The historical role of species from the Solanaceae plant family in genetic research

OpenAIRE

Gebhardt, Christiane

2016-01-01

Key message This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Abstract Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100?years...

Prolonged Adaptive Evolution of a Defensive Gene in the Solanaceae.

Science.gov (United States)

Rausher, Mark D; Huang, Jie

2016-01-01

Although plants and their natural enemies may coevolve for prolonged periods, little is known about how long individual plant defensive genes are involved in the coevolutionary process. We address this issue by examining patterns of selection on the defensive gene threonine deaminase (TD). Tomato (Solanum lycopersicum) has two copies of this gene. One performs the canonical housekeeping function in amino acid metabolism of catalyzing the first reaction in the conversion of threonine to isoleucine. The second copy functions as an antinutritive defense against lepidopteran herbivores by depleting threonine in the insect gut. Wild tobacco (Nicotiana attenuata) also contains a defensive copy. We show that a single copy of TD underwent two or three duplications near the base of the Solanaceae. One copy retains the housekeeping function, whereas a second copy evolved defensive functions. Positive selection occurred on the branch of the TD2 gene tree subtending the common ancestor of the Nicotianoideae and Solanoideae. It also occurred within the Solanoideae clade but not within the Nicotianoideae clade. Finally, it occurred on most branches leading from the common ancestor to S. lycopersicum. Based on recent calibrations of the Solanaceae phylogeny, TD2 experienced adaptive substitutions for a period of 30-50 My. We suggest that the most likely explanation for this result is fluctuating herbivore abundances: When herbivores are rare, relaxed selection increases the likelihood that slightly disadvantageous mutations will be fixed by drift; when herbivores are common, increased selection causes the evolution of compensatory adaptive mutations. Alternative explanations are also discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Solanaceae plant malformation in Chongqing City, China, reveals a pollution threat to the Yangtze River.

Science.gov (United States)

Zhang, Hongbo; Liu, Guanshan; Timko, Michael P; Li, Jiana; Wang, Wenjing; Ma, Haoran

2014-10-21

Water quality is under increasing threat from industrial and natural sources of pollutants. Here, we present our findings about a pollution incident involving the tap water of Chongqing City in China. In recent years, Solanaceae plants grown in greenhouses in this city have displayed symptoms of cupped, strappy leaves. These symptoms resembled those caused by chlorinated auxinic herbicides. We have determined that these symptoms were caused by the tap water used for irrigation. Using a bioactivity-guided fractionation method, we isolated a substance with corresponding auxinic activity from the tap water. The substance was named "solanicide" because of its strong bioactivity against Solanaceae plants. Further investigation revealed that the solanicide in the water system of Chongqing City is derived from the Jialing River, a major tributary of the Yangtze River. Therefore, it is also present in the Yangtze River downstream of Chongqing after the inflow of the Jialing River. Biological analyses indicated that solanicide is functionally similar to, but distinct from, other known chlorinated auxinic herbicides. Chemical assays further showed that solanicide structurally differs from those compounds. This study has highlighted a water pollution threat to the Yangtze River and its floodplain ecosystem.

Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

Directory of Open Access Journals (Sweden)

Danila Montewka Melotto-Passarin

2008-01-01

Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

Caavuranamide, a novel steroidal alkaloid from the ripe fruits of Solanum caavurana Vell. (Solanaceae)

Energy Technology Data Exchange (ETDEWEB)

Vaz, Nelissa Pacheco; Santos, Erica L.; Marques, Francisco A.; Maia, Beatriz H.L.N. Sales, E-mail: noronha@ufpr.br [Departamento de Quimica, Universidade Federal do Parana, Centro Politecnico, Curitiba, PR (Brazil); Costa, Emmanoel V. [Departamento de Quimica, Universidade Federal de Sergipe, Sao Cristovao, SE (Brazil); Mikich, Sandra Bos [Laboratorio de Ecologia, Embrapa Florestas, Colombo, PR (Brazil); Braga, Raquel M. [Instituto de Quimica, Universidade Estadual de Campinas, SP (Brazil); Delarmelina, Camila; Duarte, Marta C.T. [Divisao de Microbiologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil); Duarte, Marta C.T.; Ruiz, Ana Lucia T.G.; Souza, Vanessa H.S.; Carvalho, Joao E. de [Divisa de Farmacologia e Toxicologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil)

2012-07-01

Phytochemical investigation of the ripe fruits of Solanum caavurana Vell. (Solanaceae) afforded a novel steroidal alkaloid with spirosolane-type skeleton, named as caavuranamide, together with the alkaloids 4-tomatiden-3-one and 5{alpha}-tomatidan-3-one. Their structures were elucidated on the basis of spectroscopic methods. The antiproliferative and antimicrobial activities for the ethanolic extract, sub-fractions obtained from partition and acid-base treatment were also evaluated. Caavuranamide showed antibacterial activity similar to the chloramphenicol positive control against Rhodococcus equi. (author)

Caavuranamide, a novel steroidal alkaloid from the ripe fruits of Solanum caavurana Vell. (Solanaceae)

International Nuclear Information System (INIS)

Vaz, Nelissa Pacheco; Santos, Erica L.; Marques, Francisco A.; Maia, Beatriz H.L.N. Sales; Costa, Emmanoel V.; Mikich, Sandra Bos; Braga, Raquel M.; Delarmelina, Camila; Duarte, Marta C.T.; Duarte, Marta C.T.; Ruiz, Ana Lucia T.G.; Souza, Vanessa H.S.; Carvalho, Joao E. de

2012-01-01

Phytochemical investigation of the ripe fruits of Solanum caavurana Vell. (Solanaceae) afforded a novel steroidal alkaloid with spirosolane-type skeleton, named as caavuranamide, together with the alkaloids 4-tomatiden-3-one and 5α-tomatidan-3-one. Their structures were elucidated on the basis of spectroscopic methods. The antiproliferative and antimicrobial activities for the ethanolic extract, sub-fractions obtained from partition and acid-base treatment were also evaluated. Caavuranamide showed antibacterial activity similar to the chloramphenicol positive control against Rhodococcus equi. (author)

Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

Science.gov (United States)

Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

2016-05-01

Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Taxonomic synopsis and analytical key for the genera of Solanaceae from Rio Grande do Sul, Brazil Sinopse taxonômica e chave ilustrada dos gêneros de Solanaceae ocorrentes no Rio Grande do Sul, Brasil

Directory of Open Access Journals (Sweden)

Edson Luís de Carvalho Soares

2011-06-01

Full Text Available This work consists of a taxonomic synopsis of the genera of Solanaceae in Rio Grande do Sul state, Brazil. Solanaceae is represented by 28 genera in this state: Acnistus Schott, Athenaea Sendtn., Aureliana Sendtn., Bouchetia Dunal, Browalia L., Brugmansia Pers., Brunfelsia L., Calibrachoa La Llave & Lex., Capsicum L., Cestrum L., Datura L., Dyssochroma Miers, Grabowskia Schltdl., Jaborosa Juss., Lycianthes (Dunal Hassl., Melananthus Walp., Nicandra Adans., Nicotiana L., Nierembergia Ruiz & Pav., Petunia Juss., Physalis L., Salpichroa Miers, Schwenckia L., Sessea Ruiz & Pav., Solandra Sw., Solanum L. (including Cyphomandra Sendtn. and Lycopersicon Mill., Streptosolen Miers and Vassobia Rusby. Of these, 23 consist of native species , while five are represented exclusively by introduced species. The total number of species is 149, of which 118 are native and 31 are introduced (adventitious or cultivated. An identification key for genera, and also comments on the most relevant taxonomic characters of each one are presented, plus comments on the species that occur in Rio Grande do Sul state.Este trabalho consiste em uma sinopse taxonômica dos gêneros de Solanaceae no Estado do Rio Grande do Sul, Brasil. Constatou-se a ocorrência de 28 gêneros: Acnistus Schott, Athenaea Sendtn., Aureliana Sendtn., Bouchetia Dunal, Browalia L., Brugmansia Pers., Brunfelsia L., Calibrachoa La Llave & Lex., Capsicum L., Cestrum L., Datura L., Dyssochroma Miers, Grabowskia Schltdl., Jaborosa Juss., Lycianthes (Dunal Hassl., Melananthus Walp., Nicandra Adans., Nicotiana L., Nierembergia Ruiz & Pav., Petunia Juss., Physalis L., Salpichroa Miers, Schwenckia L., Sessea Ruiz & Pav., Solandra Sw., Solanum L. (incluindo Cyphomandra Sendtn. e Lycopersicon Mill., Streptosolen Miers e Vassobia Rusby. Destes, 23 apresentam espécies nativas, enquanto cinco estão representados exclusivamente por espécies introduzidas. O número total de espécies é de 149, sendo que 118 s

Antifungal glycoalkaloids, flavonoids and other chemical constituents of Solanum asperum Rich (Solanaceae)

International Nuclear Information System (INIS)

Pinto, Francisco das Chagas L.; Uchoa, Daniel Esdras de A.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo; Silva, Fernanda M. e; Theodoro, Phellipe N.E.T.; Espindola, Laila S.

2011-01-01

Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-alpha-L-ramnopyranosyl-kaempferol and 3-O-[beta-D-glucopyranosyl-(1->6)-alpha-L-ramnopyranosyl ]-7-O-alpha-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae). The structures of all compounds were determined by interpretation of their spectra (IR, MS, 1 H and 13 C NMR) and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 mug/mL) against four filamentous fungi species of the genera Microsporum and Trichophyton. (author)

Estudo Farmacognóstico e Screening Biológico de Solanum lycocarpum St. Hill (Solanaceae)

OpenAIRE

Martins, Gilmarcio Zimmermann [UNESP

2013-01-01

Devido ao negligenciamento e ao aumento de números de casos das doenças microbianas e parasitárias no Brasil, o aprimoramento da investigação científica e tecnológica na área de plantas medicinais faz-se indispensável para à busca de novos produtos antimicrobianos e antiparasitários. A Solanum lycocarpum St. Hill. (Solanaceae) é uma planta medicinal tradicionalmente utilizada na forma de polvilho de lobeira como terapia complementar para o tratamento do Diabetes Mellitus, hipocolesterolêmico ...

Isolation barriers between petunia axillaris and Petunia integrifolia (Solanaceae).

Science.gov (United States)

Dell'olivo, Alexandre; Hoballah, Maria Elena; Gübitz, Thomas; Kuhlemeier, Cris

2011-07-01

The isolation barriers restricting gene flow between populations or species are of crucial interest for understanding how biological species arise and how they are maintained. Few studies have examined the entire range of possible isolation barriers from geographic isolation to next generation hybrid viability. Here, we present a detailed analysis of isolation barriers between two flowering plant species of the genus Petunia (Solanaceae). Petunia integrifolia and P. axillaris feature divergent pollination syndromes but can produce fertile hybrids when crossed in the laboratory. Both Petunia species are primarily isolated in space but appear not to hybridize in sympatry. Our experiments demonstrate that pollinator isolation is very high but not strong enough to explain the absence of hybrids in nature. However, pollinator isolation in conjunction with male gametic isolation (i.e., pollen-pistil interaction) can explain the lack of natural hybridization, while postzygotic isolation barriers are low or nonexistent. Our study supports the notion that reproductive isolation in flowering plants is mainly caused by pre- rather than postzygotic isolation mechanisms. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

Highly Oxygenated Flavonoids from the Leaves of Nicotiana plumbaginifolia (Solanaceae

Directory of Open Access Journals (Sweden)

Md. Shafiullah Shajib

2017-11-01

Full Text Available Nicotiana plumbaginifolia Viv. is an annual herb of the family Solanaceae, which grows abundantly in the weedy lands of Bangladesh . This plant possesses analgesic, antibacterial, anti-anxiety and hepatoprotective properties, and produces various phenolic compounds including flavonoids. The present study afforded determination of total phenolic and flavonoid contents, and for the first time, the isolation and characterization of highly oxygenated flavonoids, e.g., 3,3' ,5,6,7,8-hexamethoxy- 4',5'-methylenedioxyflavone (1, 3,3' ,4' ,5',5,6,7,8-octamethoxyflavone (2, exoticin, 6,7,4',5'-dimethylenedioxy-3,5,3'-trimethoxyflavone (3 and ( 3,3' ,4',5,5',8-hexamethoxy-6,7-methylenedioxyflavone (4 from the leaves of N. plumbaginifolia . All these flavonoids are rather rare natural products, and only found in a few genera, e.g.,Polygonum and Murraya. The structures of the isolated flavonoids were elucidated by comprehensive spectroscopic analyses, e.g., UV, 1H, 13C NMR, DEPT, HSQC, HMBC and MS.

Pollen morphology and study of the visitors (Hymenoptera, Apidae) of Solanum stramoniifolium Jacq. (Solanaceae) in Central Amazon

OpenAIRE

Silva,Alexandre Coletto da; Kinupp,Valdely Ferreira; Absy,Maria Lucia; Kerr,Warwick Estevam

2004-01-01

The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The poll...

Estudios en Solanaceae – XXIII sobre dos especies nuevas de cuatresia Estudios en Solanaceae – XXIII sobre dos especies nuevas de Cuatresia

Directory of Open Access Journals (Sweden)

Hunziker Armando T.

1986-12-01

Full Text Available Two new Colombian species of Cuatre sia (Solanaceae, are clescribed and illustrated. Con motivo de la preparación de una sinopsis preliminar sobre Cuatresia A. T. Hunz., ha quedado en evidencia una serie de especies indescritas, 2 de las cuales presento seguidamente.  Es esta una buena oportunidad para llamar la atención de los colegas sobre este difícil y olvidado género de Solanáceas.  En su gran mayoría, las dificultades se originan en los materiales disponibles, que son escasos y fragmentarios; varias especies se conocen por una única colección (a veces con apenas 1 o 2 flores, en la mayoría se ignora cómo son el fruto, la semilla y el embrión, y en otros casos, las observaciones sobre el color de la corola son contradictorias, o imprecisas, o faltan por completo. Por todo ello, quisiera incitar a quienes tienen el privilegio de acceder a las regiones donde crecen estas plantas, a que extremen los recaudos para que las colecciones de Cuatresia mejoren en calidad y cantidad.

Parasitoids (Hymenoptera: Braconidae: Aphidiinae) attacking aphids feeding on solanaceae and cucurbitaceae crops in Southeastern Europe: Aphidiine-aphid-plant associations and key

Czech Academy of Sciences Publication Activity Database

Kavallieratos, N. G.; Tomanović, Ž.; Starý, Petr; Žikić, V.; Petrović-Obradović, O.

2010-01-01

Roč. 103, č. 2 (2010), s. 153-164 ISSN 0013-8746 R&D Projects: GA AV ČR IBS5007102 Grant - others:The Ministry of Science and Environment Protection(CS) 143006B Institutional research plan: CEZ:AV0Z50070508 Keywords : Aphidiinae * aphids * Solanaceae Subject RIV: EH - Ecology, Behaviour Impact factor: 1.031, year: 2010

Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers

OpenAIRE

Enciso-Rodríguez, Felix; Martínez, Rodrigo; Lobo, Mario; Barrero, Luz Stella

2010-01-01

The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae...

Screening of non-tuber bearing Solanaceae for resistance to and induction of juvenile hatch of potato cyst nematodes and their potential for trap cropping

NARCIS (Netherlands)

Scholte, K.

2000-01-01

Ninety accessions of non-tuber bearing Solanaceae were screened for (i) resistance to and (ii) stimulatory effect on juvenile hatch of potato cyst nematodes, and (iii) their growth under temperate climatic conditions. All plant species belonging to the genus Solanum tested induced hatching but this

Two new South American species of Solanum section Crinitum (Solanaceae

Directory of Open Access Journals (Sweden)

Frank Farruggia

2010-11-01

Full Text Available Two new species of Solanum section Crinitum are described here. Solanum falciforme Farruggia, sp. nov., closely resembles S. crinitum and S. lycocarpum, but differs by the presence of falcate trichomes on the young growth. It is endemic to the cerrado and adjacent woodlands of Distrito Federal, Bahia, Goiás and Minas Gerais, Brazil. The other species, Solanum pseudosycophanta Farruggia, sp.nov., has close affinities to S. sycophanta but differs from the latter inprominent long-stalked stellate hairs along the stem, calyx, petiole and the adaxial surface of the leaf, in contrast to S. sycophanta which is glabrous or pubescent with sessile to short-stalked multangulate hairs. This species is narrowly distributed in tropical montane forests of northern Peru and southern Ecuador.

Mechanitis polymnia casabranca and Ithomia lichyi lichyi (Lepidoptera: Nymphalidae damaging tree of Solanum granuloso-leprosum (Solanaceae

Directory of Open Access Journals (Sweden)

Wagner de Souza Tavares

2014-03-01

Full Text Available The Zona da Mata region is located in southeastern Minas Gerais State, Brazil with fauna and flora diversified, including herbivorous insects and Solanaceae plants. Ithomiinae caterpillars were observed damaging tree of Solanum granuloso-leprosum Dunal (Solanaceae, used for different purposes and abundant in secondary forest. The objective of this study was to identify defoliating caterpillars of S. granuloso-leprosum at the campus of Universidade Federal de Viçosa (UFV in Viçosa, Minas Gerais State, Brazil and review host plants of Mechanitis polymnia L., 1758 (Lepidoptera: Nymphalidae. Thirteen caterpillars found damaging a tree of S. granuloso-leprosum at the campus of UFV were collected and maintained in the Laboratório de Controle Biológico de Insetos (LCBI from UFV until adult emergence. These caterpillars were of two species, being ten of the first and three of the second species. Adult specimens of the latter species were identified as Ithomia lichyi lichyi D'Almeida, 1939 (Lepidoptera: Nymphalidae in the Departamento de Zoologia of Universidade Federal do Paraná (UFPR in Curitiba, Paraná State, Brazil and of the group of ten caterpillars as Mechanitis polymnia casabranca Haensch, 1905 (Lepidoptera: Nymphalidae in the Museu de Zoologia of Universidade de São Paulo (USP in São Paulo State, Brazil. This is the first report of M. polymnia casabranca and I. lichyi lichyi together damaging plant of S. granuloso-leprosum in the Zona da Mata region of Minas Gerais State, Brazil and 57 plants are recorded as host of M. polymnia.

Tuber resistance and slow rotting characteristics of potato clones associated with the Solanaceae Coordinated Agricultural Project to the US-24 clonal lineage of Phytophthora infestans

Science.gov (United States)

Late blight, caused by Phytophthora infestans, is a devastating disease on potato worldwide and new lineages of the pathogen continue to develop in the U.S. Breeding for resistance is important for economic and environmental purposes. The Solanaceae Coordinated Agricultural Project (SolCAP) focuses ...

Effects of seco-steroids purified from Physalis angulata L., Solanaceae, on the viability of Leishmania sp Efeitos de seco-esteróides purificados de Physalis angulata L., Solanaceae na viabilidade de Leishmania sp

Directory of Open Access Journals (Sweden)

Elisalva T. Guimarães

2010-12-01

Full Text Available Physalis angulata L., Solanaceae, is an annual herb commonly used in popular medicine in many tropical and subtropical countries. P. angulata extracts contain a variety of substances, but little is known about their pharmacological activities. In this work we investigated the in vitro antileishmanial activity of seco-steroids (physalins purified from P. angulata. Addition of physalins B, F, and G caused a concentration-dependent inhibition in the growth of L. amazonensis promastigotes, being the IC50 values were 6.8, 1.4, and 9.2 μM, respectively. Physalin D was less active and had an IC50 value of 30.5 μM. Physalins were also active in cultures of other Leishmania species (L. major, L. braziliensis, and L. chagasi. Our results demonstrate the potent antileishmanial activity of physalins in cultures of Leishmania species of the New and Old Worlds and suggest the therapeutic potential of these seco-steroids in leishmaniasis.Physalis angulata L., Solanaceae, é uma erva anual utilizada na medicina popular em muitos países tropicais e subtropicais. Apesar dos extratos da P. angulata apresentarem uma grande variedade de substâncias, pouco é conhecido sobre a sua atividade farmacológica. Neste trabalho foi investigado a atividade antileishmania in vitro de seco-esteroides (fisalinas purificados da P. angulata. O tratamento com as fisalinas B, F e G causou uma inibição concentração-dependente do crescimento de promastigotas de Leishmania amazonensis em cultura axênica, com valores de IC50 de 6,8, 1,4, e 9,2 μM respectivamente. A fisalina D foi menos ativa, com valores de IC50 de 30,5 μM. Foi também observada uma atividade leishmanicida em culturas de outras espécies de Leishmania (L. major, L. braziliensis e L. chagasi. Nossos resultados demonstram que as fisalinas inibem o crescimento dos promastigotas com o tratamento de espécies de Leishmania do Velho e do Novo Mundos e sugerem o potencial terapêutico destas moléculas na

Pollen morphology and study of the visitors (Hymenoptera, Apidae of Solanum stramoniifolium Jacq. (Solanaceae in Central Amazon Morfologia polínica e estudo dos visitantes (Hymenoptera, Apidae de Solanum stramoniifolium Jacq. (Solanaceae na Amazônia Central

Directory of Open Access Journals (Sweden)

Alexandre Coletto da Silva

2004-09-01

Full Text Available The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The pollen of S. stramoniifolium is tricolporate and psilate or without ornamentation. In a word, S. stramoniifolium constitutes a potential source of pollen for different species of bees with and without sting, providing an interesting field for germination studies, insect-plant interactions and floral biology that are already under way.A família Solanaceae tem ampla distribuição, principalmente nas áreas tropicais e subtropicais da América do Sul. Solanum L. é um dos mais importantes gêneros desta família com aproximadamente 1.200 espécies. O objetivo deste trabalho foi o de estudar a biologia floral com enfoque na morfologia polínica e no registro de algumas abelhas visitantes de S. stramoniifolium. Dados preliminares indicam a presença de uma espécie de abelha com ferrão e quatro espécies sem ferrão como visitantes de S. stramoniifolium. O pólen de S. stramoniifolium é tricolporado e psilado, ou seja, sem ornamentação. Conclui-se, após o estudo da biologia floral, que S. stramoniifolium constitui fonte potencial de pólen para diferentes espécies de abelhas com e sem ferrão, representando interessante campo para estudos de germinação, interações inseto-planta e biologia floral.

Natural Medium for Growing of Endophytic Bacteria from Solanaceae in Malang-Indonesia

Directory of Open Access Journals (Sweden)

Purnawati Arika

2016-01-01

Full Text Available Endophytic bacteria are important microorganisms having potential as biocontrol agents for many pathogens. Until now, the growth of it always uses semi-synthetic or synthetic medium so it was difficult to be used by farmers in the field and it was expensive to have its propagation as biocontrol agents. Based on the problem, this research will study the natural medium as propagation medium of Endophytic bacteria. It had natural ingredients such as soybean, chicken broth, egg, worms, snail, sorghum and they were easy to get by farmers. This study used endophytic bacteria from Solanaceae in Malang- Indonesia. Four isolates of endophytic bacteria were grown in agar and liquid medium with ingredients of corn flour, soybean flour, sorghum flour, snail flour, and worm flour. There is no difference in the incubation period, color, shape, and surface colony. The population in medium with snail flour ingredients at a concentration of 107 cfu/ml is the highest and snail flour is the best medium for growing endophytic bacteria.

A GIS model of habitat suitability for Solanum conocarpum (Solanaceae) in St. John, US Virgin Islands

Science.gov (United States)

Palumbo, Matthew D.; Fleming, Jonathan P.; Monsegur, Omar A.; Vilella, Francisco

2016-01-01

Solanum conocarpum (Solanaceae) (Marron Bacora) is a rare, dry-forest shrub endemic to the island of St. John, US Virgin Islands, considered for listing under the Endangered Species Act. Given its status as a species of conservation concern, we incorporated environmental characteristics of 3 observed populations and 5 additional known locations into a geographic information system (GIS) analysis to create a habitat-suitability model for the species on the island of St. John. Our model identified 1929.87 ha of highly suitable and moderately suitable habitat. Of these, 1161.20 ha (60.2%) occurred within the boundaries of Virgin Islands National Park. Our model provides spatial information on potential locations for future surveys and restoration sites for this endemic species of the US Virgin Islands.

Leaf Structure and Taxonomy of Petunia and Calibrachoa (Solanaceae

Directory of Open Access Journals (Sweden)

Claudia dos Reis

2002-03-01

Full Text Available We studied the leaf anatomy of sixteen species of Calibrachoa and eight species of Petunia. In Calibrachoa leaves, the vascular bundles sheath (endodermis was formed by parenchymatous developed cells, different from those of the mesophyll. In Petunia, this sheath did not show a marked morphological differentiation. The Calibrachoa leaves could be separated according to the type of leaf margins, the distribution of the stomata on leaf surfaces, the organization of the mesophyll and the morphology of the trichomes. Based on these results, an indented dichotomous identification key was elaborated for the species of the genus Calibrachoa.Foram estudados, sob o ponto de vista anatômico, os limbos foliares de dezesseis espécies de Calibrachoa Llav. & Lex. e de oito espécies de Petunia Juss. (Solanaceae. Em Calibrachoa, a bainha que envolve os feixes vasculares (endoderme é formada por células desenvolvidas e distintas das do mesofilo. Em Petunia, esta bainha não apresenta diferenciação morfológica marcante. As folhas das espécies de Calibrachoa foram separadas entre si levando-se em conta a distribuição dos estômatos nas faces foliares, a organização do mesofilo, o tipo de bordo e a morfologia dos tricomas. Com base nesses resultados, foi elaborada uma chave dicotômica indentada de identificação para as espécies do gênero Calibrachoa.

Mapeo de genes ribosómicos y heterocromatina en seis especies de Lycium de sudamérica (solanaceae

Directory of Open Access Journals (Sweden)

Soledad Blanco

2012-12-01

Full Text Available El clado Lycieae (Solanaceae reune 92 especies, actualmente agrupadas en un único género, Lycium. Se realizó un estudio citogenético en seis especies sudamericanas de este género, usándose por primera vez en el grupo la técnica de FISH, además de la técnica de bandeo CMA/DAPI. Se emplearon ápices radicales de las siguientes especies: L. boerhaviifolium (previamente Grabowskia, L. bridgesii (previamente Phrodus, el tetraploide L. chilense y los diploides L. cestroides, L. ciliatum y L. tenuispinosum. Se confirmó el número básico x=12. La técnica de bandeo reveló la presencia de una banda CMA+/DAPI- asociada a NORs en el primer par metacéntrico en las especies diploides, y en los dos primeros pares m en la tetraploide. Además, L. tenuispinosum mostró una banda intercalar CMA+/DAPI- en uno de sus cromosomas, en tanto que en L. bridgesii se encontraron bandas terminales e intercalares en todos los cromosomas. Con la técnica de FISH se observó que los loci 18-5,8-26S fueron consistentes con los bloques CMA+/DAPI-/NORs. Las especies diploides presentaron siempre un par cromosómico m portador de genes ADNr 5S, mientras que la especie tetraploide presentó dos pares, concordando con su nivel de ploidía. En las especies estudiadas, la diversificación no fue acompañada por rearreglos cromosómicos estructurales significativos, excepto L. bridgesii, que se destaca por poseer una fórmula cariotípica distinta y un mayor porcentaje de heterocromatina.Mapping of ribosomal genes and heterochromatin in Lycium of South America (Solanaceae. The clade Lycieae (Solanaceae embraces 92 species, currently gathered in a single genus, Lycium. A study was conducted in six South American species of this genus, using the FISH technique for the first time in the group, in addition to the CMA/DAPI banding technique. Root tips of the following species were employed: L. boerhaviifolium (previously Grabowskia, L. bridgesii (previously Phrodus, the

Insight into the evolution of the Solanaceae from the parental genomes of Petunia hybrida.

Science.gov (United States)

Bombarely, Aureliano; Moser, Michel; Amrad, Avichai; Bao, Manzhu; Bapaume, Laure; Barry, Cornelius S; Bliek, Mattijs; Boersma, Maaike R; Borghi, Lorenzo; Bruggmann, Rémy; Bucher, Marcel; D'Agostino, Nunzio; Davies, Kevin; Druege, Uwe; Dudareva, Natalia; Egea-Cortines, Marcos; Delledonne, Massimo; Fernandez-Pozo, Noe; Franken, Philipp; Grandont, Laurie; Heslop-Harrison, J S; Hintzsche, Jennifer; Johns, Mitrick; Koes, Ronald; Lv, Xiaodan; Lyons, Eric; Malla, Diwa; Martinoia, Enrico; Mattson, Neil S; Morel, Patrice; Mueller, Lukas A; Muhlemann, Joëlle; Nouri, Eva; Passeri, Valentina; Pezzotti, Mario; Qi, Qinzhou; Reinhardt, Didier; Rich, Melanie; Richert-Pöggeler, Katja R; Robbins, Tim P; Schatz, Michael C; Schranz, M Eric; Schuurink, Robert C; Schwarzacher, Trude; Spelt, Kees; Tang, Haibao; Urbanus, Susan L; Vandenbussche, Michiel; Vijverberg, Kitty; Villarino, Gonzalo H; Warner, Ryan M; Weiss, Julia; Yue, Zhen; Zethof, Jan; Quattrocchio, Francesca; Sims, Thomas L; Kuhlemeier, Cris

2016-05-27

Petunia hybrida is a popular bedding plant that has a long history as a genetic model system. We report the whole-genome sequencing and assembly of inbred derivatives of its two wild parents, P. axillaris N and P. inflata S6. The assemblies include 91.3% and 90.2% coverage of their diploid genomes (1.4 Gb; 2n = 14) containing 32,928 and 36,697 protein-coding genes, respectively. The genomes reveal that the Petunia lineage has experienced at least two rounds of hexaploidization: the older gamma event, which is shared with most Eudicots, and a more recent Solanaceae event that is shared with tomato and other solanaceous species. Transcription factors involved in the shift from bee to moth pollination reside in particularly dynamic regions of the genome, which may have been key to the remarkable diversity of floral colour patterns and pollination systems. The high-quality genome sequences will enhance the value of Petunia as a model system for research on unique biological phenomena such as small RNAs, symbiosis, self-incompatibility and circadian rhythms.

Content of atropine and scopolamine in poisonous solanaceae plants from Slovenia

Directory of Open Access Journals (Sweden)

Javor Kac

2006-03-01

Full Text Available Background: Some species from the Solanaceae family are still the cause of serious poisoning among youth in Slovenia. Usually intoxication is due to abuse of these plants to provoke hallucinations. There is still not enough data about the alkaloid content of these plants growing in Slovenia.Methods: Different plant samples were analyzed for the content of atropine and scopolamine with capillary electrophoresis after solid phase extraction of alkaloids. Plants were gathered from different areas of Slovenia between April and September 2004.Results: Results were compared and possible correlations between the alkaloid content and species, plant parts, growth conditions, and time of harvest were suggested. Atropine and scopolamine contents were assessed in deadly nightshade (Atropa belladonna L., thorn apple (Datura stramonium L., scopolia (Scopolia carniolica Jacq. and angel trumpet. The common name angel trumpet is used for Datura inoxia Mill. as well as for different Brugmansia Pers. species. The most intriguing results were the variable alkaloid content in various Brugmansia species and generally great differences in alkaloid content among various plants and their plant parts.Conclusions: All investigated plants have noticeable atropine and/or scopolamine content. The content is variable between various plants and their plant parts and therefore special care should be taken in cases of possible intoxication. It was shown that smaller or greater amounts of ingested drug can cause the same level of intoxication due to the variability in alkaloid content.

Test for Local Insect Traps against some Solanacea Insects Plant under Green House Conditions in Riyadh, Saudi Arabia

International Nuclear Information System (INIS)

Al-Ayedh, Hassan Ibn Yahiya

2005-01-01

Trapping efficiency of seven different colored sticky traps (Green, Fluorescent yellow, Orange, Pink, red, White and Yellow) was evaluated in some solanacea plants, tomatoes (Lycopersicon esculentum), eggplant (Solanum Magellan) and sweet pepper (Capsicum spp.) crops, for whitefly (Bemis ia airlifting), leaf miners (Liriomyza trifolii), thrips (Thrips tabaci) in Riyadh, Saudi Arabia. The traps were placed at four different heights (0.5, 1.0, 1.5 and 2.0 m above the ground). The experiment was laid out in a Completely Randomized Block Design (CRBD) with four replications during autumn 2001, spring and autumn 2002. Significantly high insect populations were trapped on Fluorescent yellow, yellow and green colored sticky traps. No significant differences were witnessed between mean numbers of various insects caught on sticky traps placed at different heights but more insects were trapped at 0.5 - 1.5m. (author)

Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

Science.gov (United States)

Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

2012-04-01

Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

No evidence for Fabaceae Gametophytic self-incompatibility being determined by Rosaceae, Solanaceae, and Plantaginaceae S-RNase lineage genes.

Science.gov (United States)

Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E; Vieira, Cristina P

2015-06-02

Fabaceae species are important in agronomy and livestock nourishment. They have a long breeding history, and most cultivars have lost self-incompatibility (SI), a genetic barrier to self-fertilization. Nevertheless, to improve legume crop breeding, crosses with wild SI relatives of the cultivated varieties are often performed. Therefore, it is fundamental to characterize Fabaceae SI system(s). We address the hypothesis of Fabaceae gametophytic (G)SI being RNase based, by recruiting the same S-RNase lineage gene of Rosaceae, Solanaceae or Plantaginaceae SI species. We first identify SSK1 like genes (described only in species having RNase based GSI), in the Trifolium pratense, Medicago truncatula, Cicer arietinum, Glycine max, and Lupinus angustifolius genomes. Then, we characterize the S-lineage T2-RNase genes in these genomes. In T. pratense, M. truncatula, and C. arietinum we identify S-RNase lineage genes that in phylogenetic analyses cluster with Pyrinae S-RNases. In M. truncatula and C. arietinum genomes, where large scaffolds are available, these sequences are surrounded by F-box genes that in phylogenetic analyses also cluster with S-pollen genes. In T. pratense the S-RNase lineage genes show, however, expression in tissues not involved in GSI. Moreover, levels of diversity are lower than those observed for other S-RNase genes. The M. truncatula and C. arietinum S-RNase and S-pollen like genes phylogenetically related to Pyrinae S-genes, are also expressed in tissues other than those involved in GSI. To address if other T2-RNases could be determining Fabaceae GSI, here we obtained a style with stigma transcriptome of Cytisus striatus, a species that shows significant difference on the percentage of pollen growth in self and cross-pollinations. Expression and polymorphism analyses of the C. striatus S-RNase like genes revealed that none of these genes, is the S-pistil gene. We find no evidence for Fabaceae GSI being determined by Rosaceae, Solanaceae, and

Antifungal glycoalkaloids, flavonoids and other chemical constituents of Solanum asperum Rich (Solanaceae); Glicoalcaloides antifugincos, flavonoides e outros constituintes quimicos de Solanum asperum

Energy Technology Data Exchange (ETDEWEB)

Pinto, Francisco das Chagas L.; Uchoa, Daniel Esdras de A.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo, E-mail: opessoa@ufc.b [Universidade Federal do Ceara (DQOI/UFC), Fortaleza, CE (Brazil). Dept. de Quimica Organica e Inorganica; Silva, Fernanda M. e; Theodoro, Phellipe N.E.T.; Espindola, Laila S. [Universidade de Brasilia (FCS/UnB), DF (Brazil). Fac. de Ciencias da Saude

2011-07-01

Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-alpha-L-ramnopyranosyl-kaempferol and 3-O-[beta-D-glucopyranosyl-(1->6)-alpha-L-ramnopyranosyl ]-7-O-alpha-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae). The structures of all compounds were determined by interpretation of their spectra (IR, MS, {sup 1}H and {sup 13}C NMR) and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 mug/mL) against four filamentous fungi species of the genera Microsporum and Trichophyton. (author)

POLEN DE LAS MAGNOLIOPSIDA EN EL VOLCÁN (PAMPLONA, COLOMBIA II: FAMILIAS HYPERICACEAE, LAMIACEAE, LOBELIACEAE, POLYGONACEAE, RHAMNACEAE, ROSACEAE, RUBIACEAE, SCROPHULARIACEAE Y SOLANACEAE

Directory of Open Access Journals (Sweden)

JORGE D. MERCADO-GÓMEZ

2013-12-01

Full Text Available Se caracterizó la morfología polínica de las especies pertenecientes a las familias, Hypericaceae, Lamiaceae, Lobeliaceae, Polygonaceae, Rhamnaceae, Rosaceae, Rubiaceae, Scrophulariaceae y Solanaceae, encontradas en la zona El Volcán (Pamplona, Colombia. Las observaciones, descripciones y microfotografías de los granos de polen se realizaron con microscopio de luz, contando un mínimo de 25 granos por especie. Todas las familias presentan un carácter euripalinologico, excepto Melastomataceae la cual es estenopalinologica. Asimismo, al realizar comparaciones sobre algunas especies que fueron descritas en otras zonas del bosque altoandino y páramo en la cordillera Central y Occidental, fue posible determinar variaciones en la morfología polínica.

Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

Science.gov (United States)

Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

2016-07-01

Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

Science.gov (United States)

Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

2016-01-01

Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

Plant population structure and insect herbivory on Solanum mauritianum Scopoli (Solanaceae in southern Brazil: a support to biological control

Directory of Open Access Journals (Sweden)

Deise Mari Barboza

2009-04-01

Full Text Available Solanum mauritianum Scopoli (Solanaceae, a native Brazilian shrub, has become naturalized and invasive in several countries. In South Africa, where invasions are severe, herbivorous insects that attack S. mauritianum in its native area have been considered for introduction as biological control agents. To assess the action of such herbivores on the plant, studies were carried out on a population of S. mauritianum in an area undergoing regeneration in southern Brazil. An analysis of the structure of that population was performed, as well as of herbivory by insects, in particular of Anthonomus (Curculionidae. The population structure showed an "inverted J" pattern in diameter classes, but not in height classes. Individual plants showed an aggregate distribution. The damage caused by Anthonomus did not amount to the loss of a large leaf area, but since it was inflicted on young leaves and in a large proportion, could lead to the survival decrease.Solanum mauritianum Scopoli (Solanaceae, um arbusto endêmico do sul do Brasil, naturalizou-se e tornou-se invasor em vários países do mundo. Na África do Sul, onde as invasões são severas, insetos fitófagos associados à planta no país de origem têm sido considerados para introdução como agentes de controle biológico. Para avaliar a ação de tais insetos no ambiente natural, foram conduzidos estudos em uma população de S. mauritianum em uma área em regeneração no sul do Brasil. Foi realizada análise da estrutura populacional, bem como da herbivoria causada por insetos, em particular para uma espécie do gênero Anthonomus (Curculionidae, para subsidiar o trabalho sobre controle biológico. A estrutura da população mostrou um padrão "J invertido" nas classes de diâmetro, mas não nas classes de altura; a distribuição espacial dos indivíduos era agregada. O dano causado por Anthonomus sp. não refletiu na perda real de grande área foliar. No entanto, uma vez que foi detectada uma

Callogenesis in root explants of four species of the family Solanaceae after inducing by Agrobacterium rhizogenes

Directory of Open Access Journals (Sweden)

Zahra Shakeran

2015-09-01

Full Text Available Studying explants affected by Agrobacterium rhizogenes shows that in addition to possible formation of hairy roots, it is likely that callogenesis can be induced in these tissues. The T-DNA region of A. rhizogenes codes enzymes that participate in biosynthesis of plants growth hormones. These hormones also affect callogenesis, hence, the formation of various calluses with different morphological properties are possible. It is very likely that the level of biosynthetic growth hormone, the plasmid carried by each bacteria strain, the position of T-DNA, and the level of gene expression contribute to this morphologic variation. In this study, the root explants of four species of the family Solanaceae namely Atropa belladonna, Datura metel, D. stramonium and Hyoscyamus niger were induced by using different strains of A. rhizogenes (A4, A7, AR15834, AR318, AR9402 and AR9543. Some of these explants entered callus phase and formed various calluses with different colors and shapes. Moreover, in some callus samples hairy roots were also appeared. These variations were probably caused by variations in the levels and ratios of auxin and cytokinine hormons after the induction. As shown in previous studies, the amount of secondary metabolites is reduced due to undifferentiated tissue produced in the callogenesis process.

The historical role of species from the Solanaceae plant family in genetic research.

Science.gov (United States)

Gebhardt, Christiane

2016-12-01

This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100 years. The tomato was one of the principal models in twentieth century classical genetics and a pacemaker of genome analysis in plants including molecular linkage maps, positional cloning of disease resistance genes and quantitative trait loci (QTL). Besides that, tomato is the model for the genetics of fruit development and composition. Tobacco was the major model used to establish the principals and methods of plant somatic cell genetics including in vitro propagation of cells and tissues, totipotency of somatic cells, doubled haploid production and genetic transformation. Petunia was a model for elucidating the biochemical and genetic basis of flower color and development. The cultivated potato is the economically most important Solanaceous plant and ranks third after wheat and rice as one of the world's great food crops. Potato is the model for studying the genetic basis of tuber development. Molecular genetics and genomics of potato, in particular association genetics, made valuable contributions to the genetic dissection of complex agronomic traits and the development of diagnostic markers for breeding applications. Pepper and eggplant are horticultural crops of worldwide relevance. Genetic and genomic research in pepper and eggplant mostly followed the tomato model. Comparative genome analysis of tomato, potato, pepper and eggplant contributed to the understanding of plant genome evolution.

Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers

Science.gov (United States)

2010-01-01

The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with FST > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species. PMID:21637482

Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers.

Science.gov (United States)

Enciso-Rodríguez, Felix; Martínez, Rodrigo; Lobo, Mario; Barrero, Luz Stella

2010-04-01

The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F(ST) > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.

Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII markers

Directory of Open Access Journals (Sweden)

Felix Enciso-Rodríguez

2010-01-01

Full Text Available The Lulo or naranjilla (Solanum quitoense Lam. and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt. are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32 and tree tomatoes (n = 30 through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII in other Solanaceae (Asterid species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested and tree tomatoes (26 out of 41 for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F ST > 0.90, which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.

Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the Solanaceae genomics.

Science.gov (United States)

Aoki, Koh; Yano, Kentaro; Suzuki, Ayako; Kawamura, Shingo; Sakurai, Nozomu; Suda, Kunihiro; Kurabayashi, Atsushi; Suzuki, Tatsuya; Tsugane, Taneaki; Watanabe, Manabu; Ooga, Kazuhide; Torii, Maiko; Narita, Takanori; Shin-I, Tadasu; Kohara, Yuji; Yamamoto, Naoki; Takahashi, Hideki; Watanabe, Yuichiro; Egusa, Mayumi; Kodama, Motoichiro; Ichinose, Yuki; Kikuchi, Mari; Fukushima, Sumire; Okabe, Akiko; Arie, Tsutomu; Sato, Yuko; Yazawa, Katsumi; Satoh, Shinobu; Omura, Toshikazu; Ezura, Hiroshi; Shibata, Daisuke

2010-03-30

The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs) was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706) was estimated to be 0.061%. The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the tomato whole-genome sequence and aid in tomato functional

Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum cultivar Micro-Tom, a reference system for the Solanaceae genomics

Directory of Open Access Journals (Sweden)

Kikuchi Mari

2010-03-01

Full Text Available Abstract Background The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. Results To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706 was estimated to be 0.061%. Conclusion The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the

Typification of Solanum (Solanaceae species described by Martín de Sessé y Lacasta and José Mariano Mociño

Directory of Open Access Journals (Sweden)

Knapp, Sandra

2008-06-01

Full Text Available Lectotypes, neotypes or epitypes are confirmed or designated here for 16 of the 22 names coined by Martín Sessé y Lacasta and José Mariano Mociño that were described as members of the large genus Solanum (Solanaceae: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (both homonyms, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense and S. uniflorum. A brief introduction assesses the importance of the Sessé & Mociño expedition (the Real Expedición Botánica a Nueva España to the botany of their time, and identifies difficulties in identifying and neotypifying or lectotypifying names coined by them. More than half of the names coined by Sessé and Mociño have no material associated with them. The currently accepted name for each taxon is given, and taxa of uncertain status are indicated. Each typification is accompanied by a discussion of the reasoning behind the choice of specimen, and all newly designated types are illustrated.Se confirman o designan los lectótipos, neótipos o epítipos de 16 de los 22 nombres acuñados por Martín de Sessé y Lacasta y José Mariano Mociño que o bien fueron descritos dentro del género Solanum (Solanaceae o son actualmente reconocidos como parte del mismo: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (ambos homónimos, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense y S. uniflorum. Se incluye una breve introducción explicando la importancia de la Real Expedición Botánica a Nueva España (expedición de Sessé y Mociño para la botánica de su tiempo, así como las dificultades que entraña neotipificar o lectotipificar los nombres acuñados por éllos. Se incluye el nombre aceptado para cada taxon cuando es posible y cada tipificación se acompaña de una discusión explicando

Intoxicação por Cestrum laevigatum (Solanaceae em bubalinos Poisoning by Cestrum laevigatum (Solanaceae in buffaloes

Directory of Open Access Journals (Sweden)

José Diomedes Barbosa

2010-12-01

ões necrosadas observou-se um halo de hepatócitos com vacuolização.Based on the history and clinical and pathological data, as well as on inspection of the pastures, a mortality of buffaloes in the county of Itaguaí/RJ, Brazil, was diagnosed as poisoning by Cestrum laevigatum Schlecht., a plant of the Solanaceae family. The poisoning was reproduced in two buffaloes. Dried leaves of the shrub were administered by hand, in single doses corresponding to 20g/kg and 40g/kg of the fresh leaves, to four buffaloes of the Murrah breed. The dose corresponding to 40g/kg of the fresh leaves caused signs of poisoning, as apathy, anorexia, absence of rumen movements, dysmetria, excitement and aggressiveness, followed by death of the two buffaloes within 65 hours after administration. From the two buffaloes that received the corresponding dose of 20g/kg of the fresh plant, one presented clinical signs characterized mainly by decrease of the rumen movements, but recovered 97h22min after the administration; the other buffalo did not show symptoms of poisoning. Laboratory analyses for biochemical evaluation accused hepatic alterations. In one buffalo that died, the main macroscopic finding was an orange liver with a clear nutmeg appearance; in the second buffalo, the orange liver had no nutmeg appearance. Other alterations found in these two buffaloes were slight edema of the gall bladder wall, a slightly reddish mucous membrane of the abomasum, extensive echymoses in the endocard of the left ventricle and few petechiae in the endocard of the right ventricle; the abomasum content was slightly dry, and the large intestine had little and slightly dry contents wrapped by mucus. Histopatological examination revealed severe coagulative necrosis of the liver parenchyma in the centrolobular and intermediate lobular areas, with a halo of vacuolated hepatocytes at the periphery of the necrotic areas.

Distribution of a Ty3/gypsy-like retroelement on the A and B-chromosomes of Cestrum strigilatum Ruiz & Pav. and Cestrum intermedium Sendtn. (Solanaceae

Directory of Open Access Journals (Sweden)

Jéferson Nunes Fregonezi

2007-01-01

Full Text Available Retroelements are a diversified fraction of eukaryotic genomes, with the Ty1/copia and Ty3/gypsy groups being very common in a large number of plant genomes. We isolated an internal segment of the Ty3/gypsy retroelement of Cestrum strigilatum (Solanaceae using PCR amplification with degenerate primers for a conserved region of reverse transcriptase. The isolated segment (pCs12 was sequenced and showed similarity with Ty3/gypsy retroelements of monocotyledons and dicotyledons. This segment was used as probe in chromosomes of C. strigilatum and Cestrum intermedium. Diffuse hybridization signals were observed along the chromosomes and more accentuated terminal signals in some chromosome pairs, always associated with nucleolus organizer regions (NORs. The physical relationship between the hybridization sites of pCs12 and pTa71 ribosomal probes was assessed after sequential fluorescence in situ hybridization (FISH. Hybridization signals were also detected in the B chromosomes of these species, indicating an entail among the chromosomes of A complement and B-chromosomes.

Differential strengths of selection on S-RNases from Physalis and Solanum (Solanaceae

Directory of Open Access Journals (Sweden)

Kohn Joshua R

2011-08-01

Full Text Available Abstract Background The S-RNases of the Solanaceae are highly polymorphic self-incompatibility (S- alleles subject to strong balancing selection. Relatively recent diversification of S-alleles has occurred in the genus Physalis following a historical restriction of S-allele diversity. In contrast, the genus Solanum did not undergo a restriction of S-locus diversity and its S-alleles are generally much older. Because recovery from reduced S-locus diversity should involve increased selection, we employ a statistical framework to ask whether S-locus selection intensities are higher in Physalis than Solanum. Because different S-RNase lineages diversify in Physalis and Solanum, we also ask whether different sites are under selection in different lineages. Results Maximum-likelihood and Bayesian coalescent methods found higher intensities of selection and more sites under significant positive selection in the 48 Physalis S-RNase alleles than the 49 from Solanum. Highest posterior densities of dN/dS (ω estimates show that the strength of selection is greater for Physalis at 36 codons. A nested maximum likelihood method was more conservative, but still found 16 sites with greater selection in Physalis. Neither method found any codons under significantly greater selection in Solanum. A random effects likelihood method that examines data from both taxa jointly confirmed higher selection intensities in Physalis, but did not find different proportions of sites under selection in the two datasets. The greatest differences in strengths of selection were found in the most variable regions of the S-RNases, as expected if these regions encode self-recognition specificities. Clade-specific likelihood models indicated some codons were under greater selection in background Solanum lineages than in specific lineages of Physalis implying that selection on sites may differ among lineages. Conclusions Likelihood and Bayesian methods provide a statistical approach to

Estudo fitoquímico de folhas de Solanum lycocarpum A. St.-Hil (Solanaceae e sua aplicação na alelopatia Phytochemistry of Solanum lycocarpum A.St.-Hil (Solanaceae leaves and their application in allelopathy

Directory of Open Access Journals (Sweden)

Sarah Christina Caldas Oliveira

2012-09-01

Full Text Available Solanum lycocarpum A.St.-Hil (Solanaceae é um arbusto típico da região central do Brasil (Cerrado. A atividade alelopática do extrato aquoso de folhas e frutos dessa espécie já foi verificada em estudos anteriores. O objetivo desse trabalho foi avaliar a atividade alelopática de diferentes extratos de S. lycocarpum na germinação e crescimento de quatro espécies-alvo. As folhas foram coletadas, secas e trituradas e submetidas a dois métodos distintos de extração: 1- líquido-líquido (acetato de etila e diclorometano do extrato aquoso das folhas e 2- com solventes em polaridade crescente (hexano, diclorometano, acetato de etila, acetona, metanol e água diretamente das folhas. Cada extração foi realizada com equipamento de ultrassom durante uma hora, filtrado e evaporado. Desses extratos, soluções de 800, 400 e 200 ppm foram preparadas, e água e Logran® foram usados como controle positivo e negativo, respectivamente. Cada solução, bem como os controles, foi dissolvida em DMSO para os bioensaios. As espécies alvo usadas foram: alface, agrião, tomate e cebola. Cada placa era composta de 20 sementes e foi adicionado 1 mL de solução teste com 4 repetições. As placas foram incubadas a 25 ºC no escuro. Posteriormente, as plântulas tiveram suas partes aéreas e raízes medidas e a porcentagem de germinação e inibição calculada para cada extrato. Tomate foi a espécie que mostrou maior sensibilidade para todos os extratos, seguido de agrião, cebola e alface. Os extratos que tiveram maior atividade foram o acetato de etila, acetona e as extrações líquido-líquido, indicando as frações que devem conter os princípios ativos da folha dessa espécie.Solanum lycocarpum A.St.-Hil (Solanaceae is a typical shrub in the Cerrado of central Brazil. The allelopathic activity of aqueous extracts of the leaves and fruits of this species has already been proven in previous studies. The goal of this work was to verify the

Phylogenetic fragrance patterns in Nicotiana sections Alatae and Suaveolentes.

Science.gov (United States)

Raguso, Robert A; Schlumpberger, Boris O; Kaczorowski, Rainee L; Holtsford, Timothy P

2006-09-01

We analyzed floral volatiles from eight tobacco species (Nicotiana; Solanaceae) including newly discovered Brazilian taxa (Nicotiana mutabilis and "Rastroensis") in section Alatae. Eighty-four compounds were found, including mono- and sesquiterpenoids, nitrogenous compounds, benzenoid and aliphatic alcohols, aldehydes and esters. Floral scent from recent accessions of Nicotiana alata, Nicotiana bonariensis and Nicotiana langsdorffii differed from previously published data, suggesting intraspecific variation in scent composition at the level of biosynthetic class. Newly discovered taxa in Alatae, like their relatives, emit large amounts of 1,8-cineole and smaller amounts of monoterpenes on a nocturnal rhythm, constituting a chemical synapomorphy for this lineage. Fragrance data from three species of Nicotiana sect. Suaveolentes, the sister group of Alatae, (two Australian species: N. cavicola, N. ingulba; one African species: N. africana), were compared to previously reported data from their close relative, N. suaveolens. Like N. suaveolens, N. cavicola and N. ingulba emit fragrances dominated by benzenoids and phenylpropanoids, whereas the flowers of N. africana lacked a distinct floral scent and instead emitted only small amounts of an aliphatic methyl ester from foliage. Interestingly, this ester also is emitted from foliage of N. longiflora and N. plumbaginifolia (both in section Alatae s.l.), which share a common ancestor with N. africana. This result, combined with the synapomorphic pattern of 1,8 cineole emission in Alatae s.s., suggests that phylogenetic signal explains a major component of fragrance composition among tobacco species in sections Alatae and Suaveolentes. At the intraspecific level, interpopulational scent variation is widespread in sect. Alatae, and may reflect edaphic specialization, introgression, local pollinator shifts, genetic drift or artificial selection in cultivation. Further studies with genetically and geographically well

Comparative mapping of Phytophthora resistance loci in pepper germplasm: evidence for conserved resistance loci across Solanaceae and for a large genetic diversity.

Science.gov (United States)

Thabuis, A; Palloix, A; Pflieger, S; Daubèze, A-M; Caranta, C; Lefebvre, V

2003-05-01

Phytophthora capsici Leonian, known as the causal agent of the stem, collar and root rot, is one of the most serious problems limiting the pepper crop in many areas in the world. Genetic resistance to the parasite displays complex inheritance. Quantitative trait locus (QTL) analysis was performed in three intraspecific pepper populations, each involving an unrelated resistant accession. Resistance was evaluated by artificial inoculations of roots and stems, allowing the measurement of four components involved in different steps of the plant-pathogen interaction. The three genetic maps were aligned using common markers, which enabled the detection of QTLs involved in each resistance component and the comparison of resistance factors existing among the three resistant accessions. The major resistance factor was found to be common to the three populations. Another resistance factor was found conserved between two populations, the others being specific to a single cross. This comparison across intraspecific germplasm revealed a large variability for quantitative resistance loci to P. capsici. It also provided insights both into the allelic relationships between QTLs across pepper germplasm and for the comparative mapping of resistance factors across the Solanaceae.

Phytotoxicity and cytogenotoxicity of hydroalcoholic extracts from Solanum muricatum Ait. and Solanum betaceum Cav. (Solanaceae) in the plant model Lactuca sativa.

Science.gov (United States)

Dos Santos, Fabio Eduardo; Carvalho, Marcos Schleiden Sousa; Silveira, Graciele Lurdes; Correa, Felipe Folgaroli; Cardoso, Maria das Graças; Andrade-Vieira, Larissa Fonseca; Vilela, Luciane Resende

2018-03-05

Plants are rich in biologically active compounds. They can be explored for the production of bioherbicides. In this context, the present work aimed to evaluate the allelopathic effect of hydroalcoholic extracts from two Solanaceae species: Solanum muricatum Ait. and Solanum betaceum Cav. For this end, we conducted phytochemical screening and biological assays, determining the effects of the extracts on germination, early development, cell cycle, and DNA fragmentation in plantlets and meristematic cells of the plant model Lactuca sativa L. (lettuce). The percentage of seeds germinated under effect of S. muricatum extract did not differ from the control, but plantlet growth was reduced at the highest concentrations. For S. betaceum extract, dose dependence was observed for both germination and plantlet development, with the highest concentrations inhibiting germination. The growth curves revealed the concentrations of 2.06 and 1.93 g/L for S. muricatum and S. betaceum extracts, respectively, as those reducing 50% of root growth (RG). At these concentrations, both extracts presented mitodepressive effect, besides inducing significant increase in the frequency of condensed nuclei, associated to DNA fragmentation and cytoplasmic shrinkage. The frequency of chromosome alterations was not significant. We further discuss the mechanisms of action related to the chemical composition of the extracts, which presented organic acids, reducing sugars, proteins, amino acids, and tannins, besides catechins and flavonoids, only found in the extract of S. betaceum.

In vitro production of secondary metabolite using Atropa komarovii Bline&Shal (Solanaceae hairy root culture via Agrobacterium rhizogenes ATCC15834

Directory of Open Access Journals (Sweden)

Ofelia Banihashemi

2017-07-01

Full Text Available Background & Aim:A new sustainable tissue-based system is presented by plant hairy roots, preserving all of the several specialized types of cell with critical roles in allowing bioactive secondary molecules to be synthesized more consistently as usual. The system is also essential for studying the production of alkaloid in culture. Experimental: The Atropa komarovii leaves were wounded and infected with soil gram-negative bacterium Agrobacterium rhizogenes ATCC15834. After three weeks, the transformation roots and control roots without infection, appeared, and for confirming that T-DNA Ri plasmid fragments were transformed and integrated to plant genome, the rolB gene region, was amplified using PCR. HPLC method was then used for assaying how two tropane alkaloids such as atropine (hyosciamine and scopolamine (hyoscine were produced in hairy roots,control roots, leaves and roots of plantlet. Results: The data indicated that diagnostic 500bp rol B product amplification was exhibited to be present by all the transformed hairy roots. Scopolamine content in hairy roots was considerably greater than that in control roots but greatest (Hyoscyamine atropine content was observed in control roots. Analysis of DW, FW and root length showed that fresh and dry root weight increased in hairy roots compared with that in non transformed root. Recommended applications/industries: The present study demonstrated that secondary metabolite production using medicinal plants concerns many researchers worldwide today and hairy root culture is a useful method for producing tropane alkaloids in solanaceae.

Characterization of Trichome-Expressed BAHD Acyltransferases in Petunia axillaris Reveals Distinct Acylsugar Assembly Mechanisms within the Solanaceae.

Science.gov (United States)

Nadakuduti, Satya Swathi; Uebler, Joseph B; Liu, Xiaoxiao; Jones, A Daniel; Barry, Cornelius S

2017-09-01

Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato ( Solanum lycopersicum ), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3', and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris , tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris , PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3' position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3' position in tomato, is absent in P. axillaris Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. © 2017 American Society of Plant Biologists. All Rights Reserved.

Contribution à l'étude de l'activité biologique d'extraits de feuilles de Cestrum parqui L'Herit.(Solanaceae sur le criquet pélerin Schistocerca gregaria (Forsk

Directory of Open Access Journals (Sweden)

Barbouche N.

2001-01-01

Full Text Available Contribution to the study of the biological activity of Cestrum parqui L'Herit. extracts against the locust Schistocerca gregaria (Forsk. The leaves of Cestrum parqui L'Herit. (Solanaceae, a common ornamental shrub in North Africa showed strong insecticide activity against the locust Schistocerca gregaria. The first part of this paper deals with a phytochemical survey of C. parqui. The second one reports on the toxicity of methanolic extracts (EB of leaves and fractions thereof. The mortality in treated insects (at the 5th instar injected with aqueous solutions of EB or fractions reached 100/ within a period of 2 to 4 days. The bioassays undertaken with two fractions F37 (recovered from EB by solid phase extraction and ESB (resulting from the diethylether precipitation from EB methanolic solution exhibited a similar toxicity. The n-hexane extracts obtained after F37 and ESB acidic hydrolysis showed the same TLC patterns. The toxicity of C. parqui is related to the occurrence of saponins.

Solanaceae

African Journals Online (AJOL)

GRACE

2006-05-02

May 2, 2006 ... centromeric positions and arm lengths. Meiotic behaviour of the chromosomes involved a combination of bivalent and multivalent associations especially at the polyploid levels. The significance of this work in the understanding of cytogenetic behaviour of plants and crop improvement efforts are discussed.

Comparative analyses of six solanaceous transcriptomes reveal a high degree of sequence conservation and species-specific transcripts

Directory of Open Access Journals (Sweden)

Ouyang Shu

2005-09-01

Full Text Available Abstract Background The Solanaceae is a family of closely related species with diverse phenotypes that have been exploited for agronomic purposes. Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae. The availability of large collections of Expressed Sequence Tags (ESTs for the Solanaceae now provides the opportunity to assess sequence conservation and divergence on a genomic scale. Results All available ESTs and Expressed Transcripts (ETs, 449,224 sequences for six Solanaceae species (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana, were clustered and assembled into gene indices. Examination of gene ontologies revealed that the transcripts within the gene indices encode a similar suite of biological processes. Although the ESTs and ETs were derived from a variety of tissues, 55–81% of the sequences had significant similarity at the nucleotide level with sequences among the six species. Putative orthologs could be identified for 28–58% of the sequences. This high degree of sequence conservation was supported by expression profiling using heterologous hybridizations to potato cDNA arrays that showed similar expression patterns in mature leaves for all six solanaceous species. 16–19% of the transcripts within the six Solanaceae gene indices did not have matches among Solanaceae, Arabidopsis, rice or 21 other plant gene indices. Conclusion Results from this genome scale analysis confirmed a high level of sequence conservation at the nucleotide level of the coding sequence among Solanaceae. Additionally, the results indicated that part of the Solanaceae transcriptome is likely to be unique for each species.

Characterization of Trichome-Expressed BAHD Acyltransferases in Petunia axillaris Reveals Distinct Acylsugar Assembly Mechanisms within the Solanaceae1[OPEN

Science.gov (United States)

Uebler, Joseph B.; Liu, Xiaoxiao

2017-01-01

Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato (Solanum lycopersicum), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3ʹ, and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris, tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris, PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3ʹ position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3ʹ position in tomato, is absent in P. axillaris. Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. PMID:28701351

Intoxicação natural e experimental por Metternichia princeps (Solanaceae em caprinos

Directory of Open Access Journals (Sweden)

Juliana da Silva Prado

2012-09-01

Full Text Available Entre os anos de 2007 e 2009 ocorreu uma doença nefrotóxica de evolução subaguda com alta mortandade em caprinos em uma propriedade no município de Itaguaí, estado do Rio de Janeiro. Levantou-se a suspeita de que Metternichia princeps, planta pertencente à família Solanaceae, seria a causa. Através de experimentação em caprinos o quadro clínico-patológico de intoxicação por esta planta e a dose letal foram estabelecidos. Na experimentação foram utilizados 12 caprinos de diferentes raças, de ambos os sexos, jovens a adultos, com pesos acima de 15 kg. Os animais que receberam as doses de 30g/kg em 5 dias, 15g/kg em 3 dias, doses únicas de 10g/kg e de 5g/kg, morreram. Dos três animais que receberam as doses únicas de 2,5g/kg, dois morreram e um não apresentou sinais clínicos e o animal que recebeu a dose única de 1,25g/kg, também não apresentou sinais clínicos. O início dos sinais clínicos após a administração da planta variou entre 7h e 46h45min. A evolução variou entre 3h6min e 126h40min. Os primeiros sinais clínicos apresentados foram inapetência, adipsia, apatia e relutância ao movimento. Em seguida os animais entravam em decúbito esternal e ao serem colocados em estação, mantinham os membros anteriores flexionados, apoiavam apenas os posteriores no chão até evoluírem para flexão dos quatro membros e seguia-se o decúbito lateral. À necropsia destacaram-se o edema de tecido adiposo perirrenal, rins pálidos e, ao corte, com estriação esbranquiçada desde o córtex até a região medular. À histopatologia foi verificada acentuada necrose coagulativa das células epiteliais dos túbulos uriníferos. Comparativamente aos casos naturais, os caprinos intoxicados experimentalmente por M. princeps apresentaram quadro clínico-patológico semelhante. Desta maneira foi comprovado que Metternichia princeps é responsável pela doença nefrotóxica em caprinos no Rio de Janeiro; a menor dose que causou a

Dispersals of Hyoscyameae and Mandragoreae (Solanaceae) from the New World to Eurasia in the early Miocene and their biogeographic diversification within Eurasia.

Science.gov (United States)

Tu, Tieyao; Volis, Sergei; Dillon, Michael O; Sun, Hang; Wen, Jun

2010-12-01

The cosmopolitan Solanaceae contains 21 tribes and has the greatest diversity in South America. Hyoscyameae and Mandragoreae are the only tribes of this family distributed exclusively in Eurasia with two centers of diversity: the Mediterranean-Turanian (MT) region and the Tibetan Plateau (TP). In this study, we examined the origins and biogeographical diversifications of the two tribes based on the phylogenetic framework and chronogram inferred from a combined data set of six plastid DNA regions (the atpB gene, the ndhF gene, the rps16-trnK intergenic spacer, the rbcL gene, the trnC-psbM region and the psbA-trnH intergenic spacer) with two fossil calibration points. Our data suggest that Hyoscyameae and Mandragoreae each forms a monophyletic group independently derived from different New World lineages in the early Miocene. Phylogenetic relationships within both tribes are generally well resolved. All genera of Hyoscyameae are found to be monophyletic and they diversified in middle to late Miocene. At nearly the same time, Mandragoreae split into two clades, corresponding to the MT region and the TP region, respectively. Both the phylogenetic relationships and the estimated ages of Hyoscyameae and Mandragoreae support two independent dispersal events of their ancestors from the New World into Eurasia. After their arrivals in Eurasia, the two tribes diversified primarily in the MT region and in the TP region via multiple biogeographic processes including vicariance, dispersal, recolonization or being preserved as relicts, from the mid Miocene to the late Quaternary. Published by Elsevier Inc.

Reproductive biology of endemic Solanum melissarum Bohs (Solanaceae) and updating of its current geographic distribution as the basis for its conservation in the Brazilian Cerrado.

Science.gov (United States)

Coelho, C P; Gomes, D C; Guilherme, F A G; Souza, L F

2017-11-01

The genus Solanum (family Solanaceae) includes more than 1400 species and has buzz-pollinated flowers with poricidal anthers. The present study aimed to describe the distribution, breeding system and pollination mechanism of Solanum melissarum, a species endemic to Brazil. The study of breeding system was conducted in an urban forest fragment in Jataí, GO. Distribution data were gathered from floristic surveys and digital plant databases. The floral morphology and the pollination mechanism were studied on through field observations and preserved flowers. The breeding system was determined through hand pollination treatments. The species has a distribution only in the Brazilian Atlantic forest coastal, and this study provides the first records of S. melissarum for the state of Goiás. The pendulous flowers have poricidal anthers close to the stigma, with membranous thecae joined by a connective bearing osmophores that attract males of Euglossa cordata bees. As they collect fragrances, the bees press the thecae and pollen is released through a bellows mechanism. Based on the hand-pollination treatments, this species is self-incompatible. Isolated forest fragments may not include enough pollinators to ensure the pollination of plants with specialized systems. However, they are essential for the conservation of species with interesting phytogeographic patterns, such as the vicariance observed in S. melissarum, and for the conservation of regional diversity.

Use of organic waste as biofumigant for controlling root knot nematodes (Meloidogyne spp.) on potato

Science.gov (United States)

Sari, D. I. P.; Lisnawita; Oemry, S.; Safni, I.; Lubis, K.; Tantawi, A. R.

2018-02-01

Root knot nematode (Meloidogyne spp.) is one of the important pathogens that causes big impact on potato crop yields. One of the control strategies for controlling this nematode is the use of biofumigants. Biofumigants are volatile toxic compound derived from plants, and have biocide properties against insects and plant pathogens. Organic waste such as Brassicaceae, Leguminoceae, and Solanaceae can be used as biofumigant sources. This research was conducted to determine the effectiveness of Brassicaceae, Leguminoceae, and Solanaceae as biofumigants against Meloidogyne spp. The experiment was set in a completely randomized design (CRD) with the treatments were organic wastes including Brassicaceae, Leguminoceae, and Solanaceae, both single and combinations, and 2 controls (positive and negative controls) with 3 replications. Each of the biofumigant treatments was prepared and stored for 2 weeks. Potato tubers were transplanted 15 days after germination into polybag inoculated with 1,000 Meloidogyne spp. J2s. The results showed that Brassicaceae + Solanaceae were effective in decreasing the number of galls in potato plants, however only Solanaceae improved plant growth.

Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae)

International Nuclear Information System (INIS)

Azeredo, Edson Henrique de; Lima, Eduardo; Cassino, Paulo Cesar Rodrigues

2004-01-01

Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Huefnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae). The occurrence of Diabrotica speciosa (Germar, 1824) and Agrotis ipsilon (Huefnagel, 1767) on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum quantity of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha -1 of N + K with 27.03% at P -1 , in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensitized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing. (author)

Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae); Impacto dos nutrientes N e K e de acucares soluveis sobre populacoes de Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) e Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) na cultura da batata, Solanum tuberosum L. (Solanaceae)

Energy Technology Data Exchange (ETDEWEB)

Azeredo, Edson Henrique de [Universidade Federal Fluminense (UFF), Pinheiral, RJ (Brazil). Pro-Reitoria de Extensao], e-mail: edsonhenrique.azeredo@bol.com.br; Lima, Eduardo [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Agronomia. Dept. de Solos; Cassino, Paulo Cesar Rodrigues [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Biologia. Centro Integrado de Manejo de Pragas C.R.G.

2004-03-15

Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Huefnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae). The occurrence of Diabrotica speciosa (Germar, 1824) and Agrotis ipsilon (Huefnagel, 1767) on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum quantity of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha{sup -1} of N + K with 27.03% at P< 0,05. It was observed that the effect of the dosage of N + K in the increment of the concentration of soluble sugars increased the damages in the tubercles and stems by A. ipsilon. The infestation by these species increased to 58.82% on the Monalisa cultivar, when the nitrogen dosage increased from zero to 150 kg.ha{sup -1}, in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensitized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing. (author)

SCR96, a small cysteine-rich secretory protein of Phytophthora cactorum, can trigger cell death in the Solanaceae and is important for pathogenicity and oxidative stress tolerance.

Science.gov (United States)

Chen, Xiao-Ren; Li, Yan-Peng; Li, Qi-Yuan; Xing, Yu-Ping; Liu, Bei-Bei; Tong, Yun-Hui; Xu, Jing-You

2016-05-01

Peptides and small molecules produced by both the plant pathogen Phytophthora and host plants in the apoplastic space mediate the relationship between the interplaying organisms. Various Phytophthora apoplastic effectors, including small cysteine-rich (SCR) secretory proteins, have been identified, but their roles during interaction remain to be determined. Here, we identified an SCR effector encoded by scr96, one of three novel genes encoding SCR proteins in P. cactorum with similarity to the P. cactorum phytotoxic protein PcF. Together with the other two genes, scr96 was transcriptionally induced throughout the developmental and infection stages of the pathogen. These genes triggered plant cell death (PCD) in the Solanaceae, including Nicotiana benthamiana and tomato. The scr96 gene did not show single nucleotide polymorphisms in a collection of P. cactorum isolates from different countries and host plants, suggesting that its role is essential and non-redundant during infection. Homologues of SCR96 were identified only in oomycetes, but not in fungi and other organisms. A stable protoplast transformation protocol was adapted for P. cactorum using green fluorescent protein as a marker. The silencing of scr96 in P. cactorum caused gene-silenced transformants to lose their pathogenicity on host plants and these transformants were significantly more sensitive to oxidative stress. Transient expression of scr96 partially recovered the virulence of gene-silenced transformants on plants. Overall, our results indicate that the P. cactorum scr96 gene encodes an important virulence factor that not only causes PCD in host plants, but is also important for pathogenicity and oxidative stress tolerance. © 2015 BSPP AND JOHN WILEY & SONS LTD.

Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

Directory of Open Access Journals (Sweden)

Topik Hidayat

2016-04-01

Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

Extratos metanólico e acetato de etila de Solanum megalonyx Sendtn. (Solanaceae apresentam atividade espasmolítica em íleo isolado de cobaia: um estudo comparativo

Directory of Open Access Journals (Sweden)

Rita de Cássia M. Oliveira

Full Text Available Solanum megalonyx Sendtn. (Solanaceae é conhecida popularmente por "jurubeba" no Nordeste do Brasil e se apresenta na forma de arbusto. Várias espécies de Solanum apresentam efeito espasmolítico em órgãos isolados. Assim, objetivou-se investigar e comparar o efeito dos extratos metanólico (SM-MeOH e acetato de etila (SM-AcOEt, obtidos das partes aéreas de S. megalonyx, em íleo isolado de cobaia. SM-MeOH e SM-AcOEt antagonizaram (n = 5 as contrações fásicas induzidas por 1 mM de acetilcolina (logCI50 = 3,2 ± 0,1 e 1,8 ± 0,6 mg/mL, respectivamente ou de histamina (logCI50 = 2,8 ± 0,5 e 1,7 ± 0,3 mg/mL, respectivamente. SM-MeOH e SM-AcOEt também relaxaram (n = 5 o íleo pré-contraído por 40 mM de KCl (logCE50 = 1,9 ± 0,09 e 1,9 ± 0,1 mg/mL, respectivamente, por 1 mM de histamina (logCE50 = 1,9 ± 0,07 e 1,7 ± 0,08 mg/mL, respectivamente ou de acetilcolina (logCE50 = 1,9 ± 0,02 e 1,7 ± 0,09 mg/mL, respectivamente de maneira dependente de concentração e equipotente. Demonstra-se pela primeira vez que S. megalonyx apresenta efeito espasmolítico não seletivo em íleo isolado de cobaia, sugerindo que os extratos podem estar agindo em um passo comum da via de sinalização dos agentes contráteis testados.

Development of a real-time PCR method for the differential detection and quantification of four solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum).

Science.gov (United States)

Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves

2008-03-26

The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.

Fruit anatomy of species of Solanum sect. Torva (Solanaceae Anatomía del fruto en especies de Solanum sect. Torva (Solanaceae

Directory of Open Access Journals (Sweden)

Franco E. Chiarini

2010-12-01

Full Text Available The mature fruits of 10 South American species of Solanum sect. Torva were studied. Cross and longitudinal microtome sections, stained with astra blue/basic fuchsin, were made for microscopic examination. All species present an epidermis formed by a unistrate layer of small, isodiametric cells, with dense content and cellulosic walls. Immediately below, a hypodermis is always found, consisting of a well-defined layer of lignified cells with a single calcium oxalate crystal occupying the whole lumen of each cell. This is followed by one layer of cellulosic, isodiametric cells with dense cytoplasm and then several collenchymatous layers, sometimes with sclerified cell walls. The mesocarp comprises two zones histologically differentiated: an external one (formed by regular, vacuolated, medium-sized cells with small intercellular spaces, and an internal one, commonly juicy, and developing proliferations among the seeds. The fruits analyzed are alike, and despite some particularities, they can be classified as berries in the conventional sense. All the traits examined agree with the ornithochorous dispersal syndrome. The homogeneity in fruit traits may be due to shared habit, habitat and sexual system.Se estudiaron los frutos maduros de 10 especies sudamericanas de Solanum sect. Torva. Se examinaron en microscopio cortes microtómicos transversales y longitudinales teñidos con azul astral/fucsina básica. Todas las especies presentaron una epidermis unistrata de células pequeñas, isodiamétricas, de contenido denso y paredes celulósicas. Inmediatamente por debajo se encontró siempre una hipodermis, formada por una capa bien definida de células lignificadas con un cristal de oxalato de calcio en el lúmen de cada célula. A continuación se halló otra capa de celulas isodiamétricas, celulósicas, de contenido denso, y luego varias capas de colénquima, en ocasiones con paredes esclerificadas. El mesocarpo presentó dos zonas histologicamente

Anti-ulcer and anti-Helicobacter pylori potentials of the ethyl acetate fraction of Physalis alkekengi L. var. franchetii (Solanaceae) in rodent.

Science.gov (United States)

Wang, Yong; Wang, Sui Lou; Zhang, Jiong Yi; Song, Xiao Ning; Zhang, Zhi Yong; Li, Jing Feng; Li, Song

2018-01-30

Physalis alkekengi L. var. franchetii (Solanaceae) has been widely used in Chinese folk medicine due to its wide distribution throughout the country, for the treatment of a wide range of diseases including heat and cold, sore throat, fever, fungal infection, inflammation, toothache, rheumatism, burn, analgesic, ulcer and urinary diseases. However, the effect of P. alkekengi var. franchetii on ulcer and Helicobacter pylori infection has not been reported to date. This study was designed to investigate the anti-inflammatory, anti-ulcer, anti-Helicobacter pylori and analgesic properties of ethyl acetate fraction of the crude aqueous methanolic extract from the aerial parts of the plant P. alkekengi L. var. franchetii in rodents. Acute toxicity of the crude extract of P. alkekengi L. var. franchetii (PAF) was evaluated in rats. The petroleum ether fraction (PEF), butanol fraction (BF), ethyl acetate fraction (EAF) and aqueous fraction (AF) of crude aqueous methanolic extract from PAF were screened for anti-inflammatory and anti-ulcer potential at doses of 100, 250 and 500mg/kg (p.o.), using carrageenin-induced hind paw edema and ethanol-induced gastric lesions test in rats. In vitro anti-Helicobacter pylori activity of EAF was assayed subsequently. In addition, three doses of EAF were evaluated for analgesic activity using hot plate and writhing tests, respectively. Finally, we performed a phytochemical analysis of EAF. Four fractions of crude extract from PAF significantly reduced the paw volume in carrageenin-induced hind paw edema model at different doses (100, 250 and 500mg/kg, p.o.). The fraction EAF at a dose of 500mg/kg exhibited the highest (75.92%) (0.150 ± 0.045***, ***p < 0.001) anti-inflammatory potential, which is similar to indomethacin (***P < 0.001)（0.120 ± 0.014***, 80.74% inhibition of inflammation） at 5mg/kg. Pretreatment with EAF (500mg/kg, p.o.) significantly reduced the intensity of gastric mucosal damage and showed higher gastroprotective

A revision of the Solanum elaeagnifolium clade (Elaeagnifolium clade; subgenus Leptostemonum, Solanaceae

Directory of Open Access Journals (Sweden)

Sandra Knapp

2017-08-01

Full Text Available The Solanum elaeagnifolium clade (Elaeagnifolium clade contains five species of small, often rhizomatous, shrubs from deserts and dry forests in North and South America. Members of the clade were previously classified in sections Leprophora, Nycterium and Lathyrocarpum, and were not thought to be closely related. The group is sister to the species-rich monophyletic Old World clade of spiny solanums. The species of the group have an amphitropical distribution, with three species in Mexico and the southwestern United States and three species in Argentina. Solanum elaeagnifolium occurs in both North and South America, and is a noxious invasive weed in dry areas worldwide. Members of the group are highly variable morphologically, and this variability has led to much synonymy, particularly in the widespread S. elaeagnifolium. We here review the taxonomic history, morphology, relationships and ecology of these species and provide keys for their identification, descriptions, full synonymy (including designations of lectotypes and nomenclatural notes. Illustrations, distribution maps and preliminary conservation assessments are provided for all species.

7 CFR 361.6 - Noxious weed seeds.

Science.gov (United States)

2010-01-01

... aciculatus (Retzius) Trinius Commelina benghalensis L. Crupina vulgaris Cassini Cuscuta spp. Digitaria...), nightshade (Solanaceae), and sunflower (Asteraceae). (5) Dodder (Cuscuta spp.) seeds devoid of embryos and...

Origin of allelic diversity in antirrhinum S locus RNases.

Science.gov (United States)

Xue, Y; Carpenter, R; Dickinson, H G; Coen, E S

1996-01-01

In many plant species, self-incompatibility (SI) is genetically controlled by a single multiallelic S locus. Previous analysis of S alleles in the Solanaceae, in which S locus ribonucleases (S RNases) are responsible for stylar expression of SI, has demonstrated that allelic diversity predated speciation within this family. To understand how allelic diversity has evolved, we investigated the molecular basis of gametophytic SI in Antirrhinum, a member of the Scrophulariaceae, which is closely related to the Solanaceae. We have characterized three Antirrhinum cDNAs encoding polypeptides homologous to S RNases and shown that they are encoded by genes at the S locus. RNA in situ hybridization revealed that the Antirrhinum S RNase are primarily expressed in the stylar transmitting tissue. This expression is consistent with their proposed role in arresting the growth of self-pollen tubes. S alleles from the Scrophulariaceae form a separate group from those of the Solanaceae, indicating that new S alleles have been generated since these families separated (approximately 40 million years). We propose that the recruitment of an ancestral RNase gene into SI occurred during an early stage of angiosperm evolution and that, since that time, new alleles subsequently have arisen at a low rate. PMID:8672882

ORF Alignment: NC_003295 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available ECTION DURING STARVATION OR OXYDATIVE STRESS ... TRANSCRIPTION REGULATOR PROTEIN [Ralstonia solanacea...rum] ... ref|NP_520808.1| PUTATIVE DNA PROTECTION DURING ... STARVATION OR OXYDATIVE STRESS TR

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96944 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT97016 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96931 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96911 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96668 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96940 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96935 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96933 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96937 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT97018 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96927 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96946 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96929 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

24 CFR 882.123 - Conversion of Section 23 Units to Section 8 and Section 23 monitoring.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Conversion of Section 23 Units to... Applicability, Scope and Basic Policies § 882.123 Conversion of Section 23 Units to Section 8 and Section 23 monitoring. (a)-(d) [Reserved] (e) Section 23 policies for units planned for conversion on or before...

Taxonomy of Rhagoletis population associated with wild plums in Chile

International Nuclear Information System (INIS)

Frias, Daniel; Alvina, Andres

2000-01-01

In South America, there are about fifteen Rhagoletis species that live in association with wild and cultivated Solanaceae host plants (Foote 1981, Frias 1992). The principal information on taxonomy for these species is the morphology of adults. Thus, in the genus Rhagoletis, in general, there is little information about immature stages especially on first and second larva instars (Steck et al. 1990, Carrol and Wharton 1989, Steck and Wharton 1988, Persson 1963, White and Elson-Harris 1992, Hernandez-Ortiz 1992, 1993, Frias et al. 1993). Presently, in Chile, there are 4 species associated with Solanaceae host plants. R. tomatis Foote and R. nova (Schiner) are associated with cultivated Solanaceae Lycopersicum esculentum Miller or cultivated tomatoes and Solanum muricatum Aiton or sweet cucumber respectively. R. conversa Bethes has two Solanum host plants, S. nigrum L. and S. tomatillo (Remy) Phil. F. (Frias et al. 1984). The host for R. penela Foote is unknown. Moreover, in the last few years, a population on wild plums of the Myrobalan variety (Rosaceae) was detected (Gonzalez 1989). At present, there is no information about the origin and taxonomy of this population. In this work, we have studied the morphology of eggs, three instar larvae, pupae and adults of this population associated with wild plums as well as aspects of its geographical distribution in Chile

Dieta de murciélagos nectarívoros del Parque Nacional Cerros de Amotape, Tumbes

Directory of Open Access Journals (Sweden)

Edith Arias

2011-07-01

Full Text Available En el Perú se reporta la presencia de 18 especies de murciélagos nectarívoros, sin embargo se cuenta con poca información sobre la dieta de estas especies. En este estudio se reporta por primera vez la dieta de los nectarívoros Glossophaga soricina, Lonchophylla hesperia y Anoura geoffroyi en el bosque seco ecuatorial y del bosque tropical del Pacífico del Parque Nacional Cerros de Amotape, Tumbes. Analizamos 21 contenidos gastrointestinales e identificamos ocho morfotipos de polen pertenecientes a las familias Bombacaceae, Cactaceae, Fabaceae, Solanaceae, Rubiaceae, Myrtaceae, Malvaceae y Rosaceae. Encontramos evidencia del síndrome de quiropterofilia en Bombacaceae, Cactaceae, Fabaceae, Solanaceae y Rubiaceae. Observamos que A. geoffroyi consume polen de Ceiba trichistandra, Solanaceae y Rubiacea; G. soricina consume de Abutilon reflexum, Armathocereus cartwrightianus, C. trichistandra y Rubiaceae; y L. hesperia de A. cartwrightianus, Eriobotrya japonica, Fabaceae y Psidium sp.; sugiriendo una dieta generalista en estas especies. Los murciélagos G. soricina y A. geoffroyi comparten el consumo del ceibo C. trichistandra y de la Rubiaceae, mientras que G. soricina comparte con L. hesperia el consumo del cactus A. cartwrightianus. Los otros morfotipos de polen no fueron compartidos entre murciélagos. Se encuentra además que el ceibo C. trichistandra fue la especie más consumida, especialmente por G. soricina.

Flowerlocation in Solanum dulcamara L. (Solanaceae

Directory of Open Access Journals (Sweden)

Irina Zhuravlyeva

2013-01-01

Full Text Available The morphology of inflorescence of Solanum dulcamara is studied. Pseudolateral location of inflorescence relatively to plant body is set, the absence of bracteae and the sympodial type of growing of branches are found out. From W. Troll point of view the inflorescence of nightshade is defined as the polytelica synflorescence – complex dichasium.

Effect of ripening period on composition of pepino (Solanum ...

African Journals Online (AJOL)

USER

% for raw and ... of glucose and fructose declined during ripening, whereas sucrose showed an increase in ... Solanaceae like tomato, potato, tobacco and pepper ... Abbreviation: NDF, Neutral detergent fiber; ADF, acid detergent fiber;. HPLC,.

Cullin1-P is an Essential Component of Non-Self Recognition System in Self-Incompatibility in Petunia.

Science.gov (United States)

Kubo, Ken-Ichi; Tsukahara, Mai; Fujii, Sota; Murase, Kohji; Wada, Yuko; Entani, Tetsuyuki; Iwano, Megumi; Takayama, Seiji

2016-11-01

Self-incompatibility (SI) in flowering plants is a genetic reproductive barrier to distinguish self- and non-self pollen to promote outbreeding. In Solanaceae, self-pollen is rejected by the ribonucleases expressed in the styles (S-RNases), via its cytotoxic function. On the other side, the male-determinant is the S-locus F-box proteins (SLFs) expressed in pollen. Multiple SLFs collaboratively detoxify non-self S-RNases, therefore, non-self recognition is the mode of self-/non-self discrimination in Solanaceae. It is considered that SLFs function as a substrate-recognition module of the Skp1-Cullin1-F-box (SCF) complex that inactivates non-self S-RNases via their polyubiquitination, which leads to degradation by 26S proteasome. In fact, PhSSK1 (Petunia hybrida SLF-interacting Skp1-like1) was identified as a specific component of SCF SLF and was shown to be essential for detoxification of S-RNase in Petunia However, different molecules are proposed as the candidate Cullin1, another component of SCF SLF , and there is as yet no definite conclusion. Here, we identified five Cullin1s from the expressed sequence tags (ESTs) derived from the male reproductive organ in Petunia Among them, only PhCUL1-P was co-immunoprecipitated with S 7 -SLF2. In vitro protein-binding assay suggested that PhSSK1 specifically forms a complex with PhCUL1-P in an SLF-dependent manner. Knockdown of PhCUL1-P suppressed fertility of transgenic pollen in cross-compatible pollination in the functional S-RNase-dependent manner. These results suggested that SCF SLF selectively uses PhCUL1-P. Phylogeny of Cullin1s indicates that CUL1-P is recruited into the SI machinery during the evolution of Solanaceae, suggesting that the SI components have evolved differently among species in Solanaceae and Rosaceae, despite both families sharing the S-RNase-based SI. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For

Morphological Characters, Occurrence and Distribution among ...

African Journals Online (AJOL)

ADOWIE PERE

Key words: Solanaceae, Solanum, Stomata, trichomes, Complements, Comparative. .... kind of oil secretory function which gave the leaves and stems glossary outlook. .... 25. 96. 20.66%. Anomocyti c. CWO13. Capsicum frutescens. Linn. 5. 78.

Cesarean Sections

Science.gov (United States)

... birth after a C-section, called a VBAC ) Emergency C-Sections Some C-sections are unexpected emergency ... side to nurse or using the clutch (or football) hold can take the pressure off your abdomen. ...

Antidiabetic activity of water extract of Solanum trilobatum (Linn.) in ...

African Journals Online (AJOL)

STORAGESEVER

2009-10-19

Solanaceae), a medicinal plant widely used in the traditional Ayurveda and Siddha systems of medicine for the treatment of diabetes mellitus was evaluated in the alloxan monohydrate induced diabetic model. Graded doses of the ...

Epigenetic patterns newly established after interspecific hybridization in natural populations of Solanum

Science.gov (United States)

Cara, Nicolás; Marfil, Carlos F; Masuelli, Ricardo W

2013-01-01

Interspecific hybridization is known for triggering genetic and epigenetic changes, such as modifications on DNA methylation patterns and impact on phenotypic plasticity and ecological adaptation. Wild potatoes (Solanum, section Petota) are adapted to multiple habitats along the Andes, and natural hybridizations have proven to be a common feature among species of this group. Solanum × rechei, a recently formed hybrid that grows sympatrically with the parental species S. kurtzianum and S. microdontum, represents an ideal model for studying the ecologically and evolutionary importance of hybridization in generating of epigenetic variability. Genetic and epigenetic variability and their correlation with morphological variation were investigated in wild and ex situ conserved populations of these three wild potato species using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP) techniques. We observed that novel methylation patterns doubled the number of novel genetic patterns in the hybrid and that the morphological variability measured on 30 characters had a higher correlation with the epigenetic than with the genetic variability. Statistical comparison of methylation levels suggested that the interspecific hybridization induces genome demethylation in the hybrids. A Bayesian analysis of the genetic data reveled the hybrid nature of S. × rechei, with genotypes displaying high levels of admixture with the parental species, while the epigenetic information assigned S. × rechei to its own cluster with low admixture. These findings suggested that after the hybridization event, a novel epigenetic pattern was rapidly established, which might influence the phenotypic plasticity and adaptation of the hybrid to new environments. PMID:24198938

Phyto-assisted synthesis of bio-functionalised silver nanoparticles and their potential anti-oxidant, anti-microbial and wound healing activities.

Science.gov (United States)

Mohanta, Yugal Kishore; Biswas, Kunal; Panda, Sujogya Kumar; Bandyopadhyay, Jaya; De, Debashis; Jayabalan, Rasu; Bastia, Akshaya Kumar; Mohanta, Tapan Kumar

2017-12-01

Bio- synthesis of silver nanoparticles (AgNPs) was made by using the aqueous leaf extract of Ardisia solanacea. Rapid formation of AgNPs was observed from silver nitrate upon treatment with the aqueous extract of A. solanacea leaf. The formation and stability of the AgNPs in the colloidal solution were monitored by UV-visible spectrophotometer. The mean particle diameter of AgNPs was calculated from the DLS with an average size ∼4 nm and ∼65 nm. ATR-FTIR spectroscopy confirmed the presence of alcohols, aldehydes, flavonoids, phenols and nitro compounds in the leaf which act as the stabilizing agent. Antimicrobial activity of the synthesized AgNPs was performed using agar well diffusion and broth dilution method against the Gram-positive and Gram-negative bacteria. Further, robust anti-oxidative potential was evaluated by DPPH assay. The highest antimicrobial activity of synthesized AgNPs was found against Pseudomonas aeruginosa (28.2 ± 0.52 mm) whereas moderate activity was found against Bacillus subtilis (16.1 ± 0.76), Candida kruseii (13.0 ± 1.0), and Trichophyton mentagrophytes (12.6 ± 1.52). Moreover, the potential wound healing activity was observed against the BJ-5Ta normal fibroblast cell line. Current research revealed that A. solanacea was found to be a suitable source for the green synthesis of silver nanoparticles.

Antidiabetic activity of water extract of Solanum trilobatum (Linn.) in ...

African Journals Online (AJOL)

Solanaceae), a medicinal plant widely used in the traditional Ayurveda and Siddha systems of medicine for the treatment of diabetes mellitus was evaluated in the alloxan monohydrate induced diabetic model. Graded doses of the water extract were ...

Untitled

Indian Academy of Sciences (India)

The berries (fruits) are green when unripe and of different shades of yellow ... to have high medicinal value in various diseases like cough, asthma, fever, heart disease, etc. The plant under investigation belongs to the natural order Solanacea.

Hepatoprotective activity of aerial part and root extracts of ...

African Journals Online (AJOL)

) extracts of Schwenckia americana Linn (Solanaceae) against carbon tetrachloride (CCl4)-induced hepatotoxicity in rats was studied. Adult Swiss albino rats of either sex were divided into six groups (n=6). Groups I-IV received MME and RME ...

Marker list: QM109927 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop

Marker list: QM109928 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT

QTL list: SpRg-7 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available entage concerning shoot regeneration 2 ME10-141 ... Chr07 19.51 6.84 ... 10.1186/1471-2229-11-140 22014149 ... QT73653 Solanum lycopersicum Solanaceae SpRg-7 In vitro plant regeneraion bud perc

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96955 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr08 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96953 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96951 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr01 ... 10.1007/s00122-013-2254-y 24408376

QTL list: RXopJ4 resistance locus [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT62244 Solanum lycopersicum Solanaceae RXopJ4 resistance locus resistance to bacterial spot... disease resistance to bacterial spot disease (Xanthomonas perforans (Xp)) 3 J350 ... Chr06 ... 10.1007/s00122-012-2004-6 23117718

Marker list: QM357356 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QM357356 Solanum tuberosum Solanaceae toPt-437059 Others ... CIP703825 ... Chr10 ratio of tuber length to tuber... width trait and eye depth of tuber trait 1 10.1186/s12863-015-0213-0 26024857

Cross-species BAC-FISH painting of the tomato and potato chromosome 6 reveals undescribed chromosomal rearrangements

NARCIS (Netherlands)

Tang, X.; Szinay, D.; Ramanna, M.S.; Vossen, van der E.A.G.; Datema, E.; Klein Lankhorst, R.M.; Boer, de J.M.; Peters, S.A.; Bachem, C.W.B.; Stiekema, W.J.; Visser, R.G.F.; Jong, de J.H.; Bai, Y.

2008-01-01

Ongoing genomics projects of tomato (Solanum lycopersicum ) and potato (Solanum tuberosum) are providing unique tools for comparative mapping studies in Solanaceae. At the chromosomal level, BACs can be positioned on pachytene comple-ments by fluorescent in situ hybridization (FISH) on homoeologous

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75069 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr06 101.1-107.3 3.68 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75066 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr04 65.1-81.9 2.15 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75072 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr08 72.6-87.8 2.32 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75075 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr12 49.5-63.0 2.54 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Environ: E00229 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available E00229 Belladonna leaf (USP) Crude drug Hyoscyamine [CPD:C02046], Atropine [CPD:C0...1479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] Atropa belladonna [TAX:33113] Same as: D03223 Solanaceae (nightshade family) Belladonna leaf ...

10 - 18_Aworinde

African Journals Online (AJOL)

DR. AMINU

From the data, Euphorbiaceae,. Solanaceae, Rutaceae, Malvaceae, Caesalpiniaceae, Poaceae and Apocynaceae (in order of decreasing number of species) were the most frequent Families. Taxa such as Musa species,. Vernonia amygdalina, Citrus species, Psidium guajava and Terminalia catappa were found to be the.

Bell pepper rootstock response to Phytophthora capsici under salinity stress

Science.gov (United States)

Vegetable grafting is currently used as an eco-friendly technology to increase crop productivity and overcome several biotic and abiotic stress conditions that affect Cucurbitaceae and Solanaceae vegetable crops. In recent years, researchers with breeding programs and seed companies have selected ro...

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75103 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 102.7-108.3 5.59 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75102 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 38.9-56.2 3.42 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75104 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr09 100.8-112.7 2.78 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Gut content analysis of a phloem-feeding insect, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae)

Science.gov (United States)

Potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae) is a key pest of potato (Solanum tuberosum L., Solanales: Solanaceae) and a vector of "Candidatus Liberibacter solanacearum," the pathogen associated with zebra chip disease. In addition to its presence on cultivated crops, the p...

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT97962 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536041 ... Chr01 67.8 3.83 ... 10.1007/s11032-015-0415-1 26612975

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT97965 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536863 ... Chr06 75.9 3.84 ... 10.1007/s11032-015-0415-1 26612975

Infection of potato plants with potato leafroll virus changes attraction and feeding behaviour of Myzus persicae

NARCIS (Netherlands)

Alvarez, A.E.; Garzo, E.; Verbeek, M.; Vosman, B.; Dicke, M.; Tjallingii, W.F.

2007-01-01

Potato leafroll virus (PLRV; genus Polerovirus, family Luteoviridae) is a persistently transmitted circulative virus that depends on aphids for spreading. The primary vector of PLRV is the aphid Myzus persicae (Sulzer) (Homoptera: Aphididae). Solanum tuberosum L. potato cv. Kardal (Solanaceae) has a

A new species of solitary Meteorus (Hymenoptera: Braconidae) reared from caterpillars of toxic butterflies (Lepidoptera: Nymphalidae) in Ecuador.

Science.gov (United States)

Shaw, Scott R; Jones, Guinevere Z

2009-01-01

A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nymphalidae. A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nymphalidae.

Potential economic pests of solanaceous crops: a new species of Solanum-feeding psyllid from Australia and first record from New Zealand of Acizzia solanicola (Hemiptera: Psyllidae).

Science.gov (United States)

Taylor, Gary S; Kent, Deborah S

2013-02-11

Acizzia credoensis sp. n. is described from a single population on the native plant, Solanum lasiophyllum, from semi-arid Western Australia. The host range of Acizzia solanicola Kent & Taylor, initially recorded as damaging eggplant, S. melongena, in commercial crops and gardens and on wild tobacco bush, S. mauritianum in eastern Australia, is expanded to include the following Solanaceae: rock nightshade, S. petrophilum, cape gooseberry, Physalis peruviana, and an undetermined species of angel's trumpet Brugmansia and Datura. New Zealand specimens of A. solanicola collected in early 2012 from S. mauritianum are the first record for this species from outside Australia, and possibly represent a very recent incursion. The potential for the solanaceous-inhabiting Psyllidae to vector Candidatus Liberibacter solanacearum, an economically important plant pathogen, on native Australian Solanaceae is discussed. The occurrence of A. credoensis and A. solanicola on native Australian Solanum supports the Australian origin for the solanaceous-inhabiting Acizzia psyllids.

Frugivoria em morcegos (Mammalia, Chiroptera no Parque Estadual Intervales, sudeste do Brasil Frugivory in bats (Mammalia, Chiroptera at the Intervales State Park, Southeastern Brazil

Directory of Open Access Journals (Sweden)

Fernando C. Passos

2003-09-01

Full Text Available This study was carried out at the Intervales State Park, an Atlantic Rain Forest area in Southeastern Brazil. Bats were monthly mist netted over a full year, and fecal samples were collected for dietary analysis. The seeds found in each sample were identified in the laboratory under a stereoscopic microscope by comparison with seeds taken from ripe fruits collected in the study area. Three hundred and seventy one bats were collected, of which 316 (85.2% were frugivorous. The total number of fecal samples with seeds and/or pulp was 121. Sturnira lilium (E. Geoffroy, 1810 was the most abundant species in the study area (n = 157 captures and Solanaceae fruits accounted for 78.5% of the fecal samples with seeds (n = 56. Artibeus fimbriatus Gray, 1838 (n = 21 samples fed mostly on Cecropiaceae (38% and Moraceae fruits (24%, and Artibeus lituratus (Olfers, 1818 (n = 7 samples on Cecropiaceae (57% and Moraceae (29%. Carollia perspicillata (Linnaeus, 1758 (n = 16 samples fed mostly on Piperaceae fruits (56,3%, but Solanaceae (31,3% and Rosaceae seeds (12,5% were also found in feces. Overall, seeds found in bat feces belong to eight plant families: Solanaceae (n = 67 samples; Cecropiaceae (n = 14; Piperaceae (n = 14; Moraceae (n = 8; Rosaceae (n = 3; Cucurbitaceae (n = 3; Cluseaceae (n = 1, and Araceae (n = 1. The close association of different bat species with fruits of certain plant families and genus may be related to a possible mechanism of resource partitioning that shapes the structure of the community.

Is Solanum ferox var. ferox (Solanaceae) extinct?

NARCIS (Netherlands)

Heiser, C.B.

2001-01-01

In 1995 I wrote letters to over 50 people (botanists, agricultural scientists, and former students of Indiana University) in south-eastern Asia trying to obtain a few seeds of Solanumferox L. var. ferox (S. involucratum Blume). I had over 25 replies, five of which included seeds, but none of the

Pharmacognostic and phytochemical evaluation of the Solanun ...

African Journals Online (AJOL)

Solanum sisymbriifolium Lam. (Solanaceae) is an important medicinal herb in Ayurvedic medicine. In the present investigation, the detailed pharmacognostic study of S. sisymbriifolium leaf was carried out to lay down the standards which could be useful in future experimental studies. The study included macroscopy, ...

Anti-Inflammatory and Antioxidant Activities of Methanol Extracts and ...

African Journals Online (AJOL)

Background: Methanol extracts and alkaloid fractions of different parts of four plant species belonging to Solanaceae family and used in Mexican traditional medicine were investigated for their total phenolic contents, anti-inflammatory and antioxidant properties. Materials and Methods: The total phenolic compounds of each ...

Mechanism and control of Solanum lycocarpum

NARCIS (Netherlands)

Pinto, L.V.A.; Silva, Da E.A.A.; Davide, A.C.; Mendes de Jesus, V.A.; Toorop, P.E.; Hilhorst, H.W.M.

2007-01-01

Background Solanaceae seed morphology and physiology have been widely studied but mainly in domesticated crops. The present study aimed to compare the seed morphology and the physiology of germination of Solanum lycocarpum, an important species native to the Brazilian Cerrado, with two species with

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75157 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr09 106.5-112.7 2.41 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75239 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr12 39.4-64.0 2.02 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75106 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 50% of the ger...mination of viable seeds (h-1) 2 ... Chr04 65.1-80.4 2.29 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75274 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-31.3 2.94 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75205 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-26.6 3.43 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75233 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 7.6-23.7 3.5 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. FENG LI CHUNYANG WEI CHAN QIAO ZHENXI CHEN PENG WANG PAN WEI RAN WANG LIFENG JIN JUN YANG FUCHENG LIN ZHAOPENG LUO. RESEARCH NOTE Volume 95 Issue ...

Marker list: QM183663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT

Cross-section crushing behaviour of hat-sections (Part II: Analytical modelling)

NARCIS (Netherlands)

Hofmeyer, H.

2005-01-01

Hat-sections are often used to experimentally investigate building sheeting subject to a concentrated load and bending. In car doors, hat-sections are used for side-impact protection. Their crushing behaviour can partly be explained by only observing their cross-sectional behaviour [1]. This

cDNA cloning and expression of anthocyanin biosynthetic genes in ...

African Journals Online (AJOL)

GRACE

2006-05-16

May 16, 2006 ... that influence anthocyanin pigments have been isolated from Solanaceae. A few genes of anthocyanin ... Long, 1955), and the purple anthocyanin pigments are primarily derived from the related compound ..... anthocyanin production in tuber skins. this result was similar with carrot (daucus carota l) cell ...

1271-IJBCS-Artticle-Dasmané Bambara

African Journals Online (AJOL)

hp

L'objectif de l'étude est d'évaluer la diversité taxonomique et la variabilité inter et intra-spécifique des plantes cultivées ..... Culture (16). Tomate. Lycopersicum esculentum Mill. Solanaceae. Amérique. 33. 3. 11,54 ..... Calice plus long, sauce.

Induction of cell death on Plasmodium falciparum asexual blood stages by Solanum nudum steroids

DEFF Research Database (Denmark)

López, Mary Luz; Vommaro, Rossiane; Zalis, Mariano

2010-01-01

Solanum nudum Dunal (Solanaceae) is a plant used in traditional medicine in Colombian Pacific Coast, from which five steroids denominated SNs have been isolated. The SNs compounds have antiplasmodial activity against asexual blood stages of Plasmodium falciparum strain 7G8 with an IC50 between 20...

Fungicide rotation schemes for managing Phytophthora fruit rot of watermelon across Southeastern United States (NC, SC, and GA)

Science.gov (United States)

Phytophthora capsici has been documented as a pathogen on a wide variety of vegetable crops in the family Solanaceae, Cucurbitaceae, Fabaceae, and plants belonging to 23 other families. Phytophthora fruit rot of watermelons caused by P. capsici is particularly severe in southeastern U.S where optima...

Plantas invasoras da cultura do feijoeiro (Phaseolus vulgaris L. no Estado de Minas Gerais

Directory of Open Access Journals (Sweden)

Julio Pedro Laca-Buendia

1989-01-01

Full Text Available Nas áreas de cultura do feijoeiro (Phaseolus vulgaris L., no Estado de Minas Gerais, foram coletadas e identificadas 222 espécies de plantas invasoras (= plantas daninhas, pertencentes a 35 famílias botânias, representando 118 gêneros, sendo que as famílias Compositae, Leguminosae, Gramineae, Malvaceae, Convolvulaceae, Rubiaceae, Euphorbiaceae, Amaranthaceae, Cyperaceae e Solanaceae, são as mais importantes em relação à cultura. As plantas coletadas, devidamente etiquetadas e identificadas, foram anexadas no PAMG (Herbário da Empresa de Pesquisa Agropecuária de Minas Gerais, Belo Horizonte - (MG..A survey in the cultivation area of bean in the state of Minas Gerais, Brazil, resulted in the determination of 222 weeds species, of 118 genera belonging to 35 families presenting a greater number of species areas: Compositae, Leguminosae, Gramineae, Malvaceae, Convolvulaceae, Rubiaceae, Euphorbiaceae, Amaranthaceae, Cyperaceae and Solanaceae, with 33, 30, 25, 21, 12, 10. 10, 10, 9. 8 species respectively.

Evolutionary relationships among self-incompatibility RNases

Science.gov (United States)

Igic, Boris; Kohn, Joshua R.

2001-01-01

T2-type RNases are responsible for self-pollen recognition and rejection in three distantly related families of flowering plants—the Solanaceae, Scrophulariaceae, and Rosaceae. We used phylogenetic analyses of 67 T2-type RNases together with information on intron number and position to determine whether the use of RNases for self-incompatibility in these families is homologous or convergent. All methods of phylogenetic reconstruction as well as patterns of variation in intron structure find that all self-incompatibility RNases along with non-S genes from only two taxa form a monophyletic clade. Several lines of evidence suggest that the best interpretation of this pattern is homology of self-incompatibility RNases from the Scrophulariaceae, Solanaceae, and Rosaceae. Because the most recent common ancestor of these three families is the ancestor of ≈75% of dicot families, our results indicate that RNase-based self-incompatibility was the ancestral state in the majority of dicots. PMID:11698683

Subsocial Neotropical Doryphorini (Chrysomelidae, Chrysomelinae: new observations on behavior, host plants and systematics

Directory of Open Access Journals (Sweden)

Donald M. Windsor

2013-09-01

Full Text Available A summary of literature, documented observations and field studies finds evidence that mothers actively defend offspring in at least eight species and three genera of Neotropical Chrysomelinae associated with two host plant families. Reports on three Doryphora species reveal that all are oviparous and feed on vines in the Apocyanaceae. Mothers in the two subsocial species defend eggs and larvae by straddling, blocking access at the petiole and greeting potential predators with leaf-shaking and jerky advances. A less aggressive form of maternal care is found in two Platyphora and four Proseicela species associated with Solanaceae, shrubs and small trees. For these and other morphologically similar taxa associated with Solanaceae, genetic distances support morphology-based taxonomy at the species level, reveal one new species, but raise questions regarding boundaries separating genera. We urge continued study of these magnificent insects, their enemies and their defenses, both behavioral and chemical, especially in forests along the eastern versant of the Central and South American cordillera.

AFLP

African Journals Online (AJOL)

AJL

2012-05-29

May 29, 2012 ... 3Institute of Medicinal Plants (IMP), Tehran, Iran. 4Agricultural Biotechnology Research Institute, ... Hyoscyamus sp. is one of the most important medicinal plants belonging to the Solanaceae family. ..... et al., 2006) and Matricaria chamomilla (Solouki et al.,. 2008). In conclusion, AFLP and retro/AFLP data ...

Bello et al (9)

African Journals Online (AJOL)

Timade VENTURE

family Solanaceae and it is one of the largest and ... al.,2004). The taxonomy of this important genus is of ... importance of numerical taxonomic method in ..... SME. SAE. SAM. SNI. SER. SWR. SMA. SGI. -6.4. -4.8. -3.2. -1.6. 0. 1.6. 3.2. 4.8.

Potato psyllid and the South American desert plant Nolana: an unlikely psyllid host?

Science.gov (United States)

Managing zebra chip disease in the potato growing regions of Washington, Oregon, and Idaho is complicated by confusion about the role of non-crop plant species in zebra chip epidemiology. Weedy and ornamental Solanaceae have been shown to be reservoirs of both the potato psyllid (vector of the dise...

WheelerLab: An interactive program for sequence stratigraphic analysis of seismic sections, outcrops and well sections and the generation of chronostratigraphic sections and dynamic chronostratigraphic sections

Science.gov (United States)

Amosu, Adewale; Sun, Yuefeng

WheelerLab is an interactive program that facilitates the interpretation of stratigraphic data (seismic sections, outcrop data and well sections) within a sequence stratigraphic framework and the subsequent transformation of the data into the chronostratigraphic domain. The transformation enables the identification of significant geological features, particularly erosional and non-depositional features that are not obvious in the original seismic domain. Although there are some software products that contain interactive environments for carrying out chronostratigraphic analysis, none of them are open-source codes. In addition to being open source, WheelerLab adds two important functionalities not present in currently available software: (1) WheelerLab generates a dynamic chronostratigraphic section and (2) WheelerLab enables chronostratigraphic analysis of older seismic data sets that exist only as images and not in the standard seismic file formats; it can also be used for the chronostratigraphic analysis of outcrop images and interpreted well sections. The dynamic chronostratigraphic section sequentially depicts the evolution of the chronostratigraphic chronosomes concurrently with the evolution of identified genetic stratal packages. This facilitates a better communication of the sequence-stratigraphic process. WheelerLab is designed to give the user both interactive and interpretational control over the transformation; this is most useful when determining the correct stratigraphic order for laterally separated genetic stratal packages. The program can also be used to generate synthetic sequence stratigraphic sections for chronostratigraphic analysis.

WheelerLab: An interactive program for sequence stratigraphic analysis of seismic sections, outcrops and well sections and the generation of chronostratigraphic sections and dynamic chronostratigraphic sections

Directory of Open Access Journals (Sweden)

Adewale Amosu

2017-01-01

Full Text Available WheelerLab is an interactive program that facilitates the interpretation of stratigraphic data (seismic sections, outcrop data and well sections within a sequence stratigraphic framework and the subsequent transformation of the data into the chronostratigraphic domain. The transformation enables the identification of significant geological features, particularly erosional and non-depositional features that are not obvious in the original seismic domain. Although there are some software products that contain interactive environments for carrying out chronostratigraphic analysis, none of them are open-source codes. In addition to being open source, WheelerLab adds two important functionalities not present in currently available software: (1 WheelerLab generates a dynamic chronostratigraphic section and (2 WheelerLab enables chronostratigraphic analysis of older seismic data sets that exist only as images and not in the standard seismic file formats; it can also be used for the chronostratigraphic analysis of outcrop images and interpreted well sections. The dynamic chronostratigraphic section sequentially depicts the evolution of the chronostratigraphic chronosomes concurrently with the evolution of identified genetic stratal packages. This facilitates a better communication of the sequence-stratigraphic process. WheelerLab is designed to give the user both interactive and interpretational control over the transformation; this is most useful when determining the correct stratigraphic order for laterally separated genetic stratal packages. The program can also be used to generate synthetic sequence stratigraphic sections for chronostratigraphic analysis.

The trophic plasticity of genus phelipanche pomel (orobanchaceae in bulgaria Trofichna plastichnost na rod phelipanche pomel (orobanchaceae v bulgaria

Directory of Open Access Journals (Sweden)

Kiril STOYANOV

2013-03-01

Full Text Available New data about the natural parasitism of Phelipanche ramosa (L Pomel, P. mutelii (Shultz Pomel, P. oxyloba, P. arenaria and P. purpurea in Bulgaria are collected. The information for the hosts describes 46 new trophic systems with species from the families: Brassicaceae, Solanaceae, Fabaceae, Asteraceae, Apiaceae, Poaceae, Lamiaceae, Scrophulariaceae, Chenopodiaceae, Caryophyllaceae, Araliaceae, Euphorbiaceae, Geraniaceae, Dioscoreaceae and Verbenaceae. The samples are collected outside the crop fields, far from the known host crops, from different parts of the country. Some of the registered hosts are new for Bulgaria. The voucher specimens with physical connection to the hosts are deposited in the Herbarium of The Agricultural University - Plovdiv (SOA. The collected data suggest that genus Phelipanche is represented by two trophic groups according to the known sections. Sect. Phelipanche unites the polyphags P. ramosa, P. oxyloba and P. mutelii. Sect. Arenariae consist oligophags - P. arenaria and P. purpurea.

Environ: E00010 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available E00010 Belladonna root (JP17) Crude drug Hyoscyamine [CPD:C02046], Atropine [CPD:C...01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] Atropa belladonna [TAX:33113] Same as: D03224 ...Solanaceae (nightshade family) Belladonna root Major component: Hyoscyamine [DR:D00147] CAS: 8007-93-0

Drug: D03069 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available D03069 Crude ... Drug Belladonna (USP); Belladonna extract (JP17) Hyoscyamine [CPD...:C02046], Atropine [CPD:C01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] ... Atropa belladonna... [TAX:33113] ... Same as: E00008 ATC code: A03BA04 Chemical group: DG00054 ... Solanaceae (nightshade family) Belladon

Rising rates of Caesarean sections: an audit of Caesarean sections ...

African Journals Online (AJOL)

Most of the caesarean sections were carried out because of a previous CS; maternal request and HIV status also contributed to the high rate. Conclusion: The high CS rate in private practice is probably a window to the increased rates of Caesarean section being performed worldwide. This high rate is in keeping with trends ...

Comparing the cytotoxic potential of Withania somnifera water and ...

African Journals Online (AJOL)

The plant Withania somnifera (Linn.) (Solanacea) is a well-known herbal medicine used in many parts of the world. It has anti-inflammatory, antioxidant, and antitumor as well as neural protective properties. It seems as if the two most active withanolide components, namely withaferin A and withanolide D, found in methanol ...

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96907 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr11 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96905 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376

Drug: D03223 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available D03223 Crude ... Drug Belladonna leaf (USP) Hyoscyamine [CPD:C02046], Atropine [CP...D:C01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] ... Atropa belladonna [TAX:33113] ... Same as:... E00229 ATC code: A03BA04 Chemical group: DG00054 ... Solanaceae (nightshade family) Belladonna leaf ... PubChem: 17397376 ...

Potato Genome Sequencing: A Short Glimpse of the Non-Repetitive.

Science.gov (United States)

Potato is the world’s number one vegetable crop. The potato is a member of the Solanaceae family that contains other crops such tomato pepper and eggplant as well as model species tobacco and petunia. Tomato is both an important crop as well as a model species for genetic and physical genomic info...

Standard cross-section data

International Nuclear Information System (INIS)

Carlson, A.D.

1984-01-01

The accuracy of neutron cross-section measurement is limited by the uncertainty in the standard cross-section and the errors associated with using it. Any improvement in the standard immediately improves all cross-section measurements which have been made relative to that standard. Light element, capture and fission standards are discussed. (U.K.)

Obstetrical correlates of the first time cesarean section, compared with the repeated cesarean section

International Nuclear Information System (INIS)

Rukh, G.; Akhtar, S.

2007-01-01

To determine the clinical and epidemiological characteristics in patients having their first cesarean section (FCS) and compare it with findings in patients with repeated cesarean section (RCS). This study included all the women who gave birth by cesarean sections, 817 of the total 5992 deliveries, at this unit during the study period. Data on potential risk factors for the first cesarean section (FCS) and repeated cesarean section (RCS were extracted from medical records, which were reviewed and compared between these two groups of women. Data were statistically analyzed with student t-test for comparison between means and Chi-square test for comparison between percentages. Crude odds ratio (OR) with 95% confidence interval (95% CI) were calculated. Significance was taken at p 0.05). The frequency of first cesarean section and repeat cesarean section is high in our setup. Adequate following of the programs to diminish the percentage of FCS by curtailing its predisposing factors is needed. (author)

A duplex PCR assay for the detection of Ralstonia solanacearum phylotype II strains in Musa spp.

Directory of Open Access Journals (Sweden)

Gilles Cellier

Full Text Available Banana wilt outbreaks that are attributable to Moko disease-causing strains of the pathogen Ralstonia solanacearum (Rs remain a social and economic burden for both multinational corporations and subsistence farmers. All known Moko strains belong to the phylotype II lineage, which has been previously recognized for its broad genetic basis. Moko strains are paraphyletic and are distributed among seven related but distinct phylogenetic clusters (sequevars that are potentially major threats to Musaceae, Solanaceae, and ornamental crops in many countries. Although clustered within the Moko IIB-4 sequevar, strains of the epidemiologically variant IIB-4NPB do not cause wilt on Cavendish or plantain bananas; instead, they establish a latent infection in the vascular tissues of plantains and demonstrate an expanded host range and high aggressiveness toward Solanaceae and Cucurbitaceae. Although most molecular diagnostic methods focus on strains that wilt Solanaceae (particularly potato, no relevant protocol has been described that universally detects strains of the Musaceae-infecting Rs phylotype II. Thus, a duplex PCR assay targeting Moko and IIB-4NPB variant strains was developed, and its performance was assessed using an extensive collection of 111 strains representing the known diversity of Rs Moko-related strains and IIB-4NPB variant strains along with certain related strains and families. The proposed diagnostic protocol demonstrated both high accuracy (inclusivity and exclusivity and high repeatability, detected targets on either pure culture or spiked plant extracts. Although they did not belong to the Moko clusters described at the time of the study, recently discovered banana-infecting strains from Brazil were also detected. According to our comprehensive evaluation, this duplex PCR assay appears suitable for both research and diagnostic laboratories and provides reliable detection of phylotype II Rs strains that infect Musaceae.

Environ: E00008 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available E00008 Belladonna extract (JP17) Belladonna (USP) Crude drug Hyoscyamine [CPD:C020...46], Atropine [CPD:C01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] Atropa belladonna [TAX:331...13] Same as: D03069 Solanaceae (nightshade family) Belladonna root extract Major component: Hyoscyamine [DR:D00147] CAS: 8007-93-0

S-allele diversity in Sorbus aucuparia and Crataegus monogyna (Rosaceae: Maloideae).

Science.gov (United States)

Raspé, O; Kohn, J R

2002-06-01

RT-PCR was used to obtain the first estimates from natural populations of allelic diversity at the RNase-based gametophytic self-incompatibility locus in the Rosaceae. A total of 20 alleles were retrieved from 20 Sorbus aucuparia individuals, whereas 17 alleles were found in 13 Crataegus monogyna samples. Estimates of population-level allele numbers fall within the range observed in the Solanaceae, the only other family with RNase-based incompatibility for which estimates are available. The nucleotide diversity of S-allele sequences was found to be much lower in the two Rosaceae species as compared with the Solanaceae. This was not due to a lower sequence divergence among most closely related alleles. Rather, it is the depth of the entire genealogy that differs markedly in the two families, with Rosaceae S-alleles exhibiting more recent apparent coalescence. We also investigated patterns of selection at the molecular level by comparing nucleotide diversity at synonymous and nonsynonymous sites. Stabilizing selection was inferred for the 5' region of the molecule, while evidence of diversifying selection was present elsewhere.

Pollen-expressed F-box gene family and mechanism of S-RNase-based gametophytic self-incompatibility (GSI) in Rosaceae.

Science.gov (United States)

Sassa, Hidenori; Kakui, Hiroyuki; Minamikawa, Mai

2010-03-01

Many species of Rosaceae, Solanaceae, and Plantaginaceae exhibit S-RNase-based self-incompatibility (SI) in which pistil-part specificity is controlled by S locus-encoded ribonuclease (S-RNase). Although recent findings revealed that S locus-encoded F-box protein, SLF/SFB, determines pollen-part specificity, how these pistil- and pollen-part S locus products interact in vivo and elicit the SI reaction is largely unclear. Furthermore, genetic studies suggested that pollen S function can differ among species. In Solanaceae and the rosaceous subfamily Maloideae (e.g., apple and pear), the coexistence of two different pollen S alleles in a pollen breaks down SI of the pollen, a phenomenon known as competitive interaction. However, competitive interaction seems not to occur in the subfamily Prunoideae (e.g., cherry and almond) of Rosaceae. Furthermore, the effect of the deletion of pollen S seems to vary among taxa. This review focuses on the potential differences in pollen-part function between subfamilies of Rosaceae, Maloideae, and Prunoideae, and discusses implications for the mechanistic divergence of the S-RNase-based SI.

Annotated checklist of Solanum L. (Solanaceae for Peru

Directory of Open Access Journals (Sweden)

Tiina Särkinen

2015-04-01

Full Text Available The genus Solanum is among the most species-rich genera both of the Peruvian flora and of the tropical Andes in general. The present revised checklist treats 276 species of Solanum L., of which 253 are native, while 23 are introduced and/or cultivated. A total of 74 Solanum species (29% of native species are endemic to Peru. Additional 58 species occur only in small number of populations outside Peru, and these species are here labelled as near-endemics to highlight the role Peru playes in their future protection. Species diversity is observed to peak between 2500 – 3000 m elevation, but endemic species diversity is highest between 3000 – 3500 m elevation. Cajamarca has the highest number of endemic (29 spp. and total species (130 spp., even when considering the effect of area. Centers of endemic species diversity are observed in provinces of Cajamarca (Cajamarca, Huaraz and Carhuaz (Ancash, and Canta and Huarochirí (Lima. Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca, Santiago de Chuco (La Libertad, Oxapampa (Pasco, and Cusco (Cusco. Current diversity patterns are highly correlated with collection densities, and further collecting is needed across all areas, especially from Arequipa, Ayacucho, Puno, Ancash, Huánuco, Amazonas and Cajamarca, where high levels of species diversity and endemism are indicated but only a few collections of many species are known.

Six cultivars of Solanum macrocarpon (Solanaceae in Ghana

Directory of Open Access Journals (Sweden)

Z. R. Bukenya

1987-10-01

Full Text Available The  Solanum macrocarpon complex (the cultivated egg plant has been studied in Ghana using morphological and experimental methods. Six cultivars belonging to the S.  macrocarpon complex have been recognized and described. The cultivars are  S. macrocarpon ‘Gboma’,  S. macrocarpon ‘Mankessim’,  S. macrocarpon ‘Akwaseho’,  S. macrocarpon ‘Kade’,  S. macrocarpon ‘Sarpeiman’ and  S. macrocarpon ‘Bui’. The very spiny, hairy plant traditionally called S. dasyphyllum is regarded as the wild ancestor from which the cultivars have been derived through a process of crop evolution. The variation within S. macrocarpon complex is attributable to genotypic differences and environmental factors.

Solanaceae III: henbane, hags and Hawley Harvey Crippen.

Science.gov (United States)

Lee, M R

2006-12-01

Hyoscyamus, the henbane, is one of the drugs of the ancients. Initially used both as a poison and narcotic, it was widely adopted by witches, wizards and soothsayers as a component of their hallucinatory and flying ointments. It was also used by notorious poisoners such as Madame Voisin in France. Eventually, in the nineteenth century its active principle was isolated by Ladenburg and called l-hyoscine. It proved to be a tropane alkaloid very similar to atropine. These two alkaloids proved to be very important in the study of the parasympathetic component of the autonomic nervous system, and together with physostigmine, allowed the major neurotransmitter acetylcholine to be isolated and its mechanisms of action to be characterised. The Crippen murder case in 1910 gave hyoscine further fame, indeed, notoriety. The unassuming homeopathic doctor murdered his wife with the alkaloid and then decamped for Canada with his mistress Ethel Le Neve. The case became a worldwide sensation for several reasons: the arrest of the fugitive couple by wireless telegraphy (Marconigram) and the extensive chemical and histological evidence presented by Willcox and Spilsbury. Some authorities claim that this was the beginning of the science of forensic medicine in Britain. Hyoscine is now hardly ever used in modern therapeutics but its history from antiquity to the witches and on to Dr Crippen is both bizarre and fascinating.

Cross sections for atmospheric corrections

International Nuclear Information System (INIS)

Meyer, J.P.; Casse, M.; Westergaard, N.

1975-01-01

A set of cross sections for spallation of relativistic nuclei is proposed based on (i) the best available proton cross sections, (ii) an extrapolation to heavier nuclei of the dependence on the number of nucleons lost of the 'target factor' observed for C 12 and O 16 by Lindstrom et al. (1975), in analogy with Rudstam's formalism, and (iii) on a normalization of all cross sections to the total cross sections for production of fragments with Asub(f) >= 6. The obtained cross sections for peripheral interactions are not inconsistent with simple geometrical considerations. (orig.) [de

Étude ethnobotanique et évaluation in vitro de l'activité antifongique ...

African Journals Online (AJOL)

SARAH

2016-02-29

Feb 29, 2016 ... Torréfaction, pulvérisation. Cutané, rectale. 25 Scoparia dulcis L. Scrophulariaceae Gnongnon. GC - SZ H np. 1,75 Écorce,. Feuille pétrissage. Cutané, rectale. 26 Solanum verbascifolium. Linn. Solanaceae. Vi ahovi. GC. Arb mp. 1,75 Feuille pétrissage. Cutané, rectale. 27 Solenostemon monostachyus (P.

The effect of the halophytic shrub Lycium ruthenium (Mutt) on selected soil properties of a desert ecosystem in central Iran

Science.gov (United States)

Gholam Ali Jalali; Hossein Akbarian; Charles Rhoades; Hamed Yousefzadeh

2012-01-01

We compared soil properties beneath naturally-occurring patches of Lycium ruthenicum Murray (fam. Solanaceae) to evaluate the shrub’s potential to improve the fertility of saline soils. Soil pH, total nitrogen and carbon and extractable potassium, magnesium and phosphorus were respectively significantly higher in the A and B horizons of Lycium shrub patches...

A preliminary floristic inventory in the Sierra de Mazatan, Municipios of Ures and Mazatan, Sonora, Mexico

Science.gov (United States)

Jose Jesus Sanchez-Escalante; Manuel Espericueta-Betancourt; Reyna Amanda Castillo-Gamez

2005-01-01

Presently, the flora of the Sierra de Mazatán contains 357 species of vascular plants distributed in 248 genera and 80 families. The families with the most species are Asteraceae (48), Fabaceae (45), Poaceae (28), Euphorbiaceae (18), and Acanthaceae, Cactaceae, Scrophulariaceae, and Solanaceae (11 each). The results show that the flora of the Sierra de Mazat...

WheelerLab: An interactive program for sequence stratigraphic analysis of seismic sections, outcrops and well sections and the generation of chronostratigraphic sections and dynamic chronostratigraphic sections

OpenAIRE

Adewale Amosu; Yuefeng Sun

2017-01-01

WheelerLab is an interactive program that facilitates the interpretation of stratigraphic data (seismic sections, outcrop data and well sections) within a sequence stratigraphic framework and the subsequent transformation of the data into the chronostratigraphic domain. The transformation enables the identification of significant geological features, particularly erosional and non-depositional features that are not obvious in the original seismic domain. Although there are some software produ...

Multitrajectory eikonal cross sections

International Nuclear Information System (INIS)

Turner, R.E.

1983-01-01

With the use of reference and distorted transition operators, a time-correlation-function representation of the inelastic differential cross section has recently been used to obtain distorted eikonal cross sections. These cross sections involve straight-line and reference classical translational trajectories that are unaffected by any internal-state changes which have occurred during the collision. This distorted eikonal theory is now extended to include effects of internal-state changes on the translational motion. In particular, a different classical trajectory is associated with each pair of internal states. Expressions for these inelastic cross sections are obtained in terms of time-ordered cosine and sine memory functions using the Zwanzig-Feshbach projection-operator method. Explicit formulas are obtained in the time-disordered perturbation approximation

Dosimetry and Calibration Section

International Nuclear Information System (INIS)

Otto, T.

1998-01-01

The two tasks of the Dosimetry and Calibration Section at CERN are the Individual Dosimetry Service which assures the personal monitoring of about 5000 persons potentially exposed to ionizing radiation at CERN, and the Calibration Laboratory which verifies all the instruments and monitors. This equipment is used by the sections of the RP Group for assuring radiation protection around CERN's accelerators, and by the Environmental Section of TISTE. In addition, nearly 250 electronic and 300 quartz fibre dosimeters, employed in operational dosimetry, are calibrated at least once a year. The Individual Dosimetry Service uses an extended database (INDOS) which contains information about all the individual doses ever received at CERN. For most of 1997 it was operated without the support of a database administrator as the technician who had assured this work retired. The Software Support Section of TIS-TE took over the technical responsibility of the database, but in view of the many other tasks of this Section and the lack of personnel, only a few interventions for solving immediate problems were possible

FEMA DFIRM Cross Sections

Data.gov (United States)

Minnesota Department of Natural Resources — FEMA Cross Sections are required for any Digital Flood Insurance Rate Map database where cross sections are shown on the Flood Insurance Rate Map (FIRM). Normally...

The Golden Section as Optical Limitation.

Science.gov (United States)

Elliott, Mark A; Kelly, Joy; Friedel, Jonas; Brodsky, Jennifer; Mulcahy, Paul

2015-01-01

The golden section, ϕ = (1 + √5)/2 = 1.618... and its companion ϕ = 1/ϕ = ϕ -1 = 0.618..., are irrational numbers which for centuries were believed to confer aesthetic appeal. In line with the presence of golden sectioning in natural growth patterns, recent EEG recordings show an absence of coherence between brain frequencies related by the golden ratio, suggesting the potential relevance of the golden section to brain dynamics. Using Mondrian-type patterns comprising a number of paired sections in a range of five section-section areal ratios (including golden-sectioned pairs), participants were asked to indicate as rapidly and accurately as possible the polarity (light or dark) of the smallest section in the patterns. They were also asked to independently assess the aesthetic appeal of the patterns. No preference was found for golden-sectioned patterns, while reaction times (RTs) tended to decrease overall with increasing ratio independently of each pattern's fractal dimensionality. (Fractal dimensionality was unrelated to ratio and measured in terms of the Minkowski-Bouligand box-counting dimension). The ease of detecting the smallest section also decreased with increasing ratio, although RTs were found to be substantially slower for golden-sectioned patterns under 8-paired sectioned conditions. This was confirmed by a significant linear relationship between RT and ratio (p < .001) only when the golden-sectioned RTs were excluded [the relationship was non-significant for the full complement of ratios (p = .217)]. Image analysis revealed an absence of spatial frequencies between 4 and 8 cycles-per-degree that was exclusive to the 8-paired (golden)-sectioned patterns. The significance of this was demonstrated in a subsequent experiment by addition of uniformly distributed random noise to the patterns. This provided a uniform spatial-frequency profile for all patterns, which did not influence the decrease in RT with increasing ratio but abolished the elevated

The Golden Section as Optical Limitation.

Directory of Open Access Journals (Sweden)

Mark A Elliott

Full Text Available The golden section, ϕ = (1 + √5/2 = 1.618... and its companion ϕ = 1/ϕ = ϕ -1 = 0.618..., are irrational numbers which for centuries were believed to confer aesthetic appeal. In line with the presence of golden sectioning in natural growth patterns, recent EEG recordings show an absence of coherence between brain frequencies related by the golden ratio, suggesting the potential relevance of the golden section to brain dynamics. Using Mondrian-type patterns comprising a number of paired sections in a range of five section-section areal ratios (including golden-sectioned pairs, participants were asked to indicate as rapidly and accurately as possible the polarity (light or dark of the smallest section in the patterns. They were also asked to independently assess the aesthetic appeal of the patterns. No preference was found for golden-sectioned patterns, while reaction times (RTs tended to decrease overall with increasing ratio independently of each pattern's fractal dimensionality. (Fractal dimensionality was unrelated to ratio and measured in terms of the Minkowski-Bouligand box-counting dimension. The ease of detecting the smallest section also decreased with increasing ratio, although RTs were found to be substantially slower for golden-sectioned patterns under 8-paired sectioned conditions. This was confirmed by a significant linear relationship between RT and ratio (p < .001 only when the golden-sectioned RTs were excluded [the relationship was non-significant for the full complement of ratios (p = .217]. Image analysis revealed an absence of spatial frequencies between 4 and 8 cycles-per-degree that was exclusive to the 8-paired (golden-sectioned patterns. The significance of this was demonstrated in a subsequent experiment by addition of uniformly distributed random noise to the patterns. This provided a uniform spatial-frequency profile for all patterns, which did not influence the decrease in RT with increasing ratio but abolished

VBAC (Vaginal Birth After C-Section)

Science.gov (United States)

Vaginal birth after C-section (VBAC) Overview If you've delivered a baby by C-section and ... between scheduling a repeat C-section or attempting vaginal birth after C-section (VBAC). For many women, ...

Constitutionality of section 7 of the Atomic Energy Act: Section 20 GG 'Kalkar decision'. [German Federal Republic

Energy Technology Data Exchange (ETDEWEB)

1978-06-01

OVG Muenster, decision dated Aug. 18th, 1977 - VII A 338/74: 'Section 7 of the Atomic Energy Act disagrees with the constitution in as far as it also allows the licensing of FBR type reactores'. The grounds upon which the judgment is based are given in detail: According to the opinion of the Senate, section 7 of the Atomic Energy Act does not conform to the principle of separation of powers (section 20, sub-section 2, sentence 2 GG), to the principle of parliamentary democracy (section 20, sub-section 1 and 2 GG) and to the principles of the law and order state (section 20, sub-section 3 GG) in as far as the present version enables the licensing of fast breeders.

Complication of cesarean section: pregnancy on the cicatrix of a previous cesarean section.

Science.gov (United States)

Wang, Weimin; Long, Wenqing; Yu, Qunhuan

2002-02-01

To probe into the clinical manifestation, diagnosis, as well as treatment of pregnancy on the cicatrix of a previous cesarean section at the uterine isthmus in the first trimester. Analysis of 14 patients with pregnancy on the cicatrix of a previous cesarean section at the uterine isthmus in the first trimester was made after conservative treatment by drugs from January 1996 to December 1999. The 14 patients with a pregnancy on the cicatrix of a previous cesarean section at the uterine isthmus in the first trimester were painless, had slight vaginal bleeding, and concurrently had increased serum beta-subunit human chorionic gonadotropin (beta-HCG). Doppler ultrasonic examination revealed an obvious enlargement of the previous cesarean section cicatrix in the uterine isthmus, and found a gestational sac or mixed mass attached to the cicatrice, with a very thin myometrium between the gestational sac and bladder walls. Among the 14 patients, 12 patients had crystalline trichosanthes injected into the cervix, mifepristone taken orally, or methotrexate in the form of intramuscular injection. Following this procedure, their serum beta-HCG dropped to normal. The other 2 patients had a total hysterectomy. Pregnancy on the cicatrix of a previous cesarean section at the uterine isthmus in the first trimester is a complication of cesarean section. Early diagnosis and effective conservative treatment by drugs are instrumental in decreasing the potential occurrence of uterine rupture, which is also conducive to preserving the patient's future fertility.

14 CFR Section 4 - General

Science.gov (United States)

2010-01-01

... UNIFORM SYSTEM OF ACCOUNTS AND REPORTS FOR LARGE CERTIFICATED AIR CARRIERS Balance Sheet Classifications Section 4 General (a) The balance sheet accounts are designed to show the financial condition of the air... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false General Section 4 Section 4 Aeronautics and...

Diploidization and genome size change in allopolyploids is associated with differential dynamics of low- and high-copy sequences

Czech Academy of Sciences Publication Activity Database

Renny-Byfield, S.; Kovařík, Aleš; Kelly, L.J.; Macas, Jiří; Novák, Petr; Chase, M.W. (ed.); Nichols, R. A.; Pancholi, M. R.; Grandbastien, M.-A.; Leitch, Andrew R.

2013-01-01

Roč. 74, č. 5 (2013), s. 829-839 ISSN 0960-7412 R&D Projects: GA ČR GA13-10057S; GA ČR(CZ) GBP501/12/G090 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : ALLOTETRAPLOID TOBACCO * NICOTIANA SOLANACEAE * SEED PLANTS Subject RIV: BO - Biophysics; EB - Genetics ; Molecular Biology (BC-A) Impact factor: 6.815, year: 2013

Comparison of integral cross section values of several cross section libraries in the SAND-II format

International Nuclear Information System (INIS)

Zijp, W.L.; Nolthenius, H.J.

1976-09-01

A comparison of some integral cross-section values for several cross-section libraries in the SAND-II format is presented. The integral cross-section values are calculated with the aid of the spectrum functions for a Watt fission spectrum, a 1/E spectrum and a Maxwellian spectrum. The libraries which are considered here are CCC-112B, ENDF/B-IV, DETAN74, LAPENAS and CESNEF. These 5 cross-section libraries used have all the SAND-II format. Discrepancies between cross-sections in the different libraries are indicated but not discussed

Turbine airfoil having outboard and inboard sections

Science.gov (United States)

Mazzola, Stefan; Marra, John J

2015-03-17

A turbine airfoil usable in a turbine engine and formed from at least an outboard section and an inboard section such that an inner end of the outboard section is attached to an outer end of the inboard section. The outboard section may be configured to provide a tip having adequate thickness and may extend radially inward from the tip with a generally constant cross-sectional area. The inboard section may be configured with a tapered cross-sectional area to support the outboard section.

Photon-splitting cross sections

International Nuclear Information System (INIS)

Johannessen, A.M.; Mork, K.J.; Overbo, I.

1980-01-01

The differential cross section for photon splitting (scattering of one photon into two photons) in a Coulomb field, obtained earlier by Shima, has been integrated numerically to yield various differential cross sections. Energy spectra differential with respect to the energy of one of the outgoing photons are presented for several values of the primary photon energy. Selected examples of recoil momentum distributions and some interesting doubly or multiply differential cross sections are also given. Values for the total cross section are obtained essentially for all energies. The screening effect caused by atomic electrons is also taken into account, and is found to be important for high energies, as in e + e - pair production. Comparisons with various approximate results obtained by previous authors mostly show fair agreement. We also discuss the possibilities for experimental detection and find the most promising candidate to be a measurement of both photons, and their energies, at a moderately high energy

Relativistic photon-Maxwellian electron cross sections

International Nuclear Information System (INIS)

Wienke, B.R.; Lathrop, B.L.; Devaney, J.J.

1986-01-01

Temperature corrected cross sections, complementing the Klein-Nishina set, are developed for astrophysical, plasma, and transport applications. The set is obtained from a nonlinear least squares fit to the exact photon-Maxwellian electron cross sections, using the static formula as the asymptotic basis. Two parameters are sufficient (two decimal places) to fit the exact cross sections over a range of 0-100 keV in electron temperature, and 0-1 MeV in incident photon energy. The fit is made to the total cross sections, yet the parameters predict both total and differential scattering cross sections well. Corresponding differential energy cross sections are less accurate. An extended fit to (just) the total cross sections, over the temperature and energy range 0-5 MeV, is also described. (author)

Integral nucleus-nucleus cross sections

International Nuclear Information System (INIS)

Barashenkov, V.S.; Kumawat, H.

2003-01-01

Expressions approximating the experimental integral cross sections for elastic and inelastic interactions of light and heavy nuclei at the energies up to several GeV/nucleon are presented. The calculated cross sections are inside the corridor of experimental errors or very close to it. Described in detail FORTRAN code and a numerical example of the cross section approximation are also presented

Jet inclusive cross sections

International Nuclear Information System (INIS)

Del Duca, V.

1992-11-01

Minijet production in jet inclusive cross sections at hadron colliders, with large rapidity intervals between the tagged jets, is evaluated by using the BFKL pomeron. We describe the jet inclusive cross section for an arbitrary number of tagged jets, and show that it behaves like a system of coupled pomerons

Neutron-induced fission cross sections

International Nuclear Information System (INIS)

Weigmann, H.

1991-01-01

In the history of fission research, neutron-induced fission has always played the most important role. The practical importance of neutron-induced fission rests upon the fact that additional neutrons are produced in the fission process, and thus a chain reaction becomes possible. The practical applications of neutron-induced fission will not be discussed in this chapter, but only the physical properties of one of its characteristics, namely (n,f) cross sections. The most important early summaries on the subject are the monograph edited by Michaudon which also deals with the practical applications, the earlier review article on fission by Michaudon, and the review by Bjornholm and Lynn, in which neutron-induced fission receives major attention. This chapter will attempt to go an intermediate way between the very detailed theoretical treatment in the latter review and the cited monograph which emphasizes the applied aspects and the techniques of fission cross-section measurements. The more recent investigations in the field will be included. Section II will survey the properties of cross sections for neutron-induced fission and also address some special aspects of the experimental methods applied in their measurement. Section Ill will deal with the formal theory of neutron-induced nuclear reactions for the resolved resonance region and the region of statistical nuclear reactions. In Section IV, the fission width, or fission transmission coefficient, will be discussed in detail. Section V will deal with the broader structures due to incompletely damped vibrational resonances, and in particular will address the special case of thorium and neighboring isotopes. Finally, Section VI will briefly discuss parity violation effects in neutron-induced fission. 74 refs., 14 figs., 3 tabs

Mitochondria as a Possible Place for Initial Stages of Steroid Biosynthesis in Plants

Directory of Open Access Journals (Sweden)

Elena K. Shematorova

2014-12-01

Full Text Available With the aim of thorough comparison of steroidogenic systems of plants and animals, transgenic plants of Solanaceae family expressing CYP11A1 cDNA encoding cytochrome P450SCC of mammalian mitochondria were further analysed. Positive effect of CYP11A1 on resistance of the transgenic tobacco plants to the infection by fungal phytopathogene Botrytis cinerea was for the first time detected. Subtle changes in mitochondria of the transgenic Nicotiana tabacum plants expressing mammalian CYP11A1 cDNA were demonstrated by transmissive electron microscopy. The main components of the electron transfer chain of plant mitochondria were for the first time cloned and characterized. It was established that plants from the Solanacea family (tomato, tobacco and potato contain two different genes with similar exon-intron structures (all contain 8 exons encoding mitochondrial type ferredoxins (MFDX, and one gene for mitochondrial ferredoxin reductase (MFDXR. The results obtained point out on profound relatedness of electron transfer chains of P450-dependent monooxygenases in mammalian and plant mitochondria and support our previous findings about functional compatability of steroidogenic systems of Plantae and Animalia.

The local knowledge of food plants used by Karo ethnic in Semangat Gunung Village, North Sumatra, Indonesia

Science.gov (United States)

Nisyawati, Aini, R. N.; Silalahi, M.; Purba, E. C.; Avifah, N.

2017-07-01

Research on the local knowledge of food plants used by Karo ethnic in the Semangat Gunung Village, North Sumatra has been done. The aim of this study is to reveal plant species that used by the people of Karo ethnic as food. We used the ethnobotanical approach which included open-ended, semi-structural interview, and exploration method. One eldervillage, 2 traditional healers, and 30 respondents have been selected as sources of information. Descriptive statistics have been used to analyze the gathered data. A number of 109 species which belong to 83 genus and 45 families known to be used as food sources by Karo people. Four families have the highest number of food plant species, which are Solanaceae (8 species), Poaceae (7 species), Fabaceae (6 species), and Zingiberaceae (6 species). All of those families are found in the village, both wild and Cultivated. Solanaceae is used as source of fruits, vegetables, and spices. Poaceae is used as the source of the staple food, alternative food sources, snacks, spices, and traditional foods. Fabaceae is used as source of vegetables and traditional foods. Zingiberaceae is used as source of spices.

A flórula invasora da cultura do café (Coffea arabica L. no Estado de Minas Gerais, Brasil Weeds in coffee (Coffea arabica L. plantations in the state of Minas Gerais, Brazil

Directory of Open Access Journals (Sweden)

Manuel Losada Gavilanes

1988-01-01

Full Text Available Nas áreas de cultura de café (Coffea arábica L., no Estado de Minas Gerais, foram coletadas e identificadas 388 espécies de plantas invasoras (= plantas daninhas, pertencentes a 51 famílias botânicas, representando 182 gêneros, sendo que as famílias Compositae, Gramineae, Leguminosae, Malvaceae, Solanaceae, Euphorbiaceae, Rubiaceae, Amaranthaceae, Convolvulaceae e Verbenaceae, são as mais importantes em relação à cultura. As plantas coletadas, devidamente etiquetadas e identificadas, foram anexadas, parte delas no PAMG (Herbário da EPAMIG, Belo Horizonte, MG e, a outra parte, no Herbarium ESAL (Herbário do Departamento de Biologia da Escola Superior de Agricultura de Lavras - ESAL, Lavras - MG.A survey in the cultivation area of coffee in the State of Minas Gerais, Brazil, has resulted in the determination of 388 weed species, of 182 genera belonging to 51 families; the families presenting a greater number of espécies are: Compositae, Leguminosae, Gramineae, Malvaceae, Solanaceae, Rubiaceae, Convolvulaceae, Euphorbiaceae, Amaranthaceae and Verbenaceae with 65, 48, 42, 30, 19, 17, 16, 14, 12, 10 species, respectively.

Kisaran Inang dan Keragaman Gejala Infeksi Turnip Mosaic Virus

Directory of Open Access Journals (Sweden)

Eliza Suryati Rusli

2007-07-01

Full Text Available The incidence of mosaic disease on vegetable crops in Indonesia has been reported recently. The disease is caused by TuMV which is considered as a new and important virus on caisin and turnip in Indonesia. Field survey has been conducted to determine disease incidence in vegetable growing areas. Symptom variability and host range of TuMV was further studied through mechanical inoculation to cruciferae and solanaceae plants. Observation during field survey has proved that TuMV has infected caisin and turnip in Java and Bali. The highest intensity of mosaic disease i.e. 63,3% occurs in Tumpangan-Malang, followed by Denpasar Selatan and Bandungan-Semarang with the intensity of 30,5% and 19,0% respectively. TuMV infection causes different types of symptoms, such as: wrinkled leaf, blistered leaf, vein banding, vein clearing, leaf distortion and proliferation. The host range of TuMV involves those plants belong to cruciferae (cabbage, broccoli, caisin, turnip, cauliflower, chinese cabbage, pak coy; solanaceae (N. tabacum, N. benthamiana, N. glutinosa; and chenopodiaceae (C. amaranticolor. Furthermore, N. glutinosa can be used as differential host for TuMV isolates.

Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization

Science.gov (United States)

Qin, Cheng; Yu, Changshui; Shen, Yaou; Fang, Xiaodong; Chen, Lang; Min, Jiumeng; Cheng, Jiaowen; Zhao, Shancen; Xu, Meng; Luo, Yong; Yang, Yulan; Wu, Zhiming; Mao, Likai; Wu, Haiyang; Ling-Hu, Changying; Zhou, Huangkai; Lin, Haijian; González-Morales, Sandra; Trejo-Saavedra, Diana L.; Tian, Hao; Tang, Xin; Zhao, Maojun; Huang, Zhiyong; Zhou, Anwei; Yao, Xiaoming; Cui, Junjie; Li, Wenqi; Chen, Zhe; Feng, Yongqiang; Niu, Yongchao; Bi, Shimin; Yang, Xiuwei; Li, Weipeng; Cai, Huimin; Luo, Xirong; Montes-Hernández, Salvador; Leyva-González, Marco A.; Xiong, Zhiqiang; He, Xiujing; Bai, Lijun; Tan, Shu; Tang, Xiangqun; Liu, Dan; Liu, Jinwen; Zhang, Shangxing; Chen, Maoshan; Zhang, Lu; Zhang, Li; Zhang, Yinchao; Liao, Weiqin; Zhang, Yan; Wang, Min; Lv, Xiaodan; Wen, Bo; Liu, Hongjun; Luan, Hemi; Zhang, Yonggang; Yang, Shuang; Wang, Xiaodian; Xu, Jiaohui; Li, Xueqin; Li, Shuaicheng; Wang, Junyi; Palloix, Alain; Bosland, Paul W.; Li, Yingrui; Krogh, Anders; Rivera-Bustamante, Rafael F.; Herrera-Estrella, Luis; Yin, Ye; Yu, Jiping; Hu, Kailin; Zhang, Zhiming

2014-01-01

As an economic crop, pepper satisfies people’s spicy taste and has medicinal uses worldwide. To gain a better understanding of Capsicum evolution, domestication, and specialization, we present here the genome sequence of the cultivated pepper Zunla-1 (C. annuum L.) and its wild progenitor Chiltepin (C. annuum var. glabriusculum). We estimate that the pepper genome expanded ∼0.3 Mya (with respect to the genome of other Solanaceae) by a rapid amplification of retrotransposons elements, resulting in a genome comprised of ∼81% repetitive sequences. Approximately 79% of 3.48-Gb scaffolds containing 34,476 protein-coding genes were anchored to chromosomes by a high-density genetic map. Comparison of cultivated and wild pepper genomes with 20 resequencing accessions revealed molecular footprints of artificial selection, providing us with a list of candidate domestication genes. We also found that dosage compensation effect of tandem duplication genes probably contributed to the pungent diversification in pepper. The Capsicum reference genome provides crucial information for the study of not only the evolution of the pepper genome but also, the Solanaceae family, and it will facilitate the establishment of more effective pepper breeding programs. PMID:24591624

Effectiveness of vegetable extracts for the control of Praticolella griseola (Pfeiffer (Gastropoda: Polygyridae

Directory of Open Access Journals (Sweden)

Carmen Verónica Martín Vasallo

2017-07-01

Full Text Available Molluscs have become a serious problem for vegetable crops, especially the species Praticolella griseola (Pfeiffer. Therefore, the objective was to evaluate the percentage of mortality of the plant extracts on P. griseola in both laboratory and field conditions. An "in vitro" assay was performed with vegetable extracts of maguey (Furcraea hexapetala (Jacq. Family: Agavaceae, spiny güirito (Solanum globiferum L., Family: Solanaceae, chili pepper (Capsicum frutescens L., Solanaceae, cardon (Euphorbia lactea Haw., Family: Euphorbiaceae. When evaluating three concentrations of the extract of each botanical species, a completely randomized design was used in "in vitro" conditions and random blocks on the field. The extraction of the chili pepper extract was carried out using the fruit baking method, the S. globiferum was obtained from the milling of the dried fruits and the F. hexapetala and E. lactea were obtained through the fragmentation of stalks. Extracts of F. hexapetala, S. globiferum, C. frutescens, E. lactea, are alternatives to be used by producers in the control of P. griseola. The highest percentages of mortality are reached with the extracts of C. frutescens and S. globiferum at 72 hours of application.

Comparison of integral cross section values of several cross section libraries in the SAND-II format

International Nuclear Information System (INIS)

Zijp, W.L.; Nolthenius, H.J.

1978-01-01

A comparison of some integral cross section values for several cross section libraries in the SAND-II format is presented. The integral cross section values are calculated with aid of the spectrum functions for a Watt fission spectrum, a 1/E spectrum and a Maxwellian spectrum. The libraries which are considered here are CCC-112B, ENDF/B-IV, DETAN74, LAPENAS and CESNEF. These 5 cross section libraries used have all the SAND-II format. (author)

Cross-section methodology in SIMMER

International Nuclear Information System (INIS)

Soran, P.D.

1975-11-01

The cross-section methodology incorporated in the SIMMER code is described. Data base for all cross sections is the ENDF/B system with various progressing computer codes to group collapse and modify the group constants which are used in SIMMER. Either infinitely dilute cross sections or the Bondarenko formalism can be used in SIMMER. Presently only a microscopic treatment is considered, but preliminary macroscopic algorithms have been investigated

Cross-section methodology in SIMMER

International Nuclear Information System (INIS)

Soran, P.D.

1976-05-01

The cross-section methodology incorporated in the SIMMER code is described. Data base for all cross sections is the ENDF/B system with various progressing computer codes to group collapse and modify the group constants which are used in SIMMER. Either infinitely dilute cross sections or the Bondarenko formalism can be used in SIMMER. Presently only a microscopic treatment is considered, but preliminary macroscopic algorithms have been investigated

Evaluated cross section libraries

International Nuclear Information System (INIS)

Maqurno, B.A.

1976-01-01

The dosimetry tape (ENDF/B-IV tape 412) was issued in a general CSEWG distribution, August 1974. The pointwise cross section data file was tested with specified reference spectra. A group averaged cross section data file (620 groups based on tape 412) was tested with the above spectra and the results are presented in this report

Electron collision cross sections of mercury

International Nuclear Information System (INIS)

Suzuki, Susumu; Kuzuma, Kiyotaka; Itoh, Haruo

2006-01-01

In this paper, we propose a new collision cross section set for mercury which revises the original set summarized by Hayashi in 1989. Hanne reported three excitation collision cross sections (6 3 P 0 , 6 3 P 1 , 6 3 P 2 ) determined from an electron beam experiment in 1988. As a matter for regret, no attentive consideration was given to combining these three excitation cross sections with the cross section set of Hayashi. Therefore we propose a new set where these three excitation cross sections are included. In this study, other two excitation cross sections (6 1 P 1 , 6 3 D 3 ) except for the three excitation collision cross sections (6 3 P 0 , 6 3 P 1 , 6 3 P 2 ) are taken from the original set of Hayashi. The momentum transfer cross section and the ionization collision cross section are also taken from Hayashi. A Monte Carlo Simulation (MCS) technique is applied for evaluating our new cross section set. The present results of the electron drift velocity and the ionization coefficient are compared to experimental values. Agreement is secured in relation to the electron drift velocity for 1.5 Td 2 ) is the reduced electric field, E (V/cm) is the electric field, N (1/cm 3 ) is the number density of mercury atoms at 0degC, 1 Torr, E/N is also equal to 2.828 x 10 -17 E/p 0 from the relation of the ideal gas equation, p 0 (Torr) is gas pressure at 0degC, 1 Torr=1.33322 x 10 -2 N/cm -2 and 10 -17 V/cm 2 is called 1 Td. Thus it is ensured that our new cross section set is reasonable enough to be used up to 100 eV when considering with the electron drift velocity and the ionization coefficient. (author)

Background-cross-section-dependent subgroup parameters

International Nuclear Information System (INIS)

Yamamoto, Toshihisa

2003-01-01

A new set of subgroup parameters was derived that can reproduce the self-shielded cross section against a wide range of background cross sections. The subgroup parameters are expressed with a rational equation which numerator and denominator are expressed as the expansion series of background cross section, so that the background cross section dependence is exactly taken into account in the parameters. The advantage of the new subgroup parameters is that they can reproduce the self-shielded effect not only by group basis but also by subgroup basis. Then an adaptive method is also proposed which uses fitting procedure to evaluate the background-cross-section-dependence of the parameters. One of the simple fitting formula was able to reproduce the self-shielded subgroup cross section by less than 1% error from the precise evaluation. (author)

Clean Water Act (Section 404) and Rivers and Harbors Act (Sections 9 and 10)

International Nuclear Information System (INIS)

1992-01-01

This Reference Book contains a current copy of the Clean Water Act (Section 404) and the Rivers and Harbors Act (Sections 9 and 10) and those regulations that implement those sections of the statutes and appear to be most relevant to DOE activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Updates that include important new requirements will be provided periodically. Questions concerning this Reference Book may be directed to Mark Petts, IH-231 (FTS 896-2609 or Commercial 202/586-2609)

H:\\PMKER 25(3)\\TRAORE K..xps

African Journals Online (AJOL)

AISA

Laboratoire de Phytopathologie de la Faculté d'Agronomie de l'Université de Parakou (Bénin) pour confirmer ou non la présence des trois virus responsables de maladies chez les Solanaceae à savoir le CMV, le PVMV et le PVYN. Des tampons ont été préparés conformément aux directives de Clarck et al. (1977), il s'agit.

Preliminary assessment of medicinal plants used as antimalarials in the southeastern Venezuelan Amazon

Directory of Open Access Journals (Sweden)

Caraballo Alejandro

2004-01-01

Full Text Available Eighteen species of medicinal plants used in the treatment of malaria in Bolívar State, Venezuela were recorded and they belonged to Compositae, Meliaceae, Anacardiaceae, Bixaceae, Boraginaceae, Caricaceae, Cucurbitaceae, Euphorbiaceae, Leguminosae, Myrtaceae, Phytolaccaceae, Plantaginaceae, Scrophulariaceae, Solanaceae and Verbenaceae families. Antimalarial plant activities have been linked to a range of compounds including anthroquinones, berberine, flavonoids, limonoids, naphthquinones, sesquiterpenes, quassinoids, indol and quinoline alkaloids.

Potato (Solanum tuberosum L.).

Science.gov (United States)

Chetty, Venkateswari J; Narváez-Vásquez, Javier; Orozco-Cárdenas, Martha L

2015-01-01

Agrobacterium-mediated transformation is the most common method for the incorporation of foreign genes into the genome of potato as well as many other species in the Solanaceae family. This chapter describes protocols for the genetic transformation of three species of potato: Solanum tuberosum subsp. tuberosum (Desiréé), S. tuberosum subsp. andigenum (Blue potato), and S. tuberosum subsp. andigena using internodal segments as explants.

Contribution to the knowledge of chemical plants of northeast Brazil: Solanum buddleifolium SENDTN

OpenAIRE

Francisco das Chagas Lima Pinto

2013-01-01

This work describes the chemical study of Solanum buddleifolium (Solanaceae) aimed the isolation and structural characterization of its secondary metabolites. The chemical prospection was realized using chromatographic techniques such as chromatography over silica gel Sephadex LH-20 and solid phase extraction (SPE) besides High Performance Liquid Chromatography (HPLC) From EtOH were isolated the known compounds β-sitosterol and estigmasterol betulinic acid 13-hidroxysolavetrivone polista...

Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening Comparação de bioensaios com os crustáceos Artemia salina e Thamnocephalus platyurus para abordagem de extratos de plantas com toxicidade

OpenAIRE

Pablo Mayorga; Karen R. Pérez; Sully M. Cruz; Armando Cáceres

2010-01-01

Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest) and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest), were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq.) Kunth ex ...

Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening

OpenAIRE

Mayorga,Pablo; Pérez,Karen R.; Cruz,Sully M.; Cáceres,Armando

2010-01-01

Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest) and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest), were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq.) Kunth ex ...

Coronary CT angiography characteristics of OCT-defined thin-cap fibroatheroma. A section-to-section comparison study

Energy Technology Data Exchange (ETDEWEB)

Yang, Dong Hyun; Koo, Hyun Jung; Kang, Joon-Won; Lim, Tae-Hwan [Asan Medical Center, University of Ulsan College of Medicine, Department of Radiology and Research Institute of Radiology, Seoul (Korea, Republic of); Kang, Soo-Jin; Chang, Mineok; Lee, Pil Hyung; Roh, Jae-Hyung; Ahn, Jung-Min; Park, Duk-Woo; Lee, Seung-Whan; Lee, Cheol Whan; Park, Seong-Wook; Park, Seung-Jung; Kim, Young-Hak [Asan Medical Center, University of Ulsan College of Medicine, Department of Cardiology, Seoul (Korea, Republic of); Baek, Seunghee [Asan Medical Center, University of Ulsan College of Medicine, Department of Clinical Epidemiology and Biostatistics, Seoul (Korea, Republic of); Han, Seungbong [Gachon University, Department of Applied Statistics, Gyeonggi-do (Korea, Republic of); Mintz, Gary S. [Cardiovascular Research Foundation, New York, NY (United States)

2018-02-15

To evaluate whether plaque characteristics as assessed by coronary computed tomography angiography (CCTA) were associated with the presence of a thin-cap fibroatheroma (TCFA) - a precursor of plaque rupture - defined by optical coherence tomography (OCT) in a section-to-section-level comparison. From 28 symptomatic patients, 31 coronary lesions were evaluated on 727 cross-sections co-registered by both CCTA and OCT. CCTA plaque characteristics included low attenuation plaque (LAP, <30 HU), napkin ring sign (NRS), positive remodelling (PR, remodelling index ≥1.10), and spotty calcification and plaque area and plaque burden. By OCT, presence of TCFA, lumen area and arc of lipid were determined. OCT revealed a TCFA in 69 (9.4%) sections from 19 (61.2 %) lesions. In per-section analysis, OCT-TCFA showed higher frequency of CCTA-detected LAP (58.0% vs. 18.5%), NRS (31.9% vs. 8.8%) and PR (68.1% vs. 48.0%) and greater plaque burden (70.6% vs. 61.9%) as compared to sections without OCT-TCFA (all p < 0.05). In multivariable analysis, LAP (odds ratio [OR] 4.05, p < 0.001) and NRS (OR 2.47, p = 0.005) were associated with OCT-TCFA. CCTA-measured lumen area correlated well with OCT-measured lumen area (R = 0.859, limits of agreement -0.5 ± 3.7 mm{sup 2}). LAP and NRS in CCTA were associated with the presence of OCT-defined TCFA in a section-to-section comparison. (orig.)

Electron-impact cross sections of Ne

International Nuclear Information System (INIS)

Tsurubuchi, S.; Arakawa, K.; Kinokuni, S.; Motohashi, K.

2000-01-01

Electron-impact absolute emission cross sections were measured for the 3p→3s transitions of Ne. Excitation functions of the 3s→2p first resonance lines were measured in the energy range from the threshold to 1000 eV by a polarization-free optical method and relative cross sections were normalized to the absolute values, (41.0±5.4)x10 -19 cm 2 for the 73.6 nm line and (7.1±1.0)x10 -19 cm 2 for the 74.4 nm line, which were determined at 500 eV. The integrated level-excitation cross sections of Suzuki et al for the 1s 2 and 1s 4 levels were combined with the corresponding 3p→3s cascade cross sections obtained in this paper to give absolute emission cross sections for the resonance lines. The level-excitation cross sections of the 1s 2 and 1s 4 states in Paschen notation were determined from the threshold to 1000 eV by subtracting 3p→3s cascade cross sections from the corresponding 3s→2p emission cross sections of the resonance lines. A large cascade contribution is found in the emission cross section of the resonance lines. It is 28.5% for the 73.6 nm line and 49.6% for the 74.4 nm line at 40 eV, and 17.0 and 61.8%, respectively, at 300 eV. (author)

The Physalis peruviana leaf transcriptome: assembly, annotation and gene model prediction

Directory of Open Access Journals (Sweden)

Garzón-Martínez Gina A

2012-04-01

Full Text Available Abstract Background Physalis peruviana commonly known as Cape gooseberry is a member of the Solanaceae family that has an increasing popularity due to its nutritional and medicinal values. A broad range of genomic tools is available for other Solanaceae, including tomato and potato. However, limited genomic resources are currently available for Cape gooseberry. Results We report the generation of a total of 652,614 P. peruviana Expressed Sequence Tags (ESTs, using 454 GS FLX Titanium technology. ESTs, with an average length of 371 bp, were obtained from a normalized leaf cDNA library prepared using a Colombian commercial variety. De novo assembling was performed to generate a collection of 24,014 isotigs and 110,921 singletons, with an average length of 1,638 bp and 354 bp, respectively. Functional annotation was performed using NCBI’s BLAST tools and Blast2GO, which identified putative functions for 21,191 assembled sequences, including gene families involved in all the major biological processes and molecular functions as well as defense response and amino acid metabolism pathways. Gene model predictions in P. peruviana were obtained by using the genomes of Solanum lycopersicum (tomato and Solanum tuberosum (potato. We predict 9,436 P. peruviana sequences with multiple-exon models and conserved intron positions with respect to the potato and tomato genomes. Additionally, to study species diversity we developed 5,971 SSR markers from assembled ESTs. Conclusions We present the first comprehensive analysis of the Physalis peruviana leaf transcriptome, which will provide valuable resources for development of genetic tools in the species. Assembled transcripts with gene models could serve as potential candidates for marker discovery with a variety of applications including: functional diversity, conservation and improvement to increase productivity and fruit quality. P. peruviana was estimated to be phylogenetically branched out before the

The Physalis peruviana leaf transcriptome: assembly, annotation and gene model prediction.

Science.gov (United States)

Garzón-Martínez, Gina A; Zhu, Z Iris; Landsman, David; Barrero, Luz S; Mariño-Ramírez, Leonardo

2012-04-25

Physalis peruviana commonly known as Cape gooseberry is a member of the Solanaceae family that has an increasing popularity due to its nutritional and medicinal values. A broad range of genomic tools is available for other Solanaceae, including tomato and potato. However, limited genomic resources are currently available for Cape gooseberry. We report the generation of a total of 652,614 P. peruviana Expressed Sequence Tags (ESTs), using 454 GS FLX Titanium technology. ESTs, with an average length of 371 bp, were obtained from a normalized leaf cDNA library prepared using a Colombian commercial variety. De novo assembling was performed to generate a collection of 24,014 isotigs and 110,921 singletons, with an average length of 1,638 bp and 354 bp, respectively. Functional annotation was performed using NCBI's BLAST tools and Blast2GO, which identified putative functions for 21,191 assembled sequences, including gene families involved in all the major biological processes and molecular functions as well as defense response and amino acid metabolism pathways. Gene model predictions in P. peruviana were obtained by using the genomes of Solanum lycopersicum (tomato) and Solanum tuberosum (potato). We predict 9,436 P. peruviana sequences with multiple-exon models and conserved intron positions with respect to the potato and tomato genomes. Additionally, to study species diversity we developed 5,971 SSR markers from assembled ESTs. We present the first comprehensive analysis of the Physalis peruviana leaf transcriptome, which will provide valuable resources for development of genetic tools in the species. Assembled transcripts with gene models could serve as potential candidates for marker discovery with a variety of applications including: functional diversity, conservation and improvement to increase productivity and fruit quality. P. peruviana was estimated to be phylogenetically branched out before the divergence of five other Solanaceae family members, S

Methodology of failed section location in case of leaks in PGN-200M sectional steam generator

International Nuclear Information System (INIS)

Kuznetsov, A.A.; Govorov, P.P.; Nosov, Yu.V.; Karavaev, A.P.

2009-01-01

The article considers a way of the failed section location when indications of water-sodium reaction emerge in PGN-200M sectional steam generator of the BN-600 power unit. The selection of diagnostic parameters used to locate the failed section is justified. Various alternative locations of leaks have been simulated [ru

Neutron cross sections: Book of curves

International Nuclear Information System (INIS)

McLane, V.; Dunford, C.L.; Rose, P.F.

1988-01-01

Neuton Cross Sections: Book of Curves represents the fourth edition of what was previously known as BNL-325, Neutron Cross Sections, Volume 2, CURVES. Data is presented only for (i.e., intergrated) reaction cross sections (and related fission parameters) as a function of incident-neutron energy for the energy range 0.01 eV to 200 MeV. For the first time, isometric state production cross sections have been included. 11 refs., 4 figs

Differential Top Cross-section Measurements

CERN Document Server

Fenton, Michael James; The ATLAS collaboration

2017-01-01

The top quark is the heaviest known fundamental particle. The measurement of the differential top-quark pair production cross-section provides a stringent test of advanced perturbative QCD calculations. The ATLAS collaboration has performed detailed measurements of those differential cross sections at a centre-of-mass energy of 13 TeV. This talk focuses on differential cross-section measurements in the lepton+jets final state, including using boosted top quarks to probe our understanding of top quark production in the TeV regime.

Cross-sectional anatomy for computed tomography

International Nuclear Information System (INIS)

Farkas, M.L.

1988-01-01

This self-study guide recognizes that evaluation and interpretation of CT-images demands a firm understanding of both cross-sectional anatomy and the principles of computed tomography. The objectives of this book are: to discuss the basic principles of CT, to stress the importance of cross-sectional anatomy to CT through study of selected cardinal transverse sections of head, neck, and trunk, to explain orientation and interpretation of CT-images with the aid of corresponding cross-sectional preparations

Vaginal birth after C-section

Science.gov (United States)

... this page: //medlineplus.gov/ency/patientinstructions/000589.htm Vaginal birth after C-section To use the sharing ... the same way again. Many women can have vaginal deliveries after having a C-section in the ...

Continuity between DSM-5 Section II and Section III personality traits for obsessive-compulsive personality disorder.

Science.gov (United States)

Liggett, Jacqueline; Sellbom, Martin; Bach, Bo

2018-01-01

Obsessive-compulsive personality disorder (OCPD) is formally operationalized in Section II of the DSM-5 by a heterogeneous collection of 8 categorical criteria. Section III contains an alternative model operationalizing personality disorders via dimensional personality traits and associated impairment. The extent to which the personality traits used to define OCPD in Section III correspond with the Section II operationalization of the disorder is contested. The current study aims to contribute to the evidence base necessary to solidify the optimal trait profile for this disorder via a more fine-tuned examination of OCPD. The research questions were examined using a clinical sample of 142 Danish adults who completed the Structured Clinical Interview for DSM-IV Axis II Disorders and the Personality Inventory for DSM-5 to index both the Sections II and III (personality traits) operationalizations of OCPD, respectively. Bivariate correlations supported Rigid Perfectionism and Perseveration as traits relevant to OCPD; however, hierarchical regression analyses indicated that of the 4 traits used in the Section III operationalization of OCPD, only Rigid Perfectionism uniquely predicted OCPD (p traits of Submissiveness, Suspiciousness, and (low) Impulsivity were also found to uniquely predict OCPD and its specific symptoms in a regression model. These findings indicate that the traits proposed in Section III are only partially aligned with the traditional, Section II conceptualization of OCPD, and may be augmented by incorporating Submissiveness, Suspiciousness, and (low) Impulsivity. In light of the current findings and existing literature, a modified constellation of traits to operationalize OCPD is likely justified. Copyright © 2017 John Wiley & Sons, Ltd.

Numerical taxonomic study of some solanum l. Species (solanaceae ...

African Journals Online (AJOL)

) were employed to elucidate the relationship among the taxa of the genus, while similarity matrix and dendrogram were constructed. PCA factor loading of the characters showed that characters such as plant height, leaf margin and leaf base ...

Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)

Energy Technology Data Exchange (ETDEWEB)

Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant' Anna, Carlos M.R., E-mail: mgeraldo@ufrrj.b [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Dept. de Quimica; Benassi Neto, Mario; Eberlin, Marcos N. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacases, RJ (Brazil). Setor de Quimica de Produtos Naturais. Lab. de Ciencias Quimicas

2010-07-01

The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-{beta}-D-apiofuranosyl-(1->5)-{beta}-D-apiofuranosyl-(1->6)-{beta}-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete {sup 1}H and {sup 13}C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)

Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)

International Nuclear Information System (INIS)

Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant'Anna, Carlos M.R.; Benassi Neto, Mario; Eberlin, Marcos N.; Braz-Filho, Raimundo

2010-01-01

The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1->5)-β-D-apiofuranosyl-(1->6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete 1 H and 13 C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)

Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)

OpenAIRE

Cornelius, Marli T. F.; Carvalho, Mário G. de; Silva, Tania M. S. da; Alves, Cassia C. F.; Siston, Ana P. N.; Alves, Kelly Z.; Sant'Anna, Carlos M. R.; Neto, Mario B.; Eberlin, Marcos N.; Braz-Filho, Raimundo

2010-01-01

The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1→5)-β-D-apiofuranosyl-(1→6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans- coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solama...

New records of Petunia (Solanaceae) for the Argentinean flora

OpenAIRE

Ando, Toshio; Soto, Silvina; Suárez, Enrique

2005-01-01

Petunia interior and P. guarapuavensis are reported for the first time for the Argentinean flora, and their geographical distributions are updated. Petunia interior y P. guarapuavensis son citadas por pimera vez para la Flora Argentina, con una actualización de su distribución geográfica.

Section for qualitative methods (Letter)

OpenAIRE

Todd, Z.; Madill, A.

2004-01-01

Qualitative research methods are increasingly used in all areas of psychology. We have proposed a new Section – the Qualitative Methods in Psychology Section – for anyone with an interest in using these research methods.

Nuclear Forensics and Radiochemistry: Cross Sections

Energy Technology Data Exchange (ETDEWEB)

Rundberg, Robert S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-11-08

The neutron activation of components in a nuclear device can provide useful signatures of weapon design or sophistication. This lecture will cover some of the basics of neutron reaction cross sections. Nuclear reactor cross sections will also be presented to illustrate the complexity of convolving neutron energy spectra with nuclear excitation functions to calculate useful effective reactor cross sections. Deficiencies in the nuclear database will be discussed along with tools available at Los Alamos to provide new neutron cross section data.

NDS multigroup cross section libraries

International Nuclear Information System (INIS)

DayDay, N.

1981-12-01

A summary description and documentation of the multigroup cross section libraries which exist at the IAEA Nuclear Data Section are given in this report. The libraries listed are available either on tape or in printed form. (author)

Utilization of cross-section covariance data in FBR core nuclear design and cross-section adjustment

International Nuclear Information System (INIS)

Ishikawa, Makoto

1994-01-01

In the core design of large fast breeder reactors (FBRs), it is essentially important to improve the prediction accuracy of nuclear characteristics from the viewpoint of both reducing cost and insuring reliability of the plant. The cross-section errors, that is, covariance data are one of the most dominant sources for the prediction uncertainty of the core parameters, therefore, quantitative evaluation of covariance data is indispensable for FBR core design. The first objective of the present paper is to introduce how the cross-section covariance data are utilized in the FBR core nuclear design works. The second is to delineate the cross-section adjustment study and its application to an FBR design, because this improved design method markedly enhances the needs and importance of the cross-section covariance data. (author)

Activation cross section data file, (1)

International Nuclear Information System (INIS)

Yamamuro, Nobuhiro; Iijima, Shungo.

1989-09-01

To evaluate the radioisotope productions due to the neutron irradiation in fission of fusion reactors, the data for the activation cross sections ought to be provided. It is planning to file more than 2000 activation cross sections at final. In the current year, the neutron cross sections for 14 elements from Ni to W have been calculated and evaluated in the energy range 10 -5 to 20 MeV. The calculations with a simplified-input nuclear cross section calculation system SINCROS were described, and another method of evaluation which is consistent with the JENDL-3 were also mentioned. The results of cross section calculation are in good agreement with experimental data and they were stored in the file 8, 9 and 10 of ENDF/B format. (author)

Composición química de los aceites esenciales de las hojas de Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae y Solanum subinerme (Solanaceae, recolectadas en Sucre, Venezuela

Directory of Open Access Journals (Sweden)

Gabriel Ordaz

2011-06-01

Full Text Available Los aceites esenciales son biosintetizados por plantas aromáticas y pueden obtenerse de cualquier órgano de la misma, tienen gran aplicación en la industria farmacéutica, sanitaria, cosmética, agrícola y de alimentos. Los aceites esenciales de las hojas de las plantas Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis y Solanum subinerme fueron obtenidos mediante hidrodestilación con rendimientos de 0.004, 0.032, 0.016 y 0.005%, respectivamente. La CG/EM permitió identificar la mayoría de los constituyentes de estos aceites esenciales (88.00, 89.80, 87.50 y 89.47%, respectivamente, encontrándose en mayor proporción metabolitos no volátiles de estructura no terpenoidal en H. guazumifolia (30.28%, sesquiterpenoides oxigenados en P. tuberculatum (52.19%, sesquiterpenos en S. dulcis (26.09% y derivados oxigenados de diterpenos en S. subinerme (39.67%. Los constituyentes mayoritarios fueron el diisobutilftalato (13.11% en H. guazumifolia, (--espatulenol (11.37% en P. tuberculatum y el trans-fitol (8.29 y 36.00% para S. dulcis y S. subinerme, respectivamente. El diisooctilftalato fue el constituyente común en los aceites esenciales de todas las especies y los compuestos volátiles trans-pinano, L-linalool, β-ionona, isofitol, neofitadieno, trans-fitol, dibutilftalato y hexadecanoato de metilo, fueron detectados en tres de estas esencias. Esto sugiere que dichas plantas pueden requerir metabolitos secundarios similares para su interacción ecológica, posiblemente debido a factores ambientales comunes.Chemical composition of essential oils from leaves of Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae and Solanum subinerme (Solanaceae from Sucre, Venezuela. Essential oils, biosynthesized and accumulated in aromatic plants, have a wide range of applications in the pharmaceutical health, cosmetics, food and agricultural industry. This study aimed to analyze the secondary

Is the quasielastic pion cross section really bigger than the pion-nucleus reaction cross section

International Nuclear Information System (INIS)

Silbar, R.R.

1979-01-01

It is shown that soft pion charge exchanges may increase the inclusive (π + ,π 0 ') cross section, relative to the total quasielastic (π + ,π + ') cross section, by as much as a factor of two. 4 references

Partial cross sections near the higher resonances

International Nuclear Information System (INIS)

Falk-Vairant, P.; Valladas, G.

1961-07-01

As a continuation of the report given at the 10. Rochester Conference, recent measurements of charge-exchange cross section and π 0 production in π - -p interactions are presented here. Section 1 gives a summary of the known results for the elastic, inelastic, and charge-exchange cross sections. Section 2 presents the behavior of the cross sections in the T=1/2 state, in order to discuss the resonances at 600 and 890 MeV. Section 3 discusses the charge-exchange scattering and the interference term between the T=1/2 and T=3/2 states. Section 4 presents some comments on inelastic processes. This report is reprinted from 'Reviews of Modern Physics', Vol. 33, No. 3, 362-367, July, 1961

Parametric Study of Fire Performance of Concrete Filled Hollow Steel Section Columns with Circular and Square Cross-Section

Science.gov (United States)

Nurfaidhi Rizalman, Ahmad; Tahir, Ng Seong Yap Mahmood Md; Mohammad, Shahrin

2018-03-01

Concrete filled hollow steel section column have been widely accepted by structural engineers and designers for high rise construction due to the benefits of combining steel and concrete. The advantages of concrete filled hollow steel section column include higher strength, ductility, energy absorption capacity, and good structural fire resistance. In this paper, comparison on the fire performance between circular and square concrete filled hollow steel section column is established. A three-dimensional finite element package, ABAQUS, was used to develop the numerical model to study the temperature development, critical temperature, and fire resistance time of the selected composite columns. Based on the analysis and comparison of typical parameters, the effect of equal cross-sectional size for both steel and concrete, concrete types, and thickness of external protection on temperature distribution and structural fire behaviour of the columns are discussed. The result showed that concrete filled hollow steel section column with circular cross-section generally has higher fire resistance than the square section.

New species in Aspergillus section Terrei

DEFF Research Database (Denmark)

Samson, R. A.; Peterson, S. W.; Frisvad, Jens Christian

2011-01-01

. clade including the type isolate of A. niveus (CBS 115.27) constitutes a lineage closely related to A. carneus. Fennellia nivea, the hypothesized teleomorph is not related to this clade. Aspergillus allahabadii, A. niveus var. indicus, and two species originally placed in section Versicolores, A......Section Terrei of Aspergillus was studied using a polyphasic approach including sequence analysis of parts of the beta-tubulin and calmodulin genes and the ITS region, macro- and micromorphological analyses and examination of extrolite profiles to describe three new species in this section. Based....... floccosus, A. terreus var. africanus, A. terreus var. aureus, while Aspergillus hortai is recognised at species level. Aspergillus terreus NRRL 4017 is described as the new species A. pseudoterreus. Also included in section Terrei are some species formerly placed in sections Flavipedes and Versicolores. A...

Particle sizes from sectional data

DEFF Research Database (Denmark)

Pawlas, Zbynek; Nyengaard, Jens Randel; Jensen, Eva Bjørn Vedel

2009-01-01

We propose a new statistical method for obtaining information about particle size distributions from sectional data without specific assumptions about particle shape. The method utilizes recent advances in local stereology. We show how to estimate separately from sectional data the variance due t...

Doppler broadening of cross sections

International Nuclear Information System (INIS)

Buckler, P.A.C.; Pull, I.C.

1962-12-01

Expressions for temperature dependent cross-sections in terms of resonance parameters are obtained, involving generalisations of the conventional Doppler functions, ψ and φ. Descriptions of Fortran sub-routines, which calculate broadened cross-sections in accordance with the derived formulae, are included. (author)

Research on the Cross Section Precision of High-strength Steel Tube with Rectangular Section in Rotary Draw Bending

Science.gov (United States)

Yang, Hongliang; Zhao, Hao; Xing, Zhongwen

2017-11-01

For the demand of energy conservation and security improvement, high-strength steel (HSS) is increasingly being used to produce safety related automotive components. However, cross-section distortion occurs easily in bending of HSS tube with rectangular section (RS), affecting the forming precision. HSS BR1500HS tube by rotary draw bending is taken as the study object and a description method of cross-section distortion is proposed in this paper. The influence on cross-section precision of geometric parameters including cross-section position, thickness of tube, bend radius etc. are studied by experiment. Besides, simulation of the rotary draw bending of HSS tube with rectangular section by ABAQUS are carried out and compared to the experiment. The results by simulation agree well with the experiment and show that the cross-section is approximately trapezoidal after distortion; the maximum of distortion exists at 45 ∼ 60° of the bending direction; and the absolute and relative distortion values increase with the decreasing of tube thickness or bending radius. Therefore, the results can provide a reference for the design of geometric parameters of HSS tube with rectangular section in rotary draw bending.

38 CFR 10.50 - Section 601 and section 603 payments made on first day of calendar quarter.

Science.gov (United States)

2010-07-01

... section 603 payments made on first day of calendar quarter. Cash payments and the first installment of installment payments authorized in sections 601 and 603, respectively of title VI of the World War Adjusted... 603 payments made on first day of calendar quarter. 10.50 Section 10.50 Pensions, Bonuses, and...

49 CFR 236.52 - Relayed cut-section.

Science.gov (United States)

2010-10-01

..., MAINTENANCE, AND REPAIR OF SIGNAL AND TRAIN CONTROL SYSTEMS, DEVICES, AND APPLIANCES Rules and Instructions: All Systems Track Circuits § 236.52 Relayed cut-section. Where relayed cut-section is used in... 49 Transportation 4 2010-10-01 2010-10-01 false Relayed cut-section. 236.52 Section 236.52...

JENDL gas-production cross section file

International Nuclear Information System (INIS)

Nakagawa, Tsuneo; Narita, Tsutomu

1992-05-01

The JENDL gas-production cross section file was compiled by taking cross-section data from JENDL-3 and by using the ENDF-5 format. The data were given to 23 nuclei or elements in light nuclei and structural materials. Graphs of the cross sections and brief description on their evaluation methods are given in this report. (author)

Vivitron dead section pumping tests

International Nuclear Information System (INIS)

Heugel, J.; Bayet, J.P.; Brandt, C.; Delhomme, C.; Krieg, C.; Kustner, F.; Meiss, R.; Riehl, R.; Roth, C.; Schlewer, B.; Six, P.; Weber, A.

1990-10-01

Pumping tests have been conducted on a simulated accelerator dead section. The behavior of different pump types are compared and analyzed. Vacuum conditions to be expected in the Vivitron are reached and several parameters are verified. Selection of a pump for the Vivitron dead section is confirmed

75 FR 34421 - Notice of Funds Availability for Section 514 Farm Labor Housing Loans and Section 516 Farm Labor...

Science.gov (United States)

2010-06-17

... DEPARTMENT OF AGRICULTURE Rural Housing Service Notice of Funds Availability for Section 514 Farm Labor Housing Loans and Section 516 Farm Labor Housing Grants for Off-Farm Housing for Fiscal Year (FY... the timeframe to submit pre-applications for section 514 Farm Labor Housing (FLH) loans and section...

Low Energy Neutrino Cross Sections

International Nuclear Information System (INIS)

Zeller, G.P.

2004-01-01

Present atmospheric and accelerator based neutrino oscillation experiments operate at low neutrino energies (Ev ∼ 1 GeV) to access the relevant regions of oscillation parameter space. As such, they require precise knowledge of the cross sections for neutrino-nucleon interactions in the sub-to-few GeV range. At these energies, neutrinos predominantly interact via quasi-elastic (QE) or single pion production processes, which historically have not been as well studied as the deep inelastic scattering reactions that dominate at higher energies.Data on low energy neutrino cross sections come mainly from bubble chamber, spark chamber, and emulsion experiments that collected their data decades ago. Despite relatively poor statistics and large neutrino flux uncertainties, these measurements provide an important and necessary constraint on Monte Carlo models in present use. The following sections discuss the current status of QE, resonant single pion, coherent pion, and single kaon production cross section measurements at low energy

H. W. Laboratory manual: 100 Area section

Energy Technology Data Exchange (ETDEWEB)

1950-07-01

The purpose of this manual is to present a Hazard Breakdown of all jobs normally encountered in the laboratory work of the three sections comprising the Analytic Section, Metallurgy and Control Division of the Technical Department. A Hazard Breakdown is a careful analysis of any job in which the source of possible dangers is clearly indicated for each particular step. The analysis is prepared by individuals who are thoroughly familiar with the specific job or procedure. It is felt that if the hazards herein outlined are recognized by the Laboratory personnel and the suggested safety cautions followed, the chance for injury will be minimized and the worker will become generally more safety conscious. The manual, which is prefaced by the general safety rules applying to all the laboratories, is divided into three main sections, one for each of the three sections into which the Laboratories Division is divided. These sections are as follows: Section 1 -- 200 Area Control; Section 2 -- 100 Area Control; Section 3 -- 300 Area Control, Essential Materials, and Methods Improvement.

Reactor-vessel-sectioning demonstration

International Nuclear Information System (INIS)

Lundgren, R.A.

1981-09-01

A technical demonstration was successfully completed of simulated reactor vessel sectioning using the combined techniques of air arc gouging and flame cutting. A 4-ft x 3-ft x 9-in. thick sample was fabricated of A36 carbon steel to simulate a reactor vessel wall. A 1/4-in. layer of stainless steel (SS) was tungsten inert gas (TIG)-welded to the carbon steel. Several techniques were considered to section the simulated reactor vessel; air arc gouging was selected to penetrate the stainless steel, and flame cutting was selected to sever the carbon steel. Three sectioning operations were demonstrated. For all three, the operating parameters were the same; but the position of the sample was varied. For the first cut, the sample was placed in a horizontal position, and it was successfully severed from the SS side. For the second cut, the sample was turned over and cut from the carbon steel side. Cutting from the carbon steel side has the advantages of cost reduction

Cutting work in thick section cryomicrotomy.

Science.gov (United States)

Saubermann, A J; Riley, W D; Beeuwkes, R

1977-09-01

The forces during cryosectioning were measured using miniature strain gauges attached to a load cell fitted to the drive arm of the Porter-Blum MT-2 cryomicrotome. Work was calculated and the data normalized to a standard (1 mm X 1 mm X 0.5 micrometer) section. Thermal energy generated was also calculated. Five parameters were studied: cutting angle, thickness, temperature, hardness, and block shape. Force patterns could be divided into three major groups thought to represent cutting (Type I), large fracture planes greater than 10 micrometer in length (Type II), and small fracture planes less than 10 micrometer in length (Type III). Type I and Type II produced satisfactory sections. Work in cutting ranged from an average of 78.4 muJ to 568.8 muJ. Cutting angle and temperature had the greatest effect on sectioning. Heat generated would be sufficient to cause through-section melting for 0.5 micrometer thick sections assuming the worst possible case, namely that all heat went into the section without loss. Presence of a Type II pattern (large fracture pattern) is thought to be presumptive evidence against thawing.

Flow Cytometry Section

Data.gov (United States)

Federal Laboratory Consortium — The primary goal of the Flow Cytometry Section is to provide the services of state-of-the-art multi-parameter cellular analysis and cell sorting for researchers and...

Total neutron cross section of lead

International Nuclear Information System (INIS)

Kanda, K.; Aizawa, O.

1976-01-01

The total thermal-neutron cross section of natural lead under various physical conditions was measured by the transmission method. It became clear that the total cross section at room temperature previously reported is lower than the present data. The total cross section at 400, 500, and 600 0 C, above the melting point of lead, 327 0 C, was also measured, and the changes in the cross section as a function of temperature were examined, especially near and below the melting point. The data obtained for the randomly oriented polycrystalline state at room temperature were in reasonable agreement with the theoretical values calculated by the THRUSH and UNCLE-TOM codes

Effect of evaporation section and condensation section length on thermal performance of flat plate heat pipe

International Nuclear Information System (INIS)

Wang Shuangfeng; Chen Jinjian; Hu Yanxin; Zhang Wei

2011-01-01

Flat plate heat pipes (FPHPs) are one of the available technologies to deal with the high density electronic cooling problem due to their high thermal conductivity, reliability, and low weight penalty. A series of experiments were performed to investigate the effect of evaporation and condensation length on thermal performance of flat plate heat pipes. In the experiments, the FPHP had heat transfer length of 255 mm and width of 25 mm, and pure water was used as the working fluid. The results show that comparing to vapor chamber, the FPHP could realize long-distance heat transfer; comparing to the traditional heat pipe, the FPHP has large area contact with heat sources; the thermal resistance decreased and the heat transfer limit increased with the increase of evaporation section length; the FPHP would dry out at a lower heating power with the increase of condensation section length, which indicated that the heat transfer limit decreased, but the evaporator temperature also decreased; when the condensation section length approached to evaporation section length, the FPHP had a better thermal performance. - Highlights: → A strip sintered FPHP is proposed and tested. → The total heat transfer length reaches 255 mm → The efficiency of heat transport reaches 94.4%. → When the condensation section length approached to evaporation section length, the FPHP has better overall performance.

Light Imaging Section

Data.gov (United States)

Federal Laboratory Consortium — The mission of the Light Imaging Section is to give NIAMS scientists access to state-of-the-art light imaging equipment and to offer training and assistance at all...

Density-dependent expressions for photoionization cross-sections

International Nuclear Information System (INIS)

Sun Weiguo; Ma Xiaoguang; Cheng Yansong

2004-01-01

Alternative expressions for photoionization cross-sections and dielectric influence functions are suggested to study the photoionization cross-sections of atoms in solid system. The basic picture is that the photoionization cross-section of atoms in a real system can be described as the coupling between quantum quantity (QQ) and classical quantity (CQ) parts. The QQ part represents the photoionization cross-sections of an isolated particle, while the CQ part may represent most of the important influence of the macroscopic effects (e.g., the interactions of all surrounding polarized particles, and the dielectric property, etc.) on the photoionization cross-sections. The applications to the barium system show that the number-density-dependent new photoionization formula not only obtains the same cross-sections as those from the first order approximation for ideal gas, but also can generate the cross-sections for solid barium by transforming those of ideal gas of the same species using the dielectric influence function

Density-dependent expressions for photoionization cross-sections

Energy Technology Data Exchange (ETDEWEB)

Sun Weiguo; Ma Xiaoguang; Cheng Yansong

2004-06-07

Alternative expressions for photoionization cross-sections and dielectric influence functions are suggested to study the photoionization cross-sections of atoms in solid system. The basic picture is that the photoionization cross-section of atoms in a real system can be described as the coupling between quantum quantity (QQ) and classical quantity (CQ) parts. The QQ part represents the photoionization cross-sections of an isolated particle, while the CQ part may represent most of the important influence of the macroscopic effects (e.g., the interactions of all surrounding polarized particles, and the dielectric property, etc.) on the photoionization cross-sections. The applications to the barium system show that the number-density-dependent new photoionization formula not only obtains the same cross-sections as those from the first order approximation for ideal gas, but also can generate the cross-sections for solid barium by transforming those of ideal gas of the same species using the dielectric influence function.

Neutron accelerator tube having improved ionization section

International Nuclear Information System (INIS)

Givens, W.W.

1982-01-01

A neutron accelerator tube is described having a target section, an ionization section, and a replenisher section for supplying accelerator gas to the ionization section. The ionization section is located between the target and the replenisher section and includes an ionization chamber adapted to receive accelerator gas from the replenisher section. The ionization section further includes spaced cathodes having opposed active surfaces exposed to the interior of the ionization chamber. An anode is located intermediate the cathodes whereby in response to an applied positive voltage, electrons created by field emission are transmitted between the opposed active surfaces of the cathodes and produce the emission of secondary electrons. The active surface of at least one of the cathodes is formulated of a material having a secondary electron emission factor of at least one cathode member located in the tube adjacent to th replenisher section may have a protuberant portion extending axially into the ionization chamber. The other cathode spaced from the first cathode member in the direction of the target has an aperture therein along the axis of the protuberant portion. An annular magnet extends around the exterior of the ionization chamber and envelops the anode member. Means are provided to establish a high permeability magnetic flux path extending outwardly from the opposed poles from the magnet to the active surfaces of the cathode members

Neutron accelerator tube having improved ionization section

International Nuclear Information System (INIS)

Givens, W.W.

1981-01-01

A neutron accelerator tube having a target section, an ionization section, and a replenisher section for supplying accelerator gas to the ionization section. The ionization section is located between the target and the replenisher section and includes an ionization chamber adapted to receive accelerator gas from the replenisher section. The ionization section further includes spaced cathodes having opposed active surfaces exposed to the interior of the ionization chamber. An anode is located intermediate the cathodes whereby in response to an applied positive voltage, electrons created by field emmission are transmitted between the opposed active surfaces of the cathodes and produce the emission of secondary electrons. The active surface of at least one of the cathodes is formulated of a material having a secondary electron emission factor of at least 2. One cathode member located in the tube adjacent to the replenisher section may have a protuberant portion extending axially into the ioization chamber. The other cathode spaced from the first cathode member in the direction of the target has an aperture therein along the axis of the protuberant portion. An annular magnet extends around the exterior of the ionization chamber and envelops the anode member. Means are provided to establish a high permeability magnetic flux path extending outwardly from the opposed poles from the magnet to the active surfaces of the cathode members

Top quark production cross-section measurements

CERN Document Server

Chen, Ye; The ATLAS collaboration

2017-01-01

Measurements of the inclusive and differential cross-sections for top-quark pair and single top production cross sections in proton-proton collisions with the ATLAS detector at the Large Hadron Collider are presented at center-of-mass energies of 8 TeV and 13 TeV. The inclusive measurements reach high precision and are compared to the best available theoretical calculations. These measurements, including results using boosted tops, probe our understanding of top-pair production in the TeV regime. The results are compared to Monte Carlo generators implementing LO and NLO matrix elements matched with parton showers and NLO QCD calculations. For the t-channel single top measurement, the single top-quark and anti-top-quark total production cross-sections, their ratio, as well as differential cross sections are also presented. A measurement of the production cross-section of a single top quark in association with a W boson, the second largest single-top production mode, is also presented. Finally, measurements of ...

PREFACE: Focus section on superconducting power systems Focus section on superconducting power systems

Science.gov (United States)

Cardwell, D. A.; Amemiya, N.; Fair, R.

2012-01-01

This focus section of Superconductor Science and Technology looks at the properties, technology and applications of (RE)BCO and MgB2 based superconductors for power engineering systems. Both bulk and conductor forms of material are addressed, including elements of materials fabrication and processing, and the measurement of their applied properties for various levels of system application. The areas of research include ac losses in type II materials in power devices, cables and coated conductors, the development of high current dc cables and the application of superconductors in levitation devices, motors and fault current limiters. This focus section presents a broad cross-section of contemporary issues, that represent state-of-the-art for power applications of superconductors, and highlights the areas that require further development if commercial applications of these rapidly emerging materials are to be realised. It contains papers from some of the major groups in the field, including contributions from Europe, the USA and Japan, and describes devices that are relatively close to market.

(n,{alpha}) cross section measurement of gaseous sample using gridded ionization chamber. Cross section determination

Energy Technology Data Exchange (ETDEWEB)

Sanami, Toshiya; Baba, Mamoru; Saito, Keiichiro; Ibara, Yasutaka; Hirakawa, Naohiro [Tohoku Univ., Sendai (Japan). Faculty of Engineering

1997-03-01

We are developing a method of (n,{alpha}) cross section measurement using gaseous samples in a gridded ionization chamber (GIC). This method enables cross section measurements in large solid angle without the distortion by the energy loss in a sample, but requires a method to estimate the detection efficiency. We solve this problem by using GIC signals and a tight neutron collimation. The validity of this method was confirmed through the {sup 12}C(n,{alpha}{sub 0}){sup 9}Be measurement. We applied this method to the {sup 16}O(n,{alpha}){sup 13}C cross section around 14.1 MeV. (author)

STEM mode in the SEM for the analysis of cellular sections prepared by ultramicrotome sectioning

International Nuclear Information System (INIS)

Hondow, N; Harrington, J; Brydson, R; Brown, A

2012-01-01

The use of the dual imaging capabilities of a scanning electron microscope fitted with a transmitted electron detector is highlighted in the analysis of samples with importance in the field of nanotoxicology. Cellular uptake of nanomaterials is often examined by transmission electron microscopy of thin sections prepared by ultramicrotome sectioning. Examination by SEM allows for the detection of artefacts caused by sample preparation (eg. nanomaterial pull-out) and the complementary STEM mode permits study of the interaction between nanomaterials and cells. Thin sections of two nanomaterials of importance in nanotoxicology (cadmium selenide quantum dots and single walled carbon nanotubes) are examined using STEM mode in the SEM.

METABOLITOS SECUNDARIOS DE LAS FAMILIAS ANNONACEAE,

Directory of Open Access Journals (Sweden)

Luis Enrique Castillo

2010-07-01

Full Text Available Debido a los problemas que ocasionan los insecticidas sintéticos tanto en el ambiente como en la salud humana existe un resurgimiento en investigaciones sobre los extractos de origen vegetal para el control de insectos. Se presenta una revisión de literatura especializada de los trabajos publicados de los diferentes extractos vegetales obtenidos de las familias Annonaceae, Meliaceae y Solanaceae, describiendo los compuestos o mezcla de compuestos obtenidos, así como sus mecanismos de acción que presentan sobre insectos. Las especies vegetales de las tres familias presentan compuestos muy polares. La familia Meliaceae es la más estudiada, con la azadiractina como el compuesto activo más importante. Las acetogeninas, squamocin y annonacin de la familia Annonacea, son las de mayor impacto, mientras que en la familia Solanaceae son los alcaloides y glicósidos esteroidales los principios con mayor bioactividad. La actividad biológica de los metabolitos secundarios ha sido mayor cuando se prueban los extractos, que son mezclas complejas de compuestos secundarios. La mayoría de las investigaciones revisadas han sido bioensayos in vitro para la actividad insecticida, por lo que se desconoce la efectividad de los extractos en campo.

Comparative analysis of pepper and tomato reveals euchromatin expansion of pepper genome caused by differential accumulation of Ty3/Gypsy-like elements

Directory of Open Access Journals (Sweden)

Ahn Jong Hwa

2011-01-01

Full Text Available Abstract Background Among the Solanaceae plants, the pepper genome is three times larger than that of tomato. Although the gene repertoire and gene order of both species are well conserved, the cause of the genome-size difference is not known. To determine the causes for the expansion of pepper euchromatic regions, we compared the pepper genome to that of tomato. Results For sequence-level analysis, we generated 35.6 Mb of pepper genomic sequences from euchromatin enriched 1,245 pepper BAC clones. The comparative analysis of orthologous gene-rich regions between both species revealed insertion of transposons exclusively in the pepper sequences, maintaining the gene order and content. The most common type of the transposon found was the LTR retrotransposon. Phylogenetic comparison of the LTR retrotransposons revealed that two groups of Ty3/Gypsy-like elements (Tat and Athila were overly accumulated in the pepper genome. The FISH analysis of the pepper Tat elements showed a random distribution in heterochromatic and euchromatic regions, whereas the tomato Tat elements showed heterochromatin-preferential accumulation. Conclusions Compared to tomato pepper euchromatin doubled its size by differential accumulation of a specific group of Ty3/Gypsy-like elements. Our results could provide an insight on the mechanism of genome evolution in the Solanaceae family.

In-vitro antimicrobial activity screening of some ethnoveterinary medicinal plants traditionally used against mastitis, wound and gastrointestinal tract complication in Tigray Region, Ethiopia.

Science.gov (United States)

Kalayou, Shewit; Haileselassie, Mekonnen; Gebre-Egziabher, Gebremedhin; Tiku'e, Tsegay; Sahle, Samson; Taddele, Habtamu; Ghezu, Mussie

2012-07-01

To screen the antibacterial activity of nine ethnoveterinary plants traditionally used for the treatment of mastitis, wound and gastrointestinal complications. Hydroalcoholic exctracts of medicinal plants namely, Achyranthes aspera (A. aspera) L. (Family Asparagaceae), Ficus caria (F. caria) (Family Moraceae), Malvi parviflora (M. parviflora) (Family Malvaceae), Vernonia species (V. species) (local name Alakit, Family Asteraceae), Solanum hastifolium (S. hastifolium) (Family Solanaceae), Calpurinia aurea (C. aurea) (Ait) Benth (Family Fabaceae), Nicotiana tabacum (N. tabacum) L. (Family Solanaceae), Ziziphus spina-christi (Z. spina-christi) (Family Rhamnaceae), Croton macrostachys (C. macrostachys) (Family Euphorbiaceae), were screened against clinical bacterial isolates of veterinary importance from October 2007 to April 2009. The antibacterial activity was tested using disc diffusion at two concentrations (200 mg/mL and 100 mg/mL) and broth dilution methods using 70% methanol macerated leaf extracts. With the exception of S. hastifolium all plant extracts exhibited antibacterial activity. Among the medicinal plants tested C. aurea, C. macrostachyus, A. aspera, N. tabacum and vernonia species (Alakit) showed the most promising antimicrobial properties. It can be concluded that many of the tested plants have antibacterial activity and supports the traditional usage of the plants for mastitis, wound and gastrointestinal complications treatment. Further studies into their toxicity and phytochemistry is advocated.

Polen de las Mieles de la Patagonia Andina (Chubut-Argentina Pollen of honeys from the Andean Patagonia (Chubut-Argentina

Directory of Open Access Journals (Sweden)

Alicia Forcone

2006-07-01

Full Text Available Se describen e ilustran mediante fotomicrografías tomadas con MO y MEB, 30 tipos polínicos, determinados en las mieles producidas en la región andina de Chubut (Patagonia Argentina. Los tipos morfológicos descriptos pertenecen a las siguientes familias: Alstroemeriaceae, Apiaceae, Buddlejaceae, Caryophyllaceae, Caprifoliaceae, Celastraceae, Clusiaceae, Convolvulaceae, Ericaceae, Elaeocarpaceae, Fabaceae, Fagaceae, Lamiaceae, Papaveraceae, Polemoniaceae, Polygalaceae, Proteaceae, Ranunculaceae, Rosaceae, Saxifragaceae, Solanaceae, Thymelaceae y Verbenaceae. La mayoría de los tipos polínicos descriptos fueron hallados en las mieles como polen de menor importancia o traza con excepción de Aristotelia chilensis y Escallonia sp., que alcanzaron la categoría de polen dominante, y de Lomatia hirsuta, hallada como polen secundario.Thirty pollen types identified in the honeys from the Andean region of Chubut are described and illustrated by means of LM and SEM photomicrographs. Pollen types belong to the following families: Alstroemeriaceae, Apiaceae, Buddlejaceae, Caryophyllaceae, Caprifoliaceae, Celastraceae, Clusiaceae, Convolvulaceae, Ericaceae, Elaeocarpaceae, Fabaceae, Fagaceae, Lamiaceae, Papaveraceae, Polemoniaceae, Polygalaceae, Proteaceae, Ranunculaceae, Rosaceae, Saxifragaceae, Solanaceae, Thymelaceae, and Verbenaceae. Most pollen types described were found in the honeys as minor important pollen or traces, except Aristotelia chilensis, Escallonia sp., which reached the category of dominant pollen, and Lomatia hirsuta, which was found as secondary pollen.

Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

Science.gov (United States)

Ventrella, Emanuela; Adamski, Zbigniew; Chudzińska, Ewa; Miądowicz-Kobielska, Mariola; Marciniak, Paweł; Büyükgüzel, Ender; Büyükgüzel, Kemal; Erdem, Meltem; Falabella, Patrizia; Scrano, Laura; Bufo, Sabino Aurelio

2016-01-01

Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed) generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Emanuela Ventrella

Full Text Available Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

Whole genome duplication of intra- and inter-chromosomes in the tomato genome.

Science.gov (United States)

Song, Chi; Guo, Juan; Sun, Wei; Wang, Ying

2012-07-20

Whole genome duplication (WGD) events have been proven to occur in the evolutionary history of most angiosperms. Tomato is considered a model species of the Solanaceae family. In this study, we describe the details of the evolutionary process of the tomato genome by detecting collinearity blocks and dating the WGD events on the tree of life by combining two different methods: synonymous substitution rates (Ks) and phylogenetic trees. In total, 593 collinearity blocks were discovered out of 12 pseudo-chromosomes constructed. It was evident that chromosome 2 had experienced an intra-chromosomal duplication event. Major inter-chromosomal duplication occurred among all the pseudo-chromosome. We calculated the Ks value of these collinearity blocks. Two peaks of Ks distribution were found, corresponding to two WGD events occurring approximately 36-82 million years ago (MYA) and 148-205 MYA. Additionally, the results of phylogenetic trees suggested that the more recent WGD event may have occurred after the divergence of the rosid-asterid clade, but before the major diversification in Solanaceae. The older WGD event was shown to have occurred before the divergence of the rosid-asterid clade and after the divergence of rice-Arabidopsis (monocot-dicot). Copyright © 2012. Published by Elsevier Ltd.

Three-section expiratory CT

DEFF Research Database (Denmark)

Loeve, Martine; de Bruijne, Marleen; Hartmann, Ieneke C. J.

2012-01-01

. Longitudinal follow-up was performed with three sections. All images were deidentified and randomized, and TA was scored with the Brody II system and a new quantitative system. Statistical analysis included the Wilcoxon signed rank test, calculation of Spearman and intraclass correlation coefficients, and use......Purpose: To estimate the effect of the number of computed tomography (CT) sections on trapped air (TA) assessment in patients with cystic fibrosis (CF) by using an established scoring system and a new quantitative scoring system and to compare CT and pulmonary function test (PFT) estimates of TA...

XCOM: Photon Cross Sections Database

Science.gov (United States)

SRD 8 XCOM: Photon Cross Sections Database (Web, free access)   A web database is provided which can be used to calculate photon cross sections for scattering, photoelectric absorption and pair production, as well as total attenuation coefficients, for any element, compound or mixture (Z <= 100) at energies from 1 keV to 100 GeV.

14 CFR Section 2 - General Accounting Policies

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false General Accounting Policies Section 2 Section 2 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION... General Accounting Provisions Section 2 General Accounting Policies ...

Section of LHC beampipe

CERN Multimedia

2009-01-01

A short section of the LHC beampipe including beam screen. Particle beams circulate for around 10 hours in the Large Hadron Collider (LHC). During this time, the particles make four hundred million revolutions of the machine, travelling a distance equivalent to the diameter of the solar system. The beams must travel in a pipe which is emptied of air, to avoid collisions between the particles and air molecules (which are considerably bigger than protons). The beam pipes are pumped down to an air pressure similar to that on the surface of the moon. Emptying the air from the two 27 km long Large Hadron Collider beam-pipes is equivalent in volume to emptying the nave of the Notre Dame cathedral in Paris. Initially, the air pressure is reduced by pumping. Then, cold sections of the beam-pipe are further emptied using the temperature gradient across special beam-screens inside the tube where particles travel. The warm sections are emptied using a coating called a getter that works like molecular fly-paper. This va...

Measurements of neutron capture cross sections

International Nuclear Information System (INIS)

Nakajima, Yutaka

1984-01-01

A review of measurement techniques for the neutron capture cross sections is presented. Sell transmission method, activation method, and prompt gamma-ray detection method are described using examples of capture cross section measurements. The capture cross section of 238 U measured by three different prompt gamma-ray detection methods (large liquid scintillator, Moxon-Rae detector, and pulse height weighting method) are compared and their discrepancies are resolved. A method how to derive the covariance is described. (author)

Section Level Public Land Survey - polygons

Data.gov (United States)

Minnesota Department of Natural Resources — Public Land Survey line delineations to the section level. Data are derived primarily from Section corner locations captured from paper USGS seven and one-half...

Section Level Public Land Survey - lines

Data.gov (United States)

Minnesota Department of Natural Resources — Public Land Survey line delineations to the section level. Developed from manually digitized section corners captured from paper USGS seven and one-half map sources.

Pengaruh Waktu Pemberian Pupuk Mikoriza Terhadap Pertumbuhan Dan Hasil Tanaman Paprika (Capsicum Annum Var Grossum L.)

OpenAIRE

Milla, Yulius Ndara; Widnyana, I Ketut; Pandawani, Ni Putu

2016-01-01

Paprika (Capsicum annum var grossum L.) adalah tumbuhan penghasil buah yang berasa manis dan sedikit pedas dari suku terong-terongan atau Solanaceae. Sama dengan jenis cabai lainnya. Paprika memiliki nilai jual yang bagus, permintaan pasar akan sayuran ini juga terus meningkat, terutama permintaan dari banyak restoran dan hotel berkembang di Bali. Kenyataan ini bisa dimanfaatkan dengan mengembangkan budidaya tanaman paprika untuk memasok kebutuhan pasar akan paprika yang kian hari kian me...

Vascular species composition of a contact zone between Seasonal and Araucaria forests in Guaraciaba, Far West of Santa Catarina state, southern Brazil

OpenAIRE

Gnigler, Luciana; Caddah, Mayara

2015-01-01

A floristic survey was carried out in a contact area between Araucaria Forest and Seasonal Forest areas, in the municipality of Guaraciaba, Far West of Santa Catarina state, southern Brazil. We provide a checklist containing 108 species and 42 plant families for the area. Families with the most encountered number of species were Myrtaceae (eight species), Solanaceae (eight), Euphorbiaceae (seven) and Poaceae (six). Two species are classified as endangered of extinction, following IUCN criteri...

A New Species of Solitary Meteorus (Hymenoptera: Braconidae) Reared from Caterpillars of Toxic Butterflies (Lepidoptera: Nymphalidae) in Ecuador

OpenAIRE

Shaw, Scott R.; Jones, Guinevere Z.

2009-01-01

A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nympha...

Plant elicitor peptides are conserved signals regulating direct and indirect antiherbivore defense

OpenAIRE

Huffaker, Alisa; Pearce, Gregory; Veyrat, Nathalie; Erb, Matthias; Turlings, Ted C. J.; Sartor, Ryan; Shen, Zhouxin; Briggs, Steven P.; Vaughan, Martha M.; Alborn, Hans T.; Teal, Peter E. A.; Schmelz, Eric A.

2013-01-01

Insect-induced defenses occur in nearly all plants and are regulated by conserved signaling pathways. As the first described plant peptide signal, systemin regulates antiherbivore defenses in the Solanaceae, but in other plant families, peptides with analogous activity have remained elusive. In the current study, we demonstrate that a member of the maize (Zea mays) plant elicitor peptide (Pep) family, ZmPep3, regulates responses against herbivores. Consistent with being a signal, expression o...

Development and Characterization of Microsatellite Markers for the Cape Gooseberry Physalis peruviana

OpenAIRE

Simbaqueba, Jaime; S?nchez, Pilar; Sanchez, Erika; N??ez Zarantes, Victor Manuel; Chacon, Maria Isabel; Barrero, Luz Stella; Mari?o-Ram?rez, Leonardo

2011-01-01

Physalis peruviana, commonly known as Cape gooseberry, is an Andean Solanaceae fruit with high nutritional value and interesting medicinal properties. In the present study we report the development and characterization of microsatellite loci from a P. peruviana commercial Colombian genotype. We identified 932 imperfect and 201 perfect Simple Sequence Repeats (SSR) loci in untranslated regions (UTRs) and 304 imperfect and 83 perfect SSR loci in coding regions from the assembled Physalis peruvi...

Differences between LASL- and ANL-processed cross sections

International Nuclear Information System (INIS)

Kidman, R.B.; MacFarlane, R.E.; Becker, M.

1978-03-01

As part of the Los Alamos Scientific Laboratory (LASL) cross-section processing development, LASL cross sections and results from MINX/1DX system are compared to the Argonne National Laboratory cross sections and results from the ETOE-2/MC 2 -2 system for a simple reactor problem. Exact perturbation theory is used to establish the eigenvalue effect of every isotope group cross-section difference. Cross sections, cross-section differences, and their eigenvalue effects are clearly and conveniently displayed and compared on a group-by-group basis

Special Section on Coloured Petri Nets

DEFF Research Database (Denmark)

1998-01-01

Special section on coloured Petri nets, their basic concepts, analysis methods, tool support and industrial applications.......Special section on coloured Petri nets, their basic concepts, analysis methods, tool support and industrial applications....

NNLO jet cross sections by subtraction

International Nuclear Information System (INIS)

Somogyi, G.; Bolzoni, P.; Trocsanyi, Z.

2010-06-01

We report on the computation of a class of integrals that appear when integrating the so-called iterated singly-unresolved approximate cross section of an earlier NNLO subtraction scheme over the factorised phase space of unresolved partons. The integrated approximate cross section itself can be written as the product of an insertion operator (in colour space) times the Born cross section. We give selected results for the insertion operator for processes with two and three hard partons in the final state. (orig.)

NNLO jet cross sections by subtraction

Energy Technology Data Exchange (ETDEWEB)

Somogyi, G.; Bolzoni, P. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Trocsanyi, Z. [CERN, Geneva (Switzerland)

2010-06-15

We report on the computation of a class of integrals that appear when integrating the so-called iterated singly-unresolved approximate cross section of an earlier NNLO subtraction scheme over the factorised phase space of unresolved partons. The integrated approximate cross section itself can be written as the product of an insertion operator (in colour space) times the Born cross section. We give selected results for the insertion operator for processes with two and three hard partons in the final state. (orig.)

NNLO jet cross sections by subtraction

CERN Document Server

Somogyi, Gabor; Trocsanyi, Zoltan

2010-01-01

We report on the computation of a class of integrals that appear when integrating the so-called iterated singly-unresolved approximate cross section of the NNLO subtraction scheme of [1-4], over the factorised phase space of unresolved partons. The integrated approximate cross section itself can be written as the product of an insertion operator (in colour space) times the Born cross section. We give selected results for the insertion operator for processes with two and three hard partons in the final state.

Capture cross sections on unstable nuclei

Science.gov (United States)

Tonchev, A. P.; Escher, J. E.; Scielzo, N.; Bedrossian, P.; Ilieva, R. S.; Humby, P.; Cooper, N.; Goddard, P. M.; Werner, V.; Tornow, W.; Rusev, G.; Kelley, J. H.; Pietralla, N.; Scheck, M.; Savran, D.; Löher, B.; Yates, S. W.; Crider, B. P.; Peters, E. E.; Tsoneva, N.; Goriely, S.

2017-09-01

Accurate neutron-capture cross sections on unstable nuclei near the line of beta stability are crucial for understanding the s-process nucleosynthesis. However, neutron-capture cross sections for short-lived radionuclides are difficult to measure due to the fact that the measurements require both highly radioactive samples and intense neutron sources. Essential ingredients for describing the γ decays following neutron capture are the γ-ray strength function and level densities. We will compare different indirect approaches for obtaining the most relevant observables that can constrain Hauser-Feshbach statistical-model calculations of capture cross sections. Specifically, we will consider photon scattering using monoenergetic and 100% linearly polarized photon beams. Challenges that exist on the path to obtaining neutron-capture cross sections for reactions on isotopes near and far from stability will be discussed.

Status of neutron dosimetry cross sections

International Nuclear Information System (INIS)

Griffin, P.J.; Kelly, J.G.

1992-01-01

Several new cross section libraries, such as ENDF/B-VI(release 2), IRDF-90,JEF-2.2, and JENDL-3 Dosimetry, have recently been made available to the dosimetry community. the Sandia National Laboratories (SNL) Radiation Metrology Laboratory (RML) has worked with these libraries since pre-release versions were available. this paper summarizes the results of the intercomparison and testing of dosimetry cross sections. As a result of this analysis, a compendium of the best dosimetry cross sections was assembled from the available libraries for use within the SNL RML. this library, referred to as the SNLRML Library, contains 66 general dosimetry sensors and 3 special dosimeters unique to the RML sensor inventory. The SNLRML cross sections have been put into a format compatible with commonly used spectrum determination codes

Capture cross sections on unstable nuclei

Directory of Open Access Journals (Sweden)

Tonchev A.P.

2017-01-01

Full Text Available Accurate neutron-capture cross sections on unstable nuclei near the line of beta stability are crucial for understanding the s-process nucleosynthesis. However, neutron-capture cross sections for short-lived radionuclides are difficult to measure due to the fact that the measurements require both highly radioactive samples and intense neutron sources. Essential ingredients for describing the γ decays following neutron capture are the γ-ray strength function and level densities. We will compare different indirect approaches for obtaining the most relevant observables that can constrain Hauser-Feshbach statistical-model calculations of capture cross sections. Specifically, we will consider photon scattering using monoenergetic and 100% linearly polarized photon beams. Challenges that exist on the path to obtaining neutron-capture cross sections for reactions on isotopes near and far from stability will be discussed.

Graphs of the cross sections in the recommended Monte Carlo cross-section library at the Los Alamos Scientific Laboratory

International Nuclear Information System (INIS)

Soran, P.D.; Seamon, R.E.

1980-05-01

Graphs of all neutron cross sections and photon production cross sections on the Recommended Monte Carlo Cross Section (RMCCS) library have been plotted along with local neutron heating numbers. Values for anti ν, the average number of neutrons per fission, are also given

Scattering cross section for various potential systems

Directory of Open Access Journals (Sweden)

Myagmarjav Odsuren

2017-08-01

Full Text Available We discuss the problems of scattering in this framework, and show that the applied method is very useful in the investigation of the effect of the resonance in the observed scattering cross sections. In this study, not only the scattering cross sections but also the decomposition of the scattering cross sections was computed for the α–α system. To obtain the decomposition of scattering cross sections into resonance and residual continuum terms, the complex scaled orthogonality condition model and the extended completeness relation are used. Applying the present method to the α–α and α–n systems, we obtained good reproduction of the observed phase shifts and cross sections. The decomposition into resonance and continuum terms makes clear that resonance contributions are dominant but continuum terms and their interference are not negligible. To understand the behavior of observed phase shifts and the shape of the cross sections, both resonance and continuum terms are calculated.

Scattering cross section for various potential systems

Energy Technology Data Exchange (ETDEWEB)

Odsuren, Myagmarjav; Khuukhenkhuu, Gonchigdorj; Davaa, Suren [Nuclear Research Center, School of Engineering and Applied Sciences, National University of Mongolia, Ulaanbaatar (Mongolia); Kato, Kiyoshi [Nuclear Reaction Data Centre, Faculty of Science, Hokkaido University, Sapporo (Japan)

2017-08-15

We discuss the problems of scattering in this framework, and show that the applied method is very useful in the investigation of the effect of the resonance in the observed scattering cross sections. In this study, not only the scattering cross sections but also the decomposition of the scattering cross sections was computed for the α–α system. To obtain the decomposition of scattering cross sections into resonance and residual continuum terms, the complex scaled orthogonality condition model and the extended completeness relation are used. Applying the present method to the α–α and α–n systems, we obtained good reproduction of the observed phase shifts and cross sections. The decomposition into resonance and continuum terms makes clear that resonance contributions are dominant but continuum terms and their interference are not negligible. To understand the behavior of observed phase shifts and the shape of the cross sections, both resonance and continuum terms are calculated.

Relating DSM-5 section III personality traits to section II personality disorder diagnoses.

Science.gov (United States)

Morey, L C; Benson, K T; Skodol, A E

2016-02-01

The DSM-5 Personality and Personality Disorders Work Group formulated a hybrid dimensional/categorical model that represented personality disorders as combinations of core impairments in personality functioning with specific configurations of problematic personality traits. Specific clusters of traits were selected to serve as indicators for six DSM categorical diagnoses to be retained in this system - antisocial, avoidant, borderline, narcissistic, obsessive-compulsive and schizotypal personality disorders. The goal of the current study was to describe the empirical relationships between the DSM-5 section III pathological traits and DSM-IV/DSM-5 section II personality disorder diagnoses. Data were obtained from a sample of 337 clinicians, each of whom rated one of his or her patients on all aspects of the DSM-IV and DSM-5 proposed alternative model. Regression models were constructed to examine trait-disorder relationships, and the incremental validity of core personality dysfunctions (i.e. criterion A features for each disorder) was examined in combination with the specified trait clusters. Findings suggested that the trait assignments specified by the Work Group tended to be substantially associated with corresponding DSM-IV concepts, and the criterion A features provided additional diagnostic information in all but one instance. Although the DSM-5 section III alternative model provided a substantially different taxonomic structure for personality disorders, the associations between this new approach and the traditional personality disorder concepts in DSM-5 section II make it possible to render traditional personality disorder concepts using alternative model traits in combination with core impairments in personality functioning.

Photoionization cross section of atomic and molecular oxygen

International Nuclear Information System (INIS)

Pareek, P.N.

1983-01-01

Photoionization cross sections of atomic oxygen and dissociative photoionization cross sections of molecular oxygen were measured from their respective thresholds to 120 angstrom by use of a photoionization mass spectrometer in conjunction with a spark light source. The photoionization cross sections O 2 + parent ion and O + fragment ion from neutral O 2 were obtained by a technique that eliminated the serious problem of identifying the true abundances of O + ions. These ions are generally formed with considerable kinetic energy and, because most mass spectrometers discriminate against energetic ions, true O + abundances are difficult to obtain. In the present work the relative cross sections for producing O + ions are obtained and normalized against the total cross sections in a spectral region where dissociative ionization is not possible. The fragmentation cross sections for O + were then obtained by subtraction of O 2 + cross sections from the known total photoionization cross sections. The results are compared with the previously published measurements. The absolute photoionization cross section of atomic oxygen sigma 8 /sub +/ was measured at 304 A. The actual number density of oxygen atoms within the ionization region was obtained by measuring the fraction of 0 2 molecules dissociated. This sigma/sub +/ at 304 angstrom was used to convert the relative photoinization cross sections, measured as a function of wavelength using a calibrated photodiode, to absolute cross sections. The results are compared with previous measurements and calculated cross sections. angstrom Rydberg series converging to the OII 4 P state was observed

Introduction to "PIQ"'s Special Ethics Section.

Science.gov (United States)

Hatcher, Tim

2003-01-01

Introduces "Performance Improvement Quarterly's" special section on ethics. The focus of this special section is to explore ethics and the field of human performance improvement in a broad sense by encouraging an examination of ethical concepts and responsibilities in the profession. This special section includes three critical views of…

Graphs of the cross sections in the Alternate Monte Carlo Cross Section library at the Los Alamos Scientific Laboratory

International Nuclear Information System (INIS)

Seamon, R.E.; Soran, P.D.

1980-06-01

Graphs of all neutron cross sections and photon production cross sections on the Alternate Monte Carlo Cross Section (AMCCS) library have been plotted along with local neutron heating numbers. The values of ν-bar, the average number of neutrons per fission, are also plotted for appropriate isotopes

[Caesarean section in german hospitals: validity of hospital quality report data for monitoring C-section rates].

Science.gov (United States)

Junghänel, K; Renz-Polster, H; Jarczok, M N; Hornemann, A; Böhler, T; De Bock, F

2015-04-01

It is not known if "hospital quality reports" (HQR) document Caesarean (C-) section rates at the hospital level accurately enough for use as a reliable data source when it comes to explaining regional variations of C-sections in Germany by factors at the hospital level. We aimed to answer this question using HQR from hospitals in Baden-Württemberg as data source. Diagnostic and procedure codes from HQR for the year 2008 (HQRdata), were used to calculate numbers of births, numbers of C-sections, and rates of births by C-section (CSR) for 94 of 97 hospitals in Baden-Württemberg. These numbers were compared to internal hospital (IH) data delivered upon request by 80 of 97 hospitals and stemming from vital statistics, birth registry forms, or external quality assurance datasets. There was no difference in the number of births between HQR data and IH data, but the number of C-sections and the CSR differed significantly (pCSR calculated using HQR data was 4.9 ± 17.9% higher than CSR from IH data (absolute difference 1.5 ± 5.8%). The correlation between the 2 data sources was moderate (r=0.73). Only 55% of the variance in IH data-based CSR was explained by HQR data. The proportion between highest and lowest CSR in hospitals in Baden-Württemberg was 4.9 for HQR data and 3.6 for IH data. There are significant and relevant differences between C-section rates based on ei-ther HQR or IH data. This questions routine data from HQR for 2008 as a reliable data source for research work. © Georg Thieme Verlag KG Stuttgart · New York.

ACHP | Section 3

Science.gov (United States)

. EO 13287 includes a number of actions that are intended to encourage better accounting, use Section 7 of the EO, the applicable definition of "historic properties" is the one found in the NHPA. Under that definition a "historic property" is "any prehistoric or historic

Differential cross sections and cross-section ratios for the electron-impact excitation of the neon 2p53s configuration

International Nuclear Information System (INIS)

Khakoo, M. A.; Wrkich, J.; Larsen, M.; Kleiban, G.; Kanik, I.; Trajmar, S.; Brunger, M.J.; Teubner, P.J.O.; Crowe, A.; Fontes, C.J.; Clark, R.E.H.; Zeman, V.; Bartschat, K.; Madison, D.H.; Srivastava, R.; Stauffer, A.D.

2002-01-01

Electron-impact differential cross-section measurements for the excitation of the 2p 5 3s configuration of Ne are reported. The Ne cross sections are obtained using experimental differential cross sections for the electron-impact excitation of the n=2 levels of atomic hydrogen [Khakoo et al., Phys. Rev. A 61, 012701-1 (1999)], and existing experimental helium differential cross-section measurements, as calibration standards. These calibration measurements were made using the method of gas mixtures (Ne and H followed by Ne and He), in which the gas beam profiles of the mixed gases are found to be the same within our experimental errors. We also present results from calculations of these differential cross sections using the R-matrix and unitarized first-order many-body theory, the distorted-wave Born approximation, and relativistic distorted-wave methods. Comparison with available experimental differential cross sections and differential cross-section ratios is also presented

Neutron-capture Cross Sections from Indirect Measurements

Energy Technology Data Exchange (ETDEWEB)

Escher, J E; Burke, J T; Dietrich, F S; Ressler, J J; Scielzo, N D; Thompson, I J

2011-10-18

Cross sections for compound-nuclear reactions play an important role in models of astrophysical environments and simulations of the nuclear fuel cycle. Providing reliable cross section data remains a formidable task, and direct measurements have to be complemented by theoretical predictions and indirect methods. The surrogate nuclear reactions method provides an indirect approach for determining cross sections for reactions on unstable isotopes, which are difficult or impossible to measure otherwise. Current implementations of the method provide useful cross sections for (n,f) reactions, but need to be improved upon for applications to capture reactions.

Neutron Cross Sections for Aluminium

Energy Technology Data Exchange (ETDEWEB)

Forsberg, Leif

1963-08-15

Total, elastic, inelastic, (n, 2n), (n, {alpha}), (n, p), and (n, {gamma}) cross sections for aluminium have been compiled from thermal to 100 MeV based upon literature search and theoretical interpolations and estimates. Differential elastic cross sections in the centre of mass system are represented by the Legendre coefficients. This method was chosen in order to obtain the best description of the energy dependence of the anisotropy.

National Variation in Caesarean Section Rates: A Cross Sectional Study in Ireland.

LENUS (Irish Health Repository)

Sinnott, Sarah-Jo

2016-01-01

Internationally, caesarean section (CS) rates are rising. However, mean rates of CS across providers obscure extremes of CS provision. We aimed to quantify variation between all maternity units in Ireland.

46 CFR Section 1 - Books of account.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Books of account. Section 1 Section 1 Shipping MARITIME... TRANSACTIONS UNDER AGENCY AGREEMENTS Accounts Section 1 Books of account. A separate set of books of account... agreement. The books of original entry and ledgers may be similar in design to those heretofore employed by...

The Levy sections theorem revisited

International Nuclear Information System (INIS)

Figueiredo, Annibal; Gleria, Iram; Matsushita, Raul; Silva, Sergio Da

2007-01-01

This paper revisits the Levy sections theorem. We extend the scope of the theorem to time series and apply it to historical daily returns of selected dollar exchange rates. The elevated kurtosis usually observed in such series is then explained by their volatility patterns. And the duration of exchange rate pegs explains the extra elevated kurtosis in the exchange rates of emerging markets. In the end, our extension of the theorem provides an approach that is simpler than the more common explicit modelling of fat tails and dependence. Our main purpose is to build up a technique based on the sections that allows one to artificially remove the fat tails and dependence present in a data set. By analysing data through the lenses of the Levy sections theorem one can find common patterns in otherwise very different data sets

The Levy sections theorem revisited

Science.gov (United States)

Figueiredo, Annibal; Gleria, Iram; Matsushita, Raul; Da Silva, Sergio

2007-06-01

This paper revisits the Levy sections theorem. We extend the scope of the theorem to time series and apply it to historical daily returns of selected dollar exchange rates. The elevated kurtosis usually observed in such series is then explained by their volatility patterns. And the duration of exchange rate pegs explains the extra elevated kurtosis in the exchange rates of emerging markets. In the end, our extension of the theorem provides an approach that is simpler than the more common explicit modelling of fat tails and dependence. Our main purpose is to build up a technique based on the sections that allows one to artificially remove the fat tails and dependence present in a data set. By analysing data through the lenses of the Levy sections theorem one can find common patterns in otherwise very different data sets.

Instrument ampersand controls section (IA) improvements

International Nuclear Information System (INIS)

Kramer, C.; Paul, J.

1993-01-01

This portion of the panel session briefly delineates improvements in the Instrument and Controls (IA) Section over the past few years. These improvements are listed briefly in summary form. The status of publication of the IA Section of AG-1 is reviewed

Polyphasic taxonomy of Aspergillus section Cervini

DEFF Research Database (Denmark)

Chen, A.J.; Varga, J.; Frisvad, Jens Christian

2016-01-01

Species belonging to Aspergillus section Cervini are characterised by radiate or short columnar, fawn coloured, uniseriate conidial heads. The morphology of the taxa in this section is very similar and isolates assigned to these species are frequently misidentified. In this study, a polyphasic...

Parametric equations for calculation of macroscopic cross sections

International Nuclear Information System (INIS)

Botelho, Mario Hugo; Carvalho, Fernando

2015-01-01

Neutronic calculations of the core of a nuclear reactor is one thing necessary and important for the design and management of a nuclear reactor in order to prevent accidents and control the reactor efficiently as possible. To perform these calculations a library of nuclear data, including cross sections is required. Currently, to obtain a cross section computer codes are used, which require a large amount of processing time and computer memory. This paper proposes the calculation of macroscopic cross section through the development of parametric equations. The paper illustrates the proposal for the case of macroscopic cross sections of absorption (Σa), which was chosen due to its greater complexity among other cross sections. Parametric equations created enable, quick and dynamic way, the determination of absorption cross sections, enabling the use of them in calculations of reactors. The results show efficient when compared with the absorption cross sections obtained by the ALPHA 8.8.1 code. The differences between the cross sections are less than 2% for group 2 and less than 0.60% for group 1. (author)

Neutron-capture cross sections from indirect measurements

Directory of Open Access Journals (Sweden)

Scielzo N.D.

2012-02-01

Full Text Available Cross sections for compound-nuclear reactions reactions play an important role in models of astrophysical environments and simulations of the nuclear fuel cycle. Providing reliable cross section data remains a formidable task, and direct measurements have to be complemented by theoretical predictions and indirect methods. The surrogate nuclear reactions method provides an indirect approach for determining cross sections for reactions on unstable isotopes, which are difficult or impossible to measure otherwise. Current implementations of the method provide useful cross sections for (n,f reactions, but need to be improved upon for applications to capture reactions.

Curves and tables of neutron cross sections

International Nuclear Information System (INIS)

Nakagawa, Tsuneo; Asami, Tetsuo; Yoshida, Tadashi

1990-07-01

Neutron cross-section curves from the Japanese Evaluated Nuclear Data Library version 3, JENDL-3, are presented in both graphical and tabular form for users in a wide range of application areas in the nuclear energy field. The contents cover cross sections for all the main reactions induced by neutrons with an energy below 20 MeV including; total, elastic scattering, capture, and fission, (n,n'), (n,2n), (n,3n), (n,α), (n,p) reactions. The 2200 m/s cross-section values, resonance integrals, and Maxwellian- and fission-spectrum averaged cross sections are also tabulated. (author)

Group cross-section processing method and common nuclear group cross-section library based on JENDL-3 nuclear data file

International Nuclear Information System (INIS)

Hasegawa, Akira

1991-01-01

A common group cross-section library has been developed in JAERI. This system is called 'JSSTDL-295n-104γ (neutron:295 gamma:104) group constants library system', which is composed of a common 295n-104γ group cross-section library based on JENDL-3 nuclear data file and its utility codes. This system is applicable to fast and fusion reactors. In this paper, firstly outline of group cross-section processing adopted in Prof. GROUCH-G/B system is described in detail which is a common step for all group cross-section library generation. Next available group cross-section libraries developed in Japan based on JENDL-3 are briefly reviewed. Lastly newly developed JSSTDL library system is presented with some special attention to the JENDL-3 data. (author)

Operationsteknikker ved section

DEFF Research Database (Denmark)

Aabakke, Anna J M; Secher, Niels Jørgen; Krebs, Lone

2014-01-01

Caesarean section (CS) is a common surgical procedure, and in Denmark 21% of deliveries is by CS. There is an increasing amount of scientific evidence to support the different surgical techniques used at CS. This article reviews the literature regarding CS techniques. There is still a lack of evi...

Atlas of photoneutron cross sections obtained with monoenergetic photons

International Nuclear Information System (INIS)

Dietrich, S.S.; Berman, B.L.

1988-01-01

Photoneutron cross-section and integrated cross-section data obtained with monoenergetic photons are presented in a uniform format. All of the measured partial photoneutron cross sections, the total photoneutron cross section, and the photoneutron yield cross section are plotted as functions of the incident photon energy, as are the integrated photoneutron cross sections and their first and second moments. The values of the integrated cross sections and the moments of the integrated total cross section up to the highest photon energy for which they were measured are tabulated, as are the parameters of Lorentz curves fitted to the total photoneutron cross-section data for medium and heavy nuclei (A>50). This compilation is current as of June 1987. copyright 1988 Academic Press, Inc

Fluoroscopic tomography. [for body section synthesis

Science.gov (United States)

Baily, N. A.; Crepeau, R. L.; Lasser, E. C.

1974-01-01

A fluoroscopic tomography system capable of synthesizing body sections at a number of levels within the body has been developed. The synthesized body sections may lie either in a range of planes parallel to, tilted with respect to, skewed with respect to, or both tilted and skewed with respect to the plane of motion of the X-ray tube target. In addition, body sections can be presented which are contoured to the patient's anatomy. That is to say, they may even encompass such complex surfaces as a quadratic hyperplane. In addition, tomograms of organs in motion can be imaged.

High ET jet cross sections at CDF

International Nuclear Information System (INIS)

Flaugher, B.

1996-08-01

The inclusive jet cross section for p anti p collisions at √s = 1.8 TeV as measured by the CDF collaboration will be presented. Preliminary CDF measurements of the Σ E T cross section at √s = 1.8 TeV and the central inclusive jet cross section at √s = 0.630 TeV will also be shown

Technical advances in the sectioning of dental tissue and of on-section cross-linked collagen detection in mineralized teeth.

Science.gov (United States)

Singhrao, Sim K; Sloan, Alastair J; Smith, Emma L; Archer, Charles W

2010-08-01

Immunohistochemical detection of cross-linked fibrillar collagens in mineralized tissues is much desired for exploring the mechanisms of biomineralization in health and disease. Mineralized teeth are impossible to section when embedded in conventional media, thus limiting on-section characterization of matrix proteins by immunohistochemistry. We hypothesized that by using an especially formulated acrylic resin suitable for mineralized dental tissues, not only sectioning of teeth would be possible, but also our recently developed immunofluorescence labeling technique would be amenable to fully calcified tissues for characterization of dentinal fibrillar collagens, which remains elusive. The hypothesis was tested on fixed rodent teeth embedded in Technovit 9100 New. It was possible to cut thin (1 mum) sections of mineralized teeth, and immunofluorescence characterization of cross-linked type I fibrillar collagen was selected due to its abundance in dentine. Decalcified samples of teeth embedded in paraffin wax were also used to compare immunolabeling from either method using the same immunoreagents in equivalent concentrations. In the decalcified tissue sections, type I collagen labeling in the dentine along the tubules was "patchy" and the signal in the predentine was very weak. However, enhanced signal in mineralized samples with type I collagen was detected not only in the predentine but also at the limit between intertubular dentine, within the elements of the enamel organ and subgingival stroma. This report offers advances in sectioning mineralized dental tissues and allows the application of immunofluorescence not only for on-section protein detection but importantly for detecting cross-linked fibrous collagens in both soft and mineralized tissue sections.

Activation cross section and isomeric cross section ratios for the (n ,2 n ) reaction on 153Eu

Science.gov (United States)

Luo, Junhua; Jiang, Li; Li, Suyuan

2017-10-01

The 153Eu(n ,2 n ) m1,m2,g152Eu cross section was measured by means of the activation technique at three neutron energies in the range 13-15 MeV. The quasimonoenergetic neutron beam was formed via the 3H(d ,n ) 4He reaction, in the Pd-300 Neutron Generator at the Chinese Academy of Engineering Physics (CAEP). The activities induced in the reaction products were measured using high-resolution γ-ray spectroscopy. The cross section of the population of the second high-spin (8-) isomeric state was measured along with the reaction cross section populating both the ground (3-) and the first isomeric state (0-). Cross sections were also evaluated theoretically using the numerical code TALYS-1.8, with different level density options at neutron energies varying from the reaction threshold to 20 MeV. Results are discussed and compared with the corresponding literature.

Rectangular-section mirror light pipes

Energy Technology Data Exchange (ETDEWEB)

Swift, P.D.; Lawlor, R. [School of Physical Sciences, Dublin City University, Dublin 9 (Ireland); Smith, G.B.; Gentle, A. [Department of Applied Physics, University of Technology, Sydney, Broadway, NSW 2007 (Australia)

2008-08-15

Using an integrated-ray approach an expression for the transmission of rectangular section mirror light pipe (MLP) has been derived for the case of collimated light input. The transmittance and the irradiance distribution at the exit aperture of rectangular-section MLPs have been measured experimentally and calculated theoretically for the case of collimated light input. The results presented extend the description of MLPs from the cylindrical case. Measured and calculated transmittances and irradiance distributions are in good agreement. (author)

Diversité de Ralstonia Solanacearum au Cameroun et bases génétiques de la résistance chez le piment (Capsicum Annuum) et les Solanacées

OpenAIRE

Mahbou-Somo-Toukam , Gabriel

2010-01-01

The knowledge of genetic diversity of R. solanacearum as well as the knowledge of genetic determinism of pepper resistance are critical for elaborating a strategy against this ubiquist bacterium. They will facilitate the choice and direction of fighting methods and the development of well adapted tools for quarantine measures. In a modern approach of genetics more and more based on plant models, Solanaceaes occupy a place of pioneer. On another hand the emerging breakdown of resistances seems...

Comparative Characterization of the Leaf Tissue of Physalis alkekengi and Physalis peruviana Using RNA-seq and Metabolite Profiling

OpenAIRE

Fukushima, Atsushi; Nakamura, Michimi; Suzuki, Hideyuki; Yamazaki, Mami; Knoch, Eva; Mori, Tetsuya; Umemoto, Naoyuki; Morita, Masaki; Hirai, Go; Sodeoka, Mikiko; Saito, Kazuki

2016-01-01

The genus Physalis in the Solanaceae family contains several species of benefit to humans. Examples include P. alkekengi (Chinese-lantern plant, hôzuki in Japanese) used for medicinal and for decorative purposes, and P. peruviana, also known as Cape gooseberry, which bears an edible, vitamin-rich fruit. Members of the Physalis genus are a valuable resource for phytochemicals needed for the development of medicines and functional foods. To fully utilize the potential of these phytochemicals we...

2010 ANNUAL MEETING ON NUCLEAR TECHNOLOGY. Pt. 4. Section reports

International Nuclear Information System (INIS)

Berlepsch, Thilo v.; Hering, Wolfgang

2011-01-01

Summary report on 2 Sessions of Section: - New Build and Innovations (Section 12) of the ANNUAL MEETING On NUCLEAR TECHNOLOGY held in Berlin on May 4 to 6, 2010. The other Sections 'Reactor Physics and Methods of Calculation (Section 1)', 'Thermodynamics and Fluid Dynamics (Section 2)', 'Safety of Nuclear Installations - Methods, Analysis, Results (Section 3)', 'Front End and Back End of the Fuel Cycle, Radioactive Waste, Storage (Section 4)', 'Front End of the Fuel Cycle, Fuel Elements and Core Components (Section 5)', 'Operation of Nuclear Installations (Section 6)', 'Decommissioning of Nuclear Installations (Section 7)', 'Fusion Technology (Section 8)', 'Energy Industry and Economics (Section 10)', 'Radiation Protection (Section 11)', 'New Build and Innovations (Session New Build and Innovations, Section 12)', and 'Education, Expert Knowledge, Know-how-Transfer (Section 13)' have been covered in atw issues 10, 11 and 12 (2010). (orig.)

The Golden Section.

Science.gov (United States)

Runion, Garth E.

The Golden Section, also known as the "Golden Mean" and the "Divine Proportion," is a ratio found in art and nature that has mathematical properties. This book explores these geometric and algebraic properties in a variety of activities. Construction problems, designs using the pentagon and pentagram, and opportunities to work…

Cross-Sectional Analysis of Longitudinal Mediation Processes.

Science.gov (United States)

O'Laughlin, Kristine D; Martin, Monica J; Ferrer, Emilio

2018-01-01

Statistical mediation analysis can help to identify and explain the mechanisms behind psychological processes. Examining a set of variables for mediation effects is a ubiquitous process in the social sciences literature; however, despite evidence suggesting that cross-sectional data can misrepresent the mediation of longitudinal processes, cross-sectional analyses continue to be used in this manner. Alternative longitudinal mediation models, including those rooted in a structural equation modeling framework (cross-lagged panel, latent growth curve, and latent difference score models) are currently available and may provide a better representation of mediation processes for longitudinal data. The purpose of this paper is twofold: first, we provide a comparison of cross-sectional and longitudinal mediation models; second, we advocate using models to evaluate mediation effects that capture the temporal sequence of the process under study. Two separate empirical examples are presented to illustrate differences in the conclusions drawn from cross-sectional and longitudinal mediation analyses. Findings from these examples yielded substantial differences in interpretations between the cross-sectional and longitudinal mediation models considered here. Based on these observations, researchers should use caution when attempting to use cross-sectional data in place of longitudinal data for mediation analyses.

Recommended evaluation procedure for photonuclear cross section

Energy Technology Data Exchange (ETDEWEB)

Lee, Young-Ouk; Chang, Jonghwa; Fukahori, Tokio [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

1998-03-01

In order to generate photonuclear cross section library for the necessary applications, data evaluation is combined with theoretical evaluation, since photonuclear cross sections measured cannot provide all necessary data. This report recommends a procedure consisting of four steps: (1) analysis of experimental data, (2) data evaluation, (3) theoretical evaluation and, if necessary, (4) modification of results. In the stage of analysis, data obtained by different measurements are reprocessed through the analysis of their discrepancies to a representative data set. In the data evaluation, photonuclear absorption cross sections are evaluated via giant dipole resonance and quasi-deutron mechanism. With photoabsorption cross sections from the data evaluation, theoretical evaluation is applied to determine various decay channel cross sections and emission spectra using equilibrium and preequilibrium mechanism. After this, the calculated results are compared with measured data, and in some cases the results are modified to better describe measurements. (author)

Datura inoxia Mill. (Solanaceae, a new alien species in Serbia

Directory of Open Access Journals (Sweden)

Lakušić, D.

2017-09-01

Full Text Available As ornamental plant originated from Central America, Datura inoxia Mill. has been introduced to many areas beyond its natural range. However, in many places, mainly in the Mediterranean region D. inoxia has escaped from cultivation and is being established as an alien. In relevant botanical literature its occurrence on the Balkan Peninsula has not been reported for Albania, Bosnia & Herzegovina, Macedonia (FYROM and Serbia. Based on our field and herbarium studies, we have found that D. inoxia is also present in Serbia, both as cultivated ornamental plant, but as well as an escape, with established populations. We have registered this species in 23 localities in Srem, Bačka, Banat, Šumadija and NE Serbia regions, which are situated in 16 UTM 10 km x 10 km squares. Most of the findings (16 localities refer to a small group of individuals which are cultivated, while the remaining seven relate to plants that have escaped from cultivation and have established small wild populations in the surrounding ruderal habitats, edges of natural or planted forest, waste and arable fields. Although we have registered only seven small groups of individuals that have escaped from cultivation, due to its capacity to invade natural habitats D. inoxia can be considered as potential threat for natural biodiversity in Serbia.

Breeding systems in some representatives of the genus Lycium (Solanaceae

Directory of Open Access Journals (Sweden)

L. Minne

1994-10-01

Full Text Available The development of the ovule and the embryo sac of five of the 17 species of Lycium and of one hybrid, recorded for southern Africa, was investigated. All specimens of four of the species and the hybrid (between a hermaphroditic and a functionally dioecious species were found to be functionally dioecious: they express only one sex, although both male and female organs are present in the same tlower. One species was hermaphroditic. The embryo sacs of all species, and of the hybrid, were of the normal eight-nucleate Polygonum type. The structure of the ovary and the development of the embryo sac are similar to those of L europaeum L. The absence of unreduced embryo sacs indicates that apomixis does not occur at any ploidy level in the species studied.

The evolution of chili peppers (Capsicum-Solanaceae): a cytogenetic perspective

Science.gov (United States)

Capsicum (chili peppers) is a New World genus with five crop species of great economic importance for food and spices. An up-to-date summary of the karyotypic knowledge is presented, including data on classical staining (chromosome number, size and morphology), silver impregnation (number and positi...

Effects of ionizing radiation on Capsicum baccatum var. pendulum (Solanaceae)

International Nuclear Information System (INIS)

Scaldaferro, M.A.; Prina, A.R.; Moscone, E.A.; Kwasniewska, J.

2013-01-01

Cytogenetic and somatic effects of various x-ray treatments were evaluated in pepper, Capsicum baccatum var. pendulum cv. “Cayenne”, with the aim to assess optimal conditions for obtaining viable lines. The cytogenetic effects were quantified by counting chromosome aberrations. The level of DNA fragmentation was estimated with TUNEL test (terminal transferase mediated dUTP-fluorescein nick end labeling). Irradiation to 20 Gy with 16-h presoaking can be a suitable treatment of the selected pepper cultivar for a mutagenesis program. - Highlights: • Cytogenetic and somatic effects of x-rays treatments in Capsicum were evaluated. • Frequencies of chromosome aberrations correlated with radiation doses. • Highest frequency of chromosome aberrations occurred with 20 Gy+soaking seeds. • In TUNEL test, the nuclei with DNA fragmentation were higher than in the control. • The strongest effects were observed with doses of 300 Gy or 20 Gy after soaking

Listado anotado de Solanum L. (Solanaceae) en el Perú

DEFF Research Database (Denmark)

Särkinen, Tiina; Baden, Maria; Gonzáles, Paúl

2015-01-01

), and Canta and Huarochirí (Lima). Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca), Santiago de Chuco (La Libertad), Oxapampa (Pasco), and Cusco (Cusco). Current diversity patterns are highly correlated with collection...

Recommended activation detector cross sections (RNDL-82)

International Nuclear Information System (INIS)

Bondars, Kh.Ya.; Lapenas, A.A.

1984-01-01

The results of the comparison between measured and calculated average cross sections in 5 benchmark experiments are presented. Calculations have been based on the data from 10 libraries of evaluated cross sections. The recommended library (RNDL-82) of the activation detector cross sections has been created on the basis of the comparison. RNDL-82, including 26 reactions, and the basic characteristics of the detectors are presented. (author)

Radiation Protection Section (SC/SL/RP)

CERN Document Server

2006-01-01

We should like to inform you that the Radiation Protection Section (SC/SL/RP) located on the Prévessin site has moved from Building 865 (ground floor) to new premises in Wing A of Building 892 (second floor). Telephone numbers remain the same. SC/SL/RP section

Accurate Cross Sections for Microanalysis

OpenAIRE

Rez, Peter

2002-01-01

To calculate the intensity of x-ray emission in electron beam microanalysis requires a knowledge of the energy distribution of the electrons in the solid, the energy variation of the ionization cross section of the relevant subshell, the fraction of ionizations events producing x rays of interest and the absorption coefficient of the x rays on the path to the detector. The theoretical predictions and experimental data available for ionization cross sections are limited mainly to K shells of a...

29 CFR Section 1607.16 - Definitions.

Science.gov (United States)

2010-07-01

.... Job analysis. A detailed statement of work behaviors and other information relevant to the job. L. Job description. A general statement of job duties and responsibilities. M. Knowledge. A body of information... of performance on the job. See section 5B and section 14C. E. Construct validity. Demonstrated by...

Activation cross section and isomeric cross-section ratio for the (n,2n) reaction on {sup 132,134}Ba

Energy Technology Data Exchange (ETDEWEB)

Luo, Junhua [Hexi Univ., Zhangye (China). School of Physics and Electromechanical Engineering; Hexi Univ., Zhangye (China). Inst. of New Energy; Wu, Chunlei; Jiang, Li [Chinese Academy of Engineering Physics, Mianyang (China). Inst. of Nuclear Physics and Chemistry; Li, Suyuan [Hexi Univ., Zhangye (China). Inst. of New Energy

2017-07-01

Cross sections of the {sup 132}Ba(n,2n){sup 131m,g}Ba and {sup 134}Ba(n,2n){sup 133m,g}Ba reactions and their isomeric cross section ratios σ{sub m}/σ{sub g} have been measured by means of the activation technique at three neutron energies in the range 13-15 MeV. BaCO{sub 3} samples and Nb monitor foils were activated together to determine the reaction cross section and the incident neutron flux. The quasimonoenergetic neutrons beam were produced via the {sup 3}H(d,n){sup 4}He reaction at the Pd-300 Neutron Generator of the Chinese Academy of Engineering Physics (CAEP). The activities induced in the reaction products were measured using high-resolution γ ray spectroscopy. The pure cross section of the ground-state was derived from the absolute cross section of the metastable state and the residual nuclear decay analysis. Cross sections were also evaluated theoretically using the numerical nuclear model code, TALYS-1.8 with different level density options at neutron energies varying from the reaction threshold to 20 MeV. Results are discussed and compared with the corresponding literature.

Comparative analysis among several cross section sets

International Nuclear Information System (INIS)

Caldeira, A.D.

1983-01-01

Critical parameters were calculated using the one dimensional multigroup transport theory for several cross section sets. Calculations have been performed for water mixtures of uranium metal, plutonium metal and uranium-thorium oxide, and for metallics systems, to determine the critical dimensions of geometries (sphere and cylinder). For this aim, the following cross section sets were employed: 1) multigroup cross section sets obtained from the GAMTEC-II code; 2) the HANSEN-ROACH cross section sets; 3) cross section sets from the ENDF/B-IV, processed by the NJOY code. Finally, we have also calculated the corresponding critical radius using the one dimensional multigroup transport DTF-IV code. The numerical results agree within a few percent with the critical values obtained in the literature (where the greatest discrepancy occured in the critical dimensions of water mixtures calculated with the values generated by the NJOY code), a very good results in comparison with similar works. (Author) [pt

Fission cross section measurements at intermediate energies

International Nuclear Information System (INIS)

Laptev, Alexander

2005-01-01

The activity in intermediate energy particle induced fission cross-section measurements of Pu, U isotopes, minor actinides and sub-actinides in PNPI of Russia is reviewed. The neutron-induced fission cross-section measurements are under way in the wide energy range of incident neutrons from 0.5 MeV to 200 MeV at the GNEIS facility. In number of experiments at the GNEIS facility, the neutron-induced fission cross sections were obtained for many nuclei. In another group of experiments the proton-induced fission cross-section have been measured for proton energies ranging from 200 to 1000 MeV at 100 MeV intervals using the proton beam of PNPI synchrocyclotron. (author)

Convex bodies with many elliptic sections

OpenAIRE

Arelio, Isaac; Montejano, Luis

2014-01-01

{We show in this paper that two normal elliptic sections through every point of the boundary of a smooth convex body essentially characterize an ellipsoid and furthermore, that four different pairwise non-tangent elliptic sections through every point of the $C^2$-differentiable boundary of a convex body also essentially characterize an ellipsoid.

Dielectronic recombination cross sections for H-like ions

International Nuclear Information System (INIS)

Pindzola, M.S.; Badnell, N.R.; Griffin, D.C.

1990-01-01

Dielectronic recombination cross sections for several H-like atomic ions are calculated in an isolated-resonance, distorted-wave approximation. Fine-structure and configuration-interaction effects are examined in detail for the O 7+ cross section. Hartree-Fock, intermediate-coupled, multiconfiguration dielectronic recombination cross sections for O 7+ are then compared with the recent experimental measurements obtained with the Test Storage Ring in Heidelberg. The cross-section spectra line up well in energy and the shape of the main resonance structures are comparable. The experimental integrated cross sections differ by up to 20% from theory, but this may be due in part to uncertainties in the electron distribution function

Spanwise transition section for blended wing-body aircraft

Science.gov (United States)

Hawley, Arthur V. (Inventor)

1999-01-01

A blended wing-body aircraft includes a central body, a wing, and a transition section which interconnects the body and the wing on each side of the aircraft. The two transition sections are identical, and each has a variable chord length and thickness which varies in proportion to the chord length. This enables the transition section to connect the thin wing to the thicker body. Each transition section has a negative sweep angle.

Floodplain Cross Section Lines

Data.gov (United States)

Department of Homeland Security — This table is required for any Digital Flood Insurance Rate Map database where cross sections are shown on the Flood Insurance Rate Map (FIRM). Normally any FIRM...

Combustor Section Acoustic Test

National Research Council Canada - National Science Library

Swanson, Andrew

2003-01-01

.... Following successful coupon and subelement tests on laser welding of Inco 625 heat exchangers, a full-scale scramjet flowpath section was fabricated to more realistically demonstrate the viability of the design concept...

Plants used in the treatment of leishmanial ulcers due to Leishmania (Viannia braziliensis in an endemic area of Bahia, Brazil

Directory of Open Access Journals (Sweden)

Flávio França

1996-06-01

Full Text Available This paper records the plants used in the treatment of cutaneous leishmaniasis due to Leishmania (Viannia braziliensis (L(Vb among the rural population of a cocoa- producing coastal area of Bahia state, Brazil. An enquiry conducted among a hundred patients identified 49 plant species used to treat skin ulceration caused by this Leishmania species. The principal plants used are caju-branco (Anacardium occidentale - Anacardiaceae, used by 65% of the population, folha-fogo (Clidemia hirta - Melastomataceae 39%, alfavaca-grossa (Plectranthus amboinicus - Lamiaceae 33%, mastruz (Chenopodium ambrosioides - Chenopodiaceae 31%, erva-de-santa-maria (Solatium americanum - Solanaceae (25% and transagem (Plantago major - Plantaginaceae. 2%.Este trabalho relata as plantas usadas no tratamento da leishmaniose cutânea, causada por Leishmania (Viannia braziliensis (L(Vb, na população rural da faixa litorânea produtora de cacau do estado da Bahia, Brasil. Um inquérito realizado entre 100 pacientes, identificou 49 espécies de plantas usadas para tratar úlceras de pele causadas por esta espécie de Leishmânia. As principais plantas usadas foram o cajueiro-branco (Anacardium occidentale - Anacardiaceae usado por 65% da população, a folha-fogo (Clidemia hirta - Melastomataceae 39%, a alfavaca-grossa (Plectranthus amboinicus - Lamiaceae 33%, o mastruz (Chenopodium ambrosioides - henopodiaceae 31%, a erva-de-santa-maria (Solanum americanum - Solanaceae 25% e a transagem (Plantago major - Plantaginaceae 2%.

Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

Directory of Open Access Journals (Sweden)

Yonghai Fan

2017-12-01

Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

Maternal and Fetal Outcome in Elective versus Emergency Cesarean Section

Directory of Open Access Journals (Sweden)

Anupama Suwal

2013-12-01

Results: The incidence of cesarean section was 254 (22.30% out of which emergency cesarean section accounted for 167 (65.7% and elective cesarean section for 87 (34.3%. The usual indications of emergency cesarean section were fetal distress, previous cesarean section in labour, non progress of labour and prolonged second stage of labour. The usual indications of elective cesarean section were previous cesarean section, breech, cephalopelvic disproportion and cesarean section on demand. There was found to be no significant difference in age, period of gestation, blood loss and blood transfusion in emergency vs. elective cesarean section. There was significant difference seen in the length of hospital stay, fever, urinary tract infection, wound infection and low APGAR in five minutes indicating that these were more common in emergency cesarean section. Significant difference was also seen in the incidence of postpartum haemorrhage indicating that it was seen more in elective cesarean section. Conclusions: The incidence of cesarean section in Nepal Medical College Teaching Hospital is high and the overall complication rate is higher in emergency cesarean section than in elective cesarean section. Keywords: cesarean section; fetal and maternal outcome.

Compilation of cross-sections. Pt. 1

International Nuclear Information System (INIS)

Flaminio, V.; Moorhead, W.G.; Morrison, D.R.O.; Rivoire, N.

1983-01-01

A compilation of integral cross-sections for hadronic reactions is presented. This is an updated version of CERN/HERA 79-1, 79-2, 79-3. It contains all data published up to the beginning of 1982, but some more recent data have also been included. Plots of the cross-sections versus incident laboratory momentum are also given. (orig.)

Compilation of cross-sections. Pt. 4

International Nuclear Information System (INIS)

Alekhin, S.I.; Ezhela, V.V.; Lugovsky, S.B.; Tolstenkov, A.N.; Yushchenko, O.P.; Baldini, A.; Cobal, M.; Flaminio, V.; Capiluppi, P.; Giacomelli, G.; Mandrioli, G.; Rossi, A.M.; Serra, P.; Moorhead, W.G.; Morrison, D.R.O.; Rivoire, N.

1987-01-01

This is the fourth volume in our series of data compilations on integrated cross-sections for weak, electromagnetic, and strong interaction processes. This volume covers data on reactions induced by photons, neutrinos, hyperons, and K L 0 . It contains all data published up to June 1986. Plots of the cross-sections versus incident laboratory momentum are also given. (orig.)

Assembling the LHC short straight sections

CERN Document Server

Maximilien Brice

2005-01-01

The building where the short straight sections are being assembled, was often called ‘Lego Land’ by the workers because of the wide variety of sets of magnets and cryostats. Short straight sections contain magnets for manipulating the beam inside cryostats with liquid helium to keep the magnets at a cool 1.9 K (-271.3°C).

Solid oxide fuel cell power plant having a fixed contact oxidation catalyzed section of a multi-section cathode air heat exchanger

Science.gov (United States)

Saito, Kazuo; Lin, Yao

2015-02-17

The multi-section cathode air heat exchanger (102) includes at least a first heat exchanger section (104), and a fixed contact oxidation catalyzed section (126) secured adjacent each other in a stack association. Cool cathode inlet air flows through cool air channels (110) of the at least first (104) and oxidation catalyzed sections (126). Hot anode exhaust flows through hot air channels (124) of the oxidation catalyzed section (126) and is combusted therein. The combusted anode exhaust then flows through hot air channels (112) of the first section (104) of the cathode air heat exchanger (102). The cool and hot air channels (110, 112) are secured in direct heat exchange relationship with each other so that temperatures of the heat exchanger (102) do not exceed 800.degree. C. to minimize requirements for using expensive, high-temperature alloys.

Use of frozen section in genitourinary pathology.

Science.gov (United States)

Shen, Steven S; Truong, Luan D; Ro, Jae Y; Ayala, Alberto G

2012-08-01

Frozen section diagnosis provides critical information for immediate surgical management decision making. Over the last several years, there have been some significant advances in treatment of genitourinary cancer, particularly with regard to surgical techniques. These changes in turn impact the type and frequency of intraoperative frozen section requests. In this review, we describe the main indications and diagnostic challenges of frozen section diagnosis during surgeries of each genitourinary organ system including prostate, kidney, bladder, testis, and penis. The pitfalls and approaches to different diagnostic situations are discussed. It is also stressed that pathologists must not only be familiar with the histological diagnosis, but also understand the limitations of frozen section diagnosis and communicate with urologists during the intraoperative treatment decision making process.

Transition section for acoustic waveguides

International Nuclear Information System (INIS)

Karplus, H.H.B.

1975-01-01

A means of facilitating the transmission of acoustic waves with minimal reflection between two regions having different specific acoustic impedances is described comprising a region exhibiting a constant product of cross-sectional area and specific acoustic impedance at each cross-sectional plane along the axis of the transition region. A variety of structures that exhibit this feature is disclosed, the preferred embodiment comprising a nested structure of doubly reentrant cones. This structure is useful for monitoring the operation of nuclear reactors in which random acoustic signals are generated in the course of operation

Classical scattering cross section in sputtering transport theory

International Nuclear Information System (INIS)

Zhang Zhulin

2002-01-01

For Lindhard scaling interaction potential scattering commonly used in sputtering theory, the authors analyzed the great difference between Sigmund's single power and the double power cross sections calculated. The double power cross sections can give a much better approximation to the Born-Mayer scattering in the low energy region (m∼0.1). In particular, to solve the transport equations by K r -C potential interaction given by Urbassek few years ago, only the double power cross sections (m∼0.1) can yield better approximate results for the number of recoils. Therefore, the Sigmund's single power cross section might be replaced by the double power cross sections in low energy collision cascade theory

Volcanology Section Bulletin. French Geologic Society; Bulletin de la Section de Volcanologie. Societe Geologique de France

Energy Technology Data Exchange (ETDEWEB)

Boudon, G [I.P.G.P. - Observatoire Volcanologique, 75 - Paris (France); Gourgaud, A [Universite Blaise Pascal, 63 - Clermont Ferrand (France); Soler, E [Universite Paris 6, Paris (France)

1997-12-31

This issue of the Volcanology Section Bulletin is a compilation of abstracts from the meeting the section of April, 2 1996 about the active volcanism of Central America and Mexico. The abstracts selected in this issue report on measurements of uranium, thorium and radium isotopes disequilibrium in lava, and radon fluctuations in volcanic gases. One abstract reports on new {sup 14}C datings on avalanche debris. (J.S.).

Volcanology Section Bulletin. French Geologic Society; Bulletin de la Section de Volcanologie. Societe Geologique de France

Energy Technology Data Exchange (ETDEWEB)

Boudon, G. [I.P.G.P. - Observatoire Volcanologique, 75 - Paris (France); Gourgaud, A. [Universite Blaise Pascal, 63 - Clermont Ferrand (France); Soler, E. [Universite Paris 6, Paris (France)

1996-12-31

This issue of the Volcanology Section Bulletin is a compilation of abstracts from the meeting the section of April, 2 1996 about the active volcanism of Central America and Mexico. The abstracts selected in this issue report on measurements of uranium, thorium and radium isotopes disequilibrium in lava, and radon fluctuations in volcanic gases. One abstract reports on new {sup 14}C datings on avalanche debris. (J.S.).

Broad ion beam serial section tomography

Energy Technology Data Exchange (ETDEWEB)

Winiarski, B., E-mail: b.winiarski@manchester.ac.uk [School of Materials, University of Manchester, Manchester M13 9PL (United Kingdom); Materials Division, National Physical Laboratory, Teddington TW11 0LW (United Kingdom); Gholinia, A. [School of Materials, University of Manchester, Manchester M13 9PL (United Kingdom); Mingard, K.; Gee, M. [Materials Division, National Physical Laboratory, Teddington TW11 0LW (United Kingdom); Thompson, G.E.; Withers, P.J. [School of Materials, University of Manchester, Manchester M13 9PL (United Kingdom)

2017-01-15

Here we examine the potential of serial Broad Ion Beam (BIB) Ar{sup +} ion polishing as an advanced serial section tomography (SST) technique for destructive 3D material characterisation for collecting data from volumes with lateral dimensions significantly greater than 100 µm and potentially over millimetre sized areas. Further, the associated low level of damage introduced makes BIB milling very well suited to 3D EBSD acquisition with very high indexing rates. Block face serial sectioning data registration schemes usually assume that the data comprises a series of parallel, planar slices. We quantify the variations in slice thickness and parallelity which can arise when using BIB systems comparing Gatan PECS and Ilion BIB systems for large volume serial sectioning and 3D-EBSD data acquisition. As a test case we obtain 3D morphologies and grain orientations for both phases of a WC-11%wt. Co hardmetal. In our case we have carried out the data acquisition through the manual transfer of the sample between SEM and BIB which is a very slow process (1–2 slice per day), however forthcoming automated procedures will markedly speed up the process. We show that irrespective of the sectioning method raw large area 2D-EBSD maps are affected by distortions and artefacts which affect 3D-EBSD such that quantitative analyses and visualisation can give misleading and erroneous results. Addressing and correcting these issues will offer real benefits when large area (millimetre sized) automated serial section BIBS is developed. - Highlights: • In this work we examine how microstructures can be reconstructed in three-dimensions (3D) by serial argon broad ion beam (BIB) milling, enabling much larger volumes (>250×250×100µm{sup 3}) to be acquired than by serial section focused ion beam-scanning electron microscopy (FIB-SEM). • The associated low level of damage introduced makes BIB milling very well suited to 3D-EBSD acquisition with very high indexing rates. • We explore

Cross section data for ionization of important cyanides

International Nuclear Information System (INIS)

Kaur, Jaspreet; Antony, Bobby

2015-01-01

Highlights: • Multi centre spherical complex optical potential formalism used to find the CS. • Effective method (CSP-ic) to derive ionization contribution from inelastic CS. • Result shows excellent accord with previous results and consistent behaviour. • Maiden attempt to find CS for many cyanide molecules. • Strong correlation observed between peak of ionization with target properties. - Abstract: This article presents cross section calculations for interactions of important cyanides with electrons possessing energies beginning from ionization threshold of the target molecule to 5 keV. These data are pursued to meet the ever increasing demand for cross sections by the relevant atomic and molecular community for modelling astrophysical, atmospheric and technological domains. The calculations have been executed using an amalgam of multi centre spherical complex optical potential (MSCOP) formalism and complex scattering potential-ionization contribution (CSP-ic) method. Cross sections are compared with experimental and theoretical data wherever available. Strong correlations are observed for the cross sections which affirms consistent and reliable cross sections. Isomeric effect has been interpreted using variation of cross section with structure and target properties. Our cross sections will be tabulated in atomic collision database for use in modelling various statistical and dynamical quantities.

Cross section data for ionization of important cyanides

Energy Technology Data Exchange (ETDEWEB)

Kaur, Jaspreet; Antony, Bobby, E-mail: bka.ism@gmail.com

2015-11-15

Highlights: • Multi centre spherical complex optical potential formalism used to find the CS. • Effective method (CSP-ic) to derive ionization contribution from inelastic CS. • Result shows excellent accord with previous results and consistent behaviour. • Maiden attempt to find CS for many cyanide molecules. • Strong correlation observed between peak of ionization with target properties. - Abstract: This article presents cross section calculations for interactions of important cyanides with electrons possessing energies beginning from ionization threshold of the target molecule to 5 keV. These data are pursued to meet the ever increasing demand for cross sections by the relevant atomic and molecular community for modelling astrophysical, atmospheric and technological domains. The calculations have been executed using an amalgam of multi centre spherical complex optical potential (MSCOP) formalism and complex scattering potential-ionization contribution (CSP-ic) method. Cross sections are compared with experimental and theoretical data wherever available. Strong correlations are observed for the cross sections which affirms consistent and reliable cross sections. Isomeric effect has been interpreted using variation of cross section with structure and target properties. Our cross sections will be tabulated in atomic collision database for use in modelling various statistical and dynamical quantities.

The safe motherhood referral system to reduce cesarean sections and perinatal mortality - a cross-sectional study [1995-2006

Directory of Open Access Journals (Sweden)

Rudge Marilza VC

2011-11-01

Full Text Available Abstract Background In 2000, the eight Millennium Development Goals (MDGs set targets for reducing child mortality and improving maternal health by 2015. Objective To evaluate the results of a new education and referral system for antenatal/intrapartum care as a strategy to reduce the rates of Cesarean sections (C-sections and maternal/perinatal mortality. Methods Design: Cross-sectional study. Setting: Department of Gynecology and Obstetrics, Botucatu Medical School, Sao Paulo State University/UNESP, Brazil. Population: 27,387 delivering women and 27,827 offspring. Data collection: maternal and perinatal data between 1995 and 2006 at the major level III and level II hospitals in Botucatu, Brazil following initiation of a safe motherhood education and referral system. Main outcome measures: Yearly rates of C-sections, maternal (/100,000 LB and perinatal (/1000 births mortality rates at both hospitals. Data analysis: Simple linear regression models were adjusted to estimate the referral system's annual effects on the total number of deliveries, C-section and perinatal mortality ratios in the two hospitals. The linear regression were assessed by residual analysis (Shapiro-Wilk test and the influence of possible conflicting observations was evaluated by a diagnostic test (Leverage, with p Results Over the time period evaluated, the overall C-section rate was 37.3%, there were 30 maternal deaths (maternal mortality ratio = 109.5/100,000 LB and 660 perinatal deaths (perinatal mortality rate = 23.7/1000 births. The C-section rate decreased from 46.5% to 23.4% at the level II hospital while remaining unchanged at the level III hospital. The perinatal mortality rate decreased from 9.71 to 1.66/1000 births and from 60.8 to 39.6/1000 births at the level II and level III hospital, respectively. Maternal mortality ratios were 16.3/100,000 LB and 185.1/100,000 LB at the level II and level III hospitals. There was a shift from direct to indirect causes of

Methodology series module 3: Cross-sectional studies

Directory of Open Access Journals (Sweden)

Maninder Singh Setia

2016-01-01

Full Text Available Cross-sectional study design is a type of observational study design. In a cross-sectional study, the investigator measures the outcome and the exposures in the study participants at the same time. Unlike in case–control studies (participants selected based on the outcome status or cohort studies (participants selected based on the exposure status, the participants in a cross-sectional study are just selected based on the inclusion and exclusion criteria set for the study. Once the participants have been selected for the study, the investigator follows the study to assess the exposure and the outcomes. Cross-sectional designs are used for population-based surveys and to assess the prevalence of diseases in clinic-based samples. These studies can usually be conducted relatively faster and are inexpensive. They may be conducted either before planning a cohort study or a baseline in a cohort study. These types of designs will give us information about the prevalence of outcomes or exposures; this information will be useful for designing the cohort study. However, since this is a 1-time measurement of exposure and outcome, it is difficult to derive causal relationships from cross-sectional analysis. We can estimate the prevalence of disease in cross-sectional studies. Furthermore, we will also be able to estimate the odds ratios to study the association between exposure and the outcomes in this design.

Methodology Series Module 3: Cross-sectional Studies.

Science.gov (United States)

Setia, Maninder Singh

2016-01-01

Cross-sectional study design is a type of observational study design. In a cross-sectional study, the investigator measures the outcome and the exposures in the study participants at the same time. Unlike in case-control studies (participants selected based on the outcome status) or cohort studies (participants selected based on the exposure status), the participants in a cross-sectional study are just selected based on the inclusion and exclusion criteria set for the study. Once the participants have been selected for the study, the investigator follows the study to assess the exposure and the outcomes. Cross-sectional designs are used for population-based surveys and to assess the prevalence of diseases in clinic-based samples. These studies can usually be conducted relatively faster and are inexpensive. They may be conducted either before planning a cohort study or a baseline in a cohort study. These types of designs will give us information about the prevalence of outcomes or exposures; this information will be useful for designing the cohort study. However, since this is a 1-time measurement of exposure and outcome, it is difficult to derive causal relationships from cross-sectional analysis. We can estimate the prevalence of disease in cross-sectional studies. Furthermore, we will also be able to estimate the odds ratios to study the association between exposure and the outcomes in this design.

Ulcers of anthral and pyloric section of stomach

International Nuclear Information System (INIS)

Oster, A.N.

1986-01-01

Roentgenological symptoms of the ulcer of anthral and pyloric sections of the stomach, as well as the roentgenological image of the topography of the mucous membrane of these sections during ulcerations are given. Complexity of ulcer differentiation of these sections and their roentgenological detection are emphasized

Criticality benchmark comparisons leading to cross-section upgrades

International Nuclear Information System (INIS)

Alesso, H.P.; Annese, C.E.; Heinrichs, D.P.; Lloyd, W.R.; Lent, E.M.

1993-01-01

For several years criticality benchmark calculations with COG. COG is a point-wise Monte Carlo code developed at Lawrence Livermore National Laboratory (LLNL). It solves the Boltzmann equation for the transport of neutrons and photons. The principle consideration in developing COG was that the resulting calculation would be as accurate as the point-wise cross-sectional data, since no physics computational approximations were used. The objective of this paper is to report on COG results for criticality benchmark experiments in concert with MCNP comparisons which are resulting in corrections an upgrades to the point-wise ENDL cross-section data libraries. Benchmarking discrepancies reported here indicated difficulties in the Evaluated Nuclear Data Livermore (ENDL) cross-sections for U-238 at thermal neutron energy levels. This led to a re-evaluation and selection of the appropriate cross-section values from several cross-section sets available (ENDL, ENDF/B-V). Further cross-section upgrades anticipated

40 CFR 52.2465 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.2465 Section 52.2465 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan...

40 CFR 52.2186 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.2186 Section 52.2186 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan...

40 CFR 52.1100 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.1100 Section 52.1100 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan...

40 CFR 52.1281 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.1281 Section 52.1281 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan...

40 CFR 52.1426 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.1426 Section 52.1426 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “Nebraska Air Quality...

40 CFR 52.1535 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.1535 Section 52.1535 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan...

40 CFR 52.1783 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.1783 Section 52.1783 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan...

40 CFR 52.2239 - Original Identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original Identification of plan section. 52.2239 Section 52.2239 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original Identification of plan section. (a) This section identifies the original “Tennessee Air Pollution...

A microfluidic approach to water-rock interactions using thin rock sections: Pb and U sorption onto thin shale and granite sections

Energy Technology Data Exchange (ETDEWEB)

Oh, Youn Soo [Institute of Mine Reclamation Technology, Mine Reclamation Corp., 2 Segye-ro, Wonju-si, Gangwon-do, 26464 (Korea, Republic of); Jo, Ho Young, E-mail: hyjo@korea.ac.kr [Department of Earth and Environmental Sciences, Korea University, Anam-dong, Seongbuk-gu, Seoul, 02841 (Korea, Republic of); Ryu, Ji-Hun; Kim, Geon-Young [Korea Atomic Energy Research Institute, 1045 Daedeokdaero, Yuseong-gu, Daejeon, 34057 (Korea, Republic of)

2017-02-15

Highlights: • Microfluidic tests was used to investigate water-rock (mineral) interactions. • Pb and U sorption onto thin shale and granite sections was evaluated. • Pb removal by thin shale section is related primarily to Fe-containing minerals. • A slightly larger amount of U was removed onto the thin granite section with Fe-containing minerals. - Abstract: The feasibility of using microfluidic tests to investigate water-rock (mineral) interactions in fractures regarding sorption onto thin rock sections (i.e., shale and granite) of lead (Pb) and uranium (U) was evaluated using a synthetic PbCl{sub 2} solution and uranium-containing natural groundwater as fluids. Effluent composition and element distribution on the thin rock sections before and after microfluidic testing were analyzed. Most Pb removal (9.8 mg/cm{sup 2}) occurred within 3.5 h (140 PVF), which was 74% of the total Pb removal (13.2 mg/cm{sup 2}) at the end of testing (14.5 h, 560 PVF). Element composition on the thin shale sections determined by μ-XRF analysis indicated that Pb removal was related primarily to Fe-containing minerals (e.g., pyrite). Two thin granite sections (biotite rich, Bt-R and biotite poor, Bt-P) exhibited no marked difference in uranium removal capacity, but a slightly higher amount of uranium was removed onto the thin Bt-R section (266 μg/cm{sup 2}) than the thin Bt-P section (240 μg/cm{sup 2}) within 120 h (4800 PVF). However, uranium could not be detected by micro X-ray fluorescence (μ-XRF) analysis, likely due to the detection limit. These results suggest that microfluidic testing on thin rock sections enables quantitative evaluation of rock (mineral)-water interactions at the micro-fracture or pore scale.

Evaluation of fusion-evaporation cross-section calculations

Science.gov (United States)

Blank, B.; Canchel, G.; Seis, F.; Delahaye, P.

2018-02-01

Calculated fusion-evaporation cross sections from five different codes are compared to experimental data. The present comparison extents over a large range of nuclei and isotopic chains to investigate the evolution of experimental and calculated cross sections. All models more or less overestimate the experimental cross sections. We found reasonable agreement by using the geometrical average of the five model calculations and dividing the average by a factor of 11.2. More refined analyses are made for example for the 100Sn region.

Model cross section calculations using LAHET

International Nuclear Information System (INIS)

Prael, R.E.

1992-01-01

The current status of LAHET is discussed. The effect of a multistage preequilibrium exciton model following the INC is examined for neutron emission benchmark calculations, as is the use of a Fermi breakup model for light nuclei rather than an evaporation model. Comparisons are made also for recent fission cross section experiments, and a discussion of helium production cross sections is presented

Interference analysis of fission cross section

International Nuclear Information System (INIS)

Toshkov, S.A.; Yaneva, N.B.

1976-01-01

The formula for the reaction cross-section based on the R-matrix formalism considering the interference between the two neighbouring resonances, referred to the same value of total momentum was used for the analysis of the cross-section of resonance neutron induced fission of 230Pu. The experimental resolution and thermal motion of the target nuclei were accounted for numerical integration

FENDL/E-2.0. Evaluated nuclear data library of neutron-nucleus interaction cross sections and photon production cross sections and photon-atom interaction cross sections for fusion applications. Version 1, March 1997. Summary documentation

International Nuclear Information System (INIS)

Pashchenko, A.B.; Wienke, H.

1998-01-01

This document presents the description of a physical tape containing the basic evaluated nuclear data library of neutron-nucleus interaction cross sections, photon production cross sections and photon-atom interaction cross sections for fusion applications. It is part of the evaluated nuclear data library for fusion applications FENDL-2. The data are available cost-free from the Nuclear Data Section upon request. The data can also be retrieved by the user via online access through international computer networks. (author)

Microscopic cross sections: An utopia?

Energy Technology Data Exchange (ETDEWEB)

Hilaire, S. [CEA Bruyeres-le-Chatel, DIF 91 (France); Koning, A.J. [Nuclear Research and Consultancy Group, PO Box 25, 1755 ZG Petten (Netherlands); Goriely, S. [Institut d' Astronomie et d' Astrophysique, Universite Libre de Bruxelles, Campus de la Plaine, CP 226, 1050 Brussels (Belgium)

2010-07-01

The increasing need for cross sections far from the valley of stability poses a challenge for nuclear reaction models. So far, predictions of cross sections have relied on more or less phenomenological approaches, depending on parameters adjusted to available experimental data or deduced from systematical relations. While such predictions are expected to be reliable for nuclei not too far from the experimentally known regions, it is clearly preferable to use more fundamental approaches, based on sound physical bases, when dealing with very exotic nuclei. Thanks to the high computer power available today, all major ingredients required to model a nuclear reaction can now be (and have been) microscopically (or semi-microscopically) determined starting from the information provided by a nucleon-nucleon effective interaction. We have implemented all these microscopic ingredients in the TALYS nuclear reaction code, and we are now almost able to perform fully microscopic cross section calculations. The quality of these ingredients and the impact of using them instead of the usually adopted phenomenological parameters will be discussed. (authors)

Microscopic cross sections: An utopia?

International Nuclear Information System (INIS)

Hilaire, S.; Koning, A.J.; Goriely, S.

2010-01-01

The increasing need for cross sections far from the valley of stability poses a challenge for nuclear reaction models. So far, predictions of cross sections have relied on more or less phenomenological approaches, depending on parameters adjusted to available experimental data or deduced from systematical relations.While such predictions are expected to be reliable for nuclei not too far from the experimentally known regions, it is clearly preferable to use more fundamental approaches, based on sound physical bases, when dealing with very exotic nuclei. Thanks to the high computer power available today, all major ingredients required to model a nuclear reaction can now be (and have been) microscopically (or semi-microscopically) determined starting from the information provided by a nucleon-nucleon effective interaction. We have implemented all these microscopic ingredients in the TALYS nuclear reaction code, and we are now almost able to perform fully microscopic cross section calculations. The quality of these ingredients and the impact of using them instead of the usually adopted phenomenological parameters will be discussed. (authors)

Wound Infection following Caesarean Section in a University ...

African Journals Online (AJOL)

Background: Caesarean section is a common operation in obstetric practice, but there is a general aversion to caesarean section amongst Nigerian women due to a myriad of reasons amongst which are its associated morbidity and mortality. Surgical site infection following caesarean section is both a major cause of ...

26 CFR 1.382-5 - Section 382 limitation.

Science.gov (United States)

2010-04-01

... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Section 382 limitation. 1.382-5 Section 1.382-5 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Insolvency Reorganizations § 1.382-5 Section 382 limitation. (a) Scope. Following an...

40 CFR 52.1640 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section. 52.1640 Section 52.1640 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Original identification of plan section. (a) This section identifies the original “State of New Mexico...

Fission cross section measurements of actinides at LANSCE

Energy Technology Data Exchange (ETDEWEB)

Tovesson, Fredrik [Los Alamos National Laboratory; Laptev, Alexander B [Los Alamos National Laboratory; Hill, Tony S [INL

2010-01-01

Fission cross sections of a range of actinides have been measured at the Los Alamos Neutron Science Center (LANSCE) in support of nuclear energy applications. By combining measurement at two LANSCE facilities, Lujan Center and the Weapons Neutron Research center (WNR), differential cross sections can be measured from sub-thermal energies up to 200 MeV. Incident neutron energies are determined using the time-of-flight method, and parallel-plate ionization chambers are used to measure fission cross sections relative to the {sup 235}U standard. Recent measurements include the {sup 233,238}U, {sup 239,242}Pu and {sup 243}Am neutron-induced fission cross sections. In this paper preliminary results for cross section data of {sup 243}Am and {sup 233}U will be presented.

76 FR 53880 - Funds Availability for Section 514 Farm Labor Housing Loans and Section 516 Farm Labor Housing...

Science.gov (United States)

2011-08-30

... DEPARTMENT OF AGRICULTURE Rural Housing Service Funds Availability for Section 514 Farm Labor Housing Loans and Section 516 Farm Labor Housing Grants for Off-Farm Housing for Fiscal Year 2011 AGENCY: Rural Housing Service, USDA. ACTION: Notice; correction. SUMMARY: This notice corrects the scoring...

Food Plants of 19 butterflies species (Lepidoptera from Loreto, Peru

Directory of Open Access Journals (Sweden)

Joel Vásquez Bardales

2017-04-01

Full Text Available This work reports the food plants utilized by 19 species of butterflies from Allpahuayo-Mishana Research Center and the Community of San Rafael, Loreto, Peru. We report 23 plant species and one hybrid of angiosperms used by the butterflies. Larval host plants were 21 species and five were adult nectar sources. Two species were both host plant and nectar source: Passiflora coccinea Aubl. and Passiflora edulis Sims. The most frequently used plant families were Solanaceae, Passifloraceae, Fabaceae and Aristolochiaceae.

Söke Ovasında (Aydın) yeni bir kültür bitkisi: Yer Kirazı/Altın Çilek (Physalis peruviana)

OpenAIRE

Özdemir, Yasemin; Günal, Nurten

2018-01-01

Cape gooseberry (Physalis peruviana) is an economically valuable species of Physalis in the family of Solanaceae. Native to the tropical South America, Cape Gooseberry then spread to tropical, subtropical, and sometimes mild climate zones. Physalis peruviana is a plant that highly needs heat, sun light and moisture, and that does not withstand low temperature and strong winds. It is not so much selective in terms of soil.Cape Gooseberry/Golden Strawberry was first grown in the town Bağarası i...

Minerals and essential fatty acids of the exotic fruit Physalis peruviana L. Minerais e ácidos graxos essenciais da fruta exótica Physalis peruviana L.

OpenAIRE

Eliseu Rodrigues; Ismael Ivan Rockenbach; Ciriele Cataneo; Luciano Valdemiro Gonzaga; Eduardo Sidinei Chaves; Roseane Fett

2009-01-01

Physalis peruviana is an exotic fruit that belongs to the Solanaceae family and which has recently started to be produced in Brazil, mainly in the Southern region. Once there is few data regarding its chemical composition, this work presents the centesimal and mineral composition and the fatty acid profile of the lipidic fraction of Physalis peruviana. Concerning the centesimal composition, Physalis presented high contents of ashes and total lipids, 0.8 and 3.16 g.100 g-1, respectively. In it...

Cesarean section in Ethiopia: prevalence and sociodemographic characteristics.

Science.gov (United States)

Yisma, Engida; Smithers, Lisa G; Lynch, John W; Mol, Ben W

2017-11-20

The objective of this study was to assess the prevalence and sociodemographic characteristics of cesarean section in Ethiopia. We used data collected for Ethiopia Demographic and Health Surveys (DHS) conducted in 2000, 2005, 2011, and 2016. A two-stage, stratified, clustered random sampling design was used to gather information from women who gave birth within the 5-year period before each of the surveys. We analyzed the data to identify sociodemographic characteristics associated with cesarean section using log-Poisson regression models. The national cesarean section rate increased from 0.7% in 2000 to 1.9% in 2016, with increases across seven of the eleven administrative regions of Ethiopia. Addis Ababa had the highest cesarean section rate (21.4%) in 2016 and the greatest increase since 2000. In the adjusted analysis, women who gave birth in private health facility had a 78.0% higher risk of cesarean section (adjusted prevalence ratio (aPR) (95% CI) 1.78 (1.22, 2.58)) compared with women who gave birth in public health facility. Having four or more births was associated with a lower risk of cesarean section compared with first births (aPR (95% CI) 0.36 (0.16, 0.79)). The Ethiopian national cesarean section rate is about 2%, but the rate varies widely among administrative regions, suggesting unequal access. Cesarean sections were highest among urban mothers, first births, births to women with higher education, and births to women from the richest quintile of household wealth.

New airfoil sections for straight bladed turbine

Science.gov (United States)

Boumaza, B.

1987-07-01

A theoretical investigation of aerodynamic performance for vertical axis Darrieus wind turbine with new airfoils sections is carried out. The blade section aerodynamics characteristics are determined from turbomachines cascade model. The model is also adapted to the vertical Darrieus turbine for the performance prediction of the machine. In order to choose appropriate value of zero-lift-drag coefficient in calculation, an analytical expression is introduced as function of chord-radius ratio and Reynolds numbers. New airfoils sections are proposed and analyzed for straight-bladed turbine.

New airfoil sections for straight bladed turbine

International Nuclear Information System (INIS)

Boumaza, B.

1987-07-01

A theoretical investigation of aerodynamic performance for vertical axis Darrieus wind turbine with new airfoils sections is carried out. The blade section aerodynamics characteristics are determined from turbomachines cascade model. The model is also adapted to the vertical Darrieus turbine for the performance prediction of the machine. In order to choose appropriate value of zero-lift-drag coefficient in calculation, an analytical expression is introduced as function of chord-radius ratio and Reynolds numbers. New airfoils sections are proposed and analyzed for straight-bladed turbine

Total reaction cross sections and neutron-removal cross sections of neutron-rich light nuclei measured by the COMBAS fragment-separator

Science.gov (United States)

Hue, B. M.; Isataev, T.; Erdemchimeg, B.; Artukh, A. G.; Aznabaev, D.; Davaa, S.; Klygin, S. A.; Kononenko, G. A.; Khuukhenkhuu, G.; Kuterbekov, K.; Lukyanov, S. M.; Mikhailova, T. I.; Maslov, V. A.; Mendibaev, K.; Sereda, Yu M.; Penionzhkevich, Yu E.; Vorontsov, A. N.

2017-12-01

Preliminary results of measurements of the total reaction cross sections σR and neutron removal cross section σ-xn for weakly bound 6He, 8Li, 9Be and 10Be nuclei at energy range (20-35) A MeV with 28Si target is presented. The secondary beams of light nuclei were produced by bombardment of the 22Ne (35 A MeV) primary beam on Be target and separated by COMBAS fragment-separator. In dispersive focal plane a horizontal slit defined the momentum acceptance as 1% and a wedge degrader of 200 μm Al was installed. The Bρ of the second section of the fragment-separator was adjusted for measurements in energy range (20-35) A MeV. Two-neutron removal cross sections for 6He and 10Be and one -neutron removal cross sections 8Li and 9Be were measured.

Cross section homogenization analysis for a simplified Candu reactor

International Nuclear Information System (INIS)

Pounders, Justin; Rahnema, Farzad; Mosher, Scott; Serghiuta, Dumitru; Turinsky, Paul; Sarsour, Hisham

2008-01-01

The effect of using zero current (infinite medium) boundary conditions to generate bundle homogenized cross sections for a stylized half-core Candu reactor problem is examined. Homogenized cross section from infinite medium lattice calculations are compared with cross sections homogenized using the exact flux from the reference core environment. The impact of these cross section differences is quantified by generating nodal diffusion theory solutions with both sets of cross sections. It is shown that the infinite medium spatial approximation is not negligible, and that ignoring the impact of the heterogeneous core environment on cross section homogenization leads to increased errors, particularly near control elements and the core periphery. (authors)

Total cross-section measurements progress in nuclear physics

CERN Document Server

Giacomelli, G; Mulvey, J H

2013-01-01

Total Cross-Section Measurements discusses the cross-sectional dimensions of elementary hadron collisions. The main coverage of the book is the resonance and high energy area of the given collision. A section of the book explains in detail the characteristic of a resonance region. Another section is focused on the location of the high energy region of collision. Parts of the book define the meaning of resonance in nuclear physics. Also explained are the measurement of resonance and the identification of the area where the resonance originates. Different experimental methods to measure the tota

Cesarean section and offspring's risk of multiple sclerosis

DEFF Research Database (Denmark)

Nielsen, Nete M; Bager, Peter; Stenager, Egon

2013-01-01

Apart from a recent study reporting a 2- to 3-fold increased risk of multiple sclerosis (MS) among women and men who were delivered by Cesarean section (C-section), little attention has been given to the possible association between mode of delivery and the risk of MS.......Apart from a recent study reporting a 2- to 3-fold increased risk of multiple sclerosis (MS) among women and men who were delivered by Cesarean section (C-section), little attention has been given to the possible association between mode of delivery and the risk of MS....

A Pebble Bed Reactor cross section methodology

International Nuclear Information System (INIS)

Hudson, Nathanael H.; Ougouag, Abderrafi M.; Rahnema, Farzad; Gougar, Hans

2009-01-01

A method is presented for the evaluation of microscopic cross sections for the Pebble Bed Reactor (PBR) neutron diffusion computational models during convergence to an equilibrium (asymptotic) fuel cycle. This method considers the isotopics within a core spectral zone and the leakages from such a zone as they arise during reactor operation. The randomness of the spatial distribution of fuel grains within the fuel pebbles and that of the fuel and moderator pebbles within the core, the double heterogeneity of the fuel, and the indeterminate burnup of the spectral zones all pose a unique challenge for the computation of the local microscopic cross sections. As prior knowledge of the equilibrium composition and leakage is not available, it is necessary to repeatedly re-compute the group constants with updated zone information. A method is presented to account for local spectral zone composition and leakage effects without resorting to frequent spectrum code calls. Fine group data are pre-computed for a range of isotopic states. Microscopic cross sections and zone nuclide number densities are used to construct fine group macroscopic cross sections, which, together with fission spectra, flux modulation factors, and zone buckling, are used in the solution of the slowing down balance to generate a new or updated spectrum. The microscopic cross-sections are then re-collapsed with the new spectrum for the local spectral zone. This technique is named the Spectral History Correction (SHC) method. It is found that this method accurately recalculates local broad group microscopic cross sections. Significant improvement in the core eigenvalue, flux, and power peaking factor is observed when the local cross sections are corrected for the effects of the spectral zone composition and leakage in two-dimensional PBR test problems.

Transport cross section for small-angle scattering

International Nuclear Information System (INIS)

D'yakonov, M.I.; Khaetskii, A.V.

1991-01-01

Classical mechanics is valid for describing potential scattering under the conditions (1) λ much-lt α and (2) U much-gt ℎυ/α, where λ is the de Broglie wavelength, α is the characteristic size of the scatterer, U is the characteristic value of the potential energy, and υ is the velocity of the scattered particle. The second of these conditions means that the typical value of the classical scattering angle is far larger than the diffraction angle λ/α. In this paper the authors show that this second condition need not hold in a derivation of the transport cross section. In other words, provided that the condition λ much-lt α holds, it is always possible to calculate the transport cross section from the expressions of classical mechanics, even in the region U approx-lt ℎυ/α, where the scattering is diffractive,and the differential cross section is greatly different from the classical cross section. The transport cross section is found from the classical expression even in the anticlassical case U much-lt ℎυ/α, where the Born approximation can be used

A Study of Aerodynamics in Kevlar-Wall Test Sections

OpenAIRE

Brown, Kenneth Alexander

2014-01-01

This study is undertaken to characterize the aerodynamic behavior of Kevlar-wall test sections and specifically those containing two-dimensional, lifting models. The performance of the Kevlar-wall test section can be evaluated against the standard of the hard-wall test section, which in the case of the Stability Wind Tunnel (SWT) at Virginia Tech can be alternately installed or replaced by the Kevlar-wall test section. As a first step towards the evaluation of the Kevlar-wall test section aer...

ENDF/B-5 fission product cross section evaluations

International Nuclear Information System (INIS)

Schenter, R.E.; England, T.R.

1979-12-01

Cross section evaluations were made for the 196 fission product nuclides on the ENDF/B-5 data files. Most of the evaluations involve updating the capture cross sections of the important absorbers for fast and thermal reactor systems. This included updating thermal values, resonance integrals, resonance parameter sets, and fast capture cross sections. For the fast capture results generalized least-squares calculations were made with the computer code FERRET. Input for these cross section adjustments included nuclear models calculations and both integral and differential experimental data results. The differential cross sections and their uncertainties were obtained from the CSIRS library. Integral measurement results came from CFRMF and STEK Assemblies 500, 1000, 2000, 3000, 4000. Comparisons of these evaluations with recent capture measurements are shown. 15 figures, 10 tables

Nuclear fission and neutron-induced fission cross-sections

Energy Technology Data Exchange (ETDEWEB)

James, G.D.; Lynn, J.E.; Michaudon, A.; Rowlands, J.; de Saussure, G.

1981-01-01

A general presentation of current knowledge of the fission process is given with emphasis on the low energy fission of actinide nuclei and neutron induced fission. The need for and the required accuracy of fission cross section data in nuclear energy programs are discussed. A summary is given of the steps involved in fission cross section measurement and the range of available techniques. Methods of fission detection are described with emphasis on energy dependent changed and detector efficiency. Examples of cross section measurements are given and data reduction is discussed. The calculation of fission cross sections is discussed and relevant nuclear theory including the formation and decay of compound nuclei and energy level density is introduced. A description of a practical computation of fission cross sections is given.

Nonelastic-scattering cross sections of elemental nickel

International Nuclear Information System (INIS)

Smith, A.B.; Guenther, P.T.; Whalen, J.F.

1980-06-01

Neutron total cross sections of elemental nickel were measured from 1.3 to 4.5 MeV, at intervals of approx. 50 keV, with resolutions of 30 to 50 keV and to accuracies of 1 to 2.5%. Neutron differential-elastic-scattering cross sections were measured from 1.45 to 3.8 MeV, at intervals and with resolutions comparable to those of the total cross sections, and to accuracies of 3 to 5%. The nonelastic-scattering cross section is derived from the measured values to accuracies of greater than or equal to 6%. The experimental results are compared with previously reported values as represented by ENDF/B-V, and areas of consistency and discrepancy, noted. The measured results are shown to be in good agreement with the predictions of a model previously reported by the authors. 4 figures, 1 table

Epidemio-Clinical Factors Associated with Caesarean Section in ...

African Journals Online (AJOL)

Abstract Caesarean section incurs significant cost and poses a hindrance to healthcare. The aim of the study was to determine maternal, foetal outcomes and cost. This was a cross sectional study conducted at the two health facilities. The study covered an eight month period. The rate of caesarean section was 5.69% and ...

Measurements of fission cross-sections. Chapter 4

International Nuclear Information System (INIS)

James, G.D.

1981-01-01

The steps involved in the measurement of fission cross sections are summarized and the range of techniques available are considered. Methods of fission detection are described with particular emphasis on the neutron energy dependent properties of the fission process and the details of fragment energy loss which can lead to energy-dependent changes in detector efficiency. Selected examples of fission cross-section measurements are presented and methods of data reduction, storage, analysis and evaluation, are examined. Finally requested accuracies for fission cross section data are compared to estimated available accuracies. (U.K.)

26 CFR 1.1245-6 - Relation of section 1245 to other sections.

Science.gov (United States)

2010-04-01

... accounting treatment of asset retirements), does not require recognition of such gain. (d) Installment method... 1231 (relating to property used in the trade or business), the gain recognized under section 1245(a)(1...). For limitation on amount of adjustments reflected in adjusted basis of property disposed of by an...

Vibrational enhancement of total breakup cross sections

International Nuclear Information System (INIS)

Haftel, M.I.; Lim, T.K.

1984-01-01

This paper considers the role of multi-two-body bound states, namely vibrational excitations, on total three-body breakup cross-sections. Total cross-sections are usually easy to measure, and they play a fundamental role in chemical kinetics. (orig.)

Total cross sections for electron scattering by He

International Nuclear Information System (INIS)

De Heer, F.J.; Jansen, R.H.J.

1977-01-01

A set of total cross sections for scattering of electrons by He has been evaluated over the energy range of zero to 3000 eV by means of the analysis of experiments and theories on total cross sections for elastic scattering, ionisation and excitation, and on differential cross sections for elastic and inelastic scattering. Between 0 and 19.8 eV, where no inelastic processes occur, the total cross sections for scattering are equal to those for elastic scattering. Above 19.8 eV total cross sections for scattering of electrons have been evaluated by adding those for ionisation, excitation and elastic scattering. The total cross sections thus obtained are probably accurate to about 5% over a large part of the energy range. They appear to be in very good agreement with the recent experimental results of Blaauw et al. (J. Phys. B.; 10:L299 (1977)). The present results have already proved useful for application in the dispersion relation for forward scattering in electron-helium collisions. (author)

14 CFR Section 19 - Uniform Classification of Operating Statistics

Science.gov (United States)

2010-01-01

... Statistics Section 19 Section 19 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION... AIR CARRIERS Operating Statistics Classifications Section 19 Uniform Classification of Operating Statistics ...

Heisenberg rise of total cross sections

International Nuclear Information System (INIS)

Ezhela, V.V.; Yushchenko, O.P.

1988-01-01

It is shown that on the basis of the original idea of Heisenberg on the quasiclassical picture of extended particle interactions one can construct a satisfactory description of the total cross sections, elastic cross sections, elastic diffractive slopes and mean charged multiplicities in the cm energy range from 5 to 900 GeV, and produce reasonable extrapolations up to several tens of TeV. 14 refs.; 7 figs.; 2 tabs

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Target dependence of K+-nucleus total cross sections

International Nuclear Information System (INIS)

Jiang, M.F.; Ernst, D.J.; Chen, C.M.

1995-01-01

We investigate the total cross section and its target dependence for K + -nucleus scattering using a relativistic momentum-space optical potential model which incorporates relativistically normalized wave functions, invariant two-body amplitudes, covariant kinematics, and an exact full-Fermi averaging integral. The definition of the total cross section in the presence of a Coulomb interaction is reviewed and the total cross section is calculated in a way that is consistent with what is extracted from experiment. In addition, the total cross sections for a nucleus and for the deuteron are calculated utilizing the same theory. This minimizes the dependence of the ratio of these cross sections on the details of the theory. The model dependence of the first-order optical potential calculations is investigated. The theoretical results are found to be systematically below all existing data

Cross Sections for Inner-Shell Ionization by Electron Impact

Energy Technology Data Exchange (ETDEWEB)

Llovet, Xavier, E-mail: xavier@ccit.ub.edu [Centres Científics i Tecnològics, Universitat de Barcelona, Lluís Solé i Sabarís 1-3, 08028 Barcelona (Spain); Powell, Cedric J. [Materials Measurement Science Division, National Institute of Standards and Technology, Gaithersburg, Maryland 20899-8370 (United States); Salvat, Francesc [Facultat de Física (ECM and ICC), Universitat de Barcelona, Diagonal 645, 08028 Barcelona (Spain); Jablonski, Aleksander [Institute of Physical Chemistry, Polish Academy of Sciences, ul. Kasprzaka 44/52, 01-224 Warsaw (Poland)

2014-03-15

An analysis is presented of measured and calculated cross sections for inner-shell ionization by electron impact. We describe the essentials of classical and semiclassical models and of quantum approximations for computing ionization cross sections. The emphasis is on the recent formulation of the distorted-wave Born approximation by Bote and Salvat [Phys. Rev. A 77, 042701 (2008)] that has been used to generate an extensive database of cross sections for the ionization of the K shell and the L and M subshells of all elements from hydrogen to einsteinium (Z = 1 to Z = 99) by electrons and positrons with kinetic energies up to 1 GeV. We describe a systematic method for evaluating cross sections for emission of x rays and Auger electrons based on atomic transition probabilities from the Evaluated Atomic Data Library of Perkins et al. [Lawrence Livermore National Laboratory, UCRL-ID-50400, 1991]. We made an extensive comparison of measured K-shell, L-subshell, and M-subshell ionization cross sections and of Lα x-ray production cross sections with the corresponding calculated cross sections. We identified elements for which there were at least three (for K shells) or two (for L and M subshells) mutually consistent sets of cross-section measurements and for which the cross sections varied with energy as expected by theory. The overall average root-mean-square deviation between the measured and calculated cross sections was 10.9% and the overall average deviation was −2.5%. This degree of agreement between measured and calculated ionization and x-ray production cross sections was considered to be very satisfactory given the difficulties of these measurements.

76 FR 20593 - Guidance Under Section 108(a) Concerning the Exclusion of Section 61(a)(12) Discharge of...

Science.gov (United States)

2011-04-13

... ultimate owner(s) of such partner. Some taxpayers have taken the position that the insolvency exception is... for partnerships under section 108(d)(6), the insolvency exception is available only to the extent the.... Section 1.108-9 is added to read as follows: Sec. 1.108-9 Application of insolvency and bankruptcy...

Progress report : Plasma Physics Section

International Nuclear Information System (INIS)

Iyyengar, S.K.; Rohatgi, V.K.

1975-08-01

The activities of the plasma physics section of the Bhabha Atomic Research Centre, India over the last five years (1970-75) are reported. The R and D programme of the section has been divided into four cells mainly i.e., (i) Thermal plasma (ii) Relativistic Electron Beam (iii) Energetics and (iv) Electron beam technology. The salient features of the development activities carried out in these cells are outlined. In the Thermal plasma group, considerable research work has been done in (a) fundamental plasma studies, (b) industrial plasma technology and (c) open cycle MHD power generation project. The relativistic electron beam group is engaged in improving the technology to realize high power lasers, and pulsed thermonuclear fusion. The energetics programme is oriented to develop high voltage d.c. generators and pulse generators. The electron beam techniques developed here are routinely used for melting refractory and reactive metals. The technical know-how of the welding machines developed has been transfered to industries. Equipment developed by this section, such as, (1) electron beam furnace, (2) plasma cutting torch, (3) impulse magnet charger etc. are listed. (A.K.)

Modelisation of the fission cross section

International Nuclear Information System (INIS)

Morariu, Claudia

2013-03-01

The neutron cross sections of four nuclear systems (n+ 235 U, n+ 233 U, n+ 241 Am and n+ 237 Np) are studied in the present document. The target nuclei of the first case, like 235 U and 239 Pu, have a large fission cross section after the absorption of thermal neutrons. These nuclei are called 'fissile' nuclei. The other type of nuclei, like 237 Np and 241 Am, fission mostly with fast neutrons, which exceed the fission threshold energy. These types of nuclei are called 'fertile'. The compound nuclei of the fertile nuclei have a binding energy higher than the fission barrier, while for the fissile nuclei the binding energy is lower than the fission barrier. In this work, the neutron induced cross sections for both types of nuclei are evaluated in the fast energy range. The total, reaction and shape-elastic cross sections are calculated by the coupled channel method of the optical model code ECIS, while the compound nucleus mechanism are treated by the statistical models implemented in the codes STATIS, GNASH and TALYS. The STATIS code includes a refined model of the fission process. Results from the theoretical calculations are compared with data retrieved from the experimental data base EXFOR. (author) [fr

Multilevel parametrization of fissile nuclei resonance cross sections

International Nuclear Information System (INIS)

Lukyanov, A.A.; Kolesov, V.V.; Janeva, N.

1987-01-01

Because the resonance interference has an important influence on the resonance structure of neutron cross sections energy dependence at lowest energies, multilevel scheme of the cross section parametrization which take into account the resonance interference is used for the description with the same provisions in the regions of the interferential maximum and minimum of the resonance cross sections of the fissile nuclei

NNLO jet cross sections by subtraction

Energy Technology Data Exchange (ETDEWEB)

Somogyi, G.; Bolzoni, P. [DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Trocsanyi, Z. [CERN PH-TH, on leave from University of Debrecen and Institute of Nuclear Research of HAS, H-4001 P.O.Box 51 (Hungary)

2010-08-15

We report on the computation of a class of integrals that appear when integrating the so-called iterated singly-unresolved approximate cross section of the NNLO subtraction scheme of Refs. [G. Somogyi, Z. Trocsanyi, and V. Del Duca, JHEP 06, 024 (2005), (arXiv:hep-ph/0502226); G. Somogyi and Z. Trocsanyi, (2006), (arXiv:hep-ph/0609041); G. Somogyi, Z. Trocsanyi, and V. Del Duca, JHEP 01, 070 (2007), (arXiv:hep-ph/0609042); G. Somogyi and Z. Trocsanyi, JHEP 01, 052 (2007), (arXiv:hep-ph/0609043)] over the factorised phase space of unresolved partons. The integrated approximate cross section itself can be written as the product of an insertion operator (in colour space) times the Born cross section. We give selected results for the insertion operator for processes with two and three hard partons in the final state.

NNLO jet cross sections by subtraction

International Nuclear Information System (INIS)

Somogyi, G.; Bolzoni, P.; Trocsanyi, Z.

2010-01-01

We report on the computation of a class of integrals that appear when integrating the so-called iterated singly-unresolved approximate cross section of the NNLO subtraction scheme of Refs. [G. Somogyi, Z. Trocsanyi, and V. Del Duca, JHEP 06, 024 (2005), (arXiv:hep-ph/0502226); G. Somogyi and Z. Trocsanyi, (2006), (arXiv:hep-ph/0609041); G. Somogyi, Z. Trocsanyi, and V. Del Duca, JHEP 01, 070 (2007), (arXiv:hep-ph/0609042); G. Somogyi and Z. Trocsanyi, JHEP 01, 052 (2007), (arXiv:hep-ph/0609043)] over the factorised phase space of unresolved partons. The integrated approximate cross section itself can be written as the product of an insertion operator (in colour space) times the Born cross section. We give selected results for the insertion operator for processes with two and three hard partons in the final state.

Maternal mortality following caesarean sections.

Science.gov (United States)

Sikdar, K; Kundu, S; Mandal, G S

1979-08-01

A study of 26 maternal deaths following 3647 caesarean sections was conducted in Eden Hospital from 1974-1977. During the time period there were 35,544 births and 308 total maternal deaths (8.74/1000). Indications for Caesarean sections included: 1) abnormal presentation; 2) cephalopelvic disproportion; 3) toxemia; 4) prolonged labor; 5) fetal distress; and 6) post-caesarean pregnancies. Highest mortality rates were among cephalopelvic disproportion, toxemia, and prolonged labor patients. 38.4% of the patients died due to septicaemia and peritonitis, but other deaths were due to preclampsia, shock, and hemorrhage. Proper antenatal care may have prevented anemia and preclampsia and treated other pre-existing or superimposed diseases.

Tables of RCN-2 fission-product cross section evaluation

International Nuclear Information System (INIS)

Gruppelaar, H.

1979-05-01

This report (continuation of ECN-13 and ECN-33) describes the third part of the RCN-2 evaluation of neutron cross sections for fission product nuclides in KEDAK format. It contains evaluated data for nine nuclides, i.e. 142 Nd, 143 Nd, 144 Nd, 145 Nd, 146 Nd, 147 Nd, 148 Nd, 150 Nd and 147 Pm. Most emphasis has been given to the evaluation of the radiative capture cross section, in order to provide a data base for adjustment calculations using results of integral measurements. Short evaluation reports are given for this cross section. The evaluated capture cross sections are compared with recent experimental differential and integral data. Graphs are given of the capture cross sections at neutron energies above 1 keV, in which also adjusted point cross sections, based upon integral STEK and CFRMF data have been plotted. Moreover, the results are compared with those of the well-known ENDF/B-IV evaluation for fission product nucleides. Finally, evaluation summaries are given, which include tables of other important neutron cross sections, such as the total, elastic scattering and inelastic scattering cross sections

Pion-nucleus cross sections

International Nuclear Information System (INIS)

Barashenkov, V.S.

1990-01-01

The tables of inelastic and total cross sections of π ± mesons interactions with nuclei 4 He- 238 U are presented. The tables are obtained by theoretical analysis of known experimental data for energies higher some tens of MeV. 1 ref.; 1 tab

Positive Scattering Cross Sections using Constrained Least Squares

International Nuclear Information System (INIS)

Dahl, J.A.; Ganapol, B.D.; Morel, J.E.

1999-01-01

A method which creates a positive Legendre expansion from truncated Legendre cross section libraries is presented. The cross section moments of order two and greater are modified by a constrained least squares algorithm, subject to the constraints that the zeroth and first moments remain constant, and that the standard discrete ordinate scattering matrix is positive. A method using the maximum entropy representation of the cross section which reduces the error of these modified moments is also presented. These methods are implemented in PARTISN, and numerical results from a transport calculation using highly anisotropic scattering cross sections with the exponential discontinuous spatial scheme is presented

Environmental Impact Section

International Nuclear Information System (INIS)

Anon.

1977-01-01

The Section is concerned with preparation of environmental statements and assessments and development of assessment methodologies for energy technologies. During 1976, activities involved nuclear, fossil, and geothermal energy; this work was supported by the U.S.Army, HUD, US ERDA, and US NRC. Two special studies--one on the effects of power plant intake structures on fish impingement and another on multiple uses of cooling lakes--were completed and should serve as references for future analyses. Two research projects sponsored by NRC--the Unified Transport Approach (UTA) to Power Plant Assessment and the Environmental Monitoring Data Evaluation Study--were continued. The purpose of the UA program is to develop fast-transient, one- and two-dimensional transport models for estimating thermal, radiological, chemical, and biological impacts in complicated water bodies. The impact of public use of various products that contain radioactive isotope is being evaluated. The Environmental Impact Sections assistance to NRC expanded to include assessments of fuel-fabrication facilities being considered for relicensing and two uranium in-situ solution mining facility proposals. The work for HUD comprises an assessment of the first application of MIUS in a new town development. A generic environmental statement was prepared and an environmental monitoring program for the facility was designed

Phytogeographic analysis of the genus Datura (Solanaceae in continental Mexico Análisis fitogeográfico del género Datura (Solanaceae en México continental

Directory of Open Access Journals (Sweden)

Mario Luna-Cavazos

2011-09-01

Full Text Available The geographic distribution of the species of Datura in Mexico was analyzed using numerical analysis of natural populations documented by herbarium specimens. A map of Mexico was divided into 239, 1° x 1° squares (latitude and longitude which were used as sampling geographical units and in which the presence or absence of each species of Datura was recorded. Multivariate procedures were applied: a, TWINSPAN classification to define Datura´s main distribution areas; b, Detrended Correspondence Analysis (DCA to define Datura´s main distribution gradients, and c, Canonical Correspondence Analysis (CCA to relate distribution patterns with geographical and climatic factors. Species of Datura were found in 69% (165 of the squares. TWINSPAN defined 14 groups which, when associated with Mexico’s biogeographic provinces, were concentrated in the northwestern Mexican provinces as well as in the Altiplano Norte and Altiplano Sur and the Sierra Madre Occidental. DCA indicated that Datura’s main distribution patterns are explained by 3 principal gradients: altitude, humidity, and latitude. The CCA identified longitude, precipitation of the driest quarter, altitude, and average temperature of the warmest quarter as the most important variables affecting Datura´s distribution patterns. The Depresión del Balsas region of central Mexico is the area with greatest species richness of Datura.Se analizó la distribución geográfica de las especies de Datura en México mediante análisis numérico de poblaciones naturales documentadas con ejemplares de herbario. Un mapa de México fue dividido en 239 cuadros de 1° x 1° (latitud y longitud, los cuales se usaron como unidades geográficas de muestreo, y en ellos se registró la presencia o ausencia de cada especie de Datura. Se aplicaron procedimientos estadísticos multivariados: a, clasificación por TWINSPAN para definir las principales áreas de distribución de Datura; b, análisis de correspondencia rectificado (ACR para definir los principales gradientes en la distribución de Datura y c, análisis de correspondencia canónica (ACC para relacionar los patrones de distribución con factores geográficos y climáticos. Las especies de Datura se localizaron en el 69 % (165 de los cuadros. TWINSPAN definió 14 grupos, los cuales, cuando se relacionaron con las provincias biogeográficas mexicanas, estuvieron concentrados en provincias del noroeste de México así como en el Altiplano Norte, Altiplano Sur y la sierra Madre Occidental. El ACR indicó que los patrones de distribución de Datura son explicados por 3 gradientes principales: altitud, humedad y latitud. El ACC definió a la longitud, precipitación del trimestre más seco, altitud y temperatura media del trimestre más cálido como las variables más importantes relacionadas con los patrones de distribución de Datura. La región de la depresión del Balsas es el área con la mayor riqueza de especies de Datura.

Calculation of atom displacement cross section for structure material

International Nuclear Information System (INIS)

Liu Ping; Xu Yiping

2015-01-01

The neutron radiation damage in material is an important consideration of the reactor design. The radiation damage of materials mainly comes from atom displacements of crystal structure materials. The reaction cross sections of charged particles, cross sections of displacements per atom (DPA) and KERMA are the basis of radiation damage calculation. In order to study the differences of DPA cross sections with different codes and different evaluated nuclear data libraries, the DPA cross sections for structure materials were calculated with UNF and NJOY codes, and the comparisons of results were given. The DPA cross sections from different evaluated nuclear data libraries were compared. And the comparison of DPA cross sections between NJOY and Monte Carlo codes was also done. The results show that the differences among these evaluated nuclear data libraries exist. (authors)

Tachyonic ionization cross sections of hydrogenic systems

Energy Technology Data Exchange (ETDEWEB)

Tomaschitz, Roman [Department of Physics, Hiroshima University, 1-3-1 Kagami-yama, Higashi-Hiroshima 739-8526 (Japan)

2005-03-11

Transition rates for induced and spontaneous tachyon radiation in hydrogenic systems as well as the transversal and longitudinal ionization cross sections are derived. We investigate the interaction of the superluminal radiation field with matter in atomic bound-bound and bound-free transitions. Estimates are given for Ly-{alpha} transitions effected by superluminal quanta in hydrogen-like ions. The tachyonic photoelectric effect is scrutinized, in the Born approximation and at the ionization threshold. The angular maxima occur at different scattering angles in the transversal and longitudinal cross sections, which can be used to sift out longitudinal tachyonic quanta in a photon flux. We calculate the tachyonic ionization and recombination cross sections for Rydberg states and study their asymptotic scaling with respect to the principal quantum number. At the ionization threshold of highly excited states of order n {approx} 10{sup 4}, the longitudinal cross section starts to compete with photoionization, in recombination even at lower levels.

Symmetric charge transfer cross section of uranium

International Nuclear Information System (INIS)

Shibata, Takemasa; Ogura, Koichi

1995-03-01

Symmetric charge transfer cross section of uranium was calculated under consideration of reaction paths. In the charge transfer reaction a d 3/2 electron in the U atom transfers into the d-electron site of U + ( 4 I 9/2 ) ion. The J value of the U atom produced after the reaction is 6, 5, 4 or 3, at impact energy below several tens eV, only resonant charge transfer in which the product atom is ground state (J=6) takes place. Therefore, the cross section is very small (4-5 x 10 -15 cm 2 ) compared with that considered so far. In the energy range of 100-1000eV the cross section increases with the impact energy because near resonant charge transfer in which an s-electron in the U atom transfers into the d-electron site of U + ion. Charge transfer cross section between U + in the first excited state (289 cm -1 ) and U in the ground state was also obtained. (author)

Fast optically sectioned fluorescence HiLo endomicroscopy

Science.gov (United States)

Ford, Tim N.; Lim, Daryl; Mertz, Jerome

2012-02-01

We describe a nonscanning, fiber bundle endomicroscope that performs optically sectioned fluorescence imaging with fast frame rates and real-time processing. Our sectioning technique is based on HiLo imaging, wherein two widefield images are acquired under uniform and structured illumination and numerically processed to reject out-of-focus background. This work is an improvement upon an earlier demonstration of widefield optical sectioning through a flexible fiber bundle. The improved device features lateral and axial resolutions of 2.6 and 17 μm, respectively, a net frame rate of 9.5 Hz obtained by real-time image processing with a graphics processing unit (GPU) and significantly reduced motion artifacts obtained by the use of a double-shutter camera. We demonstrate the performance of our system with optically sectioned images and videos of a fluorescently labeled chorioallantoic membrane (CAM) in the developing G. gallus embryo. HiLo endomicroscopy is a candidate technique for low-cost, high-speed clinical optical biopsies.

29 CFR 451.4 - Labor organizations under section 3(j).

Science.gov (United States)

2010-07-01

... 29 Labor 2 2010-07-01 2010-07-01 false Labor organizations under section 3(j). 451.4 Section 451.4... 1959 § 451.4 Labor organizations under section 3(j). (a) General. Section 3(j) sets forth five... one of these categories listed in section 3(j) is subject to the requirements of the Act. (b...

Prevalence of urinary incontinence and pelvic floor muscle dysfunction in primiparae two years after cesarean section: cross-sectional study.

Science.gov (United States)

Barbosa, Angélica Mércia Pascon; Marini, Gabriela; Piculo, Fernanda; Rudge, Cibele Vieira Cunha; Calderon, Iracema Mattos Paranhos; Rudge, Marilza Vieira Cunha

2013-01-01

There is uncertainty in the literature regarding the theory that obstetric events and pelvic floor injuries give rise to lower risk of subsequent urinary incontinence among women delivering via cesarean section than among women delivering vaginally. The objective of this study was to assess the two-year postpartum prevalence of urinary incontinence and pelvic floor muscle dysfunction and the factors responsible for them. Cross-sectional study, conducted in a public university. 220 women who had undergone elective cesarean section or vaginal childbirth two years earlier were selected. Their urinary incontinence symptoms were investigated, and their pelvic floor muscle dysfunction was assessed using digital palpation and a perineometer. The two-year urinary incontinence prevalences following vaginal childbirth and cesarean section were 17% and 18.9%, respectively. The only risk factor for pelvic floor muscle dysfunction was weight gain during pregnancy. Body mass index less than 25 kg/m 2 and normal pelvic floor muscle function protected against urinary incontinence. Gestational urinary incontinence increased the risk of two-year postpartum urinary incontinence. Gestational urinary incontinence was a crucial precursor of postpartum urinary incontinence. Weight gain during pregnancy increased the subsequent risk of pelvic floor muscle dysfunction, and elective cesarean section did not prevent urinary incontinence.

Prevalence of urinary incontinence and pelvic floor muscle dysfunction in primiparae two years after cesarean section: cross-sectional study

Directory of Open Access Journals (Sweden)

Angélica Mércia Pascon Barbosa

Full Text Available CONTEXT AND OBJECTIVE There is uncertainty in the literature regarding the theory that obstetric events and pelvic floor injuries give rise to lower risk of subsequent urinary incontinence among women delivering via cesarean section than among women delivering vaginally. The objective of this study was to assess the two-year postpartum prevalence of urinary incontinence and pelvic floor muscle dysfunction and the factors responsible for them. DESIGN AND SETTING Cross-sectional study, conducted in a public university. METHODS 220 women who had undergone elective cesarean section or vaginal childbirth two years earlier were selected. Their urinary incontinence symptoms were investigated, and their pelvic floor muscle dysfunction was assessed using digital palpation and a perineometer. RESULTS The two-year urinary incontinence prevalences following vaginal childbirth and cesarean section were 17% and 18.9%, respectively. The only risk factor for pelvic floor muscle dysfunction was weight gain during pregnancy. Body mass index less than 25 kg/m 2 and normal pelvic floor muscle function protected against urinary incontinence. Gestational urinary incontinence increased the risk of two-year postpartum urinary incontinence. CONCLUSION Gestational urinary incontinence was a crucial precursor of postpartum urinary incontinence. Weight gain during pregnancy increased the subsequent risk of pelvic floor muscle dysfunction, and elective cesarean section did not prevent urinary incontinence.

The MMPI-2 Restructured Form Personality Psychopathology Five Scales: bridging DSM-5 Section 2 personality disorders and DSM-5 Section 3 personality trait dimensions.

Science.gov (United States)

Finn, Jacob A; Arbisi, Paul A; Erbes, Christopher R; Polusny, Melissa A; Thuras, Paul

2014-01-01

This study examined in a college sample and a sample of non-treatment-seeking, trauma-exposed veterans the association between the MMPI-2 Restructured Form (MMPI-2-RF) Personality Psychopathology Five (PSY-5) Scales and DSM-5 Section 2 personality disorder (PD) criteria, the same system used in DSM-IV-TR, and the proposed broad personality trait dimensions contained in Section 3 of DSM-5. DSM-5 Section 2 PD symptoms were assessed using the SCID-II-PQ, and applying a replicated rational selection procedure to the SCID-II-PQ item pool, proxies for the DSM-5 Section 3 dimensions and select facets were constructed. The MMPI-2-RF PSY-5 scales demonstrated appropriate convergent and discriminant associations with both Section 2 PDs and Section 3 dimensions in both samples. These findings suggest the MMPI-2-RF PSY-5 scales can serve both conceptually and practically as a bridge between the DSM-5 Section 2 PD criteria and the DSM-5 Section 3 personality features.

First measurement of the Rayleigh cross section

NARCIS (Netherlands)

Naus, H.; Ubachs, W.

2000-01-01

Rayleigh cross section for N2, Ar and SF6 was performed using the technique of cavity ring-down spectroscopy (CRDS). The experiment was based on the assumption that scattering cross section is equal to the extinction in the absence of absorption. The theory explains the molecular origin of

Total and ionization cross sections of electron scattering by fluorocarbons

International Nuclear Information System (INIS)

Antony, B K; Joshipura, K N; Mason, N J

2005-01-01

Electron impact total cross sections (50-2000 eV) and total ionization cross sections (threshold to 2000 eV) are calculated for typical plasma etching molecules CF 4 , C 2 F 4 , C 2 F 6 , C 3 F 8 and CF 3 I and the CF x (x 1-3) radicals. The total elastic and inelastic cross sections are determined in the spherical complex potential formalism. The sum of the two gives the total cross section and the total inelastic cross section is used to calculate the total ionization cross sections. The present total and ionization cross sections are found to be consistent with other theories and experimental measurements, where they exist. Our total cross section results for CF x (x = 1-3) radicals presented here are first estimates on these species

Measurement cross sections for radioisotopes production

International Nuclear Information System (INIS)

Garrido, E.

2011-01-01

New radioactive isotopes for nuclear medicine can be produced using particle accelerators. This is one goal of Arronax, a high energy - 70 MeV - high intensity - 2*350 μA - cyclotron set up in Nantes. A priority list was established containing β - - 47 Sc, 67 Cu - β + - 44 Sc, 64 Cu, 82 Sr/ 82 Rb, 68 Ge/ 68 Ga - and α emitters - 211 At. Among these radioisotopes, the Scandium 47 and the Copper 67 have a strong interest in targeted therapy. The optimization of their productions required a good knowledge of their cross-sections but also of all the contaminants created during irradiation. We launched on Arronax a program to measure these production cross-sections using the Stacked-Foils' technique. It consists in irradiating several groups of foils - target, monitor and degrader foils - and in measuring the produced isotopes by γ-spectrometry. The monitor - nat Cu or nat Ni - is used to correct beam loss whereas degrader foils are used to lower beam energy. We chose to study the nat Ti(p,X) 47 Sc and 68 Zn(p,2p) 67 Cu reactions. Targets are respectively natural Titanium foil - bought from Goodfellow - and enriched Zinc 68 deposited on Silver. In the latter case, Zn targets were prepared in-house - electroplating of 68 Zn - and a chemical separation between Copper and Gallium isotopes has to be made before γ counting. Cross-section values for more than 40 different reactions cross-sections have been obtained from 18 MeV to 68 MeV. A comparison with the Talys code is systematically done. Several parameters of theoretical models have been studied and we found that is not possible to reproduce faithfully all the cross-sections with a given set of parameters. (author)

FENDL/E. Evaluated nuclear data library of neutron nuclear interaction cross-sections and photon production cross-sections and photon-atom interaction cross sections for fusion applications. Version 1.1 of November 1994

International Nuclear Information System (INIS)

Pashchenko, A.B.; Wienke, H.; Ganesan, S.; McLaughlin, P.K.

1996-01-01

This document presents the description of a physical tape containing the basic evaluated nuclear data library of neutron nuclear interaction cross-sections and photon production cross-sections and photon-atom interaction cross-sections for fusion applications. It is part of FENDL, the evaluated nuclear data library for fusion applications. The nuclear data are available cost-free for distribution to interested scientists upon request. The data can also be retrieved by the user via online access through international computer networks. (author). 11 refs, 1 tab

Reactor-vessel-sectioning demonstration

International Nuclear Information System (INIS)

Lundgren, R.A.

1981-07-01

A successful technical demonstration of simulated reactor vessel sectioning was completed using the combined techniques of air arc gouging and flame cutting. A 4-ft x 3-ft x 9-in. thick sample was fabricated of A36 carbon steel to simulate a reactor vessel wall. A 1/4-in layer of stainless steel (SS) was tungsten inert gas (TIG)-welded to the carbon steel. Several techniques were considered to section the simulated reactor vessel: an air arc gouger was chosen to penetrate the stainless steel, and flame cutting was selected to sever the carbon steel. After the simulated vessel was successfully cut from the SS side, another cut was made, starting from the carbon steel side. This cut was also successful. Cutting from the carbon steel side has the advantages of cost reduction since the air arc gouging step is eliminated and contamination controlled because the molten metal is blown inward

Morfologia externa de Thyridia psidii cetoides (Rosenberg & Talbot. I. Cabeça e apêndices (Lepidoptera, Nymphalidae, Ithomiinae External morphology of Thyridia psidii cetoides (Rosenberg & Talbot. I. Cabeça e apêndices (Lepidoptera, Nymphalidae, Ithomiinae

Directory of Open Access Journals (Sweden)

Jorge Manuel Saraiva Bizarro

2003-06-01

Full Text Available A detailed study of the morphology of the head of Thyridia psidii cetoides (Rosenberg & Talbot, 1914 (Nymphalidae, Ithomiinae adults from both sexes is presented. The material was obtained at the city's plant nursery "Horto Florestal de Curitiba", Paraná, Brazil; mainly by rearing eggs and larvae collected there on Cyphomandra betacea (Canavilles Sendtner, 1845 (Solanaceae. When possible, all the results obtained were compared with those already available in the literature concerning external morphology studies pertinent to other Nymphalidae subfamilies (Brassolinae, Morphinae and Danainae.

A Study of Selected Isozymes in Capsicum baccatum, Capsicum eximium, Capsicum cardenasii and Two Interspecific F1 Hybrids in Capsicum Species

OpenAIRE

ONUS, Ahmet Naci

2014-01-01

Selected isozymes were investigated in plants of Capsicum baccatum L. ( Solanaceae) accessions SA219 (P.G.Smith), Hawkes 6489 (P.G.Smith), Capsicum cardenasii Heiser and Smith accession SA268 (P.G.Smith), Capsicum eximium A.T.Hunz accession Hawkes 3860 (J.G.Hawkes) and two interspecific F1 hybrids, C. baccatum SA219 x C. eximium Hawkes 3860 and C. baccatum Hawkes 6489 x C. cardenasii SA 268. The standard technique of horizontal gel electrophoresis was employed. The gel was cut into severa...

Cross sections for hadron and lepton production processes

International Nuclear Information System (INIS)

Bhattacharya, R.

1976-01-01

Charged heavy lepton production in proton-proton collisions is studied. Motivated by recent experimental results from the Stanford Linear Accelerator Center a parton model analysis is given of the reaction p + p → L + + L - + x → μ +- + e/ -+ / + neutrinos + x. Results are presented for the total cross section and the differential cross sections with respect to the invariant mass squared of the final charged leptons and the transverse momenta of each one of them. The two-photon mechanism for pair production in colliding beam exeriments is considered. Through the use of mapped invariant integration variables, a reliable exact numerical calculation of the cross section for the production of muon and pion pairs by the two-photon mechanism is provided. Results are given for the exact total cross sections and also the differential cross sections with respect to the invariant mass squared of the pair. These are compared to the results obtained from the equivalent photon approximation method

An overview and recent changes in Section I

International Nuclear Information System (INIS)

Bernstein, M.D.

1995-01-01

Power Boilers, Section 1 of the ASME B and PV Code, is the first and oldest of the Code sections, originally published in 1915. Eighty years later Section 1 is well established, and changes are typically incremental rather than dramatic. Before reviewing some of these recent changes, it is useful to provide an overview of Section 1 rules, which were originally, and are still today, standard rules for the construction of steam boilers. Changes of the last few years affect the following portions of Section 1: The Foreword; PG-39 rules regarding small nozzles which can be attached without postweld heat treatment; rules of PG-67 and PG-70 regarding safety valve relieving capacity; PW-28 rules covering weld procedure qualification for certain nonpressure parts; PW-39 rules for postweld heat treatment; a major revision to the PW-43 rules for calculating loads permitted on structural attachments to tube walls; and some ongoing revisions to the Manufacturer's Data Report Forms

Microscopic cross-section measurements by thermal neutron activation

International Nuclear Information System (INIS)

Avila L, J.

1987-08-01

Microscopic cross sections measured by thermal neutron activation using RP-0 reactor at the Peruvian Nuclear Energy Institute. The method consists in measuring microscopic cross section ratios through activated samples, requiring being corrected in thermal and epithermal energetic range by Westcott formalism. Furthermore, the comptage ratios measured for each photopeak to its decay fraction should be normalized from interrelation between both processes above, activation microscopic cross sections are obtained

Distorted eikonal cross sections: A time-dependent view

International Nuclear Information System (INIS)

Turner, R.E.

1982-01-01

For Hamiltonians with two potentials, differential cross sections are written as time-correlation functions of reference and distorted transition operators. Distorted eikonal differential cross sections are defined in terms of straight-line and reference classical trajectories. Both elastic and inelastic results are obtained. Expressions for the inelastic cross sections are presented in terms of time-ordered cosine and sine memory functions through the use of the Zwanzig-Feshbach projection-operator method

Discussion of electron cross sections for transport calculations

International Nuclear Information System (INIS)

Berger, M.J.

1983-01-01

This paper deals with selected aspects of the cross sections needed as input for transport calculations and for the modeling of radiation effects in biological materials. Attention is centered mainly on the cross sections for inelastic interactions between electrons and water molecules and the use of these cross sections for the calculation of energy degradation spectra and of ionization and excitation yields. 40 references, 3 figures, 1 table

Hardon cross sections at ultra high energies

International Nuclear Information System (INIS)

Yodh, G.B.

1987-01-01

A review of results on total hadronic cross sections at ultra high energies obtained from a study of longitudinal development of cosmic ray air showers is given. The experimental observations show that proton-air inelastic cross section increases from 275 mb to over 500 mb as the collision energy in the center of mass increases from 20 GeV to 20 TeV. The proton-air inelastic cross section, obtained from cosmic ray data at √s = 30 TeV, is compared with calculations using various different models for the energy variation of the parameters of the elementary proton-proton interaction. Three conclusions are derived

[Caesarean section and anal incontinence].

Science.gov (United States)

Kalis, V; Stipán, J; Chaloupka, P; Karbanová, J; Rokyta, Z

2008-04-01

Summary of the impact of Caesarean section on anal incontinence. Review. Department of Gynaecology and Obstetrics, Charles University and University Hospital Plzen. Review of the current international literature. Currently, Caesarean section is not considered to reduce symptoms of anal incontinence. If there is any reduction of symptoms, that remains only for a short term (40% in 3 months after the delivery in the largest trial). In a long term, virtually in no trial has been observed any difference, and others, non-obstetrical factors (particularly aging) prevail. Current knowledge does not allow to assess sufficiently pros and cons of Caesarean compared to vaginal delivery. High risk groups, that would profit from elective Ceasarean, have not been clearly identified yet.

Total cross section results for deuterium electrodisintegration

International Nuclear Information System (INIS)

Skopik, D.M.; Murphy, J.J. II; Shin, Y.M.

1976-01-01

Theoretical total cross sections for deuterium electrodisintegration are presented as a function of incident electron energy. The cross section has been calculated using virtual photon theory with Partovi's photodisintegration calculation for E/subx/ > 10 MeV and effective range theory for E/subx/ 2 H(e, n) reaction in Tokamak reactors

Preparation of next generation set of group cross sections. 3

International Nuclear Information System (INIS)

Kaneko, Kunio

2002-03-01

This fiscal year, based on the examination result about the evaluation energy range of heavy element unresolved resonance cross sections, the upper energy limit of the energy range, where ultra-fine group cross sections are produced, was raised to 50 keV, and an improvement of the group cross section processing system was promoted. At the same time, reflecting the result of studies carried out till now, a function producing delayed neutron data was added to the general-purpose group cross section processing system , thus the preparation of general purpose group cross section processing system has been completed. On the other hand, the energy structure, data constitution and data contents of next generation group cross section set were determined, and the specification of a 151 groups next generation group cross section set was defined. Based on the above specification, a concrete library format of the next generation cross section set has been determined. After having carried out the above-described work, using the general-purpose group cross section processing system , which was complete in this study, with use of the JENDL-3. 2 evaluated nuclear data, the 151 groups next generation group cross section of 92 nuclides and the ultra fine group resonance cross section library for 29 nuclides have been prepared. Utilizing the 151 groups next generation group cross section set and the ultra-fine group resonance cross-section library, a bench mark test calculation of fast reactors has been performed by using an advanced lattice calculation code. It was confirmed, by comparing the calculation result with a calculation result of continuous energy Monte Carlo code, that the 151 groups next generation cross section set has sufficient accuracy. (author)

Section XI -- 25 years of development

International Nuclear Information System (INIS)

Hedden, O.F.

1996-01-01

The original concept of nuclear power plant designers was that the higher standards of design and fabrication would make inservice inspections unnecessary, and little attention was given to provisions for access. By 1966 the Atomic Energy Commission recognized that a planned program of periodic inservice inspections would be needed. They began development of criteria, and encouraged industry code-writing organizations to do likewise. These groups joined forces in 1968, and their product was published by ASME in 1970 as part of the Boiler and Pressure Code, Section XI, Rules for Inservice Inspection of Nuclear Reactor Coolant Systems. Section XI, 24 pages in 1970, is now 723 pages. While it originally covered only light water reactor Class 1 components and piping, it now includes Class 2, 3, and containment, and liquid metal cooled reactor plants. Along the way, rules have been developed for gas-cooled and low pressure heavy water reactor plants. The growth in size of Section XI from its modest beginning has been largely because of recognition that the rules governing plant inspection/operation need to be considerably different from the rules provided for the component designer/manufacturer. Rules have been developed in the areas of repair/replacement technology, NDE methodology, NDE acceptance standards, and analytical evaluation methods in the absence of appropriate rules in Section III

Thin-section CT of Cushing's disease

International Nuclear Information System (INIS)

Takahashi, Tatsuo; Kuwayama, Akio; Katoh, Tetsuo; Ichihara, Kaoru; Kageyama, Naoki; Nakamura, Koji.

1983-01-01

Using 1.5 mm contiguous sections with a GE CT/T 8800 scanner, we investigated the sellar regions of 22 cases of Cushing's diseases which had been diagnosed endocrinologically. Each sellar turcica was normal in size, and in only 5 cases were there significant findings on 2 mm-thick sellar-floor polytomography. Nine tumors appeared as regions of a hypodense area, and three tumors were diagnosed by indirect signs, for example, stalk deviation and diaphragmatic plane asymmetry. The other 10 cases, especially those previously operated on or irradiated, were diagnosed as falsely positive or negative. Because it is best of the microadenomas appear hypodense within the strongly contrast-enhanced anterior pituitary glands, it is better for scans to be obtained immediately after rapid intravenous contrast infusion. Hypodense areas of microadenomas are best demonstrated on direct coronal scans or reversed scans of 1.5 mm-thickness thin-slice sections. By these methods, microadenomas, if they are over 5-6 mm in diameter, can appear as hypodense. Sellar floor findings by means of thin-section CT were more sensitive than those of polytomography and had more advantages in local diagnosis. If the tumor were over 4 mm in diameter, local changes in the sellar floor could be demonstrated by thin-section CT, but by polytomography no changes in the sellar floor could be demonstrated until the tumor size reached 6 mm. (author)

Practicable methods for histological section thickness measurement in quantitative stereological analyses.

Science.gov (United States)

Matenaers, Cyrill; Popper, Bastian; Rieger, Alexandra; Wanke, Rüdiger; Blutke, Andreas

2018-01-01

The accuracy of quantitative stereological analysis tools such as the (physical) disector method substantially depends on the precise determination of the thickness of the analyzed histological sections. One conventional method for measurement of histological section thickness is to re-embed the section of interest vertically to its original section plane. The section thickness is then measured in a subsequently prepared histological section of this orthogonally re-embedded sample. However, the orthogonal re-embedding (ORE) technique is quite work- and time-intensive and may produce inaccurate section thickness measurement values due to unintentional slightly oblique (non-orthogonal) positioning of the re-embedded sample-section. Here, an improved ORE method is presented, allowing for determination of the factual section plane angle of the re-embedded section, and correction of measured section thickness values for oblique (non-orthogonal) sectioning. For this, the analyzed section is mounted flat on a foil of known thickness (calibration foil) and both the section and the calibration foil are then vertically (re-)embedded. The section angle of the re-embedded section is then calculated from the deviation of the measured section thickness of the calibration foil and its factual thickness, using basic geometry. To find a practicable, fast, and accurate alternative to ORE, the suitability of spectral reflectance (SR) measurement for determination of plastic section thicknesses was evaluated. Using a commercially available optical reflectometer (F20, Filmetrics®, USA), the thicknesses of 0.5 μm thick semi-thin Epon (glycid ether)-sections and of 1-3 μm thick plastic sections (glycolmethacrylate/ methylmethacrylate, GMA/MMA), as regularly used in physical disector analyses, could precisely be measured within few seconds. Compared to the measured section thicknesses determined by ORE, SR measures displayed less than 1% deviation. Our results prove the applicability

Section 60 revisited (The Ontario Electrical Safety Code)

Energy Technology Data Exchange (ETDEWEB)

Olechna, T.

2003-06-01

Recent changes to the Ontario Electrical Safety Code (OESC), specifically the deletion of Section 60, Electrical Communication Systems, are discussed in an effort to explain the history behind the decision and the time frame of the changes. Communication systems include telephone, telegraph, data communications, intercommunications, wired music and paging systems. In brief, the deletion of Section 60 occurred in 1983, and resulted from the fact that communication-type wiring was historically the property of the communications utility and under federal jurisdiction. Since such equipment was under federal jurisdiction, they were not inspected in Ontario, hence the deletion of Section 60 from the Ontario Code. It should be noted that although Section 60 is deleted, a number of rules applicable to communications circuits are spread throughout various sections of the Code, notably in Rule 1-032 dealing with damage and interference, Rule 4-022 involving harmonics issues, Rule 12-904(2) regulates the use of conductors that are of different sources of voltage, and Rule 10-708 which specifies the spacing and bonding requirements for communications systems. The end result is that even though Section 60 was deleted, there are these and other rules in the OESC that have direct impact on communications circuits and in effect help to protect the integrity of the system.

Electron-impact ionization cross section of rubidium

International Nuclear Information System (INIS)

Kim, Y.; Migdalek, J.; Siegel, W.; Bieron, J.

1998-01-01

A theoretical model for electron-impact ionization cross section has been applied to Rb and the theoretical cross section (from the threshold to 1 keV in incident energy) is in good agreement with the recent experimental data obtained using Rb atoms trapped in a magneto-optical trap. The theoretical model, called the binary-encounter endash dipole (BED) model, combines a modified Mott cross section with the high-energy behavior of Born cross sections. To obtain the continuum dipole oscillator strength df/dE of the 5s electron required in the BED model, we used Dirac-Fock continuum wave functions with a core polarization potential that reproduced the known position of the Cooper minimum in the photoionization cross section. For inner-shell ionization, we used a simpler version of df/dE, which retained the hydrogenic shape. The contributions of the 4p→4d, 5s, and 5p autoionizing excitations were estimated using the plane-wave Born approximation. As a by-product, we also present the dipole oscillator strengths for the 5s→np 1/2 and 5s→np 3/2 transitions for high principal quantum numbers n near the ionization threshold obtained from the Dirac-Fock wave functions with the same core polarization potential as that used for the continuum wave functions. copyright 1998 The American Physical Society

Prolonged labour as indication for emergency caesarean section

DEFF Research Database (Denmark)

Maaløe, Nanna; Sorensen, B L; Onesmo, R

2012-01-01

To audit the quality of obstetric management preceding emergency caesarean sections for prolonged labour.......To audit the quality of obstetric management preceding emergency caesarean sections for prolonged labour....

Developing Scientific Reasoning Through Drawing Cross-Sections

Science.gov (United States)

Hannula, K. A.

2012-12-01

Cross-sections and 3D models of subsurface geology are typically based on incomplete information (whether surface geologic mapping, well logs, or geophysical data). Creating and evaluating those models requires spatial and quantitative thinking skills (including penetrative thinking, understanding of horizontality, mental rotation and animation, and scaling). However, evaluating the reasonableness of a cross-section or 3D structural model also requires consideration of multiple possible geometries and geologic histories. Teaching students to create good models requires application of the scientific methods of the geosciences (such as evaluation of multiple hypotheses and combining evidence from multiple techniques). Teaching these critical thinking skills, especially combined with teaching spatial thinking skills, is challenging. My Structural Geology and Advanced Structural Geology courses have taken two different approaches to developing both the abilities to visualize and to test multiple models. In the final project in Structural Geology (a 3rd year course with a pre-requisite sophomore mapping course), students create a viable cross-section across part of the Wyoming thrust belt by hand, based on a published 1:62,500 geologic map. The cross-section must meet a number of geometric criteria (such as the template constraint), but is not required to balance. Each student tries many potential geometries while trying to find a viable solution. In most cases, the students don't visualize the implications of the geometries that they try, but have to draw them and then erase their work if it does not meet the criteria for validity. The Advanced Structural Geology course used Midland Valley's Move suite to test the cross-sections that they made in Structural Geology, mostly using the flexural slip unfolding algorithm and testing whether the resulting line lengths balanced. In both exercises, students seemed more confident in the quality of their cross-sections when the

Route 6, Section Pristina – Skopje

OpenAIRE

, F. Isufi; , N. Kelmendi; , F. Humolli; , S. Bulliqi

2016-01-01

Republic of Kosovo in the last 3-4 years has improved the road infrastructure, among others, by improving conditions for the needs of citizens of the country and by meeting the requirements of international organizations who are seeking with the right that the region of South-East to have the performance equivalent to EU standards. Section Pristina-Skopje of Route 6 represents one of the most important sections of this road going through important parts of the country and enabling direct link...

Surface tensor estimation from linear sections

DEFF Research Database (Denmark)

Kousholt, Astrid; Kiderlen, Markus; Hug, Daniel

From Crofton's formula for Minkowski tensors we derive stereological estimators of translation invariant surface tensors of convex bodies in the n-dimensional Euclidean space. The estimators are based on one-dimensional linear sections. In a design based setting we suggest three types of estimators....... These are based on isotropic uniform random lines, vertical sections, and non-isotropic random lines, respectively. Further, we derive estimators of the specific surface tensors associated with a stationary process of convex particles in the model based setting....

Surface tensor estimation from linear sections

DEFF Research Database (Denmark)

Kousholt, Astrid; Kiderlen, Markus; Hug, Daniel

2015-01-01

From Crofton’s formula for Minkowski tensors we derive stereological estimators of translation invariant surface tensors of convex bodies in the n-dimensional Euclidean space. The estimators are based on one-dimensional linear sections. In a design based setting we suggest three types of estimators....... These are based on isotropic uniform random lines, vertical sections, and non-isotropic random lines, respectively. Further, we derive estimators of the specific surface tensors associated with a stationary process of convex particles in the model based setting....

Optical Model and Cross Section Uncertainties

Energy Technology Data Exchange (ETDEWEB)

Herman,M.W.; Pigni, M.T.; Dietrich, F.S.; Oblozinsky, P.

2009-10-05

Distinct minima and maxima in the neutron total cross section uncertainties were observed in model calculations using spherical optical potential. We found this oscillating structure to be a general feature of quantum mechanical wave scattering. Specifically, we analyzed neutron interaction with 56Fe from 1 keV up to 65 MeV, and investigated physical origin of the minima.We discuss their potential importance for practical applications as well as the implications for the uncertainties in total and absorption cross sections.

Meeting cross-section requirements for nuclear-energy design

Energy Technology Data Exchange (ETDEWEB)

Weisbin, C.R.; de Saussure, G.; Santoro, R.T. (Oak Ridge National Lab., TN (USA)); Gilai, T. (Ben-Gurion Univ. of the Negev, Beersheba (Israel))

1982-01-01

Current requirements in cross-section data that are essential to nuclear-energy programmes are summarized and explained and some insight into how these data might be obtained is provided. The six sections of the paper describe: design parameters and target accuracies; data collection, evaluation and analysis; determination of high-accuracy differential nuclear data for technological applications; status of selected evaluated nuclear data; analysis of benchmark testing; identification of important cross sections and inferred needs.

7 CFR 27.9 - Marketing Services Offices; Grading Section.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Marketing Services Offices; Grading Section. 27.9 Section 27.9 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE....9 Marketing Services Offices; Grading Section. Marketing Services Offices shall be maintained at...

Average cross sections for the 252Cf neutron spectrum

International Nuclear Information System (INIS)

Dezso, Z.; Csikai, J.

1977-01-01

A number of average cross sections have been measured for 252 Cf neutrons in (n, γ), (n,p), (n,2n), (n,α) reactions by the activation method and for fission by fission chamber. Cross sections have been determined for 19 elements and 45 reactions. The (n,γ) cross section values lie in the interval from 0.3 to 200 mb. The data as a function of target neutron number increases up to about N=60 with minimum near to dosed shells. The values lie between 0.3 mb and 113 mb. These cross sections decrease significantly with increasing the threshold energy. The values are below 20 mb. The data do not exceed 10 mb. Average (n,p) cross sections as a function of the threshold energy and average fission cross sections as a function of Zsup(4/3)/A are shown. The results obtained are summarized in tables

Torsion of the bar of the round transverse section from the variable on length and the transverse section porosity

Directory of Open Access Journals (Sweden)

Shlyakhov S.M.

2017-06-01

Full Text Available The present article is devoted to the task of finding of level of the secondary tangent voltages arising in sections because of a variable on porosity length. The decision of such task will allow to consider secondary tangent voltages in case of determination of bearing capacity of a porous bar. Distribution of porosity on a transverse section is set rationally - pro-ceeding from early the solved tasks on selection of porosity in case of torsion of a bar of a round transverse section, on bar length – under the linear law. A research objective is to determine the level of secondary tangent voltages and to evaluate from value.

MXS cross-section preprocessor user's manual

International Nuclear Information System (INIS)

Parker, F.; Ishikawa, M.; Luck, L.

1987-03-01

The MXS preprocessor has been designed to reduce the execution time of programs using isotopic cross-section data and to both reduce the execution time and improve the accuracy of shielding-factor interpolation in the SIMMER-II accident analysis program. MXS is a dual-purpose preprocessing code to: (1) mix isotopes into materials and (2) fit analytic functions to the shelf-shielding data. The program uses the isotope microscopic neutron cross-section data from the CCCC standard interface file ISOTXS and the isotope Bondarenko self-shielding data from the CCCC standard interface file BRKOXS to generate cross-section and self-shielding data for materials. The materials may be a mixture of several isotopes. The self-shielding data for the materials may be the actual shielding factors or a set of coefficients for functions representing the background dependence of the shielding factors. A set of additional data is given to describe the functions necessary to interpolate the shielding factors over temperature

Youssef’s Syndrome following Cesarean Section

Directory of Open Access Journals (Sweden)

Ozer Birge

2015-01-01

Full Text Available Youssef’s syndrome is characterized by cyclic hematuria (menouria, absence of vaginal bleeding (amenorrhea, and urinary incontinence due to vesicouterine fistula (VUF, the least common of the urogynecological fistulas. Youssef’s syndrome has a variable clinical presentation. A vesicouterine fistula is an abnormal pathway between the bladder and the uterus. The most common cause is lower segment Cesarean section. Conservative treatment may be appropriate in some cases, but surgery is the definitive treatment. Vesicouterine fistula should be suspected in cases presenting with urinary incontinence even years after Cesarean section. Diagnostic tests as well as necessary appropriate surgery should be performed on cases with suspected vesicouterine fistula. We present a 40-year-old multiparous woman with vesicouterine fistula after primary Cesarean section; she presented with urinary incontinence, hematuria, and amenorrhea 1 year after the birth. Here, we discuss our case with the help of previously published studies found in the literature.

Neutron capture cross sections of Kr

Directory of Open Access Journals (Sweden)

Fiebiger Stefan

2017-01-01

Full Text Available Neutron capture and β− -decay are competing branches of the s-process nucleosynthesis path at 85Kr [1], which makes it an important branching point. The knowledge of its neutron capture cross section is therefore essential to constrain stellar models of nucleosynthesis. Despite its importance for different fields, no direct measurement of the cross section of 85Kr in the keV-regime has been performed. The currently reported uncertainties are still in the order of 50% [2, 3]. Neutron capture cross section measurements on a 4% enriched 85Kr gas enclosed in a stainless steel cylinder were performed at Los Alamos National Laboratory (LANL using the Detector for Advanced Neutron Capture Experiments (DANCE. 85Kr is radioactive isotope with a half life of 10.8 years. As this was a low-enrichment sample, the main contaminants, the stable krypton isotopes 83Kr and 86Kr, were also investigated. The material was highly enriched and contained in pressurized stainless steel spheres.

NNLO jet cross sections by subtraction

Science.gov (United States)

Somogyi, G.; Bolzoni, P.; Trócsányi, Z.

2010-08-01

We report on the computation of a class of integrals that appear when integrating the so-called iterated singly-unresolved approximate cross section of the NNLO subtraction scheme of Refs. [G. Somogyi, Z. Trócsányi, and V. Del Duca, JHEP 06, 024 (2005), arXiv:hep-ph/0502226; G. Somogyi and Z. Trócsányi, (2006), arXiv:hep-ph/0609041; G. Somogyi, Z. Trócsányi, and V. Del Duca, JHEP 01, 070 (2007), arXiv:hep-ph/0609042; G. Somogyi and Z. Trócsányi, JHEP 01, 052 (2007), arXiv:hep-ph/0609043] over the factorised phase space of unresolved partons. The integrated approximate cross section itself can be written as the product of an insertion operator (in colour space) times the Born cross section. We give selected results for the insertion operator for processes with two and three hard partons in the final state.

40 CFR 52.2087 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan.... (B) Original consent agreement between the Rhode Island Department of Environmental Management and...

Multifamily Assistance Section 8 Contracts

Data.gov (United States)

Department of Housing and Urban Development — he information regarding the Multifamily Assistance and Section 8 contracts, and properties is being furnished for the convenience of interested parties. The...

Validation of evaluated neutron standard cross sections

International Nuclear Information System (INIS)

Badikov, S.; Golashvili, T.

2008-01-01

Some steps of the validation and verification of the new version of the evaluated neutron standard cross sections were carried out. In particular: -) the evaluated covariance data was checked for physical consistency, -) energy-dependent evaluated cross-sections were tested in most important neutron benchmark field - 252 Cf spontaneous fission neutron field, -) a procedure of folding differential standard neutron data in group representation for preparation of specialized libraries of the neutron standards was verified. The results of the validation and verification of the neutron standards can be summarized as follows: a) the covariance data of the evaluated neutron standards is physically consistent since all the covariance matrices of the evaluated cross sections are positive definite, b) the 252 Cf spectrum averaged standard cross-sections are in agreement with the evaluated integral data (except for 197 Au(n,γ) reaction), c) a procedure of folding differential standard neutron data in group representation was tested, as a result a specialized library of neutron standards in the ABBN 28-group structure was prepared for use in reactor applications. (authors)

User's manual for BECAS. A cross section analysis tool for anisotropic and inhomogeneous beam sections of arbitrary geometry

Energy Technology Data Exchange (ETDEWEB)

Blasques, J.P.

2012-02-15

The BEam Cross section Analysis Software - BECAS - is a group of Matlab functions used for the analysis of the stiffness and mass properties of beam cross sections. The report presents BECAS' code and user's guide. (LN)

Parameterized representation of macroscopic cross section for PWR reactor

International Nuclear Information System (INIS)

Fiel, João Cláudio Batista; Carvalho da Silva, Fernando; Senra Martinez, Aquilino; Leal, Luiz C.

2015-01-01

Highlights: • This work describes a parameterized representation of the homogenized macroscopic cross section for PWR reactor. • Parameterization enables a quick determination of problem-dependent cross-sections to be used in few group calculations. • This work allows generating group cross-section data to perform PWR core calculations without computer code calculations. - Abstract: The purpose of this work is to describe, by means of Chebyshev polynomials, a parameterized representation of the homogenized macroscopic cross section for PWR fuel element as a function of soluble boron concentration, moderator temperature, fuel temperature, moderator density and 235 92 U enrichment. The cross-section data analyzed are fission, scattering, total, transport, absorption and capture. The parameterization enables a quick and easy determination of problem-dependent cross-sections to be used in few group calculations. The methodology presented in this paper will allow generation of group cross-section data from stored polynomials to perform PWR core calculations without the need to generate them based on computer code calculations using standard steps. The results obtained by the proposed methodology when compared with results from the SCALE code calculations show very good agreement

The total collision cross section in the glory region

International Nuclear Information System (INIS)

Biesen, J.J.H. van den.

1982-01-01

Chapter 1 presents a calculation of approximate total cross sections in the glory region from noble gas potentials. The relations between the main features of the total cross section and the properties of the potential to which these are sensitive are extensively investigated in chapter II. A beam apparatus has been developed, which allows for accurate measurements on the total cross section. All effects due to the finite angular and velocity resolution of the apparatus can be eliminated from the data to yield actual total cross sections as a function of the relative velocity. This facilitates a comparison to total cross sections predicted by potentials available in the literature. A brief description of the apparatus and of the data reduction is given in chapter III. The total cross section data obtained for various noble gas combinations are presented and analysed in chapter IV, where also a large number of potentials proposed in the literature is tested. In chapter V the quenching of the glories in the case of a non-spherical interaction is analysed. Subsequently, total cross section data for some atom-molecule systems are discussed. (Auth.)

Proton-air and proton-proton cross sections

Directory of Open Access Journals (Sweden)

Ulrich Ralf

2013-06-01

Full Text Available Different attempts to measure hadronic cross sections with cosmic ray data are reviewed. The major results are compared to each other and the differences in the corresponding analyses are discussed. Besides some important differences, it is crucial to see that all analyses are based on the same fundamental relation of longitudinal air shower development to the observed fluctuation of experimental observables. Furthermore, the relation of the measured proton-air to the more fundamental proton-proton cross section is discussed. The current global picture combines hadronic proton-proton cross section data from accelerator and cosmic ray measurements and indicates a good consistency with predictions of models up to the highest energies.

Fission-neutron displacement cross sections in metals

International Nuclear Information System (INIS)

Takamura, Saburo; Aruga, Takeo; Nakata, Kiyotomo

1985-01-01

The sensitivity damage rates for 22 metals were measured after fission-spectrum neutron irradiation at low temperature and the experimental damage rates were compared with the theoretical calculation. The relation between the theoretical displacement cross section and the atomic weight of metals can be written by two curves; one is for fcc and hcp metals, and another is for bcc metals. On the other hand, the experimental displacement cross section versus atomic weight is shown approximately by a curve for both fcc and bcc metals, and the cross section for hcp metals deviates from the curve. The defect production efficiency is 0.3-0.4 for fcc metals and 0.6-0.8 for bcc metals. (orig.)

Cross section library DOSCROS77 (in the SAND-II format)

International Nuclear Information System (INIS)

Zijp, W.L.; Nolthenius, H.J.; Borg, N.J.C.M. van der.

1977-08-01

The dosimetry cross section library DOSCROS77 is documented with tables, plots and cross section values averaged over a few reference spectra. This library is based on the ENDF/B-IV dosimetry file, supplemented with some other evaluations. The total number of reaction cross section sets incorporated in this library is 49 (+3 cover cross sections sets). The cross section data are available in a format which is suitable for the program SAND-II

40 CFR 52.465 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Delaware § 52.465 Original identification of plan section. (a) This section identifies the original “Air Implementation Plan for the State...

40 CFR 52.69 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Alabama § 52.69 Original identification of plan section. (a) This section identifies the original “Air Implementation Plan for the State...

40 CFR 52.536 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Florida § 52.536 Original identification of plan section. (a) This section identifies the original “State of Florida Air Implementation...

40 CFR 52.939 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Kentucky § 52.939 Original identification of plan section. (a) This section identifies the original “Air Implementation Plan for the...

40 CFR 52.677 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Idaho § 52.677 Original identification of plan section. (a) This section identifies the original “Idaho Air Quality Implementation Plan...

40 CFR 52.824 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Iowa § 52.824 Original identification of plan section. (a) This section identifies the original “Air Implementation Plan for the State...

40 CFR 52.2635 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section... Original identification of plan section. (a) This section identifies the original “Air Implementation Plan... implementation plan (SIP) for Sheridan, Wyoming. In addition to the original August 28 submittal, eight...

40 CFR 52.875 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Kansas § 52.875 Original identification of plan section. (a) This section identifies the original “Air Quality Implementation Plan for the...

40 CFR 52.590 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Georgia> § 52.590 Original identification of plan section. (a) This section identifies the original “Air Implementation Plan for the State...

40 CFR 52.200 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Arkansas § 52.200 Original identification of plan section. (a) This section identifies the original “Arkansas Plan for Implementation for...

40 CFR 52.2134 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Original identification of plan section... Original identification of plan section. (a) This section identifies the original “South Carolina Air... Charleston; for these two sources, the plan's original emission limits continue to apply.) (10) Permit...

40 CFR 52.999 - Original identification of plan section.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Original identification of plan section... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Louisiana § 52.999 Original identification of plan section. (a) This section identifies the original “The Louisiana Air Control Commission...