feature is high prevalence of the major pathogens in RTE foods, almost as high as in raw foods. E. coli averaged at 37.6% in raw foods and 31.6% in RTE foods. The corresponding prevalence for Salmonella was 19.9% vs 21.7%; S. aureus, 27.8% vs 25.1% and L. monocytogenes, 19.5% vs 6.7%. The average prevalence of foodborne pathogens in these countries was 34.2% (29.0-39.3%). Differences in food types as well as non-uniform protocols for sampling and identification might have contributed to high heterogeneity (I 2 >97%) although some high prevalence data could be factual with extensive varieties of raw and RTE foods
Pathogen prevalence predicts human cross-cultural variability in individualism/collectivism.
Fincher, Corey L; Thornhill, Randy; Murray, Damian R; Schaller, Mark
2008-06-07
Pathogenic diseases impose selection pressures on the social behaviour of host populations. In humans (Homo sapiens), many psychological phenomena appear to serve an antipathogen defence function. One broad implication is the existence of cross-cultural differences in human cognition and behaviour contingent upon the relative presence of pathogens in the local ecology. We focus specifically on one fundamental cultural variable: differences in individualistic versus collectivist values. We suggest that specific behavioural manifestations of collectivism (e.g. ethnocentrism, conformity) can inhibit the transmission of pathogens; and so we hypothesize that collectivism (compared with individualism) will more often characterize cultures in regions that have historically had higher prevalence of pathogens. Drawing on epidemiological data and the findings of worldwide cross-national surveys of individualism/collectivism, our results support this hypothesis: the regional prevalence of pathogens has a strong positive correlation with cultural indicators of collectivism and a strong negative correlation with individualism. The correlations remain significant even when controlling for potential confounding variables. These results help to explain the origin of a paradigmatic cross-cultural difference, and reveal previously undocumented consequences of pathogenic diseases on the variable nature of human societies.
He, Ying-Hong; Isono, Sayaka; Shibuya, Makoto; Tsuji, Masaharu; Adkar Purushothama, Charith-Raj; Tanaka, Kazuaki; Sano, Teruo
2012-01-01
To monitor the richness in microbial inhabitants in the phyllosphere of apple trees cultivated under various cultural and environmental conditions, we developed an oligo-DNA macroarray for major pathogenic and non-pathogenic fungi and bacteria inhabiting the phyllosphere of apple trees. First, we isolated culturable fungi and bacteria from apple orchards by an agar-plate culture method, and detected 32 fungal and 34 bacterial species. Alternaria, Aureobasidium, Cladosporium, Rhodotorula, Cystofilobasidium, and Epicoccum genera were predominant among the fungi, and Bacillus, Pseudomonas, Sphingomonas, Methylobacterium, and Pantoea genera were predominant among the bacteria. Based on the data, we selected 29 major non-pathogenic and 12 phytopathogenic fungi and bacteria as the targets of macroarray. Forty-one species-specific 40-base pair long oligo-DNA sequences were selected from the nucleotide sequences of rDNA-internal transcribed spacer region for fungi and 16S rDNA for bacteria. The oligo-DNAs were fixed on nylon membrane and hybridized with digoxigenin-labeled cRNA probes prepared for each species. All arrays except those for Alternaria, Bacillus, and their related species, were specifically hybridized. The array was sensitive enough to detect 10(3) CFU for Aureobasidium pullulans and Bacillus cereus. Nucleotide sequencing of 100 each of independent fungal rDNA-ITS and bacterial 16S-rDNA sequences from apple tree was in agreement with the macroarray data obtained using the same sample. Finally, we analyzed the richness in the microbial inhabitants in the samples collected from apple trees in four orchards. Major apple pathogens that cause scab, Alternaria blotch, and Marssonina blotch were detected along with several non-phytopathogenic fungal and bacterial inhabitants. The macroarray technique presented here is a strong tool to monitor the major microbial species and the community structures in the phyllosphere of apple trees and identify key species
Directory of Open Access Journals (Sweden)
Ying-Hong He
Full Text Available BACKGROUND: To monitor the richness in microbial inhabitants in the phyllosphere of apple trees cultivated under various cultural and environmental conditions, we developed an oligo-DNA macroarray for major pathogenic and non-pathogenic fungi and bacteria inhabiting the phyllosphere of apple trees. METHODS AND FINDINGS: First, we isolated culturable fungi and bacteria from apple orchards by an agar-plate culture method, and detected 32 fungal and 34 bacterial species. Alternaria, Aureobasidium, Cladosporium, Rhodotorula, Cystofilobasidium, and Epicoccum genera were predominant among the fungi, and Bacillus, Pseudomonas, Sphingomonas, Methylobacterium, and Pantoea genera were predominant among the bacteria. Based on the data, we selected 29 major non-pathogenic and 12 phytopathogenic fungi and bacteria as the targets of macroarray. Forty-one species-specific 40-base pair long oligo-DNA sequences were selected from the nucleotide sequences of rDNA-internal transcribed spacer region for fungi and 16S rDNA for bacteria. The oligo-DNAs were fixed on nylon membrane and hybridized with digoxigenin-labeled cRNA probes prepared for each species. All arrays except those for Alternaria, Bacillus, and their related species, were specifically hybridized. The array was sensitive enough to detect 10(3 CFU for Aureobasidium pullulans and Bacillus cereus. Nucleotide sequencing of 100 each of independent fungal rDNA-ITS and bacterial 16S-rDNA sequences from apple tree was in agreement with the macroarray data obtained using the same sample. Finally, we analyzed the richness in the microbial inhabitants in the samples collected from apple trees in four orchards. Major apple pathogens that cause scab, Alternaria blotch, and Marssonina blotch were detected along with several non-phytopathogenic fungal and bacterial inhabitants. CONCLUSIONS: The macroarray technique presented here is a strong tool to monitor the major microbial species and the community structures in
Directory of Open Access Journals (Sweden)
Jana eSperschneider
2014-09-01
Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.
Adaptive value of sex in microbial pathogens.
Michod, Richard E; Bernstein, Harris; Nedelcu, Aurora M
2008-05-01
Explaining the adaptive value of sex is one of the great outstanding problems in biology. The challenge comes from the difficulty in identifying the benefits provided by sex, which must outweigh the substantial costs of sex. Here, we consider the adaptive value of sex in viruses, bacteria and fungi, and particularly the information available on the adaptive role of sex in pathogenic microorganisms. Our general theme is that the varied aspects of sex in pathogens illustrate the varied issues surrounding the evolution of sex generally. These include, the benefits of sex (in the short- and long-term), as well as the costs of sex (both to the host and to the pathogen). For the benefits of sex (that is, its adaptive value), we consider three hypotheses: (i) sex provides for effective and efficient recombinational repair of DNA damages, (ii) sex provides DNA for food, and (iii) sex produces variation and reduces genetic associations among alleles under selection. Although the evolution of sex in microbial pathogens illustrates these general issues, our paper is not a general review of theories for the evolution of sex in all organisms. Rather, we focus on the adaptive value of sex in microbial pathogens and conclude that in terms of short-term benefits, the DNA repair hypothesis has the most support and is the most generally applicable hypothesis in this group. In particular, recombinational repair of DNA damages may substantially benefit pathogens when challenged by the oxidative defenses of the host. However, in the long-term, sex may help get rid of mutations, increase the rate of adaptation of the population, and, in pathogens, may infrequently create new infective strains. An additional general issue about sex illustrated by pathogens is that some of the most interesting consequences of sex are not necessarily the reasons for which sex evolved. For example, antibiotic resistance may be transferred by bacterial sex, but this transfer is probably not the reason sex
Elias, Lucília de Almeida; Bastos, Francisco Inacio
2011-12-01
This article assesses the historical context and the conceptual frame of setting up damage containment programs in the field of public health, with special emphasis on the Brazilian experience. The survey seeks to assess the relevance of such programs in the ongoing efforts to curb the spread of blood-borne and sexually transmitted infections, especially AIDS and hepatitis C. Findings from both the Brazilian and the international literature demonstrate that practical damage containment initiatives tend to be more effective when integrated with other public health measures based on common goals. Damage containment initiatives, aligned with the basic principles of public health do not limit themselves to a priori models or health care per se. They encompass a variety of pragmatic measures based on public policies and should be in line with the demands of the communities since the moment of their inception and implemented in the context of full partnership with such communities.
Wininger, Kerry; Rank, Nathan
2017-11-01
Plants colonized land over 400 million years ago. Shortly thereafter, organisms began to consume terrestrial plant tissue as a nutritional resource. Most plant enemies are plant pathogens or herbivores, and they impose natural selection for plants to evolve defenses. These traits generate selection pressures on enemies. Coevolution between terrestrial plants and their enemies is an important element of the evolutionary history of both groups. However, coevolutionary studies of plant-pathogen interactions have tended to focus on different research topics than plant-herbivore interactions. Specifically, studies of plant-pathogen interactions often adopt a "gene-for-gene" conceptual framework. In contrast, studies of plants and herbivores often investigate escalation or elaboration of plant defense and herbivore adaptations to overcome it. The main exceptions to the general pattern are studies that focus on small, sessile herbivores that share many features with plant pathogens, studies that incorporate both herbivores and pathogens into a single investigation, and studies that test aspects of Thompson's geographic mosaic theory for coevolution. We discuss the implications of these findings for future research. © 2017 New York Academy of Sciences.
Convergent evolution and mimicry of protein linear motifs in host-pathogen interactions.
Chemes, Lucía Beatriz; de Prat-Gay, Gonzalo; Sánchez, Ignacio Enrique
2015-06-01
Pathogen linear motif mimics are highly evolvable elements that facilitate rewiring of host protein interaction networks. Host linear motifs and pathogen mimics differ in sequence, leading to thermodynamic and structural differences in the resulting protein-protein interactions. Moreover, the functional output of a mimic depends on the motif and domain repertoire of the pathogen protein. Regulatory evolution mediated by linear motifs can be understood by measuring evolutionary rates, quantifying positive and negative selection and performing phylogenetic reconstructions of linear motif natural history. Convergent evolution of linear motif mimics is widespread among unrelated proteins from viral, prokaryotic and eukaryotic pathogens and can also take place within individual protein phylogenies. Statistics, biochemistry and laboratory models of infection link pathogen linear motifs to phenotypic traits such as tropism, virulence and oncogenicity. In vitro evolution experiments and analysis of natural sequences suggest that changes in linear motif composition underlie pathogen adaptation to a changing environment. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Fengping Chen
2017-06-01
Full Text Available Understanding how habitat heterogeneity may affect the evolution of plant pathogens is essential to effectively predict new epidemiological landscapes and manage genetic diversity under changing global climatic conditions. In this study, we explore the effects of habitat heterogeneity, as determined by variation in host resistance and local temperature, on the evolution of Zymoseptoria tritici by comparing the aggressiveness development of five Z. tritici populations originated from different parts of the world on two wheat cultivars varying in resistance to the pathogen. Our results show that host resistance plays an important role in the evolution of Z. tritici. The pathogen was under weak, constraining selection on a host with quantitative resistance but under a stronger, directional selection on a susceptible host. This difference is consistent with theoretical expectations that suggest that quantitative resistance may slow down the evolution of pathogens and therefore be more durable. Our results also show that local temperature interacts with host resistance in influencing the evolution of the pathogen. When infecting a susceptible host, aggressiveness development of Z. tritici was negatively correlated to temperatures of the original collection sites, suggesting a trade-off between the pathogen’s abilities of adapting to higher temperature and causing disease and global warming may have a negative effect on the evolution of pathogens. The finding that no such relationship was detected when the pathogen infected the partially resistant cultivars indicates the evolution of pathogens in quantitatively resistant hosts is less influenced by environments than in susceptible hosts.
The Role of Pathogenic Autoantibodies in Autoimmunity
Directory of Open Access Journals (Sweden)
Merrill J. Rowley
2015-11-01
Full Text Available The serological presence of autoantibodies is diagnostic of autoimmunity, and these autoantibodies may be present for many years before the presentation of autoimmune disease (AID. Although a pathogenic role has been demonstrated for various autoantibodies reactive with cell surface and extracellular autoantigens, studies using monoclonal antibodies (mAb show not all antibodies in the polyclonal response are pathogenic. Differences depend on Fab-mediated diversity in epitope specificity, Fc-mediated effects based on immunoglobulin (Ig class and subclass, activation of complement, and the milieu in which the reaction occurs. These autoantibodies often occur in organ-specific AID and this review illustrates their pathogenic and highly specific effects. The role of autoantibodies associated with intracellular antigens is less clear. In vitro they may inhibit or adversely affect well-defined intracellular biochemical pathways, yet, in vivo they are separated from their autoantigens by multiple cellular barriers. Recent evidence that Ig can traverse cell membranes, interact with intracellular proteins, and induce apoptosis has provided new evidence for a pathogenic role for such autoantibodies. An understanding of how autoantibodies behave in the polyclonal response and their role in pathogenesis of AID may help identify populations of culprit B-cells and selection of treatments that suppress or eliminate them.
Novel Target for Ameliorating Pain and Other Problems after SCI: Spontaneous Activity in Nociceptors
2016-06-01
BSCB will permit blood-borne mye- loid and lymphoid immune cells to enter the spinal cord parenchyma and exert direct inflammatory actions on central...primitive innate immune system is the first line of defense against pathogens and toxins; it is always present and it depends upon diverse cell types that...adaptive immune system, the innate immune system does not em- ploy antigen-specific humoral and cell -mediated immunity mecha- nisms. Two innate immune
N Lakshmi Priya; K Usha Krishnan; G Jayalakshmi; S Vasanthi
2015-01-01
Occupational exposure poses a significant risk of transmission of blood-borne pathogens to healthcare workers (HCWs). Adherence to standard precautions, awareness about post exposure prophylaxis is poor in developing countries. This retrospective study analyzes the self-reported cases of occupational exposure in a tertiary care hospital. During the study period, 105 HCWs sustained occupational exposure to blood and body fluids. Majority of the victims 36 (34.2%) were interns and the clinical ...
Directory of Open Access Journals (Sweden)
Hamza Yıldız
2015-03-01
Full Text Available Objective: The aim of this study was to compare the patients who have antisocial personality disorder (ASPD and the healthy individuals in terms of sexually transmitted diseases (STDs and Blood-Borne Transmitted Infections (BTIs prevalences. Methods: This study is a prospective, single-center, open-label, non-randomized controlled clinical study. There were two groups in the study. The patient group consistsed of 100 males who were diagnosed as ASPD with a clinical interview form. The control group consisted of 98 healthy males who did not have any psychiatric disorder. Dermatologic examination was performed, and clinical findings were recorded. Results: The mean age of the patient group was 21.96±2.40 (range 20-37 years. The mean age of the control group was 24.20±2.88 (21-36 years. The most common disease was gonorrhea (25% followed by genital wart (11%, molluskum contagiosum (5%, HBsAg (4%, and HSV-2 seropositivity (4% in the patients group. In the control group, HSV-2 seropositivity (4.08%, genital wart (3.06%, molluskum contagiosum (3.06%, and gonorrhe (1.02% were commonly seen in the control group. STDs and/or BVTIs were found more common in the patients group (82% than that in the control group (45.91% (X2=30.62, p=0.000. Conclusions: The patients with ASPD are at greater risk than normal population to catch a STDs or BTIs because of their lower educational levels and riskier behaviors. This condition entertains a risk in the general population and the patients themselves.
The cereal pathogen Fusarium graminearum is the primary cause of Fusarium head blight (FHB) and a significant threat to food safety and crop production. To elucidate population structure and identify genomic targets of selection within major FHB pathogen populations in North America we sequenced the...
Directory of Open Access Journals (Sweden)
Beniamino T. Cenci-Goga
2015-05-01
Full Text Available Several growth curves for selected pathogens and hygiene indicators alone and vs selected dairy starter cultures (LAB and commercial probiotics have been performed. All strains for LAB and commercial probiotics were inoculated as pure cultures into skim milk to get an initial cocci:bacilli:enterocci ratio of 2:1:1 and a concentration of approximately 107 cfu mL–1 until challenge vs selected pathogens and hygiene indicators. Selected pathogens came from the collection of the Laboratorio di Ispezione degli Alimenti di O.A. or were reference strains (Escherichia coli, CSH26 K12, Staphylococcus aureus 27R, Salmonella Derby 27, Pseudomonas fluorescens ATCC 13525, Listeria innocua ATCC 33090. Each strain was inoculated into skim milk to get an initial concentration of approximately 106 cfu mL–1. Growth curves in skim milk for the following challenges were studied: i sterility control; ii association LAB; iii association of LAB vs each selected pathogen or hygiene indicator; iv selected pathogen or hygiene indicator alone. The challenges were carried out in BHI broth and in skim milk at 37°C. The highest reduction was observed in milk but in general the association of LAB and the probiotic was able to limit the growth of pathogens and hygiene indicators.
Natural selection promotes antigenic evolvability
Graves, C.J.; Ros, V.I.D.; Stevenson, B.; Sniegowski, P.D.; Brisson, D.
2013-01-01
The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide
Evaluation of peptide selection approaches for epitope‐based vaccine design
DEFF Research Database (Denmark)
Schubert, B.; Lund, Ole; Nielsen, Morten
2013-01-01
A major challenge in epitope-based vaccine (EV) design stems from the vast genomic variation of pathogens and the diversity of the host cellular immune system. Several computational approaches have been published to assist the selection of potential T cell epitopes for EV design. So far, no thoro......A major challenge in epitope-based vaccine (EV) design stems from the vast genomic variation of pathogens and the diversity of the host cellular immune system. Several computational approaches have been published to assist the selection of potential T cell epitopes for EV design. So far...... in terms of in silico measurements simulating important vaccine properties like the ability of inducing protection against a multivariant pathogen in a population; the predicted immunogenicity; pathogen, allele, and population coverage; as well as the conservation of selected epitopes. Additionally, we...... evaluate the use of human leukocyte antigen (HLA) supertypes with regards to their applicability for population-spanning vaccine design. The results showed that in terms of induced protection methods that simultaneously aim to optimize pathogen and HLA coverage significantly outperform methods focusing...
Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo
2016-01-01
During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.
Aro, Abimbola O; Dzoyem, Jean P; Hlokwe, Tiny M; Madoroba, Evelyn; Eloff, Jacobus N; McGaw, Lyndy J
2015-07-01
Tuberculosis (TB) caused by Mycobacterium tuberculosis remains an ongoing threat to human health. Many plant species contain antimycobacterial compounds, which may serve as template molecules for new anti-TB drugs. The Rubiaceae family is the largest family of trees in southern Africa, and preliminary evidence revealed antimycobacterial activity in several species of the genus, motivating further studies. Leaf extracts of 15 tree species from the Rubiaceae family were screened for antimycobacterial activity against pathogenic M. tuberculosis and non-pathogenic Mycobacterium smegmatis, Mycobacterium aurum and Mycobacterium bovis BCG (Bacillus Calmette-Guérin) using a twofold serial microdilution assay. Cytotoxicity was determined using a tetrazolium-based colorimetric assay against C3A liver cells and Vero kidney cells. Minimum inhibitory concentration values as low as 0.04 mg/mL against M. smegmatis and M. tuberculosis were recorded. Activity against M. aurum was the best predictor of activity against pathogenic M. tuberculosis (correlation coefficient = 0.9). Bioautography indicated at least 40 different antimycobacterial compounds in the extracts. Cytotoxicity of the extracts varied, and Oxyanthus speciosus had the most promising selectivity index values. Copyright © 2015 John Wiley & Sons, Ltd.
Pathogenic mechanism in lung fibrosis
International Nuclear Information System (INIS)
Witschi, H.; Haschek, W.M.; Meyer, K.R.; Ullrich, R.L.; Dalbey, W.E.
1979-01-01
The purpose of the study was to examine whether an interaction between two agents causing alveolar epithelial damage would produce lung fibrosis. In mouse lung, intraperitoneal injection of the antioxidant butylated hydroxytoluene causes diffuse alveolar type I cell necrosis, followed by proliferation of type II alveolar cells. In animals exposed to 70% O 2 or 100-200 rad x rays during the phase of type II cell proliferation following BHT, diffuse interstitial lung fibrosis developed within 2 weeks. Quantitative analysis of the lungs for hydroxyproline showed that the interaction between BHT and O 2 or x rays was synergistic. If exposure to O 2 or x rays was delayed until epithelial recovery was complete, no fibrosis was seen. Abnormally high levels of lung collagen persisted up to 6 months after one single treatment with BHT and 100 rad x rays. A commonly seen form of chronic lung damage may thus be caused by an acute interaction between a bloodborne agent which damages the alveolar cell and a toxic inhalant or x rays, provided a critically ordered sequence of exposure is observed
Directory of Open Access Journals (Sweden)
Ioannis Sitaras
Full Text Available Evolution of Avian Influenza (AI viruses--especially of the Highly Pathogenic Avian Influenza (HPAI H5N1 subtype--is a major issue for the poultry industry. HPAI H5N1 epidemics are associated with huge economic losses and are sometimes connected to human morbidity and mortality. Vaccination (either as a preventive measure or as a means to control outbreaks is an approach that splits the scientific community, due to the risk of it being a potential driving force in HPAI evolution through the selection of mutants able to escape vaccination-induced immunity. It is therefore essential to study how mutations are selected due to immune pressure. To this effect, we performed an in vitro selection of mutants from HPAI A/turkey/Turkey/1/05 (H5N1, using immune pressure from homologous polyclonal sera. After 42 rounds of selection, we identified 5 amino acid substitutions in the Haemagglutinin (HA protein, most of which were located in areas of antigenic importance and suspected to be prone to selection pressure. We report that most of the mutations took place early in the selection process. Finally, our antigenic cartography studies showed that the antigenic distance between the selected isolates and their parent strain increased with passage number.
Kaushik, Rajni; Balasubramanian, Rajasekhar
2012-01-01
Bacterial pathogens in airborne particulate matter (PM) and in rainwater (RW) were detected using a robust and sensitive Real-Time PCR method. Both RW and PM were collected simultaneously in the tropical atmosphere of Singapore, which were then subjected to analysis for the presence of selected bacterial pathogens and potential pathogen of health concern ( Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and Aeromonas hydrophila). These pathogens were found to be prevalent in both PM and RW samples with E. coli being the most prevalent potential pathogen in both types of samples. The temporal distribution of these pathogens in PM and RW was found to be similar to each other. Using the proposed microbiological technique, the atmospheric deposition (dry and wet deposition) of bacterial pathogens to lakes and reservoirs can be studied in view of growing concerns about the outbreak of waterborne diseases.
Selective Photonic Disinfection; A ray of hope in the war against pathogens
Tsen, Shaw-Wei D.; Tsen, Kong-Thon
2016-06-01
Pathogens such as viruses and bacteria are among the greatest threats to human health worldwide. In today's era of population growth and international travel, new technologies are desperately needed to combat the spread of known and emerging pathogens. This book presents a new concept for pathogen inactivation called selective photonic disinfection (SEPHODIS). The SEPHODIS technology inactivates pathogens by mechanical means, a total paradigm shift from traditional chemical and physical methods. The unique strength of SEPHODIS resides in its capability to inactivate pathogens while preserving desirable materials such as human cells and proteins. The technology also avoids the need to use chemicals, drastically reducing the risk of side effects. These properties make SEPHODIS ideal for important biomedical applications such as safeguarding blood products and therapeutics against pathogens, as well as producing effective and safe vaccines to combat infectious disease. Written in a style that is both technically informative and easy to comprehend for the layman reader, this book illustrates the story of SEPHODIS from its initial discovery and bench studies to its real-world applications. 1 citation publication-type="journal"> Epstein J S Vostal J G 2003 FDA approach to evaluation of pathogen reduction technology Transfusion 43 1347 1349 1347-9 10.1046/j.1537-2995.2003.00584.x citation> 2 citation publication-type="journal"> Salunkhe V van der Meer P F de Korte D Seghatchian J Gutierrez L 2015 Development of blood transfusion product pathogen reduction treatments: a review of methods, current applications and demands Transfus. Apher. Sci. 52 19 34 19-34 10.1016/j.transci.2014.12.016 citation> 3 citation publication-type="book"> Sanders B Koldijk M Schuitemaker H 2015 Inactivated viral vaccines Vaccine Analysis: Strategies, Principles, and Control Nunnally B K Turula V E Sitrin RD R D Berlin Springer pp 45 80 45-80 citation> 4 citation publication
Photoinactivation of major bacterial pathogens in aquaculture
Directory of Open Access Journals (Sweden)
Heyong Jin Roh
2016-08-01
Full Text Available Abstract Background Significant increases in the bacterial resistance to various antibiotics have been found in fish farms. Non-antibiotic therapies for infectious diseases in aquaculture are needed. In recent years, light-emitting diode technology has been applied to the inactivation of pathogens, especially those affecting humans. The purpose of this study was to assess the effect of blue light (wavelengths 405 and 465 nm on seven major bacterial pathogens that affect fish and shellfish important in aquaculture. Results We successfully demonstrate inactivation activity of a 405/465-nm LED on selected bacterial pathogens. Although some bacteria were not fully inactivated by the 465-nm light, the 405-nm light had a bactericidal effect against all seven pathogens, indicating that blue light can be effective without the addition of a photosensitizer. Photobacterium damselae, Vibrio anguillarum, and Edwardsiella tarda were the most susceptible to the 405-nm light (36.1, 41.2, and 68.4 J cm−2, respectively, produced one log reduction in the bacterial populations, whereas Streptococcus parauberis was the least susceptible (153.8 J cm−2 per one log reduction. In general, optical density (OD values indicated that higher bacterial densities were associated with lower inactivating efficacy, with the exception of P. damselae and Vibrio harveyi. In conclusion, growth of the bacterial fish and shellfish pathogens evaluated in this study was inactivated by exposure to either the 405- or 465-nm light. In addition, inactivation was dependent on exposure time. Conclusions This study presents that blue LED has potentially alternative therapy for treating fish and shellfish bacterial pathogens. It has great advantages in aspect of eco-friendly treating methods differed from antimicrobial methods.
Bacteriophages for detection of bacterial pathogens
International Nuclear Information System (INIS)
Kutateladze, M.
2009-01-01
The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary
Pathogen inactivation techniques.
Pelletier, J P R; Transue, S; Snyder, E L
2006-01-01
The desire to rid the blood supply of pathogens of all types has led to the development of many technologies aimed at the same goal--eradication of the pathogen(s) without harming the blood cells or generating toxic chemical agents. This is a very ambitious goal, and one that has yet to be achieved. One approach is to shun the 'one size fits all' concept and to target pathogen-reduction agents at the Individual component types. This permits the development of technologies that might be compatible with, for example, plasma products but that would be cytocidal and thus incompatible with platelet concentrates or red blood cell units. The technologies to be discussed include solvent detergent and methylene blue treatments--designed to inactivate plasma components and derivatives; psoralens (S-59--amotosalen) designed to pathogen-reduce units of platelets; and two products aimed at red blood cells, S-303 (a Frale--frangible anchor-linker effector compound) and Inactine (a binary ethyleneimine). A final pathogen-reduction material that might actually allow one material to inactivate all three blood components--riboflavin (vitamin B2)--is also under development. The sites of action of the amotosalen (S-59), the S-303 Frale, Inactine, and riboflavin are all localized in the nucleic acid part of the pathogen. Solvent detergent materials act by dissolving the plasma envelope, thus compromising the integrity of the pathogen membrane and rendering it non-infectious. By disrupting the pathogen's ability to replicate or survive, its infectivity is removed. The degree to which bacteria and viruses are affected by a particular pathogen-reducing technology relates to its Gram-positive or Gram-negative status, to the sporulation characteristics for bacteria, and the presence of lipid or protein envelopes for viruses. Concerns related to photoproducts and other breakdown products of these technologies remain, and the toxicology of pathogen-reduction treatments is a major ongoing area
Disinfection and removal of human pathogenic bacteria in arctic waste stabilization ponds
DEFF Research Database (Denmark)
Huang, Yannan; Hansen, Lisbeth Truelstrup; Ragush, Colin M.
2017-01-01
Wastewater stabilization ponds (WSPs) are commonly used to treat municipal wastewater in Arctic Canada. The biological treatment in the WSPs is strongly influenced by climatic conditions. Currently, there is limited information about the removal of fecal and pathogenic bacteria during the short...... cool summer treatment season. With relevance to public health, the objectives of this paper were to determine if treatment in arctic WSPs resulted in the disinfection (i.e., removal of fecal indicator bacteria, Escherichia coli) and removal of selected human bacterial pathogens from the treated...... treatment of the wastewater with a 2–3 Log removal of generic indicator E. coli. The bacterial pathogens Salmonella spp., pathogenic E. coli, and Listeria monocytogenes, but not Campylobacter spp. and Helicobacter pylori, were detected in the untreated and treated wastewater, indicating that human...
Nithya, Angamuthu; Babu, Subramanian
2017-03-14
The study aimed at enumerating, identifying and categorizing the endophytic cultivable bacterial community in selected salad vegetables (carrot, cucumber, tomato and onion). Vegetable samples were collected from markets of two vegetable hot spot growing areas, during two different crop harvest seasons. Crude and diluted vegetable extracts were plated and the population of endophytic bacteria was assessed based on morphologically distinguishable colonies. The bacterial isolates were identified by growth in selective media, biochemical tests and 16S rRNA gene sequencing. The endophytic population was found to be comparably higher in cucumber and tomato in both of the sampling locations, whereas lower in carrot and onion. Bacterial isolates belonged to 5 classes covering 46 distinct species belonging to 19 genera. Human opportunistic pathogens were predominant in carrot and onion, whereas plant beneficial bacteria dominated in cucumber and tomato. Out of the 104 isolates, 16.25% are human pathogens and 26.5% are human opportunistic pathogens. Existence of a high population of plant beneficial bacteria was found to have suppressed the population of plant and human pathogens. There is a greater potential to study the native endophytic plant beneficial bacteria for developing them as biocontrol agents against human pathogens that are harboured by plants.
Directory of Open Access Journals (Sweden)
Afiono Agung Prasetyo
2016-01-01
Full Text Available Context: Data regarding the distribution of Human Leukocyte Antigen (HLA-E alleles and their association with blood-borne pathogen infections/co-infections are limited for many populations, including Indonesia. Aims: The aim of this study was to analyze the association between HLA-E allelic variants and infection with blood-borne pathogens such as hepatitis B virus (HBV, hepatitis C virus (HCV, hepatitis D virus (HDV, torque teno virus (TTV, GB virus C (GBV-C, and Toxoplasma gondii (T. gondii in Indonesian Javanese human immunodeficiency virus (HIV patients. Settings and Design: A total of 320 anti-HIV-positive blood samples were analyzed for HBV, HCV, HDV, TTV, GBV-C, and T. gondii infection status and its association with HLA-E allelic variants. Materials and Methods: Nucleic acid was extracted from plasma samples and used for the molecular detection of HBV DNA, HCV RNA, HDV RNA, TTV DNA, and GBV-C RNA, whereas hepatitis B surface antigen, anti-HCV, immunoglobulin M and G (IgM and IgG anti-T. gondii were detected through serological testing. The blood samples were genotyped for HLA-E loci using a sequence-specific primer-polymerase chain reaction. Statistical Analysis Used: Either the Chi-square or Fisher′s exact test was performed to analyze the frequency of HLA-E alleles and blood-borne pathogen infections in the population. Odds ratios (ORs were calculated to measure the association between the antibodies found and the participants′ possible risk behaviors. A logistic regression analysis was used to assess the associations. Results: HLA-EFNx010101/0101 was associated with HCV/TTV co-infection (adjusted OR [aOR]: 3.5; 95% confidence interval [CI]: 1.156-10.734; P = 0.027 and IgM/IgG anti-Toxo positivity (aOR: 27.0; 95% CI: 3.626-200.472; P = 0.001. HLA-EFNx010103/0103 was associated with TTV co-infection (aOR: 2.7; 95% CI: 1.509-4.796; P = 0.001. Conclusions: HLA-E alleles in Indonesian Javanese HIV patients were found to be associated
Directory of Open Access Journals (Sweden)
Ana L. Galiano-Carneiro
2017-08-01
Full Text Available Northern corn leaf blight (NCLB, the most devastating leaf pathogen in maize (Zea mays L., is caused by the heterothallic ascomycete Setosphaeria turcica. The pathogen population shows an extremely high genetic diversity in tropical and subtropical regions. Varietal resistance is the most efficient technique to control NCLB. Host resistance can be qualitative based on race-specific Ht genes or quantitative controlled by many genes with small effects. Quantitative resistance is moderately to highly effective and should be more durable combatting all races of the pathogen. Quantitative resistance must, however, be analyzed in many environments (= location × year combinations to select stable resistances. In the tropical and subtropical environments, quantitative resistance is the preferred option to manage NCLB epidemics. Resistance level can be increased in practical breeding programs by several recurrent selection cycles based on disease severity rating and/or by genomic selection. This review aims to address two important aspects of the NCLB pathosystem: the genetics of the fungus S. turcica and the modes of inheritance of the host plant maize, including successful breeding strategies regarding NCLB resistance. Both drivers of this pathosystem, pathogen, and host, must be taken into account to result in more durable resistance.
Gibney, Katherine B; O'Toole, Joanne; Sinclair, Martha; Leder, Karin
2017-06-01
AbstractUniversal access to safe drinking water is a global priority. To estimate the annual disease burden of campylobacteriosis, nontyphoidal salmonellosis, cryptosporidiosis, giardiasis, and norovirus attributable to waterborne transmission in Australia, we multiplied regional World Health Organization (WHO) estimates of the proportion of cases attributable to waterborne transmission by estimates of all-source disease burden for each study pathogen. Norovirus was attributed as causing the most waterborne disease cases (479,632; 95% uncertainty interval [UI]: 0-1,111,874) followed by giardiasis and campylobacteriosis. The estimated waterborne disability-adjusted life year (DALY) burden for campylobacteriosis (2,004; 95% UI: 0-5,831) was 7-fold greater than other study pathogens and exceeded the WHO guidelines for drinking water quality (1 × 10 -6 DALY per person per year) by 90-fold. However, these estimates include disease transmitted via either drinking or recreational water exposure. More precise country-specific and drinking water-specific attribution estimates would better define the health burden from drinking water and inform changes to treatment requirements.
Red Queen Processes Drive Positive Selection on Major Histocompatibility Complex (MHC Genes.
Directory of Open Access Journals (Sweden)
Maciej Jan Ejsmond
2015-11-01
Full Text Available Major Histocompatibility Complex (MHC genes code for proteins involved in the incitation of the adaptive immune response in vertebrates, which is achieved through binding oligopeptides (antigens of pathogenic origin. Across vertebrate species, substitutions of amino acids at sites responsible for the specificity of antigen binding (ABS are positively selected. This is attributed to pathogen-driven balancing selection, which is also thought to maintain the high polymorphism of MHC genes, and to cause the sharing of allelic lineages between species. However, the nature of this selection remains controversial. We used individual-based computer simulations to investigate the roles of two phenomena capable of maintaining MHC polymorphism: heterozygote advantage and host-pathogen arms race (Red Queen process. Our simulations revealed that levels of MHC polymorphism were high and driven mostly by the Red Queen process at a high pathogen mutation rate, but were low and driven mostly by heterozygote advantage when the pathogen mutation rate was low. We found that novel mutations at ABSs are strongly favored by the Red Queen process, but not by heterozygote advantage, regardless of the pathogen mutation rate. However, while the strong advantage of novel alleles increased the allele turnover rate, under a high pathogen mutation rate, allelic lineages persisted for a comparable length of time under Red Queen and under heterozygote advantage. Thus, when pathogens evolve quickly, the Red Queen is capable of explaining both positive selection and long coalescence times, but the tension between the novel allele advantage and persistence of alleles deserves further investigation.
Paleogene radiation of a plant pathogenic mushroom.
Directory of Open Access Journals (Sweden)
Martin P A Coetzee
Full Text Available The global movement and speciation of fungal plant pathogens is important, especially because of the economic losses they cause and the ease with which they are able to spread across large areas. Understanding the biogeography and origin of these plant pathogens can provide insights regarding their dispersal and current day distribution. We tested the hypothesis of a Gondwanan origin of the plant pathogenic mushroom genus Armillaria and the currently accepted premise that vicariance accounts for the extant distribution of the species.The phylogeny of a selection of Armillaria species was reconstructed based on Maximum Parsimony (MP, Maximum Likelihood (ML and Bayesian Inference (BI. A timeline was then placed on the divergence of lineages using a Bayesian relaxed molecular clock approach.Phylogenetic analyses of sequenced data for three combined nuclear regions provided strong support for three major geographically defined clades: Holarctic, South American-Australasian and African. Molecular dating placed the initial radiation of the genus at 54 million years ago within the Early Paleogene, postdating the tectonic break-up of Gondwana.The distribution of extant Armillaria species is the result of ancient long-distance dispersal rather than vicariance due to continental drift. As these finding are contrary to most prior vicariance hypotheses for fungi, our results highlight the important role of long-distance dispersal in the radiation of fungal pathogens from the Southern Hemisphere.
Evidence for acquisition of virulence effectors in pathogenic chytrids
Directory of Open Access Journals (Sweden)
Summers Kyle
2011-07-01
Full Text Available Abstract Background The decline in amphibian populations across the world is frequently linked to the infection of the chytrid fungus Batrachochytrium dendrobatidis (Bd. This is particularly perplexing because Bd was only recently discovered in 1999 and no chytrid fungus had previously been identified as a vertebrate pathogen. Results In this study, we show that two large families of known virulence effector genes, crinkler (CRN proteins and serine peptidases, were acquired by Bd from oomycete pathogens and bacteria, respectively. These two families have been duplicated after their acquisition by Bd. Additional selection analyses indicate that both families evolved under strong positive selection, suggesting that they are involved in the adaptation of Bd to its hosts. Conclusions We propose that the acquisition of virulence effectors, in combination with habitat disruption and climate change, may have driven the Bd epidemics and the decline in amphibian populations. This finding provides a starting point for biochemical investigations of chytridiomycosis.
Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal
2016-01-01
During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...
International Nuclear Information System (INIS)
EL-HIFNAWI, H.N.; EL-TABLAWY, S.Y.
2009-01-01
The effect of different growth phases on the radiation resistance, antibiotic susceptibility and pathogenicity of certain selected pathogens (Escherichia coli, Candida albicans and Staphylococcus aureus) was studied in mice. The obtained results showed that Escherichia coli was slightly more resistant to gamma radiation in 18 h than 24 h or 48 h but it was relatively more resistant to electron beam in 24 h and 48 h than 18 h. Candida albicans showed radiation resistance nearly the same in all incubation times in the case of gamma radiation while for electron beam, its radiation resistance was slightly more in 24 h and 48 h than in 18 h. On the other hand, Staphylococcus aureus recorded much more resistance to gamma radiation in the 48 h than in 24 h or 18 h whereas in the case of electron beam, it was slightly more resistant in 18 h than in 24 h and 48 h.The antibiotic susceptibility of Escherichia coli reported that the exposure to gamma radiation at 3 kGy and electron beam at 6 kGy increase the susceptibility to the nalidixic acid and nitrofurantoin. When Candida albicans was exposed to 3 kGy gamma radiation and 6 kGy electron beam, the same sensitivity to nystatin was observed in comparison with the unexposed one while the sensitivity of Staphylococcus aureus to some antibiotics (amoxicillin, nitrofurantoin and tetracycline) was decreased after exposure to gamma radiation at 0.75 and 2 kGy and electron beam at 6 kGy, but for other antibiotics (trimethoprim/ sulfamethoxazole), the sensitivity was increased at 6 kGy electron beam.The lethality percent recorded after the oral ingestion of the mice with the unexposed Escherichia coli and Candida albicans were 25% and 100%, respectively, and for 6 kGy exposure to electron beam was 0% . The cotaneous disease and abscesses caused by the intradermal injection of the mice with unexposed Staphylococcus aureus was 75% and for 6 kGy exposure to electron beam was 25%.
Natural selection and infectious disease in human populations
Karlsson, Elinor K.; Kwiatkowski, Dominic P.; Sabeti, Pardis C.
2015-01-01
The ancient biological 'arms race' between microbial pathogens and humans has shaped genetic variation in modern populations, and this has important implications for the growing field of medical genomics. As humans migrated throughout the world, populations encountered distinct pathogens, and natural selection increased the prevalence of alleles that are advantageous in the new ecosystems in both host and pathogens. This ancient history now influences human infectious disease susceptibility and microbiome homeostasis, and contributes to common diseases that show geographical disparities, such as autoimmune and metabolic disorders. Using new high-throughput technologies, analytical methods and expanding public data resources, the investigation of natural selection is leading to new insights into the function and dysfunction of human biology. PMID:24776769
Ecological theory as a foundation to control pathogenic invasion in aquaculture
De Schryver, Peter; Vadstein, Olav
2014-01-01
Detrimental host–pathogen interactions are a normal phenomenon in aquaculture animal production, and have been counteracted by prophylactic use of antibiotics. Especially, the youngest life stages of cultivated aquatic animals are susceptible to pathogen invasion, resulting in disease and mortality. To establish a more sustainable aquatic food production, there is a need for new microbial management strategies that focus on ‘join them' and not the traditional ‘beat them' approaches. We argue that ecological theory could serve as a foundation for developing sustainable microbial management methods that prevent pathogenic disease in larviculture. Management of the water microbiota in aquaculture systems according to ecological selection principles has been shown to decrease opportunistic pathogen pressure and to result in an improved performance of the cultured animals. We hypothesize that manipulation of the biodiversity of the gut microbiota can increase the host's resistance against pathogenic invasion and infection. However, substantial barriers need to be overcome before active management of the intestinal microbiota can effectively be applied in larviculture. PMID:24892581
Arginase activity in pathogenic and non-pathogenic species of Leishmania parasites.
Badirzadeh, Alireza; Taheri, Tahereh; Taslimi, Yasaman; Abdossamadi, Zahra; Heidari-Kharaji, Maryam; Gholami, Elham; Sedaghat, Baharehsadat; Niyyati, Maryam; Rafati, Sima
2017-07-01
Proliferation of Leishmania (L.) parasites depends on polyamine availability, which can be generated by the L-arginine catabolism and the enzymatic activity of arginase (ARG) of the parasites and of the mammalian hosts. In the present study, we characterized and compared the arginase (arg) genes from pathogenic L. major and L. tropica and from non-pathogenic L. tarentolae. We quantified the level of the ARG activity in promastigotes and macrophages infected with pathogenic L. major and L. tropica and non-pathogenic L. tarentolae amastigotes. The ARG's amino acid sequences of the pathogenic and non-pathogenic Leishmania demonstrated virtually 98.6% and 88% identities with the reference L. major Friedlin ARG. Higher ARG activity was observed in all pathogenic promastigotes as compared to non-pathogenic L. tarentolae. In vitro infection of human macrophage cell line (THP1) with pathogenic and non-pathogenic Leishmania spp. resulted in increased ARG activities in the infected macrophages. The ARG activities present in vivo were assessed in susceptible BALB/c and resistant C57BL/6 mice infected with L. major, L. tropica and L. tarentolae. We demonstrated that during the development of the infection, ARG is induced in both strains of mice infected with pathogenic Leishmania. However, in L. major infected BALB/c mice, the induction of ARG and parasite load increased simultaneously according to the time course of infection, whereas in C57BL/6 mice, the enzyme is upregulated solely during the period of footpad swelling. In L. tropica infected mice, the footpads' swellings were slow to develop and demonstrated minimal cutaneous pathology and ARG activity. In contrast, ARG activity was undetectable in mice inoculated with the non-pathogenic L. tarentolae. Our data suggest that infection by Leishmania parasites can increase ARG activity of the host and provides essential polyamines for parasite salvage and its replication. Moreover, the ARG of Leishmania is vital for parasite
Directory of Open Access Journals (Sweden)
Ana Pinheiro
Full Text Available IgA is the predominant immunoglobulin isotype in mucosal tissues and external secretions, playing important roles both in defense against pathogens and in maintenance of commensal microbiota. Considering the complexity of its interactions with the surrounding environment, IgA is a likely target for diversifying or positive selection. To investigate this possibility, the action of natural selection on IgA was examined in depth with six different methods: CODEML from the PAML package and the SLAC, FEL, REL, MEME and FUBAR methods implemented in the Datamonkey webserver. In considering just primate IgA, these analyses show that diversifying selection targeted five positions of the Cα1 and Cα2 domains of IgA. Extending the analysis to include other mammals identified 18 positively selected sites: ten in Cα1, five in Cα2 and three in Cα3. All but one of these positions display variation in polarity and charge. Their structural locations suggest they indirectly influence the conformation of sites on IgA that are critical for interaction with host IgA receptors and also with proteins produced by mucosal pathogens that prevent their elimination by IgA-mediated effector mechanisms. Demonstrating the plasticity of IgA in the evolution of different groups of mammals, only two of the eighteen selected positions in all mammals are included in the five selected positions in primates. That IgA residues subject to positive selection impact sites targeted both by host receptors and subversive pathogen ligands highlights the evolutionary arms race playing out between mammals and pathogens, and further emphasizes the importance of IgA in protection against mucosal pathogens.
Duris, Joseph W.; Reif, Andrew G.; Olson, Leif E.; Johnson, Heather E.
2011-01-01
The City of Wilmington, Delaware, is in the downstream part of the Brandywine Creek Basin, on the main stem of Brandywine Creek. Wilmington uses this stream, which drains a mixed-land-use area upstream, for its main drinking-water supply. Because the stream is used for drinking water, Wilmington is in need of information about the occurrence and distribution of specific fecally derived pathogenic bacteria (disease-causing bacteria) and their relations to commonly measured fecal-indicator bacteria (FIB), as well as information regarding the potential sources of the fecal pollution and pathogens in the basin. This study focused on five routinely sampled sites within the basin, one each on the West Branch and the East Branch of Brandywine Creek and at three on the main stem below the confluence of the West and East Branches. These sites were sampled monthly for 1 year. Targeted event samples were collected on two occasions during high flow and two occasions during normal flow. On the basis of this study, high flows in the Brandywine Creek Basin were related to increases in FIB densities, and in the frequency of selected pathogen and source markers, in the West Branch and main stem of Brandywine Creek, but not in the East Branch. Water exceeding the moderate fullbody-contact single-sample recreational water-quality criteria (RWQC) for Escherichia coli (E. coli) was more likely to contain selected markers for pathogenic E. coli (eaeA,stx1, and rfbO157 gene markers) and bovine fecal sources (E. hirae and LTIIa gene markers), whereas samples exceeding the enterococci RWQC were more likely to contain the same pathogenic markers but also were more likely to carry a marker indicative of human source (esp gene marker). On four sample dates, during high flow between October and March, the West Branch was the only observed potential contributor of selected pathogen and bovine source markers to the main stem of Brandywine Creek. Indeed, the stx2 marker, which indicates a highly
Anti-fungal activity of some medicinal plants on different pathogenic fungi
International Nuclear Information System (INIS)
Hussain, F.; Abid, M.; Farzana, A.; Shaukat, S.; Akbar, M.
2015-01-01
The antifungal activity of different medicinal and locally available plants extracts (leaves, fruit, seeds) which are usually found in the surrounding of fields or in the fields on some fungi were tested in lab conditions. Six different plants were selected for testing these plants were Acacia nilotica (Lamk.) Willd. Azadirachta indica (A.) Juss. Crotalaria juncea L. Eucalyptus camaldulensis Dehnh. Ocimum basilicum L. and Prosopis juliflora (Sw.) Dc. These plants showed antifungal activity against the Aspergillus flavus, A. niger, Fusarium solani, Macrophomina phaseolina and Rhizoctonia solani. These plants crude extracts of leaves showed inhibition activity against the fungi and suppressed the myclial growth. Over all selected plants exhibited moderate type of inhibition against these above mentioned pathogens. Among these plants, Azadirachta indica, Ocimum basilicum and Crotalaria juncea showed the most effective results against the Aspergillus, Fusarium and Rhizoctonia sp. of fungal pathogens. Whereas, Acacia nilotica, Eucalyptus camaldulensis and Prosopis juliflora showed least potential of inhibition against all above mentioned fungal pathogens. It is investigated in present studies that Azadirachta indica, Ocimum basilicum and Crotalaria juncea can be utilized against the management of fungal diseases particularly Aspergillus flavus, A. niger, Fusarium solani, Macrophomina phaseolina and Rhizoctonia solani. (author)
Assessment of pathogen survival potential during managed aquifer recharge with diffusion chambers.
Sidhu, J P S; Toze, S
2012-09-01
To evaluate the efficacy of using in situ diffusion chambers for pathogen decay studies in the aquifer. A comparative microbial inactivation study was carried out in groundwater by seeding selected pathogens and indicators in laboratory microcosms and Teflon diffusion chambers (in situ) fitted with 0.010- and 0.025-μm pore-size membranes. The results have shown that there is a difference in the decay rates obtained from the laboratory microcosms and in situ diffusion chambers for several pathogens. The results suggest that the use of laboratory microcosms to determine pathogen decay during the Managed Aquifer Recharge (MAR) may lead to underestimation of decay of adenovirus and Cryptosporidium and subsequent inaccurate assessment of the required residence time in the aquifer for pathogens to be removed from the recharged water. The decay rate of two indicator bacteria, Salmonella enterica and adenovirus, was found to be significantly slower (t-test, P aquifers. Reliable assessment of potential public health risks from the presence of pathogens in groundwater is essential for proper management of the MAR schemes. The results of this study suggest that in situ assessment of pathogen survival potential in diffusion chambers provided more reliable data for pathogen risk assessment and subsequent risk mitigation plans for MAR schemes. © 2012 The Authors Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Raees Khan
Full Text Available The substantial use of triclosan (TCS has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231 and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17, and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79% and soil-borne plant pathogenic bacteria (98%. These included a variety of enoyl-acyl carrier protein reductase (ENRs homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously
Khan, Raees; Roy, Nazish; Choi, Kihyuck
2018-01-01
The substantial use of triclosan (TCS) has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231) and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG) database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17), and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79%) and soil-borne plant pathogenic bacteria (98%). These included a variety of enoyl-acyl carrier protein reductase (ENRs) homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously presumed
Microbiology for Radiologists: How to Minimize Infection Transmission in the Radiology Department.
Mirza, Sobia K; Tragon, Tyson R; Fukui, Melanie B; Hartman, Matthew S; Hartman, Amy L
2015-01-01
The implementation of standardized infection control and prevention practices is increasingly relevant as modern radiology practice evolves into its more clinical role. Current Centers for Disease Control and Prevention, National Institutes of Health, and World Health Organization guidelines for the proper use of personal protective equipment, decontamination of reusable medical equipment, and appropriate management of bloodborne pathogen exposures will be reviewed. Standard precautions apply to all patients at all times and are the mainstay of infection control. Proper hand hygiene includes washing hands with soap and water when exposed to certain infectious particles, such as Clostridium difficile spores, which are not inactivated by alcohol-based hand rubs. The appropriate use of personal protective equipment in accordance with recommendations from the Centers for Disease Control and Prevention includes wearing a surgical mask during lumbar puncture. Because radiologists may perform lumbar punctures for patients with prion disease, it is important to appreciate that incineration is the most effective method of inactivating prion proteins. However, there is currently no consensus recommendation on the decontamination of prion-contaminated reusable items associated with lumbar puncture, and institutional policies should be consulted for directed management. In the event of a needlestick injury, radiology staff must be able to quickly provide appropriate initial management and seek medical attention, including laboratory testing for bloodborne pathogens. ©RSNA, 2015.
Yang, Yu; Garver, Lindsey S.; Bingham, Karen M.; Hang, Jun; Jochim, Ryan C.; Davidson, Silas A.; Richardson, Jason H.; Jarman, Richard G.
2015-01-01
Mosquito blood meals taken from humans and animals potentially represent a useful source of blood for the detection of blood-borne pathogens. In this feasibility study, Anopheles stephensi mosquitoes were fed with blood meals spiked with dengue virus type 2 (DENV-2) and harvested at serial time points. These mosquitoes are not competent vectors, and the virus is not expected to replicate. Ingested blood was spotted on Whatman FTA cards and stored at room temperature. Mosquito abdomens were removed and stored at −80°C. Control blood meal aliquots were stored in vials or applied onto FTA cards. After 4 weeks of storage, the samples were extracted using beadbeating and QIAamp Viral RNA kit (Qiagen Sciences, Germantown, MD). Recovered viral RNA was analyzed by DENV-2 TaqMan RT-PCR assay and next-generation sequencing (NGS). Overall viral RNA recovery efficiency was 15% from the directly applied dried blood spots and approximately 20% or higher for dried blood spots made by blotting mosquito midgut on FTA cards. Viral RNA in mosquito-ingested blood decreases over time, but remains detectable 24 hours after blood feeding. The viral sequences in FTA-stored specimens can be maintained at room temperature. The strategy has the potential utility in expedited zoonotic virus discovery and blood-borne pathogen surveillance. PMID:26416112
Pathogen Inactivated Plasma Concentrated: Preparation and Uses
2004-09-01
of decontamination, porcine parvovirus (PPV) was selected as a model virus; B19 is the form that infects humans. PPV is an interesting pathogen...ultrasound to cold plasma. The ultrasound generates pure ice crystals, which are then removed to leave concentrated plasma. Testing: Porcine parvovirus ...energy to “burn” any proteins that they encounter. Furthermore, as they react, they also produce multiple other reactive oxygen species (ROS) that are
RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY
Directory of Open Access Journals (Sweden)
A. Y. Prosekov
2016-01-01
Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.
Sin, Yung Wa; Annavi, Geetha; Dugdale, Hannah L.; Newman, Chris; Burke, Terry; MacDonald, David W.
2014-01-01
Pathogen-mediated selection is thought to maintain the extreme diversity in the major histocompatibility complex (MHC) genes, operating through the heterozygote advantage, rare-allele advantage and fluctuating selection mechanisms. Heterozygote advantage (i.e. recognizing and binding a wider range
The community ecology of pathogens: coinfection, coexistence and community composition.
Seabloom, Eric W; Borer, Elizabeth T; Gross, Kevin; Kendig, Amy E; Lacroix, Christelle; Mitchell, Charles E; Mordecai, Erin A; Power, Alison G
2015-04-01
Disease and community ecology share conceptual and theoretical lineages, and there has been a resurgence of interest in strengthening links between these fields. Building on recent syntheses focused on the effects of host community composition on single pathogen systems, we examine pathogen (microparasite) communities using a stochastic metacommunity model as a starting point to bridge community and disease ecology perspectives. Such models incorporate the effects of core community processes, such as ecological drift, selection and dispersal, but have not been extended to incorporate host-pathogen interactions, such as immunosuppression or synergistic mortality, that are central to disease ecology. We use a two-pathogen susceptible-infected (SI) model to fill these gaps in the metacommunity approach; however, SI models can be intractable for examining species-diverse, spatially structured systems. By placing disease into a framework developed for community ecology, our synthesis highlights areas ripe for progress, including a theoretical framework that incorporates host dynamics, spatial structuring and evolutionary processes, as well as the data needed to test the predictions of such a model. Our synthesis points the way for this framework and demonstrates that a deeper understanding of pathogen community dynamics will emerge from approaches working at the interface of disease and community ecology. © 2015 John Wiley & Sons Ltd/CNRS.
Rasool, Muhammad H.; Siddique, Abu B.; Saqalein, Muhammad; Asghar, Muhammad J.; Zahoor, Muhammad A.; Aslam, Bilal; Shafiq, Humerah B.; Nisar, Muhammad A.
2016-01-01
Objective: To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. Methods: This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural character...
Pathogen Security-Help or Hindrance?
Directory of Open Access Journals (Sweden)
Stephen Allen Morse
2015-01-01
Full Text Available Events over the past 15 years have resulted in the promulgation of regulations in the United States to enhance biosecurity by restricting the access of pathogens and toxins (i.e., biological select agents and toxins [BSAT], which pose a severe threat to human, animal or plant health or to animal or plant products, to qualified institutions, laboratories, and scientists. These regulations also reduce biosafety concerns by imposing specific requirements on laboratories working with BSATs. Furthermore, they provide a legal framework for prosecuting someone who possesses a BSAT illegally. With the implementation of these regulations has come a discussion in the scientific community about the potential of these regulations to affect the cost of doing BSAT research and international collaborations, or whether it would stop someone with a microbiological background from isolating many of the select agents from nature.
Pathogen security-help or hindrance?
Morse, Stephen A
2014-01-01
Events over the past 15 years have resulted in the promulgation of regulations in the United States to enhance biosecurity by restricting the access to pathogens and toxins (i.e., biological select agents and toxins [BSATs]), which pose a severe threat to human being, animal, or plant health or to animal or plant products, to qualified institutions, laboratories, and scientists. These regulations also reduce biosafety concerns by imposing specific requirements on laboratories working with BSATs. Furthermore, they provide a legal framework for prosecuting someone who possesses a BSAT illegally. With the implementation of these regulations has come discussion in the scientific community about the potential of these regulations to affect the cost of doing BSAT research, hamper research and international collaborations, or whether it would stop someone with a microbiological background from isolating many of the select agents from nature.
Singh, Pankaj Kumar; Ray, Soham; Thakur, Shallu; Rathour, Rajeev; Sharma, Vinay; Sharma, Tilak Raj
2018-06-01
Rice and Magnaporthe oryzae constitutes an ideal pathosystem for studying host-pathogen interaction in cereals crops. There are two alternative hypotheses, viz. Arms race and Trench warfare, which explain the co-evolutionary dynamics of hosts and pathogens which are under continuous confrontation. Arms race proposes that both R- and Avr- genes of host and pathogen, respectively, undergo positive selection. Alternatively, trench warfare suggests that either R- or Avr- gene in the pathosystem is under balanced selection intending to stabilize the genetic advantage gained over the opposition. Here, we made an attempt to test the above-stated hypotheses in rice-M. oryzae pathosystem at loci of three R-Avr gene pairs, Piz-t-AvrPiz-t, Pi54-AvrPi54 and Pita-AvrPita using allele mining approach. Allele mining is an efficient way to capture allelic variants existing in the population and to study the selective forces imposed on the variants during evolution. Results of nucleotide diversity, neutrality statistics and phylogenetic analyses reveal that Piz-t, Pi54 and AvrPita are diversified and under positive selection at their corresponding loci, while their counterparts, AvrPiz-t, AvrPi54 and Pita are conserved and under balancing selection, in nature. These results imply that rice-M. oryzae populations are engaged in a trench warfare at least at the three R/Avr loci studied. It is a maiden attempt to study the co-evolution of three R-Avr gene pairs in this pathosystem. Knowledge gained from this study will help in understanding the evolutionary dynamics of host-pathogen interaction in a better way and will also aid in developing new durable blast resistant rice varieties in future. Copyright © 2018 Elsevier Inc. All rights reserved.
Electrochemical Methodologies for the Detection of Pathogens.
Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine
2018-05-25
electrochemical-based microorganism recognition approaches and putting them into context of other sensing devices for pathogens such as culturing the microorganism on agar plates and the polymer chain reaction (PCR) method, able to identify the DNA of the microorganism. Recent breakthroughs will be highlighted, including the utilization of microfluidic devices and immunomagnetic separation for multiple pathogen analysis in a single device. We will conclude with some perspectives and outlooks to better understand shortcomings. Indeed, there is currently no adequate solution that allows the selective and sensitive binding to a specific microorganism, that is fast in detection and screening, cheap to implement, and able to be conceptualized for a wide range of biologically relevant targets.
Nunvar, Jaroslav; Kalferstova, Lucie; Bloodworth, Ruhi A M; Kolar, Michal; Degrossi, Jose; Lubovich, Silvina; Cardona, Silvia T; Drevinek, Pavel
2016-01-01
Several bacterial species from the Burkholderia cepacia complex (Bcc) are feared opportunistic pathogens that lead to debilitating lung infections with a high risk of developing fatal septicemia in cystic fibrosis (CF) patients. However, the pathogenic potential of other Bcc species is yet unknown. To elucidate clinical relevance of Burkholderia contaminans, a species frequently isolated from CF respiratory samples in Ibero-American countries, we aimed to identify its key virulence factors possibly linked with an unfavorable clinical outcome. We performed a genome-wide comparative analysis of two isolates of B. contaminans ST872 from sputum and blood culture of a female CF patient in Argentina. RNA-seq data showed significant changes in expression for quorum sensing-regulated virulence factors and motility and chemotaxis. Furthermore, we detected expression changes in a recently described low-oxygen-activated (lxa) locus which encodes stress-related proteins, and for two clusters responsible for the biosynthesis of antifungal and hemolytic compounds pyrrolnitrin and occidiofungin. Based on phenotypic assays that confirmed changes in motility and in proteolytic, hemolytic and antifungal activities, we were able to distinguish two phenotypes of B. contaminans that coexisted in the host and entered her bloodstream. Whole genome sequencing revealed that the sputum and bloodstream isolates (each representing a distinct phenotype) differed by over 1,400 mutations as a result of a mismatch repair-deficient hypermutable state of the sputum isolate. The inferred lack of purifying selection against nonsynonymous mutations and the high rate of pseudogenization in the derived isolate indicated limited evolutionary pressure during evolution in the nutrient-rich, stable CF sputum environment. The present study is the first to examine the genomic and transcriptomic differences between longitudinal isolates of B. contaminans. Detected activity of a number of putative virulence
Fábio, Caldas de Mesquita; Pati, Pascom Ana Roberta; Clarissa, Habckost Dutra de Barros; Juliana, Machado Givisiez; Taques, dos Santos Christ Maria; Larissa, de Faro Valverde; Marcelo, Araújo de Freitas; Nestor, Sosa; Peter, Reiss; William, Pape Jean; Omar, Sued; Andrew, Revell; Dechao, Wang; Peter, Reiss; Ard, van Sighem
2014-01-01
Introduction: Latin America contains the third highest estimated number of people living with HIV-1 in the world [1]. Illicit drug users (DUs) are vulnerable to HIV and other blood-borne pathogens as a result of sharing contaminated syringes and other equipment [1]. Epidemiological aspects of HIV-1 infection in the Brazilian Amazon are poorly known, especially in risk groups. This study determined the prevalence and factors associated with infection by HIV-1 among DUs in the Marajó Archipelag...
Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong
2015-04-24
Leptospirosis is a worldwide, deadly zoonotic disease. Pathogenic Leptospira causes leptospirosis. The rapid and accurate identification of pathogenic and non-pathogenic Leptospira strains is essential for appropriate therapeutic management and timely intervention for infection control. The molecular fingerprint is a simple and rapid alternative tool for microorganisms identification, which is based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In this study, molecular fingerprint was performed to identify pathogenic strains of Leptospira. Phylogenetic analysis based on 16S rRNA gene sequences was used as the reference method. In addition, a label-free technique was used to reveal the different proteins of pathogenic or non-pathogenic Leptospira. A reference database was constructed using 30 Leptospira strains, including 16 pathogenic strains and 14 non-pathogenic strains. Two super reference spectra that were associated with pathogenicity were established. Overall, 33 Leptospira strains were used for validation, and 32 of 33 Leptospira strains could be identified on the species level and all the 33 could be classified as pathogenic or non-pathogenic. The super reference spectra and the major spectra projection (MSP) dendrogram correctly categorized the Leptospira strains into pathogenic and non-pathogenic groups, which was consistent with the 16S rRNA reference methods. Between the pathogenic and non-pathogenic strains, 108 proteins were differentially expressed. molecular fingerprint is an alternative to conventional molecular identification and can rapidly distinguish between pathogenic and non-pathogenic Leptospira strains. Therefore, molecular fingerprint may play an important role in the clinical diagnosis, treatment, surveillance, and tracking of epidemic outbreaks of leptospirosis. Leptospirosis is a worldwide zoonosis that is caused by spirochetes of the genus Leptospira. Leptospirosis is a serious zoonotic
Directory of Open Access Journals (Sweden)
Lauri Mikonranta
Full Text Available Pathogen virulence is usually thought to evolve in reciprocal selection with the host. While this might be true for obligate pathogens, the life histories of opportunistic pathogens typically alternate between within-host and outside-host environments during the infection-transmission cycle. As a result, opportunistic pathogens are likely to experience conflicting selection pressures across different environments, and this could affect their virulence through life-history trait correlations. We studied these correlations experimentally by exposing an opportunistic bacterial pathogen Serratia marcescens to its natural protist predator Tetrahymena thermophila for 13 weeks, after which we measured changes in bacterial traits related to both anti-predator defence and virulence. We found that anti-predator adaptation (producing predator-resistant biofilm caused a correlative attenuation in virulence. Even though the direct mechanism was not found, reduction in virulence was most clearly connected to a predator-driven loss of a red bacterial pigment, prodigiosin. Moreover, life-history trait evolution was more divergent among replicate populations in the absence of predation, leading also to lowered virulence in some of the 'predator absent' selection lines. Together these findings suggest that the virulence of non-obligatory, opportunistic bacterial pathogens can decrease in environmental reservoirs through life history trade-offs, or random accumulation of mutations that impair virulence traits under relaxed selection.
Hepatitis B in Rwanda: Closing the gaps to end an epidemic
African Journals Online (AJOL)
here is a logistic one and with sufficient attention to detail is clearly resolvable. ... more selective criteria should be delineated; the authors favour an approach where those ... fore clinical symptoms appear, and subject to sexual and bloodborne ...
Susan E. Meyer; David L. Nelson; Suzette Clement; Alisa Ramakrishnan
2010-01-01
Evolutionary processes that maintain genetic diversity in plants are likely to include selection imposed by pathogens. Negative frequency-dependent selection is a mechanism for maintenance of resistance polymorphism in plant - pathogen interactions. We explored whether such selection operates in the Bromus tectorum - Ustilago bullata pathosystem. Gene-for-gene...
Directory of Open Access Journals (Sweden)
Karin Alvåsen
2016-07-01
Full Text Available The aim of this study was to screen for selected parasites and antibody levels against vectorborne pathogens in owned dogs in Lilongwe, Malawi. The study population consisted of 100 dogs; 80 participating in vaccination–spaying campaigns and 20 visiting a veterinary clinic as paying clients. All dogs went through a general physical examination including visual examination for signs of ectoparasites. A total of 100 blood samples were analysed using commercial snap tests and 40 faecal samples by egg flotation in saturated sodium chloride. The sampled dogs had a seroprevalence of 12% for Anaplasma spp., 22% for Ehrlichia spp., 4% for Dirofilaria immitis and 1% for Leishmania spp. Eggs from Ancylostoma spp. were found in 80% of the faecal samples, whereas eggs of Trichuris vulpis, Toxocara canis and Toxascaris leonina were only present in 3%, 8% and 13% of the samples, respectively. Ectoparasites such as Ctenocephalides sp., Trichodectes sp. and ticks were present on 98%, 25% and 11%, respectively, of the campaign dogs. Among client dogs, 35% had Ctenocephalides fleas, 10% had Trichodectes lice and none had ticks. Public education and prophylactic treatment could be used to improve the animal welfare of dogs; this would most likely also have positive impact on public health.
Molecular Tracing of Viral Pathogen in Aquaculture (MOLTRAQ): a new EMIDA project
DEFF Research Database (Denmark)
Jensen, B. Bang; Aldrin, M.; Avarre, M. C.
2012-01-01
a generic approach to viral disease control by using information on epidemiological and phylogenetic attributes from several important aquatic animal viruses. The project will i) generate and use spatio-temporal epidemiological data, phylogeographic data and gene expression data for important host......-viral pathogen systems to identify important factors affecting the spread of diseases in aquaculture, and ii) integrate these in scenario simulation models to assess effects of various control strategies for selected host-pathogen systems. The project consists of six workpackages: WP 1: Project co...
Sierro, Frederic; Evrard, Maximilien; Rizzetto, Simone; Melino, Michelle; Mitchell, Andrew J; Florido, Manuela; Beattie, Lynette; Walters, Shaun B; Tay, Szun Szun; Lu, Bo; Holz, Lauren E; Roediger, Ben; Wong, Yik Chun; Warren, Alessandra; Ritchie, William; McGuffog, Claire; Weninger, Wolfgang; Le Couteur, David G; Ginhoux, Florent; Britton, Warwick J; Heath, William R; Saunders, Bernadette M; McCaughan, Geoffrey W; Luciani, Fabio; MacDonald, Kelli P A; Ng, Lai Guan; Bowen, David G; Bertolino, Patrick
2017-08-15
The liver is positioned at the interface between two routes traversed by pathogens in disseminating infection. Whereas blood-borne pathogens are efficiently cleared in hepatic sinusoids by Kupffer cells (KCs), it is unknown how the liver prevents dissemination of peritoneal pathogens accessing its outer membrane. We report here that the hepatic capsule harbors a contiguous cellular network of liver-resident macrophages phenotypically distinct from KCs. These liver capsular macrophages (LCMs) were replenished in the steady state from blood monocytes, unlike KCs that are embryonically derived and self-renewing. LCM numbers increased after weaning in a microbiota-dependent process. LCMs sensed peritoneal bacteria and promoted neutrophil recruitment to the capsule, and their specific ablation resulted in decreased neutrophil recruitment and increased intrahepatic bacterial burden. Thus, the liver contains two separate and non-overlapping niches occupied by distinct resident macrophage populations mediating immunosurveillance at these two pathogen entry points to the liver. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yixin H Ye
2009-04-01
Full Text Available Drosophila harbor substantial genetic variation for antibacterial defense, and investment in immunity is thought to involve a costly trade-off with life history traits, including development, life span, and reproduction. To understand the way in which insects invest in fighting bacterial infection, we selected for survival following systemic infection with the opportunistic pathogen Pseudomonas aeruginosa in wild-caught Drosophila melanogaster over 10 generations. We then examined genome-wide changes in expression in the selected flies relative to unselected controls, both of which had been infected with the pathogen. This powerful combination of techniques allowed us to specifically identify the genetic basis of the evolved immune response. In response to selection, population-level survivorship to infection increased from 15% to 70%. The evolved capacity for defense was costly, however, as evidenced by reduced longevity and larval viability and a rapid loss of the trait once selection pressure was removed. Counter to expectation, we observed more rapid developmental rates in the selected flies. Selection-associated changes in expression of genes with dual involvement in developmental and immune pathways suggest pleiotropy as a possible mechanism for the positive correlation. We also found that both the Toll and the Imd pathways work synergistically to limit infectivity and that cellular immunity plays a more critical role in overcoming P. aeruginosa infection than previously reported. This work reveals novel pathways by which Drosophila can survive infection with a virulent pathogen that may be rare in wild populations, however, due to their cost.
Development of recombinant antibody technology for application in plant pathogen diagnosis
Griep, R.
1999-01-01
This thesis describes the applicability of the novel phage display technique to select plant-pathogen-specific monoclonal antibodies (MAbs) from combinatorial antibody libraries. The retrieved MAbs are so specific that they can be used as diagnostic tools in sensitive immunoassays for the
Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies
Directory of Open Access Journals (Sweden)
Arianne Brown Jordan
2018-01-01
Full Text Available Backyard poultry farms in Trinidad and Tobago (T&T play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA. Antibodies were detected in 65% (CI 95%: 50–78% of the sampled birds for Infectious bronchitis virus (IBV, 67.5% (CI 95%: 52–80% for Infectious bursal disease virus (IBDV, 10% (CI 95%: 4–23% for Newcastle disease virus (NDV, 0% (CI 95%: 0–0% for Avian influenza virus (AIV, 0% (CI 95%: 0–0% for West Nile virus (WNV, 31.7% (CI 95%: 20–47% for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0–0% for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.
A gravity model for the spread of a pollinator-borne plant pathogen.
Ferrari, Matthew J; Bjørnstad, Ottar N; Partain, Jessica L; Antonovics, Janis
2006-09-01
Many pathogens of plants are transmitted by arthropod vectors whose movement between individual hosts is influenced by foraging behavior. Insect foraging has been shown to depend on both the quality of hosts and the distances between hosts. Given the spatial distribution of host plants and individual variation in quality, vector foraging patterns may therefore produce predictable variation in exposure to pathogens. We develop a "gravity" model to describe the spatial spread of a vector-borne plant pathogen from underlying models of insect foraging in response to host quality using the pollinator-borne smut fungus Microbotryum violaceum as a case study. We fit the model to spatially explicit time series of M. violaceum transmission in replicate experimental plots of the white campion Silene latifolia. The gravity model provides a better fit than a mean field model or a model with only distance-dependent transmission. The results highlight the importance of active vector foraging in generating spatial patterns of disease incidence and for pathogen-mediated selection for floral traits.
Pandey, Vishakha; Singh, Manoj; Pandey, Dinesh; Marla, Soma; Kumar, Anil
2018-04-01
Tilletia indica is a smut fungus that incites Karnal bunt in wheat. It has been considered as quarantine pest in more than 70 countries. Despite its quarantine significance, there is meager knowledge regarding the molecular mechanisms of disease pathogenesis. Moreover, various disease management strategies have proven futile. Development of effective disease management strategy requires identification of pathogenicity/virulence factors. With this aim, the present study was conducted to compare the secretomes of T. indica isolates, that is, highly (TiK) and low (TiP) virulent isolates. About 120 and 95 protein spots were detected reproducibly in TiK and TiP secretome gel images. Nineteen protein spots, which were consistently observed as upregulated/differential in the secretome of TiK isolate, were selected for their identification by MALDI-TOF/TOF. Identified proteins exhibited homology with fungal proteins playing important role in fungal adhesion, penetration, invasion, protection against host-derived reactive oxygen species, production of virulence factors, cellular signaling, and degradation of host cell wall proteins and antifungal proteins. These results were complemented with T. indica genome sequence leading to identification of candidate pathogenicity/virulence factors homologs that were further subjected to sequence- and structure-based functional annotation. Thus, present study reports the first comparative secretome analysis of T. indica for identification of pathogenicity/virulence factors. This would provide insights into pathogenic mechanisms of T. indica and aid in devising effective disease management strategies. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Insect immunity shows specificity in protection upon secondary pathogen exposure.
Sadd, Ben M; Schmid-Hempel, Paul
2006-06-20
Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.
Piepers, S.; Peeters, K.; Opsomer, G.; Barkema, H.W.; Frankena, K.; Vliegher, de S.
2011-01-01
Risk factors for intramammary infections caused by coagulase-negative staphylococci, contagious major pathogens and environmental major pathogens in early lactating heifers were evaluated at the herd, heifer and quarter levels. In total, 764 quarters of 191 dairy heifers in 20 randomly selected
Improvement of resistance to rust through recurrent selection in pearl millet
Energy Technology Data Exchange (ETDEWEB)
Tapsoba, H. [Univ. of Georgia, Athens, GA (United States); Wilson, J.P.; Hanna, W.W. [Univ. of Georgia Coastal Plain Experimental Station, Tifton, GA (United States)
1997-04-01
Two pearl millet [Pennisetum glaucum (L.) R.Br. = P. typhoides (Burm.) Staff & Hubb., P. americanum (L.) K. Schum.] bulk populations, Tift No. 2 and Tift No. 5, served as base populations for four cycles of recurrent selection against susceptibility to Puccinia substriata Ell. & Barth, var. indica Ramachar & Cumm. A bulk inoculum of the pathogen was used. The objectives were to evaluate the progress achieved regarding overall resistance to the pathogen in the field and resistance to different races of the pathogen, and also to evaluate changes in unselected traits. During selection, the frequency of rust resistant plants continuously increased from about 30% in each base population to more than 85% by the third cycle of selection in both populations. An average increase of about 21 and 18% per cycle was obtained in Tift No. 2 and Tift No. 5, respectively. A continuous increase of the frequency of plants resistant to some races of the pathogen was also obtained. In Tift No. 5, 80% of the plants were resistant to eight races by the third cycle of selection. The accumulation of resistance observed in the seedlings was manifested in the field, both in 1993 and 1994, by a reduction of the final rust severity from the base population to the fourth selection cycle of both populations. This improvement in resistance to the rust pathogen was accompanied by an increase in the frequency of plants resistant to Pyricularia grisea (Cooke) Sacc. only in Tift No. 2. Despite the improvement in the selected character, genetic variability for agronomic traits such as plant height, number of culms/plant, flowering date, and panicle length was successfully maintained within each population. 20 refs., 1 fig., 7 tabs.
Processes for managing pathogens.
Godfree, Alan; Farrell, Joseph
2005-01-01
Wastewater contains human, animal, and plant pathogens capable of causing viral, bacterial, or parasitic infections. There are several routes whereby sewage pathogens may affect human health, including direct contact, contamination of food crops, zoonoses, and vectors. The range and numbers of pathogens in municipal wastewater vary with the level of endemic disease in the community, discharges from commercial activities, and seasonal factors. Regulations to control pathogen risk in the United States and Europe arising from land application of biosolids are based on the concept of multiple barriers to the prevention of transmission. The barriers are (i) treatment to reduce pathogen content and vector attraction, (ii) restrictions on crops grown on land to which biosolids have been applied, and (iii) minimum intervals following application and grazing or harvesting. Wastewater treatment reduces number of pathogens in the wastewater by concentrating them with the solids in the sludge. Although some treatment processes are designed specifically to inactivate pathogens, many are not, and the actual mechanisms of microbial inactivation are not fully understood for all processes. Vector attraction is reduced by stabilization (reduction of readily biodegradable material) and/or incorporation immediately following application. Concerns about health risks have renewed interest in the effects of treatment (on pathogens) and advanced treatment methods, and work performed in the United States suggests that Class A pathogen reduction can be achieved less expensively than previously thought. Effective pathogen risk management requires control to the complete chain of sludge treatment, biosolids handling and application, and post-application activities. This may be achieved by adherence to quality management systems based on hazard analysis critical control point (HACCP) principles.
Selection on resilience improves disease resistance and tolerance to infections
Mulder, H.A.; Rashidi, H.
2017-01-01
Response to infection in animals has 2 main mechanisms: resistance (ability to control pathogen burden) and tolerance (ability to maintain performance given the pathogen burden). Selection on disease resistance and tolerance to infections seems a promising avenue to increase productivity of animals
DEFF Research Database (Denmark)
Kolmos, Hans Jørn
2007-01-01
, and with water, food and drugs. This review details the more important routes of infection, highlighting among others the role of Staphylococcus aureus carriage in patients and staff, issues related to disinfection of endoscopes, and the risk of transmitting blood-borne viruses with multidose vials.......Hospital infections arise by autoinfection from patients' endogenous flora, by cross infection from other patients and hospital staff, and by transmission of pathogens from items in the hospital environment. Organisms may be transmitted by direct and indirect contact, by the airborne route...
Ren, Yuwei; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Zhang, Shujun
2017-01-01
Preventing pathogen transmission to a new host is of major interest to the immunologist and could benefit from a detailed investigation of pathogen immune evasion strategies. The first line of defense against pathogen invasion is provided by macrophages. When they sense pathogens, macrophages initiate signals to inflammatory and pro-inflammatory cytokines through pattern recognition receptors (PRRs) subsequently mediating phagocytosis and inflammation. The macrophage immune machinery classically includes two subsets: the activated M1 and the activated M2 that respond accordingly in diverse immune challenges. The lipid and glycogen metabolic pathways work together with the lysosome to help the mature phagosome to degrade and eliminate intracellular pathogens in macrophages. The viral evasion strategies are even more complex due to the interplay between autophagy and apoptosis. However, pathogens evolve several strategies to camouflage themselves against immune responses in order to ensure their survival, replication and transmission. These strategies include the muting of PRRs initiated inflammatory responses, attenuation of M1 and/or induction of M2 macrophages, suppression of autophago-lysosomal formation, interference with lipid and glycogen metabolism, and viral mediation of autophagy and apoptosis cross-talk to enhance viral replication. This review focuses on pathogen immune evasion methods and on the strategies used by the host against camouflaged pathogens.
Chagas Disease Knowledge and Risk Behaviors of the Homeless Population in Houston, TX.
Ingber, Alexandra; Garcia, Melissa N; Leon, Juan; Murray, Kristy O
2018-04-01
Chagas disease is a parasitic infection, caused by Trypanosoma cruzi, endemic in Latin America. Sylvatic T. cruzi-infected triatomine vectors are present in rural and urban areas in the southern USA and may transmit T. cruzi infection to at-risk populations, such as homeless individuals. Our study aimed to evaluate Chagas disease knowledge and behaviors potentially associated with transmission risk of Chagas disease among Houston, Texas' homeless population by performing interviews with 212 homeless individuals. The majority of the 212 surveyed homeless individuals were male (79%), African-American (43%), American-born individuals (96%). About 30% of the individuals reported having seen triatomines in Houston, and 25% had evidence of blood-borne transmission risk (IV drug use and/or unregulated tattoos). The median total time homeless was significantly associated with recognition of the triatomine vector. Our survey responses indicate that the homeless populations may exhibit potential risks for Chagas disease, due to increased vector exposure, and participation in blood-borne pathogen risk behaviors. Our findings warrant additional research to quantify the prevalence of Chagas disease among homeless populations.
Reduced Set of Virulence Genes Allows High Accuracy Prediction of Bacterial Pathogenicity in Humans
Iraola, Gregorio; Vazquez, Gustavo; Spangenberg, Lucía; Naya, Hugo
2012-01-01
Although there have been great advances in understanding bacterial pathogenesis, there is still a lack of integrative information about what makes a bacterium a human pathogen. The advent of high-throughput sequencing technologies has dramatically increased the amount of completed bacterial genomes, for both known human pathogenic and non-pathogenic strains; this information is now available to investigate genetic features that determine pathogenic phenotypes in bacteria. In this work we determined presence/absence patterns of different virulence-related genes among more than finished bacterial genomes from both human pathogenic and non-pathogenic strains, belonging to different taxonomic groups (i.e: Actinobacteria, Gammaproteobacteria, Firmicutes, etc.). An accuracy of 95% using a cross-fold validation scheme with in-fold feature selection is obtained when classifying human pathogens and non-pathogens. A reduced subset of highly informative genes () is presented and applied to an external validation set. The statistical model was implemented in the BacFier v1.0 software (freely available at ), that displays not only the prediction (pathogen/non-pathogen) and an associated probability for pathogenicity, but also the presence/absence vector for the analyzed genes, so it is possible to decipher the subset of virulence genes responsible for the classification on the analyzed genome. Furthermore, we discuss the biological relevance for bacterial pathogenesis of the core set of genes, corresponding to eight functional categories, all with evident and documented association with the phenotypes of interest. Also, we analyze which functional categories of virulence genes were more distinctive for pathogenicity in each taxonomic group, which seems to be a completely new kind of information and could lead to important evolutionary conclusions. PMID:22916122
Crawford, Gemma; Lobo, Roanna; Brown, Graham; Macri, Chloe; Smith, Hannah; Maycock, Bruce
2016-01-01
In some high-income countries, a proportion of human immunodeficiency virus (HIV), other blood-borne virus (BBV) or sexually transmitted infection (STI) diagnoses have been reported as acquired overseas in low- and middle-income countries. A review was conducted to explore HIV, other BBV or STI related knowledge, risk behavior and acquisition amongst expatriates and travelers, particularly males, travelling from high to low- and middle-income countries. Seven academic databases were searched for 26 peer reviewed articles that met inclusion criteria. Significant variability in the studies was noted, in age, travel duration and frequency and outcomes/risk factors measured and reported on. Risk factors described included longer duration of stay; being single; travel for romance or sex; alcohol and other drug use; lack of travel advice; being male; higher number of sexual partners; and inconsistent condom use. Vaccination, pre-travel health advice, and having fewer sexual partners were described as protective. Studies are needed focusing on the social context in which risk-taking occurs. Better collaboration is essential to deliver comprehensive health promotion interventions alongside more consistent pre- and post- travel testing and advice. Policy measures are crucial, including consistent evaluation indicators to assess impacts of HIV, other BBVs or STIs in the context of mobility. Risks and responses for these epidemics are shared globally. PMID:27999275
Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul
2014-05-22
The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is regulated with a zero tolerance in tomato seed. Their misidentification as pathogenic Cmm hampers a clear judgment on the seed quality and health. To get more insight in the genetic features linked to the lifestyle of these bacteria, a whole-genome sequence of the tomato seed-borne non-pathogenic Clavibacter LMG 26808 was determined. To gain a better understanding of the molecular determinants of pathogenicity, the genome sequence of LMG 26808 was compared with that of the pathogenic Cmm strain (NCPPB 382). The comparative analysis revealed that LMG 26808 does not contain plasmids pCM1 and pCM2 and also lacks the majority of important virulence factors described so far for pathogenic Cmm. This explains its apparent non-pathogenic nature in tomato plants. Moreover, the genome analysis of LMG 26808 detected sequences from a plasmid originating from a member of Enterobacteriaceae/Klebsiella relative. Genes received that way and coding for antibiotic resistance may provide a competitive advantage for survival of LMG 26808 in its ecological niche. Genetically, LMG 26808 was the most similar to the pathogenic Cmm NCPPB 382 but contained more mobile genetic elements. The genome of this non-pathogenic Clavibacter strain contained also a high number of transporters and regulatory genes. The genome sequence of the non-pathogenic Clavibacter strain LMG 26808 and the comparative analyses with other pathogenic Clavibacter strains provided a better understanding of the genetic bases of virulence and
Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population.
Schindler, Emily I; Nylen, Erik L; Ko, Audrey C; Affatigato, Louisa M; Heggen, Andrew C; Wang, Kai; Sheffield, Val C; Stone, Edwin M
2010-10-01
Accurate prediction of the pathogenic effects of specific genotypes is important for the design and execution of clinical trials as well as for meaningful counseling of individual patients. However, for many autosomal recessive diseases, it can be difficult to deduce the relative pathogenic contribution of individual alleles because relatively few affected individuals share the same two disease-causing variations. In this study, we used multiple regression analysis to estimate the pathogenicity of specific alleles of ABCA4 in patients with retinal phenotypes ranging from Stargardt disease to retinitis pigmentosa. This analysis revealed quantitative allelic effects on two aspects of the visual phenotype, visual acuity (P disease and will also aid in the optimal selection of subjects for clinical trials of new therapies.
Directory of Open Access Journals (Sweden)
Michael eSteinert
2014-01-01
Full Text Available Different species inhabit different sensory worlds and thus have evolved diverse means of processing information, learning and memory. In the escalated arms race with host defense, each pathogenic bacterium not only has evolved its individual cellular sensing and behaviour, but also collective sensing, interbacterial communication, distributed information processing, joint decision making, dissociative behaviour, and the phenotypic and genotypic heterogeneity necessary for epidemiologic success. Moreover, pathogenic populations take advantage of dormancy strategies and rapid evolutionary speed, which allow them to save co-generated intelligent traits in a collective genomic memory. This review discusses how these mechanisms add further levels of complexity to bacterial pathogenicity and transmission, and how mining for these mechanisms could help to develop new anti-infective strategies.
Balint-Kurti, P J; May, G D; Churchill, A C
2001-02-05
A genetic transformation system has been developed for three Mycosphaerella pathogens of banana and plantain (Musa spp.). Mycosphaerella fijiensis and Mycosphaerella musicola, the causal agents of black and yellow Sigatoka, respectively, and Mycosphaerella eumusae, which causes Septoria leaf spot of banana, were transformed with a construct carrying a synthetic gene encoding green fluorescent protein (GFP). Most single-spored transformants that expressed GFP constitutively were mitotically stable in the absence of selection for hygromycin B resistance. Transformants of all three species were pathogenic on the susceptible banana cultivar Grand Nain, and growth in planta was comparable to wild-type strains. GFP expression by transformants allowed us to observe extensive fungal growth within leaf tissue that eventually turned necrotic, at which point the fungi grew saprophytically on the dead tissue. Leaf chlorosis and necrosis were often observed in advance of saprophytic growth of the mycelium on necrotic tissue, which supports previous reports suggesting secretion of a phytotoxin.
Zhong, Zhenhui; Norvienyeku, Justice; Chen, Meilian; Bao, Jiandong; Lin, Lianyu; Chen, Liqiong; Lin, Yahong; Wu, Xiaoxian; Cai, Zena; Zhang, Qi; Lin, Xiaoye; Hong, Yonghe; Huang, Jun; Xu, Linghong; Zhang, Honghong; Chen, Long; Tang, Wei; Zheng, Huakun; Chen, Xiaofeng; Wang, Yanli; Lian, Bi; Zhang, Liangsheng; Tang, Haibao; Lu, Guodong; Ebbole, Daniel J; Wang, Baohua; Wang, Zonghua
2016-05-06
One major threat to global food security that requires immediate attention, is the increasing incidence of host shift and host expansion in growing number of pathogenic fungi and emergence of new pathogens. The threat is more alarming because, yield quality and quantity improvement efforts are encouraging the cultivation of uniform plants with low genetic diversity that are increasingly susceptible to emerging pathogens. However, the influence of host genome differentiation on pathogen genome differentiation and its contribution to emergence and adaptability is still obscure. Here, we compared genome sequence of 6 isolates of Magnaporthe species obtained from three different host plants. We demonstrated the evolutionary relationship between Magnaporthe species and the influence of host differentiation on pathogens. Phylogenetic analysis showed that evolution of pathogen directly corresponds with host divergence, suggesting that host-pathogen interaction has led to co-evolution. Furthermore, we identified an asymmetric selection pressure on Magnaporthe species. Oryza sativa-infecting isolates showed higher directional selection from host and subsequently tends to lower the genetic diversity in its genome. We concluded that, frequent gene loss or gain, new transposon acquisition and sequence divergence are host adaptability mechanisms for Magnaporthe species, and this coevolution processes is greatly driven by directional selection from host plants.
Meyer-Wolfarth, Friederike; Schrader, Stefan; Oldenburg, Elisabeth; Brunotte, Joachim; Weinert, Joachim
2017-04-01
In agroecosystems soil-borne fungal plant diseases are major yield-limiting factors which are difficult to control. Fungal plant pathogens, like Fusarium species, survive as a saprophyte in infected tissue like crop residues and endanger the health of the following crop by increasing the infection risk for specific plant diseases. In infected plant organs, these pathogens are able to produce mycotoxins. Mycotoxins like deoxynivalenol (DON) persist during storage, are heat resistant and of major concern for human and animal health after consumption of contaminated food and feed, respectively. Among fungivorous soil organisms, there are representatives of the soil fauna which are obviously antagonistic to a Fusarium infection and the contamination with mycotoxins. Specific members of the soil macro-, meso-, and microfauna provide a wide range of ecosystem services including the stimulation of decomposition processes which may result in the regulation of plant pathogens and the degradation of environmental contaminants. Investigations under laboratory conditions and in field were conducted to assess the functional linkage between soil faunal communities and plant pathogenic fungi (Fusarium culmorum). The aim was to examine if Fusarium biomass and the content of its mycotoxin DON decrease substantially in the presence of soil fauna (earthworms: Lumbricus terrestris, collembolans: Folsomia candida and nematodes: Aphelenchoides saprophilus) in a commercial cropping system managed with conservation tillage located in Northern Germany. The results of our investigations pointed out that the degradation performance of the introduced soil fauna must be considered as an important contribution to the biodegradation of fungal plant diseases and fungal-related contaminants. Different size classes within functional groups and the traits of keystone species appear to be significant for soil function and the provision of ecosystem services as in particular L. terrestris revealed to
Subbu Lakshmi, S; Chelladurai, G; Suresh, B
2016-09-01
The pus samples from diabetic foot ulcer patients and urine samples from urinary tract infected patients were collected and inoculated in nutrient agar plates. The colonies showing different morphologies were streaked on selective agar plates. The antibacterial assay of selected commercial antibiotics was tested against the foot ulcer and urinary tract isolates. The result revealed that most of the organisms were found to be resistant against the antibiotics. Screening of antibacterial activity of selected plants, methanol extracts of plants were prepared and tested against foot ulcer pathogens. Among the plants used, the methanolic extract Tragia involucrata was very effective against the foot ulcer pathogens and to separate the compounds present in the methanolic extract of T. involucrata, when it was subjected to column chromatography. The fractions obtained were further checked for their antibacterial property and fraction 1 which inhibited the pathogens, were subjected to thin layer chromatography and the structure of the particular phytochemical compound was elucidated by NMR study. The spices were tested for their antibacterial property against the urinary tract pathogens. Among the spices tested; Allium sativum inhibited the growth of the pathogens isolated from urinary tract infection. It can be concluded that the plants extract can be used to discover natural products that may serve as lead for the development of new pharmaceuticals addressing the major therapeutic needs.
Phylogeographic Diversity of Pathogenic and Non-Pathogenic Hantaviruses in Slovenia
Korva, Miša; Knap, Nataša; Resman Rus, Katarina; Fajs, Luka; Grubelnik, Gašper; Bremec, Matejka; Knapič, Tea; Trilar, Tomi; Avšič Županc, Tatjana
2013-01-01
Slovenia is a very diverse country from a natural geography point of view, with many different habitats within a relatively small area, in addition to major geological and climatic differences. It is therefore not surprising that several small mammal species have been confirmed to harbour hantaviruses: A. flavicollis (Dobrava virus), A. agrarius (Dobrava virus–Kurkino), M. glareolus (Puumala virus), S. areanus (Seewis virus), M. agrestis, M. arvalis and M. subterraneus (Tula virus). Three of the viruses, namely the Dobrava, Dobrava–Kurkino and Puumala viruses, cause disease in humans, with significant differences in the severity of symptoms. Due to changes in haemorrhagic fever with renal syndrome cases (HFRS) epidemiology, a detailed study on phylogenetic diversity and molecular epidemiology of pathogenic and non-pathogenic hantaviruses circulating in ecologically diverse endemic regions was performed. The study presents one of the largest collections of hantavirus L, M and S sequences obtained from hosts and patients within a single country. Several genetic lineages were determined for each hantavirus species, with higher diversity among non-pathogenic compared to pathogenic viruses. For pathogenic hantaviruses, a significant geographic clustering of human- and rodent-derived sequences was confirmed. Several geographic and ecological factors were recognized as influencing and limiting the formation of endemic areas. PMID:24335778
Mentaberre, Gregorio; Gutiérrez, Carlos; Rodríguez, Noé F; Joseph, Sunitha; González-Barrio, David; Cabezón, Oscar; de la Fuente, José; Gortazar, Christian; Boadella, Mariana
2013-12-27
The Canary Islands contain the most important dromedary camel (Camelus dromedarius) population in the European Union and are the main export point of dromedaries to continental Europe and Latin America. We investigated the presence of antibodies against relevant disease agents in 100 Canarian camel sera. Selected blood samples of the same animals were also tested by PCR. Sera were tested for antibodies against Bluetongue virus (BTV; 0%), Bovine Viral Diarrhoea virus (BVDV; 0%), Camelpox virus (CPV; 8% by serum neutralization, 16% by ELISA), Peste des Petits Ruminants virus (PPRV, 0%), Rift Valley Fever virus (RVFV; 0%) and West Nile Fever virus (WNV; 3%), the bacterial pathogens Anaplasma sp. (3%), Brucella sp. (1%), Coxiella burnetii (19%), Mycobacterium avium paratuberculosis (MAP; 22%), Mycobacterium tuberculosis complex (MTC; 10%) and Rickettsia sp. (83%), and the parasites Toxoplasma gondii (36%) and Neospora caninum (86%). The most remarkable findings were the detection of antibodies against CPV and the high antibody prevalence against C. burnetii, Rickettsia sp., T. gondii and N. caninum. By PCR, we found no C. burnetii, N. caninum and Anaplasma sp. DNA in the tested samples. However, Rickettsia sp. DNA was detected in six antibody positive tested samples. These results should be taken into consideration in order to implement adequate control measures and avoid a potential dissemination of infections to other territories. Copyright © 2013 Elsevier B.V. All rights reserved.
Hayman, L; Steffen, M J; Stevens, J; Badger, E; Tempro, P; Fuller, B; McGuire, A; Al-Sabbagh, Mohanad; Thomas, M V; Ebersole, J L
2011-04-01
Smoking is an independent risk factor for the initiation, extent and severity of periodontal disease. This study examined the ability of the host immune system to discriminate commensal oral bacteria from pathogens at mucosal surfaces, i.e. oral cavity. Serum immunoglobulin (Ig)G antibody reactive with three pathogenic and five commensal oral bacteria in 301 current smokers (age range 21-66 years) were examined by enzyme-linked immunosorbent assay. Clinical features of periodontal health were used as measures of periodontitis. Antibody to the pathogens and salivary cotinine levels were related positively to disease severity; however, the antibody levels were best described by the clinical disease unrelated to the amount of smoking. The data showed a greater immune response to pathogens than commensals that was related specifically to disease extent, and most noted in black males. Significant correlations in individual patient responses to the pathogens and commensals were lost with an increasing extent of periodontitis and serum antibody to the pathogens. Antibody to Porphyromonas gingivalis was particularly distinct with respect to the discriminatory nature of the immune responses in recognizing the pathogens. Antibody responses to selected pathogenic and commensal oral microorganisms differed among racial groups and genders. The antibody response to the pathogens was related to disease severity. The level of antibody to the pathogens, and in particular P. gingivalis, was correlated with disease severity in black and male subsets of patients. The amount of smoking did not appear to impact directly serum antibody levels to these oral bacteria. © 2011 The Authors. Clinical and Experimental Immunology © 2011 British Society for Immunology.
21 CFR 866.2360 - Selective culture medium.
2010-04-01
...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2360 Selective culture... solid biological materials intended for medical purposes to cultivate and identify certain pathogenic...
Directory of Open Access Journals (Sweden)
Charalampos Proestos
2011-01-01
Full Text Available Water-methanol extract from Filipendula ulmaria contains a variety of phenolic compounds, such as caffeic, p-coumaric and vanillic acid, myricetin, etc, which demonstrate antibacterial activity. Monitoring this activity in the broth using absorbance measurements showed that species of the Enterobacteriaceae family were more resistant than other Gram-negative and Gram-positive bacteria tested. Acidic environment enhanced the antibacterial activity of Filipendula ulmaria extract when it was tested against Salmonella Enteritidis PT4 and Listeria monocytogenes Scott A. The efficacy of Filipendula ulmaria extract against selected foodborne psychrotrophic bacteria was also tested using solid laboratory media and low incubation temperatures for better simulation of food preservation conditions. Higher concentrations of the extract, compared to minimum inhibitory concentration determined in the broth, were needed for satisfactory inhibition of spoilage bacteria. Potential use of Filipendula ulmaria extract as natural food preservative was also examined against natural spoilage flora and inoculated pathogenic bacteria on fish flesh and fish roe product (tarama salad. No significant differences of viable populations of spoilage or pathogenic bacteria were found between the treated samples and controls. Further trials of Filipendula ulmaria extract should be carried out in acidic foods with low fat and protein content, supplemented with additional adjuncts, in order to explore its potential as effective natural food antimicrobial agent.
Directory of Open Access Journals (Sweden)
Urazaliev Kairat
2013-01-01
Full Text Available Sugar beet (Beta vulgaris L. - one of the most important crop in the world. In Kazakhstan, it is a traditional and major source of domestic sugar. The industry of cultivation and production of sugar beet is one of the priority areas of agricultural development of the country. In this paper, we studied the regeneration ability of different genotypes of sugar beet explants on selective media with the culture filtrate of the pathogen fungus F. oxysporum var. orthoceras. From the roots and shoots of sugar beet the pathogen Fusarium root rot was isolated. Was obtained pure cultures of the isolated pathogen. As a result, of morphological and cultural descriptions, as well as microbiological analysis it was revealed that the isolated pathogen is Fusarium Oxysporum. The results showed the pathogenicity of the fungus. For regeneration in vitro of the sugar beet genotypes resistant to the pathogen the culture media was optimized to the culture filtrate of the fungus F. oxysporum var. orthoceras. The frequency of shoot regeneration, depending on the genotype, was 1,0-12,5 %. On these explants the multiple shoot formations were observed.
Autophagy in plant pathogenic fungi.
Liu, Xiao-Hong; Xu, Fei; Snyder, John Hugh; Shi, Huan-Bin; Lu, Jian-Ping; Lin, Fu-Cheng
2016-09-01
Autophagy is a conserved cellular process that degrades cytoplasmic constituents in vacuoles. Plant pathogenic fungi develop special infection structures and/or secrete a range of enzymes to invade their plant hosts. It has been demonstrated that monitoring autophagy processes can be extremely useful in visualizing the sequence of events leading to pathogenicity of plant pathogenic fungi. In this review, we introduce the molecular mechanisms involved in autophagy. In addition, we explore the relationship between autophagy and pathogenicity in plant pathogenic fungi. Finally, we discuss the various experimental strategies available for use in the study of autophagy in plant pathogenic fungi. Copyright © 2016 Elsevier Ltd. All rights reserved.
Signatures of positive selection in Toll-like receptor (TLR genes in mammals
Directory of Open Access Journals (Sweden)
Areal Helena
2011-12-01
Full Text Available Abstract Background Toll-like receptors (TLRs are a major class of pattern recognition receptors (PRRs expressed in the cell surface or membrane compartments of immune and non-immune cells. TLRs are encoded by a multigene family and represent the first line of defense against pathogens by detecting foreigner microbial molecular motifs, the pathogen-associated molecular patterns (PAMPs. TLRs are also important by triggering the adaptive immunity in vertebrates. They are characterized by the presence of leucine-rich repeats (LRRs in the ectodomain, which are associated with the PAMPs recognition. The direct recognition of different pathogens by TLRs might result in different evolutionary adaptations important to understand the dynamics of the host-pathogen interplay. Ten mammal TLR genes, viral (TLR3, 7, 8, 9 and non-viral (TLR1-6, 10, were selected to identify signatures of positive selection that might have been imposed by interacting pathogens and to clarify if viral and non-viral TLRs might display different patterns of molecular evolution. Results By using Maximum Likelihood approaches, evidence of positive selection was found in all the TLRs studied. The number of positively selected codons (PSC ranged between 2-26 codons (0.25%-2.65% with the non-viral TLR4 as the receptor with higher percentage of positively selected codons (2.65%, followed by the viral TLR8 (2.50%. The results indicated that viral and non-viral TLRs are similarly under positive selection. Almost all TLRs have at least one PSC located in the LRR ectodomain which underlies the importance of the pathogen recognition by this region. Conclusions Our results are not in line with previous studies on primates and birds that identified more codons under positive selection in non-viral TLRs. This might be explained by the fact that both primates and birds are homogeneous groups probably being affected by only a restricted number of related viruses with equivalent motifs to be
Ellen Perrett, Stephanie; Erricker, Mark; Lyons, Marion
2014-01-01
The purpose of this paper is to provide education on blood-borne viruses (BBVs) to prison staff to help reduce stigma within the prisons, improve the care prisoners receive and reduce the risk of occupational transmission. An e-module was used to improve staff understanding of hepatitis B (HBV), hepatitis C (HCV) and HIV at a prison in Wales, UK. An assessment was used to gather data on prison staff understanding of BBVs prior to undertaking the e-module. In total, 530/697 (76 per cent) prison staff completed the BBV e-module. Average pre- and post-course assessment scores were 8.6/11 and 10.85/11, respectively. Most staff understood the modes of hepatitis transmission, however, gaps in understanding were highlighted. In total, 22 per cent of staff believed HBV and HCV were airborne, 9 per cent believed transmission occurred through sharing cutlery. In total, 31 per cent of staff believed prisoners with hepatitis should declare their status to the prison. Practical implications: The e-module significantly improved staff understanding of BBVs and should be incorporated into future prison training packages. Future education should include how BBVs are not transmitted with an emphasis on casual contact. Medical confidentiality in prisons should also be addressed. Improving understanding will help reduce the stigma of BBVs within prison and improve the multidisciplinary care the prisoner receives. To the authors knowledge this is the first published evaluation of a BBV learning package for custodial staff. Evaluation of this educational package demonstrates a unique and valuable insight into the general understanding of BBVs by prison staff in Wales, UK.
Pathogenic adaptation of intracellular bacteria by rewiring a cis-regulatory input function.
Osborne, Suzanne E; Walthers, Don; Tomljenovic, Ana M; Mulder, David T; Silphaduang, Uma; Duong, Nancy; Lowden, Michael J; Wickham, Mark E; Waller, Ross F; Kenney, Linda J; Coombes, Brian K
2009-03-10
The acquisition of DNA by horizontal gene transfer enables bacteria to adapt to previously unexploited ecological niches. Although horizontal gene transfer and mutation of protein-coding sequences are well-recognized forms of pathogen evolution, the evolutionary significance of cis-regulatory mutations in creating phenotypic diversity through altered transcriptional outputs is not known. We show the significance of regulatory mutation for pathogen evolution by mapping and then rewiring a cis-regulatory module controlling a gene required for murine typhoid. Acquisition of a binding site for the Salmonella pathogenicity island-2 regulator, SsrB, enabled the srfN gene, ancestral to the Salmonella genus, to play a role in pathoadaptation of S. typhimurium to a host animal. We identified the evolved cis-regulatory module and quantified the fitness gain that this regulatory output accrues for the bacterium using competitive infections of host animals. Our findings highlight a mechanism of pathogen evolution involving regulatory mutation that is selected because of the fitness advantage the new regulatory output provides the incipient clones.
Development of Quorum-Based Anti-Virulence Therapeutics Targeting Gram-Negative Bacterial Pathogens
Directory of Open Access Journals (Sweden)
Wen Shan Yew
2013-08-01
Full Text Available Quorum sensing is a cell density-dependent signaling phenomenon used by bacteria for coordination of population-wide phenotypes, such as expression of virulence genes, antibiotic resistance and biofilm formation. Lately, disruption of bacterial communication has emerged as an anti-virulence strategy with enormous therapeutic potential given the increasing incidences of drug resistance in pathogenic bacteria. The quorum quenching therapeutic approach promises a lower risk of resistance development, since interference with virulence generally does not affect the growth and fitness of the bacteria and, hence, does not exert an associated selection pressure for drug-resistant strains. With better understanding of bacterial communication networks and mechanisms, many quorum quenching methods have been developed against various clinically significant bacterial pathogens. In particular, Gram-negative bacteria are an important group of pathogens, because, collectively, they are responsible for the majority of hospital-acquired infections. Here, we discuss the current understanding of existing quorum sensing mechanisms and present important inhibitory strategies that have been developed against this group of pathogenic bacteria.
Pathogenic features of heterotrophic plate count bacteria from drinking-water boreholes.
Horn, Suranie; Pieters, Rialet; Bezuidenhout, Carlos
2016-12-01
Evidence suggests that heterotrophic plate count (HPC) bacteria may be hazardous to humans with weakened health. We investigated the pathogenic potential of HPC bacteria from untreated borehole water, consumed by humans, for: their haemolytic properties, the production of extracellular enzymes such as DNase, proteinase, lipase, lecithinase, hyaluronidase and chondroitinase, the effect simulated gastric fluid has on their survival, as well as the bacteria's antibiotic-susceptible profile. HuTu-80 cells acted as model for the human intestine and were exposed to the HPC isolates to determine their effects on the viability of the cells. Several HPC isolates were α- or β-haemolytic, produced two or more extracellular enzymes, survived the SGF treatment, and showed resistance against selected antibiotics. The isolates were also harmful to the human intestinal cells to varying degrees. A novel pathogen score was calculated for each isolate. Bacillus cereus had the highest pathogen index: the pathogenicity of the other bacteria declined as follows: Aeromonas taiwanensis > Aeromonas hydrophila > Bacillus thuringiensis > Alcaligenes faecalis > Pseudomonas sp. > Bacillus pumilus > Brevibacillus sp. > Bacillus subtilis > Bacillus sp. These results demonstrated that the prevailing standards for HPCs in drinking water may expose humans with compromised immune systems to undue risk.
How Did Host Domestication Modify Life History Traits of Its Pathogens?
Directory of Open Access Journals (Sweden)
Marie De Gracia
Full Text Available Understanding evolutionary dynamics of pathogens during domestication of their hosts and rise of agro-ecosystems is essential for durable disease management. Here, we investigated changes in life-history traits of the fungal pathogen Venturia inaequalis during domestication of the apple. Life traits linked to fungal dispersal were compared between 60 strains that were sampled in domestic and wild habitats in Kazakhstan, the center of origin of both host and pathogen. Our two main findings are that transition from wild to agro-ecosystems was associated with an increase of both spore size and sporulation capacity; and that distribution of quantitative traits of the domestic population mostly overlapped with those of the wild population. Our results suggest that apple domestication had a considerable impact on fungal characters linked to its dispersal through selection from standing phenotypic diversity. We showed that pestification of V. inaequalis in orchards led to an enhanced allocation in colonization ability from standing variation in the wild area. This study emphasizes the potential threat that pathogenic fungal populations living in wild environments represent for durability of resistance in agro-ecosystems.
The occurrence and pathogenicity of Phoma exigua Desm. var. exigua for selected species of herbs
Directory of Open Access Journals (Sweden)
Zofia Machowicz-Stefaniak
2012-12-01
Full Text Available P. exigua var. exigua was isolated from underground and aboveground organs of different herb plant species in the years 1998-2006. Pathogenicity tests of three randomly chosen isolates of the fungus T 299, T 261 and T 277 for thyme and of three isolates M 1657, M 1193 and M 1635 for lemon balm were carried out. The effect of water suspension of fungus spores on the germination ability of schizocarps and of infected soil on sprouting and seedling health was studied. The study of microscopic structures of the fungus developing on plants, isolation of the fungus on artificial media and macro- and microscopic analysis on standard media are essential for the correct identification of P. exigua var. exigua. The polyphagous nature of the fungus is confirmed by the obtained results. The tested isolates were found to be occasional pathogens of thyme and lemon balm in the studied conditions. The harmfulness of the tested isolates pointed to inhibition of schizocarp germination, sprouting of plants and the ability to cause necrosis of germs, roots and epicotyl.
Multiple infections of rodents with zoonotic pathogens in Austria.
Schmidt, Sabrina; Essbauer, Sandra S; Mayer-Scholl, Anne; Poppert, Sven; Schmidt-Chanasit, Jonas; Klempa, Boris; Henning, Klaus; Schares, Gereon; Groschup, Martin H; Spitzenberger, Friederike; Richter, Dania; Heckel, Gerald; Ulrich, Rainer G
2014-07-01
Rodents are important reservoirs for a large number of zoonotic pathogens. We examined the occurrence of 11 viral, bacterial, and parasitic agents in rodent populations in Austria, including three different hantaviruses, lymphocytic choriomeningitis virus, orthopox virus, Leptospira spp., Borrelia spp., Rickettsia spp., Bartonella spp., Coxiella burnetii, and Toxoplasma gondii. In 2008, 110 rodents of four species (40 Clethrionomys glareolus, 29 Apodemus flavicollis, 26 Apodemus sylvaticus, and 15 Microtus arvalis) were trapped at two rural sites in Lower Austria. Chest cavity fluid and samples of lung, spleen, kidney, liver, brain, and ear pinna skin were collected. We screened selected tissue samples for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, Leptospira, Borrelia, Rickettsia, Bartonella spp., C. burnetii, and T. gondii by RT-PCR/PCR and detected nucleic acids of Tula hantavirus, Leptospira spp., Borrelia afzelii, Rickettsia spp., and different Bartonella species. Serological investigations were performed for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, and Rickettsia spp. Here, Dobrava-Belgrade hantavirus-, Tula hantavirus-, lymphocytic choriomeningitis virus-, orthopox virus-, and rickettsia-specific antibodies were demonstrated. Puumala hantavirus, C. burnetii, and T. gondii were neither detected by RT-PCR/PCR nor by serological methods. In addition, multiple infections with up to three pathogens were shown in nine animals of three rodent species from different trapping sites. In conclusion, these results show that rodents in Austria may host multiple zoonotic pathogens. Our observation raises important questions regarding the interactions of different pathogens in the host, the countermeasures of the host's immune system, the impact of the host-pathogen interaction on the fitness of the host, and the spread of infectious agents among wild rodents and from those to other animals or humans.
Salmonella, Shigella, and Escherichia coli O157:H7 contaminate similar types of food and all three can cause foodborne disease. Traditional microbiological enrichment broths to detect these pathogens are different in terms of their composition, which limits the application of multi-pathogen detectio...
Directory of Open Access Journals (Sweden)
Rui Wang
2017-10-01
Full Text Available Streptococcus agalactiae, or Group B Streptococcus (GBS, is a major pathogen causing neonatal sepsis and meningitis, bovine mastitis, and fish meningoencephalitis. CC23, including its namesake ST23, is not only the predominant GBS strain derived from human and cattle, but also can infect a variety of homeothermic and poikilothermic species. However, it has never been characterized in fish. This study aimed to determine the pathogenicity of ST23 GBS to fish and explore the mechanisms causing the difference in the pathogenicity of ST23 GBS based on the genome analysis. Infection of tilapia with 10 human-derived ST23 GBS isolates caused tissue damage and the distribution of pathogens within tissues. The mortality rate of infection was ranged from 76 to 100%, and it was shown that the mortality rate caused by only three human isolates had statistically significant difference compared with fish-derived ST7 strain (P < 0.05, whereas the mortality caused by other seven human isolates did not show significant difference compared with fish-derived ST7 strain. The genome comparison and prophage analysis showed that the major genome difference between virulent and non-virulent ST23 GBS was attributed to the different prophage sequences. The prophage in the P1 region contained about 43% GC and encoded 28–39 proteins, which can mediate the acquisition of YafQ/DinJ structure for GBS by phage recombination. YafQ/DinJ belongs to one of the bacterial toxin–antitoxin (TA systems and allows cells to cope with stress. The ST23 GBS strains carrying this prophage were not pathogenic to tilapia, but the strains without the prophage or carrying the pophage that had gene mutation or deletion, especially the deletion of YafQ/DinJ structure, were highly pathogenic to tilapia. In conclusion, human ST23 GBS is highly pathogenic to fish, which may be related to the phage recombination.
DEFF Research Database (Denmark)
Kania, Per Walther; Jørgensen, Thomas Rohde; Buchmann, Kurt
2007-01-01
A new method based on PCR-RFLP is presented. It is able to differentiate between the Danish non-pathogenic form of Gyrodactylus salaris and the Norwegian pathogenic form.......A new method based on PCR-RFLP is presented. It is able to differentiate between the Danish non-pathogenic form of Gyrodactylus salaris and the Norwegian pathogenic form....
Directory of Open Access Journals (Sweden)
Sarah I. Bonnet
2017-06-01
Full Text Available Ticks are among the most important vectors of pathogens affecting humans and other animals worldwide. They do not only carry pathogens however, as a diverse group of commensal and symbiotic microorganisms are also present in ticks. Unlike pathogens, their biology and their effect on ticks remain largely unexplored, and are in fact often neglected. Nonetheless, they can confer multiple detrimental, neutral, or beneficial effects to their tick hosts, and can play various roles in fitness, nutritional adaptation, development, reproduction, defense against environmental stress, and immunity. Non-pathogenic microorganisms may also play a role in driving transmission of tick-borne pathogens (TBP, with many potential implications for both human and animal health. In addition, the genetic proximity of some pathogens to mutualistic symbionts hosted by ticks is evident when studying phylogenies of several bacterial genera. The best examples are found within members of the Rickettsia, Francisella, and Coxiella genera: while in medical and veterinary research these bacteria are traditionally recognized as highly virulent vertebrate pathogens, it is now clear to evolutionary ecologists that many (if not most Coxiella, Francisella, and Rickettsia bacteria are actually non-pathogenic microorganisms exhibiting alternative lifestyles as mutualistic ticks symbionts. Consequently, ticks represent a compelling yet challenging system in which to study microbiomes and microbial interactions, and to investigate the composition, functional, and ecological implications of bacterial communities. Ultimately, deciphering the relationships between tick microorganisms as well as tick symbiont interactions will garner invaluable information, which may aid in the future development of arthropod pest and vector-borne pathogen transmission control strategies.
Pathogenic agents in freshwater resources
Geldreich, Edwin E.
1996-02-01
Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.
Task 1.5 Genomic Shift and Drift Trends of Emerging Pathogens
Energy Technology Data Exchange (ETDEWEB)
Borucki, M
2010-01-05
The Lawrence Livermore National Laboratory (LLNL) Bioinformatics group has recently taken on a role in DTRA's Transformation Medical Technologies Initiative (TMTI). The high-level goal of TMTI is to accelerate the development of broad-spectrum countermeasures. To achieve those goals, TMTI has a near term need to conduct analyses of genomic shift and drift trends of emerging pathogens, with a focused eye on select agent pathogens, as well as antibiotic and virulence markers. Most emerging human pathogens are zoonotic viruses with a genome composed of RNA. The high mutation rate of the replication enzymes of RNA viruses contributes to sequence drift and provides one mechanism for these viruses to adapt to diverse hosts (interspecies transmission events) and cause new human and zoonotic diseases. Additionally, new viral pathogens frequently emerge due to genetic shift (recombination and segment reassortment) which allows for dramatic genotypic and phenotypic changes to occur rapidly. Bacterial pathogens also evolve via genetic drift and shift, although sequence drift generally occurs at a much slower rate for bacteria as compared to RNA viruses. However, genetic shift such as lateral gene transfer and inter- and intragenomic recombination enables bacteria to rapidly acquire new mechanisms of survival and antibiotic resistance. New technologies such as rapid whole genome sequencing of bacterial genomes, ultra-deep sequencing of RNA virus populations, metagenomic studies of environments rich in antibiotic resistance genes, and the use of microarrays for the detection and characterization of emerging pathogens provide mechanisms to address the challenges posed by the rapid emergence of pathogens. Bioinformatic algorithms that enable efficient analysis of the massive amounts of data generated by these technologies as well computational modeling of protein structures and evolutionary processes need to be developed to allow the technology to fulfill its potential.
Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul
2014-01-01
Background The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is reg...
Host pathogen relations: exploring animal models for fungal pathogens.
Harwood, Catherine G; Rao, Reeta P
2014-06-30
Pathogenic fungi cause superficial infections but pose a significant public health risk when infections spread to deeper tissues, such as the lung. Within the last three decades, fungi have been identified as the leading cause of nosocomial infections making them the focus of research. This review outlines the model systems such as the mouse, zebrafish larvae, flies, and nematodes, as well as ex vivo and in vitro systems available to study common fungal pathogens.
Insight of Genus Corynebacterium: Ascertaining the Role of Pathogenic and Non-pathogenic Species.
Oliveira, Alberto; Oliveira, Leticia C; Aburjaile, Flavia; Benevides, Leandro; Tiwari, Sandeep; Jamal, Syed B; Silva, Arthur; Figueiredo, Henrique C P; Ghosh, Preetam; Portela, Ricardo W; De Carvalho Azevedo, Vasco A; Wattam, Alice R
2017-01-01
This review gathers recent information about genomic and transcriptomic studies in the Corynebacterium genus, exploring, for example, prediction of pathogenicity islands and stress response in different pathogenic and non-pathogenic species. In addition, is described several phylogeny studies to Corynebacterium , exploring since the identification of species until biological speciation in one species belonging to the genus Corynebacterium . Important concepts associated with virulence highlighting the role of Pld protein and Tox gene. The adhesion, characteristic of virulence factor, was described using the sortase mechanism that is associated to anchorage to the cell wall. In addition, survival inside the host cell and some diseases, were too addressed for pathogenic corynebacteria, while important biochemical pathways and biotechnological applications retain the focus of this review for non-pathogenic corynebacteria. Concluding, this review broadly explores characteristics in genus Corynebacterium showing to have strong relevance inside the medical, veterinary, and biotechnology field.
Antibacterial Effect of Carvacrol and Coconut Oil on Selected Pathogenic Bacteria
Directory of Open Access Journals (Sweden)
Božik M.
2018-03-01
Full Text Available Essential oils play a prominent role as flavouring agents and fragrances in the food and perfume industries. Carvacrol is a major component of various essential oils, such as oregano and thyme oils, and is responsible for their antimicrobial activity. Lauric acid is a medium-chain fatty acid (MCFA with a high antibacterial potential. Both carvacrol and MCFAs have been used empirically as antimicrobial agents. Here, we tested the inhibitory properties of carvacrol and coconut (Cocos nucifera L. oil containing a high percentage of MCFAs against 5 harmful bacterial pathogens: Escherichia coli, Salmonella Enteritidis, Staphylococcus aureus, Listeria monocytogenes, and Enterococcus cecorum. Gas chromatography (GC-FID analysis of coconut oil showed a high concentration of lauric acid (41%. Microdilution antimicrobial assays showed that the combination of carvacrol and coconut oil had a stronger antibacterial effect against all tested bacteria than both agents separately. We conclude that carvacrol could significantly improve the antibacterial effect of coconut oil.
Efferocytosis of Pathogen-Infected Cells
Directory of Open Access Journals (Sweden)
Niloofar Karaji
2017-12-01
Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.
Emerging Pathogens Initiative (EPI)
Department of Veterans Affairs — The Emerging Pathogens Initiative (EPI) database contains emerging pathogens information from the local Veterans Affairs Medical Centers (VAMCs). The EPI software...
Contamination of food and water by pathogens is a substantial public health issue in the United States. According to the Centers for Disease Control and Prevention, 49% of foodborne illness is caused by produce, and despite efforts to reduce produce contamination, these issues persist. Escherichia c...
Circumscription of the anthracnose pathogens Colletotrichum lindemuthianum and C. nigrum.
Liu, Fang; Cai, Lei; Crous, Pedro W; Damm, Ulrike
2013-01-01
The anthracnose pathogen of common bean (Phaseolus vulgaris) is usually identified as Colletotrichum lindemuthianum, while anthracnose of potato (Solanum tuberosum), peppers (Capsicum annuum), tomato (S. lycopersicum) and several other crop plants is often attributed to C. coccodes. In order to study the phylogenetic relationships of these important pathogens, we conducted a multigene analysis (ITS, ACT, TUB2, CHS-1, GAPDH) of strains previously identified as C. lindemuthianum, C. coccodes and other related species, as well as representative species of the major Colletotrichum species complexes. Strains of C. lindemuthianum belonged to a single clade; we selected an authentic specimen as lectotype, and an appropriate specimen and culture from the CBS collection to serve as epitype. Two clades were resolved within C. coccodes s. lat. One clade included the ex-neotype strain of C. coccodes on Solanum, while an epitype was selected for C. nigrum, which represents the oldest name of the second clade, which occurs on Capsicum, Solanum, as well as several other host plants. Furthermore, we recognized C. lycopersici as a synonym of C. nigrum, and C. biologicum as a synonym of C. coccodes.
Bertels, Frederic; Marzel, Alex; Leventhal, Gabriel; Mitov, Venelin; Fellay, Jacques; Günthard, Huldrych F; Böni, Jürg; Yerly, Sabine; Klimkait, Thomas; Aubert, Vincent; Battegay, Manuel; Rauch, Andri; Cavassini, Matthias; Calmy, Alexandra; Bernasconi, Enos; Schmid, Patrick; Scherrer, Alexandra U; Müller, Viktor; Bonhoeffer, Sebastian; Kouyos, Roger; Regoes, Roland R
2018-01-01
Pathogen strains may differ in virulence because they attain different loads in their hosts, or because they induce different disease-causing mechanisms independent of their load. In evolutionary ecology, the latter is referred to as "per-parasite pathogenicity". Using viral load and CD4+ T-cell measures from 2014 HIV-1 subtype B-infected individuals enrolled in the Swiss HIV Cohort Study, we investigated if virulence-measured as the rate of decline of CD4+ T cells-and per-parasite pathogenicity are heritable from donor to recipient. We estimated heritability by donor-recipient regressions applied to 196 previously identified transmission pairs, and by phylogenetic mixed models applied to a phylogenetic tree inferred from HIV pol sequences. Regressing the CD4+ T-cell declines and per-parasite pathogenicities of the transmission pairs did not yield heritability estimates significantly different from zero. With the phylogenetic mixed model, however, our best estimate for the heritability of the CD4+ T-cell decline is 17% (5-30%), and that of the per-parasite pathogenicity is 17% (4-29%). Further, we confirm that the set-point viral load is heritable, and estimate a heritability of 29% (12-46%). Interestingly, the pattern of evolution of all these traits differs significantly from neutrality, and is most consistent with stabilizing selection for the set-point viral load, and with directional selection for the CD4+ T-cell decline and the per-parasite pathogenicity. Our analysis shows that the viral genotype affects virulence mainly by modulating the per-parasite pathogenicity, while the indirect effect via the set-point viral load is minor. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Zueva, Ksenia J; Lumme, Jaakko; Veselov, Alexey E; Kent, Matthew P; Lien, Sigbjørn; Primmer, Craig R
2014-01-01
Mechanisms of host-parasite co-adaptation have long been of interest in evolutionary biology; however, determining the genetic basis of parasite resistance has been challenging. Current advances in genome technologies provide new opportunities for obtaining a genome-scale view of the action of parasite-driven natural selection in wild populations and thus facilitate the search for specific genomic regions underlying inter-population differences in pathogen response. European populations of Atlantic salmon (Salmo salar L.) exhibit natural variance in susceptibility levels to the ectoparasite Gyrodactylus salaris Malmberg 1957, ranging from resistance to extreme susceptibility, and are therefore a good model for studying the evolution of virulence and resistance. However, distinguishing the molecular signatures of genetic drift and environment-associated selection in small populations such as land-locked Atlantic salmon populations presents a challenge, specifically in the search for pathogen-driven selection. We used a novel genome-scan analysis approach that enabled us to i) identify signals of selection in salmon populations affected by varying levels of genetic drift and ii) separate potentially selected loci into the categories of pathogen (G. salaris)-driven selection and selection acting upon other environmental characteristics. A total of 4631 single nucleotide polymorphisms (SNPs) were screened in Atlantic salmon from 12 different northern European populations. We identified three genomic regions potentially affected by parasite-driven selection, as well as three regions presumably affected by salinity-driven directional selection. Functional annotation of candidate SNPs is consistent with the role of the detected genomic regions in immune defence and, implicitly, in osmoregulation. These results provide new insights into the genetic basis of pathogen susceptibility in Atlantic salmon and will enable future searches for the specific genes involved.
Mutation directional selection sheds light on prion pathogenesis
International Nuclear Information System (INIS)
Shen, Liang; Ji, Hong-Fang
2011-01-01
Highlights: → Most pathogenic mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. → Mutation-induced changes may strengthen the interactions between PrP and facilitating factors. → The findings also have significant implications for exploring potential regions involved in the conformational transition from PrP C to PrP Sc . -- Abstract: As mutations in the PRNP gene account for human hereditary prion diseases (PrDs), it is crucial to elucidating how these mutations affect the central pathogenic conformational transition of normal cellular prion protein (PrP C ) to abnormal scrapie isoform (PrP Sc ). Many studies proposed that these pathogenic mutations may make PrP more susceptible to conformational change through altering its structure stability. By evaluating the most recent observations regarding pathogenic mutations, it was found that the pathogenic mutations do not exert a uniform effect on the thermodynamic stability of the human PrP's structure. Through analyzing the reported PrDs-related mutations, we found that 25 out of 27 mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. Based on the triggering role reported by previous studies of facilitating factors in PrP C conversion, e.g., lipid and polyanion, we proposed that the mutation-induced changes may strengthen the interaction between PrP and facilitating factors, which will accelerate PrP conversion and cause PrDs.
Mutation directional selection sheds light on prion pathogenesis
Energy Technology Data Exchange (ETDEWEB)
Shen, Liang [Shandong Provincial Research Center for Bioinformatic Engineering and Technique, Shandong University of Technology, Zibo 255049 (China); Ji, Hong-Fang, E-mail: jhf@sdut.edu.cn [Shandong Provincial Research Center for Bioinformatic Engineering and Technique, Shandong University of Technology, Zibo 255049 (China)
2011-07-01
Highlights: {yields} Most pathogenic mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. {yields} Mutation-induced changes may strengthen the interactions between PrP and facilitating factors. {yields} The findings also have significant implications for exploring potential regions involved in the conformational transition from PrP{sup C} to PrP{sup Sc}. -- Abstract: As mutations in the PRNP gene account for human hereditary prion diseases (PrDs), it is crucial to elucidating how these mutations affect the central pathogenic conformational transition of normal cellular prion protein (PrP{sup C}) to abnormal scrapie isoform (PrP{sup Sc}). Many studies proposed that these pathogenic mutations may make PrP more susceptible to conformational change through altering its structure stability. By evaluating the most recent observations regarding pathogenic mutations, it was found that the pathogenic mutations do not exert a uniform effect on the thermodynamic stability of the human PrP's structure. Through analyzing the reported PrDs-related mutations, we found that 25 out of 27 mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. Based on the triggering role reported by previous studies of facilitating factors in PrP{sup C} conversion, e.g., lipid and polyanion, we proposed that the mutation-induced changes may strengthen the interaction between PrP and facilitating factors, which will accelerate PrP conversion and cause PrDs.
Host Pathogen Relations: Exploring Animal Models for Fungal Pathogens
Directory of Open Access Journals (Sweden)
Catherine G. Harwood
2014-06-01
Full Text Available Pathogenic fungi cause superficial infections but pose a significant public health risk when infections spread to deeper tissues, such as the lung. Within the last three decades, fungi have been identified as the leading cause of nosocomial infections making them the focus of research. This review outlines the model systems such as the mouse, zebrafish larvae, flies, and nematodes, as well as ex vivo and in vitro systems available to study common fungal pathogens.
DEFF Research Database (Denmark)
Jonstrup, Søren Peter; Gray, Tanya; Kahns, Søren
2009-01-01
A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part of the Eu......A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part...... of the European Community Reference Laboratory for Fish Diseases function. This concept has been initially developed for viral haemorrhagic septicaemia virus and will be extended in future to include information on other significant aquaculture pathogens. Information included for each isolate comprises sequence...... to obtain data from any selected part of the genome of interest. The output of the sequence search can be readily retrieved as a FASTA file ready to be imported into a sequence alignment tool of choice, facilitating further molecular epidemiological study....
Trotter, Patrick B; Summers, Dominic M; Robb, Matthew; Hulme, William; Ushiro-Lumb, Ines; Watson, Christopher J E; Neuberger, James; Bradley, J Andrew
2017-07-01
Deceased organ donors are routinely screened for behaviors that increase the risk of transmissible blood-borne viral (BBV) infection, but the impact of this information on organ donation and transplant outcome is not well documented. Our aim was to establish the impact of such behavior on organ donation and utilization, as well transplant recipient outcomes. We identified all UK deceased organ donors from 2003 to 2015 with a disclosed history of increased risk behavior (IRB) including intravenous drug use (IVDU), imprisonment and increased risk sexual behavior. Of 17 262 potential donors, 659 (3.8%) had IRB for BBV and 285 (1.7%) were seropositive for BBV, of whom half had a history of IRB (mostly IVDU [78.5%]). Of actual donors with IRB, 393 were seronegative for viral markers at time of donation. A history of recent IVDU was associated with fewer potential donors proceeding to become actual organ donors (64% vs 75%, P = 0.007). Donors with IRB provided 1091 organs for transplantation (624 kidneys and 467 other organs). Transplant outcome was similar in recipients of organs from donors with and without IRB. There were 3 cases of unexpected hepatitis C virus transmission, all from an active IVDU donor who was hepatitis C virus seronegative at time of donation, but was found to be viremic on retrospective testing. Donors with a history of IRB provide a valuable source of organs for transplantation with good transplant outcomes and there is scope for increasing the use of organs from such donors.
Patra, Kailash P; Choudhury, Biswa; Matthias, Michael M; Baga, Sheyenne; Bandyopadhya, Keya; Vinetz, Joseph M
2015-10-30
Lipopolysaccharides (LPS) are complex, amphipathic biomolecules that constitute the major surface component of Gram-negative bacteria. Leptospira, unlike other human-pathogenic spirochetes, produce LPS, which is fundamental to the taxonomy of the genus, involved in host-adaption and also the target of diagnostic antibodies. Despite its significance, little is known of Leptospira LPS composition and carbohydrate structure among different serovars. LPS from Leptospira interrogans serovar Copenhageni strain L1-130, a pathogenic species, and L. licerasiae serovar Varillal strain VAR 010, an intermediately pathogenic species, were studied. LPS prepared from aqueous and phenol phases were analyzed separately. L. interrogans serovar Copenhageni has additional sugars not found in L. licerasiae serovar Varillal, including fucose (2.7%), a high amount of GlcNAc (12.3%), and two different types of dideoxy HexNAc. SDS-PAGE indicated that L. interrogans serovar Copenhageni LPS had a far higher molecular weight and complexity than that of L. licerasiae serovar Varillal. Chemical composition showed that L. interrogans serovar Copenhageni LPS has an extended O-antigenic polysaccharide consisting of sugars, not present in L. licerasiae serovar Varillal. Arabinose, xylose, mannose, galactose and L-glycero-D-mannoheptose were detected in both the species. Fatty acid analysis by gas chromatography-mass spectrometry (GC-MS) showed the presence of hydroxypalmitate (3-OH-C16:0) only in L. interrogans serovar Copenhageni. Negative staining electron microscopic examination of LPS showed different filamentous morphologies in L. interrogans serovar Copenhageni vs. L. licerasiae serovar Varillal. This comparative biochemical analysis of pathogenic and intermediately pathogenic Leptospira LPS reveals important carbohydrate and lipid differences that underlie future work in understanding the mechanisms of host-adaptation, pathogenicity and vaccine development in leptospirosis.
DEFF Research Database (Denmark)
Schulz, Jana; Ryser-Degiorgis, Marie-Pierre; Kuiken, Thijs
2017-01-01
Background: The need for wildlife health surveillance as part of disease control in wildlife, domestic animals and humans on the global level is widely recognized. However, the objectives, methods and intensity of existing wildlife health surveillance programs vary greatly among European countries......, resulting in a patchwork of data that are difficult to merge and compare. This survey aimed at evaluating the need and potential for data harmonization in wildlife health in Europe. The specific objective was to collect information on methods currently used to estimate host abundance and pathogen prevalence...... estimation, there is an urgent need to develop tools for the routine collection of host abundance data in a harmonized way. Wildlife health experts are encouraged to apply the harmonized APHAEA protocols in epidemiological studies in wildlife and to increase cooperation....
Antiviral therapy: a perspective.
Shahidi Bonjar, Amir Hashem
2016-01-01
This paper discusses extracorporeal removal of viral particles and their antigens from the blood as an auxiliary therapy. This hypothesis has not been reported before. In some chronic blood-borne viral infections, the virus remains systemic and persistent for extended periods of time, with adverse effects that weaken the immune system. Blood titers of virus and its toxins are proportional to the severity of the disease, and their reduction can alleviate symptoms, leading to improved health. Several blood-borne viral infections can be overcome by the young, but are life-threatening in the elderly. It is known that some older people have extreme difficulty tolerating viral infections such as influenza and the common cold. Further, several types of viral infection persist throughout the life of the individual and cannot be eliminated by conventional treatments. Well-known infections of this type include HIV and hepatitis B. In the case of Ebola virus, patients remain infectious as long as their blood contains the virus. According to the present hypothesis, an extracorporeal viral antibody column (EVAC) is proposed for elimination or reduction of the blood viral titer when treating blood-borne viral infection. EVAC would selectively trap viral antigens and toxins in the blood into an extracorporeal circuit, while returning detoxified blood back to the patient's body. It is anticipated that EVAC would reduce mortality caused by blood-borne viral infections in the elderly since reduction of blood virus titers would improve health, leading to improved overall patient performance. Such enhancement would also make conventional therapies even more effective. EVAC could have a lifesaving role in treatment of viral illness, especially those involving lethal viruses such as Ebola, where the patient's recovery to a large extent depends on their general health status. EVAC would be for single use and appropriately disposed of after each detoxification procedure. When sufficient
Hancks, Dustin C; Hartley, Melissa K; Hagan, Celia; Clark, Nathan L; Elde, Nels C
2015-05-01
A diverse subset of pattern recognition receptors (PRRs) detects pathogen-associated nucleic acids to initiate crucial innate immune responses in host organisms. Reflecting their importance for host defense, pathogens encode various countermeasures to evade or inhibit these immune effectors. PRRs directly engaged by pathogen inhibitors often evolve under recurrent bouts of positive selection that have been described as molecular 'arms races.' Cyclic GMP-AMP synthase (cGAS) was recently identified as a key PRR. Upon binding cytoplasmic double-stranded DNA (dsDNA) from various viruses, cGAS generates the small nucleotide secondary messenger cGAMP to signal activation of innate defenses. Here we report an evolutionary history of cGAS with recurrent positive selection in the primate lineage. Recent studies indicate a high degree of structural similarity between cGAS and 2'-5'-oligoadenylate synthase 1 (OAS1), a PRR that detects double-stranded RNA (dsRNA), despite low sequence identity between the respective genes. We present comprehensive comparative evolutionary analysis of cGAS and OAS1 primate sequences and observe positive selection at nucleic acid binding interfaces and distributed throughout both genes. Our data revealed homologous regions with strong signatures of positive selection, suggesting common mechanisms employed by unknown pathogen encoded inhibitors and similar modes of evasion from antagonism. Our analysis of cGAS diversification also identified alternately spliced forms missing multiple sites under positive selection. Further analysis of selection on the OAS family in primates, which comprises OAS1, OAS2, OAS3 and OASL, suggests a hypothesis where gene duplications and domain fusion events result in paralogs that provide another means of escaping pathogen inhibitors. Together our comparative evolutionary analysis of cGAS and OAS provides new insights into distinct mechanisms by which key molecular sentinels of the innate immune system have adapted
Directory of Open Access Journals (Sweden)
Dustin C Hancks
2015-05-01
Full Text Available A diverse subset of pattern recognition receptors (PRRs detects pathogen-associated nucleic acids to initiate crucial innate immune responses in host organisms. Reflecting their importance for host defense, pathogens encode various countermeasures to evade or inhibit these immune effectors. PRRs directly engaged by pathogen inhibitors often evolve under recurrent bouts of positive selection that have been described as molecular 'arms races.' Cyclic GMP-AMP synthase (cGAS was recently identified as a key PRR. Upon binding cytoplasmic double-stranded DNA (dsDNA from various viruses, cGAS generates the small nucleotide secondary messenger cGAMP to signal activation of innate defenses. Here we report an evolutionary history of cGAS with recurrent positive selection in the primate lineage. Recent studies indicate a high degree of structural similarity between cGAS and 2'-5'-oligoadenylate synthase 1 (OAS1, a PRR that detects double-stranded RNA (dsRNA, despite low sequence identity between the respective genes. We present comprehensive comparative evolutionary analysis of cGAS and OAS1 primate sequences and observe positive selection at nucleic acid binding interfaces and distributed throughout both genes. Our data revealed homologous regions with strong signatures of positive selection, suggesting common mechanisms employed by unknown pathogen encoded inhibitors and similar modes of evasion from antagonism. Our analysis of cGAS diversification also identified alternately spliced forms missing multiple sites under positive selection. Further analysis of selection on the OAS family in primates, which comprises OAS1, OAS2, OAS3 and OASL, suggests a hypothesis where gene duplications and domain fusion events result in paralogs that provide another means of escaping pathogen inhibitors. Together our comparative evolutionary analysis of cGAS and OAS provides new insights into distinct mechanisms by which key molecular sentinels of the innate immune system
Yeater, Michael C; Kirsch, Katie R; Taylor, T Matthew; Mitchell, Jeff; Osburn, Wesley N
2015-04-01
The objectives of this study were (i) to assess the efficacy of quaternary ammonium chloride-based wet foam (WF) and dry foam (DF) sanitizer systems (600 ppm) for reducing Listeria innocua (a nonpathogenic surrogate of Listeria monocytogenes) or a 100.0 μg/ml rifampin-resistant Salmonella Typhimurium LT2 (a nonpathogenic surrogate of Salmonella enterica serovar Typhimurium) on niche and transfer point areas of an unwashed retail deli slicer as compared with traditional chlorine (Cl(-)) treatment (200 ppm) and (ii) to compare sanitizer surface contact times (10 and 15 min) for pathogen surrogate control. Turkey frankfurter slurries inoculated with L. innocua or Salmonella Typhimurium were used to inoculate seven high-risk sites on a commercial slicer. After 30 min of bacterial attachment, slicers were dry wiped to remove excess food matter, followed by a randomly assigned sanitizer treatment. Surviving pathogen surrogate cells were enumerated on modified Oxford's agar not containing antimicrobic supplement (L. innocua) or on tryptic soy agar supplemented with 100 μg/ml rifampin (Salmonella Typhimurium LT2). Replicate-specific L. innocua and Salmonella Typhimurium reductions were calculated as log CFU per square centimeter of control minus log CFU per square centimeter of enumerated survivors for each site. For both organisms, all sanitizer treatments differed from each other, with Cl(-) producing the least reduction and WF the greatest reduction. A significant (P < 0.05) site-by-treatment interaction was observed. The results of the study indicate that quaternary ammonium chloride sanitizers (600 ppm) applied by both WF and DF were more effective at reducing L. innocua and Salmonella Typhimurium than a traditional Cl sanitizer (200 ppm) on unwashed slicer surfaces.
Surgical excision of lung metastases from squamous carcinoma of ...
African Journals Online (AJOL)
These 2 case reports serveto emphasizetwo important points concerning carcinoma of the cervix: (i) blood-borne metastases are now frequently encountered in this disease; and (ii). in selected cases surgical excision of a secondary deposit in the lung is the treatment of choice and may even result -in cure.
In vitro photoinactivation of bovine mastitis related pathogens.
Sellera, Fábio Parra; Sabino, Caetano Padial; Ribeiro, Martha Simões; Gargano, Ronaldo Gomes; Benites, Nilson Roberti; Melville, Priscilla Anne; Pogliani, Fabio Celidonio
2016-03-01
Bovine mastitis is considered the most important disease of worldwide dairy industry. Treatment of this disease is based on the application intramammary antibiotic, which favors an increase in the number of resistant bacteria in the last decade. Photodynamic inactivation (PDI) has been investigated in different areas of Health Sciences, and has shown great potential for inactivating different pathogens, without any selection of resistant microorganisms. The objective of this study was to investigate the efficacy of PDI in the inactivation of pathogens associated with bovine mastitis. We tested the effectiveness of PDI against antibiotic resistant strains, isolated from bovine mastitis, from the following species: Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae, Corynebacterium bovis, and the alga Prototheca zopfii. Nine experimental groups were evaluated: control, no treatment; light only, irradiation of a red light-emitting diode (λ=662 (20) nm) for 180 s; exposure to 50 μM methylene blue alone for 5 min; and PDI for 5, 10, 30, 60, 120 and 180 s. S. dysgalactiae, S. aureus, and C. bovis were inactivated after 30s of irradiation, whereas S. agalactiae was inactivated after 120 s and P. zopfii at 180 s of irradiation. These results show that PDI can be an interesting tool for inactivating pathogens for bovine mastitis. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Fuchs Thilo M
2008-01-01
Full Text Available Abstract Background Photorhabdus luminescens and Yersinia enterocolitica are both enteric bacteria which are associated with insects. P. luminescens lives in symbiosis with soil nematodes and is highly pathogenic towards insects but not to humans. In contrast, Y. enterocolitica is widely found in the environment and mainly known to cause gastroenteritis in men, but has only recently been shown to be also toxic for insects. It is expected that both pathogens share an overlap of genetic determinants that play a role within the insect host. Results A selective genome comparison was applied. Proteins belonging to the class of two-component regulatory systems, quorum sensing, universal stress proteins, and c-di-GMP signalling have been analysed. The interorganismic synopsis of selected regulatory systems uncovered common and distinct signalling mechanisms of both pathogens used for perception of signals within the insect host. Particularly, a new class of LuxR-like regulators was identified, which might be involved in detecting insect-specific molecules. In addition, the genetic overlap unravelled a two-component system that is unique for the genera Photorhabdus and Yersinia and is therefore suggested to play a major role in the pathogen-insect relationship. Our analysis also highlights factors of both pathogens that are expressed at low temperatures as encountered in insects in contrast to higher (body temperature, providing evidence that temperature is a yet under-investigated environmental signal for bacterial adaptation to various hosts. Common degradative metabolic pathways are described that might be used to explore nutrients within the insect gut or hemolymph, thus enabling the proliferation of P. luminescens and Y. enterocolitica in their invertebrate hosts. A strikingly higher number of genes encoding insecticidal toxins and other virulence factors in P. luminescens compared to Y. enterocolitica correlates with the higher virulence of P
Barton, Ian S; Fuqua, Clay; Platt, Thomas G
2018-01-01
Many important pathogens maintain significant populations in highly disparate disease and non-disease environments. The consequences of this environmental heterogeneity in shaping the ecological and evolutionary dynamics of these facultative pathogens are incompletely understood. Agrobacterium tumefaciens, the causative agent for crown gall disease of plants has proven a productive model for many aspects of interactions between pathogens and their hosts and with other microbes. In this review, we highlight how this past work provides valuable context for the use of this system to examine how heterogeneity and transitions between disease and non-disease environments influence the ecology and evolution of facultative pathogens. We focus on several features common among facultative pathogens, such as the physiological remodelling required to colonize hosts from environmental reservoirs and the consequences of competition with host and non-host associated microbiota. In addition, we discuss how the life history of facultative pathogens likely often results in ecological tradeoffs associated with performance in disease and non-disease environments. These pathogens may therefore have different competitive dynamics in disease and non-disease environments and are subject to shifting selective pressures that can result in pathoadaptation or the within-host spread of avirulent phenotypes. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Expanding the potential of NAI-107 for treating serious ESKAPE pathogens
DEFF Research Database (Denmark)
Brunati, Cristina; Thomsen, Thomas T; Gaspari, Eleonora
2018-01-01
Objectives: To characterize NAI-107 and related lantibiotics for their in vitro activity against Gram-negative pathogens, alone or in combination with polymyxin, and against non-dividing cells or biofilms of Staphylococcus aureus. NAI-107 was also evaluated for its propensity to select or induce...... showed that NAI-107 and its brominated variant are highly active against Neisseria gonorrhoeae and some other fastidious Gram-negative pathogens. Furthermore, all compounds strongly synergized with polymyxin against Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and Pseudomonas...... self-resistance in Gram-positive bacteria. Methods: We used MIC determinations and chequerboard experiments to establish the antibacterial activity of the examined compounds against target microorganisms. Time-kill assays were used to evaluate killing of exponential and stationary-phase cells...
Methods for detecting pathogens in the beef food chain: detecting particular pathogens
The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...
Natural selection promotes antigenic evolvability.
Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin
2013-01-01
The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.
Natural selection promotes antigenic evolvability.
Directory of Open Access Journals (Sweden)
Christopher J Graves
Full Text Available The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish
Removal of pathogenic bacteria from sewage-treated effluent and biosolids for agricultural purposes
Al-Gheethi, A. A.; Efaq, A. N.; Bala, J. D.; Norli, I.; Abdel-Monem, M. O.; Ab. Kadir, M. O.
2018-05-01
The reuse of treated sewage for irrigation is considered as an important alternative water source in the new water management strategy of the countries that face a severe deficiency of water resources such as the Middle East countries. The organic material and fertilizing elements contained in biosolids are essential for maintaining soil fertility. However, both treated sewage and biosolids contain a large diversity of pathogens that would be transmitted to the environment and infect human directly or indirectly. Therefore, those pathogens should be reduced from the treated sewage and biosolids before the reuse in the agriculture. This paper reviews the considerations for reuse of treated sewage and biosolids in agriculture and further treatments used for reduction of pathogenic bacteria. The treatment methods used for the reduction of pathogens in these wastes have reviewed. It appeared that the main concern associated with the reduction of pathogenic bacteria lies in their ability to regrow in the treated sewage and biosolids. Therefore, the effective treatment method is that it has the potential to destruct pathogens cells and remove the nutrients to prevent the regrowth or recontamination from the surrounded environment. The removal of nutrients might be applicable in the sewage but not in the biosolids due to high nutrient contents. However, the reduction of health risk in the biosolids might be carried out by regulating the biosolid utilization and selecting the plant species grown in the fertilized soil with biosolids.
Occurrence of mastitis pathogens in relation to somatic cells
Directory of Open Access Journals (Sweden)
Marcela Vyletělová Klimešová
2013-01-01
Full Text Available There were examined 161 cows from 4 farms in total. The suspect animals were selected according to viscosity test results, clinical symptoms and somatic cell count (SCC. Milk samples were examined for the presence of pathogens and for SCC. 55 mastitis pathogens were identified. The most frequently isolated species was Enterococcus faecalis (n = 20, followed by Staphylococcus aureus (n = 6 and Streptococcus uberis (n = 5. The SCC ranged from 9 to 24 204 ths.ml−1. There was positive occurrence of bacteria genus Staphylococcus and Enterococcus at lower SCC (50 ths.ml−1 and at higher SCC numbers (> 300 ths. ml−1 bacteria genus Streptococcus, Enterobacter and Escherichia coli. Differences in SCC were significant (P < 0.001 in negative samples xg 131 SCC versus 491 for positive, 611 for staphylococci and 464 ths.ml−1 for other positive. SCC discrimination limit for practical likelihood of pathogen occurrence estimation in infectious sample groups was calculated. This limit for suspicion of infection is 159 for positive group, 113 for staphylococci and 174 ths.ml−1 for other positive. This could be possible to recommend the value 174 ths.ml−1 for practical use with target to apply preventive or curative measures.
Amixicile, a novel strategy for targeting oral anaerobic pathogens.
Hutcherson, Justin A; Sinclair, Kathryn M; Belvin, Benjamin R; Gui, Qin; Hoffman, Paul S; Lewis, Janina P
2017-09-05
The oral microflora is composed of both health-promoting as well as disease-initiating bacteria. Many of the disease-initiating bacteria are anaerobic and include organisms such as Porphyromonas gingivalis, Prevotella intermedia, Fusobacterium nucleatum, and Tannerella forsythia. Here we investigated a novel therapeutic, amixicile, that targets pyruvate:ferredoxin oxidoreductase (PFOR), a major metabolic enzyme involved in energy generation through oxidative decarboxylation of pyruvate. PFOR is present in these anaerobic pathogenic bacteria and thus we hypothesized that amixicile would effectively inhibit their growth. In general, PFOR is present in all obligate anaerobic bacteria, while oral commensal aerobes, including aerotolerant ones, such as Streptococcus gordonii, use pyruvate dehydrogenase to decarboxylate pyruvate. Accordingly, we observed that growth of the PFOR-containing anaerobic periodontal pathogens, grown in both monospecies as well as multispecies broth cultures was inhibited in a dose-dependent manner while that of S. gordonii was unaffected. Furthermore, we also show that amixicile is effective against these pathogens grown as monospecies and multispecies biofilms. Finally, amixicile is the first selective therapeutic agent active against bacteria internalized by host cells. Together, the results show that amixicile is an effective inhibitor of oral anaerobic bacteria and as such, is a good candidate for treatment of periodontal diseases.
Greig, Denise J.; Ip, Hon S.; Gulland, Frances M. D.; Miller, Woutrina A.; Conrad, Patricia A.; Field, Cara L.; Fleetwood, Michelle; Harvey, James T.; Jang, Spencer; Packham, Andrea; Wheeler, Elizabeth; Hall, Ailsa J.
2014-01-01
The infection status of harbor seals Phoca vitulina in central California, USA, was evaluated through broad surveillance for pathogens in stranded and wild-caught animals from 2001 to 2008, with most samples collected in 2007 and 2008. Stranded animals from Mendocino County to San Luis Obispo County were sampled at a rehabilitation facility: The Marine Mammal Center (TMMC, n = 175); wild-caught animals were sampled at 2 locations: San Francisco Bay (SF, n = 78) and Tomales Bay (TB, n = 97), that differed in degree of urbanization. Low prevalences of Salmonella, Campylobacter, Giardia, and Cryptosporidium were detected in the feces of stranded and wild-caught seals. Clostridium perfringens and Escherichia coli were more prevalent in the feces of stranded (58% [78 out of 135] and 76% [102 out of 135]) than wild-caught (42% [45 out of 106] and 66% [68 out of 106]) seals, whereas Vibrio spp. were 16 times more likely to be cultured from the feces of seals from SF than TB or TMMC (p neurona, and type A influenza was only detected in the wild-caught harbor seals (post-weaning age classes), whereas antibody titers to Leptospira spp. were detected in stranded and wild-caught seals. No stranded (n = 109) or wild-caught (n = 217) harbor seals had antibodies to phocine distemper virus, although a single low titer to canine distemper virus was detected. These results highlight the role of harbor seals as sentinel species for zoonotic and terrestrial pathogens in the marine environment.
Vermeer, Louic S.; Lan, Yun; Abbate, Vincenzo; Ruh, Emrah; Bui, Tam T.; Wilkinson, Louise J.; Kanno, Tokuwa; Jumagulova, Elmira; Kozlowska, Justyna; Patel, Jayneil; McIntyre, Caitlin A.; Yam, W. C.; Siu, Gilman; Atkinson, R. Andrew; Lam, Jenny K. W.
2012-01-01
Background: Antimicrobial peptides (AMPs) have the potential to act against multiple pathogenic targets. Results: AMPs that maintain conformational flexibility are more potent against multiple pathogens and less hemolytic. Conclusion: Antimicrobial action and hemolysis proceed via differing mechanisms. Significance: The potency, selectivity, and ability of AMPs to reach intracellular pathogens can be modulated using general principles.
Lipids in host-pathogen interactions: pathogens exploit the complexity of the host cell lipidome.
van der Meer-Janssen, Ynske P M; van Galen, Josse; Batenburg, Joseph J; Helms, J Bernd
2010-01-01
Lipids were long believed to have a structural role in biomembranes and a role in energy storage utilizing cellular lipid droplets and plasma lipoproteins. Research over the last decades has identified an additional role of lipids in cellular signaling, membrane microdomain organization and dynamics, and membrane trafficking. These properties make lipids an attractive target for pathogens to modulate host cell processes in order to allow their survival and replication. In this review we will summarize the often ingenious strategies of pathogens to modify the lipid homeostasis of host cells, allowing them to divert cellular processes. To this end pathogens take full advantage of the complexity of the lipidome. The examples are categorized in generalized and emerging principles describing the involvement of lipids in host-pathogen interactions. Several pathogens are described that simultaneously induce multiple changes in the host cell signaling and trafficking mechanisms. Elucidation of these pathogen-induced changes may have important implications for drug development. The emergence of high-throughput lipidomic techniques will allow the description of changes of the host cell lipidome at the level of individual molecular lipid species and the identification of lipid biomarkers.
International Nuclear Information System (INIS)
Niemand, J.G.
1985-01-01
The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process
Kissinger, Christina N; Cameron, Sydney A; Thorp, Robbin W; White, Brendan; Solter, Leellen F
2011-07-01
Pathogens have been implicated as potential factors in the recent decline of some North American bumble bee (Bombus) species, but little information has been reported about the natural enemy complex of bumble bees in the United States. We targeted bumble bee populations in a state-wide survey in Illinois and several sites in California and Oregon where declines have been reported to determine presence and prevalence of natural enemies. Based on our observations, most parasites and pathogens appear to be widespread generalists among bumble bee species, but susceptibility to some natural enemies appeared to vary. Copyright © 2011 Elsevier Inc. All rights reserved.
Chiu, Charles Y
2015-01-01
Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672
Uh Seong Jeong; Ju Hee Kim; Ki Kwon Lee; Seong Soo Cheong; Wang Hyu Lee
2013-01-01
The strains of Colletotrichum gloeosporioides, C. coccodes, C. acutatum isolated from black raspberry werepathogenic to apple and strawberry after dropping inoculation, but showed weak pathogenicity in hot-pepperand tomato. The anthracnose pathogens of C. gloeosporioides, C. orbiculare, C. acutatum isolated from apple,hot-pepper and pumpkin showed pathogenicity in black raspberry. Moreover, the anthracnose pathogensisolated from apple caused disease symptoms in non-wounded inoculation.
Rapid detection of pathogenic bacteria by volatile organic compound (VOC) analysis
Senecal, Andre G.; Magnone, Joshua; Yeomans, Walter; Powers, Edmund M.
2002-02-01
Developments in rapid detection technologies have made countless improvements over the years. However, because of the limited sample that these technologies can process in a single run, the chance of capturing and identifying a small amount of pathogens is difficult. The problem is further magnified by the natural random distribution of pathogens in foods. Methods to simplify pathogenic detection through the identification of bacteria specific VOC were studied. E. coli O157:H7 and Salmonella typhimurium were grown on selected agar medium to model protein, and carbohydrate based foods. Pathogenic and common spoilage bacteria (Pseudomonas and Morexella) were screened for unique VOC production. Bacteria were grown on agar slants in closed vials. Headspace sampling was performed at intervals up to 24 hours using Solid Phase Micro-Extraction (SPME) techniques followed by GC/MS analysis. Development of unique volatiles was followed to establish sensitivity of detection. E. coli produced VOC not found in either Trypticase Soy Yeast (TSY) agar blanks or spoilage organism samples were - indole, 1-decanol, and 2-nonanone. Salmonella specific VOC grown on TSY were 3-methyl-1-butanol, dimethyl sulfide, 2-undecanol, 2-pentadecanol and 1-octanol. Trials on potato dextrose agar (PDA) slants indicated VOC specific for E. coli and Salmonella when compared to PDA blanks and Pseudomonas samples. However, these VOC peaks were similar for both pathogens. Morexella did not grow on PDA slants. Work will continue with model growth mediums at various temperatures, and mixed flora inoculums. As well as, VOC production based on the dynamics of bacterial growth.
Bioactive Metabolites from Pathogenic and Endophytic Fungi of Forest Trees.
Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Scanu, Bruno; Evidente, Antonio; Cimmino, Alessio
2018-01-01
Fungi play an important role in terrestrial ecosystems interacting positively or negatively with plants. These interactions are complex and the outcomes are different depending on the fungal lifestyles, saprotrophic, mutualistic or pathogenic. Furthermore, fungi are well known for producing secondary metabolites, originating from different biosynthetic pathways, which possess biological properties of considerable biotechnological interest. Among the terrestrial ecosystems, temperate forests represent an enormous reservoir of fungal diversity. This review will highlight the goldmine of secondary metabolites produced by pathogenic and endophytic fungi of forest trees with focus on their biological activities. A structured search of bibliographic databases for peer-reviewed research literature was undertaken using a research discovery application providing access to a large and authoritative source of references. The papers selected were examined and the main results were reported and discussed. Two hundred forthy-one papers were included in the review, outlined a large number of secondary metabolites produced by pathogenic and endophiltic fungi and their biological activities, including phytotoxic, antifungal, antioomycetes, antibacterial, brine shrimp lethality, mosquito biting deterrence and larvicidal, cytotoxic, antiproliferative and many other bioactivities. The findings of this review confirm the importance of secondary metabolites produced by pathogenic and endophytic fungi from forest plants growing in temperate regions as an excellent prospects to discover compounds with new bioactivities and mode of actions. In addition, the potential of some metabolites as a source of new drugs and biopesticides is underlined. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Future research needs involving pathogens in groundwater
Bradford, Scott A.; Harvey, Ronald W.
2017-01-01
Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.
Future research needs involving pathogens in groundwater
Bradford, Scott A.; Harvey, Ronald W.
2017-06-01
Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.
Langhammer, Penny F; Lips, Karen R; Burrowes, Patricia A; Tunstall, Tate; Palmer, Crystal M; Collins, James P
2013-01-01
Laboratory investigations into the amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd), have accelerated recently, given the pathogen's role in causing the global decline and extinction of amphibians. Studies in which host animals were exposed to Bd have largely assumed that lab-maintained pathogen cultures retained the infective and pathogenic properties of wild isolates. Attenuated pathogenicity is common in artificially maintained cultures of other pathogenic fungi, but to date, it is unknown whether, and to what degree, Bd might change in culture. We compared zoospore production over time in two samples of a single Bd isolate having different passage histories: one maintained in artificial media for more than six years (JEL427-P39), and one recently thawed from cryopreserved stock (JEL427-P9). In a common garden experiment, we then exposed two different amphibian species, Eleutherodactylus coqui and Atelopus zeteki, to both cultures to test whether Bd attenuates in pathogenicity with in vitro passages. The culture with the shorter passage history, JEL427-P9, had significantly greater zoospore densities over time compared to JEL427-P39. This difference in zoospore production was associated with a difference in pathogenicity for a susceptible amphibian species, indicating that fecundity may be an important virulence factor for Bd. In the 130-day experiment, Atelopus zeteki frogs exposed to the JEL427-P9 culture experienced higher average infection intensity and 100% mortality, compared with 60% mortality for frogs exposed to JEL427-P39. This effect was not observed with Eleutherodactylus coqui, which was able to clear infection. We hypothesize that the differences in phenotypic performance observed with Atelopus zeteki are rooted in changes of the Bd genome. Future investigations enabled by this study will focus on the underlying mechanisms of Bd pathogenicity.
Directory of Open Access Journals (Sweden)
Penny F Langhammer
Full Text Available Laboratory investigations into the amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd, have accelerated recently, given the pathogen's role in causing the global decline and extinction of amphibians. Studies in which host animals were exposed to Bd have largely assumed that lab-maintained pathogen cultures retained the infective and pathogenic properties of wild isolates. Attenuated pathogenicity is common in artificially maintained cultures of other pathogenic fungi, but to date, it is unknown whether, and to what degree, Bd might change in culture. We compared zoospore production over time in two samples of a single Bd isolate having different passage histories: one maintained in artificial media for more than six years (JEL427-P39, and one recently thawed from cryopreserved stock (JEL427-P9. In a common garden experiment, we then exposed two different amphibian species, Eleutherodactylus coqui and Atelopus zeteki, to both cultures to test whether Bd attenuates in pathogenicity with in vitro passages. The culture with the shorter passage history, JEL427-P9, had significantly greater zoospore densities over time compared to JEL427-P39. This difference in zoospore production was associated with a difference in pathogenicity for a susceptible amphibian species, indicating that fecundity may be an important virulence factor for Bd. In the 130-day experiment, Atelopus zeteki frogs exposed to the JEL427-P9 culture experienced higher average infection intensity and 100% mortality, compared with 60% mortality for frogs exposed to JEL427-P39. This effect was not observed with Eleutherodactylus coqui, which was able to clear infection. We hypothesize that the differences in phenotypic performance observed with Atelopus zeteki are rooted in changes of the Bd genome. Future investigations enabled by this study will focus on the underlying mechanisms of Bd pathogenicity.
A quantum-dot-based fluoroassay for detection of food-borne pathogens.
Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass
2017-09-01
Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.
Molecular detection of salmonella species from selected vegetables ...
African Journals Online (AJOL)
Molecular detection of salmonella species from selected vegetables sold in a north-central ... African Journal of Clinical and Experimental Microbiology ... of the pure isolates testing positive as being pathogenic after biochemical analysis.
Quantifying climate change impacts on runoff of zoonotic pathogens from land
Sterk, Ankie; de Roda Husman, Ana Maria; Stergiadi, Maria; de Nijs, Ton; Schijven, Jack
2013-04-01
Several studies have shown a correlation between rainfall and waterborne disease outbreaks. One of the mechanisms whereby rainfall may cause outbreaks is through an increase in runoff of animal faeces from fields to surface waters. Faeces originating from wildlife, domestic animals or manure-fertilized fields, is considered an important source of zoonotic pathogens to which people may be exposed by water recreation or drinking-water consumption. Climate changes affect runoff because of increasing winter precipitation and more extreme precipitation events, as well as changes in evaporation. Furthermore, drier summers are leading to longer periods of high soil moisture deficits, increasing the hydrophobicity of soil and consequently changing infiltration capacities. A conceptual model is designed to describe the impacts of climate changes on the terrestrial and aquatic ecosystems, which are both directly and indirectly affecting pathogen loads in the environment and subsequent public health risks. One of the major outcomes was the lack of quantitative data and limited qualitative analyses of impacts of climate changes on pathogen runoff. Quantifying the processes by which micro-organisms are transported from fields to waters is important to be able to estimate such impacts to enable targeted implementation of effective intervention measures. A quantitative model using Mathematica software will be developed to estimate concentrations of pathogens originating from overland flow during runoff events. Different input sources will be included by applying different land-use scenarios, including point source faecal pollution from dairy cows and geese and diffuse source pollution by fertilization. Zoonotic pathogens, i.e. Cryptosporidium and Campylobacter, were selected based on transport properties, faecal loads and disease burden. Transport and survival rates of these pathogens are determined including effects of changes in precipitation but also temperature induced
DEFF Research Database (Denmark)
Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.
2015-01-01
with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...
Pathogen-induced maternal effects result in enhanced immune responsiveness across generations.
Rosengaus, Rebeca B; Hays, Nicole; Biro, Colette; Kemos, James; Zaman, Muizz; Murray, Joseph; Gezahegn, Bruck; Smith, Wendy
2017-05-01
Parental investment theory postulates that adults can accurately perceive cues from their surroundings, anticipate the needs of future offspring based on those cues, and selectively allocate nongenetic resources to their progeny. Such context-dependent parental contributions can result in phenotypically variable offspring. Consistent with these predictions, we show that bacterially exposed Manduca sexta mothers oviposited significantly more variable embryos (as measured by mass, volume, hatching time, and hatching success) relative to naïve and control mothers. By using an in vivo "clearance of infection" assay, we also show that challenged larvae born to heat-killed- or live- Serratia -injected mothers, supported lower microbial loads and cleared the infection faster than progeny of control mothers. Our data support the notion that mothers can anticipate the future pathogenic risks and immunological needs of their unborn offspring, providing progeny with enhanced immune protection likely through transgenerational immune priming. Although the inclusion of live Serratia into oocytes does not appear to be the mechanism by which mothers confer protection to their young, other mechanisms, including epigenetic modifications in the progeny due to maternal pathogenic stress, may be at play. The adaptive nature of maternal effects in the face of pathogenic stress provides insights into parental investment, resource allocation, and life-history theories and highlights the significant role that pathogen-induced maternal effects play as generators and modulators of evolutionary change.
Hodgkinson, Alison J; Cakebread, Julie; Callaghan, Megan; Harris, Paul; Brunt, Rachel; Anderson, Rachel C; Armstrong, Kelly M; Haigh, Brendan
2017-03-01
Secretory IgA (SIgA) from milk contributes to early colonization and maintenance of commensal/symbiotic bacteria in the gut, as well as providing defence against pathogens. SIgA binds bacteria using specific antigenic sites or non-specifically via its glycans attached to α-heavy-chain and secretory component. In our study, we tested the hypothesis that human and bovine SIgA have similar innate-binding activity for bacteria. SIgAs, isolated from human and bovine milk, were incubated with a selection of commensal, pathogenic and probiotic bacteria. Using flow cytometry, we measured numbers of bacteria binding SIgA and their level of SIgA binding. The percentage of bacteria bound by human and bovine SIgA varied from 30 to 90% depending on bacterial species and strains, but was remarkably consistent between human and bovine SIgA. The level of SIgA binding per bacterial cell was lower for those bacteria that had a higher percentage of SIgA-bound bacteria, and higher for those bacteria that had lower percentage of SIgA-bound bacteria. Overall, human and bovine SIgA interacted with bacteria in a comparable way. This contributes to longer term research about the potential benefits of bovine SIgA for human consumers. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pathogenic and genetic diversity of Xanthomonas translucens pv. undulosa in North Dakota.
Adhikari, Tika B; Gurung, Suraj; Hansen, Jana M; Bonman, J Michael
2012-04-01
Bacterial leaf streak (BLS), caused by Xanthomonas translucens pv. undulosa, has become more prevalent recently in North Dakota and neighboring states. From five locations in North Dakota, 226 strains of X. translucens pv. undulosa were collected and evaluated for pathogenicity and then selected strains were inoculated on a set of 12 wheat cultivars and other cereal hosts. The genetic diversity of all strains was determined using repetitive sequence-based polymerase chain reaction (rep-PCR) and insertion sequence-based (IS)-PCR. Bacterial strains were pathogenic on wheat and barley but symptom severity was greatest on wheat. Strains varied greatly in aggressiveness, and wheat cultivars also showed differential responses to several strains. The 16S ribosomal DNA sequences of the strains were identical, and distinct from those of the other Xanthomonas pathovars. Combined rep-PCR and IS-PCR data produced 213 haplotypes. Similar haplotypes were detected in more than one location. Although diversity was greatest (≈92%) among individuals within a location, statistically significant (P ≤ 0.001 or 0.05) genetic differentiation among locations was estimated, indicating geographic differentiation between pathogen populations. The results of this study provide information on the pathogen diversity in North Dakota, which will be useful to better identify and characterize resistant germplasm.
Lazebnik, Jenny
2017-01-01
Currently, fungicides are necessary to protect potato crops against late blight, Phytophthora infestans, one of the world’s most damaging crop pathogens. The introgression of plant resistance genes from wild potato species targeted specifically to the late blight pathogen into
DEFF Research Database (Denmark)
Pedersen, Karl; Skall, Helle Frank; Lassen-Nielsen, Anne Marie
2009-01-01
A selection of 16 field isolates of Photobacterium damselae from marine rainbow trout farms in Denmark was subjected to phenotypic and genotypic characterization and pathogenicity to fish. All isolates belonged to the subspecies damselae, being positive for haemolysis, motility and urease...
Mucosal immunity to pathogenic intestinal bacteria.
Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela
2016-03-01
The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.
Priya, N Lakshmi; Krishnan, K Usha; Jayalakshmi, G; Vasanthi, S
2015-01-01
Occupational exposure poses a significant risk of transmission of blood-borne pathogens to healthcare workers (HCWs). Adherence to standard precautions, awareness about post exposure prophylaxis is poor in developing countries. This retrospective study analyzes the self-reported cases of occupational exposure in a tertiary care hospital. During the study period, 105 HCWs sustained occupational exposure to blood and body fluids. Majority of the victims 36 (34.2%) were interns and the clinical practice that led to the occupational exposure was withdrawal of blood (45.7%). Good infection control practices and emphasis on appropriate disposal are needed to increase the occupational safety for HCWs.
APIC position paper: Safe injection, infusion, and medication vial practices in health care.
Dolan, Susan A; Arias, Kathleen Meehan; Felizardo, Gwen; Barnes, Sue; Kraska, Susan; Patrick, Marcia; Bumsted, Amelia
2016-07-01
The transmission of bloodborne viruses and other microbial pathogens to patients during routine health care procedures continues to occur because of the use of improper injection, infusion, medication vial, and point-of-care testing practices by health care personnel. These unsafe practices occur in various clinical settings and result in unacceptable and devastating events for patients. This document updates the Association for Professionals in Infection Control and Epidemiology 2010 position paper on safe injection, infusion, and medication vial practices in health care. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Reincarnation of ancient links between coagulation and complement.
Conway, E M
2015-06-01
Throughout evolution, organisms have developed means to contain wounds by simultaneously limiting bleeding and eliminating pathogens and damaged host cells via the recruitment of innate defense mechanisms. Disease emerges when there is unchecked activation of innate immune and/or coagulation responses. A key component of innate immunity is the complement system. Concurrent excess activation of coagulation and complement - two major blood-borne proteolytic pathways - is evident in numerous diseases, including atherosclerosis, diabetes, venous thromboembolic disease, thrombotic microangiopathies, arthritis, cancer, and infectious diseases. Delineating the cross-talk between these two cascades will uncover novel therapeutic insights. © 2015 International Society on Thrombosis and Haemostasis.
An emerging cyberinfrastructure for biodefense pathogen and pathogen-host data.
Zhang, C; Crasta, O; Cammer, S; Will, R; Kenyon, R; Sullivan, D; Yu, Q; Sun, W; Jha, R; Liu, D; Xue, T; Zhang, Y; Moore, M; McGarvey, P; Huang, H; Chen, Y; Zhang, J; Mazumder, R; Wu, C; Sobral, B
2008-01-01
The NIAID-funded Biodefense Proteomics Resource Center (RC) provides storage, dissemination, visualization and analysis capabilities for the experimental data deposited by seven Proteomics Research Centers (PRCs). The data and its publication is to support researchers working to discover candidates for the next generation of vaccines, therapeutics and diagnostics against NIAID's Category A, B and C priority pathogens. The data includes transcriptional profiles, protein profiles, protein structural data and host-pathogen protein interactions, in the context of the pathogen life cycle in vivo and in vitro. The database has stored and supported host or pathogen data derived from Bacillus, Brucella, Cryptosporidium, Salmonella, SARS, Toxoplasma, Vibrio and Yersinia, human tissue libraries, and mouse macrophages. These publicly available data cover diverse data types such as mass spectrometry, yeast two-hybrid (Y2H), gene expression profiles, X-ray and NMR determined protein structures and protein expression clones. The growing database covers over 23 000 unique genes/proteins from different experiments and organisms. All of the genes/proteins are annotated and integrated across experiments using UniProt Knowledgebase (UniProtKB) accession numbers. The web-interface for the database enables searching, querying and downloading at the level of experiment, group and individual gene(s)/protein(s) via UniProtKB accession numbers or protein function keywords. The system is accessible at http://www.proteomicsresource.org/.
Wei, Shun-Guang; Yu, Yang; Felder, Robert B
2018-03-01
We previously reported that microinjection of the proinflammatory cytokine interleukin-1β (IL-1β) into the subfornical organ (SFO) elicits a pressor response accompanied by increases in inflammation and renin-angiotensin system (RAS) activity in the SFO and hypothalamic paraventricular nucleus (PVN). The present study sought to determine whether blood-borne IL-1β induces similar neurochemical changes in the SFO and PVN and, if so, whether increased inflammation and RAS activity at the SFO level orchestrate the sympathoexcitatory response to circulating IL-1β. In urethane-anesthetized male Sprague-Dawley rats, intravenous injection of IL-1β (500 ng) increased blood pressure, heart rate, renal sympathetic nerve activity, and mRNA for angiotensin-converting enzyme, angiotensin II type 1a receptor, cyclooxygenase-2, tumor necrosis factor-α, and IL-1β, as well as the tumor necrosis factor-α p55 receptor and the IL-1 receptor, in the SFO and PVN. Pretreatment with SFO microinjections of the angiotensin II type 1a receptor blocker losartan (1 µg), the angiotensin-converting enzyme inhibitor captopril (1 µg), or the cyclooxygenase-2 inhibitor NS-398 (2 µg) attenuated expression of these excitatory mediators in the SFO and downstream in the PVN and the IL-1β-induced pressor responses. An SFO lesion minimized the IL-1β-induced expression of inflammatory and RAS components as well as c-Fos, an indicator of neuronal excitation, in the PVN. These studies demonstrate that circulating IL-1β, which increases in cardiovascular disorders such as hypertension and heart failure, acts on the SFO to increase inflammation and RAS activity in the SFO and PVN and that intervening in these neurochemical processes in the SFO can significantly reduce the sympathetic response.
Highly pathogenic avian influenza.
Swayne, D E; Suarez, D L
2000-08-01
Highly pathogenic (HP) avian influenza (AI) (HPAI) is an extremely contagious, multi-organ systemic disease of poultry leading to high mortality, and caused by some H5 and H7 subtypes of type A influenza virus, family Orthomyxoviridae. However, most AI virus strains are mildly pathogenic (MP) and produce either subclinical infections or respiratory and/or reproductive diseases in a variety of domestic and wild bird species. Highly pathogenic avian influenza is a List A disease of the Office International des Epizooties, while MPAI is neither a List A nor List B disease. Eighteen outbreaks of HPAI have been documented since the identification of AI virus as the cause of fowl plague in 1955. Mildly pathogenic avian influenza viruses are maintained in wild aquatic bird reservoirs, occasionally crossing over to domestic poultry and causing outbreaks of mild disease. Highly pathogenic avian influenza viruses do not have a recognised wild bird reservoir, but can occasionally be isolated from wild birds during outbreaks in domestic poultry. Highly pathogenic avian influenza viruses have been documented to arise from MPAI viruses through mutations in the haemagglutinin surface protein. Prevention of exposure to the virus and eradication are the accepted methods for dealing with HPAI. Control programmes, which imply allowing a low incidence of infection, are not an acceptable method for managing HPAI, but have been used during some outbreaks of MPAI. The components of a strategy to deal with MPAI or HPAI include surveillance and diagnosis, biosecurity, education, quarantine and depopulation. Vaccination has been used in some control and eradication programmes for AI.
Breaking into the epithelial apical-junctional complex--news from pathogen hackers.
Vogelmann, Roger; Amieva, Manuel R; Falkow, Stanley; Nelson, W James
2004-02-01
The epithelial apical-junctional complex is a key regulator of cellular functions. In addition, it is an important target for microbial pathogens that manipulate the cell to survive, proliferate and sometimes persist within a host. Out of a myriad of potential molecular targets, some bacterial and viral pathogens have selected a subset of protein targets at the apical-junctional complex of epithelial cells. Studying how microbes use these targets also teaches us about the inherent physiological properties of host molecules in the context of normal junctional structure and function. Thus, we have learned that three recently uncovered components of the apical-junctional complex of the Ig superfamily--junctional adhesion molecule, Nectin and the coxsackievirus and adenovirus receptor--are important regulators of junction structure and function and represent critical targets of microbial virulence gene products.
Blood-borne HIV: Risks and Prevention | Ramlagan | SAHARA-J ...
African Journals Online (AJOL)
The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more information about how to print, save, and work with PDFs, Highwire Press provides a helpful Frequently Asked Questions about PDFs.
Directory of Open Access Journals (Sweden)
Marco Geria
2014-01-01
Full Text Available Thirty-five strains of lactic acid bacteria were isolated from artisanal raw milk cheese, presumptively identified and tested against one dairy Escherichia coli strain. Six lactobacilli, exhibiting antagonistic activity, were identified at the species level and their action was evaluated against four strains of Gram-foodborne pathogens (Escherichia coli O26, Escherichia coli O157:H7, Salmonella spp. 1023, and Salmonella Typhimurium and the control strain Escherichia coli ATCC 45922. The antagonistic activity was determined by spot method and the inhibition zones were measured by Autodesk AutoCAD 2007. Three strains, all Lactobacillus paracasei, were active against all the pathogens; the other strains, all Lactobacillus plantarum, showed antagonistic activity against some pathogens. This study highlights the intense and different antagonistic activity induced by lactobacilli against various foodborne pathogens thus demonstrating that using selected lactic acid bacteria strains as adjunct cultures could be an effective strategy to prevent the development of foodborne pathogens in artisanal raw milk cheeses, and thus improving their safety.
The Impact of Recombination Hotspots on Genome Evolution of a Fungal Plant Pathogen.
Croll, Daniel; Lendenmann, Mark H; Stewart, Ethan; McDonald, Bruce A
2015-11-01
Recombination has an impact on genome evolution by maintaining chromosomal integrity, affecting the efficacy of selection, and increasing genetic variability in populations. Recombination rates are a key determinant of the coevolutionary dynamics between hosts and their pathogens. Historic recombination events created devastating new pathogens, but the impact of ongoing recombination in sexual pathogens is poorly understood. Many fungal pathogens of plants undergo regular sexual cycles, and sex is considered to be a major factor contributing to virulence. We generated a recombination map at kilobase-scale resolution for the haploid plant pathogenic fungus Zymoseptoria tritici. To account for intraspecific variation in recombination rates, we constructed genetic maps from two independent crosses. We localized a total of 10,287 crossover events in 441 progeny and found that recombination rates were highly heterogeneous within and among chromosomes. Recombination rates on large chromosomes were inversely correlated with chromosome length. Short accessory chromosomes often lacked evidence for crossovers between parental chromosomes. Recombination was concentrated in narrow hotspots that were preferentially located close to telomeres. Hotspots were only partially conserved between the two crosses, suggesting that hotspots are short-lived and may vary according to genomic background. Genes located in hotspot regions were enriched in genes encoding secreted proteins. Population resequencing showed that chromosomal regions with high recombination rates were strongly correlated with regions of low linkage disequilibrium. Hence, genes in pathogen recombination hotspots are likely to evolve faster in natural populations and may represent a greater threat to the host. Copyright © 2015 by the Genetics Society of America.
Resistance to Root Galling Caused by the Powdery Scab Pathogen Spongospora subterranea in Potato
Potato selections (clones and commercial cultivars) were examined for resistance to root galling, caused by the powdery scab pathogen Spongospora subterranea in 7 field trials conducted between 2003 and 2007 in the states of Washington (WA) and Idaho (ID). In 2003, Shepody demonstrated the highest l...
Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen
International Nuclear Information System (INIS)
Chitra, K.; Annadurai, G.
2013-01-01
In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.
Interaction of pathogens with host cholesterol metabolism.
Sviridov, Dmitri; Bukrinsky, Michael
2014-10-01
Pathogens of different taxa, from prions to protozoa, target cellular cholesterol metabolism to advance their own development and to impair host immune responses, but also causing metabolic complications, for example, atherosclerosis. This review describes recent findings of how pathogens do it. A common theme in interaction between pathogens and host cholesterol metabolism is pathogens targeting lipid rafts of the host plasma membrane. Many intracellular pathogens use rafts as an entry gate, taking advantage of the endocytic machinery and high abundance of outward-looking molecules that can be used as receptors. At the same time, disruption of the rafts' functional capacity, achieved by the pathogens through a number of various means, impairs the ability of the host to generate immune response, thus helping pathogen to thrive. Pathogens cannot synthesize cholesterol, and salvaging host cholesterol helps pathogens build advanced cholesterol-containing membranes and assembly platforms. Impact on cholesterol metabolism is not limited to the infected cells; proteins and microRNAs secreted by infected cells affect lipid metabolism systemically. Given an essential role that host cholesterol metabolism plays in pathogen development, targeting this interaction may be a viable strategy to fight infections, as well as metabolic complications of the infections.
Khalaf, Eman M.; Raizada, Manish N.
2018-01-01
package microbes with significant disease-suppression potential. As seeds can act as vectors for genetic transmission of endophytes across host generations, it is interesting to hypothesize whether humans, when selecting seeds of healthy hosts, may have inadvertently selected for disease-suppressing seed endophytes. As the majority of pathogen-suppressing endophytes belong to Bacillus and Paenibacillus, and since Bacilli are widely used as commercial biocontrol agents of vegetables, we propose that these agents are mimicking the ecological niche established by their endophytic cousins. PMID:29459850
Directory of Open Access Journals (Sweden)
Eman M. Khalaf
2018-02-01
cucurbits package microbes with significant disease-suppression potential. As seeds can act as vectors for genetic transmission of endophytes across host generations, it is interesting to hypothesize whether humans, when selecting seeds of healthy hosts, may have inadvertently selected for disease-suppressing seed endophytes. As the majority of pathogen-suppressing endophytes belong to Bacillus and Paenibacillus, and since Bacilli are widely used as commercial biocontrol agents of vegetables, we propose that these agents are mimicking the ecological niche established by their endophytic cousins.
Directory of Open Access Journals (Sweden)
Eman M. Khalaf
2018-02-01
cucurbits package microbes with significant disease-suppression potential. As seeds can act as vectors for genetic transmission of endophytes across host generations, it is interesting to hypothesize whether humans, when selecting seeds of healthy hosts, may have inadvertently selected for disease-suppressing seed endophytes. As the majority of pathogen-suppressing endophytes belong to Bacillus and Paenibacillus, and since Bacilli are widely used as commercial biocontrol agents of vegetables, we propose that these agents are mimicking the ecological niche established by their endophytic cousins.
Flores-Ponce, Mitzi; Vallebueno-Estrada, Miguel; González-Orozco, Eduardo; Ramos-Aboites, Hilda E; García-Chávez, J Noé; Simões, Nelson; Montiel, Rafael
2017-04-26
The entomopathogenic nematode Steinernema carpocapsae has been used worldwide as a biocontrol agent for insect pests, making it an interesting model for understanding parasite-host interactions. Two models propose that these interactions are co-evolutionary processes in such a way that equilibrium is never reached. In one model, known as "arms race", new alleles in relevant genes are fixed in both host and pathogens by directional positive selection, producing recurrent and alternating selective sweeps. In the other model, known as"trench warfare", persistent dynamic fluctuations in allele frequencies are sustained by balancing selection. There are some examples of genes evolving according to both models, however, it is not clear to what extent these interactions might alter genome-level evolutionary patterns and intraspecific diversity. Here we investigate some of these aspects by studying genomic variation in S. carpocapsae and other pathogenic and free-living nematodes from phylogenetic clades IV and V. To look for signatures of an arms-race dynamic, we conducted massive scans to detect directional positive selection in interspecific data. In free-living nematodes, we detected a significantly higher proportion of genes with sites under positive selection than in parasitic nematodes. However, in these genes, we found more enriched Gene Ontology terms in parasites. To detect possible effects of dynamic polymorphisms interactions we looked for signatures of balancing selection in intraspecific genomic data. The observed distribution of Tajima's D values in S. carpocapsae was more skewed to positive values and significantly different from the observed distribution in the free-living Caenorhabditis briggsae. Also, the proportion of significant positive values of Tajima's D was elevated in genes that were differentially expressed after induction with insect tissues as compared to both non-differentially expressed genes and the global scan. Our study provides a first
Microbial pathogens in source and treated waters from drinking water treatment plants in the US
An occurrence survey was conducted on selected pathogens in source and treated drinking water collected from 25 drinking water treatment plants (DWTPs) in the United States. Water samples were analyzed for the protozoa Giardia and Cryptosporidium (EPA Method 1623); the fungi Asp...
Tropism and pathogenicity of rickettsiae
Directory of Open Access Journals (Sweden)
Tsuneo eUchiyama
2012-06-01
Full Text Available Rickettsiae are obligate intracellular parasitic bacteria that cause febrile exanthematous illnesses such as Rocky Mountain spotted fever, Mediterranean spotted fever, epidemic and murine typhus, etc. Although the vector ranges of each Rickettsia species are rather restricted; i.e., ticks belonging to Arachnida and lice and fleas belonging to Insecta usually act as vectors for spotted fever group and typhus group rickettsiae, respectively, it would be interesting to elucidate the mechanisms controlling the vector tropism of rickettsiae. This review discusses the factors determining the vector tropism of rickettsiae. In brief, the vector tropism of rickettsiae species is basically consistent with their tropism towards cultured tick and insect cells. The mechanisms responsible for rickettsiae pathogenicity are also described. Recently, genomic analyses of rickettsiae have revealed that they possess several genes that are homologous to those affecting the pathogenicity of other bacteria. Analyses comparing the genomes of pathogenic and nonpathogenic strains of rickettsiae have detected many factors that are related to rickettsial pathogenicity. It is also known that a reduction in the rickettsial genome has occurred during the course of its evolution. Interestingly, Rickettsia species with small genomes, such as Rickettsia prowazekii, are more pathogenic to humans than those with larger genomes. This review also examines the growth kinetics of pathogenic and nonpathogenic species of spotted fever group rickettsiae in mammalian cells. The growth of nonpathogenic species is restricted in these cells, which is mediated, at least in part, by autophagy. The superinfection of nonpathogenic rickettsiae-infected cells with pathogenic rickettsiae results in an elevated yield of the nonpathogenic rickettsiae and the growth of the pathogenic rickettsiae. Autophagy is restricted in these cells. These results are discussed in this review.
Lee, G. M.; McGee, P. A.; Oldroyd, B. P.
2013-03-01
The queens of many eusocial insect species are polyandrous. The evolution of polyandry from ancestral monoandry is intriguing because polyandry undermines the kin-selected benefits of high intracolonial relatedness that are understood to have been central to the evolution of eusociality. An accumulating body of evidence suggests that polyandry evolved from monoandry in part because genetically diverse colonies better resist infection by pathogens. However, a core assumption of the "parasite-pathogen hypothesis", that there is variation in virulence among strains of pathogens, remains largely untested in vivo. Here, we demonstrate variation in virulence among isolates of Ascosphaera apis, the causative organism of chalkbrood disease in its honey bee ( Apis mellifera) host. More importantly, we show a pathogen-host genotypic interaction for resistance and pathogenicity. Our findings therefore support the parasite-parasite hypothesis as a factor in the evolution of polyandry among eusocial insects.
Proximal Sensing of Plant-Pathogen Interactions in Spring Barley with Three Fluorescence Techniques
Directory of Open Access Journals (Sweden)
Georg Leufen
2014-06-01
Full Text Available In the last years fluorescence spectroscopy has come to be viewed as an essential approach in key research fields of applied plant sciences. However, the quantity and particularly the quality of information produced by different equipment might vary considerably. In this study we investigate the potential of three optical devices for the proximal sensing of plant-pathogen interactions in four genotypes of spring barley. For this purpose, the fluorescence lifetime, the image-resolved multispectral fluorescence and selected indices of a portable multiparametric fluorescence device were recorded at 3, 6, and 9 days after inoculation (dai from healthy leaves as well as from leaves inoculated with powdery mildew (Blumeria graminis or leaf rust (Puccinia hordei. Genotype-specific responses to pathogen infections were revealed already at 3 dai by higher fluorescence mean lifetimes in the spectral range from 410 to 560 nm in the less susceptible varieties. Noticeable pathogen-induced modifications were also revealed by the ‘Blue-to-Far-Red Fluorescence Ratio’ and the ‘Simple Fluorescence Ratio’. Particularly in the susceptible varieties the differences became more evident in the time-course of the experiment i.e., following the pathogen development. The relevance of the blue and green fluorescence to exploit the plant-pathogen interaction was demonstrated by the multispectral fluorescence imaging system. As shown, mildewed leaves were characterized by exceptionally high blue fluorescence, contrasting the values observed in rust inoculated leaves. Further, we confirm that the intensity of green fluorescence depends on the pathogen infection and the stage of disease development; this information might allow a differentiation of both diseases. Moreover, our results demonstrate that the detection area might influence the quality of the information, although it had a minor impact only in the current study. Finally, we highlight the relevance of
Whole genome sequencing revealed host adaptation-focused genomic plasticity of pathogenic Leptospira
Xu, Yinghua; Zhu, Yongzhang; Wang, Yuezhu; Chang, Yung-Fu; Zhang, Ying; Jiang, Xiugao; Zhuang, Xuran; Zhu, Yongqiang; Zhang, Jinlong; Zeng, Lingbing; Yang, Minjun; Li, Shijun; Wang, Shengyue; Ye, Qiang; Xin, Xiaofang; Zhao, Guoping; Zheng, Huajun; Guo, Xiaokui; Wang, Junzhi
2016-01-01
Leptospirosis, caused by pathogenic Leptospira spp., has recently been recognized as an emerging infectious disease worldwide. Despite its severity and global importance, knowledge about the molecular pathogenesis and virulence evolution of Leptospira spp. remains limited. Here we sequenced and analyzed 102 isolates representing global sources. A high genomic variability were observed among different Leptospira species, which was attributed to massive gene gain and loss events allowing for adaptation to specific niche conditions and changing host environments. Horizontal gene transfer and gene duplication allowed the stepwise acquisition of virulence factors in pathogenic Leptospira evolved from a recent common ancestor. More importantly, the abundant expansion of specific virulence-related protein families, such as metalloproteases-associated paralogs, were exclusively identified in pathogenic species, reflecting the importance of these protein families in the pathogenesis of leptospirosis. Our observations also indicated that positive selection played a crucial role on this bacteria adaptation to hosts. These novel findings may lead to greater understanding of the global diversity and virulence evolution of Leptospira spp. PMID:26833181
Pathogen recognition in the innate immune response.
Kumar, Himanshu; Kawai, Taro; Akira, Shizuo
2009-04-28
Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.
Directory of Open Access Journals (Sweden)
Hart C Anthony
2009-06-01
Full Text Available Abstract Background Persistent diarrhoea in children is a common problem in low and middle income countries. To help target appropriate treatment for specific pathogens in the absence of diagnostic tests, we systematically reviewed pathogens most commonly associated with persistent diarrhoea in children. Methods We sought all descriptive studies of pathogens in the stool of children with diarrhoea of over 14 days duration in low and middle income countries with a comprehensive search of the MEDLINE, EMBASE, LILACS and WEB OF SCIENCE databases. We described the study designs and populations, assessed the quality of the laboratory tests, and extracted and summarised data on pathogens. For Escherichia coli, we calculated high and low prevalence estimates of all enteropathic types combined. Results across studies were compared for geographical patterns. Results Nineteen studies were included. Some used episodes of diarrhoea as the unit of analysis, others used children. The quality of reporting of laboratory procedures varied, and pathogens (particularly E. coli types were classified in different ways. As there were no apparent regional differences in pathogen prevalence, we aggregated data between studies to give a guide to overall prevalence. Enteropathic E. coli types were commonly found in children with persistent diarrhoea (up to 63%. Various other organisms, including viruses, bacteria and parasites, were detected but across all studies their prevalence was under 10%. However, these pathogens were also found in similar frequencies in children without diarrhoea. Conclusion A number of pathogens are commonly associated with persistent diarrhoea in children, but in children without diarrhoea the pathogens are found with similar frequencies. New research with carefully selected controls and standardised laboratory investigations across countries will help map causes and help explore effective options for presumptive treatment.
Sidhu, J P S; Toze, S; Hodgers, L; Barry, K; Page, D; Li, Y; Dillon, P
2015-09-01
Recycling of stormwater water and treated effluent via managed aquifer recharge (MAR) has often been hampered because of perceptions of low microbiological quality of recovered water and associated health risks. The goal of this study was to assess the removal of selected pathogens in four large-scale MAR schemes and to determine the influence of aquifer characteristics, geochemistry, and type of recharge water on the pathogen survival times. Bacterial pathogens tested in this study had the shortest one log removal time (, 200 d). Human adenovirus and rotavirus were relatively persistent under anaerobic conditions (, >200 d). Human adenovirus survived longer than all the other enteric virus tested in the study and hence could be used as a conservative indicator for virus removal in groundwater during MAR. The results suggest that site-specific subsurface conditions such as groundwater chemistry can have considerable influence on the decay rates of enteric pathogens and that viruses are likely to be the critical pathogens from a public health perspective. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.
Natural soil reservoirs for human pathogenic and fecal indicator bacteria
Boschiroli, Maria L; Falkinham, Joseph; Favre-Bonte, Sabine; Nazaret, Sylvie; Piveteau, Pascal; Sadowsky, Michael J.; Byappanahalli, Muruleedhara; Delaquis, Pascal; Hartmann, Alain
2016-01-01
Soils receive inputs of human pathogenic and indicator bacteria through land application of animal manures or sewage sludge, and inputs by wildlife. Soil is an extremely heterogeneous substrate and contains meso- and macrofauna that may be reservoirs for bacteria of human health concern. The ability to detect and quantify bacteria of human health concern is important in risk assessments and in evaluating the efficacy of agricultural soil management practices that are protective of crop quality and protective of adjacent water resources. The present chapter describes the distribution of selected Gram-positive and Gram-negative bacteria in soils. Methods for detecting and quantifying soilborne bacteria including extraction, enrichment using immunomagnetic capture, culturing, molecular detection and deep sequencing of metagenomic DNA to detect pathogens are overviewed. Methods for strain phenotypic and genotypic characterization are presented, as well as how comparison with clinical isolates can inform the potential for human health risk.
Selection of Surrogate Bacteria for Use in Food Safety Challenge Studies: A Review.
Hu, Mengyi; Gurtler, Joshua B
2017-09-01
Nonpathogenic surrogate bacteria are prevalently used in a variety of food challenge studies in place of foodborne pathogens such as Listeria monocytogenes, Salmonella, Escherichia coli O157:H7, and Clostridium botulinum because of safety and sanitary concerns. Surrogate bacteria should have growth characteristics and/or inactivation kinetics similar to those of target pathogens under given conditions in challenge studies. It is of great importance to carefully select and validate potential surrogate bacteria when verifying microbial inactivation processes. A validated surrogate responds similar to the targeted pathogen when tested for inactivation kinetics, growth parameters, or survivability under given conditions in agreement with appropriate statistical analyses. However, a considerable number of food studies involving putative surrogate bacteria lack convincing validation sources or adequate validation processes. Most of the validation information for surrogates in these studies is anecdotal and has been collected from previous publications but may not be sufficient for given conditions in the study at hand. This review is limited to an overview of select studies and discussion of the general criteria and approaches for selecting potential surrogate bacteria under given conditions. The review also includes a list of documented bacterial pathogen surrogates and their corresponding food products and treatments to provide guidance for future studies.
2.1 Natural History of Highly Pathogenic Avian Influenza H5N1
Sonnberg, Stephanie; Webby, Richard J.; Webster, Robert G.
2013-01-01
The ecology of highly pathogenic avian influenza (HPAI) H5N1 has significantly changed from sporadic outbreaks in terrestrial poultry to persistent circulation in terrestrial and aquatic poultry and potentially in wild waterfowl. A novel genotype of HPAI H5N1 arose in 1996 in southern China and through ongoing mutation, reassortment, and natural selection, has diverged into distinct lineages and expanded into multiple reservoir hosts. The evolution of Goose/Guangdong-lineage highly pathogenic H5N1 viruses is ongoing: while stable interactions exist with some reservoir hosts, these viruses are continuing to evolve and adapt to others, and pose an un-calculable risk to sporadic hosts, including humans. PMID:23735535
Sienkiewicz, Monika; Łysakowska, Monika; Kowalczyk, Edward; Szymańska, Grażyna; Kochan, Ewa; Krukowska, Jolanta; Olszewski, Jurek; Zielińska-Bliźniewska, Hanna
2017-03-01
The aim of this work was to characterize the ability of essential oils to support antibiotics against pathogenic bacteria in wounds. Gram-positive and Gram-negative bacteria obtained from wound infections were identified according to standard microbiological methods. Essential oils were analysed by GC-FID-MS. The susceptibility of bacteria to antibiotics, essential oils and their combination was assessed using the disc-diffusion method. The Minimal Inhibitory Concentration and Minimum Bactericidal Concentration of the essential oils were established by the micro-dilution broth method. Although cinnamon, clove, thyme and lavender essential oils were found to have the greatest antibacterial activity when used alone, the greatest additive and synergistic effects against pathogenic wound bacteria in combination with recommended antibiotics were demonstrated by basil, clary sage and rosemary oils. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.
Arthropods vector grapevine trunk disease pathogens.
Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F
2014-10-01
Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.
Pathogens' toolbox to manipulate human complement.
Fernández, Francisco J; Gómez, Sara; Vega, M Cristina
2017-12-14
The surveillance and pathogen fighting functions of the complement system have evolved to protect mammals from life-threatening infections. In turn, pathogens have developed complex molecular mechanisms to subvert, divert and evade the effector functions of the complement. The study of complement immunoevasion by pathogens sheds light on their infection drivers, knowledge that is essential to implement therapies. At the same time, complement evasion also acts as a discovery ground that reveals important aspects of how complement works under physiological conditions. In recent years, complex interrelationships between infection insults and the onset of autoimmune and complement dysregulation diseases have led to propose that encounters with pathogens can act as triggering factors for disease. The correct management of these diseases involves the recognition of their triggering factors and the development and administration of complement-associated molecular therapies. Even more recently, unsuspected proteins from pathogens have been shown to possess moonlighting functions as virulence factors, raising the possibility that behind the first line of virulence factors there be many more pathogen proteins playing secondary, helping and supporting roles for the pathogen to successfully establish infections. In an era where antibiotics have a progressively reduced effect on the management and control of infectious diseases worldwide, knowledge on the mechanisms of pathogenic invasion and evasion look more necessary and pressing than ever. Copyright © 2017 Elsevier Ltd. All rights reserved.
[Modes of action of agrochemicals against plant pathogenic organisms].
Leroux, Pierre
2003-01-01
The chemical control of plant pathogens concerns mainly fungal diseases of crops. Most of the available fungicides act directly on essential fungal functions such as respiration, sterol biosynthesis or cell division. Consequently, these compounds can exhibit undesirable toxicological and environmental effects and sometimes select fungal resistant strains. Plant activators are expected to provide sustainable disease management in several crops because the development of resistance is not expected. Considering the future, the discovery of novel antifungal molecules will reap advantage from throughput screening methodologies and functional genomics.
Population Genetics and Natural Selection in Rheumatic Disease.
Ramos, Paula S
2017-08-01
Human genetic diversity is the result of population genetic forces. This genetic variation influences disease risk and contributes to health disparities. Natural selection is an important influence on human genetic variation. Because immune and inflammatory function genes are enriched for signals of positive selection, the prevalence of rheumatic disease-risk alleles seen in different populations is partially the result of differing selective pressures (eg, due to pathogens). This review summarizes the genetic regions associated with susceptibility to different rheumatic diseases and concomitant evidence for natural selection, including known agents of selection exerting selective pressure in these regions. Copyright © 2017 Elsevier Inc. All rights reserved.
Molecular marker-assisted selection for resistance to pathogens in tomato
International Nuclear Information System (INIS)
Barone, A.; Frusciante, L.
2007-01-01
Since the 1980s, the use of molecular markers has been suggested to improve the efficiency of releasing resistant varieties, thus overcoming difficulties met with classical breeding. For tomato, a high-density molecular map is available in which more than 40 resistance genes are localized. Markers linked to these genes can be used to speed up gene transfer and pyramiding. Suitable PCR markers targeting resistance genes were constructed directly on the sequences of resistance genes or on restriction fragment length polymorphisms (RFLPs) tightly linked to them, and used to select resistant genotypes in backcross schemes. In some cases, the BC 5 generation was reached, and genotypes that cumulated two homozygous resistant genes were also obtained. These results supported the feasibility of using marker-assisted selection (MAS) in tomato and reinforcing the potential of this approach for other genes, which is today also driven by the development of new techniques and increasing knowledge about the tomato genome. (author)
Directory of Open Access Journals (Sweden)
Mohd. Sayeed Akthar
2014-09-01
Full Text Available Objective: To investigate the antimicrobial activity of leaf extract of Piper nigrum (P. nigrum and Cassia didymobotyra (C. didymobotyra (aqueous, methanol, ethanol and petroleum ether against the food borne pathogenic bacteria [Staphylococcus aureus (S. aureus, Escherichia coli (E. coli, Salmonella typhimurium and Pseudomonas aeruginosa] and fungi [Aspergillus spp. and Candida albicans (C. albicans] and also to investigate the presence of various phytochemicals in the leaf extracts of tested plants. Methods: The antimicrobial activity was determined by disc diffusion method. Minimum inhibitory concentration (MIC, minimum bactericidal and fungicidal concentration were determined by serial dilution method. Results: Methanol leaf extract of test plants exhibited greater antimicrobial activity against the selected bacterial and fungal strains. The MIC results showed that ethanol, methanol and petroleum ether leaf extract of P. nigrum inhibited the growth of S. aureus and E. coli at concentration of 12.5 mg/mL. While, ethanol and methanol leaf extracts of C. didymobotyra inhibited the growth of S. aureus at concentration of 6.25 mg/mL. The MIC values for ethanol, methanol and petroleum ether leaf extract of P. nigrum inhibited the growth of C. albicans at concentration of 25.0 mg/mL. While, it was reported that at concentration of 12.5 mg/mL methanol leaf extract of P. nigrum was against the Aspergillus spp. The MIC values of methanol leaf extract of C. didymobotyra inhibited the growth of C. albicans and Aspergillus spp. at concentration of 12.5 mg/mL and 6.25 mg/mL, respectively. The minimum bactericidal concentration of ethanol, methanol leaf extract of P. nigrum for E. coli and ethanol, methanol leaf extract of C. didymobotyra for S. aureus was recorded at concentration 12.5 mg/mL. The minimum fungicidal concentration of ethanol and methanol leaf extract of P. nigrum and C. didymobotyra on C. albicans was recorded at concentration of 25.0 mg
Effectiveness of irradiation in killing pathogens
International Nuclear Information System (INIS)
Yeager, J.G.; Ward, R.L.
1980-01-01
United States Environmental Protection Agency regulations include gamma ray irradiation of sludge as an approved Process to Further Reduce Pathogens (PFRP) prior to land application. Research at Sandia National Laboratories on pathogen inactivation in sludge by gamma irradiation has demonstrated that the 1 Mrad PFRP dose is capable, by itself, of eliminating bacterial, fungal, and parasitic pathogens from sludge. Gamma irradiation of sludge in conjunction with the required Processes to Significantly Reduce Pathogens (PSRP) should also eliminate the viral hazard from wastewater sludges
Schade, Franziska M; Shama, Lisa N S; Wegner, K Mathias
2014-07-26
for some families at elevated temperatures showed that there is evolutionary potential for resistance to Vibrio sp. in both thermal environments. The negative genetic correlation of pathogen resistance between thermal environments, on the other hand, indicates that adaptation to current conditions can be a weak predictor for performance in changing environments. The observed feedback on selective gradients exerted on life history traits may exacerbate this effect, as it can also modify the response to selection for other vital components of fitness.
Energy Technology Data Exchange (ETDEWEB)
Krishnan, A
2006-08-30
The threats of bio-terrorism and newly emerging infectious diseases pose serious challenges to the national security infrastructure. Rapid detection and diagnosis of infectious disease in human populations, as well as characterizing pathogen biology, are critical for reducing the morbidity and mortality associated with such threats. One of the key challenges in managing an infectious disease outbreak, whether through natural causes or acts of overt terrorism, is detection early enough to initiate effective countermeasures. Much recent attention has been directed towards the utility of biomarkers or molecular signatures that result from the interaction of the pathogen with the host for improving our ability to diagnose and mitigate the impact of a developing infection during the time window when effective countermeasures can be instituted. Host responses may provide early signals in blood even from localized infections. Multiple innate and adaptive immune molecules, in combination with other biochemical markers, may provide disease-specific information and new targets for countermeasures. The presence of pathogen specific markers and an understanding of the molecular capabilities and adaptations of the pathogen when it interacts with its host may likewise assist in early detection and provide opportunities for targeting countermeasures. An important question that needs to be addressed is whether these molecular-based approaches will prove useful for early diagnosis, complement current methods of direct agent detection, and aid development and use of countermeasures. Lawrence Livermore National Laboratory (LLNL) will host a workshop to explore the utility of host- and pathogen-based molecular diagnostics, prioritize key research issues, and determine the critical steps needed to transition host-pathogen research to tools that can be applied towards a more effective national bio-defense strategy. The workshop will bring together leading researchers/scientists in the
Pathogenic mycoflora on carrot seeds
Directory of Open Access Journals (Sweden)
Bogdan Nowicki
2013-12-01
Full Text Available Altogether 300 seed samples were collected during 9 years in 8 regions of Poland and the fungi Were isolated and their pathogenicity to carrot seedlings was examined. Alternaria rudicina provcd to be the most important pathogen although. A. alternata was more common. The other important pathogens were Fusarium spp., Phoma spp. and Botrytis cinerea. The infection of carrot seeds by A. radicina should be used as an important criterium in seed quality evaluation.
Selection of antibiotic resistance at very low antibiotic concentrations
Sandegren, Linus
2014-01-01
Human use of antibiotics has driven the selective enrichment of pathogenic bacteria resistant to clinically used drugs. Traditionally, the selection of resistance has been considered to occur mainly at high, therapeutic levels of antibiotics, but we are now beginning to understand better the importance of selection of resistance at low levels of antibiotics. The concentration of an antibiotic varies in different body compartments during treatment, and low concentrations of antibiotics are fou...
Pathogenicity of Aspergillus westerdijkiae to females and oothecae of Periplaneta Americana
Directory of Open Access Journals (Sweden)
Mariah Valente Baggio
2016-01-01
Full Text Available ABSTRACT: Cockroach control is performed by the application of chemical insecticides which exert high selective pressure on populations and introduces synthetic substances in the environment, motivating the search for other methods of control such as entomopathogenic fungi. The objectives of this study were to investigate the pathogenicity of the JAB 42 Aspergillus westerdijkiae to females and oothecae of Periplaneta americana and to demonstrate its mechanism of action on oothecae. Suspensions containing 106 to 108 conidia/ml were used to infect females and oothecae. Mortality and other variables such as scanning electron microscopy were used to demonstrate the mechanism of action of the fungus. The isolated JAB 42 A. westerdijkiae is pathogenic to oothecae of P. americana, with low capacity to kill females. Adhesion, germination, penetration and extrusion of the fungus on the cockroach oothecae were observed.
Antiviral therapy: a perspective
Directory of Open Access Journals (Sweden)
Shahidi Bonjar AH
2016-02-01
Full Text Available Amir Hashem Shahidi Bonjar Clinician Scientist, Institute of Applied Research in Dentistry, Kerman University of Medical Sciences, Kerman, Iran Abstract: This paper discusses extracorporeal removal of viral particles and their antigens from the blood as an auxiliary therapy. This hypothesis has not been reported before. In some chronic blood-borne viral infections, the virus remains systemic and persistent for extended periods of time, with adverse effects that weaken the immune system. Blood titers of virus and its toxins are proportional to the severity of the disease, and their reduction can alleviate symptoms, leading to improved health. Several blood-borne viral infections can be overcome by the young, but are life-threatening in the elderly. It is known that some older people have extreme difficulty tolerating viral infections such as influenza and the common cold. Further, several types of viral infection persist throughout the life of the individual and cannot be eliminated by conventional treatments. Well-known infections of this type include HIV and hepatitis B. In the case of Ebola virus, patients remain infectious as long as their blood contains the virus. According to the present hypothesis, an extracorporeal viral antibody column (EVAC is proposed for elimination or reduction of the blood viral titer when treating blood-borne viral infection. EVAC would selectively trap viral antigens and toxins in the blood into an extracorporeal circuit, while returning detoxified blood back to the patient’s body. It is anticipated that EVAC would reduce mortality caused by blood-borne viral infections in the elderly since reduction of blood virus titers would improve health, leading to improved overall patient performance. Such enhancement would also make conventional therapies even more effective. EVAC could have a lifesaving role in treatment of viral illness, especially those involving lethal viruses such as Ebola, where the patient
Biosensors for plant pathogen detection.
Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben
2017-07-15
Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.
Waterborne Pathogens: Detection Methods and Challenges
Directory of Open Access Journals (Sweden)
Flor Yazmín Ramírez-Castillo
2015-05-01
Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.
Algae as reservoirs for coral pathogens.
Directory of Open Access Journals (Sweden)
Michael J Sweet
Full Text Available Benthic algae are associated with coral death in the form of stress and disease. It's been proposed that they release exudates, which facilitate invasion of potentially pathogenic microbes at the coral-algal interface, resulting in coral disease. However, the original source of these pathogens remains unknown. This study examined the ability of benthic algae to act as reservoirs of coral pathogens by characterizing surface associated microbes associated with major Caribbean and Indo-Pacific algal species/types and by comparing them to potential pathogens of two dominant coral diseases: White Syndrome (WS in the Indo-Pacific and Yellow Band Disease (YBD in the Caribbean. Coral and algal sampling was conducted simultaneously at the same sites to avoid spatial effects. Potential pathogens were defined as those absent or rare in healthy corals, increasing in abundance in healthy tissues adjacent to a disease lesion, and dominant in disease lesions. Potentially pathogenic bacteria were detected in both WS and YBD and were also present within the majority of algal species/types (54 and 100% for WS and YBD respectively. Pathogenic ciliates were associated only with WS and not YBD lesions and these were also present in 36% of the Indo-Pacific algal species. Although potential pathogens were associated with many algal species, their presence was inconsistent among replicate algal samples and detection rates were relatively low, suggestive of low density and occurrence. At the community level, coral-associated microbes irrespective of the health of their host differed from algal-associated microbes, supporting that algae and corals have distinctive microbial communities associated with their tissue. We conclude that benthic algae are common reservoirs for a variety of different potential coral pathogens. However, algal-associated microbes alone are unlikely to cause coral death. Initial damage or stress to the coral via other competitive mechanisms is
Directory of Open Access Journals (Sweden)
Muhammad H. Rasool
2016-03-01
Full Text Available Objective: To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. Methods: This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural characteristics, microscopy, and biochemical tests. Disc diffusion assay was carried out using Muller Hinton agar medium, and minimum inhibitory concentration was determined using broth dilution method against isolated pathogens. Results: One hundred and forty-one (100% samples were positive for some bacteria. Frequency of occurrence was Bacillus cereus (B. cereus (66%, Escherichia coli (E. coli (48.5%, Salmonella typhi (S. Typhi (27.7%, Pseudomonas aeruginosa (P. aeruginosa (8.5%, and Staphylococcus aureus (S. aureus (4.3%. Single pathogen was detected in 20 (14.2% samples whereas combinations were found in 121 (85.8% samples. Bacillus cereus and E. coli were the most frequently detected pathogens followed by the S. Typhi, P. aeruginosa, and Staph. aureus. The percentage occurrence of isolated pathogens was 31% in B. cereus, 31% in E. coli, 18% in S. Typhi, 5% in P. aeruginosa, and 3% in Staph. aureus. Conclusion: Pseudomonas aeruginosa showed resistance against Amoxicillin and Cefotaxime, whereas S. aureus was found resistant against Cefotaxime. Statistical analysis using one way Analysis of Variance revealed that Ofloxacin and Gentamicin had significant (p<0.05 differences against all isolates as compared with other antibiotics used in this study.
Rasool, Muhammad H; Siddique, Abu B; Saqalein, Muhammad; Asghar, Muhammad J; Zahoor, Muhammad A; Aslam, Bilal; Shafiq, Humerah B; Nisar, Muhammad A
2016-03-01
To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural characteristics, microscopy, and biochemical tests. Disc diffusion assay was carried out using Muller Hinton agar medium, and minimum inhibitory concentration was determined using broth dilution method against isolated pathogens. One hundred and forty-one (100%) samples were positive for some bacteria. Frequency of occurrence was Bacillus cereus (B. cereus) (66%), Escherichia coli (E.coli) (48.5%), Salmonella typhi (S. Typhi) (27.7%), Pseudomonas aeruginosa (P. aeruginosa) (8.5%), and Staphylococcus aureus (S. aureus) (4.3%). Single pathogen was detected in 20 (14.2%) samples whereas combinations were found in 121 (85.8%) samples. Bacillus cereus and E.coli were the most frequently detected pathogens followed by the S. Typhi, P. aeruginosa, and Staph. aureus. The percentage occurrence of isolated pathogens was 31% in B. cereus, 31% in E. coli, 18% in S. Typhi, 5% in P. aeruginosa, and 3% in Staph. aureus. Pseudomonas aeruginosa showed resistance against Amoxicillin and Cefotaxime, whereas S. aureus was found resistant against Cefotaxime. Statistical analysis using one way Analysis of Variance revealed that Ofloxacin and Gentamicin had significant (p less than 0.05) differences against all isolates as compared with other antibiotics used in this study.
Salvo, Vanessa-Sarah; Fabiano, Mauro
2007-05-01
Sediments of five Ligurian beaches in compliance with European Union bathing water regulations were studied based on the characteristics of the fungal assemblage during the tourism season. Among the 179 taxa of filamentous fungi isolated, 120 were opportunistic pathogens, such as Acremonium sp., and the genus Penicillium was also present as the pathogenic species P. citrinum. Furthermore, 5% of the total filamentous fungi belonged to the dermatophyte genus Microsporum, whose species can cause mycoses. Beach sediments showed elevated densities of opportunistic pathogens, of pathogenic filamentous fungi, and of yeasts during the tourism season. Although monitoring of beach sediments for microbiological contamination is not mandatory, and disease transmission from sediments has not yet been demonstrated, our study suggests that beach sediments may act as a reservoir of potential pathogens, including fungi. In addition, the mycoflora displayed high sensitivity to critical environmental situations in the beaches studied. Therefore, the fungal community can be a useful tool for assessing the quality of sandy beaches in terms of sanitary and environmental quality.
Vincent, A; Cohen, M; Bernet, C; Parneix, P; L'Hériteau, F; Branger, B; Talon, D; Hommel, C; Abiteboul, D; Coignard, B
2006-05-01
Midwives appear to be the health care workers exposed to the highest rates of bloodborne injury. In this paper - based on a national survey - we describe the bloodborne injuries occurring in this profession. During the year 2003, 241 hospitals took part in a national survey of bloodborne injuries. Employees registered anonymous standardized reports of bloodborne events with the Occupational Medicine Unit. The data were processed by the coordination center for the fight against nosocomial infections (C. CLIN) which is in charge of the national analysis of all the events reported in this database. 169 of the 6973 bloodborne events reported during 2003 (2.4%), were signed by midwives or midwife students. The first three most frequent accidents reported were: ocular projections during childbirth, pricks when repairing episiotomy, pricks or cuts when handling soiled instruments. Improving knowledge of risk as well as promotion of protection/prevention measures well adapted to this profession should be helpful in optimizing future attitudes.
Sexual Reproduction of Human Fungal Pathogens
Heitman, Joseph; Carter, Dee A.; Dyer, Paul S.; Soll, David R.
2014-01-01
We review here recent advances in our understanding of sexual reproduction in fungal pathogens that commonly infect humans, including Candida albicans, Cryptococcus neoformans/gattii, and Aspergillus fumigatus. Where appropriate or relevant, we introduce findings on other species associated with human infections. In particular, we focus on rapid advances involving genetic, genomic, and population genetic approaches that have reshaped our view of how fungal pathogens evolve. Rather than being asexual, mitotic, and largely clonal, as was thought to be prevalent as recently as a decade ago, we now appreciate that the vast majority of pathogenic fungi have retained extant sexual, or parasexual, cycles. In some examples, sexual and parasexual unions of pathogenic fungi involve closely related individuals, generating diversity in the population but with more restricted recombination than expected from fertile, sexual, outcrossing and recombining populations. In other cases, species and isolates participate in global outcrossing populations with the capacity for considerable levels of gene flow. These findings illustrate general principles of eukaryotic pathogen emergence with relevance for other fungi, parasitic eukaryotic pathogens, and both unicellular and multicellular eukaryotic organisms. PMID:25085958
A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.
Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu
2015-05-01
Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Contamination of water resources by pathogenic bacteria
2014-01-01
Water-borne pathogen contamination in water resources and related diseases are a major water quality concern throughout the world. Increasing interest in controlling water-borne pathogens in water resources evidenced by a large number of recent publications clearly attests to the need for studies that synthesize knowledge from multiple fields covering comparative aspects of pathogen contamination, and unify them in a single place in order to present and address the problem as a whole. Providing a broader perceptive of pathogen contamination in freshwater (rivers, lakes, reservoirs, groundwater) and saline water (estuaries and coastal waters) resources, this review paper attempts to develop the first comprehensive single source of existing information on pathogen contamination in multiple types of water resources. In addition, a comprehensive discussion describes the challenges associated with using indicator organisms. Potential impacts of water resources development on pathogen contamination as well as challenges that lie ahead for addressing pathogen contamination are also discussed. PMID:25006540
Directory of Open Access Journals (Sweden)
Ivaylo Sirakov
2016-11-01
Full Text Available One of the main challenges in aquaponics is disease control. One possible solution for this is biological control with organisms exerting inhibitory effects on fish and plant pathogens. The aim of this study was to examine the potential of isolating microorganisms that exert an inhibitory effect on both plant and fish pathogens from an established aquaponic system. We obtained 924 isolates on selective King’s B agar and 101 isolates on MRS agar from different compartments of a model aquaponic system and tested them for antagonism against the plant pathogen Pythium ultimum and fish pathogen Saprolegnia parasitica. Overall, 42 isolates were able to inhibit both fungi. Although not yet tested in vivo, these findings open new options for the implementation of biological control of diseases in aquaponics, where plants and fish are cultivated in the same water recirculating system.
Directory of Open Access Journals (Sweden)
Rubén Jerves-Cobo
2018-03-01
Full Text Available The quality of water prior to its use for drinking, farming or recreational purposes must comply with several physicochemical and microbiological standards to safeguard society and the environment. In order to satisfy these standards, expensive analyses and highly trained personnel in laboratories are required. Whereas macroinvertebrates have been used as ecological indicators to review the health of aquatic ecosystems. In this research, the relationship between microbial pathogens and macrobenthic invertebrate taxa was examined in the Machangara River located in the southern Andes of Ecuador, in which 33 sites, according to their land use, were chosen to collect physicochemical, microbiological and biological parameters. Decision tree models (DTMs were used to generate rules that link the presence and abundance of some benthic families to microbial pathogen standards. The aforementioned DTMs provide an indirect, approximate, and quick way of checking the fulfillment of Ecuadorian regulations for water use related to microbial pathogens. The models built and optimized with the WEKA package, were evaluated based on both statistical and ecological criteria to make them as clear and simple as possible. As a result, two different and reliable models were obtained, which could be used as proxy indicators in a preliminary assessment of pollution of microbial pathogens in rivers. The DTMs can be easily applied by staff with minimal training in the identification of the sensitive taxa selected by the models. The presence of selected macroinvertebrate taxa in conjunction with the decision trees can be used as a screening tool to evaluate sites that require additional follow up analyses to confirm whether microbial water quality standards are met.
Mrljak, Vladimir; Kuleš, Josipa; Mihaljević, Željko; Torti, Marin; Gotić, Jelena; Crnogaj, Martina; Živičnjak, Tatjana; Mayer, Iva; Šmit, Iva; Bhide, Mangesh; Barić Rafaj, Renata
2017-06-01
Vector-borne pathogens (VBPs) are a group of globally extended and quickly spreading pathogens that are transmitted by various arthropod vectors. The aim of the present study was to investigate the seroprevalence against Babesia canis, Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Leishmania infantum, Dirofilaria immitis, and Ehrlichia canis in dogs in Croatia. We investigated 435 randomly selected apparently healthy dogs in 13 different locations of Croatia for antibodies to B. canis by indirect immunofluorescence using a commercial IFA IgG Antibody Kit. All samples were also tested for qualitative detection of D. immitis antigen and for antibodies to A. phagocytophilum, B. burgdorferi sensu lato, L. infantum, and E. canis with two point-of-care assays. Overall, 112 dogs (25.74%, 95% confidence interval [CI] 21.70-30.12) were serologically positive for one or more of the pathogens. B. canis was the most prevalent pathogen (20.00%, 95% CI 16.34-24.07), followed by A. phagocytophilum (6.21%, 95% CI 4.12-8.90), L. infantum, (1.38%, 95% CI 0.51-2.97), and B. burgdorferi sensu lato (0.69%, 95% CI 0.01-2.00). The lowest seroprevalence was for D. immitis and E. canis (0.46%, 95% CI 0.01-1.65). Coinfection was determined in 12 dogs (2.76%, 95% CI 1.43-4.77), of which 10 were positive to two pathogens (7 with B. canis and A. phagocytophilum and 1 B. canis with B. burgdorferi sensu lato or L. infantum or E. canis). One dog was positive to three pathogens and another dog to four pathogens. Seroprevalence for babesia was age, breed, and lifestyle/use dependent. Purebred dogs had almost half the chance of developing disease than crossbred (OR = 0.58, p Croatia. Some of these VBPs are zoonotic and represent a potential risk to public health.
Lu, Shan; Jin, Dong; Wu, Shusheng; Yang, Jing; Lan, Ruiting; Bai, Xiangning; Liu, Sha; Meng, Qiong; Yuan, Xuejiao; Zhou, Juan; Pu, Ji; Chen, Qiang; Dai, Hang; Hu, Yuanyuan; Xiong, Yanwen; Ye, Changyun; Xu, Jianguo
2016-12-07
Escherichia coli is both of a widespread harmless gut commensal and a versatile pathogen of humans. Domestic animals are a well-known reservoir for pathogenic E. coli. However, studies of E. coli populations from wild animals that have been separated from human activities had been very limited. Here we obtained 580 isolates from intestinal contents of 116 wild Marmot Marmota himalayana from Qinghai-Tibet plateau, China, with five isolates per animal. We selected 125 (hereinafter referred to as strains) from the 580 isolates for genome sequencing, based on unique pulse field gel electrophoresis patterns and at least one isolate per animal. Whole genome sequence analysis revealed that all 125 strains carried at least one and the majority (79.2%) carried multiple virulence genes based on the analysis of 22 selected virulence genes. In particular, the majority of the strains carried virulence genes from different pathovars as potential 'hybrid pathogens'. The alleles of eight virulence genes from the Marmot E. coli were found to have diverged earlier than all known alleles from human and other animal E. coli. Phylogenetic analysis of the 125 Marmot E. coli genomes and 355 genomes selected from 1622 human and other E. coli strains identified two new phylogroups, G and H, both of which diverged earlier than the other phylogroups. Eight of the 12 well-known pathogenic E. coli lineages were found to share a most recent common ancestor with one or more Marmot E. coli strains. Our results suggested that the intestinal E. coli of the Marmots contained a diverse virulence gene pool and is potentially pathogenic to humans. These findings provided a new understanding of the evolutionary origin of pathogenic E. coli.
Epigenetic control of effectors in plant pathogens
Directory of Open Access Journals (Sweden)
Mark eGijzen
2014-11-01
Full Text Available Plant pathogens display impressive versatility in adapting to host immune systems. Pathogen effector proteins facilitate disease but can become avirulence (Avr factors when the host acquires discrete recognition capabilities that trigger immunity. The mechanisms that lead to changes to pathogen Avr factors that enable escape from host immunity are diverse, and include epigenetic switches that allow for reuse or recycling of effectors. This perspective outlines possibilities of how epigenetic control of Avr effector gene expression may have arisen and persisted in plant pathogens, and how it presents special problems for diagnosis and detection of specific pathogen strains or pathotypes.
Wang, Rongbo; Zhang, Meixiang; Liu, Hong; Xu, Jing; Yu, Jia; He, Feng; Zhang, Xiong; Dong, Suomeng; Dou, Daolong
2016-04-01
Pathogen nutrient acquisition and metabolism are critical for successful infection and colonization. However, the nutrient requirements and metabolic pathways related to pathogenesis in oomycete pathogens are unknown. In this study, we bioinformatically identified Phytophthora sojae aspartate aminotransferases (AATs), which are key enzymes that coordinate carbon and nitrogen metabolism. We demonstrated that P. sojae encodes more AATs than the analysed fungi. Some of the AATs contained additional prephenate dehydratase and/or prephenate dehydrogenase domains in their N-termini, which are unique to oomycetes. Silencing of PsAAT3, an infection-inducible expression gene, reduced P. sojae pathogenicity on soybean plants and affected the growth under N-starving condition, suggesting that PsAAT3 is involved in pathogen pathogenicity and nitrogen utilisation during infection. Our results suggest that P. sojae and other oomycete pathogens may have distinct amino acid metabolism pathways and that PsAAT3 is important for its full pathogenicity. Copyright © 2016 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Exposure and Knowledge of Sharps Injuries among Medical Students in Seven States of Mexico
Directory of Open Access Journals (Sweden)
Adrián Camacho-Ortiz
2015-03-01
Full Text Available Background: Medical students are vulnerable to accidental exposure to blood-borne pathogens when performing clinical activities. Knowledge of both the prevalence of exposure and necessary reporting procedures is important to minimize the risk of harm to medical students. Methods: A cross-sectional online survey of medical students from 19 universities from seven states in Mexico was utilized to determine the prevalence of needle stick injuries amongst medical students and the associated reporting procedures. Results: We included 312 respondents; of these, 52.24% were men and 47.76% were women, with a mean age of 23.19 years (SD ± 2.11 years. Nearly all of them (94.23% were medical students doing clerkships in public hospitals. Mean knowledge score of blood-borne pathogens was 3.6 (SD ± 1.16 on a scale of 0-10 designed specifically for this study. Thirty-five per cent of the respondents had sustained a needle stick injury at some point during their medical school training, and 33.97% reported some type of mucocutaneous exposure. Overall, the non-reporting rate of needle stick injury was 48.34%. Approximately 25% of the respondents were not familiar with reporting procedures in the event of a needle stick injury or mucocutaneous exposure; 61.50% had received information from their hospital about the standard protocol to follow after a blood or body fluid exposure. Conclusion: In this Mexican population of medical students, there is a high risk of suffering needle stick injuries during medical training. Furthermore, knowledge regarding prevention, evaluation, and reporting of needle stick injuries is suboptimal.
Frydenborg, Beck R; Krediet, Cory J; Teplitski, Max; Ritchie, Kim B
2014-02-01
Bacteria living within the surface mucus layer of corals compete for nutrients and space. A number of stresses affect the outcome of this competition. The interactions between native microorganisms and opportunistic pathogens largely determine the coral holobiont's overall health and fitness. In this study, we tested the hypothesis that commensal bacteria isolated from the mucus layer of a healthy elkhorn coral, Acropora palmata, are capable of inhibition of opportunistic pathogens, Vibrio shiloi AK1 and Vibrio coralliilyticus. These vibrios are known to cause disease in corals and their virulence is temperature dependent. Elevated temperature (30 °C) increased the cell numbers of one commensal and both Vibrio pathogens in monocultures. We further tested the hypothesis that elevated temperature favors pathogenic organisms by simultaneously increasing the fitness of vibrios and decreasing the fitness of commensals by measuring growth of each species within a co-culture over the course of 1 week. In competition experiments between vibrios and commensals, the proportion of Vibrio spp. increased significantly under elevated temperature. We finished by investigating several temperature-dependent mechanisms that could influence co-culture differences via changes in competitive fitness. The ability of Vibrio spp. to utilize glycoproteins found in A. palmata mucus increased or remained stable when exposed to elevated temperature, while commensals' tended to decrease utilization. In both vibrios and commensals, protease activity increased at 30 °C, while chiA expression increased under elevated temperatures for Vibrio spp. These results provide insight into potential mechanisms through which elevated temperature may select for pathogenic bacterial dominance and lead to disease or a decrease in coral fitness.
Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal
Coy, Monique R.; Stelinski, Lukasz L.; Pelz-Stelinski, Kirsten S.
2015-01-01
The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas) affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama). CLas is the putative causal agent of huanglongbing (HLB), which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies. PMID:26083763
Directory of Open Access Journals (Sweden)
Xavier Martini
Full Text Available The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama. CLas is the putative causal agent of huanglongbing (HLB, which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies.
Multidrug-resistant pathogens in the food supply.
Doyle, Marjorie E
2015-04-01
Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in
Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel
2017-05-01
Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
SCREENING OF FLUORESCENT RHIZOBACTERIA FOR THE BIOCONTROL OF SOILBORNE PLANT PATHOGENIC FUNGI
Directory of Open Access Journals (Sweden)
ANELISE DIAS
2014-01-01
Full Text Available The biocontrol of soilborne plant pathogens represents a promising approach from the environ- mental and practical points of view. Fluorescent pseudomonad rhizobacteria are well known by their antagonis- tic capacity towards several plant pathogens due to a diversity of antimicrobial metabolites they produce. This study was conceived to select and characterize rhizobacteria having antagonistic potential towards the patho- genic fungi Rhizoctonia solani and Sclerotium rolfsii. A total of 94 bacterial strains isolated from the rhizospheres of four vegetable species under organic cultivation were evaluated. Twenty-two strains which predominate in lettuce and rudbeckia rhizospheres showed identical biochemical profiles to Pseudomonas fluo- rescens, while in kale and parsley rhizospheres identical profiles to Pseudomonas putida (subgroups A and B strains prevailed. Two types of antagonism were verified in vitro and defined as competition and inhibition of mycelial growth. Sixty percent of the evaluated strains showed antagonistic potential and, among those, 24 strains expressed antagonism to both target fungi, with P. fluorescens being the most representative bacterial species. This work clearly identified a number of strains with potential for use as plant growth-promoting and biocontrol of the two soilborne fungal pathogens in vegetable crops production systems.
Bactericidal activities of GM flax seedcake extract on pathogenic bacteria clinical strains.
Zuk, Magdalena; Dorotkiewicz-Jach, Agata; Drulis-Kawa, Zuzanna; Arendt, Malgorzata; Kulma, Anna; Szopa, Jan
2014-07-29
The antibiotic resistance of pathogenic microorganisms is a worldwide problem. Each year several million people across the world acquire infections with bacteria that are antibiotic-resistant, which is costly in terms of human health. New antibiotics are extremely needed to overcome the current resistance problem. Transgenic flax plants overproducing compounds from phenylpropanoid pathway accumulate phenolic derivatives of potential antioxidative, and thus, antimicrobial activity. Alkali hydrolyzed seedcake extract containing coumaric acid, ferulic acid, caffeic acid, and lignan in high quantities was used as an assayed against pathogenic bacteria (commonly used model organisms and clinical strains). It was shown that the extract components had antibacterial activity, which might be useful as a prophylactic against bacterial infection. Bacteria topoisomerase II (gyrase) inhibition and genomic DNA disintegration are suggested to be the main reason for rendering antibacterial action. The data obtained strongly suggest that the seedcake extract preparation is a suitable candidate for antimicrobial action with a broad spectrum and partial selectivity. Such preparation can be applied in cases where there is a risk of multibacterial infection and excellent answer on global increase in multidrug resistance in pathogenic bacteria.
Directory of Open Access Journals (Sweden)
Sujal S. Phadke
2018-01-01
Full Text Available Environmental opportunistic pathogens can exploit vulnerable hosts through expression of traits selected for in their natural environments. Pathogenicity is itself a complicated trait underpinned by multiple complex traits, such as thermotolerance, morphology, and stress response. The baker’s yeast, Saccharomyces cerevisiae, is a species with broad environmental tolerance that has been increasingly reported as an opportunistic pathogen of humans. Here we leveraged the genetic resources available in yeast and a model insect species, the greater waxmoth Galleria mellonella, to provide a genome-wide analysis of pathogenicity factors. Using serial passaging experiments of genetically marked wild-type strains, a hybrid strain was identified as the most fit genotype across all replicates. To dissect the genetic basis for pathogenicity in the hybrid isolate, bulk segregant analysis was performed which revealed eight quantitative trait loci significantly differing between the two bulks with alleles from both parents contributing to pathogenicity. A second passaging experiment with a library of deletion mutants for most yeast genes identified a large number of mutations whose relative fitness differed in vivo vs. in vitro, including mutations in genes controlling cell wall integrity, mitochondrial function, and tyrosine metabolism. Yeast is presumably subjected to a massive assault by the innate insect immune system that leads to melanization of the host and to a large bottleneck in yeast population size. Our data support that resistance to the innate immune response of the insect is key to survival in the host and identifies shared genetic mechanisms between S. cerevisiae and other opportunistic fungal pathogens.
Greub, Gilbert; Kebbi-Beghdadi, Carole; Bertelli, Claire; Collyn, François; Riederer, Beat M; Yersin, Camille; Croxatto, Antony; Raoult, Didier
2009-12-23
With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.
Choi, Yoon-E; Lee, Changsu; Goodwin, Stephen B
2016-03-01
The ascomycete fungus Mycosphaerella graminicola (synonym Zymoseptoria tritici) is an important pathogen of wheat causing economically significant losses. The primary nutritional mode of this fungus is thought to be hemibiotrophic. This pathogenic lifestyle is associated with an early biotrophic stage of nutrient uptake followed by a necrotrophic stage aided possibly by production of a toxin or reactive oxygen species (ROS). In many other fungi, the genes CREA and AREA are important during the biotrophic stage of infection, while the NOXa gene product is important during necrotrophic growth. To test the hypothesis that these genes are important for pathogenicity of M. graminicola, we employed an over-expression strategy for the selected target genes CREA, AREA, and NOXa, which might function as regulators of nutrient acquisition or ROS generation. Increased expressions of CREA, AREA, and NOXa in M. graminicola were confirmed via quantitative real-time PCR and strains were subsequently assayed for pathogenicity. Among them, the NOXa over-expression strain, NO2, resulted in significantly increased virulence. Moreover, instead of the usual filamentous growth, we observed a predominance of yeast-like growth of NO2 which was correlated with ROS production. Our data indicate that ROS generation via NOXa is important to pathogenicity as well as development in M. graminicola.
Type IV pili in Francisella – A virulence trait in an intracellular pathogen
Directory of Open Access Journals (Sweden)
Emelie eNäslund Salomonsson
2011-02-01
Full Text Available Francisella tularensis is a highly virulent intracellular human pathogen that is capable of rapid proliferation in the infected host. Mutants affected in intracellular survival and growth are highly attenuated which highlights the importance of the intracellular phase of the infection. Genomic analysis has revealed that Francisella encodes all genes required for expression of functional type IV pili (Tfp, and in this focused review we summarise recent findings regarding this system in the pathogenesis of tularemia. Tfp are dynamic adhesive structures that have been identified as major virulence determinants in several human pathogens, but it is not obvious what role these structures could have in an intracellular pathogen like Francisella. In the human pathogenic strains, genes required for secretion and assembly of Tfp and one pilin, PilA, have shown to be required for full virulence. Importantly, specific genetic differences have been identified between the different Francisella subspecies where in the most pathogenic type A variants all genes are intact while several Tfp genes are pseudogenes in the less pathogenic type B strains. This suggests that there has been a selection for expression of Tfp with different properties in the different subspecies. There is also a possibility that the genetic differences reflect adaption to different environmental niches of the subspecies and plays a role in transmission of tularemia. This is also in line with recent findings where Tfp pilins are found to be glycosylated which could reflect a role for Tfp in the environment to promote survival and transmission. We are still far from understanding the role of Tfp in virulence and transmission of tularemia, but with the genomic information and genetic tools available we are in a good position to address these issues in the future.
Stam, Remco; Scheikl, Daniela; Tellier, Aurélien
2017-01-01
Wild tomatoes are a valuable source of disease resistance germplasm for tomato ( Solanum lycopersicum ) breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense , both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense . We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens ( Alternaria solani , Phytophthora infestans and a Fusarium sp .) and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense , resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved.
Immunity to plant pathogens and iron homeostasis.
Aznar, Aude; Chen, Nicolas W G; Thomine, Sebastien; Dellagi, Alia
2015-11-01
Iron is essential for metabolic processes in most living organisms. Pathogens and their hosts often compete for the acquisition of this nutrient. However, iron can catalyze the formation of deleterious reactive oxygen species. Hosts may use iron to increase local oxidative stress in defense responses against pathogens. Due to this duality, iron plays a complex role in plant-pathogen interactions. Plant defenses against pathogens and plant response to iron deficiency share several features, such as secretion of phenolic compounds, and use common hormone signaling pathways. Moreover, fine tuning of iron localization during infection involves genes coding iron transport and iron storage proteins, which have been shown to contribute to immunity. The influence of the plant iron status on the outcome of a given pathogen attack is strongly dependent on the nature of the pathogen infection strategy and on the host species. Microbial siderophores emerged as important factors as they have the ability to trigger plant defense responses. Depending on the plant species, siderophore perception can be mediated by their strong iron scavenging capacity or possibly via specific recognition as pathogen associated molecular patterns. This review highlights that iron has a key role in several plant-pathogen interactions by modulating immunity. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.
Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G
2018-03-01
Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.
Universal precautions--do Irish anaesthetists comply?
LENUS (Irish Health Repository)
O'Rourke, N
2012-02-03
BACKGROUND: Anaesthetists are at high risk from blood-borne pathogens. Universal Precautions (UP) include the routine use of appropriate barrier precautions and techniques to reduce the likelihood of exposure to blood, body fluids and tissues that may contain pathogens. The compliance of Irish anaesthetists with these precautions has not been studied. AIM: To study the attitudes of Irish anaesthetists to Universal Precautions. METHOD: A postal questionnaire was sent to 210 anaesthetists currently practising in Ireland. The questionnaire was based on a model used in Australia and New Zealand. RESULTS: There was a 50% response rate to the survey. Only 15% of respondents had taken a risk history from a patient in the preceding four weeks. Resheathing of needles was commonplace. The effectiveness of hepatitis B immunisation was rarely checked and only 66% of respondents believe implementation of Universal Precautions to be practical. CONCLUSION: Irish anaesthetists comply poorly with Universal Precautions.
Molecular detection of human bacterial pathogens
National Research Council Canada - National Science Library
Liu, Dongyou
2011-01-01
.... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...
Directory of Open Access Journals (Sweden)
N Lakshmi Priya
2015-01-01
Full Text Available Occupational exposure poses a significant risk of transmission of blood-borne pathogens to healthcare workers (HCWs. Adherence to standard precautions, awareness about post exposure prophylaxis is poor in developing countries. This retrospective study analyzes the self-reported cases of occupational exposure in a tertiary care hospital. During the study period, 105 HCWs sustained occupational exposure to blood and body fluids. Majority of the victims 36 (34.2% were interns and the clinical practice that led to the occupational exposure was withdrawal of blood (45.7%. Good infection control practices and emphasis on appropriate disposal are needed to increase the occupational safety for HCWs.
Directory of Open Access Journals (Sweden)
Aines Castro-Prieto
Full Text Available Genes under selection provide ecologically important information useful for conservation issues. Major histocompatibility complex (MHC class I and II genes are essential for the immune defence against pathogens from intracellular (e.g. viruses and extracellular (e.g. helminths origins, respectively. Serosurvey studies in Namibian cheetahs (Acinonyx juabuts revealed higher exposure to viral pathogens in individuals from north-central than east-central regions. Here we examined whether the observed differences in exposure to viruses influence the patterns of genetic variation and differentiation at MHC loci in 88 free-ranging Namibian cheetahs.Genetic variation at MHC I and II loci was assessed through single-stranded conformation polymorphism (SSCP analysis and sequencing. While the overall allelic diversity did not differ, we observed a high genetic differentiation at MHC class I loci between cheetahs from north-central and east-central Namibia. No such differentiation in MHC class II and neutral markers were found.Our results suggest that MHC class I variation mirrors the variation in selection pressure imposed by viruses in free-ranging cheetahs across Namibian farmland. This is of high significance for future management and conservation programs of this species.
Breaking into the epithelial apical–junctional complex — news from pathogen hackers
Vogelmann, Roger; Amieva, Manuel R; Falkow, Stanley; Nelson, W James
2012-01-01
The epithelial apical–junctional complex is a key regulator of cellular functions. In addition, it is an important target for microbial pathogens that manipulate the cell to survive, proliferate and sometimes persist within a host. Out of a myriad of potential molecular targets, some bacterial and viral pathogens have selected a subset of protein targets at the apical–junctional complex of epithelial cells. Studying how microbes use these targets also teaches us about the inherent physiological properties of host molecules in the context of normal junctional structure and function. Thus, we have learned that three recently uncovered components of the apical–junctional complex of the Ig superfamily — junctional adhesion molecule, Nectin and the coxsackievirus and adenovirus receptor — are important regulators of junction structure and function and represent critical targets of microbial virulence gene products. PMID:15037310
The adaptation of two distantly related microsporidia to their mosquito hosts was investigated. Edhazardia aedis is a specialist pathogen that infects Aedes aegypti, the main vector of dengue and yellow fever arboviruses. Vavraia culicis is a generalist pathogen of several insects including Anophele...
Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans.
Zadoks, Ruth N; Middleton, John R; McDougall, Scott; Katholm, Jorgen; Schukken, Ynte H
2011-12-01
Mastitis, inflammation of the mammary gland, can be caused by a wide range of organisms, including gram-negative and gram-positive bacteria, mycoplasmas and algae. Many microbial species that are common causes of bovine mastitis, such as Escherichia coli, Klebsiella pneumoniae, Streptococcus agalactiae and Staphylococcus aureus also occur as commensals or pathogens of humans whereas other causative species, such as Streptococcus uberis, Streptococcus dysgalactiae subsp. dysgalactiae or Staphylococcus chromogenes, are almost exclusively found in animals. A wide range of molecular typing methods have been used in the past two decades to investigate the epidemiology of bovine mastitis at the subspecies level. These include comparative typing methods that are based on electrophoretic banding patterns, library typing methods that are based on the sequence of selected genes, virulence gene arrays and whole genome sequencing projects. The strain distribution of mastitis pathogens has been investigated within individual animals and across animals, herds, countries and host species, with consideration of the mammary gland, other animal or human body sites, and environmental sources. Molecular epidemiological studies have contributed considerably to our understanding of sources, transmission routes, and prognosis for many bovine mastitis pathogens and to our understanding of mechanisms of host-adaptation and disease causation. In this review, we summarize knowledge gleaned from two decades of molecular epidemiological studies of mastitis pathogens in dairy cattle and discuss aspects of comparative relevance to human medicine.
Pathogenicity island mobility and gene content.
Energy Technology Data Exchange (ETDEWEB)
Williams, Kelly Porter
2013-10-01
Key goals towards national biosecurity include methods for analyzing pathogens, predicting their emergence, and developing countermeasures. These goals are served by studying bacterial genes that promote pathogenicity and the pathogenicity islands that mobilize them. Cyberinfrastructure promoting an island database advances this field and enables deeper bioinformatic analysis that may identify novel pathogenicity genes. New automated methods and rich visualizations were developed for identifying pathogenicity islands, based on the principle that islands occur sporadically among closely related strains. The chromosomally-ordered pan-genome organizes all genes from a clade of strains; gaps in this visualization indicate islands, and decorations of the gene matrix facilitate exploration of island gene functions. A %E2%80%9Clearned phyloblocks%E2%80%9D method was developed for automated island identification, that trains on the phylogenetic patterns of islands identified by other methods. Learned phyloblocks better defined termini of previously identified islands in multidrug-resistant Klebsiella pneumoniae ATCC BAA-2146, and found its only antibiotic resistance island.
Plant innate immunity against human bacterial pathogens
Directory of Open Access Journals (Sweden)
Maeli eMelotto
2014-08-01
Full Text Available Certain human bacterial pathogens such as the enterohemorrhagic Escherichia coli and Salmonella enterica are not proven to be plant pathogens yet. Nonetheless, under certain conditions they can survive on, penetrate into, and colonize internal plant tissues causing serious food borne disease outbreaks. In this review, we highlight current understanding on the molecular mechanisms of plant responses against human bacterial pathogens and discuss salient common and contrasting themes of plant interactions with phytopathogens or human pathogens.
Uncovering plant-pathogen crosstalk through apoplastic proteomic studies.
Delaunois, Bertrand; Jeandet, Philippe; Clément, Christophe; Baillieul, Fabienne; Dorey, Stéphan; Cordelier, Sylvain
2014-01-01
Plant pathogens have evolved by developing different strategies to infect their host, which in turn have elaborated immune responses to counter the pathogen invasion. The apoplast, including the cell wall and extracellular space outside the plasma membrane, is one of the first compartments where pathogen-host interaction occurs. The plant cell wall is composed of a complex network of polysaccharides polymers and glycoproteins and serves as a natural physical barrier against pathogen invasion. The apoplastic fluid, circulating through the cell wall and intercellular spaces, provides a means for delivering molecules and facilitating intercellular communications. Some plant-pathogen interactions lead to plant cell wall degradation allowing pathogens to penetrate into the cells. In turn, the plant immune system recognizes microbial- or damage-associated molecular patterns (MAMPs or DAMPs) and initiates a set of basal immune responses, including the strengthening of the plant cell wall. The establishment of defense requires the regulation of a wide variety of proteins that are involved at different levels, from receptor perception of the pathogen via signaling mechanisms to the strengthening of the cell wall or degradation of the pathogen itself. A fine regulation of apoplastic proteins is therefore essential for rapid and effective pathogen perception and for maintaining cell wall integrity. This review aims to provide insight into analyses using proteomic approaches of the apoplast to highlight the modulation of the apoplastic protein patterns during pathogen infection and to unravel the key players involved in plant-pathogen interaction.
Campuzano, Susana; Yáñez-Sedeño, Paloma; Pingarrón, José Manuel
2017-11-03
Rapid and reliable diagnosis of infectious diseases caused by pathogens, and timely initiation of appropriate treatment are critical determinants to promote optimal clinical outcomes and general public health. Conventional in vitro diagnostics for infectious diseases are time-consuming and require centralized laboratories, experienced personnel and bulky equipment. Recent advances in electrochemical affinity biosensors have demonstrated to surpass conventional standards in regards to time, simplicity, accuracy and cost in this field. The tremendous potential offered by electrochemical affinity biosensors to detect on-site infectious pathogens at clinically relevant levels in scarcely treated body fluids is clearly stated in this review. The development and application of selected examples using different specific receptors, assay formats and electrochemical approaches focusing on the determination of specific circulating biomarkers of different molecular (genetic, regulatory and functional) levels associated with bacterial and viral pathogens are critically discussed. Existing challenges still to be addressed and future directions in this rapidly advancing and highly interesting field are also briefly pointed out.
Martini, Xavier; Willett, Denis S; Kuhns, Emily H; Stelinski, Lukasz L
2016-05-01
Plant pathogens can manipulate the odor of their host; the odor of an infected plant is often attractive to the plant pathogen vector. It has been suggested that this odor-mediated manipulation attracts vectors and may contribute to spread of disease; however, this requires further broad demonstration among vector-pathogen systems. In addition, disruption of this indirect chemical communication between the pathogen and the vector has not been attempted. We present a model that demonstrates how a phytophathogen (Candidatus Liberibacter asiaticus) can increase its spread by indirectly manipulating the behavior of its vector (Asian citrus psyllid, Diaphorina citri Kuwayama). The model indicates that when vectors are attracted to pathogen-infected hosts, the proportion of infected vectors increases, as well as, the proportion of infected hosts. Additionally, the peak of infected host populations occurs earlier as compared with controls. These changes in disease dynamics were more important during scenarios with higher vector mortality. Subsequently, we conducted a series of experiments to disrupt the behavior of the Asian citrus psyllid. To do so, we exposed the vector to methyl salicylate, the major compound released following host infection with the pathogen. We observed that during exposure or after pre-exposure to methyl salicylate, the host preference can be altered; indeed, the Asian citrus psyllids were unable to select infected hosts over uninfected counterparts. We suggest mechanisms to explain these interactions and potential applications of disrupting herbivore host preference with plant volatiles for sustainable management of insect vectors.
Progress in rapid detection and identification of unknown human and agricultural pathogens
International Nuclear Information System (INIS)
Barnes, T; Holzrichter, J F; Milanovich, F P
1999-01-01
The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content
Geraylou, Z.; Vanhove, M.P.M.; Souffreau, C.; Rurangwa, E.; Buyse, J.; Ollevier, F.
2014-01-01
To select and characterize potential probiotic bacteria from the gut microbiota of Siberian sturgeon (Acipenser baerii), 129 strains isolated from the hindgut were screened for antagonistic activity against five fish pathogens. Ten isolates showed antagonism towards three or more pathogens. Nine of
Lectins in human pathogenic fungi.
Gallegos, Belém; Martínez, Ruth; Pérez, Laura; Del Socorro Pina, María; Perez, Eduardo; Hernández, Pedro
2014-01-01
Lectins are carbohydrate-binding proteins widely distributed in nature. They constitute a highly diverse group of proteins consisting of many different protein families that are, in general, structurally unrelated. In the last few years, mushroom and other fungal lectins have attracted wide attention due to their antitumour, antiproliferative and immunomodulatory activities. The present mini-review provides concise information about recent developments in understanding lectins from human pathogenic fungi. A bibliographic search was performed in the Science Direct and PubMed databases, using the following keywords "lectin", "fungi", "human" and "pathogenic". Lectins present in fungi have been classified; however, the role played by lectins derived from human pathogenic fungi in infectious processes remains uncertain; thus, this is a scientific field requiring more research. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Occurrence of root parsley pathogens inhabiting seeds
Directory of Open Access Journals (Sweden)
Bogdan Nowicki
2013-12-01
Full Text Available The studies on root parsley pathogens inhabiting seeds were conducted during 1981-1988 and in 1993. Filter paper method with prefreezing and keeping under light was used. Each test sample comprised 500 seeds. Pathogenicity of collected fungal isolates was tested following two laboratory methods. 238 seed samples were studied. 18 fungal species were found but only 7 proved to be important pathogens of root parsley. The most common inhabitants of root parsley seeds were Alternaria spp. A.allernata occurred on 74,8% of seeds but only a few isolates showed to be slightly pathogenic while A.petroselini and A.radicina were higly pathogenic and inhabited 11,4 and 4,2% of seeds, respectively. The second group of important pathogens were species of Fusarium found on 3,9% of seeds. F.avenaceum dominated as it comprised 48% of Fusarium isolates, the next were as follow: F.culmorum - 20%, F.equiseti - 15%, F.solani - 8%, F.oxysporum - 7% and F.dimerum -2%. Some fungi like Botrytis cinerea, Septoria petroselini and Phoma spp. inhabited low number of seeds, respectively O,4; 0,5 and 0,8%, but they were highly pathogenic to root parsley. The fungi: Bipolaris sorokiniana, Drechslera biseptata, Stemphylium botryosum and Ulocludium consortiale showed slight pathogenicity. They were isolated from 3,8% of seeds.
Comparative genomics and the evolution of pathogenicity in human pathogenic fungi.
LENUS (Irish Health Repository)
Moran, Gary P
2011-01-01
Because most fungi have evolved to be free-living in the environment and because the infections they cause are usually opportunistic in nature, it is often difficult to identify specific traits that contribute to fungal pathogenesis. In recent years, there has been a surge in the number of sequenced genomes of human fungal pathogens, and comparison of these sequences has proved to be an excellent resource for exploring commonalities and differences in how these species interact with their hosts. In order to survive in the human body, fungi must be able to adapt to new nutrient sources and environmental stresses. Therefore, genes involved in carbohydrate and amino acid metabolism and transport and genes encoding secondary metabolites tend to be overrepresented in pathogenic species (e.g., Aspergillus fumigatus). However, it is clear that human commensal yeast species such as Candida albicans have also evolved a range of specific factors that facilitate direct interaction with host tissues. The evolution of virulence across the human pathogenic fungi has occurred largely through very similar mechanisms. One of the most important mechanisms is gene duplication and the expansion of gene families, particularly in subtelomeric regions. Unlike the case for prokaryotic pathogens, horizontal transfer of genes between species and other genera does not seem to have played a significant role in the evolution of fungal virulence. New sequencing technologies promise the prospect of even greater numbers of genome sequences, facilitating the sequencing of multiple genomes and transcriptomes within individual species, and will undoubtedly contribute to a deeper insight into fungal pathogenesis.
Lee, Boyoung; Lee, Soohyun; Ryu, Choong-Min
2012-07-01
Plants modulate defence signalling networks in response to different biotic stresses. The present study evaluated the effect of a phloem-sucking aphid on plant defence mechanisms in pepper (Capsicum annuum) during subsequent pathogen attacks on leaves and rhizosphere bacteria on roots. Plants were pretreated with aphids and/or the chemical trigger benzothiadiazol (BTH) 7 d before being challenged with two pathogenic bacteria, Xanthomonas axonopodis pv. vesicatoria (Xav) as a compatible pathogen and X. axonopodis pv. glycines (Xag) as an incompatible (non-host) pathogen. Disease severity was noticeably lower in aphid- and BTH + aphid-treated plants than in controls. Although treatment with BTH or aphids alone did not affect the hypersensitive response (HR) against Xag strain 8ra, the combination treatment had a synergistic effect on the HR. The aphid population was reduced by BTH pretreatment and by combination treatment with BTH and bacterial pathogens in a synergistic manner. Analysis of the expression of the defence-related genes Capsicum annum pathogenesis-related gene 9 (CaPR9), chitinase 2 (CaCHI2), SAR8·2 and Lipoxygenase1 (CaLOX1) revealed that aphid infestation resulted in the priming of the systemic defence responses against compatible and incompatible pathogens. Conversely, pre-challenge with the compatible pathogen Xav on pepper leaves significantly reduced aphid numbers. Aphid infestation increased the population of the beneficial Bacillus subtilis GB03 but reduced that of the pathogenic Ralstonia solanacearum SL1931. The expression of defence-related genes in the root and leaf after aphid feeding indicated that the above-ground aphid infestation elicited salicylic acid and jasmonic acid signalling throughout the whole plant. The findings of this study show that aphid feeding elicits plant resistance responses and attracts beneficial bacterial populations to help the plant cope with subsequent pathogen attacks.
Management of outbreaks of nosocomial pathogens in Neonatal Intensive Care Unit
Directory of Open Access Journals (Sweden)
B. Ghirardi
2013-12-01
Full Text Available Outbreaks of nosocomial pathogens are one of the most relevant problems in Neonatal Intensive Care Unit (NICU. Many factors contribute to the onset of an epidemic, including virulence of the pathogen and vulnerability of the infants hospitalized in NICU. Outbreaks are often caused by multidrug-resistant organisms (MDROs. MDROs are defined as microorganisms, predominantly bacteria, that are resistant to one or more classes of antimicrobial agents. MDROs, including methicillin-resistant Staphylococcus aureus (MRSA, vancomycin-resistant enterococci (VRE and certain gram-negative bacilli (GNB, have important infection control implications. Once MDROs are introduced into a healthcare setting, transmission and persistence of the resistant strain is determined by the availability of vulnerable patients, selective pressure exerted by antimicrobial use, increased potential for transmission from larger numbers of infected or colonized patients (“colonization pressure”, and the impact of adherence to prevention efforts. Often, routine infection control measures are not enough to contain outbreaks, and additional control measures are needed, including implementation of hand hygiene, cohorting of infected/colonized infants, neonatal surveillance cultures, screening of healthcare workers and decolonization of neonates and/or healthcare workers in selected cases. In this review, we report the practices we developed in our NICU to contain an epidemic. These recommendations reflect the experience of the group, as well as the findings of the current literature.
76 FR 24793 - Highly Pathogenic Avian Influenza
2011-05-03
.... APHIS-2006-0074] RIN 0579-AC36 Highly Pathogenic Avian Influenza AGENCY: Animal and Plant Health... any subtype of highly pathogenic avian influenza is considered to exist. The interim rule also imposed... avian influenza, or that have moved through regions where any subtype of highly pathogenic avian...
A brief history of antibiotics and select advances in their synthesis.
Nicolaou, Kyriacos C; Rigol, Stephan
2018-02-01
The advent of modern antibiotics contributed enormously to the dramatic extension of human lifespan since their discovery by virtue of their lethal and selective action against pathogenic microbes. And yet despite our powerful arsenal of weapons against these pathogens, the war against them has not been won. And it may never be. Drug resistance is still menacing the society with many lives being lost due to deadly infections caused by continuously evolving strains spread beyond our means to eradicate them or prevent their spreading. Herein, the emergence and evolution of antibiotics is briefly reviewed, and a select number of total syntheses of naturally occurring antibiotics from the authors' laboratories are highlighted. The article concludes with a strong endorsement of the current efforts to intensify our fight against these dangerous pathogens with the hope that, this time, these initiatives will be sufficiently focused and serious enough so as to achieve our set goals of, at least, being prepared and ahead of them as part of our drive to improve humanity's healthcare and wellbeing.
Regulatory T cells and immunity to pathogens.
Rouse, Barry T; Suvas, Susmit
2007-09-01
Immune responses to pathogens are modulated by one or more types of cells that perform a regulatory function. Some cells with this function, such as CD4+ Foxp3+ natural regulatory T cells (nTreg), pre-exist prior to infections whereas others may be induced as a consequence of infection (adaptive Treg). With pathogens that have a complex pathogenesis, multiple types of regulatory cells could influence the outcome. One major property of Treg is to help minimize collateral tissue damage that can occur during immune reactions to a chronic infection. The consequence is less damage to the host but in such situations the pathogen is likely to establish persistence. In some cases, a fine balance is established between Treg responses, effector components of immunity and the pathogen. Treg responses to pathogens may also act to hamper the efficacy of immune control. This review discusses these issues as well as the likely mechanisms by which various pathogens can signal the participation of Treg during infection.
Evolution and genome architecture in fungal plant pathogens.
Möller, Mareike; Stukenbrock, Eva H
2017-12-01
The fungal kingdom comprises some of the most devastating plant pathogens. Sequencing the genomes of fungal pathogens has shown a remarkable variability in genome size and architecture. Population genomic data enable us to understand the mechanisms and the history of changes in genome size and adaptive evolution in plant pathogens. Although transposable elements predominantly have negative effects on their host, fungal pathogens provide prominent examples of advantageous associations between rapidly evolving transposable elements and virulence genes that cause variation in virulence phenotypes. By providing homogeneous environments at large regional scales, managed ecosystems, such as modern agriculture, can be conducive for the rapid evolution and dispersal of pathogens. In this Review, we summarize key examples from fungal plant pathogen genomics and discuss evolutionary processes in pathogenic fungi in the context of molecular evolution, population genomics and agriculture.
New trends in emerging pathogens.
Skovgaard, Niels
2007-12-15
The emergence of pathogens is the result of a number of impact in all parts of the food chain. The emerging technologies in food production explain how new pathogens can establish themselves in the food chain and compromise food safety. The impact of the food technology is analysed for several bacteria, such as Yersinia, Campylobacter, Arcobacter, Helicobacter pullorum, Enterobacter sakazakii, Mycobacterium avium spp. paratuberculosis, prions related to vCJD and others. The importance of the ability of many microbes to form VBNC forms is elaborated on. Research on culture independent methods may address this outstanding issue to the better understanding of emerging pathogens. The "demerging" of pathogens also occur, and examples of this are explained. The reaction of bacteria to stresses and sublethal treatments, and how exposure to one stress factor can confer resistance to other stresses, literally speaking causing contagious resistance, are explained. The implication of this e.g. in modern approaches of food preservation, such as Minimally processed Foods, is considerable. Intestinal colonization of EHEC may be regulated by Quorum sensing, and this ability of microbes plays an important role in the colonization of microbes in food and on food processing equipment, an important factor in the emergence of pathogens. The emergence of Saccharomyces cerevisiae, as an opportunistic human pathogen, used for centuries for food and production of alcoholic beverages, calls for research in molecular tools to distinguish between probiotic and clinical strains. Cyclospora cayetanensis and Norovirus outbreaks can no longer be designated as emerging pathogens, they share however one characteristic in the epidemiology of emerging nature, the importance of the hygiene in the primary production stage, including supply of potable water, and the application of GMP and the HACCP principles in the beginning of the food chain. Hepatitis E virus is a potential emerging food borne
Host-pathogen interactions: A cholera surveillance system
Energy Technology Data Exchange (ETDEWEB)
Wright, Aaron T.
2016-02-22
Bacterial pathogen-secreted proteases may play a key role in inhibiting a potentially widespread host-pathogen interaction. Activity-based protein profiling enabled the identification of a major Vibrio cholerae serine protease that limits the ability of a host-derived intestinal lectin to bind to the bacterial pathogen in vivo.
Buelow, Elena; Bello González, Teresita D J; Fuentes, Susana; de Steenhuijsen Piters, Wouter A A; Lahti, Leo; Bayjanov, Jumamurat R; Majoor, Eline A M; Braat, Johanna C; van Mourik, Maaike S M; Oostdijk, Evelien A N; Willems, Rob J L; Bonten, Marc J M; van Passel, Mark W J; Smidt, Hauke; van Schaik, Willem
2017-01-01
The gut microbiota is a reservoir of opportunistic pathogens that can cause life-threatening infections in critically ill patients during their stay in an intensive care unit (ICU). To suppress gut colonization with opportunistic pathogens, a prophylactic antibiotic regimen, termed "selective
Long-term social dynamics drive loss of function in pathogenic bacteria
DEFF Research Database (Denmark)
Breum Andersen, Sandra; Marvig, Rasmus Lykke; Molin, Søren
2015-01-01
Laboratory experiments show that social interactions between bacterial cells can drive evolutionary change at the population level, but significant challenges limit attempts to assess the relevance of these findings to natural populations, where selection pressures are unknown. We have increasingly...... sophisticated methods for monitoring phenotypic and genotypic dynamics in bacteria causing infectious disease, but in contrast, we lack evidence-based adaptive explanations for those changes. Evolutionary change during infection is often interpreted as host adaptation, but this assumption neglects to consider...... social dynamics shown to drive evolutionary change in vitro. We provide evidence to show that long-term behavioral dynamics observed in a pathogen are driven by selection to outcompete neighboring conspecific cells through social interactions. We find that Pseudomonas aeruginosa bacteria, causing lung...
The effect of pathogens and pests on honey bee gene expression
Navajas Navarro, Maria; Martin, Jean-François; Le Conte, Yves; Queen's University Belfast
2008-01-01
The effect of pathogens and pests on honey bee gene expression is a fascinating area of research in itself and can lead to new molecular tools for diagnostics and selection in beekeeping. In this framework, we first investigated Varroa-bee interactions by using a combination of nuc1ear and mitochondrial DNA markers of Varroa destructor to trace the parasite invasion of Apis mellifera since it shifted from A. cerana. The extremely low worldwide mite genetic diversity found on A. ...
Directory of Open Access Journals (Sweden)
Hikmate eAbriouel
2015-10-01
Full Text Available Despite the use of several Weissella strains for biotechnological and probiotic purposes, certain species of this genus were found to act as opportunistic pathogens, while strains of W. ceti were recognized to be pathogenic for farmed rainbow trout. Herein, we investigated the pathogenic potential of weissellas based on in silico analyses of the 13 whole genome sequences available to date in the NCBI database.Our screening allowed us to find several virulence determinants such as collagen adhesins, aggregation substances, mucus-binding proteins and hemolysins in some species. Moreover, we detected several antibiotic resistance-encoding genes, whose presence could increase the potential pathogenicity of some strains, but should not be regarded as an excluding trait for beneficial weissellas,as long as these genes are not present on mobile genetic elements. Thus, selection of weissellas intended to be used as starters or for biotechnological or probiotic purposes should be investigated regarding their safety aspects on a strain to strain basis, preferably also by genome sequencing, since nucleotide sequence heterogeneity in virulence and antibiotic resistance genes makes PCR-based screeningunreliable for safety assessments. In this sense, the application of W. confusa and W. cibaria strains as starter cultures or as probiotics should be approached with caution, by carefully selecting strains that lack pathogenic potential.
Genome-Enhanced Detection and Identification (GEDI of plant pathogens
Directory of Open Access Journals (Sweden)
Nicolas Feau
2018-02-01
Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.
Directory of Open Access Journals (Sweden)
Joe Kgaladi
2013-03-01
Full Text Available Several lyssavirus species occur in Africa (Rabies virus, Lagos bat virus, Mokola virus, Duvenhage virus, Shimoni bat virus and Ikoma lyssavirus, displaying a high sequence diversity between isolates belonging to the same species. There is limited information about comparative pathogenesis of these African lyssaviruses and this precludes authoritative opinion on the potential public and veterinary health impact. In this study, an analysis of representative African lyssaviruses attempted to correlate viral genomic sequence similarities and differences with the corresponding pathogenic profiles observed in mice. The study demonstrated that the virus isolates evaluated could be lethal to mice when introduced intramuscularly and that different isolates of the same lyssavirus species differ in their virulence. Using real-time polymerase chain reaction (PCR, viral RNA was detected in brain tissue, but no viral RNA was detected in the salivary glands or blood of mice that succumbed to infection. Comparison of known pathogenic domains indicated that pathogenicity is likely to be dependent on multiple domains. Cumulatively, our results re-emphasised the realisation that the pathogenicity of a lyssavirus species cannot be deduced based on studies of only a single isolate of the species or a single pathogenic domain.
Directory of Open Access Journals (Sweden)
Gilbert Greub
Full Text Available BACKGROUND: With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. METHODS/PRINCIPAL FINDINGS: We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. CONCLUSIONS/SIGNIFICANCE: This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.
Targeting of the hydrophobic metabolome by pathogens.
Helms, J Bernd; Kaloyanova, Dora V; Strating, Jeroen R P; van Hellemond, Jaap J; van der Schaar, Hilde M; Tielens, Aloysius G M; van Kuppeveld, Frank J M; Brouwers, Jos F
2015-05-01
The hydrophobic molecules of the metabolome - also named the lipidome - constitute a major part of the entire metabolome. Novel technologies show the existence of a staggering number of individual lipid species, the biological functions of which are, with the exception of only a few lipid species, unknown. Much can be learned from pathogens that have evolved to take advantage of the complexity of the lipidome to escape the immune system of the host organism and to allow their survival and replication. Different types of pathogens target different lipids as shown in interaction maps, allowing visualization of differences between different types of pathogens. Bacterial and viral pathogens target predominantly structural and signaling lipids to alter the cellular phenotype of the host cell. Fungal and parasitic pathogens have complex lipidomes themselves and target predominantly the release of polyunsaturated fatty acids from the host cell lipidome, resulting in the generation of eicosanoids by either the host cell or the pathogen. Thus, whereas viruses and bacteria induce predominantly alterations in lipid metabolites at the host cell level, eukaryotic pathogens focus on interference with lipid metabolites affecting systemic inflammatory reactions that are part of the immune system. A better understanding of the interplay between host-pathogen interactions will not only help elucidate the fundamental role of lipid species in cellular physiology, but will also aid in the generation of novel therapeutic drugs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Vladimir Pyatov
2017-01-01
Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.
Directory of Open Access Journals (Sweden)
T. V. Chernenkaya
2015-01-01
Full Text Available ABSTRACT. Changes in the structure of the main causative agents of nosocomial infections and significant spread of multidrugresistant strains of bacteria are a natural biological response for antibiotics that selectively inhibit pathogens and contribute to selection, survival and growth of drug resistant strains of bacteria. In this literature review we present the change of structure of the major causative microorganisms of nosocomial septic infections and theirs resistance to antibiotics for the last 70 years.
Deconstructing host-pathogen interactions in Drosophila
Directory of Open Access Journals (Sweden)
Ethan Bier
2012-01-01
Full Text Available Many of the cellular mechanisms underlying host responses to pathogens have been well conserved during evolution. As a result, Drosophila can be used to deconstruct many of the key events in host-pathogen interactions by using a wealth of well-developed molecular and genetic tools. In this review, we aim to emphasize the great leverage provided by the suite of genomic and classical genetic approaches available in flies for decoding details of host-pathogen interactions; these findings can then be applied to studies in higher organisms. We first briefly summarize the general strategies by which Drosophila resists and responds to pathogens. We then focus on how recently developed genome-wide RNA interference (RNAi screens conducted in cells and flies, combined with classical genetic methods, have provided molecular insight into host-pathogen interactions, covering examples of bacteria, fungi and viruses. Finally, we discuss novel strategies for how flies can be used as a tool to examine how specific isolated virulence factors act on an intact host.
PIML: the Pathogen Information Markup Language.
He, Yongqun; Vines, Richard R; Wattam, Alice R; Abramochkin, Georgiy V; Dickerman, Allan W; Eckart, J Dana; Sobral, Bruno W S
2005-01-01
A vast amount of information about human, animal and plant pathogens has been acquired, stored and displayed in varied formats through different resources, both electronically and otherwise. However, there is no community standard format for organizing this information or agreement on machine-readable format(s) for data exchange, thereby hampering interoperation efforts across information systems harboring such infectious disease data. The Pathogen Information Markup Language (PIML) is a free, open, XML-based format for representing pathogen information. XSLT-based visual presentations of valid PIML documents were developed and can be accessed through the PathInfo website or as part of the interoperable web services federation known as ToolBus/PathPort. Currently, detailed PIML documents are available for 21 pathogens deemed of high priority with regard to public health and national biological defense. A dynamic query system allows simple queries as well as comparisons among these pathogens. Continuing efforts are being taken to include other groups' supporting PIML and to develop more PIML documents. All the PIML-related information is accessible from http://www.vbi.vt.edu/pathport/pathinfo/
Directory of Open Access Journals (Sweden)
Daniel PALMERO
2012-05-01
Full Text Available Fusarium proliferatum has been reported on garlic in the Northwest USA, Spain and Serbia, causing water-soaked tan-colored lesions on cloves. In this work, Fusarium proliferatum was isolated from 300 symptomatic garlic bulbs. Morphological identification of Fusarium was confirmed using species-specific PCR assays and EF-1α sequencing. Confirmation of pathogenicity was conducted with eighteen isolates. Six randomly selected F. proliferatum isolates from garlic were tested for specific pathogenicity and screened for fusaric acid production. Additionally, pathogenicity of each F. proliferatum isolate was tested on healthy seedlings of onion (Allium cepa, leek (A. porrum, scallions (A. fistulosum, chives (A. schoenoprasum and garlic (A. sativum. A disease severity index (DSI was calculated as the mean severity on three plants of each species with four test replicates. Symptoms on onion and garlic plants were observed three weeks after inoculation. All isolates tested produced symptoms on all varieties inoculated. Inoculation of F. proliferatum isolates from diseased garlic onto other Allium species provided new information on host range and pathogenicity. The results demonstrated differences in susceptibility with respect to host species and cultivar. The F. proliferatum isolates tested all produced fusaric acid (FA; correlations between FA production and isolate pathogenicity are discussed. Additionally, all isolates showed the presence of the FUM1 gene suggesting the ability of Spanish isolates to produce fumonisins.
Shigella IpaH Family Effectors as a Versatile Model for Studying Pathogenic Bacteria.
Ashida, Hiroshi; Sasakawa, Chihiro
2015-01-01
Shigella spp. are highly adapted human pathogens that cause bacillary dysentery (shigellosis). Via the type III secretion system (T3SS), Shigella deliver a subset of virulence proteins (effectors) that are responsible for pathogenesis, with functions including pyroptosis, invasion of the epithelial cells, intracellular survival, and evasion of host immune responses. Intriguingly, T3SS effector activity and strategies are not unique to Shigella, but are shared by many other bacterial pathogens, including Salmonella, Yersinia, and enteropathogenic Escherichia coli (EPEC). Therefore, studying Shigella T3SS effectors will not only improve our understanding of bacterial infection systems, but also provide a molecular basis for developing live bacterial vaccines and antibacterial drugs. One of Shigella T3SS effectors, IpaH family proteins, which have E3 ubiquitin ligase activity and are widely conserved among other bacterial pathogens, are very relevant because they promote bacterial survival by triggering cell death and modulating the host immune responses. Here, we describe selected examples of Shigella pathogenesis, with particular emphasis on the roles of IpaH family effectors, which shed new light on bacterial survival strategies and provide clues about how to overcome bacterial infections.
Shigella IpaH family effectors as a versatile model for studying pathogenic bacteria
Directory of Open Access Journals (Sweden)
Hiroshi eAshida
2016-01-01
Full Text Available Shigella spp. are highly adapted human pathogens that cause bacillary dysentery (shigellosis. Via the type III secretion system (T3SS, Shigella deliver a subset of virulence proteins (effectors that are responsible for pathogenesis, with functions including pyroptosis, invasion of the epithelial cells, intracellular survival, and evasion of host immune responses. Intriguingly, T3SS effector activity and strategies are not unique to Shigella, but are shared by many other bacterial pathogens, including Salmonella, Yersinia, and enteropathogenic Escherichia coli (EPEC. Therefore, studying Shigella T3SS effectors will not only improve our understanding of bacterial infection systems, but also provide a molecular basis for developing live bacterial vaccines and antibacterial drugs. One of Shigella T3SS effectors, IpaH family proteins, which have E3 ubiquitin ligase activity and are widely conserved among other bacterial pathogens, are very relevant because they promote bacterial survival by triggering cell death and modulating the host immune responses. Here, we describe selected examples of Shigella pathogenesis, with particular emphasis on the roles of IpaH family effectors, which shed new light on bacterial survival strategies and provide clues about how to overcome bacterial infections.
Jing, Ming; Wang, Lei
2016-02-15
In the study, 454-pyrosequencing technology was employed to investigate the species of pathogenic bacteria and the proportion of each pathogen in secondary effluent. Culture-based, qPCR and Q-RT-PCR methods were employed to analyze the removal of indicator (E. coli) and pathogen (Salmonella and Mycobacterium) by ultraviolet (UV) disinfection at a dose of 60 mJ x Cm(-2). The results showed that 11 kinds of pathogenic bacteria were found and the most abundant potentially pathogenic bacteria in the secondary effluent were affiliated with the genera of Clostridium (2.96%), Arcobacter (0.82%) and Mycobacterium (0.36%). 99.9% of culturable E. coli and Salmonella were removed by UV disinfection (60 mJ x cm(-2), however, less than 90% of culturable Mycobacterium were removed. The removal efficiencies of viable E. coli, Salmonella and Mycobacterium were low. Q-RT-PCR seemed to be a promising method for evaluating viable microorganisms in samples. Besides, pathogenic bacteria entered into VBNC state at a UV dose of 60 mJ x cm(-2). Other advanced treatment processes were needed to ensure safe utilization of reclaimed water.
Heme Synthesis and Acquisition in Bacterial Pathogens.
Choby, Jacob E; Skaar, Eric P
2016-08-28
Bacterial pathogens require the iron-containing cofactor heme to cause disease. Heme is essential to the function of hemoproteins, which are involved in energy generation by the electron transport chain, detoxification of host immune effectors, and other processes. During infection, bacterial pathogens must synthesize heme or acquire heme from the host; however, host heme is sequestered in high-affinity hemoproteins. Pathogens have evolved elaborate strategies to acquire heme from host sources, particularly hemoglobin, and both heme acquisition and synthesis are important for pathogenesis. Paradoxically, excess heme is toxic to bacteria and pathogens must rely on heme detoxification strategies. Heme is a key nutrient in the struggle for survival between host and pathogen, and its study has offered significant insight into the molecular mechanisms of bacterial pathogenesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Antibacterial activity of some selected plants traditionally used as ...
African Journals Online (AJOL)
Antibacterial activity of some selected plants traditionally used as medicine in Manipur. ... Hence these plants can be used to discover bioactive natural products that may serve as leads in the development of the new pharmaceuticals. Keywords: Antibacterial, human pathogens, methanolic extract, traditional medicine
Practical Approaches for Detecting Selection in Microbial Genomes.
Hedge, Jessica; Wilson, Daniel J
2016-02-01
Microbial genome evolution is shaped by a variety of selective pressures. Understanding how these processes occur can help to address important problems in microbiology by explaining observed differences in phenotypes, including virulence and resistance to antibiotics. Greater access to whole-genome sequencing provides microbiologists with the opportunity to perform large-scale analyses of selection in novel settings, such as within individual hosts. This tutorial aims to guide researchers through the fundamentals underpinning popular methods for measuring selection in pathogens. These methods are transferable to a wide variety of organisms, and the exercises provided are designed for researchers with any level of programming experience.
Fecundity compensation and tolerance to a sterilizing pathogen in Daphnia.
Vale, P F; Little, T J
2012-09-01
Hosts are armed with several lines of defence in the battle against parasites: they may prevent the establishment of infection, reduce parasite growth once infected or persevere through mechanisms that reduce the damage caused by infection, called tolerance. Studies on tolerance in animals have focused on mortality, and sterility tolerance has not been investigated experimentally. Here, we tested for genetic variation in the multiple steps of defence when the invertebrate Daphnia magna is infected with the sterilizing bacterial pathogen Pasteuria ramosa: anti-infection resistance, anti-growth resistance and the ability to tolerate sterilization once infected. When exposed to nine doses of a genetically diverse pathogen inoculum, six host genotypes varied in their average susceptibility to infection and in their parasite loads once infected. How host fecundity changed with increasing parasite loads did not vary between genotypes, indicating that there was no genetic variation for this measure of fecundity tolerance. However, genotypes differed in their level of fecundity compensation under infection, and we discuss how, by increasing host fitness without targeting parasite densities, fecundity compensation is consistent with the functional definition of tolerance. Such infection-induced life-history shifts are not traditionally considered to be part of the immune response, but may crucially reduce harm (in terms of fitness loss) caused by disease, and are a distinct source of selection on pathogens. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.
Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito
2017-12-22
Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.
Wyrsch, Ethan R; Roy Chowdhury, Piklu; Chapman, Toni A; Charles, Ian G; Hammond, Jeffrey M; Djordjevic, Steven P
2016-01-01
Contamination of waste effluent from hospitals and intensive food animal production with antimicrobial residues is an immense global problem. Antimicrobial residues exert selection pressures that influence the acquisition of antimicrobial resistance and virulence genes in diverse microbial populations. Despite these concerns there is only a limited understanding of how antimicrobial residues contribute to the global problem of antimicrobial resistance. Furthermore, rapid detection of emerging bacterial pathogens and strains with resistance to more than one antibiotic class remains a challenge. A comprehensive, sequence-based genomic epidemiological surveillance model that captures essential microbial metadata is needed, both to improve surveillance for antimicrobial resistance and to monitor pathogen evolution. Escherichia coli is an important pathogen causing both intestinal [intestinal pathogenic E. coli (IPEC)] and extraintestinal [extraintestinal pathogenic E. coli (ExPEC)] disease in humans and food animals. ExPEC are the most frequently isolated Gram negative pathogen affecting human health, linked to food production practices and are often resistant to multiple antibiotics. Cattle are a known reservoir of IPEC but they are not recognized as a source of ExPEC that impact human or animal health. In contrast, poultry are a recognized source of multiple antibiotic resistant ExPEC, while swine have received comparatively less attention in this regard. Here, we review what is known about ExPEC in swine and how pig production contributes to the problem of antibiotic resistance.
Prediction of molecular mimicry candidates in human pathogenic bacteria.
Doxey, Andrew C; McConkey, Brendan J
2013-08-15
Molecular mimicry of host proteins is a common strategy adopted by bacterial pathogens to interfere with and exploit host processes. Despite the availability of pathogen genomes, few studies have attempted to predict virulence-associated mimicry relationships directly from genomic sequences. Here, we analyzed the proteomes of 62 pathogenic and 66 non-pathogenic bacterial species, and screened for the top pathogen-specific or pathogen-enriched sequence similarities to human proteins. The screen identified approximately 100 potential mimicry relationships including well-characterized examples among the top-scoring hits (e.g., RalF, internalin, yopH, and others), with about 1/3 of predicted relationships supported by existing literature. Examination of homology to virulence factors, statistically enriched functions, and comparison with literature indicated that the detected mimics target key host structures (e.g., extracellular matrix, ECM) and pathways (e.g., cell adhesion, lipid metabolism, and immune signaling). The top-scoring and most widespread mimicry pattern detected among pathogens consisted of elevated sequence similarities to ECM proteins including collagens and leucine-rich repeat proteins. Unexpectedly, analysis of the pathogen counterparts of these proteins revealed that they have evolved independently in different species of bacterial pathogens from separate repeat amplifications. Thus, our analysis provides evidence for two classes of mimics: complex proteins such as enzymes that have been acquired by eukaryote-to-pathogen horizontal transfer, and simpler repeat proteins that have independently evolved to mimic the host ECM. Ultimately, computational detection of pathogen-specific and pathogen-enriched similarities to host proteins provides insights into potentially novel mimicry-mediated virulence mechanisms of pathogenic bacteria.
Metabolites produced by antagonistic microbes inhibit the principal avocado pathogens in vitro
Directory of Open Access Journals (Sweden)
Sara Ramírez R.
2015-04-01
Full Text Available The demand for Hass avocado in the global market exceeds the supply by over 50%. Colombia has a remarkable advantage as a producer in the region due to its high yields. However, the productivity of this crop can be seriously affected by diseases such as root rot, caused by Phytophthora cinnamomi, postharvest body rot and stem end rot, caused by Colletotrichum sp. and Phomopsis sp., respectively. The potential of 76 bacterial isolates obtained from avocado rhizosphere to produce inhibitory metabolites against avocado's pathogens was evaluated. The antagonistic effect of the rhizobacteria against P. cinnamomi, Colletotrichum sp. and Phomopsis sp. was tested through dual cultures. Thirty-six percent of the tested isolates presented inhibition halos against P. cinnamomi, 36% against Colletotrichum sp. and 67% against Phomopsis sp. Additionally, three isolates were selected for fermentation tests using different broth cultures. The extracts obtained from fermentations in the minimal medium of isolates ARP5.1 and AED06 showed inhibitory activity against the evaluated pathogens, but this effect was not observed with the AED26 extract. The media supplemented with copper chloride did not enhance activity of the extracts. These results suggest that using microbial metabolic extracts is a viable alternative for controlling avocado pathogens in vitro.
A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.
Directory of Open Access Journals (Sweden)
Boyang Cao
Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.
A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.
Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei
2014-01-01
Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776
Energy Technology Data Exchange (ETDEWEB)
Burnum-Johnson, Kristin E.; Kyle, Jennifer E.; Eisfeld, Amie J.; Casey, Cameron P.; Stratton, Kelly G.; Gonzalez, Juan F.; Habyarimana, Fabien; Negretti, Nicholas M.; Sims, Amy C.; Chauhan, Sadhana; Thackray, Larissa B.; Halfmann, Peter J.; Walters, Kevin B.; Kim, Young-Mo; Zink, Erika M.; Nicora, Carrie D.; Weitz, Karl K.; Webb-Robertson, Bobbie-Jo M.; Nakayasu, Ernesto S.; Ahmer, Brian; Konkel, Michael E.; Motin, Vladimir; Baric, Ralph S.; Diamond, Michael S.; Kawaoka, Yoshihiro; Waters, Katrina M.; Smith, Richard D.; Metz, Thomas O.
2017-01-01
The continued emergence and spread of infectious agents is of increasing concern due to increased population growth and the associated increased livestock production to meet food demands, increased urbanization and land-use changes, and greater travel. A systems biology approach to infectious disease research can significantly advance our understanding of host-pathogen relationships and facilitate the development of new therapies and vaccines. Molecular characterization of infectious samples outside of appropriate biosafety containment can only take place subsequent to pathogen inactivation. Herein, we describe a modified Folch extraction using chloroform/methanol that facilitates the molecular characterization of infectious samples by enabling simultaneous pathogen inactivation and extraction of proteins, metabolites, and lipids for subsequent mass spectrometry-based multi-omics measurements. This metabolite, protein and lipid extraction (MPLEx) method resulted in complete inactivation of bacterial and viral pathogens with exposed lipid membranes, including Yersinia pestis, Salmonella Typhimurium, and Campylobacter jejuni in pure culture, and Yersinia pestis, Campylobacter jejuni, West Nile, MERS-CoV, Ebola, and influenza H7N9 viruses in infection studies. Partial inactivation was observed for pathogens without exposed lipid membranes including 99.99% inactivation of community-associated methicillin-resistant Staphylococcus aureus, 99.6% and >99% inactivation of Clostridium difficile spores and vegetative cells, respectively, and 50% inactivation of adenovirus type 5. To demonstrate that MPLEx yields biomaterial of sufficient quality for subsequent multi-omics analyses, we highlight select proteomics, metabolomics and lipidomics data from human epithelial lung cells infected with wild-type and mutant forms of influenza H7N9. We believe that MPLEx will facilitate systems biology studies of infectious samples by enabling simultaneous pathogen inactivation and multi
Directory of Open Access Journals (Sweden)
Remco Stam
2017-01-01
Full Text Available Wild tomatoes are a valuable source of disease resistance germplasm for tomato (Solanum lycopersicum breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense, both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense. We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens (Alternaria solani, Phytophthora infestans and a Fusarium sp. and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense, resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved.
Scheikl, Daniela; Tellier, Aurélien
2017-01-01
Wild tomatoes are a valuable source of disease resistance germplasm for tomato (Solanum lycopersicum) breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense, both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense. We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens (Alternaria solani, Phytophthora infestans and a Fusarium sp.) and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense, resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved. PMID:28133579
Directory of Open Access Journals (Sweden)
Corinne P. Oechslin
2017-11-01
Full Text Available Abstract Background Throughout Europe, Ixodes ricinus transmits numerous pathogens. Its widespread distribution is not limited to rural but also includes urbanized areas. To date, comprehensive data on pathogen carrier rates of I. ricinus ticks in urban areas of Switzerland is lacking. Results Ixodes ricinus ticks sampled at 18 (sub- urban collection sites throughout Switzerland showed carrier rates of 0% for tick-borne encephalitis virus, 18.0% for Borrelia burgdorferi (sensu lato, 2.5% for Borrelia miyamotoi, 13.5% for Rickettsia spp., 1.4% for Anaplasma phagocytophilum, 6.2% for "Candidatus Neoehrlichia mikurensis", and 0.8% for Babesia venatorum (Babesia sp., EU1. Site-specific prevalence at collection sites with n > 45 ticks (n = 9 significantly differed for B. burgdorferi (s.l., Rickettsia spp., and "Ca. N. mikurensis", but were not related to the habitat type. Three hundred fifty eight out of 1078 I. ricinus ticks (33.2% tested positive for at least one pathogen. Thereof, about 20% (71/358 were carrying two or three different potentially disease-causing agents. Using next generation sequencing, we could detect true pathogens, tick symbionts and organisms of environmental or human origin in ten selected samples. Conclusions Our data document the presence of pathogens in the (sub- urban I. ricinus tick population in Switzerland, with carrier rates as high as those in rural regions. Carriage of multiple pathogens was repeatedly observed, demonstrating the risk of acquiring multiple infections as a consequence of a tick bite.
Enger, B D; Fox, L K; Gay, J M; Johnson, K A
2015-02-01
A. It can be concluded that different mastitis pathogen species and strains within species may possess different sensitivities to teat dips, which may have implications in selection of teat dips on dairies. Furthermore, a 30-s premilking dip contact time for iodophors and 15 s for H2O2 dips may be optimal in reducing pathogen load in the shortest amount of time. A reduction in premilking teat dip contact time may improve milking parlor efficiency. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Advances and Challenges in Genomic Selection for Disease Resistance.
Poland, Jesse; Rutkoski, Jessica
2016-08-04
Breeding for disease resistance is a central focus of plant breeding programs, as any successful variety must have the complete package of high yield, disease resistance, agronomic performance, and end-use quality. With the need to accelerate the development of improved varieties, genomics-assisted breeding is becoming an important tool in breeding programs. With marker-assisted selection, there has been success in breeding for disease resistance; however, much of this work and research has focused on identifying, mapping, and selecting for major resistance genes that tend to be highly effective but vulnerable to breakdown with rapid changes in pathogen races. In contrast, breeding for minor-gene quantitative resistance tends to produce more durable varieties but is a more challenging breeding objective. As the genetic architecture of resistance shifts from single major R genes to a diffused architecture of many minor genes, the best approach for molecular breeding will shift from marker-assisted selection to genomic selection. Genomics-assisted breeding for quantitative resistance will therefore necessitate whole-genome prediction models and selection methodology as implemented for classical complex traits such as yield. Here, we examine multiple case studies testing whole-genome prediction models and genomic selection for disease resistance. In general, whole-genome models for disease resistance can produce prediction accuracy suitable for application in breeding. These models also largely outperform multiple linear regression as would be applied in marker-assisted selection. With the implementation of genomic selection for yield and other agronomic traits, whole-genome marker profiles will be available for the entire set of breeding lines, enabling genomic selection for disease at no additional direct cost. In this context, the scope of implementing genomics selection for disease resistance, and specifically for quantitative resistance and quarantined pathogens
Harder, Robin; Heimersson, Sara; Svanström, Magdalena; Peters, Gregory M
2014-08-19
The environmental performance of wastewater and sewage sludge management is commonly assessed using life cycle assessment (LCA), whereas pathogen risk is evaluated with quantitative microbial risk assessment (QMRA). This study explored the application of QMRA methodology with intent to include pathogen risk in LCA and facilitate a comparison with other potential impacts on human health considered in LCA. Pathogen risk was estimated for a model wastewater treatment system (WWTS) located in an industrialized country and consisting of primary, secondary, and tertiary wastewater treatment, anaerobic sludge digestion, and land application of sewage sludge. The estimation was based on eight previous QMRA studies as well as parameter values taken from the literature. A total pathogen risk (expressed as burden of disease) on the order of 0.2-9 disability-adjusted life years (DALY) per year of operation was estimated for the model WWTS serving 28,600 persons and for the pathogens and exposure pathways included in this study. The comparison of pathogen risk with other potential impacts on human health considered in LCA is detailed in part 2 of this article series.
Mortality from selected diseases that can be transmitted by water - United States, 2003-2009.
Gargano, J W; Adam, E A; Collier, S A; Fullerton, K E; Feinman, S J; Beach, M J
2017-06-01
Diseases spread by water are caused by fecal-oral, contact, inhalation, or other routes, resulting in illnesses affecting multiple body systems. We selected 13 pathogens or syndromes implicated in waterborne disease outbreaks or other well-documented waterborne transmission (acute otitis externa, Campylobacter, Cryptosporidium, Escherichia coli (E. coli), free-living ameba, Giardia, Hepatitis A virus, Legionella (Legionnaires' disease), nontuberculous mycobacteria (NTM), Pseudomonas-related pneumonia or septicemia, Salmonella, Shigella, and Vibrio). We documented annual numbers of deaths in the United States associated with these infections using a combination of death certificate data, nationally representative hospital discharge data, and disease-specific surveillance systems (2003-2009). We documented 6,939 annual total deaths associated with the 13 infections; of these, 493 (7%) were caused by seven pathogens transmitted by the fecal-oral route. A total of 6,301 deaths (91%) were associated with infections from Pseudomonas, NTM, and Legionella, environmental pathogens that grow in water system biofilms. Biofilm-associated pathogens can cause illness following inhalation of aerosols or contact with contaminated water. These findings suggest that most mortality from these 13 selected infections in the United States does not result from classical fecal-oral transmission but rather from other transmission routes.
Prevalence of foodborne pathogens in food from selected African countries – a meta-analysis
DEFF Research Database (Denmark)
Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph
2017-01-01
for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78....../116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella......Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews...
Adenoid Reservoir for Pathogenic Biofilm Bacteria▿
Nistico, L.; Kreft, R.; Gieseke, A.; Coticchia, J. M.; Burrows, A.; Khampang, P.; Liu, Y.; Kerschner, J. E.; Post, J. C.; Lonergan, S.; Sampath, R.; Hu, F. Z.; Ehrlich, G. D.; Stoodley, P.; Hall-Stoodley, L.
2011-01-01
Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that adenoidectomy is effective in the treatment of COM, suggesting that the adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the adenoid, samples were obtained from 35 children undergoing adenoidectomy for chronic OM or obstructive sleep apnea. We used a novel, culture-independent molecular diagnostic methodology, followed by confocal microscopy, to investigate the in situ distribution and organization of pathogens in the adenoids to determine whether pathogenic bacteria exhibited criteria characteristic of biofilms. The Ibis T5000 Universal Biosensor System was used to interrogate the extent of the microbial diversity within adenoid biopsy specimens. Using a suite of 16 broad-range bacterial primers, we demonstrated that adenoids from both diagnostic groups were colonized with polymicrobial biofilms. Haemophilus influenzae was present in more adenoids from the COM group (P = 0.005), but there was no significant difference between the two patient groups for Streptococcus pneumoniae or Staphylococcus aureus. Fluorescence in situ hybridization, lectin binding, and the use of antibodies specific for host epithelial cells demonstrated that pathogens were aggregated, surrounded by a carbohydrate matrix, and localized on and within the epithelial cell surface, which is consistent with criteria for bacterial biofilms. PMID:21307211
Martín-Navarro, Carmen M; Lorenzo-Morales, Jacob; Cabrera-Serra, M Gabriela; Rancel, Fernando; Coronado-Alvarez, Nieves M; Piñero, José E; Valladares, Basilio
2008-11-01
Pathogenic strains of the genus Acanthamoeba are causative agents of a serious sight-threatening infection of the eye known as Acanthamoeba keratitis. The prevalence of this infection has risen in the past 20 years, mainly due to the increase in number of contact lens wearers. In this study, the prevalence of Acanthamoeba in a risk group constituted by asymptomatic contact lens wearers from Tenerife, Canary Islands, Spain, was evaluated. Contact lenses and contact lens cases were analysed for the presence of Acanthamoeba isolates. The isolates' genotypes were also determined after rDNA sequencing. The pathogenic potential of the isolated strains was subsequently established using previously described molecular and biochemical assays, which allowed the selection of three strains with high pathogenic potential. Furthermore, the sensitivity of these isolates against two standard drugs, ciprofloxacin and chlorhexidine, was analysed. As the three selected strains were sensitive to chlorhexidine, its activity and IC(50) were evaluated. Chlorhexidine was found to be active against these strains and the obtained IC(50) values were compared to the concentrations of this drug present in contact lens maintenance solutions. It was observed that the measured IC(50) was higher than the concentration found in these maintenance solutions. Therefore, the ineffectiveness of chlorhexidine-containing contact lens maintenance solutions against potentially pathogenic strains of Acanthamoeba is demonstrated in this study.
Regulatory Proteolysis in Arabidopsis-Pathogen Interactions.
Pogány, Miklós; Dankó, Tamás; Kámán-Tóth, Evelin; Schwarczinger, Ildikó; Bozsó, Zoltán
2015-09-24
Approximately two and a half percent of protein coding genes in Arabidopsis encode enzymes with known or putative proteolytic activity. Proteases possess not only common housekeeping functions by recycling nonfunctional proteins. By irreversibly cleaving other proteins, they regulate crucial developmental processes and control responses to environmental changes. Regulatory proteolysis is also indispensable in interactions between plants and their microbial pathogens. Proteolytic cleavage is simultaneously used both by plant cells, to recognize and inactivate invading pathogens, and by microbes, to overcome the immune system of the plant and successfully colonize host cells. In this review, we present available results on the group of proteases in the model plant Arabidopsis thaliana whose functions in microbial pathogenesis were confirmed. Pathogen-derived proteolytic factors are also discussed when they are involved in the cleavage of host metabolites. Considering the wealth of review papers available in the field of the ubiquitin-26S proteasome system results on the ubiquitin cascade are not presented. Arabidopsis and its pathogens are conferred with abundant sets of proteases. This review compiles a list of those that are apparently involved in an interaction between the plant and its pathogens, also presenting their molecular partners when available.
Effects of selective digestive decontamination (SDD) on the gut resistome
Buelow, E.; Bello Gonzalez, T.D.G.; Versluis, D.; Oostdijk, E.A.N.; Ogilvie, L.A.; Mourik, van M.S.M.; Oosterink, L.; Passel, van M.W.J.; Smidt, H.; D’Andrea, M.M.; Been, de M.; Jones, B.V.; Willems, R.J.L.; Bonten, M.J.M.; Schaik, W.
2014-01-01
Objectives Selective digestive decontamination (SDD) is an infection prevention measure for critically ill patients in intensive care units (ICUs) that aims to eradicate opportunistic pathogens from the oropharynx and intestines, while sparing the anaerobic flora, by the application of
Pathogen Decontamination of Food Crop Soil: A Review.
Gurtler, Joshua B
2017-09-01
The purpose of this review is to delineate means of decontaminating soil. This information might be used to mitigate soil-associated risks of foodborne pathogens. The majority of the research in the published literature involves inactivation of plant pathogens in soil, i.e., those pathogens harmful to fruit and vegetable production and ornamental plants. Very little has been published regarding the inactivation of foodborne human pathogens in crop soil. Nevertheless, because decontamination techniques for plant pathogens might also be useful methods for eliminating foodborne pathogens, this review also includes inactivation of plant pathogens, with appropriate discussion and comparisons, in the hopes that these methods may one day be validated against foodborne pathogens. Some of the major soil decontamination methods that have been investigated and are covered include chemical decontamination (chemigation), solarization, steaming, biofumigation, bacterial competitive exclusion, torch flaming, microwave treatment, and amendment with biochar. Other innovative means of inactivating foodborne pathogens in soils may be discovered and explored in the future, provided that these techniques are economically feasible in terms of chemicals, equipment, and labor. Food microbiology and food safety researchers should reach out to soil scientists and plant pathologists to create links where they do not currently exist and strengthen relationships where they do exist to take advantage of multidisciplinary skills. In time, agricultural output and the demand for fresh produce will increase. With advances in the sensitivity of pathogen testing and epidemiological tracebacks, the need to mitigate preharvest bacterial contamination of fresh produce will become paramount. Hence, soil decontamination technologies may become more economically feasible and practical in light of increasing the microbial safety of fresh produce.
Terrazas, Marc M; Anderson, Cort L; Jacobs, Sarah J; Cain, Kenneth D
2018-05-25
In response to population declines of Burbot Lota lota maculosa, conservation aquaculture methods have been developed for this species. In general, Burbot are relatively resistant to many salmonid pathogens; however, cultured juvenile Burbot have experienced periodic epizootic disease outbreaks during production. A series of trials were conducted to determine the virulence of select bacteria isolated from juvenile Burbot following outbreaks that occurred in 2012 and 2013 at the University of Idaho's Aquaculture Research Institute. Initial clinical diagnostics and sampling resulted in the isolation of numerous putative bacterial pathogens. To determine which bacteria were the most likely causative agents contributing to these epizootics, juvenile Burbot were injectied intraperitoneally (IP) with select bacteria in log phase growth. Mortality associated with specific isolates was recorded, and more comprehensive challenges followed this initial screening. These challenges used side-by-side IP and immersion methods to expose Burbot to potential pathogens. The challenges resulted in significantly higher mortalities in fish following IP injection of two Aeromonas sp. isolates compared to controls (P ≤ 0.01), but no difference in mortality for immersion challenged groups was observed (P = 0.42). Results demonstrate that two isolates (Aeromonas sp.) cultured from the epizootics are virulent to Burbot. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2014-01-31
Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in
Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A
2010-01-01
Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.
Pathogenicity of highly pathogenic avian influenza virus in mammals
de Wit, Emmie; Kawaoka, Yoshihiro; de Jong, Menno D.; Fouchier, Ron A. M.
2008-01-01
In recent years, there has been an increase in outbreaks of highly pathogenic avian influenza (HPAI) in poultry. Occasionally, these outbreaks have resulted in transmission of influenza viruses to humans and other mammals, with symptoms ranging from conjunctivitis to pneumonia and death. Here, the
Protein Disulfide Isomerase and Host-Pathogen Interaction
Directory of Open Access Journals (Sweden)
Beatriz S. Stolf
2011-01-01
Full Text Available Reactive oxygen species (ROS production by immunological cells is known to cause damage to pathogens. Increasing evidence accumulated in the last decade has shown, however, that ROS (and redox signals functionally regulate different cellular pathways in the host-pathogen interaction. These especially affect (i pathogen entry through protein redox switches and redox modification (i.e., intra- and interdisulfide and cysteine oxidation and (ii phagocytic ROS production via Nox family NADPH oxidase enzyme and the control of phagolysosome function with key implications for antigen processing. The protein disulfide isomerase (PDI family of redox chaperones is closely involved in both processes and is also implicated in protein unfolding and trafficking across the endoplasmic reticulum (ER and towards the cytosol, a thiol-based redox locus for antigen processing. Here, we summarise examples of the cellular association of host PDI with different pathogens and explore the possible roles of pathogen PDIs in infection. A better understanding of these complex regulatory steps will provide insightful information on the redox role and coevolutional biological process, and assist the development of more specific therapeutic strategies in pathogen-mediated infections.
Pathogenicity of Shigella in chickens.
Shi, Run; Yang, Xia; Chen, Lu; Chang, Hong-tao; Liu, Hong-ying; Zhao, Jun; Wang, Xin-wei; Wang, Chuan-qing
2014-01-01
Shigellosis in chickens was first reported in 2004. This study aimed to determine the pathogenicity of Shigella in chickens and the possibility of cross-infection between humans and chickens. The pathogenicity of Shigella in chickens was examined via infection of three-day-old SPF chickens with Shigella strain ZD02 isolated from a human patient. The virulence and invasiveness were examined by infection of the chicken intestines and primary chicken intestinal epithelial cells. The results showed Shigella can cause death via intraperitoneal injection in SPF chickens, but only induce depression via crop injection. Immunohistochemistry and transmission electron microscopy revealed the Shigella can invade the intestinal epithelia. Immunohistochemistry of the primary chicken intestinal epithelial cells infected with Shigella showed the bacteria were internalized into the epithelial cells. Electron microscopy also confirmed that Shigella invaded primary chicken intestinal epithelia and was encapsulated by phagosome-like membranes. Our data demonstrate that Shigella can invade primary chicken intestinal epithelial cells in vitro and chicken intestinal mucosa in vivo, resulting in pathogenicity and even death. The findings suggest Shigella isolated from human or chicken share similar pathogenicity as well as the possibility of human-poultry cross-infection, which is of public health significance.
Polymers for binding of the gram-positive oral pathogen Streptococcus mutans
Magennis, Eugene P.; Francini, Nora; Mastrotto, Francesca; Catania, Rosa; Redhead, Martin; Fernandez-Trillo, Francisco; Bradshaw, David; Churchley, David; Winzer, Klaus; Alexander, Cameron
2017-01-01
Streptococcus mutans is the most significant pathogenic bacterium implicated in the formation of dental caries and, both directly and indirectly, has been associated with severe conditions such as multiple sclerosis, cerebrovascular and peripheral artery disease. Polymers able to selectively bind S. mutans and/or inhibit its adhesion to oral tissue in a non-lethal manner would offer possibilities for addressing pathogenicity without selecting for populations resistant against bactericidal agents. In the present work two libraries of 2-(dimethylamino)ethyl methacrylate (pDMAEMA)-based polymers were synthesized with various proportions of either N,N,N-trimethylethanaminium cationic- or sulfobetaine zwitterionic groups. These copolymers where initially tested as potential macromolecular ligands for S. mutans NCTC 10449, whilst Escherichia coli MG1655 was used as Gram-negative control bacteria. pDMAEMA-derived materials with high proportions of zwitterionic repeating units were found to be selective for S. mutans, in both isolated and S. mutans–E. coli mixed bacterial cultures. Fully sulfobetainized pDMAEMA was subsequently found to bind/cluster preferentially Gram-positive S. mutans and S. aureus compared to Gram negative E. coli and V. harveyi. A key initial stage of S. mutans pathogenesis involves a lectin-mediated adhesion to the tooth surface, thus the range of potential macromolecular ligands was further expanded by investigating two glycopolymers bearing α-mannopyranoside and β-galactopyranoside pendant units. Results with these polymers indicated that preferential binding to either S. mutans or E. coli can be obtained by modulating the glycosylation pattern of the chosen multivalent ligands without incurring unacceptable cytotoxicity in a model gastrointestinal cell line. Overall, our results allowed to identify a structure–property relationship for the potential antimicrobial polymers investigated, and suggest that preferential binding to Gram-positive S
Guo, Yue Ping; Wong, Po Ming; Li, Yi; Or, Peggy Pui Lai
2012-08-01
Surgical teams rely on surgical gloves as a barrier to protect themselves against blood-borne pathogenic infections during surgery. Double-gloving is adopted by surgeons to tackle the problem of glove perforation. Nevertheless, double-gloving is not practiced commonly by operating room nurses and there are only limited studies about double-gloving that targets only perioperative nurses. The aim of this research was to assess the effectiveness of double-gloving in protecting perioperative nurses by comparing the frequency of glove perforation between single-gloving and double-gloving groups. A prospective and randomized study was performed. Nurses were assigned randomly to single-gloved and double-gloved groups for comparison of the glove perforation rate. Water-leakage and air-inflation tests were used to detect glove perforation. Glove perforations was detected in 10 of 112 sets of single-gloves (8.9%) and 12 of 106 sets of outer gloves in the double-gloved group (11.3%). There was no inner double-glove perforation (0%). Glove perforations were found in 6 and 4 of the 112 sets of single-gloves for the first assistants (5.36%) and the scrub nurses (3.57%), and 5 and 7 of 106 sets of outer gloves in the double-gloved group for the first assistants (4.72%) and the scrub nurses (6.60%), respectively. The average occurrence of perforation was 69.8 minutes (range, 20-110 min) after the beginning of surgery. The sites of perforation were localized mostly on the left middle finger (42%) and the left ring finger (33.3%). Based on the findings of the study, double-gloving is indeed effective in protecting operating room nurses against blood-borne pathogen exposure. It should be introduced as a routine practice. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Bianco Aida
2013-02-01
Full Text Available Abstract Background Evidence exists regarding the full prevention of HCV transmission to hemodialysis patients by implementing universal precaution. However, little information is available regarding the frequency with which hospitals have adopted evidence-based practices for preventing HCV infection among hemodialysis patients. A cross-sectional survey has been conducted among nurses in Calabria region (Italy in order to acquire information about the level of knowledge, the attitudes and the frequencies of evidence-based practices that prevent hospital transmission of HCV. Methods All 37 hemodialysis units (HDU of Calabria were included in the study and all nurses were invited to participate in the study and to fill in a self-administered questionnaire. Results 90% of the nurses working in HDU participated in the study. Correct answers about HCV pattern of transmission ranged from 73.7% to 99.3% and were significantly higher in respondents who knew that isolation of HCV-infected patients is not recommended and among those who knew that previous bloodstream infections should be included in medical record and among nurses with fewer years of practice. Most correctly thought that evidence-based infection control measures provide adequate protection against transmission of bloodborne pathogens among healthcare workers. Positive attitude was significantly higher among more knowledgeable nurses. Self-reporting of appropriate handwashing procedures were significantly more likely in nurses who were aware that transmission of bloodborne pathogens among healthcare workers may be prevented through adoption of evidence-based practices and with a correct knowledge about HCV transmission patterns. Conclusions Behavior changes should be aimed at abandoning outdated practices and adopting and maintaining evidence-based practices. Initiatives focused at enabling and reinforcing adherence to effective prevention practices among nurses in HDU are strongly needed.
Tracing pathogens in the food chain
Brul, S.; Fratamico, P.M.; McMeekin, T.A.
2010-01-01
Successful methods for the detection and investigation of outbreaks of foodborne disease are essential for ensuring consumer safety. Increased understanding of the transmission of pathogens in food chains will also assist efforts to safeguard public health. Tracing pathogens in the food chain
Natural Selection in Virulence Genes of Francisella tularensis.
Gunnell, Mark K; Robison, Richard A; Adams, Byron J
2016-06-01
A fundamental tenet of evolution is that alleles that are under negative selection are often deleterious and confer no evolutionary advantage. Negatively selected alleles are removed from the gene pool and are eventually extinguished from the population. Conversely, alleles under positive selection do confer an evolutionary advantage and lead to an increase in the overall fitness of the organism. These alleles increase in frequency until they eventually become fixed in the population. Francisella tularensis is a zoonotic pathogen and a potential biothreat agent. The most virulent type of F. tularensis, Type A, is distributed across North America with Type A.I occurring mainly in the east and Type A.II appearing mainly in the west. F. tularensis is thought to be a genome in decay (losing genes) because of the relatively large number of pseudogenes present in its genome. We hypothesized that the observed frequency of gene loss/pseudogenes may be an artifact of evolution in response to a changing environment, and that genes involved in virulence should be under strong positive selection. To test this hypothesis, we sequenced and compared whole genomes of Type A.I and A.II isolates. We analyzed a subset of virulence and housekeeping genes from several F. tularensis subspecies genomes to ascertain the presence and extent of positive selection. Eleven previously identified virulence genes were screened for positive selection along with 10 housekeeping genes. Analyses of selection yielded one housekeeping gene and 7 virulence genes which showed significant evidence of positive selection at loci implicated in cell surface structures and membrane proteins, metabolism and biosynthesis, transcription, translation and cell separation, and substrate binding and transport. Our results suggest that while the loss of functional genes through disuse could be accelerated by negative selection, the genome decay in Francisella could also be the byproduct of adaptive evolution
Food-borne pathogens, health and role of dietary phytochemicals.
Shetty, K; Labbe, R G
1998-12-01
Infectious diseases transmitted by food have become a major public health concern in recent years. In the USA alone, there are an estimated 6-33 million cases each year. The list of responsible agents continues to grow. In the past 20 years some dozen new pathogens that are primarily food-borne have been identified. Fruits and vegetables, often from the global food market, have been added to the traditional vehicles of food-borne illness; that is, undercooked meat, poultry, seafood, or unpasteurized milk. Such products are minimally processed and have fewer barriers to microbial growth such as salt, sugar or preservatives. The evolution of the epidemiology of food-borne illness requires a rethinking of traditional, though still valid, solutions for their prevention. Among various strategies to prevent food-borne pathogens, use of dietary phytochemicals is promising. The major obstacle in the use of dietary phytochemical is the consistency of phytochemicals in different foods due to their natural genetic variation. We have developed a novel tissue-culture-based selection strategy to isolate elite phenolic phytochemical-producing clonal lines of species belonging to the family Lamiaceae. Among several species we have targeted elite clonal lines of thyme (Thymus vulgaris) and oregano (Origanum vulgare) against Escherichia coli and Clostridium perfrigens in fresh and processed meats. We are also evaluating high phenolic profile-containing clonal lines of basil (Ocimum basilicum) to inhibit gastric ulcer-causing Helicobacter pylori. Other elite lines of the members of the family Lamiaceae, rosemary (Rosmarinus officinalis) and salvia (Salvia officinalis) also hold promise against a wide range of food pathogens such as Salmonella species in poultry products and Vibrio species in seafood.
Wang, Shu-Xia; Zhang, Jia-Ming; Wu, Kai; Chen, Juan; Shi, Jian-Feng
2014-08-01
To investigate the pathogenic infection and its drug resistance in expressed prostatic secretion (EPS) and its correlation with serum PSA, and provide some evidence for the systematic and normalized diagnosis and treatment of prostatitis. Three EPS swabs were collected from each of the 320 prostatis patients following measurement of the serum PSA level, 1 for bacterial culture and identification, 1 for detection of Mycoplasma and drug sensitivity, and the other for examination of Chlamydia trachomatis antigen by colloidal gold immunoblot. Totally 244 strains were isolated from the 320 EPS samples, including 188 bacterial strains (dominated by Staphylococcus and sensitive to vancomycin or linezolid) and 44 Mycoplasma and Chlamydia strains (mainly Ureaplasma urealyticum and susceptible to josamycin or doxycycline). The serum PSA level was significantly higher in the pathogen-positive than in the pathogen-negative group ([6.98 +/- 0.56] microg/L vs [2.32 +/- 0.12] microg/L, P Prostatitis may lead to the elevation of the serum PSA level and the pathogens involved vary in their resistance to different antibacterial spectrums. Therefore, appropriate and individualized antibiotic therapy should be selected according to etiological diagnosis and the results of drug sensitivity test.
Inhibition of Fungal Pathogens across Genotypes and Temperatures by Amphibian Skin Bacteria
Directory of Open Access Journals (Sweden)
Carly R. Muletz-Wolz
2017-08-01
Full Text Available Symbiotic bacteria may dampen the impacts of infectious diseases on hosts by inhibiting pathogen growth. However, our understanding of the generality of pathogen inhibition by different bacterial taxa across pathogen genotypes and environmental conditions is limited. Bacterial inhibitory properties are of particular interest for the amphibian-killing fungal pathogens (Batrachochytrium dendrobatidis and Batrachochytrium salamandrivorans, for which probiotic applications as conservation strategies have been proposed. We quantified the inhibition strength of five putatively B. dendrobatidis-inhibitory bacteria isolated from woodland salamander skin against six Batrachochytrium genotypes at two temperatures (12 and 18°C. We selected six genotypes from across the Batrachochytrium phylogeny: B. salamandrivorans, B. dendrobatidis-Brazil and four genotypes of the B. dendrobatidis Global Panzootic Lineage (GPL1: JEL647, JEL404; GPL2: SRS810, JEL423. We performed 96-well plate challenge assays in a full factorial design. We detected a Batrachochytrium genotype by temperature interaction on bacterial inhibition score for all bacteria, indicating that bacteria vary in ability to inhibit Batrachochytrium depending on pathogen genotype and temperature. Acinetobacter rhizosphaerae moderately inhibited B. salamandrivorans at both temperatures (μ = 46–53%, but not any B. dendrobatidis genotypes. Chryseobacterium sp. inhibited three Batrachochytrium genotypes at both temperatures (μ = 5–71%. Pseudomonas sp. strain 1 inhibited all Batrachochytrium genotypes at 12°C and four Batrachochytrium genotypes at 18°C (μ = 5–100%. Pseudomonas sp. strain 2 and Stenotrophomonas sp. moderately to strongly inhibited all six Batrachochytrium genotypes at both temperatures (μ = 57–100%. All bacteria consistently inhibited B. salamandrivorans. Using cluster analysis of inhibition scores, we found that more closely related Batrachochytrium genotypes grouped together
Giacopuzzi, Edoardo; Laffranchi, Mattia; Berardelli, Romina; Ravasio, Viola; Ferrarotti, Ilaria; Gooptu, Bibek; Borsani, Giuseppe; Fra, Annamaria
2018-06-07
The growth of publicly available data informing upon genetic variations, mechanisms of disease and disease sub-phenotypes offers great potential for personalised medicine. Computational approaches are likely required to assess large numbers of novel genetic variants. However, the integration of genetic, structural and pathophysiological data still represents a challenge for computational predictions and their clinical use. We addressed these issues for alpha-1-antitrypsin deficiency, a disease mediated by mutations in the SERPINA1 gene encoding alpha-1-antitrypsin. We compiled a comprehensive database of SERPINA1 coding mutations and assigned them apparent pathological relevance based upon available data. 'Benign' and 'Pathogenic' mutations were used to assess performance of 31 pathogenicity predictors. Well-performing algorithms clustered the subset of variants known to be severely pathogenic with high scores. Eight new mutations identified in the ExAC database and achieving high scores were selected for characterisation in cell models and showed secretory deficiency and polymer formation, supporting the predictive power of our computational approach. The behaviour of the pathogenic new variants and consistent outliers were rationalised by considering the protein structural context and residue conservation. These findings highlight the potential of computational methods to provide meaningful predictions of the pathogenic significance of novel mutations and identify areas for further investigation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.