WorldWideScience

Sample records for secondary darwinian method

  1. Darwinian evolution

    NARCIS (Netherlands)

    Jagers op Akkerhuis, Gerard A.J.M.; Spijkerboer, Hendrik Pieter; Koelewijn, Hans Peter

    2016-01-01

    Darwinian evolution is a central tenet in biology. Conventionally, the defi nition of Darwinian evolution is linked to a population-based process that can be measured by focusing on changes in DNA/allele frequencies. However, in some publications it has been suggested that selection represents a

  2. What makes Darwinian hydrology "Darwinian"? Asking a different kind of question about landscapes

    Science.gov (United States)

    Harman, C.; Troch, P. A.

    2014-02-01

    There have been repeated calls for a Darwinian approach to hydrologic science, or for a synthesis of Darwinian and Newtonian approaches, to deepen understanding of the hydrologic system in the larger landscape context, and so develop a better basis for predictions now and in an uncertain future. But what exactly makes a Darwinian approach to hydrology "Darwinian"? While there have now been a number of discussions of Darwinian approaches, many referencing Harte (2002), the term is potentially a source of confusion because its connections to Darwin remain allusive rather than explicit. Here we suggest that the Darwinian approach to hydrology follows the example of Charles Darwin by focusing attention on the patterns of variation in populations and seeking hypotheses that explain these patterns in terms of the mechanisms and conditions that determine their historical development. These hypotheses do not simply catalog patterns or predict them statistically - they connect the present structure with processes operating in the past. Nor are they explanations presented without independent evidence or critical analysis - Darwin's hypotheses about the mechanisms underlying present-day variation could be independently tested and validated. With a Darwinian framework in mind, it is easy to see that a great deal of hydrologic research has already been done that contributes to a Darwinian hydrology - whether deliberately or not. We discuss some practical and philosophical issues with this approach to hydrologic science: how are explanatory hypotheses generated? What constitutes a good hypothesis? How are hypotheses tested? "Historical" sciences - including paleohydrology - have long grappled with these questions, as must a Darwinian hydrologic science. We can draw on Darwin's own example for some answers, though there are ongoing debates about the philosophical nature of his methods and reasoning. Darwin used a range of methods of historical reasoning to develop explanatory

  3. Darwinian Model Building

    NARCIS (Netherlands)

    Kester, Do; Bontekoe, Romke; MohammadDjafari, A; Bercher, JF; Bessiere, P

    2010-01-01

    We present a way to generate heuristic mathematical models based on the Darwinian principles of variation and selection in a pool of individuals over many generations. Each individual has a genotype (the hereditary properties) and a phenotype (the expression of these properties in the environment).

  4. Darwinian Model Building

    International Nuclear Information System (INIS)

    Kester, Do; Bontekoe, Romke

    2011-01-01

    We present a way to generate heuristic mathematical models based on the Darwinian principles of variation and selection in a pool of individuals over many generations. Each individual has a genotype (the hereditary properties) and a phenotype (the expression of these properties in the environment). Variation is achieved by cross-over and mutation operations on the genotype which consists in the present case of a single chromosome. The genotypes 'live' in the environment of the data. Nested Sampling is used to optimize the free parameters of the models given the data, thus giving rise to the phenotypes. Selection is based on the phenotypes.The evidences which naturally follow from the Nested Sampling Algorithm are used in a second level of Nested Sampling to find increasingly better models.The data in this paper originate from the Leiden Cytology and Pathology Laboratory (LCPL), which screens pap smears for cervical cancer. We have data for 1750 women who on average underwent 5 tests each. The data on individual women are treated as a small time series. We will try to estimate the next value of the prime cancer indicator from previous tests of the same woman.

  5. Quantum Darwinism as a Darwinian process

    OpenAIRE

    Campbell, John

    2010-01-01

    The Darwinian nature of Wojciech Zurek's theory of Quantum Darwinism is evaluated against the criteria of a Darwinian process as understood within Universal Darwinism. The characteristics of a Darwinian process are developed including the consequences of accumulated adaptations resulting in adaptive systems operating in accordance with Friston's free energy principle and employing environmental simulations. Quantum theory, as developed in Zurek's research program and encapsulated by his theor...

  6. Darwinian evolution on a chip.

    Directory of Open Access Journals (Sweden)

    Brian M Paegel

    2008-04-01

    Full Text Available Computer control of Darwinian evolution has been demonstrated by propagating a population of RNA enzymes in a microfluidic device. The RNA population was challenged to catalyze the ligation of an oligonucleotide substrate under conditions of progressively lower substrate concentrations. A microchip-based serial dilution circuit automated an exponential growth phase followed by a 10-fold dilution, which was repeated for 500 log-growth iterations. Evolution was observed in real time as the population adapted and achieved progressively faster growth rates over time. The final evolved enzyme contained a set of 11 mutations that conferred a 90-fold improvement in substrate utilization, coinciding with the applied selective pressure. This system reduces evolution to a microfluidic algorithm, allowing the experimenter to observe and manipulate adaptation.

  7. Darwinian hydrology: can the methodology Charles Darwin pioneered help hydrologic science?

    Science.gov (United States)

    Harman, C.; Troch, P. A.

    2013-05-01

    There have been repeated calls for a Darwinian approach to hydrologic science or for a synthesis of Darwinian and Newtonian approaches, to deepen understanding the hydrologic system in the larger landscape context, and so develop a better basis for predictions now and in an uncertain future. But what exactly makes a Darwinian approach to hydrology "Darwinian"? While there have now been a number of discussions of Darwinian approaches, many referencing Harte (2002), the term is potentially a source of confusion while its connections to Darwin remain allusive rather than explicit. Here we discuss the methods that Charles Darwin pioneered to understand a variety of complex systems in terms of their historical processes of change. We suggest that the Darwinian approach to hydrology follows his lead by focusing attention on the patterns of variation in populations, seeking hypotheses that explain these patterns in terms of the mechanisms and conditions that determine their historical development, using deduction and modeling to derive consequent hypotheses that follow from a proposed explanation, and critically testing these hypotheses against new observations. It is not sufficient to catalogue the patterns or predict them statistically. Nor is it sufficient for the explanations to amount to a "just-so" story not subject to critical analysis. Darwin's theories linked present-day variation to mechanisms that operated over history, and could be independently test and falsified by comparing new observations to the predictions of corollary hypotheses they generated. With a Darwinian framework in mind it is easy to see that a great deal of hydrologic research has already been done that contributes to a Darwinian hydrology - whether deliberately or not. The various heuristic methods that Darwin used to develop explanatory theories - extrapolating mechanisms, space for time substitution, and looking for signatures of history - have direct application in hydrologic science. Some

  8. Darwinian Controversies: An Historiographical Recounting

    Science.gov (United States)

    Depew, David J.

    2010-05-01

    This essay reviews key controversies in the history of the Darwinian research tradition: the Wilberforce-Huxley debate in 1860, early twentieth-century debates about the heritability of acquired characteristics and the consistency of Mendelian genetics with natural selection; the 1925 Scopes trial about teaching evolution; tensions about race, culture, and eugenics at the 1959 centenary celebration Darwin’s Origin of Species; adaptationism and its critics in the Sociobiology debate of 1970s and, more recently, Evolutionary Psychology; and current disputes about Intelligent Design. These controversies, I argue, are etched into public memory because they occur at the emotionally charged boundaries between public-political, technical-scientific, and personal-religious spheres of discourse. Over most of them falls the shadow of eugenics. The main lesson is that the history of Darwinism cannot be told except by showing the mutual influence of the different norms of discourse that obtain in the personal, technical, and public spheres. Nor can evolutionary biology successfully be taught to citizens and citizens-to-be until the fractious intersections between spheres of discourse have been made explicit. In the course of showing why, I take rival evolutionary approaches to be dynamical historical research traditions rather than static theories. Accordingly, I distinguish Darwin’s version of Darwinism from its later transformations. I pay special attention to the role Darwin assigned to development in evolution, which was marginalized by twentieth-century population genetical Darwinism, but has recently resurfaced in new forms. I also show how the disputed phrases “survival of the fittest” and “social Darwinism” have shaped personal anxieties about “Darwinism,” have provoked public opposition to teaching evolution in public schools, and have cast a shadow over efforts to effectively communicate to the public largely successful technical efforts to make

  9. Nonequilibrium Entropic Bounds for Darwinian Replicators

    Directory of Open Access Journals (Sweden)

    Jordi Piñero

    2018-01-01

    Full Text Available Life evolved on our planet by means of a combination of Darwinian selection and innovations leading to higher levels of complexity. The emergence and selection of replicating entities is a central problem in prebiotic evolution. Theoretical models have shown how populations of different types of replicating entities exclude or coexist with other classes of replicators. Models are typically kinetic, based on standard replicator equations. On the other hand, the presence of thermodynamical constraints for these systems remain an open question. This is largely due to the lack of a general theory of statistical methods for systems far from equilibrium. Nonetheless, a first approach to this problem has been put forward in a series of novel developements falling under the rubric of the extended second law of thermodynamics. The work presented here is twofold: firstly, we review this theoretical framework and provide a brief description of the three fundamental replicator types in prebiotic evolution: parabolic, malthusian and hyperbolic. Secondly, we employ these previously mentioned techinques to explore how replicators are constrained by thermodynamics. Finally, we comment and discuss where further research should be focused on.

  10. Sexual selection: Another Darwinian process.

    Science.gov (United States)

    Gayon, Jean

    2010-02-01

    the Darwin-Wallace controversy was that most Darwinian biologists avoided the subject of sexual selection until at least the 1950s, Ronald Fisher being a major exception. This controversy still deserves attention from modern evolutionary biologists, because the modern approach inherits from both Darwin and Wallace. The modern approach tends to present sexual selection as a special aspect of the theory of natural selection, although it also recognizes the big difficulties resulting from the inevitable interaction between these two natural processes of selection. And contra Wallace, it considers mate choice as a major process that deserves a proper evolutionary treatment. The paper's conclusion explains why sexual selection can be taken as a test case for a proper assessment of "Darwinism" as a scientific tradition. Darwin's and Wallace's attitudes towards sexual selection reveal two different interpretations of the principle of natural selection: Wallace's had an environmentalist conception of natural selection, whereas Darwin was primarily sensitive to the element of competition involved in the intimate mechanism of any natural process of selection. Sexual selection, which can lack adaptive significance, reveals this exemplarily. 2010 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  11. Authentic Teaching Experiences in Secondary Mathematics Methods

    Science.gov (United States)

    Stickles, Paula R.

    2015-01-01

    Often secondary mathematics methods courses include classroom peer teaching, but many pre-service teachers find it challenging to teach their classmate peers as there are no discipline issues and little mathematical discourse as the "students" know the content. We will share a recent change in our methods course where pre-service…

  12. Directional Darwinian Selection in proteins.

    Science.gov (United States)

    McClellan, David A

    2013-01-01

    Molecular evolution is a very active field of research, with several complementary approaches, including dN/dS, HON90, MM01, and others. Each has documented strengths and weaknesses, and no one approach provides a clear picture of how natural selection works at the molecular level. The purpose of this work is to present a simple new method that uses quantitative amino acid properties to identify and characterize directional selection in proteins. Inferred amino acid replacements are viewed through the prism of a single physicochemical property to determine the amount and direction of change caused by each replacement. This allows the calculation of the probability that the mean change in the single property associated with the amino acid replacements is equal to zero (H0: μ = 0; i.e., no net change) using a simple two-tailed t-test. Example data from calanoid and cyclopoid copepod cytochrome oxidase subunit I sequence pairs are presented to demonstrate how directional selection may be linked to major shifts in adaptive zones, and that convergent evolution at the whole organism level may be the result of convergent protein adaptations. Rather than replace previous methods, this new method further complements existing methods to provide a holistic glimpse of how natural selection shapes protein structure and function over evolutionary time.

  13. Method for the secondary recovery of petroleum

    Energy Technology Data Exchange (ETDEWEB)

    Roth, H H

    1966-10-11

    A method for the secondary recovery of petroleum from subterranean formations consists of flooding these formations with aqueous fluids. These aqueous fluids contain one or more saline solutes which are either present before the flooding or which are dissolved from the formation during flooding. These fluids contain, as a thickening agent, a substantially linear, high molecular weight, water-soluble alkenylaromatic polymer which has sulfonic acid or sulfonate groups on the aromatic nuclei. This saline solute and polymer are mutually compatible. (5 claims)

  14. The relativity of Darwinian populations and the ecology of endosymbiosis.

    Science.gov (United States)

    Stencel, Adrian

    If there is a single discipline of science calling the basic concepts of biology into question, it is without doubt microbiology. Indeed, developments in microbiology have recently forced us to rethink such fundamental concepts as the organism, individual, and genome. In this paper I show how microorganisms are changing our understanding of natural aggregations and develop the concept of a Darwinian population to embrace these discoveries. I start by showing that it is hard to set the boundaries of a Darwinian population, and I suggest thinking of a Darwinian population as a relative property of a Darwinian individual. Then I argue, in contrast to the commonly held view, that Darwinian populations are multispecies units, and that in order to accept the multispecies account of Darwinian populations we have to separate fitness from natural selection. Finally, I show how all these ideas provide a theoretical framework leading to a more precise understanding of the ecology of endosymbiosis than is afforded by poetic metaphors such as 'slavery'.

  15. Is evolution Darwinian or/and Lamarckian?

    Directory of Open Access Journals (Sweden)

    Wolf Yuri I

    2009-11-01

    can be construed as a quasi-Lamarckian phenomenon because the induced genomic changes, although random, are triggered by environmental factors and are beneficial to the organism. Conclusion Both Darwinian and Lamarckian modalities of evolution appear to be important, and reflect different aspects of the interaction between populations and the environment. Reviewers this article was reviewed by Juergen Brosius, Valerian Dolja, and Martijn Huynen. For complete reports, see the Reviewers' reports section.

  16. Methods for Handling Missing Secondary Respondent Data

    Science.gov (United States)

    Young, Rebekah; Johnson, David

    2013-01-01

    Secondary respondent data are underutilized because researchers avoid using these data in the presence of substantial missing data. The authors reviewed, evaluated, and tested solutions to this problem. Five strategies of dealing with missing partner data were reviewed: (a) complete case analysis, (b) inverse probability weighting, (c) correction…

  17. The Problem with a Darwinian View of Humanity

    Science.gov (United States)

    Cunningham, Paul F.

    2009-01-01

    Comments on the special issue on Charles Darwin and psychology (Dewsbury, February-March 2009), in which the authors present evidence supporting the validity of Charles Darwin's theory of evolution and how generations of psychologists have viewed the natural world through its light, taking Darwinian theories for granted as being a literal…

  18. Secondary air injection system and method

    Science.gov (United States)

    Wu, Ko-Jen; Walter, Darrell J.

    2014-08-19

    According to one embodiment of the invention, a secondary air injection system includes a first conduit in fluid communication with at least one first exhaust passage of the internal combustion engine and a second conduit in fluid communication with at least one second exhaust passage of the internal combustion engine, wherein the at least one first and second exhaust passages are in fluid communication with a turbocharger. The system also includes an air supply in fluid communication with the first and second conduits and a flow control device that controls fluid communication between the air supply and the first conduit and the second conduit and thereby controls fluid communication to the first and second exhaust passages of the internal combustion engine.

  19. A good Darwinian? Winwood Reade and the making of a late Victorian evolutionary epic.

    Science.gov (United States)

    Hesketh, Ian

    2015-06-01

    In 1871 the travel writer and anthropologist W. Winwood Reade (1838-1875) was inspired by his correspondence with Darwin to turn his narrow ethnological research on West African tribes into the broadest history imaginable, one that would show Darwin's great principle of natural selection at work throughout the evolutionary history of humanity, stretching back to the origins of the universe itself. But when Martyrdom of Man was published in 1872, Reade confessed that Darwin would not likely find him a very good Darwinian, as he was unable to show that natural selection was anything more than a secondary law that arranges all details. When it came to historicising humans within the sweeping history of all creation, Reade argued that the primary law was that of development, a less contentious theory of human evolution that was better suited to Reade's progressive and teleological history of life. By focussing on the extensive correspondence between Reade and Darwin, this paper reconstructs the attempt to make an explicitly Darwinian evolutionary epic in order to shed light on the moral and aesthetic demands that worked to give shape to Victorian efforts to historicise humans within a vastly expanding timeframe. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Secondary waste minimization in analytical methods

    International Nuclear Information System (INIS)

    Green, D.W.; Smith, L.L.; Crain, J.S.; Boparai, A.S.; Kiely, J.T.; Yaeger, J.S.; Schilling, J.B.

    1995-01-01

    The characterization phase of site remediation is an important and costly part of the process. Because toxic solvents and other hazardous materials are used in common analytical methods, characterization is also a source of new waste, including mixed waste. Alternative analytical methods can reduce the volume or form of hazardous waste produced either in the sample preparation step or in the measurement step. The authors are examining alternative methods in the areas of inorganic, radiological, and organic analysis. For determining inorganic constituents, alternative methods were studied for sample introduction into inductively coupled plasma spectrometers. Figures of merit for the alternative methods, as well as their associated waste volumes, were compared with the conventional approaches. In the radiological area, the authors are comparing conventional methods for gross α/β measurements of soil samples to an alternative method that uses high-pressure microwave dissolution. For determination of organic constituents, microwave-assisted extraction was studied for RCRA regulated semivolatile organics in a variety of solid matrices, including spiked samples in blank soil; polynuclear aromatic hydrocarbons in soils, sludges, and sediments; and semivolatile organics in soil. Extraction efficiencies were determined under varying conditions of time, temperature, microwave power, moisture content, and extraction solvent. Solvent usage was cut from the 300 mL used in conventional extraction methods to about 30 mL. Extraction results varied from one matrix to another. In most cases, the microwave-assisted extraction technique was as efficient as the more common Soxhlet or sonication extraction techniques

  1. Using the Socratic Method in Secondary Teaching.

    Science.gov (United States)

    Schoeman, Stephen

    1997-01-01

    Students are more accustomed to receiving knowledge than to questioning knowledge, challenging underlying assumptions, and seeing inconsistencies and irrelevancies. The Socratic method requires teachers to challenge students' critical thinking abilities by developing questions based on analogies and hypothetical situations. Although the Socratic…

  2. Darwin and Reductionisms: Victorian, Neo-Darwinian and Postgenomic Biologies

    Directory of Open Access Journals (Sweden)

    Angelique Richardson

    2010-10-01

    Full Text Available This article compares the open-ended Darwinism of Charles Darwin, George Lewes, George Eliot and Thomas Hardy with reductive post-Weismann and early eugenist views and more recent neo-Darwinian ideas including literary Darwinism. It argues that some Victorians had a clear sense of the complexities of the natural world, and of the centrality of environment to life. This awareness contrasts with the processes of divorce and isolation that underpin neo-Darwinian understandings of evolutionary development. But biologists and philosophers of biology are now emphasising the complex and dynamic relations between organism and environment in ways that would have appealed to Darwin’s contemporaries. The article establishes that there are significant parallels between mid-Victorian and postgenomic thought.

  3. Breeding novel solutions in the brain: a model of Darwinian neurodynamics.

    Science.gov (United States)

    Szilágyi, András; Zachar, István; Fedor, Anna; de Vladar, Harold P; Szathmáry, Eörs

    2016-01-01

    Background : The fact that surplus connections and neurons are pruned during development is well established. We complement this selectionist picture by a proof-of-principle model of evolutionary search in the brain, that accounts for new variations in theory space. We present a model for Darwinian evolutionary search for candidate solutions in the brain. Methods : We combine known components of the brain - recurrent neural networks (acting as attractors), the action selection loop and implicit working memory - to provide the appropriate Darwinian architecture. We employ a population of attractor networks with palimpsest memory. The action selection loop is employed with winners-share-all dynamics to select for candidate solutions that are transiently stored in implicit working memory. Results : We document two processes: selection of stored solutions and evolutionary search for novel solutions. During the replication of candidate solutions attractor networks occasionally produce recombinant patterns, increasing variation on which selection can act. Combinatorial search acts on multiplying units (activity patterns) with hereditary variation and novel variants appear due to (i) noisy recall of patterns from the attractor networks, (ii) noise during transmission of candidate solutions as messages between networks, and, (iii) spontaneously generated, untrained patterns in spurious attractors. Conclusions : Attractor dynamics of recurrent neural networks can be used to model Darwinian search. The proposed architecture can be used for fast search among stored solutions (by selection) and for evolutionary search when novel candidate solutions are generated in successive iterations. Since all the suggested components are present in advanced nervous systems, we hypothesize that the brain could implement a truly evolutionary combinatorial search system, capable of generating novel variants.

  4. Simplified Hybrid-Secondary Uncluttered Machine And Method

    Science.gov (United States)

    Hsu, John S [Oak Ridge, TN

    2005-05-10

    An electric machine (40, 40') has a stator (43) and a rotor (46) and a primary air gap (48) has secondary coils (47c, 47d) separated from the rotor (46) by a secondary air gap (49) so as to induce a slip current in the secondary coils (47c, 47d). The rotor (46, 76) has magnetic brushes (A, B, C, D) or wires (80) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments. A method of providing a slip energy controller is also disclosed.

  5. A method for rapid similarity analysis of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Liu Na

    2006-11-01

    Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.

  6. Hybrid-secondary uncluttered permanent magnet machine and method

    Science.gov (United States)

    Hsu, John S.

    2005-12-20

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  7. César Vallejo and the Stones of Darwinian Risk

    Directory of Open Access Journals (Sweden)

    Christiane von Buelow

    1990-01-01

    Full Text Available César Vallejo's short story, "Los caynas" (1923, relates a tale of species mutation, of men who become apes. The story, however, is something more than the reflection of the positivist interpretation of Darwinian theory. It can be read as a critique of Positivism's pseudo-scientific ideals or as a version of the Oedipal drama in which the son encounters and rejects his ape father. The ambivalence raises the question of whether Vallejo's Darwinism is to be read literally or ironically as well, as marking an antinomy present throughout his writing between the human subject's immersion in the species and the possibility of a collective human-transformation.

  8. Classification of methods and equipment recovery secondary waters

    Directory of Open Access Journals (Sweden)

    G. V. Kalashnikov

    2017-01-01

    Full Text Available The issues of purification of secondary waters of industrial production have an important place and are relevant in the environmental activities of all food and chemical industries. For cleaning the transporter-washing water of beet-sugar production the key role is played by the equipment of treatment plants. A wide variety of wastewater treatment equipment is classified according to various methods. Typical structures used are sedimentation tanks, hydrocyclones, separators, centrifuges. In turn, they have a different degree of purification, productivity through the incoming suspension and purified secondary water. This is equipment is divided into designs, depending on the range of particles to be removed. A general classification of methods for cleaning the transporter-washing water, as well as the corresponding equipment, is made. Based on the analysis of processes and instrumentation, the main methods of wastewater treatment are identified: mechanical, physicochemical, combined, biological and disinfection. To increase the degree of purification and reduce technical and economic costs, a combined method is widely used. The main task of the site for cleaning the transporter-washing waters of sugar beet production is to provide the enterprise with water in the required quantity and quality, with economical use of water resources, taking into account the absence of pollution of surface and groundwater by industrial wastewater. In the sugar industry is currently new types of washing equipment of foreign production are widely used, which require high quality and a large amount of purified transporter-washing water for normal operation. The proposed classification makes it possible to carry out a comparative technical and economic analysis when choosing the methods and equipment for recuperation of secondary waters. The main equipment secondary water recovery used at the beet-sugar plant is considered. The most common beet processing plant is a

  9. Research and Application on Fractional-Order Darwinian PSO Based Adaptive Extended Kalman Filtering Algorithm

    Directory of Open Access Journals (Sweden)

    Qiguang Zhu

    2014-05-01

    Full Text Available To resolve the difficulty in establishing accurate priori noise model for the extended Kalman filtering algorithm, propose the fractional-order Darwinian particle swarm optimization (PSO algorithm has been proposed and introduced into the fuzzy adaptive extended Kalman filtering algorithm. The natural selection method has been adopted to improve the standard particle swarm optimization algorithm, which enhanced the diversity of particles and avoided the premature. In addition, the fractional calculus has been used to improve the evolution speed of particles. The PSO algorithm after improved has been applied to train fuzzy adaptive extended Kalman filter and achieve the simultaneous localization and mapping. The simulation results have shown that compared with the geese particle swarm optimization training of fuzzy adaptive extended Kalman filter localization and mapping algorithm, has been greatly improved in terms of localization and mapping.

  10. Warfare, genocide, and ethnic conflict: a Darwinian approach.

    Science.gov (United States)

    Dimijian, Gregory G

    2010-07-01

    As the 21st century dawns, I reflect on the history of humankind with growing concern about the need to understand the underlying biological and cultural roots of ethnic conflict and warfare. In the many studies of human conflict, innate biological predispositions have been neglected. This article is the third part of a series of seminars for medical residents at the University of Texas Southwestern Medical School at Dallas (see http://adarwinstudygroup.org/). The series starts with in-depth coverage of Darwinian natural and sexual selection, with examples from the domestication of animals and plants and the crisis of antibiotic resistance. The series strives to show how biology has been neglected in the study of the we-they orientation of human behavior, with its devastating consequences. The subject material is profoundly disturbing, as it looks at "human nature" and contrasts the "dark side" of human behavior with the opposite, profoundly caring and loving side.

  11. Diversification and enrichment of clinical biomaterials inspired by Darwinian evolution.

    Science.gov (United States)

    Green, D W; Watson, G S; Watson, J A; Lee, D-J; Lee, J-M; Jung, H-S

    2016-09-15

    Regenerative medicine and biomaterials design are driven by biomimicry. There is the essential requirement to emulate human cell, tissue, organ and physiological complexity to ensure long-lasting clinical success. Biomimicry projects for biomaterials innovation can be re-invigorated with evolutionary insights and perspectives, since Darwinian evolution is the original dynamic process for biological organisation and complexity. Many existing human inspired regenerative biomaterials (defined as a nature generated, nature derived and nature mimicking structure, produced within a biological system, which can deputise for, or replace human tissues for which it closely matches) are without important elements of biological complexity such as, hierarchy and autonomous actions. It is possible to engineer these essential elements into clinical biomaterials via bioinspired implementation of concepts, processes and mechanisms played out during Darwinian evolution; mechanisms such as, directed, computational, accelerated evolutions and artificial selection contrived in the laboratory. These dynamos for innovation can be used during biomaterials fabrication, but also to choose optimal designs in the regeneration process. Further evolutionary information can help at the design stage; gleaned from the historical evolution of material adaptations compared across phylogenies to changes in their environment and habitats. Taken together, harnessing evolutionary mechanisms and evolutionary pathways, leading to ideal adaptations, will eventually provide a new class of Darwinian and evolutionary biomaterials. This will provide bioengineers with a more diversified and more efficient innovation tool for biomaterial design, synthesis and function than currently achieved with synthetic materials chemistry programmes and rational based materials design approach, which require reasoned logic. It will also inject further creativity, diversity and richness into the biomedical technologies that

  12. The Darwinian revolution La revolución darwiniana

    Directory of Open Access Journals (Sweden)

    ÓSCAR M CHAVES

    2010-06-01

    Full Text Available The scientific revolution probably began at 16th century with the heliocentric theory of the eminent astronomer Nicolaus Copernicus, but it was culminated with the masterful discoveries of Galileo Galilei and Isaac Newton at 17th century who revealed that planet movements around the sun and other similar phenomena can be explained by simple mechanical laws of physics and astronomy. However, the origin, complexity and configuration of living beings remained in the mystery until 19th century, with the publication of "On the origin of species". In this essay I discuss the importance of the Darwinian scientific revolution, its beginnings, and the main objections of creationists to his evolutionary ideas. Darwin demonstrated that the origin and complexity of living beings can be explained by natural processes, without the intervention of a supernatural being. However, the beginnings of the Darwinian revolution were particularly difficult and 128 years after his death, the controversy between evolutionists and creationists still persists.Con base en la teoría heliocéntrica formulada por Nicolás Copérnico en el siglo XVI, Galileo Galilei e Isaac Newton iniciaron la revolución científica al demostrar que los movimientos de los planetas alrededor del sol podían ser explicados por las leyes de la física y la astronomía. No obstante, el origen y complejidad del mundo orgánico permaneció en el misterio hasta mediados del siglo XIX, cuando Charles Darwin publicó su célebre obra 'El origen de las especies'. Desde entonces, la selección natural se ha convertido en una de las teorías científicas más umversalmente aceptadas y Darwin en el fundador de la biología moderna. En este ensayo se discute la importancia de la revolución darwiniana, sus inicios y las principales objeciones de sus detractores. Darwin demostró que el origen y la complejidad de los seres vivos pueden ser explicados por procesos naturales sin necesidad de la intervenci

  13. Fractional order Darwinian particle swarm optimization applications and evaluation of an evolutionary algorithm

    CERN Document Server

    Couceiro, Micael

    2015-01-01

    This book examines the bottom-up applicability of swarm intelligence to solving multiple problems, such as curve fitting, image segmentation, and swarm robotics. It compares the capabilities of some of the better-known bio-inspired optimization approaches, especially Particle Swarm Optimization (PSO), Darwinian Particle Swarm Optimization (DPSO) and the recently proposed Fractional Order Darwinian Particle Swarm Optimization (FODPSO), and comprehensively discusses their advantages and disadvantages. Further, it demonstrates the superiority and key advantages of using the FODPSO algorithm, suc

  14. Breeding novel solutions in the brain: a model of Darwinian neurodynamics [version 1; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    András Szilágyi

    2016-09-01

    Full Text Available Background: The fact that surplus connections and neurons are pruned during development is well established. We complement this selectionist picture by a proof-of-principle model of evolutionary search in the brain, that accounts for new variations in theory space. We present a model for Darwinian evolutionary search for candidate solutions in the brain. Methods: We combine known components of the brain – recurrent neural networks (acting as attractors, the action selection loop and implicit working memory – to provide the appropriate Darwinian architecture. We employ a population of attractor networks with palimpsest memory. The action selection loop is employed with winners-share-all dynamics to select for candidate solutions that are transiently stored in implicit working memory. Results: We document two processes: selection of stored solutions and evolutionary search for novel solutions. During the replication of candidate solutions attractor networks occasionally produce recombinant patterns, increasing variation on which selection can act. Combinatorial search acts on multiplying units (activity patterns with hereditary variation and novel variants appear due to (i noisy recall of patterns from the attractor networks, (ii noise during transmission of candidate solutions as messages between networks, and, (iii spontaneously generated, untrained patterns in spurious attractors. Conclusions: Attractor dynamics of recurrent neural networks can be used to model Darwinian search. The proposed architecture can be used for fast search among stored solutions (by selection and for evolutionary search when novel candidate solutions are generated in successive iterations. Since all the suggested components are present in advanced nervous systems, we hypothesize that the brain could implement a truly evolutionary combinatorial search system, capable of generating novel variants.

  15. Breeding novel solutions in the brain: a model of Darwinian neurodynamics [version 2; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    András Szilágyi

    2017-06-01

    Full Text Available Background: The fact that surplus connections and neurons are pruned during development is well established. We complement this selectionist picture by a proof-of-principle model of evolutionary search in the brain, that accounts for new variations in theory space. We present a model for Darwinian evolutionary search for candidate solutions in the brain. Methods: We combine known components of the brain – recurrent neural networks (acting as attractors, the action selection loop and implicit working memory – to provide the appropriate Darwinian architecture. We employ a population of attractor networks with palimpsest memory. The action selection loop is employed with winners-share-all dynamics to select for candidate solutions that are transiently stored in implicit working memory. Results: We document two processes: selection of stored solutions and evolutionary search for novel solutions. During the replication of candidate solutions attractor networks occasionally produce recombinant patterns, increasing variation on which selection can act. Combinatorial search acts on multiplying units (activity patterns with hereditary variation and novel variants appear due to (i noisy recall of patterns from the attractor networks, (ii noise during transmission of candidate solutions as messages between networks, and, (iii spontaneously generated, untrained patterns in spurious attractors. Conclusions: Attractor dynamics of recurrent neural networks can be used to model Darwinian search. The proposed architecture can be used for fast search among stored solutions (by selection and for evolutionary search when novel candidate solutions are generated in successive iterations. Since all the suggested components are present in advanced nervous systems, we hypothesize that the brain could implement a truly evolutionary combinatorial search system, capable of generating novel variants.

  16. Metabolomics methods for the synthetic biology of secondary metabolism

    NARCIS (Netherlands)

    Quoc-Thai Nguyen, [No Value; Merlo, Maria E.; Medema, Marnix H.; Jankevics, Andris; Breitling, Rainer; Takano, Eriko; Just, Wilhelm; Reiss, Thomas

    2012-01-01

    Many microbial secondary metabolites are of high biotechnological value for medicine, agriculture, and the food industry. Bacterial genome mining has revealed numerous novel secondary metabolite biosynthetic gene clusters, which encode the potential to synthesize a large diversity of compounds that

  17. Apparatus and method for controlling the secondary injection of fuel

    Science.gov (United States)

    Martin, Scott M.; Cai, Weidong; Harris, Jr., Arthur J.

    2013-03-05

    A combustor (28) for a gas turbine engine is provided comprising a primary combustion chamber (30) for combusting a first fuel to form a combustion flow stream (50) and a transition piece (32) located downstream from the primary combustion chamber (30). The transition piece (32) comprises a plurality of injectors (66) located around a circumference of the transition piece (32) for injecting a second fuel into the combustion flow stream (50). The injectors (66) are effective to create a radial temperature profile (74) at an exit (58) of the transition piece (32) having a reduced coefficient of variation relative to a radial temperature profile (64) at an inlet (54) of the transition piece (32). Methods for controlling the temperature profile of a secondary injection are also provided.

  18. The population dynamics of cancer: a Darwinian perspective.

    Science.gov (United States)

    Vineis, Paolo; Berwick, Marianne

    2006-10-01

    Carcinogenesis, at least for some types of cancer, can be interpreted as the consequence of selection of mutated cells similar to what, in the theory of evolution, occurs at the population level. Instead of considering a population of organisms, we can refer to a population of cells belonging to multicellular organisms. Many carcinogens are mutagens, and the observed geographic distribution of cancer is, at least in part, attributable to environmental mutagens. However, the rapid change in risk for some cancers after migration suggests that carcinogenesis involves--in addition to mutations--some late event that most probably consists of the selection of cells already carrying mutations. We review a few examples of such selective pressures: finasteride in prostate cancer, vitamin supplementation in smokers, acquired resistance to chemotherapy, peripheral resistance to insulin, and sunlight and mutations in melanoma. A disease model for such a hypothesis is represented by Paroxysmal Nocturnal Hemoglobinuria (PNH). Mutations can be present at birth, as in the case of PNH, and can have a frequency much higher than the occurrence of the corresponding disease (PNH or lymphocytic leukaemia in children). However, PNH does not require a mutator phenotype, only a mutant phenotype followed by selection. A characteristic feature of cancer, instead, is likely to be the development of the mutator phenotype. We propose a 'Darwinian' model of carcinogenesis. If the model is correct, it suggests that prevention is more complex than avoiding exposure to mutagens. Mutations and genetic instability can be already present at birth. Mutations can be selected in the course of life if they increase survival advantage of the cell under certain environmental circumstances. In addition, gene-environment interactions cannot be interpreted according to a simplified linear model (based on the 'analysis of variance' concept); experimental work suggests that a more comprehensive non

  19. Brassinosteroid action in flowering plants: a Darwinian perspective.

    Science.gov (United States)

    Kutschera, Ulrich; Wang, Zhi-Yong

    2012-06-01

    The year 2012 marks the 150th anniversary of the publication of Charles Darwin's first botanical book, on the fertilization of orchids (1862), wherein he described pollen grains and outlined his evolutionary principles with respect to plant research. Five decades later, the growth-promoting effect of extracts of Orchid pollen on coleoptile elongation was documented. These studies led to the discovery of a new class of phytohormones, the brassinosteroids (BRs) that were isolated from rapeseed (Brassica napus) pollen. These growth-promoting steroids, which regulate height, fertility, and seed-filling in crop plants such as rice (Oryza sativa), also induce stress- and disease resistance in green algae and angiosperms. The origin and current status of BR-research is described here, with reference to BR-action and -signal transduction, and it is shown that modern high-yield rice varieties with erect leaves are deficient in endogenous BRs. Since brassinosteroids induce pathogen resistance in rice plants and hence can suppress rice blast- and bacterial blight-diseases, genetic manipulation of BR-biosynthesis or -perception may be a means to increase crop production. Basic research on BR activity in plants, such as Arabidopsis and rice, has the potential to increase crop yields further as part of a 21th century 'green biotech-revolution' that can be traced back to Darwin's classical breeding experiments. It is concluded that 'Nothing in brassinosteroid research makes sense except in the light of Darwinian evolution' and the value of basic science is highlighted, with reference to the genetic engineering of better food crops that may become resistant to a variety of plant diseases.

  20. Emerging of Stochastic Dynamical Equalities and Steady State Thermodynamics from Darwinian Dynamics

    International Nuclear Information System (INIS)

    Ao, P.

    2008-01-01

    The evolutionary dynamics first conceived by Darwin and Wallace, referring to as Darwinian dynamics in the present paper, has been found to be universally valid in biology. The statistical mechanics and thermodynamics, while enormous successful in physics, have been in an awkward situation of wanting a consistent dynamical understanding. Here we present from a formal point of view an exploration of the connection between thermodynamics and Darwinian dynamics and a few related topics. We first show that the stochasticity in Darwinian dynamics implies the existence temperature, hence the canonical distribution of Boltzmann-Gibbs type. In term of relative entropy the Second Law of thermodynamics is dynamically demonstrated without detailed balance condition, and is valid regardless of size of the system. In particular, the dynamical component responsible for breaking detailed balance condition does not contribute to the change of the relative entropy. Two types of stochastic dynamical equalities of current interest are explicitly discussed in the present approach: One is based on Feynman-Kac formula and another is a generalization of Einstein relation. Both are directly accessible to experimental tests. Our demonstration indicates that Darwinian dynamics represents logically a simple and straightforward starting point for statistical mechanics and thermodynamics and is complementary to and consistent with conservative dynamics that dominates the physical sciences. Present exploration suggests the existence of a unified stochastic dynamical framework both near and far from equilibrium

  1. Explanation of climate and human impacts on sediment discharge change in Darwinian hydrology: Derivation of a differential equation

    Science.gov (United States)

    Zhang, Jianjun; Gao, Guangyao; Fu, Bojie; Zhang, Lu

    2018-04-01

    The assessment for impacts of climate variability and human activities on suspended sediment yield (SSY) change has long been a question of great interest. However, the sediment generation processes are sophisticated with high nonlinearity and great uncertainty, which give rise to extreme complexity for SSY change assessment in Newtonian approach. Consequently, few approaches can be simply but widely applied to decompose impacts of climatic variability and human activities on SSY change. Thus, it is an urgent need to develop advanced methods that are simple and robust. Since that the Newtonian approach is hardly achievable due to limitation of either observations or knowledge of mechanisms, there have been repeated calls to capture the hydrologic system in Darwinian approach for hydrological change prediction or explanation. As streamflow is the carrier of suspended sediment, SSY change are thus documented in changes of sediment concentrated flow and suspended sediment concentration - water discharge (C-Q) relationships. By deduced corollaries, a differential equation of sediment discharge change was derived to explicitly decompose impacts of climate variability and human activities in Darwinian hydrology. Besides, a new form of sediment rating curves was proposed and curved as C-Q relationships and probability distribution of sediment concentrated flow. River sediment flux can be revealed by this representation, which simply elucidates mechanism of SSY generation covering a range of time scales from finer than rainfall-event to long term. By the new sediment rating curves, the differential equation was partly solved using a segmentation algorithm proposed and validated in this paper, and then was submitted to water balance framework expressed by Budyko-type equation. Thus, for catchment management, hydrologists can obtain explicit explanation of how climate variation and human activities propagate through landscape and result in sediment discharge change. The

  2. Key Competencies and Characteristics for Innovative Teaching among Secondary School Teachers: A Mixed-Methods Research

    Science.gov (United States)

    Zhu, Chang; Wang, Di

    2014-01-01

    This research aims to understand the key competencies and characteristics for innovative teaching as perceived by Chinese secondary teachers. A mixed-methods research was used to investigate secondary teachers' views. First, a qualitative study was conducted with interviews of teachers to understand the perceived key competencies and…

  3. Computational RNA secondary structure design: empirical complexity and improved methods

    Directory of Open Access Journals (Sweden)

    Condon Anne

    2007-01-01

    Full Text Available Abstract Background We investigate the empirical complexity of the RNA secondary structure design problem, that is, the scaling of the typical difficulty of the design task for various classes of RNA structures as the size of the target structure is increased. The purpose of this work is to understand better the factors that make RNA structures hard to design for existing, high-performance algorithms. Such understanding provides the basis for improving the performance of one of the best algorithms for this problem, RNA-SSD, and for characterising its limitations. Results To gain insights into the practical complexity of the problem, we present a scaling analysis on random and biologically motivated structures using an improved version of the RNA-SSD algorithm, and also the RNAinverse algorithm from the Vienna package. Since primary structure constraints are relevant for designing RNA structures, we also investigate the correlation between the number and the location of the primary structure constraints when designing structures and the performance of the RNA-SSD algorithm. The scaling analysis on random and biologically motivated structures supports the hypothesis that the running time of both algorithms scales polynomially with the size of the structure. We also found that the algorithms are in general faster when constraints are placed only on paired bases in the structure. Furthermore, we prove that, according to the standard thermodynamic model, for some structures that the RNA-SSD algorithm was unable to design, there exists no sequence whose minimum free energy structure is the target structure. Conclusion Our analysis helps to better understand the strengths and limitations of both the RNA-SSD and RNAinverse algorithms, and suggests ways in which the performance of these algorithms can be further improved.

  4. Methods to assess secondary volatile lipid oxidation products in complex food matrices

    DEFF Research Database (Denmark)

    Jacobsen, Charlotte; Yesiltas, Betül

    A range of different methods are available to determine secondary volatile lipid oxidation products. These methods include e.g. spectrophotometric determination of anisidine values and TBARS as well as GC based methods for determination of specific volatile oxidation products such as pentanal...... headspace methods on the same food matrices will be presented....

  5. Standard Test Method for Calibration of Non-Concentrator Photovoltaic Secondary Reference Cells

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers calibration and characterization of secondary terrestrial photovoltaic reference cells to a desired reference spectral irradiance distribution. The recommended physical requirements for these reference cells are described in Specification E1040. Reference cells are principally used in the determination of the electrical performance of a photovoltaic device. 1.2 Secondary reference cells are calibrated indoors using simulated sunlight or outdoors in natural sunlight by reference to a primary reference cell previously calibrated to the same desired reference spectral irradiance distribution. 1.3 Secondary reference cells calibrated according to this test method will have the same radiometric traceability as the of the primary reference cell used for the calibration. Therefore, if the primary reference cell is traceable to the World Radiometric Reference (WRR, see Test Method E816), the resulting secondary reference cell will also be traceable to the WRR. 1.4 This test method appli...

  6. Extending and expanding the Darwinian synthesis: the role of complex systems dynamics.

    Science.gov (United States)

    Weber, Bruce H

    2011-03-01

    Darwinism is defined here as an evolving research tradition based upon the concepts of natural selection acting upon heritable variation articulated via background assumptions about systems dynamics. Darwin's theory of evolution was developed within a context of the background assumptions of Newtonian systems dynamics. The Modern Evolutionary Synthesis, or neo-Darwinism, successfully joined Darwinian selection and Mendelian genetics by developing population genetics informed by background assumptions of Boltzmannian systems dynamics. Currently the Darwinian Research Tradition is changing as it incorporates new information and ideas from molecular biology, paleontology, developmental biology, and systems ecology. This putative expanded and extended synthesis is most perspicuously deployed using background assumptions from complex systems dynamics. Such attempts seek to not only broaden the range of phenomena encompassed by the Darwinian Research Tradition, such as neutral molecular evolution, punctuated equilibrium, as well as developmental biology, and systems ecology more generally, but to also address issues of the emergence of evolutionary novelties as well as of life itself. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. EUGENICS, THE GIRARDIAN THEORY OF SACRIFICE, AND THE NEW DARWINIAN ETHICS

    Directory of Open Access Journals (Sweden)

    THOMAS RYBA

    2011-11-01

    Full Text Available In this paper I argue that, though many ethical systems recognizesacrifice as moral action, the utilitarian appropriation of Neo-Darwinian theory especially as it justifies eugenics as a “winnowing of the human stock” is in Girardian terms analogous to the sacrificial scapegoating of innocents. This argument is accomplished in four steps. (1 I show that within some ethical systems sacrifice is recognized as moral behavior driven by a specific axiology (or theory of value (2 I discuss some of the meta-ethical problems connected with Neo-Darwinian naturalism and naturalism, in general. (3 I show how modern varieties of naturalism and Darwinian naturalism, inparticular are especially inclined to lead to a moral justification of eugenic scapegoating and how Girardian theory is helpful in identifying the moral disorder connected with eugenics. (4 Finally, I conclude by arguing that Darwin’s thought is susceptible to another kind of interpretation, one that need not lead to the valorization of eugenics.

  8. Estimation method for first excursion probability of secondary system with impact and friction using maximum response

    International Nuclear Information System (INIS)

    Shigeru Aoki

    2005-01-01

    The secondary system such as pipings, tanks and other mechanical equipment is installed in the primary system such as building. The important secondary systems should be designed to maintain their function even if they are subjected to destructive earthquake excitations. The secondary system has many nonlinear characteristics. Impact and friction characteristic, which are observed in mechanical supports and joints, are common nonlinear characteristics. As impact damper and friction damper, impact and friction characteristic are used for reduction of seismic response. In this paper, analytical methods of the first excursion probability of the secondary system with impact and friction, subjected to earthquake excitation are proposed. By using the methods, the effects of impact force, gap size and friction force on the first excursion probability are examined. When the tolerance level is normalized by the maximum response of the secondary system without impact or friction characteristics, variation of the first excursion probability is very small for various values of the natural period. In order to examine the effectiveness of the proposed method, the obtained results are compared with those obtained by the simulation method. Some estimation methods for the maximum response of the secondary system with nonlinear characteristics have been developed. (author)

  9. Protein secondary structure assignment revisited: a detailed analysis of different assignment methods

    Directory of Open Access Journals (Sweden)

    de Brevern Alexandre G

    2005-09-01

    Full Text Available Abstract Background A number of methods are now available to perform automatic assignment of periodic secondary structures from atomic coordinates, based on different characteristics of the secondary structures. In general these methods exhibit a broad consensus as to the location of most helix and strand core segments in protein structures. However the termini of the segments are often ill-defined and it is difficult to decide unambiguously which residues at the edge of the segments have to be included. In addition, there is a "twilight zone" where secondary structure segments depart significantly from the idealized models of Pauling and Corey. For these segments, one has to decide whether the observed structural variations are merely distorsions or whether they constitute a break in the secondary structure. Methods To address these problems, we have developed a method for secondary structure assignment, called KAKSI. Assignments made by KAKSI are compared with assignments given by DSSP, STRIDE, XTLSSTR, PSEA and SECSTR, as well as secondary structures found in PDB files, on 4 datasets (X-ray structures with different resolution range, NMR structures. Results A detailed comparison of KAKSI assignments with those of STRIDE and PSEA reveals that KAKSI assigns slightly longer helices and strands than STRIDE in case of one-to-one correspondence between the segments. However, KAKSI tends also to favor the assignment of several short helices when STRIDE and PSEA assign longer, kinked, helices. Helices assigned by KAKSI have geometrical characteristics close to those described in the PDB. They are more linear than helices assigned by other methods. The same tendency to split long segments is observed for strands, although less systematically. We present a number of cases of secondary structure assignments that illustrate this behavior. Conclusion Our method provides valuable assignments which favor the regularity of secondary structure segments.

  10. Application of Monte Carlo method in determination of secondary characteristic X radiation in XFA

    International Nuclear Information System (INIS)

    Roubicek, P.

    1982-01-01

    Secondary characteristic radiation is excited by primary radiation from the X-ray tube and by secondary radiation of other elements so that excitations of several orders result. The Monte Carlo method was used to consider all these possibilities and the resulting flux of characteristic radiation was simulated for samples of silicate raw materials. A comparison of the results of these computations with experiments allows to determine the effect of sample preparation on the characteristic radiation flux. (M.D.)

  11. Teaching for Conceptual Change in Elementary and Secondary Science Methods Courses.

    Science.gov (United States)

    Marion, Robin; Hewson, Peter W.; Tabachnick, B. Robert; Blomker, Kathryn B.

    1999-01-01

    Describes and analyzes two science methods courses at the elementary and secondary levels for how they addressed four ideas: (1) how students learn science; (2) how teachers teach science to students; (3) how prospective science teachers learn about the first two ideas; and (4) how methods instructors teach prospective science teachers about the…

  12. Methods and Beyond: Learning to Teach Latino Bilingual Learners in Mainstream Secondary[superscript3] Classes

    Science.gov (United States)

    Schall-Leckrone, Laura; Pavlak, Christina

    2014-01-01

    This article reports empirical evidence about the influence of a pre-service methods course on preparing aspiring and practicing content teachers to work with adolescent bilingual learners in secondary schools. Qualitative methods were used to analyze the extent to which participants developed abilities to plan instruction and to think complexly…

  13. Comparing Management Models of Secondary Schools in Tamaulipas, Mexico: An Exploration with a Delphi Method

    Science.gov (United States)

    Navarro-Leal, Marco Aurelio; Garcia, Concepcion Nino; Saldivar, Luisa Caballero

    2012-01-01

    For a preliminary exploration of management models between two secondary schools, a Delphi method was used in order to identify and focus relevant topics for a larger research. A first approximation with this method proved to be a heuristic tool to focus and define some categories and guidelines of enquiry. It was found that in both of the schools…

  14. Classifying Secondary Task Driving Safety Using Method of F-ANP

    Directory of Open Access Journals (Sweden)

    Lisheng Jin

    2015-02-01

    Full Text Available This study was designed to build an evaluation system for secondary task driving safety by using method of Fuzzy Analytic Network Process (F-ANP. Forty drivers completed driving on driving simulator while interacting with or without a secondary task. Measures of fixations, saccades, and vehicle running status were analyzed. According to five experts' opinions, a hierarchical model for secondary task driving safety evaluation was built. The hierarchical model was divided into three levels: goal, assessment dimension, and criteria. Seven indexes make up the level of criteria, and the assessment dimension includes two clusters: vehicle control risk and driver eye movement risk. By method of F-ANP, the priorities of the criteria and the subcriteria were determined. Furthermore, to rank the driving safety, an approach based on the principle of maximum membership degree was adopted. At last, a case study of secondary task driving safety evaluation by forty drivers using the proposed method was done. The results indicated that the application of the proposed method is practically feasible and adoptable for secondary task driving safety evaluation.

  15. SAAS: Short Amino Acid Sequence - A Promising Protein Secondary Structure Prediction Method of Single Sequence

    Directory of Open Access Journals (Sweden)

    Zhou Yuan Wu

    2013-07-01

    Full Text Available In statistical methods of predicting protein secondary structure, many researchers focus on single amino acid frequencies in α-helices, β-sheets, and so on, or the impact near amino acids on an amino acid forming a secondary structure. But the paper considers a short sequence of amino acids (3, 4, 5 or 6 amino acids as integer, and statistics short sequence's probability forming secondary structure. Also, many researchers select low homologous sequences as statistical database. But this paper select whole PDB database. In this paper we propose a strategy to predict protein secondary structure using simple statistical method. Numerical computation shows that, short amino acids sequence as integer to statistics, which can easy see trend of short sequence forming secondary structure, and it will work well to select large statistical database (whole PDB database without considering homologous, and Q3 accuracy is ca. 74% using this paper proposed simple statistical method, but accuracy of others statistical methods is less than 70%.

  16. Tumor progression: chance and necessity in Darwinian and Lamarckian somatic (mutationless) evolution.

    Science.gov (United States)

    Huang, Sui

    2012-09-01

    Current investigation of cancer progression towards increasing malignancy focuses on the molecular pathways that produce the various cancerous traits of cells. Their acquisition is explained by the somatic mutation theory: tumor progression is the result of a neo-Darwinian evolution in the tissue. Herein cells are the units of selection. Random genetic mutations permanently affecting these pathways create malignant cell phenotypes that are selected for in the disturbed tissue. However, could it be that the capacity of the genome and its gene regulatory network to generate the vast diversity of cell types during development, i.e., to produce inheritable phenotypic changes without mutations, is harnessed by tumorigenesis to propel a directional change towards malignancy? Here we take an encompassing perspective, transcending the orthodoxy of molecular carcinogenesis and review mechanisms of somatic evolution beyond the Neo-Darwinian scheme. We discuss the central concept of "cancer attractors" - the hidden stable states of gene regulatory networks normally not occupied by cells. Noise-induced transitions into such attractors provide a source for randomness (chance) and regulatory constraints (necessity) in the acquisition of novel expression profiles that can be inherited across cell divisions, and hence, can be selected for. But attractors can also be reached in response to environmental signals - thus offering the possibility for inheriting acquired traits that can also be selected for. Therefore, we face the possibility of non-genetic (mutation-independent) equivalents to both Darwinian and Lamarckian evolution which may jointly explain the arrow of change pointing toward increasing malignancy. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Field Studies: Novels as Darwinian Niches, Poetry for Physicists and Mathematicians

    Directory of Open Access Journals (Sweden)

    Daniel Walter Brown

    2010-10-01

    Full Text Available This brief forum contribution reflects upon some historical factors in the formation of nineteenth century science and of the literature and science discipline that has since arisen to study its literary receptions. Noting the preponderance of studies focusing upon forms of scientific developmentalism, principally Darwinian biology, and of novels and other prose, and more broadly, on literary figures, rather than the writings of scientists, the paper introduces some poetry on science by scientists. It concentrates principally on those working and writing in the fields of physics and mathematics, areas that have been neglected in literature and science studies.

  18. Non-Darwinian evolution for the source detection of atmospheric releases

    Science.gov (United States)

    Cervone, Guido; Franzese, Pasquale

    2011-08-01

    A non-Darwinian evolutionary algorithm is presented as search engine to identify the characteristics of a source of atmospheric pollutants, given a set of concentration measurements. The algorithm drives iteratively a forward dispersion model from tentative sources toward the real source. The solutions of non-Darwinian evolution processes are not generated through pseudo-random operators, unlike traditional evolutionary algorithms, but through a reasoning process based on machine learning rule generation and instantiation. The new algorithm is tested with both a synthetic case and with the Prairie Grass field experiment. To further test the capabilities of the algorithm to work in real-world scenarios, the source identification of all Prairie Grass releases was performed with a decreasing number of sensor measurements, and a relationship is found between the precision of the solution, the number of sensors available, and the levels of concentration measured by the sensors. The proposed methodology can be used for a variety of optimization problems, and is particularly suited for problems where the operations needed for evaluating new candidate solutions are computationally expensive.

  19. The Mastodon in the room: how Darwinian is neo-Darwinism?

    Science.gov (United States)

    Brooks, Daniel R

    2011-03-01

    Failing to acknowledge substantial differences between Darwinism and neo-Darwinism impedes evolutionary biology. Darwin described evolution as the outcome of interactions between the nature of the organism and the nature of the conditions, each relatively autonomous but both historically and spatially intertwined. Furthermore, he postulated that the nature of the organism was more important than the nature of the conditions, leading to natural selection as an inevitable emergent product of biological systems. The neo-Darwinian tradition assumed a creative rather than selective view of natural selection, with the nature of the organism determined by the nature of the conditions, rendering the nature of the organism and temporal contingency unnecessary. Contemporary advances in biology, specifically the phylogenetics revolution and evo-devo, underscore the significance of history and the nature of the organism in biology. Darwinism explains more biology better, and better resolves apparent anomalies between living systems and more general natural laws, than does neo-Darwinism. The "extended" or "expanded" synthesis currently called for by neo-Darwinians is Darwinism. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. Why mental disorders are just mental dysfunctions (and nothing more): some Darwinian arguments.

    Science.gov (United States)

    De Block, Andreas

    2008-09-01

    Mental disorders are often thought to be harmful dysfunctions. Jerome Wakefield has argued that such dysfunctions should be understood as failures of naturally selected functions. This suggests, implicitly, that evolutionary biology and other Darwinian disciplines hold important information for anyone working on answering the philosophical question, 'what is a mental disorder?'. In this article, the author argues that Darwinian theory is not only relevant to the understanding of the disrupted functions, but it also sheds light on the disruption itself, as well as on the harm that attends the disruption. The arguments advanced here are partially based on the view that a core feature of Darwinism is that it stresses the environmental relativity of functions and dysfunctions. These arguments show a very close empirical connection between social judgments (values) and dysfunctions (psychopathology), which is of interest for psychiatric theory. Philosophically, they lead to the conclusion that the concept of mental disorder is identical to the concept of mental dysfunction. Consequently, it is both misleading and redundant to conceptualize mental disorders as 'harmful dysfunctions', and not simply as 'mental dysfunctions'.

  1. Experience in Use of Project Method during Technology Lessons in Secondary Schools of the USA

    Science.gov (United States)

    Sheludko, Inna

    2015-01-01

    The article examines the opportunities and prospects for the use of experience of project method during "technology lessons" in US secondary schools, since the value of project technology implementation experience into the educational process in the USA for ensuring holistic development of children, preparing them for adult life, in…

  2. Motivation Beliefs of Secondary School Teachers in Canada and Singapore: A Mixed Methods Study

    Science.gov (United States)

    Klassen, Robert M.; Chong, Wan Har; Huan, Vivien S.; Wong, Isabella; Kates, Allison; Hannok, Wanwisa

    2008-01-01

    A mixed methods approach was used to explore secondary teachers' motivation beliefs in Canada and Singapore. Results from Study 1 revealed that socio-economic status (SES) was the strongest predictor of school climate in Canada, and that collective efficacy mediated the effect of SES on school climate in Singapore, but not in Canada. In Study 2,…

  3. The Physically Active Lifestyle of Flemish Secondary School Teachers: A Mixed-Methods Approach towards Developing a Physical Activity Intervention

    Science.gov (United States)

    Bogaert, Inge; De Martelaer, Kristine; Deforche, Benedicte; Clarys, Peter; Zinzen, Evert

    2015-01-01

    Objective: The primary aim of this study was to describe and analyse the physical activity and sedentary levels of secondary school teachers in Flanders. A secondary aim was to collect information regarding a possible worksite intervention of special relevance to secondary school teachers. Design: Mixed-methods quantitative and qualitative…

  4. Numerical and Experimental Characterization of a Composite Secondary Bonded Adhesive Lap Joint Using the Ultrasonics method

    Science.gov (United States)

    Kumar, M. R.; Ghosh, A.; Karuppannan, D.

    2018-05-01

    The construction of aircraft using advanced composites have become very popular during the past two decades, in which many innovative manufacturing processes, such as cocuring, cobonding, and secondary bonding processes, have been adopted. The secondary bonding process has become less popular than the other two ones because of nonavailability of process database and certification issues. In this article, an attempt is made to classify the quality of bonding using nondestructive ultrasonic inspection methods. Specimens were prepared and tested using the nondestructive ultrasonic Through Transmission (TT), Pulse Echo (PE), and air coupled guided wave techniques. It is concluded that the ultrasonic pulse echo technique is the best one for inspecting composite secondary bonded adhesive joints.

  5. A new online secondary path modeling method for adaptive active structure vibration control

    International Nuclear Information System (INIS)

    Pu, Yuxue; Zhang, Fang; Jiang, Jinhui

    2014-01-01

    This paper proposes a new variable step size FXLMS algorithm with an auxiliary noise power scheduling strategy for online secondary path modeling. The step size for the secondary path modeling filter and the gain of auxiliary noise are varied in accordance with the parameters available directly. The proposed method has a low computational complexity. Computer simulations show that an active vibration control system with the proposed method gives much better vibration attenuation and modeling accuracy at a faster convergence rate than existing methods. National Instruments’ CompactRIO is used as an embedded processor to control simply supported beam vibration. Experimental results indicate that the vibration of the beam has been effectively attenuated. (papers)

  6. If we are all cultural Darwinians what's the fuss about? : clarifying recent disagreements in the field of cultural evolution

    NARCIS (Netherlands)

    Acerbi, A.; Mesoudi, A.

    2015-01-01

    Cultural evolution studies are characterized by the notion that culture evolves accordingly to broadly Darwinian principles. Yet how far the analogy between cultural and genetic evolution should be pushed is open to debate. Here, we examine a recent disagreement that concerns the extent to which

  7. Determining Methods used in Teaching Geography in Secondary Schools in Rongo District, Kenya

    OpenAIRE

    Omoro Benjamin; Luke Wakhungu Nato

    2014-01-01

    This article dealt with methods of teaching Geography in Kenya but also the world over. The importance of Geography in secondary school curriculum cannot be overemphasized. Improving the performance of Geography education is a great societal need in Kenya not only for industrialization of the country as contained in the vision 2030 but also for ensuring food security in the country through practices like land reclamation and irrigation farming The objective of this article was; to find out th...

  8. Physical microscopic free-choice model in the framework of a Darwinian approach to quantum mechanics

    Energy Technology Data Exchange (ETDEWEB)

    Baladron, Carlos [Departamento de Fisica Teorica, Atomica y Optica, Universidad de Valladolid, E-47011, Valladolid (Spain)

    2017-06-15

    A compatibilistic model of free choice for a fundamental particle is built within a general framework that explores the possibility that quantum mechanics be the emergent result of generalised Darwinian evolution acting on the abstract landscape of possible physical theories. The central element in this approach is a probabilistic classical Turing machine -basically an information processor plus a randomiser- methodologically associated with every fundamental particle. In this scheme every system acts not under a general law, but as a consequence of the command of a particular, evolved algorithm. This evolved programme enables the particle to algorithmically anticipate possible future world configurations in information space, and as a consequence, without altering the natural forward causal order in physical space, to incorporate elements to the decision making procedure that are neither purely random nor strictly in the past, but in a possible future. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  9. Genetic structure and evidence of putative Darwinian diversifying selection in the Potato yellow vein virus (PYVV

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2013-08-01

    Full Text Available The population structure and genetic variation of Potato yellow vein virus (PYVV were estimated by analysis of the nucleotide and deduced amino acid sequence of the coat protein of 69 isolates, reported in GenBank, from Solanum tuberosum (ST and Solanum phureja (SP hosts from different regions; predominantly Cundinamarca, Antioquia and Nariño, located in central and southwestern Colombia. Bioinformatics analysis revealed that despite the wide geographic distribution of different hosts and different collecting years, PYVV maintains a genetic similarity between 97.1 to 100.0%, indicating high spatial and temporal genetic stability of the major coat protein. No recombination events were found, but evidence was seen for the first time that this protein could be undergoing Darwinian diversifying selection

  10. Evolutionism through Chinese Eyes: Yan Fu, Ma Junwu and Their translations of Darwinian Evolutionism

    Directory of Open Access Journals (Sweden)

    Tsing-song Vincent Shen

    2015-04-01

    Full Text Available The huge impact that Darwinian Evolutionism has effected over Chinese intellectuals through Yan Fu's translation of Huxley's "Evolution and Ethics" into the Tianyanlun, is in fact based on Chinese traditional worldview on the one hand and the novel ideas it brings to the Chinese mind facing the challenge of transition. However, Yan Fu's translation is not as scientific as it should be when dealing with Huxley's discourse. Ma Junwu's translation of Darwin's "On the Origin of Species" attempts to be more scientific, in an effort to supply exact scientific terms and discourse in Chinese. However, at the end it is social Darwinism that has won the mind of the Chinese people. This paper analyses the ideas in Chinese past that leads to Chinese perception of Darwimism evolutionism and examines the ways it has been translated by Yan Fu and Ma Junwu.  

  11. Radiation leakage monitoring method and device from primary to secondary coolant systems in nuclear reactor

    International Nuclear Information System (INIS)

    Tajiri, Yoshiaki; Umehara, Toshihiro; Yamada, Masataka.

    1993-01-01

    The present invention monitors radiation leaked from any one of primary cooling systems to secondary cooling systems in a plurality of steam generators. That is, radiation monitoring means each corresponding to steam each generators are disposed to the upstream of a position where main steam pipes are joined. With such a constitution, since the detection object of each of radiation monitoring means is secondary coolants before mixing with secondary coolants of other secondary loops or dilution, lowering of detection accuracy can be avoided. Except for the abnormal case, that is, a case neither of radiation leakage nor of background change, the device is adapted as a convenient measuring system only with calculation performance. Once abnormality occurs, a loop having a value exceeding a standard value is identified by a single channel analyzer function. The amount of radiation leakage from the steam generator belonging to the specified loop is monitored quantitatively by a multichannel analyzer function. According to the method of the present invention, since specific spectrum analysis is conducted upon occurrence of abnormality, presence of radiation leakage and the scale thereof can be judged rapidly. (I.S.)

  12. SVM-PB-Pred: SVM based protein block prediction method using sequence profiles and secondary structures.

    Science.gov (United States)

    Suresh, V; Parthasarathy, S

    2014-01-01

    We developed a support vector machine based web server called SVM-PB-Pred, to predict the Protein Block for any given amino acid sequence. The input features of SVM-PB-Pred include i) sequence profiles (PSSM) and ii) actual secondary structures (SS) from DSSP method or predicted secondary structures from NPS@ and GOR4 methods. There were three combined input features PSSM+SS(DSSP), PSSM+SS(NPS@) and PSSM+SS(GOR4) used to test and train the SVM models. Similarly, four datasets RS90, DB433, LI1264 and SP1577 were used to develop the SVM models. These four SVM models developed were tested using three different benchmarking tests namely; (i) self consistency, (ii) seven fold cross validation test and (iii) independent case test. The maximum possible prediction accuracy of ~70% was observed in self consistency test for the SVM models of both LI1264 and SP1577 datasets, where PSSM+SS(DSSP) input features was used to test. The prediction accuracies were reduced to ~53% for PSSM+SS(NPS@) and ~43% for PSSM+SS(GOR4) in independent case test, for the SVM models of above two same datasets. Using our method, it is possible to predict the protein block letters for any query protein sequence with ~53% accuracy, when the SP1577 dataset and predicted secondary structure from NPS@ server were used. The SVM-PB-Pred server can be freely accessed through http://bioinfo.bdu.ac.in/~svmpbpred.

  13. Effectiveness of Demonstration and Lecture Methods in Learning Concept in Economics among Secondary School Students in Borno State, Nigeria

    Science.gov (United States)

    Muhammad, Amin Umar; Bala, Dauda; Ladu, Kolomi Mutah

    2016-01-01

    This study investigated the Effectiveness of Demonstration and Lecture Methods in Learning concepts in Economics among Secondary School Students in Borno state, Nigeria. Five objectives: to determine the effectiveness of demonstration method in learning economics concepts among secondary school students in Borno state, determine the effectiveness…

  14. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction

    Science.gov (United States)

    Puton, Tomasz; Kozlowski, Lukasz P.; Rother, Kristian M.; Bujnicki, Janusz M.

    2013-01-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks. PMID:23435231

  15. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction.

    Science.gov (United States)

    Puton, Tomasz; Kozlowski, Lukasz P; Rother, Kristian M; Bujnicki, Janusz M

    2013-04-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks.

  16. MODEL OF METHODS OF FORMING BIOLOGICAL PICTURE OF THE WORLD OF SECONDARY SCHOOL PUPILS

    Directory of Open Access Journals (Sweden)

    Mikhail A. Yakunchev

    2016-12-01

    Full Text Available Introduction: the problem of development of a model of methods of forming the biological picture of the world of pupils as a multicomponent and integrative expression of the complete educational process is considered in the article. It is stated that the results of the study have theoretical and practical importance for effective subject preparation of senior pupils based on acquiring of systematic and generalized knowledge about wildlife. The correspondence of the main idea of the article to the scientific profile of the journal “Integration of Education” determines the choice of the periodical for publication. Materials and Methods: the results of the analysis of materials on modeling of the educational process, on specific models of the formation of a complete comprehension of the scientific picture of the world and its biological component make it possible to suggest a lack of elaboration of the aspect of pedagogical research under study. Therefore, the search for methods to overcome these gaps and to substantiate a particular model, relevant for its practical application by a teacher, is important. The study was based on the use of methods of theoretical level, including the analysis of pedagogical and methodological literature, modeling and generalized expression of the model of forming the biological picture of the world of secondary school senior pupils, which were of higher priority. Results: the use of models of organization of subject preparation of secondary school pupils takes a priority position, as they help to achieve the desired results of training, education and development. The model of methods of forming a biological picture of the world is represented as a theoretical construct in the unity of objective, substantive, procedural, diagnostic and effective blocks. Discussion and Conclusions: in a generalized form the article expresses the model of methods of forming the biological picture of the world of secondary school

  17. Assessing the Risk of Secondary Transfer Via Fingerprint Brush Contamination Using Enhanced Sensitivity DNA Analysis Methods.

    Science.gov (United States)

    Bolivar, Paula-Andrea; Tracey, Martin; McCord, Bruce

    2016-01-01

    Experiments were performed to determine the extent of cross-contamination of DNA resulting from secondary transfer due to fingerprint brushes used on multiple items of evidence. Analysis of both standard and low copy number (LCN) STR was performed. Two different procedures were used to enhance sensitivity, post-PCR cleanup and increased cycle number. Under standard STR typing procedures, some additional alleles were produced that were not present in the controls or blanks; however, there was insufficient data to include the contaminant donor as a contributor. Inclusion of the contaminant donor did occur for one sample using post-PCR cleanup. Detection of the contaminant donor occurred for every replicate of the 31 cycle amplifications; however, using LCN interpretation recommendations for consensus profiles, only one sample would include the contaminant donor. Our results indicate that detection of secondary transfer of DNA can occur through fingerprint brush contamination and is enhanced using LCN-DNA methods. © 2015 American Academy of Forensic Sciences.

  18. Methods to reduce intraocular pressure on secondary glaucoma after severe eye burns

    Directory of Open Access Journals (Sweden)

    A. V. Solovieva

    2014-07-01

    Full Text Available Purpose: Show the results of treatment of secondary glaucoma after severe eye burns.Methods: We observed 70 patients (108 eyes with severe burns the eyes and their consequences, secondary glaucoma was observed in 40 patients (58 eyes. All patients with secondary glaucoma received traditional antihypertensive therapy, with its failure to resort to antiglaucomatous surgery. Cataract extraction performed in 24 cases, 16 of them in combination with other surgery: the reconstruction of the anterior chamber, penetrating keratoplasty, sinustrabeculectomy, diode laser cyclocoagulation. Diode laser cy- clocoagulation performed 42 times in 8 of them in combination with other antiglaucomatous surgery: cataract surgery, reconstruction of the anterior chamber. Sinustrabeculectomy in patients with secondary glaucoma was performed in 7 cases, 4 of them with collagen implant drainage. Ahmed glaucoma drainage implant performed in 5 cases.Results: In 23 out of 58 (39.6% of long-term compensation glaucoma IOP was achieved antihypertensive therapy without sur- gery. After cataract extraction resistant compensated IOP was achieved in 10 cases, a temporary (1 to 42 months — in 11 cases, IOP is not reduced in 2 cases. After completing diode laser cyclocoagulation stable normalization of IOP occurred in 16 cases, the temporary (from 1 month to 2 years — in 20 cases, 4 cases of IOP reduction was not achieved. As a result sinustrabeculectomy in 4 cases IOP decreased, in one case the hypotensive effect is not there. After implantation Ahmed glaucoma valve in 2 cases was achieved stable normalization of IOP, in the 2 cases — the temporary; in 1 case developed endophthalmitis, and the device was removed.Conclusion: the immediate effect of antiglaucomatous treatment was 96.6%, but the high incidence of IOP decompensation (73.7% suggesting the need for continuous follow-up patients after severe eye burn injury, and a readiness to use other methods to reduce IOP.

  19. Methods to reduce intraocular pressure on secondary glaucoma after severe eye burns

    Directory of Open Access Journals (Sweden)

    A. V. Solovieva

    2012-01-01

    Full Text Available Purpose: Show the results of treatment of secondary glaucoma after severe eye burns.Methods: We observed 70 patients (108 eyes with severe burns the eyes and their consequences, secondary glaucoma was observed in 40 patients (58 eyes. All patients with secondary glaucoma received traditional antihypertensive therapy, with its failure to resort to antiglaucomatous surgery. Cataract extraction performed in 24 cases, 16 of them in combination with other surgery: the reconstruction of the anterior chamber, penetrating keratoplasty, sinustrabeculectomy, diode laser cyclocoagulation. Diode laser cy- clocoagulation performed 42 times in 8 of them in combination with other antiglaucomatous surgery: cataract surgery, reconstruction of the anterior chamber. Sinustrabeculectomy in patients with secondary glaucoma was performed in 7 cases, 4 of them with collagen implant drainage. Ahmed glaucoma drainage implant performed in 5 cases.Results: In 23 out of 58 (39.6% of long-term compensation glaucoma IOP was achieved antihypertensive therapy without sur- gery. After cataract extraction resistant compensated IOP was achieved in 10 cases, a temporary (1 to 42 months — in 11 cases, IOP is not reduced in 2 cases. After completing diode laser cyclocoagulation stable normalization of IOP occurred in 16 cases, the temporary (from 1 month to 2 years — in 20 cases, 4 cases of IOP reduction was not achieved. As a result sinustrabeculectomy in 4 cases IOP decreased, in one case the hypotensive effect is not there. After implantation Ahmed glaucoma valve in 2 cases was achieved stable normalization of IOP, in the 2 cases — the temporary; in 1 case developed endophthalmitis, and the device was removed.Conclusion: the immediate effect of antiglaucomatous treatment was 96.6%, but the high incidence of IOP decompensation (73.7% suggesting the need for continuous follow-up patients after severe eye burn injury, and a readiness to use other methods to reduce IOP.

  20. An axisymmetric method of creep analysis for primary and secondary creep

    International Nuclear Information System (INIS)

    Jahed, Hamid; Bidabadi, Jalal

    2003-01-01

    A general axisymmetric method for elastic-plastic analysis was previously proposed by Jahed and Dubey [ASME J Pressure Vessels Technol 119 (1997) 264]. In the present work the method is extended to the time domain. General rate type governing equations are derived and solved in terms of rate of change of displacement as a function of rate of change in loading. Different types of loading, such as internal and external pressure, centrifugal loading and temperature gradient, are considered. To derive specific equations and employ the proposed formulation, the problem of an inhomogeneous non-uniform rotating disc is worked out. Primary and secondary creep behaviour is predicted using the proposed method and results are compared to FEM results. The problem of creep in pressurized vessels is also solved. Several numerical examples show the effectiveness and robustness of the proposed method

  1. The multiple imputation method: a case study involving secondary data analysis.

    Science.gov (United States)

    Walani, Salimah R; Cleland, Charles M

    2015-05-01

    To illustrate with the example of a secondary data analysis study the use of the multiple imputation method to replace missing data. Most large public datasets have missing data, which need to be handled by researchers conducting secondary data analysis studies. Multiple imputation is a technique widely used to replace missing values while preserving the sample size and sampling variability of the data. The 2004 National Sample Survey of Registered Nurses. The authors created a model to impute missing values using the chained equation method. They used imputation diagnostics procedures and conducted regression analysis of imputed data to determine the differences between the log hourly wages of internationally educated and US-educated registered nurses. The authors used multiple imputation procedures to replace missing values in a large dataset with 29,059 observations. Five multiple imputed datasets were created. Imputation diagnostics using time series and density plots showed that imputation was successful. The authors also present an example of the use of multiple imputed datasets to conduct regression analysis to answer a substantive research question. Multiple imputation is a powerful technique for imputing missing values in large datasets while preserving the sample size and variance of the data. Even though the chained equation method involves complex statistical computations, recent innovations in software and computation have made it possible for researchers to conduct this technique on large datasets. The authors recommend nurse researchers use multiple imputation methods for handling missing data to improve the statistical power and external validity of their studies.

  2. Interpretive focus groups: a participatory method for interpreting and extending secondary analysis of qualitative data

    Directory of Open Access Journals (Sweden)

    Michelle Redman-MacLaren

    2014-08-01

    Full Text Available Background: Participatory approaches to qualitative research practice constantly change in response to evolving research environments. Researchers are increasingly encouraged to undertake secondary analysis of qualitative data, despite epistemological and ethical challenges. Interpretive focus groups can be described as a more participative method for groups to analyse qualitative data. Objective: To facilitate interpretive focus groups with women in Papua New Guinea to extend analysis of existing qualitative data and co-create new primary data. The purpose of this was to inform a transformational grounded theory and subsequent health promoting action. Design: A two-step approach was used in a grounded theory study about how women experience male circumcision in Papua New Guinea. Participants analysed portions or ‘chunks’ of existing qualitative data in story circles and built upon this analysis by using the visual research method of storyboarding. Results: New understandings of the data were evoked when women in interpretive focus groups analysed the data ‘chunks’. Interpretive focus groups encouraged women to share their personal experiences about male circumcision. The visual method of storyboarding enabled women to draw pictures to represent their experiences. This provided an additional focus for whole-of-group discussions about the research topic. Conclusions: Interpretive focus groups offer opportunity to enhance trustworthiness of findings when researchers undertake secondary analysis of qualitative data. The co-analysis of existing data and co-generation of new data between research participants and researchers informed an emergent transformational grounded theory and subsequent health promoting action.

  3. Interpretive focus groups: a participatory method for interpreting and extending secondary analysis of qualitative data.

    Science.gov (United States)

    Redman-MacLaren, Michelle; Mills, Jane; Tommbe, Rachael

    2014-01-01

    Participatory approaches to qualitative research practice constantly change in response to evolving research environments. Researchers are increasingly encouraged to undertake secondary analysis of qualitative data, despite epistemological and ethical challenges. Interpretive focus groups can be described as a more participative method for groups to analyse qualitative data. To facilitate interpretive focus groups with women in Papua New Guinea to extend analysis of existing qualitative data and co-create new primary data. The purpose of this was to inform a transformational grounded theory and subsequent health promoting action. A two-step approach was used in a grounded theory study about how women experience male circumcision in Papua New Guinea. Participants analysed portions or 'chunks' of existing qualitative data in story circles and built upon this analysis by using the visual research method of storyboarding. New understandings of the data were evoked when women in interpretive focus groups analysed the data 'chunks'. Interpretive focus groups encouraged women to share their personal experiences about male circumcision. The visual method of storyboarding enabled women to draw pictures to represent their experiences. This provided an additional focus for whole-of-group discussions about the research topic. Interpretive focus groups offer opportunity to enhance trustworthiness of findings when researchers undertake secondary analysis of qualitative data. The co-analysis of existing data and co-generation of new data between research participants and researchers informed an emergent transformational grounded theory and subsequent health promoting action.

  4. Constraints on primary and secondary particulate carbon sources using chemical tracer and 14C methods during CalNex-Bakersfield

    Data.gov (United States)

    U.S. Environmental Protection Agency — The present study investigates primary and secondary sources of organic carbon for Bakersfield, CA, USA as part of the 2010 CalNex study. The method used here...

  5. The molecular and mathematical basis of Waddington's epigenetic landscape: a framework for post-Darwinian biology?

    Science.gov (United States)

    Huang, Sui

    2012-02-01

    The Neo-Darwinian concept of natural selection is plausible when one assumes a straightforward causation of phenotype by genotype. However, such simple 1:1 mapping must now give place to the modern concepts of gene regulatory networks and gene expression noise. Both can, in the absence of genetic mutations, jointly generate a diversity of inheritable randomly occupied phenotypic states that could also serve as a substrate for natural selection. This form of epigenetic dynamics challenges Neo-Darwinism. It needs to incorporate the non-linear, stochastic dynamics of gene networks. A first step is to consider the mathematical correspondence between gene regulatory networks and Waddington's metaphoric 'epigenetic landscape', which actually represents the quasi-potential function of global network dynamics. It explains the coexistence of multiple stable phenotypes within one genotype. The landscape's topography with its attractors is shaped by evolution through mutational re-wiring of regulatory interactions - offering a link between genetic mutation and sudden, broad evolutionary changes. Copyright © 2012 WILEY Periodicals, Inc.

  6. Adaptive evolution of cooperation through Darwinian dynamics in Public Goods games.

    Science.gov (United States)

    Deng, Kuiying; Chu, Tianguang

    2011-01-01

    The linear or threshold Public Goods game (PGG) is extensively accepted as a paradigmatic model to approach the evolution of cooperation in social dilemmas. Here we explore the significant effect of nonlinearity of the structures of public goods on the evolution of cooperation within the well-mixed population by adopting Darwinian dynamics, which simultaneously consider the evolution of populations and strategies on a continuous adaptive landscape, and extend the concept of evolutionarily stable strategy (ESS) as a coalition of strategies that is both convergent-stable and resistant to invasion. Results show (i) that in the linear PGG contributing nothing is an ESS, which contradicts experimental data, (ii) that in the threshold PGG contributing the threshold value is a fragile ESS, which cannot resist the invasion of contributing nothing, and (iii) that there exists a robust ESS of contributing more than half in the sigmoid PGG if the return rate is relatively high. This work reveals the significant effect of the nonlinearity of the structures of public goods on the evolution of cooperation, and suggests that, compared with the linear or threshold PGG, the sigmoid PGG might be a more proper model for the evolution of cooperation within the well-mixed population.

  7. Darwinian algorithms and the Wason selection task: a factorial analysis of social contract selection task problems.

    Science.gov (United States)

    Platt, R D; Griggs, R A

    1993-08-01

    In four experiments with 760 subjects, the present study examined Cosmides' Darwinian algorithm theory of reasoning: specifically, its explanation of facilitation on the Wason selection task. The first experiment replicated Cosmides' finding of facilitation for social contract versions of the selection task, using both her multiple-problem format and a single-problem format. Experiment 2 examined performance on Cosmides' three main social contract problems while manipulating the perspective of the subject and the presence and absence of cost-benefit information. The presence of cost-benefit information improved performance in two of the three problems while the perspective manipulation had no effect. In Experiment 3, the cost-benefit effect was replicated; and performance on one of the three problems was enhanced by the presence of explicit negatives on the NOT-P and NOT-Q cards. Experiment 4 examined the role of the deontic term "must" in the facilitation observed for two of the social contract problems. The presence of "must" led to a significant improvement in performance. The results of these experiments are strongly supportive of social contract theory in that cost-benefit information is necessary for substantial facilitation to be observed in Cosmides' problems. These findings also suggest the presence of other cues that can help guide subjects to a deontic social contract interpretation when the social contract nature of the problem is not clear.

  8. Numerical design and testing of a sound source for secondary calibration of microphones using the Boundary Element Method

    DEFF Research Database (Denmark)

    Cutanda Henriquez, Vicente; Juhl, Peter Møller; Barrera Figueroa, Salvador

    2009-01-01

    Secondary calibration of microphones in free field is performed by placing the microphone under calibration in an anechoic chamber with a sound source, and exposing it to a controlled sound field. A calibrated microphone is also measured as a reference. While the two measurements are usually made...... apart to avoid acoustic interaction. As a part of the project Euromet-792, aiming to investigate and improve methods for secondary free-field calibration of microphones, a sound source suitable for simultaneous secondary free-field calibration has been designed using the Boundary Element Method...... of the Danish Fundamental Metrology Institute (DFM). The design and verification of the source are presented in this communication....

  9. Evaluation of the Teaching Methods Used in Secondary School Biology Lessons

    Directory of Open Access Journals (Sweden)

    Porozovs Juris

    2015-06-01

    Full Text Available The teacher’s skills in conducting the lesson and choice of teaching methods play an essential role in creating students’ interest in biology. The aim of the research was to study the opinion of secondary school students and biology teachers regarding the most successful teaching methods used in biology lessons and viable options to make biology lessons more interesting. The research comprised polling students and biology teachers from several schools, namely: 2 secondary schools in Jelgava, 2 in Riga and 1 in Vecumnieki. The responses revealed that 58% of students find biology lessons interesting. 56% of students indicated that their ability to focus attention during biology lessons depends on the task presented to them. Most of all they prefer watching the teacher’s presentations, listening to their teacher telling about the actual topic as well as performing laboratory work and group-work. Many students like participating in discussions, whereas a far smaller number would do various exercises, individual tasks, fill out worksheets or complete projects. Least of all students wish to work with the textbook. The methods most frequently applied by teachers are as follows: lecture, explanation, demonstration, and discussion. Teachers believe that their students prefer laboratory work and discussions as well as listening to their teacher and watching presentations or films. They also indicate at the necessity to link theory with practice and to involve information technologies. While teaching their subject biology teachers try to establish relationship between theory and real life in order to develop their students’ interest in natural processes.

  10. The viability of alternative assessment methods in the Greek upper secondary school: the oral portfolio

    Directory of Open Access Journals (Sweden)

    Angeliki Daphni

    2012-02-01

    Full Text Available Τhe final examination of the English language subject, in the context of the Greek state upper secondary education, is a traditional paper-and-pencil test which does not include any assessment of oracy skills. This article explores the viability of the oral portfolio as an alternative assessment and pedagogic method that can facilitate the assessment of speaking and listening skills and create a more motivating learning environment. To this effect, three methodological tools were designed, namely, a questionnaire addressing upper secondary English teachers in Greek state schools, a case study involving an oral portfolio implementation and finally, a questionnaire for students to record their experience. The study demonstrates that implementation of the portfolio contributed to a successful assessment of oracy skills and that it was a stimulating experience for students. The results of the study also showed that the pedagogical value of the portfolio counterbalanced its practical constraints. The paper concludes by putting forward recommendations for the future application of this assessment technique in state school education.

  11. Effects of an instruction method in thinking skills with students from compulsory secondary education.

    Science.gov (United States)

    de Acedo Lizarraga, María Luisa Sanz; de Acedo Baquedano, María Teresa Sanz; Pollán Rufo, Milagros

    2010-05-01

    The purpose of this study was to assess the effects caused by the instruction method "Think actively in academic contexts, TAAC", an adaptation of Wallace and Adams' (1993) method of thinking skills, creativity, self-regulation, and academic learning, with students from the second grade of Compulsory Secondary Education (CSE). We used a pretest-intervention-posttest design with control group. The sample was made up of 110 participants, aged between 13 and 15 years, 58 of them in the experimental group and 52 in the control group. Six assessment instruments were administered before and after applying the method in order to measure the dependent variables. The method, divided into eight stages, was used in all the didactic units of the syllabus content of Natural Sciences, Social Sciences, and Language, during one academic course, and allowed the conjoint teaching of thinking skills and the syllabus content. The results of the analyses of variance indicate positive impact of the intervention, as the experimental subjects improved significantly in thinking skills and academic achievement. Some interesting reflections for research and education are derived from this study.

  12. Method of forming components for a high-temperature secondary electrochemical cell

    Science.gov (United States)

    Mrazek, Franklin C.; Battles, James E.

    1983-01-01

    A method of forming a component for a high-temperature secondary electrochemical cell having a positive electrode including a sulfide selected from the group consisting of iron sulfides, nickel sulfides, copper sulfides and cobalt sulfides, a negative electrode including an alloy of aluminum and an electrically insulating porous separator between said electrodes. The improvement comprises forming a slurry of solid particles dispersed in a liquid electrolyte such as the lithium chloride-potassium chloride eutetic, casting the slurry into a form having the shape of one of the components and smoothing the exposed surface of the slurry, cooling the cast slurry to form the solid component, and removing same. Electrodes and separators can be thus formed.

  13. An ontology-based method for secondary use of electronic dental record data

    Science.gov (United States)

    Schleyer, Titus KL; Ruttenberg, Alan; Duncan, William; Haendel, Melissa; Torniai, Carlo; Acharya, Amit; Song, Mei; Thyvalikakath, Thankam P.; Liu, Kaihong; Hernandez, Pedro

    A key question for healthcare is how to operationalize the vision of the Learning Healthcare System, in which electronic health record data become a continuous information source for quality assurance and research. This project presents an initial, ontology-based, method for secondary use of electronic dental record (EDR) data. We defined a set of dental clinical research questions; constructed the Oral Health and Disease Ontology (OHD); analyzed data from a commercial EDR database; and created a knowledge base, with the OHD used to represent clinical data about 4,500 patients from a single dental practice. Currently, the OHD includes 213 classes and reuses 1,658 classes from other ontologies. We have developed an initial set of SPARQL queries to allow extraction of data about patients, teeth, surfaces, restorations and findings. Further work will establish a complete, open and reproducible workflow for extracting and aggregating data from a variety of EDRs for research and quality assurance. PMID:24303273

  14. An ontology-based method for secondary use of electronic dental record data.

    Science.gov (United States)

    Schleyer, Titus Kl; Ruttenberg, Alan; Duncan, William; Haendel, Melissa; Torniai, Carlo; Acharya, Amit; Song, Mei; Thyvalikakath, Thankam P; Liu, Kaihong; Hernandez, Pedro

    2013-01-01

    A key question for healthcare is how to operationalize the vision of the Learning Healthcare System, in which electronic health record data become a continuous information source for quality assurance and research. This project presents an initial, ontology-based, method for secondary use of electronic dental record (EDR) data. We defined a set of dental clinical research questions; constructed the Oral Health and Disease Ontology (OHD); analyzed data from a commercial EDR database; and created a knowledge base, with the OHD used to represent clinical data about 4,500 patients from a single dental practice. Currently, the OHD includes 213 classes and reuses 1,658 classes from other ontologies. We have developed an initial set of SPARQL queries to allow extraction of data about patients, teeth, surfaces, restorations and findings. Further work will establish a complete, open and reproducible workflow for extracting and aggregating data from a variety of EDRs for research and quality assurance.

  15. Processing method for chemical cleaning liquid on the secondary side of steam generator

    International Nuclear Information System (INIS)

    Nishihara, Yukio; Inagaki, Yuzo.

    1993-01-01

    Upon processing nitrilotriacetate (NTA), Fe liquid wastes mainly comprising Fe and Cu liquid wastes mainly comprising ethylene diamine and Cu generated upon chemical cleaning on the secondary side of a steam generator, pH of the Fe liquid wastes is lowered to deposit and separate NTA. Then, Fe ions in a filtrates are deposited on a cathode by electrolysis, as well as remaining NTA is decomposed by oxidation at an anode by O 2 gas. Cu liquid wastes are reacted with naphthalene disulfate and Ba ions and the reaction products are separated by deposition as sludges. Remaining Cu ions in the filtrates are deposited on the cathode by electrolysis. With such procedures, concentration of COD(NTA), Fe ions and Cu ions can greatly be reduced. Further, since capacity of the device can easily be increased in this method, a great amount of liquid wastes can be processed in a relatively short period of time. (T.M.)

  16. Secondary iris recognition method based on local energy-orientation feature

    Science.gov (United States)

    Huo, Guang; Liu, Yuanning; Zhu, Xiaodong; Dong, Hongxing

    2015-01-01

    This paper proposes a secondary iris recognition based on local features. The application of the energy-orientation feature (EOF) by two-dimensional Gabor filter to the extraction of the iris goes before the first recognition by the threshold of similarity, which sets the whole iris database into two categories-a correctly recognized class and a class to be recognized. Therefore, the former are accepted and the latter are transformed by histogram to achieve an energy-orientation histogram feature (EOHF), which is followed by a second recognition with the chi-square distance. The experiment has proved that the proposed method, because of its higher correct recognition rate, could be designated as the most efficient and effective among its companion studies in iris recognition algorithms.

  17. Instructional Methods and Students' End of Term Achievement in Biology in Selected Secondary Schools in Sokoto Metropolis, Sokoto State Nigeria

    Science.gov (United States)

    Shamsuddeen, Abdulrahman; Amina, Hassan

    2016-01-01

    This study investigated the Correlation between instructional methods and students end of term achievement in Biology in selected secondary schools in Sokoto Metropolis, Sokoto State Nigeria. The study addressed three Specific objectives. To examine the relationship between; Cooperative learning methods, guided discovery, Simulation Method and…

  18. Combining sequence-based prediction methods and circular dichroism and infrared spectroscopic data to improve protein secondary structure determinations

    Directory of Open Access Journals (Sweden)

    Lees Jonathan G

    2008-01-01

    Full Text Available Abstract Background A number of sequence-based methods exist for protein secondary structure prediction. Protein secondary structures can also be determined experimentally from circular dichroism, and infrared spectroscopic data using empirical analysis methods. It has been proposed that comparable accuracy can be obtained from sequence-based predictions as from these biophysical measurements. Here we have examined the secondary structure determination accuracies of sequence prediction methods with the empirically determined values from the spectroscopic data on datasets of proteins for which both crystal structures and spectroscopic data are available. Results In this study we show that the sequence prediction methods have accuracies nearly comparable to those of spectroscopic methods. However, we also demonstrate that combining the spectroscopic and sequences techniques produces significant overall improvements in secondary structure determinations. In addition, combining the extra information content available from synchrotron radiation circular dichroism data with sequence methods also shows improvements. Conclusion Combining sequence prediction with experimentally determined spectroscopic methods for protein secondary structure content significantly enhances the accuracy of the overall results obtained.

  19. Homo sapiens as physician and patient: a view from Darwinian medicine.

    Science.gov (United States)

    Román-Franco, Angel A

    2013-09-01

    Medicine's cardinal diagnostic and therapeutic resource is the clinical encounter. Over the last two centuries and particularly over the last five decades the function of the clinical encounter has been eroded to the point of near irrelevance because of the atomized and atomizing influence of technology and microspecialization. Meanwhile, over the past five decades the exceptionalist view of Homo sapiens inherent in the social and religious traditions of the West has similarly undergone radical changes. H. sapiens is now best understood as a microecosystem integrated into a much broader ecosystem: the biosphere. That human microecosystem is composed of constituents derived from the archaeal, bacterial, and eukaryan domains via endosymbiotic, commensalistic and mutualistic interactions. This amalgamation of 100 trillion cells and viral elements is regulated by a composite genome aggregated over the 3.8 billion years of evolutionary history of organic life. No component of H. sapiens or its genome can be identified as irreducibly and exclusively human. H. sapiens' humanity is an emergent property of the microecosystem. Ironically as H. sapiens is viewed by evolutionary science in a highly integrated manner medicine approaches it as a balkanized, deaggregated entity through the eye of 150 different specialties. To effectively address the needs of H sapiens in its role as patient by the same species in its role as physician the disparate views must be harmonized. Here I review some conceptual elements that would assist a physician in addressing the needs of the patient in integrum, as a microecosystem, by the former address the latter as a historical gestalt being. The optimal way to recover the harmony between patient and physician is through a revitalization of the clinical encounter via an ecological and Darwinian epistemology.

  20. Sustainability of outdoor school ground smoking bans at secondary schools: a mixed-method study.

    Science.gov (United States)

    Rozema, A D; Mathijssen, J J P; Jansen, M W J; van Oers, J A M

    2018-02-01

    Although increasing numbers of countries are implementing outdoor school ground smoking bans at secondary schools, less attention is paid to the post-implementation period even though sustainability of a policy is essential for long-term effectiveness. Therefore, this study assesses the level of sustainability and examines perceived barriers/facilitators related to the sustainability of an outdoor school ground smoking ban at secondary schools. A mixed-method design was used with a sequential explanatory approach. In phase I, 438 online surveys were conducted and in phase II, 15 semi-structured interviews were obtained from directors of relevant schools. ANOVA (phase I) and a thematic approach (phase II) were used to analyze data. Level of sustainability of an outdoor school ground smoking ban was high at the 48% Dutch schools with an outdoor smoking ban. Furthermore, school size was significantly associated with sustainability. The perceived barriers/facilitators fell into three categories: (i) smoking ban implementation factors (side-effects, enforcement, communication, guidelines and collaboration), (ii) school factors (physical environment, school culture, education type and school policy) and (iii) community environment factors (legislation and social environment). Internationally, the spread of outdoor school ground smoking bans could be further promoted. Once implemented, the ban has become 'normal' practice and investments tend to endure. Moreover, involvement of all staff is important for sustainability as they function as role models, have an interrelationship with students, and share responsibility for enforcement. These findings are promising for the sustainability of future tobacco control initiatives to further protect against the morbidity/mortality associated with smoking. © The Author 2017. Published by Oxford University Press on behalf of the European Public Health Association.

  1. Effect of Simulation Techniques and Lecture Method on Students' Academic Performance in Mafoni Day Secondary School Maiduguri, Borno State, Nigeria

    Science.gov (United States)

    Bello, Sulaiman; Ibi, Mustapha Baba; Bukar, Ibrahim Bulama

    2016-01-01

    The study examined the effect of simulation technique and lecture method on students' academic performance in Mafoni Day Secondary School, Maiduguri. The study used both simulation technique and lecture methods of teaching at the basic level of education in the teaching/learning environment. The study aimed at determining the best predictor among…

  2. Methods and Materials in Teaching Secondary School Mathematics - Syllabus. Revised Edition.

    Science.gov (United States)

    Gallia, Thomas J.

    This syllabus describes a course designed for the student interested in teaching mathematics at the secondary level and includes both campus centered activities and a field experience. The professor teaching this class is expected to "bridge the gap" between theory in the college classroom and practice as viewed in the secondary school. The…

  3. Research with secondary data : Different matching methods and does it matter.

    NARCIS (Netherlands)

    de Leeuw, Tim; Keijl, Stefan

    Our review of all SMJ studies of the last six years reveals that 63 percent use multiple secondary databases, but only 11 percent report how the connections between these databases were made. This limits our knowledge of how information across secondary databases can be combined and restricts the

  4. Impact of Including Authentic Inquiry Experiences in Methods Courses for Pre-Service Secondary Teachers

    Science.gov (United States)

    Slater, T. F.; Elfring, L.; Novodvorsky, I.; Talanquer, V.; Quintenz, J.

    2007-12-01

    Science education reform documents universally call for students to have authentic and meaningful experiences using real data in the context of their science education. The underlying philosophical position is that students analyzing data can have experiences that mimic actual research. In short, research experiences that reflect the scientific spirit of inquiry potentially can: prepare students to address real world complex problems; develop students' ability to use scientific methods; prepare students to critically evaluate the validity of data or evidence and of the consequent interpretations or conclusions; teach quantitative skills, technical methods, and scientific concepts; increase verbal, written, and graphical communication skills; and train students in the values and ethics of working with scientific data. However, it is unclear what the broader pre-service teacher preparation community is doing in preparing future teachers to promote, manage, and successful facilitate their own students in conducting authentic scientific inquiry. Surveys of undergraduates in secondary science education programs suggests that students have had almost no experiences themselves in conducting open scientific inquiry where they develop researchable questions, design strategies to pursue evidence, and communicate data-based conclusions. In response, the College of Science Teacher Preparation Program at the University of Arizona requires all students enrolled in its various science teaching methods courses to complete an open inquiry research project and defend their findings at a specially designed inquiry science mini-conference at the end of the term. End-of-term surveys show that students enjoy their research experience and believe that this experience enhances their ability to facilitate their own future students in conducting open inquiry.

  5. A consistent modelling methodology for secondary settling tanks: a reliable numerical method.

    Science.gov (United States)

    Bürger, Raimund; Diehl, Stefan; Farås, Sebastian; Nopens, Ingmar; Torfs, Elena

    2013-01-01

    The consistent modelling methodology for secondary settling tanks (SSTs) leads to a partial differential equation (PDE) of nonlinear convection-diffusion type as a one-dimensional model for the solids concentration as a function of depth and time. This PDE includes a flux that depends discontinuously on spatial position modelling hindered settling and bulk flows, a singular source term describing the feed mechanism, a degenerating term accounting for sediment compressibility, and a dispersion term for turbulence. In addition, the solution itself is discontinuous. A consistent, reliable and robust numerical method that properly handles these difficulties is presented. Many constitutive relations for hindered settling, compression and dispersion can be used within the model, allowing the user to switch on and off effects of interest depending on the modelling goal as well as investigate the suitability of certain constitutive expressions. Simulations show the effect of the dispersion term on effluent suspended solids and total sludge mass in the SST. The focus is on correct implementation whereas calibration and validation are not pursued.

  6. Surgical management of pilonidal sinus patients by primary and secondary repair methods: a comparative study

    Directory of Open Access Journals (Sweden)

    Haji Barati B

    2010-12-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Gross difference in return to work exists in pilonidal sinus patients operated by primary and secondary repair. This survey was to evaluate the results of surgical management of pilonidal sinus with primary or secondary closure."n"nMethods: In a randomized clinical trial, patients with pilonidal sinus referring to the surgical clinic of Shariati Hospital in Tehran, Iran between March 2007 and March 2009 were underwent either excision with midline closure (primary, n=40, or excision without closure (secondary, n=40. The recorded outcomes were hospital stay, healing time, time off work, postoperative pain, patient's satisfaction and the recurrence rate."n"nResults: Majority of the patients were male (87.50%. There was no significant difference in the hospital stay. Time off work (8.65±1.73 Vs. 11.53±2.33 days, p=0.001 and healing time (3.43±0.92 Vs. 5.3±0.79 days, p=0.001 were shorter in primary group; but, there were no significant differences in hospital stay and number of visits. Intensity of postoperative pain in the 1st (37.75±6.5 Vs. 43.63±5.06, p=0.001, 2nd (26.75±6.66 Vs. 34.63±5.48, p=0.001, 3rd (18.25±6.05 Vs. 27.88±6.88, p=0.001, and 7th (8.45±3.85 Vs. 17.88±6.19, p=0.001 days were

  7. A comparative method for finding and folding RNA secondary structures within protein-coding regions

    DEFF Research Database (Denmark)

    Pedersen, Jakob Skou; Meyer, Irmtraud Margret; Forsberg, Roald

    2004-01-01

    that RNA-DECODER's parameters can be automatically trained to successfully fold known secondary structures within the HCV genome. We scan the genomes of HCV and polio virus for conserved secondary-structure elements, and analyze performance as a function of available evolutionary information. On known...... secondary structures, RNA-DECODER shows a sensitivity similar to the programs MFOLD, PFOLD and RNAALIFOLD. When scanning the entire genomes of HCV and polio virus for structure elements, RNA-DECODER's results indicate a markedly higher specificity than MFOLD, PFOLD and RNAALIFOLD....

  8. Neuroprotection and secondary damage following spinal cord injury: concepts and methods.

    Science.gov (United States)

    Hilton, Brett J; Moulson, Aaron J; Tetzlaff, Wolfram

    2017-06-23

    Neuroprotection refers to the attenuation of pathophysiological processes triggered by acute injury to minimize secondary damage. The development of neuroprotective treatments represents a major goal in the field of spinal cord injury (SCI) research. In this review, we discuss the strengths and limitations of the methodologies employed to assess secondary damage and neuroprotection in preclinical models of traumatic SCI. We also discuss modelling issues and how new tools might be exploited to study secondary damage and neuroprotection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Toward the Darwinian transition: Switching between distributed and speciated states in a simple model of early life.

    Science.gov (United States)

    Arnoldt, Hinrich; Strogatz, Steven H; Timme, Marc

    2015-01-01

    It has been hypothesized that in the era just before the last universal common ancestor emerged, life on earth was fundamentally collective. Ancient life forms shared their genetic material freely through massive horizontal gene transfer (HGT). At a certain point, however, life made a transition to the modern era of individuality and vertical descent. Here we present a minimal model for stochastic processes potentially contributing to this hypothesized "Darwinian transition." The model suggests that HGT-dominated dynamics may have been intermittently interrupted by selection-driven processes during which genotypes became fitter and decreased their inclination toward HGT. Stochastic switching in the population dynamics with three-point (hypernetwork) interactions may have destabilized the HGT-dominated collective state and essentially contributed to the emergence of vertical descent and the first well-defined species in early evolution. A systematic nonlinear analysis of the stochastic model dynamics covering key features of evolutionary processes (such as selection, mutation, drift and HGT) supports this view. Our findings thus suggest a viable direction out of early collective evolution, potentially enabling the start of individuality and vertical Darwinian evolution.

  10. "Plants that Remind Me of Home": Collecting, Plant Geography, and a Forgotten Expedition in the Darwinian Revolution.

    Science.gov (United States)

    Hung, Kuang-Chi

    2017-02-01

    In 1859, Harvard botanist Asa Gray (1810-1888) published an essay of what he called "the abstract of Japan botany." In it, he applied Charles Darwin's evolutionary theory to explain why strong similarities could be found between the flora of Japan and that of eastern North America, which provoked his famous debate with Louis Agassiz (1807-1873) and initiated Gray's efforts to secure a place for Darwinian biology in the American sciences. Notably, although the Gray-Agassiz debate has become one of the most thoroughly studied scientific debates, historians of science remain unable to answer one critical question: How was Gray able to acquire specimens from Japan? Making use of previously unknown archival materials, this article scrutinizes the institutional, instrumental, financial, and military settings that enabled Gray's collector, Charles Wright (1811-1885), to travel to Japan, as well as examine Wright's collecting practices in Japan. I argue that it is necessary to examine Gray's diagnosis of Japan's flora and the subsequent debate about it from the viewpoint of field sciences. The field-centered approach not only unveils an array of historical significances that have been overshadowed by the analytical framework of the Darwinian revolution and the reception of Darwinism, but also places a seemingly domestic incident in a transnational context.

  11. Effects of Lecture Method Supplemented with Music and Computer Animation on Senior Secondary School Students' Academic Achievement in Electrochemistry

    Science.gov (United States)

    Akpoghol, T. V.; Ezeudu, F. O.; Adzape, J. N.; Otor, E. E.

    2016-01-01

    The study investigated the effects of Lecture Method Supplemented with Music (LMM) and Computer Animation (LMC) on senior secondary school students' academic achievement in electrochemistry in Makurdi metropolis. Six research questions and six hypotheses guided the study. The design of the study was quasi experimental, specifically the pre-test,…

  12. Relative Effect of Lecture Method Supplemented with Music and Computer Animation on Senior Secondary School Students' Retention in Electrochemistry

    Science.gov (United States)

    Akpoghol, T. V.; Ezeudu, F. O.; Adzape, J. N.; Otor, E. E.

    2016-01-01

    The study investigated the effects of Lecture Method Supplemented with Music (LMM) and Computer Animation (LMC) on senior secondary school students' retention in electrochemistry in Makurdi metropolis. Three research questions and three hypotheses guided the study. The design of the study was quasi experimental, specifically the pre-test,…

  13. Calculation methods and algorithms development of dynamic loadings on NPP secondary circuit equipment at shock and pulse actions

    International Nuclear Information System (INIS)

    Kuznetsov, D.V.; Kormilitsyn, V.M.; Proskuryakov, K.N.

    2010-01-01

    Calculation results of acoustic parameters fluctuations in low-pressure regenerative heating system of NPP with WWER-1000 type reactor were presented. The spectral structure of acoustic fluctuations was shown to depend on configuration of secondary circuit equipment, its geometrical sizes and operation mode. Estimations of natural oscillations frequencies of working medium pressure in the secondary circuit equipment were resulted. The developed calculation methods and algorithms are intended for revealing and prevention of initiation conditions of vibrations resonances in elements of the secondary circuit equipment with acoustic oscillations in working medium, both under operating conditions and in the design stage of the second circuit of NPP with WWER-1000 type reactor. Analysis of pass-band dependence on operation mode was carried out to solve the given problem [ru

  14. Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

    Directory of Open Access Journals (Sweden)

    Mariana Minatel Braga

    2010-03-01

    Full Text Available Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent, radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC analysis, and the area under the ROC curve (Az, and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2 and dentine (D3 thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively. In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

  15. Methods to induce primary and secondary traumatic damage in organotypic hippocampal slice cultures.

    Science.gov (United States)

    Adamchik, Y; Frantseva, M V; Weisspapir, M; Carlen, P L; Perez Velazquez, J L

    2000-04-01

    Organotypic brain slice cultures have been used in a variety of studies on neurodegenerative processes [K.M. Abdel-Hamid, M. Tymianski, Mechanisms and effects of intracellular calcium buffering on neuronal survival in organotypic hippocampal cultures exposed to anoxia/aglycemia or to excitotoxins, J. Neurosci. 17, 1997, pp. 3538-3553; D.W. Newell, A. Barth, V. Papermaster, A.T. Malouf, Glutamate and non-glutamate receptor mediated toxicity caused by oxygen and glucose deprivation in organotypic hippocampal cultures, J. Neurosci. 15, 1995, pp. 7702-7711; J.L. Perez Velazquez, M.V. Frantseva, P.L. Carlen, In vitro ischemia promotes glutamate mediated free radical generation and intracellular calcium accumulation in pyramidal neurons of cultured hippocampal slices, J. Neurosci. 23, 1997, pp. 9085-9094; L. Stoppini, L.A. Buchs, D. Muller, A simple method for organotypic cultures of nervous tissue, J. Neurosci. Methods 37, 1991, pp. 173-182; R.C. Tasker, J.T. Coyle, J.J. Vornov, The regional vulnerability to hypoglycemia induced neurotoxicity in organotypic hippocampal culture: protection by early tetrodotoxin or delayed MK 801, J. Neurosci. 12, 1992, pp. 4298-4308.]. We describe two methods to induce traumatic cell damage in hippocampal organotypic cultures. Primary trauma injury was achieved by rolling a stainless steel cylinder (0.9 g) on the organotypic slices. Secondary injury was followed after dropping a weight (0.137 g) on a localised area of the organotypic slice, from a height of 2 mm. The time course and extent of cell death were determined by measuring the fluorescence of the viability indicator propidium iodide (PI) at several time points after the injury. The initial localised impact damage spread 24 and 67 h after injury, cell death being 25% and 54%, respectively, when slices were kept at 37 degrees C. To validate these methods as models to assess neuroprotective strategies, similar insults were applied to slices at relatively low temperatures (30

  16. Alarm analysis of secondary loop system based on MFM and SDG methods

    International Nuclear Information System (INIS)

    Yang Ning; Lu Gubing; Chen Pan

    2014-01-01

    The multilevel flow model (MFM) and the signed directed graph (SDG) were combined to analyze the alarm signals of the secondary loop system for nuclear power plant. The MFM was used to delaminate and describe nuclear power plant, and the SDG was used to analyze the logicality of the facility sign in the MFM. Two kinds of faults in the secondary loop system in nuclear power plant were simulated and the alarm signals were analyzed. The simulation results show that the fault source can be identified exactly and the transmit route of the alarm signals can be described clearly, which is helpful for operators to judge. (authors)

  17. Sustainability of outdoor school ground smoking bans at secondary schools : A mixed-method study

    NARCIS (Netherlands)

    Rozema, A. D.; Mathijssen, J. J. P.; Jansen, M. W. J.; Van Oers, J. A. M.

    2017-01-01

    Although increasing numbers of countries are implementing outdoor school ground smoking bans at secondary schools, less attention is paid to the post-implementation period even though sustainability of a policy is essential for long-term effectiveness. Therefore, this study assesses the level of

  18. Mixed Methods Study Using Constructive Learning Team Model for Secondary Mathematics Teachers

    Science.gov (United States)

    Ritter, Kristy L.

    2010-01-01

    The constructive learning team model for secondary mathematics teachers (CLTM) was created to provide students with learning opportunities and experiences that address deficiencies in oral and written communication, logical processes and analysis, mathematical operations, independent learning, teamwork, and technology utilization. This study…

  19. Developing and Validating a Competence Framework for Secondary Mathematics Student Teachers through a Delphi Method

    Science.gov (United States)

    Muñiz-Rodríguez, Laura; Alonso, Pedro; Rodríguez-Muñiz, Luis J.; Valcke, Martin

    2017-01-01

    Initial teacher education programmes provide student teachers with the desired competences to develop themselves as teachers. Although a generic framework for teaching competences is available covering all school subjects in Spain, the initial teacher education programmes curriculum does not specify which competences secondary mathematics student…

  20. Calculation of primary and secondary dose in proton therapy of brain tumors using Monte Carlo method

    International Nuclear Information System (INIS)

    Moghbel Esfahani, F.; Alamatsaz, M.; Karimian, A.

    2012-01-01

    High-energy beams of protons offer significant advantages for the treatment of deep-seated local tumors. Their physical depth-dose distribution in tissue is characterized by a small entrance dose and a distinct maximum - Bragg peak - near the end of range with a sharp falloff at the distal edge. Therefore, research must be done to investigate the possible negative and positive effects of using proton therapy as a treatment modality. In proton therapy, protons do account for the vast majority of dose. However, when protons travel through matter, secondary particles are created by the interactions of protons and matter en route to and within the patient. It is believed that secondary dose can lead to secondary cancer, especially in pediatric cases. Therefore, the focus of this work is determining both primary and secondary dose. Dose calculations were performed by MCNPX in tumoral and healthy parts of brain. The brain tumor has a 10 mm diameter and is located 16 cm under the skin surface. The brain was simulated by a cylindrical water phantom with the dimensions of 19 x 19cm 2 (length x diameter), with 0.5 cm thickness of plexiglass (C 4 H 6 O 2 ). Then beam characteristics were investigated to ensure the accuracy of the model. Simulations were initially validated with against packages such as SRIM/TRIM. Dose calculations were performed using different configurations to evaluate depth-dose profiles and dose 2D distributions.The results of the simulation show that the best proton energy interval, to cover completely the brain tumor, is from 152 to 154 MeV. (authors)

  1. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  2. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth.

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-09-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%).

  3. Investigation of the spray characteristics for a secondary fuel injection nozzle using a digital image processing method

    Science.gov (United States)

    Jeong, Haeyoung; Lee, Kihyung; Ikeda, Yuji

    2007-05-01

    There are many ways to reduce diesel engine exhaust emissions. However, NOx emission is difficult to reduce because the hydrocarbon (HC) concentration in a diesel engine is not sufficient for NOx conversion. Therefore, in order to create stoichiometric conditions in the De-NOx catalyst, a secondary injection system is designed to inject liquid HC into the exhaust pipe. The atomization and distribution characteristics of the HC injected from a secondary injector are key technologies to obtain a high NOx conversion because inhomogeneous droplets of injected HC cause not only high fuel consumption but also deterioration of NOx emission. This paper describes the spray characteristics of a secondary injector including the spray angle, penetration length and breakup behaviour of the spray to optimize the reduction rate of the NOx catalyst. In this study, various optical diagnostics were applied to investigate these spray characteristics, the atomization mechanism and spray developing process. The visualization and image processing method for the spray pulsation were developed by high speed photography. The influence of the fuel supply pressure on the spray behaviour and a more detailed spray developing process have been analysed experimentally using image processing. Finally, the experimental results were used to correlate the spray structure to the injection system performance and to provide a design guide for a secondary injector nozzle.

  4. Suitability of Secondary PEEK Telescopic Crowns on Zirconia Primary Crowns: The Influence of Fabrication Method and Taper.

    Science.gov (United States)

    Merk, Susanne; Wagner, Christina; Stock, Veronika; Eichberger, Marlis; Schmidlin, Patrick R; Roos, Malgorzata; Stawarczyk, Bogna

    2016-11-08

    This study investigates the retention load (RL) between ZrO₂ primary crowns and secondary polyetheretherketone (PEEK) crowns made by different fabrication methods with three different tapers. Standardized primary ZrO₂ crowns were fabricated with three different tapers: 0°, 1°, and 2° ( n = 10/group). Ten secondary crowns were fabricated (i) milled from breCam BioHPP blanks (PM); (ii) pressed from industrially fabricated PEEK pellets (PP) (BioHPP Pellet); or (iii) pressed from granular PEEK (PG) (BioHPP Granulat). One calibrated operator adjusted all crowns. In total, the RL of 90 secondary crowns were measured in pull-off tests at 50 mm/min, and each specimen was tested 20 times. Two- and one-way ANOVAs followed by a Scheffé's post-hoc test were used for data analysis ( p impact on the results. Within the 2° taper, the fabrication method had no influence on the RL. Within the PM group, the 2° taper showed significantly higher retention load compared with the 1° taper. The taper with 0° was in the same range value as the 1° and 2° tapers. No impact of the taper on the retention value was observed between the PP groups. Within the PG groups, the 0° taper presented significantly lower RL than the 1° taper, whereas the 2° taper showed no differences. The fabrication method of the secondary PEEK crowns and taper angles showed no consistent effect within all tested groups.

  5. Suitability of Secondary PEEK Telescopic Crowns on Zirconia Primary Crowns: The Influence of Fabrication Method and Taper

    Directory of Open Access Journals (Sweden)

    Susanne Merk

    2016-11-01

    Full Text Available This study investigates the retention load (RL between ZrO2 primary crowns and secondary polyetheretherketone (PEEK crowns made by different fabrication methods with three different tapers. Standardized primary ZrO2 crowns were fabricated with three different tapers: 0°, 1°, and 2° (n = 10/group. Ten secondary crowns were fabricated (i milled from breCam BioHPP blanks (PM; (ii pressed from industrially fabricated PEEK pellets (PP (BioHPP Pellet; or (iii pressed from granular PEEK (PG (BioHPP Granulat. One calibrated operator adjusted all crowns. In total, the RL of 90 secondary crowns were measured in pull-off tests at 50 mm/min, and each specimen was tested 20 times. Two- and one-way ANOVAs followed by a Scheffé’s post-hoc test were used for data analysis (p < 0.05. Within crowns with a 0° taper, the PP group showed significantly higher retention load values compared with the other groups. Among the 1° taper, the PM group presented significantly lower retention loads than the PP group. However, the pressing type had no impact on the results. Within the 2° taper, the fabrication method had no influence on the RL. Within the PM group, the 2° taper showed significantly higher retention load compared with the 1° taper. The taper with 0° was in the same range value as the 1° and 2° tapers. No impact of the taper on the retention value was observed between the PP groups. Within the PG groups, the 0° taper presented significantly lower RL than the 1° taper, whereas the 2° taper showed no differences. The fabrication method of the secondary PEEK crowns and taper angles showed no consistent effect within all tested groups.

  6. Alkalisation agent measurement with differential conductivity method in secondary water system

    International Nuclear Information System (INIS)

    Wuhrmann, Peter; Lendi, Marco

    2012-09-01

    Besides ammonia hydroxide, also morpholine and ethanol-amine (ETA) are mainly used as a pH regulating agent on the secondary water side [1]. The concentration of the alkalisation agent can only be calculated if the chemical composition in the sample is known [2]. Therefore, for a reliable alkalisation agent measurement, there are three major steps to take: A reliable specific and (degassed) acid conductivity measurement, pH calculation and the selection of the chemical model for concentration calculation of the alkalisation agent (authors)

  7. In-situ measurements of the secondary electron yield in an accelerator environment: Instrumentation and methods

    International Nuclear Information System (INIS)

    Hartung, W.H.; Asner, D.M.; Conway, J.V.; Dennett, C.A.; Greenwald, S.; Kim, J.-S.; Li, Y.; Moore, T.P.; Omanovic, V.; Palmer, M.A.; Strohman, C.R.

    2015-01-01

    The performance of a particle accelerator can be limited by the build-up of an electron cloud (EC) in the vacuum chamber. Secondary electron emission from the chamber walls can contribute to EC growth. An apparatus for in-situ measurements of the secondary electron yield (SEY) in the Cornell Electron Storage Ring (CESR) was developed in connection with EC studies for the CESR Test Accelerator program. The CESR in-situ system, in operation since 2010, allows for SEY measurements as a function of incident electron energy and angle on samples that are exposed to the accelerator environment, typically 5.3 GeV counter-rotating beams of electrons and positrons. The system was designed for periodic measurements to observe beam conditioning of the SEY with discrimination between exposure to direct photons from synchrotron radiation versus scattered photons and cloud electrons. The samples can be exchanged without venting the CESR vacuum chamber. Measurements have been done on metal surfaces and EC-mitigation coatings. The in-situ SEY apparatus and improvements to the measurement tools and techniques are described

  8. In-situ measurements of the secondary electron yield in an accelerator environment: Instrumentation and methods

    Energy Technology Data Exchange (ETDEWEB)

    Hartung, W.H., E-mail: wh29@cornell.edu; Asner, D.M.; Conway, J.V.; Dennett, C.A.; Greenwald, S.; Kim, J.-S.; Li, Y.; Moore, T.P.; Omanovic, V.; Palmer, M.A.; Strohman, C.R.

    2015-05-21

    The performance of a particle accelerator can be limited by the build-up of an electron cloud (EC) in the vacuum chamber. Secondary electron emission from the chamber walls can contribute to EC growth. An apparatus for in-situ measurements of the secondary electron yield (SEY) in the Cornell Electron Storage Ring (CESR) was developed in connection with EC studies for the CESR Test Accelerator program. The CESR in-situ system, in operation since 2010, allows for SEY measurements as a function of incident electron energy and angle on samples that are exposed to the accelerator environment, typically 5.3 GeV counter-rotating beams of electrons and positrons. The system was designed for periodic measurements to observe beam conditioning of the SEY with discrimination between exposure to direct photons from synchrotron radiation versus scattered photons and cloud electrons. The samples can be exchanged without venting the CESR vacuum chamber. Measurements have been done on metal surfaces and EC-mitigation coatings. The in-situ SEY apparatus and improvements to the measurement tools and techniques are described.

  9. A study on the Stress Corrosion Cracking reduction method of Steam Generator secondary side of KSNP

    International Nuclear Information System (INIS)

    Kim, June Hoon; Lee, Goune Jin

    2014-01-01

    In order to avoid sludge accumulation affecting the life of the steam generator, the best way is to prevent the sludge inflow in advance by optimization of water quality management through chemical concentration and pH control etc. However it is very difficult to prevent sludge accumulation under the weak condition of corrosion, such as condensation, boiling and high temperature of feed-water in NPPs. Particularly stress corrosion cracking occurs in a top-of-tube sheet area of steam generator with an increase in number of operation years of Korea Standard Nuclear Plant(KSNP)... The purpose of this study is to improve suppression of stress corrosion cracking and life extension for steam generator and improve plant efficiency by performing full length bulk high chemical cleaning in order to remove iron oxide of steam generator secondary side in KSNP Hanbit Unit 6. This study analyzed the Free EDTA and Fe concentrations and sludge removal after performed full length bulk high temperature chemical cleaning for removing the iron oxide of steam generator secondary side, which of Hanbit unit 6 of KSNP. 1) It showed a typical pattern that Fe concentration increased in accordance with to decrease Free EDTA(Ethylene Diamine Tetea acetic Acid) concentration. 2) Sludge removal based on iron oxide after performing the full length bulk high temperature chemical cleaning was 3001kg and sludge removal by lancing additionally was 200.1kg

  10. Evaluation of Pentachlorophenol Residues in Some Hygienic Papers Prepared from Virgin and Secondary Pulp by Electron Capture Gas Chromatographic Method

    Directory of Open Access Journals (Sweden)

    Behrouz Akbari-adergani

    2016-01-01

    Full Text Available In this study, residual amount of pentachlorophenol (PCP as the most important paper preservative, which is extremely hazardous pollutant, was determined in some tissue papers and napkins. Twenty-five samples of two producing hygienic paper factories prepared from virgin and secondary pulp were analyzed for the presence of trace amount of PCP. The analytical procedure involved direct extraction of PCP from hygienic paper and its determination by gas chromatography with electron capture detection. The statistical results for the analysis of all samples revealed that there were significant differences between mean of PCP in hygienic papers prepared from virgin and secondary pulp (P<0.05. This method gave recoveries of 86-98% for hygienic paper made from virgin pulp and 79-92% for hygienic paper made from secondary pulp. The limit of detection (LOD and limit of quantification (LOQ for PCP were 6.3 and 21.0 mg/kg, respectively. The analytical method has the requisite sensitivity, accuracy, precision and specificity to assay PCP in hygienic papers. This study demonstrates a concern with exposition to PCP considering that hygienic paper is largely consumed in the society.

  11. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  12. Becoming pregnant during secondary school: findings from concurrent mixed methods research in Anambra State, Nigeria.

    Science.gov (United States)

    Onyeka, Ifeoma N; Miettola, Juhani; Ilika, Amobi L; Vaskilampi, Tuula

    2012-03-01

    Pregnancies among teenagers and problems associated with premarital births have raised concerns in many countries. It is important to explore unintended pregnancy from the viewpoints of local stakeholders such as students, schools/teachers, and community members. This study assessed reported cases of unintended pregnancy among students and perceptions of these pregnancies by members of the community. This study took place in a rural community in Anambra state, southeastern Nigeria. A cross-sectional survey of 1,234 students and 46 teachers in five secondary schools was carried out using self-administered questionnaires. In addition, focus group discussions (FGD) involving 10 parents and in-depth interview (IDI) with a student who became pregnant were conducted. Reports of pregnancy were more common during second and third years of junior secondary school than other school years or level. According to teachers, ignorance was the main reason given by students who became pregnant. Students who became pregnant were reported to have performed poorly academically and lived with both parents, who were either subsistence farmers or petty traders. In the IDI, the ex-student opined that pregnant students faced shame, marital limitations and lack of respect from community members. Participants in the FGD suggested that teenagers should be provided with sex education in schools and in churches; parents should communicate with teenagers about sexual matters and make adequate financial provision; and the male partners should be held more accountable for the pregnancies. Poor sexual knowledge and poor socioeconomic conditions play important roles in teenage pregnancy. Male participation may enhance effectiveness of prevention programmes.

  13. Improvement of a separation method for the reduction of secondary waste from the water-jet abrasive suspension cutting technique

    International Nuclear Information System (INIS)

    Brandauer, M.; Gentes, S.; Heneka, A.; Krauss, C.O.; Geckeis, H.; Plaschke, M.; Schild, D.; Tobie, W.

    2017-01-01

    Full text of publication follows. Disassembling the reactor pressure vessel and its built-in components is a huge challenge in the deconstruction of a nuclear power plant. After being exposed to neutron irradiation for years, the activated components need to be disassembled and packed by remote controlled techniques. Underwater disassembling systems have the advantage of the shielding effect of water against radiation. To avoid the generation of aerosols, cold cutting processes are preferred. A cutting method that meets these requirements is the water-jet abrasive suspension cutting technique (WASS). This method provides high flexibility and is immune towards mechanical stress in the components. During the cutting process, a mixture of abrasive particles and radioactive steel particles from the cut components is generated. Depending on the operational conditions, the amount of this secondary waste increases substantially. Therefore, despite of its intrinsic technical benefits, WASS has a serious disadvantage towards other cutting techniques due to the huge disposal costs of secondary waste. During our previous joint research project between KIT and AREVA GmbH called NENAWAS ('New Disposal Methods for the Secondary Waste Treatment of the Water-jet Abrasive Suspension Cutting Technique', funded by the German ministry for education and research, BMBF), a prototype separation device for WASS secondary waste was developed and tested. Using a magnetic filter, steel particles could be successfully separated from the rest of the secondary waste. The separation process is examined using elemental analysis (ICP-OES) for quantification of the separation grade. Additionally, morphologies of particles and particle aggregates before and after the separation process were examined by scanning electron microscopy (SEM). In the abrasive particle fraction after separation of the steel particles a remaining contamination by tiny steel particles could be detected by elemental and

  14. Calculation of the secondary gamma radiation by the Monte Carlo method at displaced sampling from distributed sources

    International Nuclear Information System (INIS)

    Petrov, Eh.E.; Fadeev, I.A.

    1979-01-01

    A possibility to use displaced sampling from a bulk gamma source in calculating the secondary gamma fields by the Monte Carlo method is discussed. The algorithm proposed is based on the concept of conjugate functions alongside the dispersion minimization technique. For the sake of simplicity a plane source is considered. The algorithm has been put into practice on the M-220 computer. The differential gamma current and flux spectra in 21cm-thick lead have been calculated. The source of secondary gamma-quanta was assumed to be a distributed, constant and isotropic one emitting 4 MeV gamma quanta with the rate of 10 9 quanta/cm 3 xs. The calculations have demonstrated that the last 7 cm of lead are responsible for the whole gamma spectral pattern. The spectra practically coincide with the ones calculated by the ROZ computer code. Thus the algorithm proposed can be offectively used in the calculations of secondary gamma radiation transport and reduces the computation time by 2-4 times

  15. Development of the mitigation method for carbon steel corrosion with ceramics in PWR secondary system

    International Nuclear Information System (INIS)

    Okamura, Masato; Shibasaki, Osamu; Miyazaki, Toyoaki; Kaneko, Tetsuji

    2012-09-01

    To verify the effect of depositing ceramic (TiO 2 , La 2 O 3 , and Y 2 O 3 ) on carbon steel to mitigate corrosion, corrosion tests were conducted under simulated chemistry conditions in a PWR secondary system. Test specimens (STPT410) were prepared with and without deposited ceramics. The ceramics were deposited on the specimens under high-temperature and high-pressure water conditions. Corrosion tests were conducted under high pH conditions (9.8) with a flow rate of 1.0-4.7 m/s at 185 deg. C for 200 hours. At a flow rate of 1.0 m/s, the amount of corrosion of the specimens with the ceramics was less than half of that of the specimens without the ceramics. As the flow rate increased, the amount of corrosion increased. However, even at a flow rate of 4.7 m/s, the amount of corrosion was reduced by approximately 30% by depositing the ceramics. After the corrosion tests, the surfaces of the specimens were analyzed with SEM and XRD. When the deposited ceramic was TiO 2 , the surface was densely covered with fine particles (less than 1 μm). From XRD analysis, these particles were identified as ilmenite (FeTiO 3 ). We consider that ilmenite may play an important role in mitigating the corrosion of carbon steel. (authors)

  16. Problem-Based Learning Method: Secondary Education 10th Grade Chemistry Course Mixtures Topic

    Science.gov (United States)

    Üce, Musa; Ates, Ismail

    2016-01-01

    In this research; aim was determining student achievement by comparing problem-based learning method with teacher-centered traditional method of teaching 10th grade chemistry lesson mixtures topic. Pretest-posttest control group research design is implemented. Research sample includes; two classes of (total of 48 students) an Anatolian High School…

  17. The Influence of Darwinian Ideas on Greek Literary Writers of the Late Nineteenth and Early Twentieth Centuries: The Case of Emmanuel Roidis

    Directory of Open Access Journals (Sweden)

    Maria Zarimis

    2008-11-01

    Full Text Available Darwin's works provoked an enormous response in many disciplines including the literary world. This paper presents a portion of my doctoral thesis3, which responds to a blind spot in Greek literary scholarship on evolutionary ideas in comparison to other Western countries. Little work to date focuses on modern Greek writers's responses to Darwinian and other evolutionary ideas. This paper explores the impact of Darwin in selected writings of Emmanuel Roidis and how Roidis satirised Darwinism in his essays and short stories, contributing to the Darwinian discourse on "man's place in nature" and by placing humanity on the same continuum as other primates. The year 2009 marks the 200th anniversary of Darwin's birth and the 150th anniversary of the first publication of his The Origin of Species. It is timely, then, to consider Darwin's impact on modern Greek literature.

  18. The Threat of Unexamined Secondary Data: A Critical Race Transformative Convergent Mixed Methods

    Science.gov (United States)

    Garcia, Nichole M.; Mayorga, Oscar J.

    2018-01-01

    This article uses a critical race theory framework to conceptualize a Critical Race Transformative Convergent Mixed Methods (CRTCMM) in education. CRTCMM is a methodology that challenges normative educational research practices by acknowledging that racism permeates educational institutions and marginalizes Communities of Color. The focus of this…

  19. Teaching Basic Quantum Mechanics in Secondary School Using Concepts of Feynman Path Integrals Method

    Science.gov (United States)

    Fanaro, Maria de los Angeles; Otero, Maria Rita; Arlego, Marcelo

    2012-01-01

    This paper discusses the teaching of basic quantum mechanics in high school. Rather than following the usual formalism, our approach is based on Feynman's path integral method. Our presentation makes use of simulation software and avoids sophisticated mathematical formalism. (Contains 3 figures.)

  20. Teaching Politics in Secondary Education: Analyzing Instructional Methods from the 2008 Presidential Election

    Science.gov (United States)

    Journell, Wayne

    2011-01-01

    This article describes the instructional methods of four high school government teachers during their coverage of the 2008 presidential election. By analyzing the ways in which these teachers attempted to generate interest in the election and further their students' conceptualization of politics, the author seeks to better understand political…

  1. Teaching Two Basic Nanotechnology Concepts in Secondary School by Using a Variety of Teaching Methods

    Science.gov (United States)

    Blonder, Ron; Sakhnini, Sohair

    2012-01-01

    A nanotechnology module was developed for ninth grade students in the context of teaching chemistry. Two basic concepts in nanotechnology were chosen: (1) size and scale and (2) surface-area-to-volume ratio (SA/V). A wide spectrum of instructional methods (e.g., game-based learning, learning with multimedia, learning with models, project based…

  2. Appreciative Inquiry as a Method for Participatory Change in Secondary Schools in Lebanon

    Science.gov (United States)

    Shuayb, Maha

    2014-01-01

    Appreciative inquiry is a strategy which takes a positive approach to organizational development. It aims to identify good practice, design effective development plans, and ensure implementation. This article examines the potentials and limitations of using the appreciative inquiry in a mixed methods research design for developing school…

  3. An overview of translation in language teaching methods: implications for EFL in secondary education in the region of Murcia

    Directory of Open Access Journals (Sweden)

    Teresa Marqués Aguado

    2013-07-01

    Full Text Available Various activities and resources have been used across time to promote and enhance the learning of foreign languages. Among these, translation has been cherished or dismissed depending on the preferred teaching method at each period. With the arrival of the Communicative approach, which focuses on communicative competence, its role has apparently become even more unstable.This article seeks to explore the role of translation in the main teaching methods used in Spain. This will in turn serve as the background against which the current educational scenario (with the communicative approach and the tenets of the Common European Framework of Reference for Languages will be measured with a view to ascertaining the role that translation may currently play. The particular situation of Secondary Education in the Region of Murcia will be discussed in the light of the curricula for this stage.

  4. Alfred Russel Wallace (1823-1913): the forgotten co-founder of the Neo-Darwinian theory of biological evolution.

    Science.gov (United States)

    Kutschera, Ulrich; Hossfeld, Uwe

    2013-12-01

    The British naturalist Alfred Russel Wallace (1823-1913), who had to leave school aged 14 and never attended university, did extensive fieldwork, first in the Amazon River basin (1848-1852) and then in Southeast Asia (1854-1862). Based on this experience, and after reading the corresponding scientific literature, Wallace postulated that species were not created, but are modified descendants of pre-existing varieties (Sarawak Law paper, 1855). Evolution is brought about by a struggle for existence via natural selection, which results in the adaptation of those individuals in variable populations who survive and reproduce (Ternate essay, 1858). In his monograph Darwinism (1889), and in subsequent publications, Wallace extended the contents of Darwin's Origin of Species (1859) into the Neo-Darwinian theory of biological evolution, with reference to the work of August Weismann (1834-1914). Wallace also became the (co)-founder of biogeography, biodiversity research, astrobiology and evolutionary anthropology. Moreover, he envisioned what was later called the anthropocene (i.e., the age of human environmental destructiveness). However, since Wallace believed in atheistic spiritualism and mixed up scientific facts and supernatural speculations in some of his writings, he remains a controversial figure in the history of biology.

  5. A comparison of two microscale laboratory reporting methods in a secondary chemistry classroom

    Science.gov (United States)

    Martinez, Lance Michael

    This study attempted to determine if there was a difference between the laboratory achievement of students who used a modified reporting method and those who used traditional laboratory reporting. The study also determined the relationships between laboratory performance scores and the independent variables score on the Group Assessment of Logical Thinking (GALT) test, chronological age in months, gender, and ethnicity for each of the treatment groups. The study was conducted using 113 high school students who were enrolled in first-year general chemistry classes at Pueblo South High School in Colorado. The research design used was the quasi-experimental Nonequivalent Control Group Design. The statistical treatment consisted of the Multiple Regression Analysis and the Analysis of Covariance. Based on the GALT, students in the two groups were generally in the concrete and transitional stages of the Piagetian cognitive levels. The findings of the study revealed that the traditional and the modified methods of laboratory reporting did not have any effect on the laboratory performance outcome of the subjects. However, the students who used the traditional method of reporting showed a higher laboratory performance score when evaluation was conducted using the New Standards rubric recommended by the state. Multiple Regression Analysis revealed that there was a significant relationship between the criterion variable student laboratory performance outcome of individuals who employed traditional laboratory reporting methods and the composite set of predictor variables. On the contrary, there was no significant relationship between the criterion variable student laboratory performance outcome of individuals who employed modified laboratory reporting methods and the composite set of predictor variables.

  6. Multiple methods of surgical treatment combined with primary IOL implantation on traumatic lens subluxation/dislocation in patients with secondary glaucoma

    OpenAIRE

    Wang, Rui; Bi, Chun-Chao; Lei, Chun-Ling; Sun, Wen-Tao; Wang, Shan-Shan; Dong, Xiao-Juan

    2014-01-01

    AIM:To describe clinical findings and complications from cases of traumatic lens subluxation/dislocation in patients with secondary glaucoma, and discuss the multiple treating methods of operation combined with primary intraocular lens (IOL) implantation.METHODS:Non-comparative retrospective observational case series. Participants:30 cases (30 eyes) of lens subluxation/dislocation in patients with secondary glaucoma were investigated which accepted the surgical treatment by author in the Opht...

  7. A Systematic Protein Refolding Screen Method using the DGR Approach Reveals that Time and Secondary TSA are Essential Variables.

    Science.gov (United States)

    Wang, Yuanze; van Oosterwijk, Niels; Ali, Ameena M; Adawy, Alaa; Anindya, Atsarina L; Dömling, Alexander S S; Groves, Matthew R

    2017-08-24

    Refolding of proteins derived from inclusion bodies is very promising as it can provide a reliable source of target proteins of high purity. However, inclusion body-based protein production is often limited by the lack of techniques for the detection of correctly refolded protein. Thus, the selection of the refolding conditions is mostly achieved using trial and error approaches and is thus a time-consuming process. In this study, we use the latest developments in the differential scanning fluorimetry guided refolding approach as an analytical method to detect correctly refolded protein. We describe a systematic buffer screen that contains a 96-well primary pH-refolding screen in conjunction with a secondary additive screen. Our research demonstrates that this approach could be applied for determining refolding conditions for several proteins. In addition, it revealed which "helper" molecules, such as arginine and additives are essential. Four different proteins: HA-RBD, MDM2, IL-17A and PD-L1 were used to validate our refolding approach. Our systematic protocol evaluates the impact of the "helper" molecules, the pH, buffer system and time on the protein refolding process in a high-throughput fashion. Finally, we demonstrate that refolding time and a secondary thermal shift assay buffer screen are critical factors for improving refolding efficiency.

  8. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  9. Place of the imaging methods for diagnosis and treatment of primary and secondary hepatic tumors

    Energy Technology Data Exchange (ETDEWEB)

    Mircheva, M [Meditsinska Akademiya, Sofia (Bulgaria). Nauchen Institut po Vytreshni Bolesti

    1991-01-01

    A review is presented of the methods in which the imaging and treatment of liver tumors are mutually connected: ultrasound study, radioimmunoscintigraphy with {sup 111}InF(ab){sub 2}-fragments from anti-CEA monoclonal antibodies and computerized tomography (CT). Special attention has been paid to different approaches for increasing of the sensitivity and specificity of CT: contrast intensification of the image with water-soluble contrast media; bolus administration of the contrast media by dynamic CT-scanning; introduction of the contrast matter in truncus coeliacus and/or a. hepatica; late CT. From the terapeutic point of view suspending of different cytostatics in Lipiodol and their intraarterial administration are discussed. The angiographic study is a prerequisite for arterial chemotherapy. Its advantages is stressed against to transcatheter introduction of antimitotic drugs (by using of percutaneous catheters through a. brachialis, a. femoralis or by surgical implantation). The creation of conjugated chemotherapeutic polymers which helps to obtain a depot-effect in conservative treatment is mentioned as a new approach in improving the regional chemotherapy. The first results from nuclear-magnetic resonance tomography are evaluated. The tendency for integration of the individual visualization and therapeutic approaches is stressed. 58 refs.

  10. Application of microbiological methods for secondary oil recovery from the Carpathian crude oil reservoirs

    Energy Technology Data Exchange (ETDEWEB)

    Karaskiewicz, J

    1974-01-01

    The investigation made it possible to isolate from different ecologic environmental (soil, crude oil, formation water, industrial wastes) bacteria cultures of the genus Arthrobacter, Clostridium, Mycobacterium, Peptococcus, and Pseudomonas. These heterotrophic bacteria are characterized by a high metabolic and biogeochemical activity hydrocarbon transformation. Experiments on a technical scale were conducted from 1961 to 1971 in 20 wells; in this study, only the 16 most typical examples are discussed. The experiments were conducted in Carpathian crude oil reservoirs. To each well, a 500:1 mixture of the so-called bacteria vaccine (containing an active biomass of cultures obtained by a specific cultivation method and holding 6 x 10/sup 5/ bacteria cells in 1 ml of fluid, 2,000 kg of molasses, and 50 cu m of water originating from the reservoir submitted to treatment) was injected at 500 to 1,200 m. The intensification of the microbiological processes in the reservoir was observed. This phenomenon occurred not only in the wells to which the bacteria vaccine was injected, but also in the surrounding producing wells. At the same time, an increase in the crude oil production occurred on the average within the range from 20 to 200% and the surpluses of crude oil production continued for 2 to 8 yr. (92 refs.)

  11. Secondary successions of biota in oil-polluted peat soil upon different biological remediation methods

    Science.gov (United States)

    Melekhina, E. N.; Markarova, M. Yu.; Shchemelinina, T. N.; Anchugova, E. M.; Kanev, V. A.

    2015-06-01

    The effects of different bioremediation methods on restoration of the oil-polluted peat soil (Histosol) in the northernmost taiga subzone of European Russia was studied. The population dynamics of microorganisms belonging to different trophic groups (hydrocarbon-oxidizing, ammonifying, nitrifying, and oligonitrophilic) were analyzed together with data on the soil enzyme (catalase and dehydrogenase) activities, population densities of soil microfauna groups, their structures, and states of phytocenoses during a sevenyear-long succession. The remediation with biopreparations Roder composed of oil-oxidizing microorganisms-Roder with Rhodococcus rubber and R. erythropolis and Universal with Rhodotorula glutinis and Rhodococcus sp.-was more efficient than the agrochemical and technical remediation. It was concluded that the biopreparations activate microbiological oil destruction, thereby accelerating restoration succession of phytocenosis and zoocenosis. The succession of dominant microfauna groups was observed: the dipteran larvae and Mesostigmata mites predominant at the early stages were replaced by collembolans at later stages. The pioneer oribatid mite species were Tectocepheus velatus, Oppiella nova, Liochthonius sellnicki, Oribatula tibialis, and Eupelops sp.

  12. Digital Badges for STEM Learning in Secondary Contexts: A Mixed Methods Study

    Science.gov (United States)

    Elkordy, Angela

    The deficit in STEM skills is a matter of concern for national economies and a major focus for educational policy makers. The development of Information and Communications Technologies (ICT) has resulted in a rapidly changing workforce of global scale. In addition, ICT have fostered the growth of digital and mobile technologies which have been the learning context, formal and informal, for a generation of youth. The purpose of this study was to design an intervention based upon a competency-based, digitally-mediated, learning intervention: digital badges for learning STEM habits of mind and practices. Designed purposefully, digital badge learning trajectories and criteria can be flexible tools for scaffolding, measuring, and communicating the acquisition of knowledge, skills, or competencies. One of the most often discussed attributes of digital badges, is the ability of badges to motivate learners. However, the research base to support this claim is in its infancy; there is little empirical evidence. A skills-based digital badge intervention was designed to demonstrate mastery learning in key, age-appropriate, STEM competencies aligned with Next Generation Science Standards (NGSS) and other educational standards. A mixed methods approach was used to study the impact of a digital badge intervention in the sample middle and high school population. Among the findings were statistically significant measures which substantiate that in this student population, the digital badges increased perceived competence and motivated learners to persist at task.

  13. Measurement of Primary and Secondary Stability of Dental Implants by Resonance Frequency Analysis Method in Mandible

    Science.gov (United States)

    Shokri, Mehran; Daraeighadikolaei, Arash

    2013-01-01

    Background. There is no doubt that the success of the dental implants depends on the stability. The aim of this work was to measure the stability of dental implants prior to loading the implants, using a resonance frequency analysis (RFA) by Osstell mentor device. Methods. Ten healthy and nonsmoker patients over 40 years of age with at least six months of complete or partial edentulous mouth received screw-type dental implants by a 1-stage procedure. RFA measurements were obtained at surgery and 1, 2, 3, 4, 5, 7, and 11 weeks after the implant surgery. Results. Among fifteen implants, the lowest mean stability measurement was for the 4th week after surgery in all bone types. At placement, the mean ISQ obtained with the magnetic device was 77.2 with 95% confidence interval (CI) = 2.49, and then it decreased until the 4th week to 72.13 (95% CI = 2.88), and at the last measurement, the mean implant stability significantly (P value implant placement. These suggestions need to be further assessed through future studies. PMID:23737790

  14. Perceived Effectiveness of Identified Methods and Techniques Teachers Adopt in Prose Literature Lessons in some Secondary Schools in Owerri

    Directory of Open Access Journals (Sweden)

    F. O. Ezeokoli

    2016-07-01

    Full Text Available The study determined the methods adopted by teachers in prose literature-in-English classrooms, activities of teachers and students, teachers’ perceived effectiveness of techniques used. It also examined the objectives of teaching prose literature that teachers should address and the extent teachers believe in student-identified difficulties of studying prose literature. The study adopted the descriptive survey research design. Purposive sampling technique was used to select 85 schools in Owerri metropolis and in each school, all literature teachers of senior secondary I and II were involved. In all, 246 literature teachers participated out of which 15 were purposively selected for observation. The two instruments were: Teachers’ Questionnaire (r = 0.87 and Classroom Observation Schedule (r = 0.73. Data were analysed using frequency counts and percentages. Results revealed that teachers adopted lecture (28.4%, reading (10.9% and discussion (7.3% methods. Teacher’s activities during the lesson include: giving background information, summarizing, dictating notes, reading aloud and explaining and asking questions. The adopted techniques include: questioning, oral reading, silent reading and discussion. Teachers’ perceived questioning as the most effective technique followed by debating and summarizing. Teachers identified development of students’ critical faculties and analytical skills, literary appreciation and language skills to be of utmost concern. It was concluded that the methods adopted by teachers are not diverse enough to cater for the needs and backgrounds of students. Keywords: Methods, Techniques, Perceived Effectiveness, Objectives, Literature-in-English

  15. Improved Method for In Vitro Secondary Amastigogenesis of Trypanosoma cruzi: Morphometrical and Molecular Analysis of Intermediate Developmental Forms

    Directory of Open Access Journals (Sweden)

    L. A. Hernández-Osorio

    2010-01-01

    Full Text Available Trypanosoma cruzi undergoes a biphasic life cycle that consists of four alternate developmental stages. In vitro conditions to obtain a synchronic transformation and efficient rates of pure intermediate forms (IFs, which are indispensable for further biochemical, biological, and molecular studies, have not been reported. In the present study, we established an improved method to obtain IFs from secondary amastigogenesis. During the transformation kinetics, we observed progressive decreases in the size of the parasite body, undulating membrane and flagellum that were concomitant with nucleus remodeling and kinetoplast displacement. In addition, a gradual reduction in parasite movement and acquisition of the amastigote-specific Ssp4 antigen were observed. Therefore, our results showed that the in vitro conditions used obtained large quantities of highly synchronous and pure IFs that were clearly distinguished by morphometrical and molecular analyses. Obtaining these IFs represents the first step towards an understanding of the molecular mechanisms involved in amastigogenesis.

  16. Secondary Hypertension

    Science.gov (United States)

    Secondary hypertension Overview Secondary hypertension (secondary high blood pressure) is high blood pressure that's caused by another medical condition. Secondary hypertension can be caused by conditions that affect your kidneys, ...

  17. Theoretical and Experimental Studies of Dissimilar Secondary Metallurgy Methods for Improving Steel Cleanliness

    Science.gov (United States)

    Pitts-Baggett, April

    Due to a continual increasing industry demand for clean steels, a multi-depth sampling approach was developed to gain a more detailed depiction of the reactions occurring in the ladle throughout the Ladle Metallurgy Furnace (LMF) processing. This sampling technique allows for the ability for samples to be reached at depths, which have not been able to be captured before, of approximately 1.5 m below the slag layer. These samples were also taken in conjunction with samples taken just under the slag layer as well as in between those samples. Additional samples were also taken during the processing including multi-point slag sampling. The heats were divided in to five key processing steps: Start of heat (S), after Alloying (A), after desulfurization/start of pre-Rinse (R), prior to Ca treatment (C), and End of heat (E). Sampling sets were collected to compare the effects of silicon, desulfurization rates, slag emulsification, slag evolution and inclusion evolution. By gaining the ability to gather multiple depths, it was determined that the slag emulsification has the ability to follow the flow pattern of the ladle deeper into the ladle than previously seen in literature. Inclusion evolution has been shown by numerous researchers; however, this study showed differences in the inclusion grouping and distribution at the different depths of the ladle through Automated Feature Analysis (AFA). Also, the inclusion path was seen to change depending on both the silicon content and the sulfur content of the steel. This method was applied to develop a desulfurization model at Nucor Steel Tuscaloosa, Inc. (NSTI). In addition to a desulfurization model, a calcium (Ca) model was also developed. The Ca model was applied to target a finished inclusion region based on the conditions up to the wire treatment. These conditions included time, silicon content, and sulfur concentration. Due to the inability of this model to handle every process variable, a new procedure was created to

  18. Primary and secondary battery consumption trends in Sweden 1996–2013: Method development and detailed accounting by battery type

    International Nuclear Information System (INIS)

    Patrício, João; Kalmykova, Yuliya; Berg, Per E.O.; Rosado, Leonardo; Åberg, Helena

    2015-01-01

    Highlights: • Developed MFA method was validated by the national statistics. • Exponential increase of EEE sales leads to increase in integrated battery consumption. • Digital convergence is likely to be a cause for primary batteries consumption decline. • Factors for estimation of integrated batteries in EE are provided. • Sweden reached the collection rates defined by European Union. - Abstract: In this article, a new method based on Material Flow Accounting is proposed to study detailed material flows in battery consumption that can be replicated for other countries. The method uses regularly available statistics on import, industrial production and export of batteries and battery-containing electric and electronic equipment (EEE). To promote method use by other scholars with no access to such data, several empirically results and their trends over time, for different types of batteries occurrence among the EEE types are provided. The information provided by the method can be used to: identify drivers of battery consumption; study the dynamic behavior of battery flows – due to technology development, policies, consumers behavior and infrastructures. The method is exemplified by the study of battery flows in Sweden for years 1996–2013. The batteries were accounted, both in units and weight, as primary and secondary batteries; loose and integrated; by electrochemical composition and share of battery use between different types of EEE. Results show that, despite a fivefold increase in the consumption of rechargeable batteries, they account for only about 14% of total use of portable batteries. Recent increase in digital convergence has resulted in a sharp decline in the consumption of primary batteries, which has now stabilized at a fairly low level. Conversely, the consumption of integrated batteries has increased sharply. In 2013, 61% of the total weight of batteries sold in Sweden was collected, and for the particular case of alkaline manganese

  19. Primary and secondary battery consumption trends in Sweden 1996–2013: Method development and detailed accounting by battery type

    Energy Technology Data Exchange (ETDEWEB)

    Patrício, João, E-mail: joao.patricio@chalmers.se [Department of Civil and Environmental Engineering, Chalmers University of Technology, 412 96 Gothenburg (Sweden); Kalmykova, Yuliya; Berg, Per E.O.; Rosado, Leonardo [Department of Civil and Environmental Engineering, Chalmers University of Technology, 412 96 Gothenburg (Sweden); Åberg, Helena [The Faculty of Education, University of Gothenburg, 40530 Gothenburg (Sweden)

    2015-05-15

    Highlights: • Developed MFA method was validated by the national statistics. • Exponential increase of EEE sales leads to increase in integrated battery consumption. • Digital convergence is likely to be a cause for primary batteries consumption decline. • Factors for estimation of integrated batteries in EE are provided. • Sweden reached the collection rates defined by European Union. - Abstract: In this article, a new method based on Material Flow Accounting is proposed to study detailed material flows in battery consumption that can be replicated for other countries. The method uses regularly available statistics on import, industrial production and export of batteries and battery-containing electric and electronic equipment (EEE). To promote method use by other scholars with no access to such data, several empirically results and their trends over time, for different types of batteries occurrence among the EEE types are provided. The information provided by the method can be used to: identify drivers of battery consumption; study the dynamic behavior of battery flows – due to technology development, policies, consumers behavior and infrastructures. The method is exemplified by the study of battery flows in Sweden for years 1996–2013. The batteries were accounted, both in units and weight, as primary and secondary batteries; loose and integrated; by electrochemical composition and share of battery use between different types of EEE. Results show that, despite a fivefold increase in the consumption of rechargeable batteries, they account for only about 14% of total use of portable batteries. Recent increase in digital convergence has resulted in a sharp decline in the consumption of primary batteries, which has now stabilized at a fairly low level. Conversely, the consumption of integrated batteries has increased sharply. In 2013, 61% of the total weight of batteries sold in Sweden was collected, and for the particular case of alkaline manganese

  20. Protein Based Molecular Markers Provide Reliable Means to Understand Prokaryotic Phylogeny and Support Darwinian Mode of Evolution

    Directory of Open Access Journals (Sweden)

    Vaibhav eBhandari

    2012-07-01

    Full Text Available The analyses of genome sequences have led to the proposal that lateral gene transfers (LGTs among prokaryotes are so widespread that they disguise the interrelationships among these organisms. This has led to questioning whether the Darwinian model of evolution is applicable to the prokaryotic organisms. In this review, we discuss the usefulness of taxon-specific molecular markers such as conserved signature indels (CSIs and conserved signature proteins (CSPs for understanding the evolutionary relationships among prokaryotes and to assess the influence of LGTs on prokaryotic evolution. The analyses of genomic sequences have identified large numbers of CSIs and CSPs that are unique properties of different groups of prokaryotes ranging from phylum to genus levels. The species distribution patterns of these molecular signatures strongly support a tree-like vertical inheritance of the genes containing these molecular signatures that is consistent with phylogenetic trees. Recent detailed studies in this regard on Thermotogae and Archaea, which are reviewed here, have identified large numbers of CSIs and CSPs that are specific for the species from these two taxa and a number of their major clades. The genetic changes responsible for these CSIs (and CSPs initially likely occurred in the common ancestors of these taxa and then vertically transferred to various descendants. Although some CSIs and CSPs in unrelated groups of prokaryotes were identified, their small numbers and random occurrence has no apparent influence on the consistent tree-like branching pattern emerging from other markers. These results provide evidence that although LGT is an important evolutionary force, it does not mask the tree-like branching pattern of prokaryotes or understanding of their evolutionary relationships. The identified CSIs and CSPs also provide novel and highly specific means for identification of different groups of microbes and for taxonomical and biochemical

  1. Protein based molecular markers provide reliable means to understand prokaryotic phylogeny and support Darwinian mode of evolution.

    Science.gov (United States)

    Bhandari, Vaibhav; Naushad, Hafiz S; Gupta, Radhey S

    2012-01-01

    The analyses of genome sequences have led to the proposal that lateral gene transfers (LGTs) among prokaryotes are so widespread that they disguise the interrelationships among these organisms. This has led to questioning of whether the Darwinian model of evolution is applicable to prokaryotic organisms. In this review, we discuss the usefulness of taxon-specific molecular markers such as conserved signature indels (CSIs) and conserved signature proteins (CSPs) for understanding the evolutionary relationships among prokaryotes and to assess the influence of LGTs on prokaryotic evolution. The analyses of genomic sequences have identified large numbers of CSIs and CSPs that are unique properties of different groups of prokaryotes ranging from phylum to genus levels. The species distribution patterns of these molecular signatures strongly support a tree-like vertical inheritance of the genes containing these molecular signatures that is consistent with phylogenetic trees. Recent detailed studies in this regard on the Thermotogae and Archaea, which are reviewed here, have identified large numbers of CSIs and CSPs that are specific for the species from these two taxa and a number of their major clades. The genetic changes responsible for these CSIs (and CSPs) initially likely occurred in the common ancestors of these taxa and then vertically transferred to various descendants. Although some CSIs and CSPs in unrelated groups of prokaryotes were identified, their small numbers and random occurrence has no apparent influence on the consistent tree-like branching pattern emerging from other markers. These results provide evidence that although LGT is an important evolutionary force, it does not mask the tree-like branching pattern of prokaryotes or understanding of their evolutionary relationships. The identified CSIs and CSPs also provide novel and highly specific means for identification of different groups of microbes and for taxonomical and biochemical studies.

  2. Brewing controversies: Darwinian perspective on the adaptive and maladaptive effects of caffeine and ethanol as dietary autonomic modulators.

    Science.gov (United States)

    Yun, Anthony J; Doux, John D; Daniel, Stephanie M

    2007-01-01

    Ethanol and caffeine are two of the oldest human drugs. Their pervasive integration into the modern human diet may reflect behavioral attempts to correct maladaptations induced by evolutionary displacement of the autonomic system. The dietary adoption of caffeine may parallel the emergence of cognition as an independent basis of competition. Enhancement of the cognitive ability to gather and process information likely evolved as a valuable adjunct to physical behavior in prehistoric fight-or-flight encounters. Caffeine effectively exploits this pre-existing association between adrenergic activity and cognitive readiness, leading to its use in the modern environment where success in competition increasingly depends on cognitive, rather than physical, prowess. Ethanol may have emerged as a dietary means to buffer the maladaptive chronic sympathetic activation and fear response associated with stressful lifestyles and the social phobias associated with the dissolution of kin networks. We explore the health implications of ethanol and caffeine use, with particular attention to their acute and chronic effects on the autonomic axis. The putative protective effects of ethanol in surviving major trauma or reducing inflammation and heart disease may relate to tempering the behavioral and cardiovascular consequences of catastrophic or chronic sympathetic activation. Acute or chronic abuse of ethanol manifests paradoxical pro-adrenergic effects such as tremors and insomnia that may partly represent compensatory responses. Compensatory remodeling may also explain why confirmation of detrimental effects related to caffeine-induced sympathetic activation has proven elusive; indeed, paradoxical pro-vagal benefits may eventually be recognized. Ethanol and caffeine are potential agents that may beneficially expand the dynamic range of the autonomic system. In an environment where the Darwinian value of knowledge has increasingly supplanted that of physical traits, the consumption

  3. Primary and secondary battery consumption trends in Sweden 1996-2013: method development and detailed accounting by battery type.

    Science.gov (United States)

    Patrício, João; Kalmykova, Yuliya; Berg, Per E O; Rosado, Leonardo; Åberg, Helena

    2015-05-01

    In this article, a new method based on Material Flow Accounting is proposed to study detailed material flows in battery consumption that can be replicated for other countries. The method uses regularly available statistics on import, industrial production and export of batteries and battery-containing electric and electronic equipment (EEE). To promote method use by other scholars with no access to such data, several empirically results and their trends over time, for different types of batteries occurrence among the EEE types are provided. The information provided by the method can be used to: identify drivers of battery consumption; study the dynamic behavior of battery flows - due to technology development, policies, consumers behavior and infrastructures. The method is exemplified by the study of battery flows in Sweden for years 1996-2013. The batteries were accounted, both in units and weight, as primary and secondary batteries; loose and integrated; by electrochemical composition and share of battery use between different types of EEE. Results show that, despite a fivefold increase in the consumption of rechargeable batteries, they account for only about 14% of total use of portable batteries. Recent increase in digital convergence has resulted in a sharp decline in the consumption of primary batteries, which has now stabilized at a fairly low level. Conversely, the consumption of integrated batteries has increased sharply. In 2013, 61% of the total weight of batteries sold in Sweden was collected, and for the particular case of alkaline manganese dioxide batteries, the value achieved 74%. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Automated correlation and classification of secondary ion mass spectrometry images using a k-means cluster method.

    Science.gov (United States)

    Konicek, Andrew R; Lefman, Jonathan; Szakal, Christopher

    2012-08-07

    We present a novel method for correlating and classifying ion-specific time-of-flight secondary ion mass spectrometry (ToF-SIMS) images within a multispectral dataset by grouping images with similar pixel intensity distributions. Binary centroid images are created by employing a k-means-based custom algorithm. Centroid images are compared to grayscale SIMS images using a newly developed correlation method that assigns the SIMS images to classes that have similar spatial (rather than spectral) patterns. Image features of both large and small spatial extent are identified without the need for image pre-processing, such as normalization or fixed-range mass-binning. A subsequent classification step tracks the class assignment of SIMS images over multiple iterations of increasing n classes per iteration, providing information about groups of images that have similar chemistry. Details are discussed while presenting data acquired with ToF-SIMS on a model sample of laser-printed inks. This approach can lead to the identification of distinct ion-specific chemistries for mass spectral imaging by ToF-SIMS, as well as matrix-assisted laser desorption ionization (MALDI), and desorption electrospray ionization (DESI).

  5. Direct Measurements of Human Colon Crypt Stem Cell Niche Genetic Fidelity: The Role of Chance in Non-Darwinian Mutation Selection

    Directory of Open Access Journals (Sweden)

    Haeyoun eKang

    2013-10-01

    Full Text Available Perfect human stem cell genetic fidelity would prevent aging and cancer. However, perfection would be difficult to achieve, and aging is universal and cancers common. A hypothesis is that because mutations are inevitable over a human lifetime, downstream mechanisms have evolved to manage the deleterious effects of beneficial and lethal mutations. In the colon, a crypt stem cell architecture reduces the number of mitotic cells at risk for mutation accumulation, and multiple niche stem cells ensure that a lethal mutation within any single stem cell does not lead to crypt death. In addition, the architecture of the colon crypt stem cell niche may harness probability or chance to randomly discard many beneficial mutations that might lead to cancer. An analysis of somatic chromosome copy number alterations (CNAs reveals a lack of perfect fidelity in individual normal human crypts, with age-related increases and higher frequencies in ulcerative colitis, a proliferative, inflammatory disease. The age-related increase in somatic CNAs appears consistent with relatively normal replication error and cell division rates. Surprisingly, and similar to point mutations in cancer genomes, the types of crypt mutations were more consistent with random fixation rather than selection. In theory, a simple non-Darwinian way to nullify selection is to reduce the size of the reproducing population. Fates are more determined by chance rather than selection in very small populations, and therefore selection may be minimized within small crypt niches. The desired effect is that many beneficial mutations that might lead to cancer are randomly lost by drift rather than fixed by selection. The subdivision of the colon into multiple very small stem cell niches may trade Darwinian evolution for non-Darwinian somatic cell evolution, capitulating to aging but reducing cancer risks.

  6. Reform-based science teaching: A mixed-methods approach to explaining variation in secondary science teacher practice

    Science.gov (United States)

    Jetty, Lauren E.

    The purpose of this two-phase, sequential explanatory mixed-methods study was to understand and explain the variation seen in secondary science teachers' enactment of reform-based instructional practices. Utilizing teacher socialization theory, this mixed-methods analysis was conducted to determine the relative influence of secondary science teachers' characteristics, backgrounds and experiences across their teacher development to explain the range of teaching practices exhibited by graduates from three reform-oriented teacher preparation programs. Data for this study were obtained from the Investigating the Meaningfulness of Preservice Programs Across the Continuum of Teaching (IMPPACT) Project, a multi-university, longitudinal study funded by NSF. In the first quantitative phase of the study, data for the sample (N=120) were collected from three surveys from the IMPPACT Project database. Hierarchical multiple regression analysis was used to examine the separate as well as the combined influence of factors such as teachers' personal and professional background characteristics, beliefs about reform-based science teaching, feelings of preparedness to teach science, school context, school culture and climate of professional learning, and influences of the policy environment on the teachers' use of reform-based instructional practices. Findings indicate three blocks of variables, professional background, beliefs/efficacy, and local school context added significant contribution to explaining nearly 38% of the variation in secondary science teachers' use of reform-based instructional practices. The five variables that significantly contributed to explaining variation in teachers' use of reform-based instructional practices in the full model were, university of teacher preparation, sense of preparation for teaching science, the quality of professional development, science content focused professional, and the perceived level of professional autonomy. Using the results

  7. Characterization of biogenic secondary organic aerosols using statistical methods; Charakterisierung Biogener Sekundaerer Organischer Aerosole mit Statistischen Methoden

    Energy Technology Data Exchange (ETDEWEB)

    Spindler, Christian

    2010-07-01

    Atmospheric aerosols have important influence on the radiation balance of the Earth, on visibility and human health. Secondary organic aerosol is formed from gas-to-particle conversion of oxidized volatile organic compounds. A dominant fraction of the gases originates from plant emissions, making biogenic secondary organic aerosol (BSOA) an especially important constituent of the atmosphere. Knowing the chemical composition of BSOA particles is crucial for a thorough understanding of aerosol processes in the environment. In this work, the chemical composition of BSOA particles was measured with aerosol mass spectrometry and analyzed with statistical methods. The experimental part of the work comprises process studies of the formation and aging of biogenic aerosols in simulation chambers. Using a plant chamber, real tree emissions were used to produce particles in a way close to conditions in forest environments. In the outdoor chamber SAPHIR, OH-radicals were produced from the photooxidation of ozone under illumination with natural sunlight. Here, BSOA was produced from defined mixtures of mono- and sesquiterpenes that represent boreal forest emissions. A third kind of experiments was performed in the indoor chamber AIDA. Here, particles were produced from ozonolysis of single monoterpenes and aged by condensing OH-oxidation products. Two aerosol mass spectrometers (AMS) were used to measure the chemical composition of the particles. One of the instruments is equipped with a quadrupole mass spectrometer providing unit mass resolution. The second instrument contains a time-of-flight mass spectrometer and provides mass resolution sufficient to distinguish different fragments with the same nominal mass. Aerosol mass spectra obtained with these instruments are strongly fragmented due to electron impact ionization of the evaporated molecules. In addition, typical BSOA mass spectra are very similar to each other. In order to get a more detailed knowledge about the mass

  8. Secondary dentine as a sole parameter for age estimation: Comparison and reliability of qualitative and quantitative methods among North Western adult Indians

    Directory of Open Access Journals (Sweden)

    Jasbir Arora

    2016-06-01

    Full Text Available The indestructible nature of teeth against most of the environmental abuses makes its use in disaster victim identification (DVI. The present study has been undertaken to examine the reliability of Gustafson’s qualitative method and Kedici’s quantitative method of measuring secondary dentine for age estimation among North Western adult Indians. 196 (M = 85; F = 111 single rooted teeth were collected from the Department of Oral Health Sciences, PGIMER, Chandigarh. Ground sections were prepared and the amount of secondary dentine formed was scored qualitatively according to Gustafson’s (0–3 scoring system (method 1 and quantitatively following Kedici’s micrometric measurement method (method 2. Out of 196 teeth 180 samples (M = 80; F = 100 were found to be suitable for measuring secondary dentine following Kedici’s method. Absolute mean error of age was calculated by both methodologies. Results clearly showed that in pooled data, method 1 gave an error of ±10.4 years whereas method 2 exhibited an error of approximately ±13 years. A statistically significant difference was noted in absolute mean error of age between two methods of measuring secondary dentine for age estimation. Further, it was also revealed that teeth extracted for periodontal reasons severely decreased the accuracy of Kedici’s method however, the disease had no effect while estimating age by Gustafson’s method. No significant gender differences were noted in the absolute mean error of age by both methods which suggest that there is no need to separate data on the basis of gender.

  9. Comparison of Classic vs. Role plays Teaching Methods on the Menstrual Hygiene Behavior of Secondary School Girls in Iran

    Directory of Open Access Journals (Sweden)

    R Ostovar

    2013-09-01

    Background & aim: Awareness about the different aspects of health during puberty plays an important role in the health of girls and finally on their health future pregnancy. The aim of the present study was to to compare the effect of role playing and classical training methods in the the improvement of puberty health among secondary school girls in Yasouj City, Iran. Methods: In this study, the educational need during puberty school girls in the interview was determined. The two schools girls were randomly selected (students any school-60. Next, a knowledge and attitude questionnaire and a behavior checklist related to the main puberty health problems were completed. Then one of the schools randomly was selected as educational interventions schools and other were studied as controls. After grouping the students into four groups of 15, intervention were conducted in four sessions including: role-play, question and answer, and lecture. In the control group, all number of school students received training on puberty health through a classical education (lectures. The results were subsequently compared. Data were analyzed by Student t-test paired t-test, and analysis of variance. Results: The results of this study showed that the level of knowledge, attitude and behavior related to health matters during puberty showed significant improvement in the girls before and after implementation of educational intervention through role play (p<0.05.Thus, the mean score in group role play before intervention was 2.35±1.53 and after was 3.96±1.27 , The mean performance score before intervention 6.04±2.34 and after was, 8.61±1.55, respectively, while in classical group differences were not statistically significant (p<0.05 Conclusion: In comparison with the classical method of health education, teaching through role play significantly improved the level of knowledge, attitude and practice related to puberty health among adolescent girls. Key Words: Education, Adolescent Girls

  10. Enhancing Academic Achievement and Retention in Senior Secondary School Chemistry through Discussion and Lecture Methods: A Case Study of Some Selected Secondary Schools in Gboko, Benue State, Nigeria

    Science.gov (United States)

    Omwirhiren, Efe M.

    2015-01-01

    The present study was initiated to determine how academic achievement and retention in chemistry is enhanced using the two instructional methods among SSII students and ascertained the differential performance of male and female students in chemistry with a view of improving student performance in chemistry. The study adopted a non-equivalent…

  11. Punctuated Equilibrium in Statistical Models of Generalized Coevolutionary Resilience: How Sudden Ecosystem Transitions Can Entrain Both Phenotype Expression and Darwinian Selection

    Science.gov (United States)

    Wallace, Rodrick; Wallace, Deborah

    We argue that mesoscale ecosystem resilience shifts akin to sudden phase transitions in physical systems can entrain similarly punctuated events of gene expression on more rapid time scales, and, in part through such means, slower changes induced by selection pressure, triggering punctuated equilibrium Darwinian evolutionary transitions on geologic time scales. The approach reduces ecosystem, gene expression, and Darwinian genetic dynamics to a least common denominator of information sources interacting by crosstalk at markedly differing rates. Pettini's 'topological hypothesis', via a homology between information source uncertainty and free energy density, generates a regression-like class of statistical models of sudden coevolutionary phase transition based on the Rate Distortion and Shannon-McMillan Theorems of information theory which links all three levels. A mathematical treatment of Holling's extended keystone hypothesis regarding the particular role of mesoscale phenomena in entraining both slower and faster dynamical structures produces the result. A main theme is the necessity of a cognitive paradigm for gene expression, mirroring I. Cohen's cognitive approach to immune function. Invocation of the necessary conditions imposed by the asymptotic limit theorems of communication theory enables us to penetrate one layer more deeply before needing to impose an empirically-derived phenomenological system of 'Onsager relation' recursive coevolutionary stochastic differential equations. Extending the development to second order via a large deviations argument permits modeling the influence of human cultural structures on ecosystems as 'farming'.

  12. Comparative Analyses of the Teaching Methods and Evaluation Practices in English Subject at Secondary School Certificate (SSC) and General Certificate of Education (GCE O-Level) in Pakistan

    Science.gov (United States)

    Behlol, Malik Ghulam; Anwar, Mohammad

    2011-01-01

    The study was conducted to compare the teaching methods and evaluation practices in English subject at secondary school certificate (SSC) and general certificate of education GCE-O-level in Pakistan. The population of the study was students, teachers and experts at SSC and 0-level in the Punjab province. Purposive and random sampling techniques…

  13. Computer modeling in free spreadsheets OpenOffice.Calc as one of the modern methods of teaching physics and mathematics cycle subjects in primary and secondary schools

    Directory of Open Access Journals (Sweden)

    Markushevich M.V.

    2016-10-01

    Full Text Available the article details the use of such modern method of training as computer simulation applied to modelling of various kinds of mechanical motion of a material point in the free spreadsheet OpenOffice.org Calc while designing physics and computer science lessons in primary and secondary schools. Particular attention is paid to the application of computer modeling integrated with other modern teaching methods.

  14. The Strategy of New Product Introduction in Durable Goods with Secondary Market: Application of the Optimization Method to Supply Chain Problem

    Directory of Open Access Journals (Sweden)

    Pei Zhao

    2014-01-01

    Full Text Available The aim of this paper is to address how the secondary market affects the strategy of the manufacturer’s new product introduction by using the optimization method. To do so, we develop a two-period model in which a monopolistic manufacturer sells its new durable products directly to end consumers in both periods, while an entrant operates a reverse channel selling used products in the secondary market. We assume that the manufacturer launches a higher quality product in the second period for the technological innovation. We find that the secondary market can actually increase the manufacturer’s profitability and drives the new product introduction in the second period. We also derive the effect of the durability and the degree of quality improvement on the pricing of supply chain partners.

  15. Bayesian Methods and Universal Darwinism

    Science.gov (United States)

    Campbell, John

    2009-12-01

    Bayesian methods since the time of Laplace have been understood by their practitioners as closely aligned to the scientific method. Indeed a recent Champion of Bayesian methods, E. T. Jaynes, titled his textbook on the subject Probability Theory: the Logic of Science. Many philosophers of science including Karl Popper and Donald Campbell have interpreted the evolution of Science as a Darwinian process consisting of a `copy with selective retention' algorithm abstracted from Darwin's theory of Natural Selection. Arguments are presented for an isomorphism between Bayesian Methods and Darwinian processes. Universal Darwinism, as the term has been developed by Richard Dawkins, Daniel Dennett and Susan Blackmore, is the collection of scientific theories which explain the creation and evolution of their subject matter as due to the Operation of Darwinian processes. These subject matters span the fields of atomic physics, chemistry, biology and the social sciences. The principle of Maximum Entropy states that Systems will evolve to states of highest entropy subject to the constraints of scientific law. This principle may be inverted to provide illumination as to the nature of scientific law. Our best cosmological theories suggest the universe contained much less complexity during the period shortly after the Big Bang than it does at present. The scientific subject matter of atomic physics, chemistry, biology and the social sciences has been created since that time. An explanation is proposed for the existence of this subject matter as due to the evolution of constraints in the form of adaptations imposed on Maximum Entropy. It is argued these adaptations were discovered and instantiated through the Operations of a succession of Darwinian processes.

  16. CSSI-PRO: a method for secondary structure type editing, assignment and estimation in proteins using linear combination of backbone chemical shifts

    International Nuclear Information System (INIS)

    Swain, Monalisa; Atreya, Hanudatta S.

    2009-01-01

    Estimation of secondary structure in polypeptides is important for studying their structure, folding and dynamics. In NMR spectroscopy, such information is generally obtained after sequence specific resonance assignments are completed. We present here a new methodology for assignment of secondary structure type to spin systems in proteins directly from NMR spectra, without prior knowledge of resonance assignments. The methodology, named Combination of Shifts for Secondary Structure Identification in Proteins (CSSI-PRO), involves detection of specific linear combination of backbone 1 H α and 13 C' chemical shifts in a two-dimensional (2D) NMR experiment based on G-matrix Fourier transform (GFT) NMR spectroscopy. Such linear combinations of shifts facilitate editing of residues belonging to α-helical/β-strand regions into distinct spectral regions nearly independent of the amino acid type, thereby allowing the estimation of overall secondary structure content of the protein. Comparison of the predicted secondary structure content with those estimated based on their respective 3D structures and/or the method of Chemical Shift Index for 237 proteins gives a correlation of more than 90% and an overall rmsd of 7.0%, which is comparable to other biophysical techniques used for structural characterization of proteins. Taken together, this methodology has a wide range of applications in NMR spectroscopy such as rapid protein structure determination, monitoring conformational changes in protein-folding/ligand-binding studies and automated resonance assignment

  17. Greenhouse Facility Management Experts Identification of Competencies and Teaching Methods to Support Secondary Agricultural Education Instructors: A Modified Delphi Study

    Science.gov (United States)

    Franklin, Edward A.

    2011-01-01

    In this study the Delphi technique has been used to develop a list of educational competencies for preparing secondary agricultural education instructors to effectively manage their school greenhouse facilities. The use of specialized facilities in agricultural education requires appropriate preparation of agricultural education teachers. The…

  18. Comparison and validation of Fourier transform infrared spectroscopic methods for monitoring secondary cell wall cellulose from cotton fibers

    Science.gov (United States)

    The amount of secondary cell wall (SCW) cellulose in the fiber affects the quality and commercial value of cotton. Accurate assessments of SCW cellulose are essential for improving cotton fibers. Fourier Transform Infrared (FT-IR) spectroscopy enables distinguishing SCW from other cell wall componen...

  19. Initial placement and secondary displacement of a new suture-method catheter for sciatic nerve block in healthy volunteers

    DEFF Research Database (Denmark)

    Lyngeraa, T S; Rothe, C; Steen-Hansen, C

    2017-01-01

    electromyography and cold sensation. After return of motor and sensory function, volunteers performed standardised physical exercises; injection of the same study medication was repeated in the same leg and followed by motor and sensory assessments. Fifteen of 16 (94%; 95%CI 72-99%) initial catheter placements...... displacement was 5 mm. Catheters with secondary block failure were displaced between 6 and 10 mm. One catheter was displaced 1.8 mm that resulted in a decrease in maximum voluntary isometric contraction of less than 20%. After repeat test injection, 14 of the 16 volunteers had loss of cold sensation. Neither...

  20. Quantitative secondary electron detection

    Science.gov (United States)

    Agrawal, Jyoti; Joy, David C.; Nayak, Subuhadarshi

    2018-05-08

    Quantitative Secondary Electron Detection (QSED) using the array of solid state devices (SSD) based electron-counters enable critical dimension metrology measurements in materials such as semiconductors, nanomaterials, and biological samples (FIG. 3). Methods and devices effect a quantitative detection of secondary electrons with the array of solid state detectors comprising a number of solid state detectors. An array senses the number of secondary electrons with a plurality of solid state detectors, counting the number of secondary electrons with a time to digital converter circuit in counter mode.

  1. Measurements of secondary electron cross sections by the pulsed electron beam time-of-flight method. I. Molecular nitrogen

    International Nuclear Information System (INIS)

    Goruganthu, R.R.; Wilson, W.G.; Bonham, R.A.

    1983-01-01

    The secondary electron cross sections for gaseous molecular nitrogen are reported at ejection angles of 30, 45, 60, 75, 90, 105, 120, 135 and 150 0 , for the energy range 1.5 eV to 20 eV and incident electron energy of 1 keV. The pulsed electron beam time-of-flight methd was employed. The results were placed on an absolute scale by normalization to the elastic scattering. They were compared, where possible, with those reported by Opal, Beaty, and Peterson (OBP). The agreement is somewhat better when the OBP data are divided by 0.53 + 0.47 sintheta as suggested by Rudd and DuBois. Fits of our data by Legendre-polynomial expansions are used to estimate the low-energy portion of the cross-section, dsigma/dE. This work suggests that existing experimental cross sections for secondary electron ejection as a function of angle and ejected energy may be no better known than +-40%, especially in the low energy region. 7 references, 14 figures, 2 tables

  2. [Secondary hypertension].

    Science.gov (United States)

    Yoshida, Yuichi; Shibata, Hirotaka

    2015-11-01

    Hypertension is a common disease and a crucial predisposing factor of cardiovascular diseases. Approximately 10% of hypertensive patients are secondary hypertension, a pathogenetic factor of which can be identified. Secondary hypertension consists of endocrine, renal, and other diseases. Primary aldosteronism, Cushing's syndrome, pheochromocytoma, hyperthyroidism, and hypothyroidism result in endocrine hypertension. Renal parenchymal hypertension and renovascular hypertension result in renal hypertension. Other diseases such as obstructive sleep apnea syndrome are also very prevalent in secondary hypertension. It is very crucial to find and treat secondary hypertension at earlier stages since most secondary hypertension is curable or can be dramatically improved by specific treatment. One should keep in mind that screening of secondary hypertension should be done at least once in a daily clinical practice.

  3. EFFECTS OF TWO METHODS OF INSTRUCTION ON STUDENTS’ CRITICAL RESPONSE TO PROSE LITERATURE TEXT IN ENGLISH IN SOME SECONDARY SCHOOLS IN BENIN CITY

    Directory of Open Access Journals (Sweden)

    F. O. EZEOKOLI

    2016-08-01

    Full Text Available This study investigated the effects of two methods of instruction on secondary school students’ critical response to Prose Literature text. The study adopted a pretest, posttest, control group quasi experimental design. The participants in the study were 84 Senior Secondary II students of Literature-in-English purposively selected from four Schools in Ikpoba-Okha Local Government Area of Edo State. Two intact classes were randomly assigned to each of the treatment and control groups. Three hypotheses were tested at 0.05 alpha level. The instruments used were: Critical Response to Prose Literature Test (r = .75, Questionnaire on Home Background of Students (r = .82, and Critical Response to Prose Literature Test Marking Guide. Data obtained were subjected to Analysis of Covariance and graph. The results showed significant main effect of treatment on students’ critical response to Prose Literature (F (1, 77 = 44.731; p < .05. Students exposed to Engagement Strategies Method performed better than those exposed to the Conventional Method of instruction. Further, home background of students had no significant effect on students’ critical response to Prose Literature text (F (2, 77 = 4.902; p < .05. There was significant interaction effect of treatment and home background of students on students’ critical response to Prose Literature text (F (2, 77 = 3.508; p < .05. It was concluded that Engagement Strategies Method is effective in promoting students’ critical response to Prose Literature text. Teachers of Literature-in-English should employ Engagement Strategies Method in teaching Prose Literature to students in Senior Secondary Schools.

  4. An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutions

    Directory of Open Access Journals (Sweden)

    Barash Danny

    2008-04-01

    Full Text Available Abstract Background RNAmute is an interactive Java application which, given an RNA sequence, calculates the secondary structure of all single point mutations and organizes them into categories according to their similarity to the predicted structure of the wild type. The secondary structure predictions are performed using the Vienna RNA package. A more efficient implementation of RNAmute is needed, however, to extend from the case of single point mutations to the general case of multiple point mutations, which may often be desired for computational predictions alongside mutagenesis experiments. But analyzing multiple point mutations, a process that requires traversing all possible mutations, becomes highly expensive since the running time is O(nm for a sequence of length n with m-point mutations. Using Vienna's RNAsubopt, we present a method that selects only those mutations, based on stability considerations, which are likely to be conformational rearranging. The approach is best examined using the dot plot representation for RNA secondary structure. Results Using RNAsubopt, the suboptimal solutions for a given wild-type sequence are calculated once. Then, specific mutations are selected that are most likely to cause a conformational rearrangement. For an RNA sequence of about 100 nts and 3-point mutations (n = 100, m = 3, for example, the proposed method reduces the running time from several hours or even days to several minutes, thus enabling the practical application of RNAmute to the analysis of multiple-point mutations. Conclusion A highly efficient addition to RNAmute that is as user friendly as the original application but that facilitates the practical analysis of multiple-point mutations is presented. Such an extension can now be exploited prior to site-directed mutagenesis experiments by virologists, for example, who investigate the change of function in an RNA virus via mutations that disrupt important motifs in its secondary

  5. Optimal Control Method of Parabolic Partial Differential Equations and Its Application to Heat Transfer Model in Continuous Cast Secondary Cooling Zone

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    2015-01-01

    Full Text Available Our work is devoted to a class of optimal control problems of parabolic partial differential equations. Because of the partial differential equations constraints, it is rather difficult to solve the optimization problem. The gradient of the cost function can be found by the adjoint problem approach. Based on the adjoint problem approach, the gradient of cost function is proved to be Lipschitz continuous. An improved conjugate method is applied to solve this optimization problem and this algorithm is proved to be convergent. This method is applied to set-point values in continuous cast secondary cooling zone. Based on the real data in a plant, the simulation experiments show that the method can ensure the steel billet quality. From these experiment results, it is concluded that the improved conjugate gradient algorithm is convergent and the method is effective in optimal control problem of partial differential equations.

  6. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  7. Secondary Evaluations.

    Science.gov (United States)

    Cook, Thomas D.

    Secondary evaluations, in which an investigator takes a body of evaluation data collected by a primary evaluation researcher and examines the data to see if the original conclusions about the program correspond with his own, are discussed. The different kinds of secondary evaluations and the advantages and disadvantages of each are pointed out,…

  8. Multiple methods of surgical treatment combined with primary IOL implantation on traumatic lens subluxation/dislocation in patients with secondary glaucoma.

    Science.gov (United States)

    Wang, Rui; Bi, Chun-Chao; Lei, Chun-Ling; Sun, Wen-Tao; Wang, Shan-Shan; Dong, Xiao-Juan

    2014-01-01

    To describe clinical findings and complications from cases of traumatic lens subluxation/dislocation in patients with secondary glaucoma, and discuss the multiple treating methods of operation combined with primary intraocular lens (IOL) implantation. Non-comparative retrospective observational case series. 30 cases (30 eyes) of lens subluxation/dislocation in patients with secondary glaucoma were investigated which accepted the surgical treatment by author in the Ophthalmology of Xi'an No.4 Hospital from 2007 to 2011. According to the different situations of lens subluxation/dislocation, various surgical procedures were performed such as crystalline lens phacoemulsification, crystalline lens phacoemulsification combined anterior vitrectomy, intracapsular cataract extraction combined anterior vitrectomy, lensectomy combined anterior vitrectomy though peripheral transparent cornea incision, pars plana lensectomy combined pars plana vitrectomy, and intravitreal cavity crystalline lens phacofragmentation combined pars plana vitrectomy. And whether to implement trabeculectomy depended on the different situations of secondary glaucoma. The posterior chamber intraocular lenses (PC-IOLs) were implanted in the capsular-bag or trassclerally sutured in the sulus decided by whether the capsular were present. visual acuity, intraocular pressure, the situation of intraocular lens and complications after the operations. The follow-up time was 11-36mo (21.4±7.13). Postoperative visual acuity of all eyes were improved; 28 cases maintained IOP below 21 mm Hg; 2 cases had slightly IOL subluxation, 4 cases had slightly tilted lens optical area; 1 case had postoperative choroidal detachment; 4 cases had postoperative corneal edema more than 1wk, but eventually recovered transparent; 2 cases had mild postoperative vitreous hemorrhage, and absorbed 4wk later. There was no postoperative retinal detachment, IOL dislocation, and endophthalmitis. To take early treatment of traumatic lens

  9. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  10. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  11. EPR Technology as Sensitive Method for Oxidative Stress Detection in Primary and Secondary Keratinocytes Induced by Two Selected Nanoparticles.

    Science.gov (United States)

    Lohan, S B; Ahlberg, S; Mensch, A; Höppe, D; Giulbudagian, M; Calderón, M; Grether-Beck, S; Krutmann, J; Lademann, J; Meinke, M C

    2017-12-01

    Exogenous factors can cause an imbalance in the redox state of biological systems, promoting the development of oxidative stress, especially reactive oxygen species (ROS). To monitor the intensity of ROS production in secondary keratinocytes (HaCaT) by diesel exhaust particles and thermoresponsive nanogels (tNG), electron paramagnetic resonance (EPR) spectroscopy after 1 and 24 h of incubation, respectively, was applied. Their cytotoxicity was analyzed by a cell viability assay (XTT). For tNG an increase in the cell viability and ROS production of 10% was visible after 24 h, whereas 1 h showed no effect. A ten times lower concentration of diesel exhaust particles exhibited no significant toxic effects on HaCaT cells for both incubation times, thus normal adult human keratinocytes (NHK) were additionally analyzed by XTT and EPR spectroscopy. Here, after 24 h a slight increase of 18% in metabolic activity was observed. However, this effect could not be explained by the ROS formation. A slight increase in the ROS production was only visible after 1 h of incubation time for HaCaT (9%) and NHK (14%).

  12. Simple method for preparation of secondary amides of phosphorylacetic acids and their use for actinide extraction and sorption from nitric acid solutions

    International Nuclear Information System (INIS)

    Artyushin, O.I.; Sharova, E.V.; Odinets, I.L.; Lenevich, S.V.; Mastruykova, T.A.; Morgalyuk, V.P.; Tananaev, I.G.; Pribylova, G.V.; Myasoedova, G.V.; Myasoedov, B.F.

    2004-01-01

    An effective method of synthesis of secondary alkylamides of phosphorylacetic acids (APA), based on amidation of ethyl esters of phosphorylacetic acids with primary aliphatic amines, was developed. Extraction of americium(III) complexes with APA solutions in dichloroethane and uranium(VI) sorption by sorbents with non-covalently fixed APA from nitric acid solutions were studied. In the course of americium(III) extraction there is no correlation between Am III distribution factor and APA structure, whereas during uranium(VI) sorption a dependence of U VI extraction degree on the complexing agent structure is observed [ru

  13. Secondary fuel delivery system

    Science.gov (United States)

    Parker, David M.; Cai, Weidong; Garan, Daniel W.; Harris, Arthur J.

    2010-02-23

    A secondary fuel delivery system for delivering a secondary stream of fuel and/or diluent to a secondary combustion zone located in the transition piece of a combustion engine, downstream of the engine primary combustion region is disclosed. The system includes a manifold formed integral to, and surrounding a portion of, the transition piece, a manifold inlet port, and a collection of injection nozzles. A flowsleeve augments fuel/diluent flow velocity and improves the system cooling effectiveness. Passive cooling elements, including effusion cooling holes located within the transition boundary and thermal-stress-dissipating gaps that resist thermal stress accumulation, provide supplemental heat dissipation in key areas. The system delivers a secondary fuel/diluent mixture to a secondary combustion zone located along the length of the transition piece, while reducing the impact of elevated vibration levels found within the transition piece and avoiding the heat dissipation difficulties often associated with traditional vibration reduction methods.

  14. Secondary Headaches

    Science.gov (United States)

    ... in the medical history or examination to suggest secondary headache. Headache can be caused by general medical conditions such as severe hypertension, or by conditions that affect the brain and ...

  15. An investigation into the disciplinary methods used by teachers in a secondary township school in South Africa

    Directory of Open Access Journals (Sweden)

    Numvula J. Serame

    2013-11-01

    Full Text Available The research that this article reports on investigated the incidence of learner discipline problems, the effect of them on teachers, the teachers’ methods of maintaining discipline and the effectiveness of those methods in one township, namely Jouberton in Klerksdorp, South Africa. The experiences of both teachers and learners were surveyed. It was found that discipline at the school is far from satisfactory and problems with discipline are more serious than the international norm indicates. These problems have a serious effect on a large part of the teachers’ family life, personal health, job satisfaction and morale. Whilst both teachers and learners commendably prefer the educationally sound preventive and positive methods of maintaining discipline, the application of these methods appears not to be effective: it seems as if teacher education falls short in the area of maintaining discipline, particularly regarding the successful application of proactive methods of maintaining discipline. Finally, the learners’ views on the maintenance of discipline are an alarming indictment of the principles of democracy, human rights and human dignity, and of rationality as a tool for conflict resolution. Recommendations are made for follow-up research with the objective of amelioration.

  16. A Secondary Voltage Control Method for an AC/DC Coupled Transmission System Based on Model Predictive Control

    DEFF Research Database (Denmark)

    Xu, Fengda; Guo, Qinglai; Sun, Hongbin

    2015-01-01

    For an AC/DC coupled transmission system, the change of transmission power on the DC lines will significantly influence the AC systems’ voltage. This paper describes a method to coordinated control the reactive power of power plants and shunt capacitors at DC converter stations nearby, in order t...

  17. Multiple methods of surgical treatment combined with primary IOL implantation on traumatic lens subluxation/dislocation in patients with secondary glaucoma

    Directory of Open Access Journals (Sweden)

    Rui Wang

    2014-04-01

    Full Text Available AIM:To describe clinical findings and complications from cases of traumatic lens subluxation/dislocation in patients with secondary glaucoma, and discuss the multiple treating methods of operation combined with primary intraocular lens (IOL implantation.METHODS:Non-comparative retrospective observational case series. Participants:30 cases (30 eyes of lens subluxation/dislocation in patients with secondary glaucoma were investigated which accepted the surgical treatment by author in the Ophthalmology of Xi''an No.4 Hospital from 2007 to 2011. According to the different situations of lens subluxation/dislocation, various surgical procedures were performed such as crystalline lens phacoemulsification, crystalline lens phacoemulsification combined anterior vitrectomy, intracapsular cataract extraction combined anterior vitrectomy, lensectomy combined anterior vitrectomy though peripheral transparent cornea incision, pars plana lensectomy combined pars plana vitrectomy, and intravitreal cavity crystalline lens phacofragmentation combined pars plana vitrectomy. And whether to implement trabeculectomy depended on the different situations of secondary glaucoma. The posterior chamber intraocular lenses (PC-IOLs were implanted in the capsular-bag or trassclerally sutured in the sulus decided by whether the capsular were present. Main outcome measures:visual acuity, intraocular pressure, the situation of intraocular lens and complications after the operations.RESULTS: The follow-up time was 11-36mo (21.4±7.13. Postoperative visual acuity of all eyes were improved; 28 cases maintained IOP below 21 mm Hg; 2 cases had slightly IOL subluxation, 4 cases had slightly tilted lens optical area; 1 case had postoperative choroidal detachment; 4 cases had postoperative corneal edema more than 1wk, but eventually recovered transparent; 2 cases had mild postoperative vitreous hemorrhage, and absorbed 4wk later. There was no postoperative retinal detachment, IOL

  18. Development of methods to predict both the dynamic and the pseudo-static response of secondary structures subjected to seismic excitations

    International Nuclear Information System (INIS)

    Subudhi, M.; Bezler, P.

    1984-01-01

    Multiple independent support excitation time history formulations have been used to investigate simplified methods to predict the inertial (or dynamic) component of response as well as the pseudo-static (or static) component of response of secondary structures subjected to seismic excitations. For the dynamic component the independent response spectrum method is used with current industry practice for the modal and direction of excitation combinations being adopted and various procedures for the group combination and sequence being investigated. SRSS combination between support groups is found to yield satisfactory results. For the static component, support grouping by elevation for preliminary design followed by support grouping by attachment point for final design assure overall safety in the design

  19. Teaching secondary mathematics

    CERN Document Server

    Rock, David

    2013-01-01

    Solidly grounded in up-to-date research, theory and technology,?Teaching Secondary Mathematics?is a practical, student-friendly, and popular text for secondary mathematics methods courses. It provides clear and useful approaches for mathematics teachers, and shows how concepts typically found in a secondary mathematics curriculum can be taught in a positive and encouraging way. The thoroughly revised fourth edition combines this pragmatic approach with truly innovative and integrated technology content throughout. Synthesized content between the book and comprehensive companion websi

  20. A new method to discriminate secondary organic aerosols from different sources using high-resolution aerosol mass spectra

    Directory of Open Access Journals (Sweden)

    M. F. Heringa

    2012-02-01

    Full Text Available Organic aerosol (OA represents a significant and often major fraction of the non-refractory PM1 (particulate matter with an aerodynamic diameter da < 1 μm mass. Secondary organic aerosol (SOA is an important contributor to the OA and can be formed from biogenic and anthropogenic precursors. Here we present results from the characterization of SOA produced from the emissions of three different anthropogenic sources. SOA from a log wood burner, a Euro 2 diesel car and a two-stroke Euro 2 scooter were characterized with an Aerodyne high-resolution time-of-flight aerosol mass spectrometer (HR-TOF-AMS and compared to SOA from α-pinene.

    The emissions were sampled from the chimney/tailpipe by a heated inlet system and filtered before injection into a smog chamber. The gas phase emissions were irradiated by xenon arc lamps to initiate photo-chemistry which led to nucleation and subsequent particle growth by SOA production.

    Duplicate experiments were performed for each SOA type, with the averaged organic mass spectra showing Pearson's r values >0.94 for the correlations between the four different SOA types after five hours of aging. High-resolution mass spectra (HR-MS showed that the dominant peaks in the MS, m/z 43 and 44, are dominated by the oxygenated ions C2H3O+ and CO2+, respectively, similarly to the relatively fresh semi-volatile oxygenated OA (SV-OOA observed in the ambient aerosol. The atomic O:C ratios were found to be in the range of 0.25–0.55 with no major increase during the first five hours of aging. On average, the diesel SOA showed the lowest O:C ratio followed by SOA from wood burning, α-pinene and the scooter emissions. Grouping the fragment ions revealed that the SOA source with the highest O:C ratio had the largest fraction of small ions.

    The HR data of the four sources could be clustered and separated using

  1. Medicine authentication technology as a counterfeit medicine-detection tool: a Delphi method study to establish expert opinion on manual medicine authentication technology in secondary care.

    Science.gov (United States)

    Naughton, Bernard; Roberts, Lindsey; Dopson, Sue; Brindley, David; Chapman, Stephen

    2017-05-06

    This study aims to establish expert opinion and potential improvements for the Falsified Medicines Directive mandated medicines authentication technology. A two-round Delphi method study using an online questionnaire. Large National Health Service (NHS) foundation trust teaching hospital. Secondary care pharmacists and accredited checking technicians. Seven-point rating scale answers which reached a consensus of 70-80% with a standard deviation (SD) of <1.0. Likert scale questions which reached a consensus of 70-80%, a SD of <1.0 and classified as important according to study criteria. Consensus expert opinion has described database cross-checking technology as quick and user friendly and suggested the inclusion of an audio signal to further support the detection of counterfeit medicines in secondary care (70% consensus, 0.9 SD); other important consensus with a SD of <1.0 included reviewing the colour and information in warning pop up screens to ensure they were not mistaken for the 'already dispensed here' pop up, encouraging the dispenser/checker to act on the warnings and making it mandatory to complete an 'action taken' documentation process to improve the quarantine of potentially counterfeit, expired or recalled medicines. This paper informs key opinion leaders and decision makers as to the positives and negatives of medicines authentication technology from an operator's perspective and suggests the adjustments which may be required to improve operator compliance and the detection of counterfeit medicines in the secondary care sector. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  2. Microwave and thermal pretreatment as methods for increasing the biogas potential of secondary sludge from municipal wastewater treatment plants

    DEFF Research Database (Denmark)

    Kuglarz, Mariusz; Karakashev, Dimitar Borisov; Angelidaki, Irini

    2013-01-01

    In the present study, the sludge was pretreated with microwave irradiation and low-temperature thermal method, both conducted under the same temperature range (30–100°C). Microwave pretreatment was found to be superior over the thermal treatment with respect to sludge solubilization and biogas pr...... experiments indicated that pre-treated sludge (microwave irradiation: 900W, temperature: 60–70°C) gave 35% more methane, compared to untreated sludge. Moreover, the results of this study clearly demonstrated that microwave pretreated sludge showed better degree of sanitation....

  3. Decision support for environmental management of industrial non-hazardous secondary materials: New analytical methods combined with simulation and optimization modeling.

    Science.gov (United States)

    Little, Keith W; Koralegedara, Nadeesha H; Northeim, Coleen M; Al-Abed, Souhail R

    2017-07-01

    Non-hazardous solid materials from industrial processes, once regarded as waste and disposed in landfills, offer numerous environmental and economic advantages when put to beneficial uses (BUs). Proper management of these industrial non-hazardous secondary materials (INSM) requires estimates of their probable environmental impacts among disposal as well as BU options. The U.S. Environmental Protection Agency (EPA) has recently approved new analytical methods (EPA Methods 1313-1316) to assess leachability of constituents of potential concern in these materials. These new methods are more realistic for many disposal and BU options than historical methods, such as the toxicity characteristic leaching protocol. Experimental data from these new methods are used to parameterize a chemical fate and transport (F&T) model to simulate long-term environmental releases from flue gas desulfurization gypsum (FGDG) when disposed of in an industrial landfill or beneficially used as an agricultural soil amendment. The F&T model is also coupled with optimization algorithms, the Beneficial Use Decision Support System (BUDSS), under development by EPA to enhance INSM management. Published by Elsevier Ltd.

  4. Attitudes, Motivations and Beliefs about L2 Reading in the Filipino Secondary School Classroom: A Mixed-methods Study

    Directory of Open Access Journals (Sweden)

    Andrzej Cirocki

    2016-11-01

    Full Text Available This study is a two-part investigation. The first part focuses on ESL learners' attitudes and motivations for reading in the target language. The second part deals with ESL teachers' beliefs about motivating L2 learners to read. The study involved 100 ESL learners (N=100 and 30 teachers (N=30 from rural schools in Mindanao, the Philippines. All the participants were recruited through convenience sampling. In other words, participants were selected based on their convenient accessibility and proximity. The current study is a mixed-methods project. Both quantitative and qualitative methods were employed to collect different types of data. The instruments used were: a L2 reading attitude survey, a questionnaire dealing with motivations for L2 reading, a survey on beliefs about motivating L2 learners to read in English, a semi-structured interview and a L2-reading-lesson observation. The quantitative data were statistically analysed. Whenever appropriate, the data were presented in tables and on graphs. The qualitative data were analysed through thematic coding and used to support the quantitative data. The findings show that students have both positive and negative attitudes towards various aspects of L2 reading. They also have different levels of motivation for reading in English, with female participants having higher scores than male participants. The teachers, on the other hand, hold diverse beliefs about motivating learners to read in English. No significant correlation was found between teacher beliefs and students' motivations for reading in English. After the findings have been described, implications for teacher education and instructional practice are offered.

  5. Assessing the Influence of Seasonal and Spatial Variations on the Estimation of Secondary Organic Carbon in Urban Particulate Matter by Applying the EC-Tracer Method

    Directory of Open Access Journals (Sweden)

    Sandra Wagener

    2014-04-01

    Full Text Available The elemental carbon (EC-tracer method was applied to PM10 and PM1 data of three sampling sites in the City of Berlin from February to October 2010. The sites were characterized by differing exposure to traffic and vegetation. The aim was to determine the secondary organic carbon (SOC concentration and to describe the parameters influencing the application of the EC-tracer method. The evaluation was based on comparisons with results obtained from positive matrix factorization (PMF applied to the same samples. To obtain site- and seasonal representative primary OC/EC-ratios ([OC/EC]p, the EC-tracer method was performed separately for each station, and additionally discrete for samples with high and low contribution of biomass burning. Estimated SOC-concentrations for all stations were between 11% and 33% of total OC. SOC-concentrations obtained with PMF exceeded EC-tracer results more than 100% at the park in the period with low biomass burning emissions in PM10. The deviations were besides others attributed to the high ratio of biogenic to combustion emissions and to direct exposure to vegetation. The occurrences of biomass burning emissions in contrast lead to increased SOC-concentrations compared to PMF in PM10. The obtained results distinguish that the EC-tracer-method provides well comparable results with PMF if sites are strongly influenced by one characteristic primary combustion source, but was found to be adversely influenced by direct and relatively high biogenic emissions.

  6. Assessment methods as effective tools for learning outcomes of students in senior secondary schools in Ila-Orangun, south western Nigeria

    Directory of Open Access Journals (Sweden)

    Lamidi W.A

    2013-06-01

    Full Text Available Different methods of assessment on the students learning outcomes in Agricultural Science at five different secondary schools in Ila-Orangun, Osun State were studied. An arm of a class was used for each test; Continuous Assessment (CA and Conventional Method (CM were used for each arm. Students were taught during their normal school times for the maximum time of forty minutes thrice a week. There were ten objective questions weekly for each assessment of the students in the CA method for six weeks. The same questions were used throughout for all the schools, done simultaneously for CA. Also, sixty questions at once at the end of the sixth week for CM. Standard deviation and regression equations for the mean values were used in the analysis. The results show that CA could be adjudged to be better off than the CM because of its higher mean values in all the schools than the CM. The higher R2 values of 0.99 and 0.88 revealed stronger correlation between different methods of assessment and the targeted learners. The CA test should be used instead of CM; the CM does not make learners to gain much cognitive knowledge when compare with what CA does to students.

  7. Electrochemical characteristics of silver- and nickel-coated synthetic graphite prepared by a gas suspension spray coating method for the anode of lithium secondary batteries

    International Nuclear Information System (INIS)

    Choi, Won Chang; Byun, Dongjin; Lee, Joong Kee; Cho, Byung won

    2004-01-01

    Four kinds of synthetic graphite coated with silver and nickel for the anodes of lithium secondary batteries were prepared by a gas suspension spray coating method. The electrode coated with silver showed higher charge-discharge capacities due to a Ag-Li alloy, but rate capability decreased at higher charge-discharge rate. This result can be explained by the formation of an artificial Ag oxidation film with higher impedance, this lowered the rate capability at high charge-discharge rate due to its low electrical conductivity. Rate capability is improved, however, by coating nickel and silver together on the surface of synthetic graphite. The nickel which is inactive with oxidation reaction plays an important role as a conducting agent which enhanced the conductivity of the electrode

  8. TU-H-BRC-01: A New Fabrication Method for Secondary Skin Collimation Using 3D Scanner and 3D Printer

    Energy Technology Data Exchange (ETDEWEB)

    Jung, J [The Catholic University of Korea, Seoul, N/A (Korea, Republic of); Potter, N; Suh, T [The catholic university of Korea, Seoul (Korea, Republic of); Liu, C [University Florida, Gainesville, FL (United States); Lu, B [University of Florida, Gainesville, FL (United States)

    2016-06-15

    Purpose: Using secondary skin collimation (SSC) to protect the critical organ surrounding the tumors is always desirable for electron and/or ortho-voltage treatments. However, the time-consuming and labor-intensive fabrication processes of current method (manually fabricate the lead mask) restrict the general use of SSC. The aim of this study is to develop a new SSC fabrication method using 3D scanning and 3D printing technologies in order to largely decrease the human labor involvement and fabrication time, also improve the fabrication accuracy. Methods: First, the patient surface was scanned with a 3D scanner (Structure Sensor, Occipital, CO). The raw scan data was subsequently transferred to a 3D modeling software (Rhinoceros, Ver. 5.0, McNeel North America, Seattle, WA). The tumor contour was then digitized and shielding region was determined by clinicians in the same software. The corresponding SCC conformed to the skin surface was then automatically generated by the software with the proper shielding thickness. The shell of the SCC (with hollow inside) was consequently printed by a 3D printer (Lulzbot TAZ, Aleph Objects, CO) using plastic material. Finally, the hollow mold of SCC was filled up with a melted cerrobend alloy. Once the cerrobend alloy cooled down, the fabrication of SCC was accomplished. Results: The results indicated the proposed method can achieve a much shorter time on making a SCC compared with tradition fabrication method. The processes of making a skin contour model for patients have been eliminated with the new method. SCC created by the new method possessed better accuracy and better conformality to patient’s skin contours. Conclusion: In this study, we have demonstrated a new method for the SCC fabrication. It is anticipated that our method can be an alternative way to replace conventional manual-based methods for electron and/or ortho-voltage SCC fabrication. This research was supported by the Global Ph.D. Fellowship Program through

  9. TU-H-BRC-01: A New Fabrication Method for Secondary Skin Collimation Using 3D Scanner and 3D Printer

    International Nuclear Information System (INIS)

    Jung, J; Potter, N; Suh, T; Liu, C; Lu, B

    2016-01-01

    Purpose: Using secondary skin collimation (SSC) to protect the critical organ surrounding the tumors is always desirable for electron and/or ortho-voltage treatments. However, the time-consuming and labor-intensive fabrication processes of current method (manually fabricate the lead mask) restrict the general use of SSC. The aim of this study is to develop a new SSC fabrication method using 3D scanning and 3D printing technologies in order to largely decrease the human labor involvement and fabrication time, also improve the fabrication accuracy. Methods: First, the patient surface was scanned with a 3D scanner (Structure Sensor, Occipital, CO). The raw scan data was subsequently transferred to a 3D modeling software (Rhinoceros, Ver. 5.0, McNeel North America, Seattle, WA). The tumor contour was then digitized and shielding region was determined by clinicians in the same software. The corresponding SCC conformed to the skin surface was then automatically generated by the software with the proper shielding thickness. The shell of the SCC (with hollow inside) was consequently printed by a 3D printer (Lulzbot TAZ, Aleph Objects, CO) using plastic material. Finally, the hollow mold of SCC was filled up with a melted cerrobend alloy. Once the cerrobend alloy cooled down, the fabrication of SCC was accomplished. Results: The results indicated the proposed method can achieve a much shorter time on making a SCC compared with tradition fabrication method. The processes of making a skin contour model for patients have been eliminated with the new method. SCC created by the new method possessed better accuracy and better conformality to patient’s skin contours. Conclusion: In this study, we have demonstrated a new method for the SCC fabrication. It is anticipated that our method can be an alternative way to replace conventional manual-based methods for electron and/or ortho-voltage SCC fabrication. This research was supported by the Global Ph.D. Fellowship Program through

  10. Secondary combined suicide pact.

    Science.gov (United States)

    Jayanth, S H; Girish Chandra, Y P; Hugar, Basappa S; Kainoor, Sunilkumar

    2014-03-01

    This article reports a combined suicide pact, where in a young couple; a 26 year old male and a 20 year old female committed suicide by using two methods. The couple had resorted to hanging and self-immolation to prevent failure of single method alone. In secondary combined suicides, several other methods of suicide are tried after the first method chosen has failed. It is primary combined suicide only when two or more methods are used simultaneously. Both types of combined suicide by one individual is well reported in the literature whereas the same by two persons together is rare. In this report, the deceased were disappointed lovers, poor and the family members were against their marriage. The investigation of scene, methods employed to commit suicide, autopsy findings and the interview with their relatives altogether suggested that it was a secondary combined suicide pact. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  11. Multi-Trait Multi-Method Matrices for the Validation of Creativity and Critical Thinking Assessments for Secondary School Students in England and Greece

    Directory of Open Access Journals (Sweden)

    Ourania Maria Ventista

    2017-08-01

    Full Text Available The aim of this paper is the validation of measurement tools which assess critical thinking and creativity as general constructs instead of subject-specific skills. Specifically, this research examined whether there is convergent and discriminant (or divergent validity between measurement tools of creativity and critical thinking. For this purpose, the multi-trait and multi-method matrix suggested by Campbell and Fiske (1959 was used. This matrix presented the correlation of scores that students obtain in different assessments in order to reveal whether the assessments measure the same or different constructs. Specifically, the two methods used were written and oral exams, and the two traits measured were critical thinking and creativity. For the validation of the assessments, 30 secondary-school students in Greece and 21 in England completed the assessments. The sample in both countries provided similar results. The critical thinking tools demonstrated convergent validity when compared with each other and discriminant validity with the creativity assessments. Furthermore, creativity assessments which measure the same aspect of creativity demonstrated convergent validity. To conclude, this research provided indicators that critical thinking and creativity as general constructs can be measured in a valid way. However, since the sample was small, further investigation of the validation of the assessment tools with a bigger sample is recommended.

  12. Use of details in secondary emission spectra in order to take into account element composition in the radioisotopic, x-ray-fluorescence method

    Energy Technology Data Exchange (ETDEWEB)

    Ivanyukovich, G A; Meier, V A; Nakhabtsev, V S

    1974-01-01

    A study is made of secondary emission spectra applicable to the conditions of determining tin in complex iron ores. Use is made of recorders having an intermediate target of samarium oxide, which assure measurement under geometry of a direct field of vision. It is shown that the integral count rate with a definite selection of the initial condition of discrimination or the count rate in the 32 to 34 keV interval of energies characterizes mainly the composition of the filler. With the purpose of increasing the accuracy and decreasing the effect of equipment factors it is more suitable to estimate the filler composition from the integral count rate. Methods are considered for taking into account the effect of composition of the medium on the measurement results according to the method of spectral ratios by means of a nomogram and analytical expressions. With measurements on models the error of determining the tin content was +- 5 percent in effective atomic number range of 13 to 20, while the error was 50 percent without the introduction of corrections. 10 refs. (tr-auth)

  13. Secondary osteoporosis.

    Science.gov (United States)

    Gennari, C; Martini, G; Nuti, R

    1998-06-01

    Generalized osteoporosis currently represents a heterogeneous group of conditions with many different causes and pathogenetic mechanisms, that often are variably associated. The term "secondary" is applied to all patients with osteoporosis in whom the identifiable causal factors are other than menopause and aging. In this heterogeneous group of conditions, produced by many different pathogenetic mechanisms, a negative bone balance may be variably associated with low, normal or increased bone remodeling states. A consistent group of secondary osteoporosis is related to endocrinological or iatrogenic causes. Exogenous hypercortisolism may be considered an important risk factor for secondary osteoporosis in the community, and probably glucocorticoid-induced osteoporosis is the most common type of secondary osteoporosis. Supraphysiological doses of corticosteroids cause two abnormalities in bone metabolism: a relative increase in bone resorption, and a relative reduction in bone formation. Bone loss, mostly of trabecular bone, with its resultant fractures is the most incapacitating consequence of osteoporosis. The estimated incidence of fractures in patients prescribed corticosteroid is 30% to 50%. Osteoporosis is considered one of the potentially serious side effects of heparin therapy. The occurrence of heparin-induced osteoporosis appeared to be strictly related to the length of treatment (over 4-5 months), and the dosage (15,000 U or more daily), but the pathogenesis is poorly understood. It has been suggested that heparin could cause an increase in bone resorption by increasing the number of differentiated osteoclasts, and by enhancing the activity of individual osteoclasts. Hyperthyroidism is frequently associated with loss of trabecular and cortical bone; the enhanced bone turnover that develops in thyrotoxicosis is characterized by an increase in the number of osteoclasts and resorption sites, and an increase in the ratio of resorptive to formative bone

  14. Secondary osteoporosis.

    Science.gov (United States)

    Boyle, I T

    1993-10-01

    Osteoporosis with attendant increased fracture risk is a common complication of many other diseases. Indeed, almost all chronic diseases make some impact on life-style, usually by restricting physical activity and hence reducing the anabolic effect of exercise and gravitational strains on the skeleton. Restricted appetite and modified gastrointestinal tract function is another commonplace finding that has an impact on bone nutrition and synthesis, as on other systems. Sex hormone status is of particular importance for the maintenance of the normal skeleton, and the postmenopausal woman is at particular risk for most causes of secondary osteoporosis. In dealing with secondary osteoporosis in the hypo-oestrogenic woman, the question of giving hormone replacement therapy in addition to other disease-specific therapy should always be considered, as, for example, in a young amenorrhoeic woman with Crohn's disease. Similarly, in hypogonadal men the administration of testosterone is useful for bone conservation. The wider availability of bone densitometry ought to make us more aware of the presence of osteoporosis in the many disease states discussed above. This is particularly important as the life span of such patients is now increased by improved management of the underlying disease process in many instances. Even in steroid-induced osteoporosis--one of the commonest and most severe forms of osteoporosis--we now have some effective therapy in the form of the bisphosphonates and other anti-bone-resorbing drug classes. The possibility of prophylaxis against secondary osteoporosis has therefore become a possibility, although the very long-term effects of such drug regimens are still unknown. In some situations, such as thyrotoxicosis, Cushing's syndrome and immobilization, spontaneous resolution of at least part of the osteoporosis is possible after cure of the underlying problem. The shorter the existence of the basic problem, the more successful the restoration of the

  15. Secondary liquefaction in ethanol production

    DEFF Research Database (Denmark)

    2007-01-01

    The invention relates to a method of producing ethanol by fermentation, said method comprising a secondary liquefaction step in the presence of a themostable acid alpha-amylase or, a themostable maltogenic acid alpha-amylase.......The invention relates to a method of producing ethanol by fermentation, said method comprising a secondary liquefaction step in the presence of a themostable acid alpha-amylase or, a themostable maltogenic acid alpha-amylase....

  16. Autoradiographic detection of [125I]-secondary antiserum: a sensitive light and electron microscopic labeling method compatible with peroxidase immunocytochemistry for dual localization of neuronal antigens

    International Nuclear Information System (INIS)

    Pickel, V.M.; Chan, J.; Milner, T.A.

    1986-01-01

    We examined whether autoradiographic localization of [ 125 I]-antirabbit immunoglobulin (IgG) was suitable for light and electron microscopic detection of a rabbit antiserum to the catecholamine-synthesizing enzyme, tyrosine hydroxylase (TH), and whether autoradiographic and peroxidase labeling could be combined for simultaneous immunocytochemical identification of TH and neuropeptides in brain. Adult rat brains were fixed by aortic arch perfusion with acrolein and paraformaldehyde. Vibratome sections of the fixed tissues were incubated with various dilutions of TH antiserum followed by [ 125 I]-secondary IgG. These sections were then directly processed for autoradiography or were incubated with rabbit antiserum to substance P (SP) or methionine [Met5]-enkephalin (ME). These latter sections were then processed by the peroxidase-antiperoxidase (PAP) or conjugated peroxidase methods followed by autoradiography. Exposure periods of 12-20 days for light microscopy or 90 days for electron microscopy yielded substantial accumulations of silver grains even at the highest (1:30,000) dilution of TH antiserum. At this dilution, immunoreactivity for TH was virtually nondetectable by PAP and conjugated peroxidase methods. The differential sensitivities of the autoradiographic versus peroxidase methods provided a means for separable identification of rabbit antiserum to TH and to SP or ME. Ultrastructural analysis of the catecholaminergic neurons in the medial nuclei of the solitary tract (NTS) showed selective cytoplasmic localization of silver grains for [ 125 I]-labeling of TH in perikarya, dendrites, and terminals. Within single thin sections prepared for dual labeling, the peroxidase marker for SP and for ME was differentially localized with respect to autoradiographic labeling of TH

  17. The Darwinian concept of stress: benefits of allostasis and costs of allostatic load and the trade-offs in health and disease.

    Science.gov (United States)

    Korte, S Mechiel; Koolhaas, Jaap M; Wingfield, John C; McEwen, Bruce S

    2005-02-01

    Why do we get the stress-related diseases we do? Why do some people have flare ups of autoimmune disease, whereas others suffer from melancholic depression during a stressful period in their life? In the present review possible explanations will be given by using different levels of analysis. First, we explain in evolutionary terms why different organisms adopt different behavioral strategies to cope with stress. It has become clear that natural selection maintains a balance of different traits preserving genes for high aggression (Hawks) and low aggression (Doves) within a population. The existence of these personality types (Hawks-Doves) is widespread in the animal kingdom, not only between males and females but also within the same gender across species. Second, proximate (causal) explanations are given for the different stress responses and how they work. Hawks and Doves differ in underlying physiology and these differences are associated with their respective behavioral strategies; for example, bold Hawks preferentially adopt the fight-flight response when establishing a new territory or defending an existing territory, while cautious Doves show the freeze-hide response to adapt to threats in their environment. Thus, adaptive processes that actively maintain stability through change (allostasis) depend on the personality type and the associated stress responses. Third, we describe how the expression of the various stress responses can result in specific benefits to the organism. Fourth, we discuss how the benefits of allostasis and the costs of adaptation (allostatic load) lead to different trade-offs in health and disease, thereby reinforcing a Darwinian concept of stress. Collectively, this provides some explanation of why individuals may differ in their vulnerability to different stress-related diseases and how this relates to the range of personality types, especially aggressive Hawks and non-aggressive Doves in a population. A conceptual framework is

  18. Application of Sol-Gel Method as a Protective Layer on a Specular Reflective Surface for Secondary Reflector in a Solar Receiver

    Energy Technology Data Exchange (ETDEWEB)

    Afrin, Samia; Dagdelen, John; Ma, Zhiwen; Kumar, Vinod

    2017-01-01

    Highly-specular reflective surfaces that can withstand elevated-temperatures are desirable for many applications including reflective heat shielding in solar receivers and secondary reflectors, which can be used between primary concentrators and heat collectors. A high-efficiency, high-temperature solar receiver design based on arrays of cavities needs a highly-specular reflective surface on its front section to help sunlight penetrate into the absorber tubes for effective flux spreading. Since this application is for high-temperature solar receivers, this surface needs to be durable and to maintain its optical properties through the usable life. Degradation mechanisms associated with elevated temperatures and thermal cycling, which include cracking, delamination, corrosion/oxidation, and environmental effects, could cause the optical properties of surfaces to degrade rapidly in these conditions. Protected mirror surfaces for these applications have been tested by depositing a thin layer of SiO2 on top of electrodeposited silver by means of the sol-gel method. To obtain an effective thin film structure, this sol-gel procedure has been investigated extensively by varying process parameters that affect film porosity and thickness. Endurance tests have been performed in a furnace at 150 degrees C for thousands of hours. This paper presents the sol-gel process for intermediate-temperature specular reflective coatings and provides the long-term reliability test results of sol-gel protected silver-coated surfaces.

  19. A combination method for simulation of secondary knock-on atoms of boron carbide induced by neutron irradiation in SPRR-300

    International Nuclear Information System (INIS)

    Wu, Jian-Chun; Feng, Qi-Jie; Liu, Xian-Kun; Zhan, Chang-Yong; Zou, Yu; Liu, Yao-Guang

    2016-01-01

    A multiscale sequence of simulation should be used to predict properties of materials under irradiation. Binary collision theory and molecular dynamics (MDs) method are commonly used to characterize the displacement cascades induced by neutrons in a material. In order to reduce the clock time spent for the MD simulation of damages induced by high-energy primary knock-on atoms (PKAs), the damage zones were split into sub-cascade according to the sub-cascade formation criteria. Two well-known codes, Geant4 and TRIM, were used to simulate high-energy PKA-induced cascades in B_4C and then produce the secondary knock-on atom (SKA) energy spectrum. It has been found that both high-energy primary knock-on B and C atoms move a long range in the boron carbide. These atoms produce sub-cascades at the tip of trajectory. The energy received by most of the SKAs is <10 keV, which can be used as input to reduce the clock time spent for MD simulation.

  20. Do Galaxies Follow Darwinian Evolution?

    Science.gov (United States)

    2006-12-01

    Using VIMOS on ESO's Very Large Telescope, a team of French and Italian astronomers have shown the strong influence the environment exerts on the way galaxies form and evolve. The scientists have for the first time charted remote parts of the Universe, showing that the distribution of galaxies has considerably evolved with time, depending on the galaxies' immediate surroundings. This surprising discovery poses new challenges for theories of the formation and evolution of galaxies. The 'nature versus nurture' debate is a hot topic in human psychology. But astronomers too face similar conundrums, in particular when trying to solve a problem that goes to the very heart of cosmological theories: are the galaxies we see today simply the product of the primordial conditions in which they formed, or did experiences in the past change the path of their evolution? ESO PR Photo 17/06 ESO PR Photo 45/06 Galaxy Distribution in Space In a large, three-year long survey carried out with VIMOS [1], the Visible Imager and Multi-Object Spectrograph on ESO's VLT, astronomers studied more than 6,500 galaxies over a wide range of distances to investigate how their properties vary over different timescales, in different environments and for varying galaxy luminosities [2]. They were able to build an atlas of the Universe in three dimensions, going back more than 9 billion years. This new census reveals a surprising result. The colour-density relation, that describes the relationship between the properties of a galaxy and its environment, was markedly different 7 billion years ago. The astronomers thus found that the galaxies' luminosity, their initial genetic properties, and the environments they reside in have a profound impact on their evolution. "Our results indicate that environment is a key player in galaxy evolution, but there's no simple answer to the 'nature versus nurture' problem in galaxy evolution," said Olivier Le Fèvre from the Laboratoire d'Astrophysique de Marseille, France, who coordinates the VIMOS VLT Deep Survey team that made the discovery. "They suggest that galaxies as we see them today are the product of their inherent genetic information, evolved over time, as well as complex interactions with their environments, such as mergers." Scientists have known for several decades that galaxies in the Universe's past look different to those in the present-day Universe, local to the Milky Way [3]. Today, galaxies can be roughly classified as red, when few or no new stars are being born, or blue, where star formation is still ongoing. Moreover, a strong correlation exists between a galaxy's colour and the environment it resides in: the more sociable types found in dense clusters are more likely to be red than the more isolated ones. By looking back at a wide range of galaxies of a variety of ages, the astronomers were aiming to study how this peculiar correlation has evolved over time. "Using VIMOS, we were able to use the largest sample of galaxies currently available for this type of study, and because of the instrument's ability to study many objects at a time we obtained many more measurements than previously possible," said Angela Iovino, from the Brera Astronomical Observatory, Italy, another member of the team. The team's discovery of a marked variation in the 'colour-density' relationship, depending on whether a galaxy is found in a cluster or alone, and on its luminosity, has many potential implications. The findings suggest for example that being located in a cluster quenches a galaxy's ability to form stars more quickly compared with those in isolation. Luminous galaxies also run out of star-forming material at an earlier time than fainter ones. They conclude that the connection between galaxies' colour, luminosity and their local environment is not merely a result of primordial conditions 'imprinted' during their formation - but just as for humans, galaxies' relationship and interactions can have a profound impact on their evolution.

  1. Darwinian foundations for evolutionary economics

    NARCIS (Netherlands)

    Stoelhorst, J.W.

    2008-01-01

    This paper engages with the methodological debate on the contribution of Darwinism to Veblen's (1898) evolutionary research program for economics. I argue that ontological continuity, generalized Darwinism, and multi-level selection are necessary building blocks for an explanatory framework that can

  2. Balinsky’s Darwinian roots

    Directory of Open Access Journals (Sweden)

    B. Fabian

    2010-02-01

    Full Text Available Boris Ivan Balinsky (1905–1997 was Professor and Head of the Department of Zoology at the University of the Witwatersrand (Wits,Johannesburg,South Africa. He came to Wits in 1949 (via Munich and Edinburghfrom Kiev,where he was Professor of Embryology. As an acclaimed experimental embryologist he was especially famous for inducing a supernumerary limb in a newt when he was a19-year-old student in Ivan Schmalhausen’s laboratory in Kiev 1924. In Johannesburg he wrote his famous text book of embryology, which influenced generations of students around the world.In addition to pioneering the application of electronmicros-copy to the study of early development, he tackled a variety of projects of general zoological interest. Lesser known is his latter daywork, carried out during his retirement, on variation and hereditability (especially of wing colourationin the butterfly Acraeahorta, on which he published five papers from 1974 to 1986. His butterfly work showing the loose connection between the genotype and phenotype, with the genotype expressing itself in a variable way in the face of a constant physical environment,is of special interest in the current era of evolutionary and ecological developmental biology. His exposure to the stimulating evolutionary ideas of Schmalhausen during his early Kiev years no doubt provided a context for his butterfly work.Some ideas about how the ‘loose connection between the genotype and phenotype’maybe achieved through behavioral modification or positional information during development are addressed in this paper in the light of recent work.In his eighties Balinsky worked on the classification of microlepidoptera on which he published several papers. He died in September 1997, just short of his 92nd birthday.

  3. Decision Support for Environmental Management of Industrial Non-Hazardous Secondary Materials: New Analytical Methods Combined with Simulation and Optimization Modeling

    Science.gov (United States)

    Non-hazardous solid materials from industrial processes, once regarded as waste and disposed in landfills, offer numerous environmental and economic advantages when put to beneficial uses (BUs). Proper management of these industrial non-hazardous secondary materials (INSM) requir...

  4. Systematic evaluation of a secondary method for measuring diagnostic-level medical ultrasound transducer output power based on a large-area pyroelectric sensor

    Science.gov (United States)

    Zeqiri, B.; Žauhar, G.; Rajagopal, S.; Pounder, A.

    2012-06-01

    A systematic study of the application of a novel pyroelectric technique to the measurement of diagnostic-level medical ultrasound output power is described. The method exploits the pyroelectric properties of a 0.028 mm thick membrane of polyvinylidene fluoride (PVDF), backed by an acoustic absorber whose ultrasonic absorption coefficient approaches 1000 dB cm-1 at 3 MHz. When exposed to an ultrasonic field, absorption of ultrasound adjacent to the PVDF-absorber interface results in heating and the generation of a pyroelectric output voltage across gold electrodes deposited on the membrane. For a sensor large enough to intercept the whole of the acoustic beam, the output voltage can be calibrated for the measurement of acoustic output power. A number of key performance properties of the method have been investigated. The technique is very sensitive, with a power to voltage conversion factor of typically 0.23 V W-1. The frequency response of a particular embodiment of the sensor in which acoustic power reflected at the absorber-PVDF interface is subsequently returned to the pyroelectric membrane to be absorbed, has been evaluated over the frequency range 1.5 MHz to 10 MHz. This has shown the frequency response to be flat to within ±4%, above 2.5 MHz. Below this frequency, the sensitivity falls by 20% at 1.5 MHz. Linearity of the technique has been demonstrated to within ±1.6% for applied acoustic power levels from 1 mW up to 120 mW. A number of other studies targeted at assessing the achievable measurement uncertainties are presented. These involve: the effects of soaking, the influence of the angle of incidence of the acoustic beam, measurement repeatability and sensitivity to transducer positioning. Additionally, over the range 20 °C to 30 °C, the rate of change in sensitivity with ambient temperature has been shown to be +0.5% °C-1. Implications of the work for the development of a sensitive, traceable, portable, secondary method of ultrasound output power

  5. Help-Seeking Behaviors for Intimate Partner Violence Perpetration by Men Receiving Substance Use Treatment: A Mixed-Methods Secondary Analysis.

    Science.gov (United States)

    Hashimoto, Nozomu; Radcliffe, Polly; Gilchrist, Gail

    2018-05-01

    Despite the high prevalence of intimate partner violence (IPV) perpetration by men receiving substance use treatment, little is known about their help-seeking behaviors for IPV. A secondary analysis of a mixed-methods study of men receiving substance use treatment who perpetrated IPV examined the prevalence, characteristics, and barriers associated with IPV perpetration disclosure and help-seeking. In total, 170 men were interviewed using a structured questionnaire, and a subsample of 20 were interviewed in-depth about their experiences. Logistic regression determined variables associated with disclosure and help-seeking. Thematic analysis of the in-depth interviews explored barriers to disclosure and help-seeking. Only half the participants had told anyone about their IPV perpetration and about one quarter reported having sought any sort of support. Whereas participants were more likely to disclose their IPV perpetration to informal resources (such as friends or family), they tended to seek help from formal resources (such as health professionals or the police). A greater proportion of physical IPV perpetrators, who had disclosed, had been arrested or had police involvement for IPV, suggesting that their disclosure may not have been voluntary. The following themes emerged from the qualitative data about the barriers to disclosure and help-seeking for IPV perpetration: fear that their children would be taken into care by social services, shame and embarrassment, and a minimization or normalization of their behavior. In addition, many participants highlighted that they had never been previously asked about IPV during treatment for substance use and stressed the need for greater expertise in or knowledge of this topic from specialist services. Substance use treatment services should enquire about men's relationships and IPV perpetration to facilitate disclosure and provide support. Further research is necessary to determine the context of disclosure and help

  6. Attenuated Total Reflection Fourier Transform Infrared (ATR FT-IR) Spectroscopy as an Analytical Method to Investigate the Secondary Structure of a Model Protein Embedded in Solid Lipid Matrices.

    Science.gov (United States)

    Zeeshan, Farrukh; Tabbassum, Misbah; Jorgensen, Lene; Medlicott, Natalie J

    2018-02-01

    Protein drugs may encounter conformational perturbations during the formulation processing of lipid-based solid dosage forms. In aqueous protein solutions, attenuated total reflection Fourier transform infrared (ATR FT-IR) spectroscopy can investigate these conformational changes following the subtraction of spectral interference of solvent with protein amide I bands. However, in solid dosage forms, the possible spectral contribution of lipid carriers to protein amide I band may be an obstacle to determine conformational alterations. The objective of this study was to develop an ATR FT-IR spectroscopic method for the analysis of protein secondary structure embedded in solid lipid matrices. Bovine serum albumin (BSA) was chosen as a model protein, while Precirol AT05 (glycerol palmitostearate, melting point 58 ℃) was employed as the model lipid matrix. Bovine serum albumin was incorporated into lipid using physical mixing, melting and mixing, or wet granulation mixing methods. Attenuated total reflection FT-IR spectroscopy and size exclusion chromatography (SEC) were performed for the analysis of BSA secondary structure and its dissolution in aqueous media, respectively. The results showed significant interference of Precirol ATO5 with BSA amide I band which was subtracted up to 90% w/w lipid content to analyze BSA secondary structure. In addition, ATR FT-IR spectroscopy also detected thermally denatured BSA solid alone and in the presence of lipid matrix indicating its suitability for the detection of denatured protein solids in lipid matrices. Despite being in the solid state, conformational changes occurred to BSA upon incorporation into solid lipid matrices. However, the extent of these conformational alterations was found to be dependent on the mixing method employed as indicated by area overlap calculations. For instance, the melting and mixing method imparted negligible effect on BSA secondary structure, whereas the wet granulation mixing method promoted

  7. THE META-METHOD: AN EXPERIMENTAL EVALUATION OF A THREE-SIDED DIDACTICAL APPROACH TO REINFORCE METACOGNITION AMONG SECONDARY SCHOOL STUDENTS

    NARCIS (Netherlands)

    Ernst-Militaru, Rodica; Ghysels, Joris; Nijhof, Plonie

    To stimulate learning, both cognitive and metacognitive strategies are believed to be effective. This contribution reports on the experimental evaluation of an approach to develop metacognitive skills among students in secondary school. In the experiment 653 students of two schools and three age

  8. Knowledge, attitude and practices of adolescent secondary school ...

    African Journals Online (AJOL)

    Knowledge, attitude and practices of adolescent secondary school students in Uvwie ... METHOD: A cross sectional study was carried out on 358 senior secondary ... secondary school students in Uvwie have a fairly good knowledge of AIDS, ...

  9. Secondary beams at GANIL

    International Nuclear Information System (INIS)

    Doubre, H.

    1992-01-01

    GANIL, a user's facility since 1983, can deliver a broad spectrum of heavy-ion beams, from He to U, to well-equipped experimental areas. Their very large intensities are to be exploited to produce secondary beams, either using the fragmentation method (beams at energy per nucleon larger than 30 MeV/u), or the ISOL method. With the latter one, these ions have to be re-accelerated. The project of a cyclotron as a post-accelerator is described. (author) 11 refs.; 7 figs.; 3 tabs

  10. Determination of the secondary structure content of proteins in aqueous solutions from their amide I and amide II infrared bands. Comparison between classical and partial least-squares methods

    International Nuclear Information System (INIS)

    Dousseau, F.; Pezolet, M.

    1990-01-01

    A method for estimating protein secondary structure from infrared spectra has been developed. The infrared spectra of H 2 O solutions of 13 proteins of known crystal structure have been recorded and corrected for the spectral contribution of water in the amide I and II region by using the algorithm of Dousseau et al. This calibration set of proteins has been analyzed by using either a classical least-squares (CLS) method or the partial least-squares (PLS) method. The pure-structure spectra calculated by the classical least-squares method are in good agreement with spectra of poly(L-lysine) in the α-helix, β-sheet, and undefined conformations. The results show that the best agreement between the secondary structure determined by X-ray crystal-lography and that predicted by infrared spectroscopy is obtained when both the amide I and II bands are used to generate the calibration set, when the PLS method is used, and when it is assumed that the secondary structure of proteins is composed of only four types of structure: ordered and disordered α-helices, β-sheet, and undefined conformation. Attempts to include turns in the secondary structure estimation have led to a loss of accuracy. The spectra of the calibration proteins were also recorded in 2 H 2 O solution. After correction for the contribution of the combination band of 2 H 2 O in the amide I' band region, the spectra were analyzed with PLS, but the results were not as good as for the spectra obtained in H 2 O, especially for the α-helical conformation

  11. Development of methodics for the characterization of the composition of the ion-collision-induced secondary-particle flux by comparison of the yield contributions of photoinduced ion formation processes

    International Nuclear Information System (INIS)

    Vering, Guido

    2008-01-01

    The aim of this work was to develop a method to distinguish between different ion formation processes and to determine the influence of these processes on the total number of detected monatomic ions of a certain element. A vector/matrix-formalism was developed, which describes the physical processes of sputtering, ion formation, mass separation and detection in laser-SNMS. In the framework of the method developed, based on this theoretic formalism, changes in the secondary flux contribution of the respective element were observed by comparing the detected monatomic ion yield obtained in specifically aligned (SIMS and) laser-SNMS experiments. The yields resulting from these experiments were used to calculate characteristic numbers to compare the flux composition from different surfaces. The potential of the method was demonstrated for the elements boron, iron and gadolinium by investigating the changes in the flux composition of secondary particles sputtered from metallic surfaces, as a function of the oxygen concentration at the surface. Finally, combined laser-SNMS depth profiles and images, obtained with both laser systems, were presented to demonstrate how the parallel detection of the three differently originated ion signals of the same element can be used to get additional information about the composition of the flux of secondary particles synchronously during the analysis of elemental distributions. In this respect the presented method can be a very helpful tool to prevent misleading interpretations of SIMS or laser-SNMS data. (orig.)

  12. Summarizing primary and secondary effects

    DEFF Research Database (Denmark)

    Karlson, Kristian Bernt

    2013-01-01

    Current methods for decomposing class differentials in educational decisions into primary and secondary effects produce many parameters, rendering them ill-equipped for parsimonious comparisons across countries or birth cohorts. This paper develops a parametric method that provides an optimal...... summary of primary and secondary effects across discrete class origins. Under the testable assumption that the pattern of effects of class origins on academic ability is proportional to the pattern of effects of class origins on educational choice net of academic ability, the method returns a single...

  13. A novel electrostatic ion-energy spectrometer by the use of a proposed ``self-collection'' method for secondary-electron emission from a metal collector

    Science.gov (United States)

    Hirata, M.; Nagashima, S.; Cho, T.; Kohagura, J.; Yoshida, M.; Ito, H.; Numakura, T.; Minami, R.; Kondoh, T.; Nakashima, Y.; Yatsu, K.; Miyoshi, S.

    2003-03-01

    For the purpose of end-loss-ion energy analyses in open-field plasmas, a newly developed electrostatic ion-energy spectrometer is proposed on the basis of a "self-collection" principle for secondary-electron emission from a metal collector. The ion-energy spectrometer is designed with multiple grids for analyzing incident ion energies, and a set of parallelly placed metal plates with respect to lines of ambient magnetic forces in an open-ended device. One of the most important characteristic properties of this spectrometer is the use of our proposed principle of a "self-collection" mechanism due to E×B drifts for secondary electrons emitted from the grounded metal-plate collector by the use of no further additional magnetic systems except the ambient open-ended fields B. The proof-of-principle and characterization experiments are carried out by the use of a test-ion-beam line along with an additional use of a Helmholtz coil system for the formation of open magnetic fields similar to those in the GAMMA 10 end region. The applications of the developed ion-energy spectrometer for end-loss-ion diagnostics in the GAMMA 10 plasma experiments are demonstrated under the conditions with simultaneous incidence of energetic electrons produced by electron-cyclotron heatings for end-loss-plugging potential formation, since these electrons have contributed to disturb these ion signals from conventional end-loss-ion detectors.

  14. DETECTION OF LOCAL SITE CONDITIONS INFLUENCING EARTHQUAKE SHOCK AND SECONDARY EFFECTS IN THE VALPARAISO AREA IN CENTRAL-CHILE USING REMOTE SENSING AND GIS METHODS

    Directory of Open Access Journals (Sweden)

    Barbara Theilen-Willige

    2011-01-01

    Full Text Available The potential contribution of remote sensing and GIS techniques to earthquake hazard analysis was investigated in Valparaiso in Chile in order to improve the systematic, standardized inventory of those areas that are more susceptible to earthquake ground motions or to earthquake related secondary effects such as landslides, liquefaction, soil amplifications, compaction or even tsunami-waves. Geophysical, topographical, geological data and satellite images were collected, processed, and integrated into a spatial database using Geoinformation Systems (GIS and image processing techniques. The GIS integrated evaluation of satellite imageries, of digital topographic data and of various open-source geodata can contribute to the acquisition of those specific tectonic, geomorphologic/ topographic settings influencing local site conditions in Valparaiso, Chile. Using the weighted overlay techniques in GIS, susceptibility maps were produced indicating areas, where causal factors influencing near- surface earthquake shock occur aggregated. Causal factors (such as unconsolidated sedimentary layers within a basin’s topography, higher groundwater tables, etc. summarizing and interfering each other, rise the susceptibility of soil amplification and of earthquake related secondary effects. This approach was used as well to create a tsunami flooding susceptibility map. LANDSAT Thermal Band 6-imageries were analysed to get information of surface water currents in this area.

  15. A general method for the purification of synthetic oligodeoxyribonucleotides containing strong secondary structure by reversed-phase high-performance liquid chromatography on PRP-1 resin.

    Science.gov (United States)

    Germann, M W; Pon, R T; van de Sande, J H

    1987-09-01

    Synthetic 5'-dimethoxytritylated oligodeoxyribonucleotides, which contained strong secondary structure, were satisfactorily denatured and purified by reversed-phase HPLC on PRP-1 columns when strongly alkaline conditions (0.05 M NaOH) were employed. This procedure was suitable for the purification of hairpin structures, e.g., d(CG)nT4(CG)n (n = 4, 5, 6), and oligo(dG) sequences, e.g., d(G)24, as well as oligodeoxyribonucleotide probes which contained degenerate base sites. Oligodeoxyribonucleotides as long as 50 bases in length were purified. Recovery of injected oligonucleotides was typically 90% or better. The high capacity of the PRP-1 resin also allowed purification to be performed on a preparative scale (2-8 mg per injection). Enzymatic degradation and HPLC analysis indicated that no modification of the heterocyclic bases occurred under the alkaline conditions described.

  16. A los 150 años desde "El origen de las especies": ¿es darwinista la biología contemporánea? At 150 years since "The origin of species": Is contemporary biology Darwinian?

    Directory of Open Access Journals (Sweden)

    GUILLERMO FOLGUERA

    2009-12-01

    Full Text Available A los 150 años de la publicación de "El origen de las especies" de Charles Darwin, numerosos homenajes se han realizado en diferentes ciudades del mundo. Sin embargo, es importante preguntarse hacia el seno de la comunidad científica acerca del alcance efectivo del darwinisimo dentro de la biología. En este trabajo analizamos este supuesto intentando responder, al menos de una manera aproximativa, la pregunta: ¿es darwinista la biología en la actualidad? A estos fines, consideramos algunos de los principales aportes que suelen asignarse al darwinismo en las ciencias de los sistemas vivos: el análisis y centro en la diversidad, un origen único de los sistemas vivos, la incorporación del azar y el reconocimiento de las causas proximales. En términos generales detectamos importantes líneas de continuidad entre el darwinismo y las diferentes disciplinas que componen a la biología contemporánea. Sin embargo, esta situación dista de ser general y no ocurre para todas las ideas analizadas. En este sentido, en algunas áreas del conocimiento el darwinismo solo se ha filtrado mediante la implementación de recortes significativos (tal como el caso de la reducción de los procesos evolutivos a la selección natural, o bien a través de aspectos que aún no son debidamente incorporados en la investigación científica (tal como en el caso del estudio de la variabilidad. Por lo tanto, la futura incorporación de estos elementos se presenta como un desafío importante para lograr una biología integradora.After 150 years of the publication of the Origin of Species by Charles Darwin, a number of tributes had honored him worldwide. However, it seems important to ask about the effective application of Darwin's ideas within the biological disciplines. Herein we analyze this problem trying to answer the question: is contemporary biology Darwinian? To this end, we consider some of the main assumed contributions of Darwinism to the sciences of living

  17. Detection of local site conditions influencing earthquake shaking and secondary effects in Southwest-Haiti using remote sensing and GIS-methods

    Directory of Open Access Journals (Sweden)

    B. Theilen-Willige

    2010-06-01

    Full Text Available The potential contribution of remote sensing and GIS techniques to earthquake hazard analysis was investigated in SW-Haiti in order to improve the systematic, standardized inventory of those areas that are more susceptible to earthquake ground motions or to earthquake related secondary effects such as landslides, liquefaction, soil amplifications, compaction or even tsunami-waves. Geophysical, topographical, geological data and satellite images were collected, processed, and integrated into a spatial database using Geoinformation Systems (GIS and image processing techniques. The GIS integrated evaluation of satellite imageries, of digital topographic data and of various open-source geodata can contribute to the acquisition of those specific tectonic, geomorphologic/topographic settings influencing local site conditions in Haiti and, thus, to a first data base stock. Using the weighted overlay techniques in GIS susceptibility maps were produced indicating areas where causal factors influencing surface-near earthquake shock occur aggregated and interfering each other and, thus, rise the susceptibility to soil amplification. This approach was used as well to create landslide and flooding susceptibility maps.

  18. On the development of standardization methods for measuring the degree of graphitization of industrial materials, correlation of scientific characterization with the industrially relevant secondary properties of graphitic material

    International Nuclear Information System (INIS)

    Fitzer, E.; Koechling, K.H.

    1984-01-01

    The completed research roject comprised the development of standardization methods for measuring the degree of graphitization of industrial materials, the testing of characterization methods with regard to significance, the correlation of scientific characterization with industrially relevant material properties and the resultant modification of industrial processes for the manufacture of coke raw materials and graphitic materials. Also targeted within the scope of this project were the grouping of comparable characterization methods and the drawing up of unequivocal terminology for scientific and industrial-commercial usage, with both aims based on intensified national and international teamwork. (orig./WL) [de

  19. Transitions in Secondary Education

    DEFF Research Database (Denmark)

    Larsen, Britt Østergaard; Jensen, Leif; Pilegaard Jensen, Torben

    2014-01-01

    statistical model of educational progression. By using this method, we parcel educational attainment into a series of transitions and the model is able to control for educational selection and unobserved heterogeneity. We apply counterfactual analyses to allow a formal decomposition of the effects of social......The purpose of this article is to investigate educational choices and attainment of children who experience social problems during their upbringing. The study explores the extent to which social problems can help explain the gaps in entry and dropout rates in upper secondary education in Denmark...... between students from different socioeconomic backgrounds. Population-based registers are used to include information on family upbringing, e.g. alcohol abuse, criminality, use of psychopharmaca and out-of-home placement. We estimate a parsimonious version of Cameron and Heckman's (2001) dynamic...

  20. [3H]Leucine incorporation method as a tool to measure secondary production by periphytic bacteria associated to the roots of floating aquatic macrophyte.

    Science.gov (United States)

    Miranda, M R; Guimarães, J R D; Coelho-Souza, A S

    2007-10-01

    The present study assessed the application of [(3)H]Leucine incorporation into protein by periphytic bacteria associated with the roots of the floating aquatic macrophyte Eichornia crassipes. Basic assumptions underlying the method, such as linearity of leucine incorporation, saturation level of incorporation rates, incorporation into other macromolecules, specificity of incorporation for bacterial assemblages and [(3)H]Leucine degradation during samples storage were tested, and two procedures for extracting the incorporated leucine were compared. Both methods gave the same results, however, the hot TCA extraction method was less time consuming than the alkaline extraction method. Incorporation of [(3)H]Leucine was linear for up to 40 min. Saturation concentration of [(3)H]Leucine incorporation into protein was 1500 nM. An experiment with prokaryotic and eukaryotic inhibitors showed no significant [(3)H]Leucine incorporation into eukaryotes even in high leucine concentrations. No significant amounts of radiolabel were incorporated into other macromolecules. The maximum time of sample storage after the incubation is 15 days. The leucine incorporation method can be a reliable tool to measure bacterial production in the periphyton root-associated bacteria.

  1. PWR secondary water chemistry guidelines

    International Nuclear Information System (INIS)

    Bell, M.J.; Blomgren, J.C.; Fackelmann, J.M.

    1982-10-01

    Steam generators in pressurized water reactor (PWR) nuclear power plants have experienced tubing degradation by a variety of corrosion-related mechanisms which depend directly on secondary water chemistry. As a result of this experience, the Steam Generator Owners Group and EPRI have sponsored a major program to provide solutions to PWR steam generator problems. This report, PWR Secondary Water Chemistry Guidelines, in addition to presenting justification for water chemistry control parameters, discusses available analytical methods, data management and surveillance, and the management philosophy required to successfully implement the guidelines

  2. Examining the Impact of a Video Case-Based Mathematics Methods Course on Secondary Pre-Service Teachers' Skills at Analysing Students' Strategies

    Science.gov (United States)

    Martinez, Mara Vanina; Superfine, Alison Castro; Carlton, Theresa; Dasgupta, Chandan

    2015-01-01

    This paper focuses on results from a study conducted with two cohorts of pre-service teachers (PSTs) in a video case-based mathematics methods course at a large Midwestern university in the US. The motivation for this study was to look beyond whether or not PSTs pay attention to mathematical thinking of students, as shown by previous studies when…

  3. Phase-rectified signal averaging method to predict perinatal outcome in infants with very preterm fetal growth restriction- a secondary analysis of TRUFFLE-trial

    NARCIS (Netherlands)

    Lobmaier, Silvia M.; Mensing van Charante, Nico; Ferrazzi, Enrico; Giussani, Dino A.; Shaw, Caroline J.; Müller, Alexander; Ortiz, Javier U.; Ostermayer, Eva; Haller, Bernhard; Prefumo, Federico; Frusca, Tiziana; Hecher, Kurt; Arabin, Birgit; Thilaganathan, Baskaran; Papageorghiou, Aris T.; Bhide, Amarnath; Martinelli, Pasquale; Duvekot, Johannes J.; van Eyck, Jim; Visser, Gerard H A; Schmidt, Georg; Ganzevoort, Wessel; Lees, Christoph C.; Schneider, Karl T M; Bilardo, Caterina M.; Brezinka, Christoph; Diemert, Anke; Derks, Jan B.; Schlembach, Dietmar; Todros, Tullia; Valcamonico, Adriana; Marlow, Neil; van Wassenaer-Leemhuis, Aleid

    2016-01-01

    Background Phase-rectified signal averaging, an innovative signal processing technique, can be used to investigate quasi-periodic oscillations in noisy, nonstationary signals that are obtained from fetal heart rate. Phase-rectified signal averaging is currently the best method to predict survival

  4. Phase-rectified signal averaging method to predict perinatal outcome in infants with very preterm fetal growth restriction- a secondary analysis of TRUFFLE-trial

    NARCIS (Netherlands)

    Lobmaier, Silvia M.; Mensing van Charante, Nico; Ferrazzi, Enrico; Giussani, Dino A.; Shaw, Caroline J.; Müller, Alexander; Ortiz, Javier U.; Ostermayer, Eva; Haller, Bernhard; Prefumo, Federico; Frusca, Tiziana; Hecher, Kurt; Arabin, Birgit; Thilaganathan, Baskaran; Papageorghiou, Aris T.; Bhide, Amarnath; Martinelli, Pasquale; Duvekot, Johannes J.; van Eyck, Jim; Visser, Gerard H. A.; Schmidt, Georg; Ganzevoort, Wessel; Lees, Christoph C.; Schneider, Karl T. M.; Bilardo, Caterina M.; Brezinka, Christoph; Diemert, Anke; Derks, Jan B.; Schlembach, Dietmar; Todros, Tullia; Valcamonico, Adriana; Marlow, Neil; van Wassenaer-Leemhuis, Aleid

    2016-01-01

    Phase-rectified signal averaging, an innovative signal processing technique, can be used to investigate quasi-periodic oscillations in noisy, nonstationary signals that are obtained from fetal heart rate. Phase-rectified signal averaging is currently the best method to predict survival after

  5. An experimental assessment of methods used to compute secondary electron emission yield for tungsten and molybdenum electrodes based on exposure to Alcator C-Mod scrape-off layer plasmas

    Science.gov (United States)

    McCarthy, W.; LaBombard, B.; Brunner, D.; Kuang, A. Q.

    2018-03-01

    Plasma potentials computed from Langmuir probe data rely on a method to account for secondary electron emission (SEE) from the electrodes. However, significant variations exist among published models for SEE and the reported experimental parameters used to evaluate them. As a means to critically assess SEE computation methods, two of four tungsten electrodes on a Langmuir-Mach probe head were replaced with molybdenum and exposed to Alcator C-Mod boundary plasmas where electron temperatures exceed 50 eV and SEE becomes significant. In this situation, plasma potentials computed for either material should be identical—the SEE evaluation method should properly account for the differences in SEE yields. Of the six methods used to compute SEE, two are found to produce consistent results (Sternglass model with Bronstein experimental parameters and Young-Dekker model with Bronstein experimental parameters). In contrast, the method previously used for C-Mod data analysis (Sternglass model with Kollath parameters) was found to be inconsistent. We have since adopted Young-Dekker-Bronstein as the preferred method.

  6. Effectiveness of McKenzie Method-Based Self-Management Approach for the Secondary Prevention of a Recurrence of Low Back Pain (SAFE Trial): Protocol for a Pragmatic Randomized Controlled Trial.

    Science.gov (United States)

    de Campos, Tarcisio F; Maher, Chris G; Clare, Helen A; da Silva, Tatiane M; Hancock, Mark J

    2017-08-01

    Although many people recover quickly from an episode of low back pain (LBP), recurrence is very common. There is limited evidence on effective prevention strategies for recurrences of LBP. The purpose of this study was to determine the effectiveness of a McKenzie method-based self-management approach in the secondary prevention of LBP. This will be a pragmatic randomized controlled trial. Participants will be recruited from the community and primary care, with the intervention delivered in a number of physical therapist practices in Sydney, Australia. The study will have 396 participants, all of whom are at least 18 years old. Participants will be randomly assigned to either the McKenzie method-based self-management approach group or a minimal intervention control group. The primary outcome will be days to first self-reported recurrence of an episode of activity-limiting LBP. The secondary outcomes will include: days to first self-reported recurrence of an episode of LBP, days to first self-reported recurrence of an episode of LBP leading to care seeking, and the impact of LBP over a 12-month period. All participants will be followed up monthly for a minimum of 12 months or until they have a recurrence of activity-limiting LBP. All participants will also be followed-up at 3, 6, 9, and 12 months to assess the impact of back pain, physical activity levels, study program adherence, credibility, and adverse events. Participants and therapists will not be masked to the interventions. To our knowledge, this will be the first large, high-quality randomized controlled trial investigating the effectiveness of a McKenzie method-based self-management approach for preventing recurrences of LBP. If this approach is found to be effective, it will offer a low-cost, simple method for reducing the personal and societal burdens of LBP. © 2017 American Physical Therapy Association

  7. Secondary School Students' Predictors of Science Attitudes

    Science.gov (United States)

    Tosun, Cemal; Genç, Murat

    2016-01-01

    The purpose of this study is to identify the factors that affect the secondary school students' attitudes in science. This study was conducted using survey method. The sample of the study was 503 students from four different secondary schools in Bartin and Düzce. Data were obtained using the Survey of Factors Affecting Students' Science Attitudes…

  8. Efficacy of secondary isoniazid preventive therapy among ...

    African Journals Online (AJOL)

    Objective. To determine the efficacy of secondary preventive therapy against tuberculosis (TB) among goldminers working in South Africa. Design. An observational study. Methods. The incidence of recurrent TB was compared between two cohorts of HIV-infected miners: one cohort had received secondary preventive ...

  9. Qualitative Secondary Analysis: A Case Exemplar.

    Science.gov (United States)

    Tate, Judith Ann; Happ, Mary Beth

    Qualitative secondary analysis (QSA) is the use of qualitative data that was collected by someone else or was collected to answer a different research question. Secondary analysis of qualitative data provides an opportunity to maximize data utility, particularly with difficult-to-reach patient populations. However, qualitative secondary analysis methods require careful consideration and explicit description to best understand, contextualize, and evaluate the research results. In this article, we describe methodologic considerations using a case exemplar to illustrate challenges specific to qualitative secondary analysis and strategies to overcome them. Copyright © 2017 National Association of Pediatric Nurse Practitioners. Published by Elsevier Inc. All rights reserved.

  10. Meteorological detrending of primary and secondary pollutant concentrations: Method application and evaluation using long-term (2000-2012) data in Atlanta

    Science.gov (United States)

    Henneman, Lucas R. F.; Holmes, Heather A.; Mulholland, James A.; Russell, Armistead G.

    2015-10-01

    The effectiveness of air pollution regulations and controls are evaluated based on measured air pollutant concentrations. Air pollution levels, however, are highly sensitive to both emissions and meteorological fluctuations. Therefore, an assessment of the change in air pollutant levels due to emissions controls must account for these meteorological fluctuations. Two empirical methods to quantify the impact of meteorology on pollutant levels are discussed and applied to the 13-year time period between 2000 and 2012 in Atlanta, GA. The methods employ Kolmogorov-Zurbenko filters and linear regressions to detrended pollutant signals into long-term, seasonal, weekly, short-term, and white-noise components. The methods differ in how changes in weekly and holiday emissions are accounted for. Both can provide meteorological adjustments on a daily basis for future use in acute health analyses. The meteorological impact on daily signals of ozone, NOx, CO, SO2, PM2.5, and PM species are quantified. Analyses show that the substantial decreases in seasonal averages of NOx and SO2 correspond with controls implemented in the metropolitan Atlanta area. Detrending allows for the impacts of some controls to be observed with averaging times of as little as 3 months. Annual average concentrations of NOx, SO2, and CO have all fallen by at least 50% since 2000. Reductions in NOx levels, however, do not lead to uniform reductions in ozone. While average detrended summer average maximum daily average 8 h ozone (MDA8h O3) levels fell by 4% (2.2 ± 2 ppb) between 2000 and 2012, winter averages have increased by 12% (3.8 ± 1.4 ppb), providing further evidence that high ozone levels are NOx-limited and lower ozone concentrations are NOx-inhibited. High ozone days (with MDA8h O3 greater than 60 ppb) decreased both in number and in magnitude over the study period.

  11. Demarcation of secondary hyperalgesia zones

    DEFF Research Database (Denmark)

    Ringsted, Thomas K; Enghuus, Casper; Petersen, Morten A

    2015-01-01

    of analgesic drug effects in humans. However, since the methods applied in demarcating the secondary hyperalgesia zone seem inconsistent across studies, we examined the effect of a standardized approach upon the measurement of SHA following a first degree burn injury (BI). NEW METHOD: The study was a two.......0001). No day-to-day or observer-to-observer differences in SHAs were observed. Intraclass correlation coefficients, in the range of 0.51 to 0.84, indicated a moderate to almost perfect reliability between observers. COMPARISON WITH EXISTING METHODS: No standardized approach in SHA-assessment has hitherto been...... presented. CONCLUSIONS: This is the first study to demonstrate that demarcation of secondary hyperalgesia zones depends on the developed pressure of the punctate stimulator used....

  12. Development of a supercritical fluid extraction-gas chromatography-mass spectrometry method for the identification of highly polar compounds in secondary organic aerosols formed from biogenic hydrocarbons in smog chamber experiments.

    Science.gov (United States)

    Chiappini, L; Perraudin, E; Durand-Jolibois, R; Doussin, J F

    2006-11-01

    A new one-step method for the analysis of highly polar components of secondary organic aerosols (SOA) has been developed. This method should lead to a better understanding of SOA formation and evolution since it enables the compounds responsible for SOA formation to be identified. Since it is based on supercritical fluid extraction coupled to gas chromatography-mass spectrometry, it minimizes the analysis time and significantly enhances sensitivity, which makes it suitable for trace-level compounds, which are constituents of SOA. One of the key features of this method is the in situ derivatisation step: an online silylation allowing the measurement of highly polar, polyfunctional compounds, which is a prerequisite for the elucidation of chemical mechanisms. This paper presents the development of this analytical method and highlights its ability to address this major atmospheric issue through the analysis of SOA formed from the ozonolysis of a biogenic hydrocarbon (sabinene). Ozonolysis of sabinene was performed in a 6 m3 Teflon chamber. The aerosol components were derivatised in situ. More than thirty products, such as sabinaketone, sabinic acid and other multifunctional compounds including dicarboxylic acids and oxoacids, were measured. Nine of them were identified and quantified. The sensitivity and the linearity (0.91method were both good and detection limits ranged from 1.2 to 6.4 ng for the investigated compounds.

  13. Development of a supercritical fluid extraction-gas chromatography-mass spectrometry method for the identification of highly polar compounds in secondary organic aerosols formed from biogenic hydrocarbons in smog chamber experiments

    Energy Technology Data Exchange (ETDEWEB)

    Chiappini, L.; Perraudin, E.; Durand-Jolibois, R.; Doussin, J.F. [Universites Paris, Laboratoire Interuniversitaire des Systemes Atmospheriques, UMR CNRS 7583, Creteil (France)

    2006-11-15

    A new one-step method for the analysis of highly polar components of secondary organic aerosols (SOA) has been developed. This method should lead to a better understanding of SOA formation and evolution since it enables the compounds responsible for SOA formation to be identified. Since it is based on supercritical fluid extraction coupled to gas chromatography-mass spectrometry, it minimizes the analysis time and significantly enhances sensitivity, which makes it suitable for trace-level compounds, which are constituents of SOA. One of the key features of this method is the in situ derivatisation step: an online silylation allowing the measurement of highly polar, polyfunctional compounds, which is a prerequisite for the elucidation of chemical mechanisms. This paper presents the development of this analytical method and highlights its ability to address this major atmospheric issue through the analysis of SOA formed from the ozonolysis of a biogenic hydrocarbon (sabinene). Ozonolysis of sabinene was performed in a 6 m{sup 3} Teflon chamber. The aerosol components were derivatised in situ. More than thirty products, such as sabinaketone, sabinic acid and other multifunctional compounds including dicarboxylic acids and oxoacids, were measured. Nine of them were identified and quantified. The sensitivity and the linearity (0.91 < R < 0.98) of the method were both good and detection limits ranged from 1.2 to 6.4 ng for the investigated compounds. (orig.)

  14. Corrosion of non-irradiated UAl{sub x}-Al fuel in the presence of clay pore solution. A quantitative XRD secondary phase analysis applying the DDM method

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, Andreas [Halle-Wittenberg Univ. (Germany). Dept. of Mineralogy and Geochemistry; RWTH Aachen Univ. (Germany). Inst. of Crystallography; Klinkenberg, Martina; Curtius, Hildegard [Forschungszentrum Juelich GmbH (Germany). Inst. of Energy and Climate Research, IEK-6 Nuclear Waste Management

    2017-04-01

    Corrosion experiments with non-irradiated metallic UAl{sub x}-Al research reactor fuel elements were carried out in autoclaves to identify and quantify the corrosion products. Such compounds, considering the long-term safety assessment of final repositories, can interact with the released inventory and this constitutes a sink for radionuclide migration in formation waters. Therefore, the metallic fuel sample was subjected to clay pore solution to investigate its process of disintegration by analyzing the resulting products and the remnants, i.e. the secondary phases. Due to the fast corrosion rate a full sample disintegration was observed within the experimental period of 1 year at 90 C. The obtained solids were subdivided into different grain size fractions and prepared for analysis. The elemental analysis of the suspension showed that, uranium and aluminum are concentrated in the solids, whereas iron was mainly dissolved. Non-ambient X-ray diffraction (XRD) combined with the derivative difference minimization (DDM) method was applied for the qualitative and quantitative phase analysis (QPA) of the secondary phases. Gypsum and hemihydrate (bassanite), residues of non-corroded nuclear fuel, hematite, and goethite were identified. The quantitative phase analysis showed that goethite is the major crystalline phase. The amorphous content exceeded 80 wt% and hosted the uranium. All other compounds were present to a minor content. The obtained results by XRD were well supported by complementary scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS) analysis.

  15. The enrichment secondary market

    International Nuclear Information System (INIS)

    Einbund, D.R.

    1986-01-01

    This paper will addresses two topics: the background to the present status of the enrichment secondary market and the future outlook of the secondary market in enrichment services, and the viability of the nuclear fuel brokerage industry. These two topics are inevitably connected, as most secondary market activity, not only in enrichment but also in natural uranium, has traditionally been conducted with the participation of brokers. Therefore, the author interrelates these topics

  16. Grafting computer projected simulations and interactive engagement methods within a traditional classroom setting: The influence on secondary level students' understanding of Newtonian mechanics and on attitudes towards physics

    Science.gov (United States)

    Zoubeir, Wassim Fouad

    This research explored the effects of a constructivist approach using computer projected simulations (CPS) and interactive engagement (IE) methods on 12th grade school students. The treatment lasted 18 weeks during the 1999-2000 fall semester and seeked to evaluate three variations in students': (1)conceptual understanding of Newtonian mechanics as measured by the Force Concept Inventory (FCI), (2)modification of their views about science as measured by the Views About Science Survey (VASS), and (3)achievement on traditional examinations, as measured by their end of semester grades. Analysis of Covariance (ANCOVA) was applied to determine the differences between the mean scores of the experimental group students, and students of the control group, who were exposed to traditional teaching methods only. The FCI data analysis showed that, after 18 weeks, conceptual understanding of Newtonian mechanics had markedly improved only in the experimental group (F(1,99) = 44.739, p performance on the VASS instrument for both groups (F(1,99) = .033, p = .856), confirming previous and comparable findings for studies of short implementation period. The lack of statistically significant difference between the control and experimental groups in graded achievement, while controlling for students' previous achievement, was unexpected (F(1,99) = 1.178, p = .280). It is suggested that in this particular setting, the influence of a technical factor may have been overlooked: the monitored and systematic drill exercises using elaborate math formulae to prepare students for traditional math-loaded exams. Still, despite being intentionally deprived of such preparation throughout the study, students of the experimental group did not achieve less than their counterpart, and in addition, they had gained a satisfactory understanding of Newtonian mechanics. This result points unmistakably at a plausible positive correlation between a better grasp of basic concepts in physics in a challenging

  17. Bring Your Own Device Technology: Preliminary Results from a Mixed Methods Study to Explore Student Experience of In-Class Response Systems in Post-Secondary Education

    Directory of Open Access Journals (Sweden)

    Matthew Numer

    2015-02-01

    Full Text Available This research examines the effectiveness of Bring Your Own Device (BYOD technology in a postsecondary classroom. Despite recent advances in the technological tools available to educators, there is a significant gap in the literature regarding student efficacy, engagement and contribution to learning. This paper will present the preliminary findings of the first phases of an evaluation project measuring student interaction with BYOD technology in a large group setting. Employing a mixed methods design, the findings from two focus groups and two online surveys will be discussed. This project involved students in the Winter and Fall 2014 semesters of a fourth year Human Sexuality course which has enrolment of approximately 400 per semester. The findings suggest that BYOD technology contributes to student engagement and participation in the classroom setting. Further, the findings suggest that students are comfortable in using this tool, and perceived the experience as enjoyable.

  18. Potassium-doped copper oxide nanoparticles synthesized by a solvothermal method as an anode material for high-performance lithium ion secondary battery

    Energy Technology Data Exchange (ETDEWEB)

    Thi, Trang Vu; Rai, Alok Kumar; Gim, Jihyeon; Kim, Jaekook, E-mail: jaekook@chonnam.ac.kr

    2014-06-01

    A simple and efficient approach was developed to synthesize CuO nanoparticles with improved electrochemical performance. Potassium (K{sup +})-doped CuO nanoparticles were synthesized by a simple and cost-effective solvothermal method followed by annealing at 500 °C for 5 h under air atmosphere. For comparison, an undoped CuO sample was also synthesized under the same conditions. X-ray diffraction analysis demonstrates that the K{sup +} ion doping caused no change in the phase structure, and highly crystalline K{sub x}Cu{sub 1−x}O{sub 1−δ} (x = 0.10) powder without any impurity was obtained. As an anode material for a lithium ion battery, the K{sup +}-doped CuO nanoparticle electrode exhibited better capacity retention with a reversible capacity of over 354.6 mA h g{sup −1} for up to 30 cycles at 0.1 C, as well as a high charge capacity of 162.3 mA h g{sup −1} at a high current rate of 3.2 C, in comparison to an undoped CuO electrode (275.9 mA h g{sup −1} at 0.1 C and 68.9 mA h g{sup −1} at 3.2 C). The high rate capability and better cycleability of the doped electrode can be attributed to the influence of the K{sup +} ion nanostructure on the increased electronic conductivity, diffusion efficiency, and kinetic properties of CuO during the lithiation and delithiation process.

  19. Potassium-doped copper oxide nanoparticles synthesized by a solvothermal method as an anode material for high-performance lithium ion secondary battery

    International Nuclear Information System (INIS)

    Thi, Trang Vu; Rai, Alok Kumar; Gim, Jihyeon; Kim, Jaekook

    2014-01-01

    A simple and efficient approach was developed to synthesize CuO nanoparticles with improved electrochemical performance. Potassium (K + )-doped CuO nanoparticles were synthesized by a simple and cost-effective solvothermal method followed by annealing at 500 °C for 5 h under air atmosphere. For comparison, an undoped CuO sample was also synthesized under the same conditions. X-ray diffraction analysis demonstrates that the K + ion doping caused no change in the phase structure, and highly crystalline K x Cu 1−x O 1−δ (x = 0.10) powder without any impurity was obtained. As an anode material for a lithium ion battery, the K + -doped CuO nanoparticle electrode exhibited better capacity retention with a reversible capacity of over 354.6 mA h g −1 for up to 30 cycles at 0.1 C, as well as a high charge capacity of 162.3 mA h g −1 at a high current rate of 3.2 C, in comparison to an undoped CuO electrode (275.9 mA h g −1 at 0.1 C and 68.9 mA h g −1 at 3.2 C). The high rate capability and better cycleability of the doped electrode can be attributed to the influence of the K + ion nanostructure on the increased electronic conductivity, diffusion efficiency, and kinetic properties of CuO during the lithiation and delithiation process.

  20. Potassium-doped copper oxide nanoparticles synthesized by a solvothermal method as an anode material for high-performance lithium ion secondary battery

    Science.gov (United States)

    Thi, Trang Vu; Rai, Alok Kumar; Gim, Jihyeon; Kim, Jaekook

    2014-06-01

    A simple and efficient approach was developed to synthesize CuO nanoparticles with improved electrochemical performance. Potassium (K+)-doped CuO nanoparticles were synthesized by a simple and cost-effective solvothermal method followed by annealing at 500 °C for 5 h under air atmosphere. For comparison, an undoped CuO sample was also synthesized under the same conditions. X-ray diffraction analysis demonstrates that the K+ ion doping caused no change in the phase structure, and highly crystalline KxCu1-xO1-δ (x = 0.10) powder without any impurity was obtained. As an anode material for a lithium ion battery, the K+-doped CuO nanoparticle electrode exhibited better capacity retention with a reversible capacity of over 354.6 mA h g-1 for up to 30 cycles at 0.1 C, as well as a high charge capacity of 162.3 mA h g-1 at a high current rate of 3.2 C, in comparison to an undoped CuO electrode (275.9 mA h g-1 at 0.1 C and 68.9 mA h g-1 at 3.2 C). The high rate capability and better cycleability of the doped electrode can be attributed to the influence of the K+ ion nanostructure on the increased electronic conductivity, diffusion efficiency, and kinetic properties of CuO during the lithiation and delithiation process.

  1. Secondary acute pneumonias

    International Nuclear Information System (INIS)

    Rozenshtraukh, L.C.; Rybakova, N.I.; Vinner, M.G.

    1987-01-01

    Pathological changes, promoting the development of secondary pneumonias, are investigated. To this group belong: blood circulation disturbance in small circle, bronchial passability disturbance, aspiration of liquids, gases and vapors, infections and purulent processes, intoxications, injuries, operative interference. Roetgenologic symptomatics of each secondary acute pneumonia form is presented in detail

  2. Characteristics and Pathways of Long-Stay Patients in High and Medium Secure Settings in England; A Secondary Publication From a Large Mixed-Methods Study

    Directory of Open Access Journals (Sweden)

    Birgit A. Völlm

    2018-04-01

    Full Text Available Background: Many patients experience extended stays within forensic care, but the characteristics of long-stay patients are poorly understood.Aims: To describe the characteristics of long-stay patients in high and medium secure settings in England.Method: Detailed file reviews provided clinical, offending and risk data for a large representative sample of 401 forensic patients from 2 of the 3 high secure settings and from 23 of the 57 medium secure settings in England on 1 April 2013. The threshold for long-stay status was defined as 5 years in medium secure care or 10 years in high secure care, or 15 years in a combination of high and medium secure settings.Results: 22% of patients in high security and 18% in medium security met the definition for “long-stay,” with 20% staying longer than 20 years. Of the long-stay sample, 58% were violent offenders (22% both sexual and violent, 27% had been convicted for violent or sexual offences whilst in an institutional setting, and 26% had committed a serious assault on staff in the last 5 years. The most prevalent diagnosis was schizophrenia (60% followed by personality disorder (47%, predominantly antisocial and borderline types; 16% were categorised as having an intellectual disability. Overall, 7% of the long-stay sample had never been convicted of any offence, and 16.5% had no index offence prompting admission. Although some significant differences were found between the high and medium secure samples, there were more similarities than contrasts between these two levels of security. The treatment pathways of these long-stay patients involved multiple moves between settings. An unsuccessful referral to a setting of lower security was recorded over the last 5 years for 33% of the sample.Conclusions: Long-stay patients accounted for one fifth of the forensic inpatient population in England in this representative sample. A significant proportion of this group remain unsettled. High levels of

  3. Liquorice: a root cause of secondary hypertension

    OpenAIRE

    Varma, Ravi; Ross, Calum N.

    2017-01-01

    We describe a patient presenting with hypertension and hypokalaemia who was ultimately diagnosed with liquorice- induced pseudohyperaldosteronism. This rare cause of secondary hypertension illustrates the importance of a methodical approach to the assessment of hypertension.

  4. Perception of Sexuality Education amongst Secondary School ...

    African Journals Online (AJOL)

    Perception of Sexuality Education amongst Secondary School Students in Port ... Methods: A structured, anonymous and self-administered questionnaire, used as ... Only 7.6% acknowledged the school teacher as a source of information.

  5. Vascular Morphodynamics During Secondary Growth.

    Science.gov (United States)

    de Reuille, Pierre Barbier; Ragni, Laura

    2017-01-01

    Quantification of vascular morphodynamics during secondary growth has been hampered by the scale of the process. Even in the tiny model plant Arabidopsis thaliana, the xylem can include more than 2000 cells in a single cross section, rendering manual counting impractical. Moreover, due to its deep location, xylem is an inaccessible tissue, limiting live imaging. A novel method to visualize and measure secondary growth progression has been proposed: "the Quantitative Histology" approach. This method is based on a detailed anatomical atlas, and image segmentation coupled with machine learning to automatically extract cell shapes and identify cell type. Here we present a new version of this approach, with a user-friendly interface implemented in the open source software LithoGraphX.

  6. Secondary and tertiary hyperparathyroidism.

    Science.gov (United States)

    Jamal, Sophie A; Miller, Paul D

    2013-01-01

    We reviewed the etiology and management of secondary and tertiary hyperparathyroidism. Secondary hyperparathyroidism is characterized by an increase in parathyroid hormone (PTH) that is appropriate and in response to a stimulus, most commonly low serum calcium. In secondary hyperparathyroidism, the serum calcium is normal and the PTH level is elevated. Tertiary hyperparathyroidism is characterized by excessive secretion of PTH after longstanding secondary hyperparathyroidism, in which hypercalcemia has ensued. Tertiary hyperparathyroidism typically occurs in men and women with chronic kidney disease usually after kidney transplant. The etiology and treatment of secondary hyperparathyroidism is relatively straightforward whereas data on the management of tertiary hyperparathyroidism is limited to a few small trials with short follow-up. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

  7. Secondary acute leukemia - review of 15 cases

    Energy Technology Data Exchange (ETDEWEB)

    Venugopal, P; Rajni, A; Gopal, R; Saikia, T; Kurkure, P A; Nair, C N; Advani, S H

    1988-12-01

    Acute leukemia is a rare complication of long-term chemotherapy, immunosuppressive therapy and radiotherapy. With improved survival in cancer patients resulting from modern methods of investigations and treatment, more case of secondary leukemia have come to light. In this review, fifteen cases of secondary leukemia, its prognostic implications and methods to reduce the risk of its development are emphasised. Relevant literature is also reviewed. (author). 3 tabs., 24 refs.

  8. Basic aspects of secondary electron distributions

    International Nuclear Information System (INIS)

    Kim, Y.K.

    1975-07-01

    Graphical methods proposed by Platzman and by Fano are applied to the analysis of the basic features observed in secondary electron spectra. These methods are useful not only in checking the consistency of experimental data, but also in extrapolating the spectra to the range of primary- and secondary-electron energies not covered by experiments. Illustrative examples are presented for He, Ne, and NO. (U.S.)

  9. Spitzer Secondary Eclipse Depths with Multiple Intrapixel Sensitivity Correction Methods Observations of WASP-13b, WASP-15b, WASP-16b, WASP-62b, and HAT-P-22b

    Science.gov (United States)

    Kilpatrick, Brian M.; Lewis, Nikole K.; Kataria, Tiffany; Deming, Drake; Ingalls, James G.; Krick, Jessica E.; Tucker, Gregory S.

    2017-01-01

    We measure the 4.5 μm thermal emission of five transiting hot Jupiters, WASP-13b, WASP-15b, WASP-16b, WASP-62b, and HAT-P-22b using channel 2 of the Infrared Array Camera (IRAC) on the Spitzer Space Telescope. Significant intrapixel sensitivity variations in Spitzer IRAC data require careful correction in order to achieve precision on the order of several hundred parts per million (ppm) for the measurement of exoplanet secondary eclipses. We determine eclipse depths by first correcting the raw data using three independent data reduction methods. The Pixel Gain Map (PMAP), Nearest Neighbors (NNBR), and Pixel Level Decorrelation (PLD) each correct for the intrapixel sensitivity effect in Spitzer photometric time-series observations. The results from each methodology are compared against each other to establish if they reach a statistically equivalent result in every case and to evaluate their ability to minimize uncertainty in the measurement. We find that all three methods produce reliable results. For every planet examined here NNBR and PLD produce results that are in statistical agreement. However, the PMAP method appears to produce results in slight disagreement in cases where the stellar centroid is not kept consistently on the most well characterized area of the detector. We evaluate the ability of each method to reduce the scatter in the residuals as well as in the correlated noise in the corrected data. The NNBR and PLD methods consistently minimize both white and red noise levels and should be considered reliable and consistent. The planets in this study span equilibrium temperatures from 1100 to 2000 K and have brightness temperatures that require either high albedo or efficient recirculation. However, it is possible that other processes such as clouds or disequilibrium chemistry may also be responsible for producing these brightness temperatures.

  10. SPITZER SECONDARY ECLIPSE DEPTHS WITH MULTIPLE INTRAPIXEL SENSITIVITY CORRECTION METHODS OBSERVATIONS OF WASP-13b, WASP-15b, WASP-16b, WASP-62b, AND HAT-P-22b

    Energy Technology Data Exchange (ETDEWEB)

    Kilpatrick, Brian M.; Tucker, Gregory S. [Department of Physics, Box 1843, Brown University, Providence, RI 02904 (United States); Lewis, Nikole K. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Kataria, Tiffany [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States); Deming, Drake [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Ingalls, James G.; Krick, Jessica E., E-mail: brian_kilpatrick@brown.edu, E-mail: nlewis@stsci.org, E-mail: tiffany.kataria@jpl.nasa.gov, E-mail: ddeming@astro.umd.edu, E-mail: krick@ipac.caltech.edu [Spitzer Science Center, Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 220-6, Pasadena, CA 91125 (United States)

    2017-01-01

    We measure the 4.5 μ m thermal emission of five transiting hot Jupiters, WASP-13b, WASP-15b, WASP-16b, WASP-62b, and HAT-P-22b using channel 2 of the Infrared Array Camera (IRAC) on the Spitzer Space Telescope . Significant intrapixel sensitivity variations in Spitzer IRAC data require careful correction in order to achieve precision on the order of several hundred parts per million (ppm) for the measurement of exoplanet secondary eclipses. We determine eclipse depths by first correcting the raw data using three independent data reduction methods. The Pixel Gain Map (PMAP), Nearest Neighbors (NNBR), and Pixel Level Decorrelation (PLD) each correct for the intrapixel sensitivity effect in Spitzer photometric time-series observations. The results from each methodology are compared against each other to establish if they reach a statistically equivalent result in every case and to evaluate their ability to minimize uncertainty in the measurement. We find that all three methods produce reliable results. For every planet examined here NNBR and PLD produce results that are in statistical agreement. However, the PMAP method appears to produce results in slight disagreement in cases where the stellar centroid is not kept consistently on the most well characterized area of the detector. We evaluate the ability of each method to reduce the scatter in the residuals as well as in the correlated noise in the corrected data. The NNBR and PLD methods consistently minimize both white and red noise levels and should be considered reliable and consistent. The planets in this study span equilibrium temperatures from 1100 to 2000 K and have brightness temperatures that require either high albedo or efficient recirculation. However, it is possible that other processes such as clouds or disequilibrium chemistry may also be responsible for producing these brightness temperatures.

  11. The SU.FOL.OM3 Study: a secondary prevention trial testing the impact of supplementation with folate and B-vitamins and/or Omega-3 PUFA on fatal and non fatal cardiovascular events, design, methods and participants characteristics

    Directory of Open Access Journals (Sweden)

    Czernichow Sébastien

    2008-06-01

    Full Text Available Abstract Background During the last decades, many basic and clinical research have pointed to the role of B vitamins (folate, vitamins B6 and B12 and n-3 fatty acids as nutritional factors that might have a protective effect on the development of cardiovascular diseases (CVD. Methods/design The SU.FOL.OM3 (SUpplementation with FOlate, vitamin B6 and B12 and/or OMega-3 fatty acids trial is a randomized double-blind, placebo-controlled, secondary-prevention trial designed to test the efficacy of 5-methyl tetra-hydro-folates (5-MTHF supplementation, in combination with vitamin B6 and B12 and/or n-3 fatty acids, at nutritional doses, on fatal and non fatal ischemic CVD in a 2 × 2 factorial design. A total of 2501 patients aged between 45 and 80 years who had a past history, in the previous year, of myocardial infarction (n = 1151 or instable angina pectoris (n = 711 or an ischemic stroke (n = 639 were included. Subjects have to be supplemented and followed up for five years. Daily supplementation comprised nutritional doses of 5-MTHF (560 μg, vitamin B6 (3 mg and B12 (20 μg and/or n-3 fatty acids (600 mg with an EPA:DHA ratio of 2:1. A factorial design 2 × 2 has been applied to investigate the separate effects of the B-vitamins, and the n-3 fatty acids, as well as their interaction as compared to the placebo. The primary endpoint is a combination of myocardial infarction, ischemic stroke and cardiovascular death. Secondary endpoints are events of the composite endpoint taken separately, total mortality, and other cardiovascular events such as acute coronary syndromes, coronary revascularization, cardiac failure, arrhythmia... Conclusion Baseline socio-demographic and medical characteristics of participants are totally comparable in the four randomized groups. Trial registration Current Controlled Trials ISRCTN41926726

  12. Secondary amenorrhea (image)

    Science.gov (United States)

    Secondary amenorrhea is the cessation of menstrual flow for a period of 6 months or more in the absence ... as anxiety can be the root cause of amenorrhea. Treatment can range from behavior modification for excessive ...

  13. Towards secondary fingerprint classification

    CSIR Research Space (South Africa)

    Msiza, IS

    2011-07-01

    Full Text Available an accuracy figure of 76.8%. This small difference between the two figures is indicative of the validity of the proposed secondary classification module. Keywords?fingerprint core; fingerprint delta; primary classifi- cation; secondary classification I..., namely, the fingerprint core and the fingerprint delta. Forensically, a fingerprint core is defined as the innermost turning point where the fingerprint ridges form a loop, while the fingerprint delta is defined as the point where these ridges form a...

  14. Secondary Fire Analysis.

    Science.gov (United States)

    1981-09-01

    Megaton Weapons and Secondary Ignition There are very few well documented data on fires initiated by physical damage (i.e., secondary ignitions). Those data...where significant physical damage to buildings and/or contents can occur. Where this outer bound is located relative to the primary ignition range is...maintenance 7.9 Busline facilities, including shops 3.0 Convalescent homes8 3.1 Hospitals 8.0 Radio and television transmitters Collges and universities

  15. Method

    Directory of Open Access Journals (Sweden)

    Ling Fiona W.M.

    2017-01-01

    Full Text Available Rapid prototyping of microchannel gain lots of attention from researchers along with the rapid development of microfluidic technology. The conventional methods carried few disadvantages such as high cost, time consuming, required high operating pressure and temperature and involve expertise in operating the equipment. In this work, new method adapting xurography method is introduced to replace the conventional method of fabrication of microchannels. The novelty in this study is replacing the adhesion film with clear plastic film which was used to cut the design of the microchannel as the material is more suitable for fabricating more complex microchannel design. The microchannel was then mold using polymethyldisiloxane (PDMS and bonded with a clean glass to produce a close microchannel. The microchannel produced had a clean edge indicating good master mold was produced using the cutting plotter and the bonding between the PDMS and glass was good where no leakage was observed. The materials used in this method is cheap and the total time consumed is less than 5 hours where this method is suitable for rapid prototyping of microchannel.

  16. Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS).

    Science.gov (United States)

    Abraham, J L; Chandra, S; Agrawal, A

    2014-11-01

    Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry instrument, CAMECA IMS 3f secondary ion mass spectrometry ion microscope. The beryllium content of shrapnel (∼100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (∼25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y- and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (∼0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either

  17. Uncertainty analysis for secondary energy distributions

    International Nuclear Information System (INIS)

    Gerstl, S.A.W.

    1978-01-01

    In many transport calculations the integral design parameter of interest (response) is determined mainly by secondary particles such as gamma rays from (n,γ) reactions or secondary neutrons from inelastic scattering events or (n,2n) reactions. Standard sensitivity analysis usually allows to calculate the sensitivities to the production cross sections of such secondaries, but an extended formalism is needed to also obtain the sensitivities to the energy distribution of the generated secondary particles. For a 30-group standard cross-section set 84% of all non-zero table positions pertain to the description of secondary energy distributions (SED's) and only 16% to the actual reaction cross sections. Therefore, any sensitivity/uncertainty analysis which does not consider the effects of SED's is incomplete and neglects most of the input data. This paper describes the methods of how sensitivity profiles for SED's are obtained and used to estimate the uncertainty of an integral response due to uncertainties in these SED's. The detailed theory is documented elsewhere and implemented in the LASL sensitivity code SENSIT. SED sensitivity profiles have proven particularly valuable in cross-section uncertainty analyses for fusion reactors. Even when the production cross sections for secondary neutrons were assumed to be without error, the uncertainties in the energy distribution of these secondaries produced appreciable uncertainties in the calculated tritium breeding rate. However, complete error files for SED's are presently nonexistent. Therefore, methods will be described that allow rough error estimates due to estimated SED uncertainties based on integral SED sensitivities

  18. method

    Directory of Open Access Journals (Sweden)

    L. M. Kimball

    2002-01-01

    Full Text Available This paper presents an interior point algorithm to solve the multiperiod hydrothermal economic dispatch (HTED. The multiperiod HTED is a large scale nonlinear programming problem. Various optimization methods have been applied to the multiperiod HTED, but most neglect important network characteristics or require decomposition into thermal and hydro subproblems. The algorithm described here exploits the special bordered block diagonal structure and sparsity of the Newton system for the first order necessary conditions to result in a fast efficient algorithm that can account for all network aspects. Applying this new algorithm challenges a conventional method for the use of available hydro resources known as the peak shaving heuristic.

  19. Determination of primary combustion source organic carbon-to-elemental carbon (OC / EC ratio using ambient OC and EC measurements: secondary OC-EC correlation minimization method

    Directory of Open Access Journals (Sweden)

    C. Wu

    2016-05-01

    Full Text Available Elemental carbon (EC has been widely used as a tracer to track the portion of co-emitted primary organic carbon (OC and, by extension, to estimate secondary OC (SOC from ambient observations of EC and OC. Key to this EC tracer method is to determine an appropriate OC / EC ratio that represents primary combustion emission sources (i.e., (OC / ECpri at the observation site. The conventional approaches include regressing OC against EC within a fixed percentile of the lowest (OC / EC ratio data (usually 5–20 % or relying on a subset of sampling days with low photochemical activity and dominated by local emissions. The drawback of these approaches is rooted in its empirical nature, i.e., a lack of clear quantitative criteria in the selection of data subsets for the (OC / ECpri determination. We examine here a method that derives (OC / ECpri through calculating a hypothetical set of (OC / ECpri and SOC followed by seeking the minimum of the coefficient of correlation (R2 between SOC and EC. The hypothetical (OC / ECpri that generates the minimum R2(SOC,EC then represents the actual (OC / ECpri ratio if variations of EC and SOC are independent and (OC / ECpri is relatively constant in the study period. This Minimum R Squared (MRS method has a clear quantitative criterion for the (OC / ECpri calculation. This work uses numerically simulated data to evaluate the accuracy of SOC estimation by the MRS method and to compare with two commonly used methods: minimum OC / EC (OC / ECmin and OC / EC percentile (OC / EC10 %. Log-normally distributed EC and OC concentrations with known proportion of SOC are numerically produced through a pseudorandom number generator. Three scenarios are considered, including a single primary source, two independent primary sources, and two correlated primary sources. The MRS method consistently yields the most accurate SOC estimation. Unbiased SOC estimation by OC

  20. Secondary ion mass spectroscopy (SIMS)

    International Nuclear Information System (INIS)

    Naik, P.K.

    1975-01-01

    Secondary Ion Mass Spectrometry (SIMS) which is primarily a method for investigating the chemical composition of the uppermost atomic layer of solid surfaces is explained. In this method, the specimen is bombarded with a primary positive ion beam of small current density monolayer. Positive and negative ions sputtered from the specimen are mass analysed to give the surface chemical composition. The analytical system which consists of a primary ion source, a target manipulator and a mass spectrometer housed in an ultrahigh vacuum system is described. This method can also be used for profile measurements in thin films by using higher current densities of the primary ions. Fields of application such as surface reactions, semiconductors, thin films emission processes, chemistry, metallurgy are touched upon. Various aspects of this method such as the sputtering process, instrumentation, and applications are discussed. (K.B.)

  1. Modes of failures: primary and secondary stresses

    International Nuclear Information System (INIS)

    Roche, R.L.

    1987-07-01

    The paper begins with a reminder that the purpose of stress classification is to ensure suitable margins with respect to failure modes. The distinction between primary stresses and secondary stresses is then examined and a method is given for assessing the degree of elastic follow up in the elastic plastic field. The importance of elastic follow up is then highlighted by an examination of the effect of primary and secondary stresses on crack behavior

  2. Ionic secondary emission SIMS principles and instrumentation

    International Nuclear Information System (INIS)

    Darque-Ceretti, E.; Migeon, H.N.; Aucouturier, M.

    1998-01-01

    The ionic analysis by secondary emission (SIMS) is one of material analysis based on the ions bombardment. That is micro-analysis method in taking into account that the dimensions of the analysed volume are under the micrometer. This paper details in a first part some ionic secondary emission principle to introduce a description of the instrumentation: microprobe, ions production, spectrometers. (A.L.B.)

  3. Secondary metabolites from Ganoderma.

    Science.gov (United States)

    Baby, Sabulal; Johnson, Anil John; Govindan, Balaji

    2015-06-01

    Ganoderma is a genus of medicinal mushrooms. This review deals with secondary metabolites isolated from Ganoderma and their biological significance. Phytochemical studies over the last 40years led to the isolation of 431 secondary metabolites from various Ganoderma species. The major secondary compounds isolated are (a) C30 lanostanes (ganoderic acids), (b) C30 lanostanes (aldehydes, alcohols, esters, glycosides, lactones, ketones), (c) C27 lanostanes (lucidenic acids), (d) C27 lanostanes (alcohols, lactones, esters), (e) C24, C25 lanostanes (f) C30 pentacyclic triterpenes, (g) meroterpenoids, (h) farnesyl hydroquinones (meroterpenoids), (i) C15 sesquiterpenoids, (j) steroids, (k) alkaloids, (l) prenyl hydroquinone (m) benzofurans, (n) benzopyran-4-one derivatives and (o) benzenoid derivatives. Ganoderma lucidum is the species extensively studied for its secondary metabolites and biological activities. Ganoderma applanatum, Ganoderma colossum, Ganoderma sinense, Ganoderma cochlear, Ganoderma tsugae, Ganoderma amboinense, Ganoderma orbiforme, Ganoderma resinaceum, Ganoderma hainanense, Ganoderma concinna, Ganoderma pfeifferi, Ganoderma neo-japonicum, Ganoderma tropicum, Ganoderma australe, Ganoderma carnosum, Ganoderma fornicatum, Ganoderma lipsiense (synonym G. applanatum), Ganoderma mastoporum, Ganoderma theaecolum, Ganoderma boninense, Ganoderma capense and Ganoderma annulare are the other Ganoderma species subjected to phytochemical studies. Further phytochemical studies on Ganoderma could lead to the discovery of hitherto unknown biologically active secondary metabolites. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Pittendrigh: The Darwinian Clock-Watcher

    Indian Academy of Sciences (India)

    to our current understanding of how timing systems work in living organisms. .... to periodic factors in the geophysical environment. He postulated .... clocks against temperature, nutrition and light, while the latter needs maintenance of a stable.

  5. How Darwinian reductionism refutes genetic determinism.

    Science.gov (United States)

    Rosoff, Philip M; Rosenberg, Alex

    2006-03-01

    Genetic determinism labels the morally problematical claim that some socially significant traits, traits we care about, such as sexual orientation, gender roles, violence, alcoholism, mental illness, intelligence, are largely the results of the operation of genes and not much alterable by environment, learning or other human intervention. Genetic determinism does not require that genes literally fix these socially significant traits, but rather that they constrain them within narrow channels beyond human intervention. In this essay we analyze genetic determinism in light of what is now known about the inborn error of metabolism phenylketonuria (PKU), which has for so long been the poster child 'simple' argument in favor of some form of genetic determinism. We demonstrate that this case proves the exact opposite of what it has been proposed to support and provides a strong refutation of genetic determinism in all its guises.

  6. Darwinian pluralism and the multilevel selection debate

    Indian Academy of Sciences (India)

    2014-03-15

    Mar 15, 2014 ... replicate like genes and do not reproduce like organisms. But. (2) is not the point ... ary 'unit' remains the whole genetic code of the individual, the ..... ciality) and then converted for other functions in modified. 'social niches' ...

  7. Surface treatment method for hydrogen adsorbing alloy powder and alkali secondary battery fabricated by applying the method; Suiso kyuzo gokin funmatsu no hyomen shori hoho to sorewo tekiyoshite eraeta arukari niji denchi

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, K. [Furukawa Electric Co. Ltd., Tokyo (Japan); Sawa, H. [The Furukawa Battery Co. Ltd., Yokohama (Japan)

    1997-03-07

    Corrosion of alloy proceeds in the conventional hydrogen absorbing alloy because the composing hydrogen absorbing alloy powder contacts with high concentration alkali electrolyte in the battery. Immersion into alkali aqueous solution and pulverization by metal fluoride compound of the electrode have been practiced to solve the problem, but internal resistance of the battery increases and the charge and discharge properties of the battery are deteriorated. This invention relates to a method in which hydrogen absorbing alloy electrode powder or the hydrogen alloy electrode whose main content is the said powder is contacted with alkali aqueous solution to increase the specific surface area of the hydrogen absorbing alloy powder, followed by its contact with pH3-6 acidic aqueous solution containing fluorine ions. As a result, corrosion resistance of the surface of hydrogen absorbing alloy powder after the treatment against high concentration alkali electrolyte is improved to elongate the cycle life. Salts of LiF, NaF, KF, RbF, and CsF or their hydrogen salts can be used as the supply source of fluorine ions. 3 tabs.

  8. Dynamics of secondary forests

    NARCIS (Netherlands)

    Breugel, van M.

    2007-01-01

    The succession of tropical secondary forests on abandoned agricultural fields has been studied since long, most often by comparing stands of different age since abandonment. These so-called chronosequence studies have yielded much insight in general patterns of succession and the constraints and

  9. Two secondary drops

    Indian Academy of Sciences (India)

    Figure shows formation of two secondary drops of unequal size and their merger. The process is same as the earlier process until t= 0.039 Tc with necking occurring at two places, one at the bottom of the column and the other at the middle. The necking at the middle of the liquid column is due to Raleigh instability.

  10. [Primary and secondary encopresis].

    Science.gov (United States)

    Lang-Langer, Ellen

    2007-01-01

    While the difficulty of the child to part with its faeces in primary encopresis is linked to the incapability to experience the object as separated and independent from himself, secondary encopresis is a progressed psychical state of development. In this case we have to deal with regression caused by conflict. Two case-studies show clearly the differences.

  11. [Secondary thrombotic microangiopathies].

    Science.gov (United States)

    Coppo, P

    2017-11-01

    Thrombotic microangiopathies (TMA) are termed secondary when associated to a specific context favouring their occurrence. They encompass mainly TMA associated with pregnancy, allogeneic hematopoietic stem cell transplantation, cancer, drugs, or HIV infection. Secondary TMA represent a heterogeneous group of diseases which clinical presentation largely depends on the associated context. It is therefore mandatory to recognize these conditions since they have a significant impact in TMA management and prognosis. A successful management still represents a challenge in secondary TMA. Significant progresses have been made in the understanding of pregnancy-associated TMA, allowing an improvement of prognosis; on the opposite, other forms of secondary TMA such as hematopoietic stem cell transplantation-associated TMA or TMA associated with chemotherapy remain of dismal prognosis. A better understanding of pathophysiology in these forms of TMA, in association with a more empirical approach through the use of new therapeutic agents that can also help in the understanding on new mechanisms a posteriori, should improve their prognosis. The preliminary encouraging results reported with complement blockers in this field could represent a convincing example. Copyright © 2017 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  12. Secondary coolant purification system

    International Nuclear Information System (INIS)

    Stiteler, F.Z.; Donohue, J.P.

    1978-01-01

    The present invention combines the attributes of volatile chemical addition, continuous blowdown, and full flow condensate demineralization. During normal plant operation (defined as no primary to secondary leakage) condensate from the condenser is pumped through a full flow condensate demineralizer system by the condensate pumps. Volatile chemical additions are made. Dissolved and suspended solids are removed in the condensate polishers by ion exchange and/or filtration. At the same time a continuous blowdown of approximately 1 percent of the main steaming rate of the steam generators is maintained. Radiation detectors monitor the secondary coolant. If these monitors indicate no primary to secondary leakage, the blowdown is cooled and returned directly to the condensate pump discharge. If one of the radiation monitors should indicate a primary to secondary leak, when the temperature of the effluent exiting from the blowdown heat exchanger is compatible with the resin specifications of the ion exchangers, the bypass valve causes the blowdown flow to pass through the blowdown ion exchangers

  13. The secondary metabolite bioinformatics portal

    DEFF Research Database (Denmark)

    Weber, Tilmann; Kim, Hyun Uk

    2016-01-01

    . In this context, this review gives a summary of tools and databases that currently are available to mine, identify and characterize natural product biosynthesis pathways and their producers based on ‘omics data. A web portal called Secondary Metabolite Bioinformatics Portal (SMBP at http...... analytical and chemical methods gave access to this group of compounds, nowadays genomics-based methods offer complementary approaches to find, identify and characterize such molecules. This paradigm shift also resulted in a high demand for computational tools to assist researchers in their daily work......Natural products are among the most important sources of lead molecules for drug discovery. With the development of affordable whole-genome sequencing technologies and other ‘omics tools, the field of natural products research is currently undergoing a shift in paradigms. While, for decades, mainly...

  14. Secondary hypertension in adults.

    Science.gov (United States)

    Puar, Troy Hai Kiat; Mok, Yingjuan; Debajyoti, Roy; Khoo, Joan; How, Choon How; Ng, Alvin Kok Heong

    2016-05-01

    Secondary hypertension occurs in a significant proportion of adult patients (~10%). In young patients, renal causes (glomerulonephritis) and coarctation of the aorta should be considered. In older patients, primary aldosteronism, obstructive sleep apnoea and renal artery stenosis are more prevalent than previously thought. Primary aldosteronism can be screened by taking morning aldosterone and renin levels, and should be considered in patients with severe, resistant or hypokalaemia-associated hypertension. Symptoms of obstructive sleep apnoea should be sought. Worsening of renal function after starting an angiotensin-converting enzyme inhibitor suggests the possibility of renal artery stenosis. Recognition, diagnosis and treatment of secondary causes of hypertension lead to good clinical outcomes and the possible reversal of end-organ damage, in addition to blood pressure control. As most patients with hypertension are managed at the primary care level, it is important for primary care physicians to recognise these conditions and refer patients appropriately. Copyright: © Singapore Medical Association.

  15. THE SECONDARY EXTINCTION CORRECTION

    Energy Technology Data Exchange (ETDEWEB)

    Zachariasen, W. H.

    1963-03-15

    It is shown that Darwin's formula for the secondary extinction correction, which has been universally accepted and extensively used, contains an appreciable error in the x-ray diffraction case. The correct formula is derived. As a first order correction for secondary extinction, Darwin showed that one should use an effective absorption coefficient mu + gQ where an unpolarized incident beam is presumed. The new derivation shows that the effective absorption coefficient is mu + 2gQ(1 + cos/sup 4/2 theta )/(1 plus or minus cos/sup 2/2 theta )/s up 2/, which gives mu + gQ at theta =0 deg and theta = 90 deg , but mu + 2gQ at theta = 45 deg . Darwin's theory remains valid when applied to neutron diffraction. (auth)

  16. Secondary Breast Augmentation.

    Science.gov (United States)

    Brown, Mitchell H; Somogyi, Ron B; Aggarwal, Shagun

    2016-07-01

    After studying this article, the participant should be able to: 1. Assess common clinical problems in the secondary breast augmentation patient. 2. Describe a treatment plan to correct the most common complications of breast augmentation. 3. Provide surgical and nonsurgical options for managing complications of breast augmentation. 4. Decrease the incidence of future complications through accurate assessment, preoperative planning, and precise surgical technique. Breast augmentation has been increasing steadily in popularity over the past three decades. Many of these patients present with secondary problems or complications following their primary breast augmentation. Two of the most common complications are capsular contracture and implant malposition. Familiarity and comfort with the assessment and management of these complications is necessary for all plastic surgeons. An up-to-date understanding of current devices and techniques may decrease the need to manage future complications from the current cohort of breast augmentation patients.

  17. Secondary victims of rape

    DEFF Research Database (Denmark)

    Christiansen, Dorte Mølgaard; Bak, Rikke; Elklit, Ask

    2012-01-01

    secondary victims, including family members, partners, and friends of male and female rape victims. We found that many respondents found it difficult to support the PV and that their relationship with the PV was often affected by the assault. Furthermore, the sample showed significant levels...... of social support for the respondent, and feeling let down by others. The respondents were generally interested in friend-, family-, and partner-focused interventions, particularly in receiving education about how best to support a rape victim...

  18. Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS)

    Science.gov (United States)

    Abraham, Jerrold L.; Chandra, Subhash; Agrawal, Anoop

    2014-01-01

    Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease (CBD) from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water, and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry (SIMS) instrument, CAMECA IMS 3f SIMS ion microscope. The beryllium content of shrapnel (~100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (~25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y-and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (~0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either present in an

  19. EFFECTIVENESS OF FOLK MATHEMATICS ON ACHIEVEMENT AT SECONDARY LEVEL STUDENT

    OpenAIRE

    Mrs. K. K. Sumathi

    2016-01-01

    The present study is aimed at finding the effectiveness of folk mathematics on achievement at secondary level student. It was an experimental method conducted on secondary school students in teaching mathematics for seventh standard. The result concluded by the investigator was that the effect of folk mathematics was better than the traditional method of teaching.

  20. Characteristics and generation of secondary jets and secondary gigantic jets

    Science.gov (United States)

    Lee, Li-Jou; Huang, Sung-Ming; Chou, Jung-Kung; Kuo, Cheng-Ling; Chen, Alfred B.; Su, Han-Tzong; Hsu, Rue-Rou; Frey, Harald U.; Takahashi, Yukihiro; Lee, Lou-Chuang

    2012-06-01

    Secondary transient luminous events (TLEs) recorded by the ISUAL-FORMOSAT2 mission can either be secondary jets or secondary gigantic jets (GJs), depending on their terminal altitudes. The secondary jets emerge from the cloud top beneath the preceding sprites and extend upward to the base of the sprites at ˜50 km. The secondary jets likely are negative electric discharges with vertically straight luminous columns, morphologically resembling the trailing jet of the type-I GJs. The number of luminous columns in a secondary jet seems to be affected by the size of the effective capacitor plate formed near the base of the preceding sprites and the charge distribution left behind by the sprite-inducing positive cloud-to-ground discharges. The secondary GJs originate from the cloud top under the shielding area of the preceding sprites, and develop upward to reach the lower ionosphere at ˜90 km. The observed morphology of the secondary GJs can either be the curvy shifted secondary GJs extending outside the region occupied by the preceding sprites or the straight pop-through secondary GJs developing through the center of the preceding circular sprites. A key factor in determining the terminal height of the secondary TLEs appears to be the local ionosphere boundary height that established by the preceding sprites. The abundance and the distribution of the negative charge in the thundercloud following the sprite-inducing positive cloud-to-ground discharges may play important role in the generation of the secondary TLEs.

  1. Prediction of the Secondary Structure of HIV-1 gp120

    DEFF Research Database (Denmark)

    Hansen, Jan; Lund, Ole; Nielsen, Jens O.

    1996-01-01

    Fourier transform infrared spectroscopy. The predicted secondary structure of gp120 compared well with data from NMR analysis of synthetic peptides from the V3 loop and the C4 region. As a first step towards modeling the tertiary structure of gp120, the predicted secondary structure may guide the design......The secondary structure of HIV-1 gp120 was predicted using multiple alignment and a combination of two independent methods based on neural network and nearest-neighbor algorithms. The methods agreed on the secondary structure for 80% of the residues in BH10 gp120. Six helices were predicted in HIV...

  2. Causes of secondary headache (image)

    Science.gov (United States)

    Temporomandibular joint, or TMJ, dysfunction, can be a cause of secondary headache. Secondary headaches result from underlying disorders which produce pain as a symptom. The TMJ may become painful and dysfunctional as a result ...

  3. Developing the Conflicts Management Model for School Administrators of Secondary School under the Office of Secondary Educational Service Area 20

    Directory of Open Access Journals (Sweden)

    Pornpan Ruangrit

    2017-09-01

    Full Text Available This study aimed to 1 investigate the cause of conflict which in the secondary schools under the Secondary School under the Office of Secondary Educational Service Area 20, 2 study the conflict management method which administrators applied in Secondary School under the Office of Secondary Educational Service Area 20, and 3 develop conflict management model for Secondary School under the Office of Secondary Educational Service Area 20. The participants were 115 school administrators (44 school directors and 71 deputy directors which were selected by random sampling technique. The research instruments included a questionnaire, which reliability value was 0.97, and an interview schedule that were administered to the respondents. The data were analyzed by frequency, percentage, mean, and standard deviation. The result of the study showed that: 1. the causes of conflict in Secondary School under the Office of Secondary Educational Service Area 20 in overall was at the high level with the mean of 4.21, the internal conflict was at the high level with the mean of 4.22, and the external conflict was at the high level with the mean of 4.19. 2. Overall, conflict management method used by administrators in Secondary School under the Office of Secondary Educational Service Area 20was at a high level. Considering each aspect, the compromising method was the highest level at 4.48. 3. Developing conflict management model in Secondary School under the Office of Secondary Educational Service Area 20 were the collaboration and making understand method. These should be used for conflict management to achieve the success and to reach the standard which including responsibility, accountability, equality, teamwork, and communication competence.

  4. Organic particulate matter formation at varying relative humidity using surrogate secondary and primary organic compounds with activity corrections in the condensed phase obtained using a method based on the Wilson equation

    Science.gov (United States)

    Chang, E. I.; Pankow, J. F.

    2010-06-01

    Secondary organic aerosol (SOA) formation in the atmosphere is currently often modeled using a multiple lumped "two-product" (N·2p) approach. The N·2p approach neglects: 1) variation of activity coefficient (ζi) values and mean molecular weight solid #000; color: #000;">MW in the particulate matter (PM) phase; 2) water uptake into the PM; and 3) the possibility of phase separation in the PM. This study considers these effects by adopting an (N·2p)ζpsolid #000; color: #000;">MW,ζ approach (θ is a phase index). Specific chemical structures are assigned to 25 lumped SOA compounds and to 15 representative primary organic aerosol (POA) compounds to allow calculation of ζi and solid #000; color: #000;">MW values. The SOA structure assignments are based on chamber-derived 2p gas/particle partition coefficient values coupled with known effects of structure on vapor pressure pL,io (atm). To facilitate adoption of the (N·2p)ζpsolid #000; color: #000;">MW,θ approach in large-scale models, this study also develops CP-Wilson.1 (Chang-Pankow-Wilson.1), a group-contribution ζi-prediction method that is more computationally economical than the UNIFAC model of Fredenslund et al. (1975). Group parameter values required by CP-Wilson.1 are obtained by fitting ζi values to predictions from UNIFAC. The (N·2p)ζpsolid #000; color: #000;">MW,θ approach is applied (using CP-Wilson.1) to several real α-pinene/O3 chamber cases for high reacted hydrocarbon levels (ΔHC≈400 to 1000 μg m-3) when relative humidity (RH) ≍50%. Good agreement between the chamber and predicted results is obtained using both the (N·2p)ζpsolid #000; color: #000;">MW,θ and N·2p approaches, indicating relatively small water effects under these conditions. However, for a hypothetical α-pinene/O3 case at ΔHC=30 μg m-3 and RH=50%, the (N·2p)ζpsolid #000; color: #000;">MW,θ approach predicts that water uptake will lead to an organic PM level that is more double that predicted by the N·2p

  5. Secondary Vertex Finder Algorithm

    CERN Document Server

    Heer, Sebastian; The ATLAS collaboration

    2017-01-01

    If a jet originates from a b-quark, a b-hadron is formed during the fragmentation process. In its dominant decay modes, the b-hadron decays into a c-hadron via the electroweak interaction. Both b- and c-hadrons have lifetimes long enough, to travel a few millimetres before decaying. Thus displaced vertices from b- and subsequent c-hadron decays provide a strong signature for a b-jet. Reconstructing these secondary vertices (SV) and their properties is the aim of this algorithm. The performance of this algorithm is studied with tt̄ events, requiring at least one lepton, simulated at 13 TeV.

  6. SECONDARY (ENDOCRINE HYPERTENSION: LECTURE

    Directory of Open Access Journals (Sweden)

    M. Yu. Yukina

    2016-01-01

    Full Text Available Hypertension is a  very common disease with high morbidity and reduction in quality of life. Endocrine disorders are the most common cause of secondary hypertension affecting ~3% of the population. Primary aldosteronism can be the cause of endocrine hypertension more often than other endocrine disorders. Other less common causes of endocrine hypertension include Cushing syndrome, pheochromocytoma, thyroid disorders, and hyperparathyroidism. Endocrine hypertension is potentially curable if the underlying cause is identified and treated accordingly. Younger age at manifestation of resistance to multiple antihypertensive drugs, together with other clinical signs of an endocrine disorder, should raise the suspicion and prompt the appropriate evaluation.

  7. Changing Pattern of Bacteriuria among Asymptomatic Secondary ...

    African Journals Online (AJOL)

    Subjects and Methods: A survey of 628 adolescents attending secondary schools in Enugu was ... females in whom asymptomatic bacteriuria needs to be treated in pregnancy in order to prevent the attendant risks to the fetus. Thus, there is a ...

  8. 5. CASE SERIES OF MANIA SECONDARY

    African Journals Online (AJOL)

    Esem

    meeting the criteria for DSM IV- TR is increasing. What is not clear with this increase is whether it is primary mania or secondary mania linked with HIV. METHODS. This study design was a case series in which patients with acute manic episodes were admitted to. Chainama Hills College Hospital and University. Teaching ...

  9. Substance Abuse Among Female Senior Secondary School ...

    African Journals Online (AJOL)

    Objective: To study the prevalence of substance abuse among female secondary school students in Anambra State. Design: This is a cross sectional study. Materials and Methods: A pre-tested structured questionnaire was used to obtain information on smoking, use of sedatives and alcohol drinking habits from 725 ...

  10. Food Literacy at Secondary Schools in Australia

    Science.gov (United States)

    Ronto, Rimante; Ball, Lauren; Pendergast, Donna; Harris, Neil D.

    2016-01-01

    Background: Food literacy can encourage adolescents to develop healthy dietary patterns. This study examined home economics teachers' (HET) perspectives of the importance, curriculum, self-efficacy, and food environments regarding food literacy in secondary schools in Australia. Methods: A 20-item cross-sectional survey was completed by 205 HETs.…

  11. Preservice Secondary Mathematics Teachers' Knowledge of Students

    Science.gov (United States)

    Kilic, Hulya

    2011-01-01

    The aim of this paper is to present the nature of preservice secondary mathematics teachers' knowledge of students as emerged from a study investigating the development of their pedagogical content knowledge in a methods course and its associated field experience. Six preservice teachers participated in the study and the data were collected in the…

  12. [Secondary osteoporosis in gynecology].

    Science.gov (United States)

    Taguchi, Y; Gorai, I

    1998-06-01

    Several diseases and medications are known to induce secondary osteoporosis. Among them, same situations are related to gynecological field. They include Turner's syndrome, anorexia nervosa, ovarian dysfunction, oophorectomy, GnRH agonist therapy, and osteoporosis associated with pregnancy. We briefly describe these secondary osteoporosis in this article as follows. Several studies have found osteoporosis to be a common complication of Turner's syndrome and hormone replacement therapy has been used as a possible management; in anorexic patient, low body weight, prolonged amenorrhea, early onset of anorexia nervosa, and hypercortisolism have been reported to be risks for bone demineralization; since oophorectomy which is a common intervention in gynecology leads osteoporosis, it is important to prevent osteoporosis caused by surgery as well as postmenopausal osteoporosis; GnRH agonist, which induces estrogen deficient state and affect bone mass, is commonly used as a management for endometriosis and leiomyoma of uterus; associated with pregnancy, post-pregnancy spinal osteoporosis and transient osteoporosis of the hip are clinically considered to be important and heparin therapy and magnesium sulfate therapy are commonly employed during pregnancy, affecting calcium homeostasis.

  13. Radioactive heavy ion secondary beams

    International Nuclear Information System (INIS)

    Bimbot, R.

    1987-01-01

    The production of secondary radioactive beams at GANIL using the LISE spectrometer is reviewed. The experimental devices, and secondary beam characteristics are summarized. Production of neutron rich secondary beams was studied for the systems Ar40 + Be at 44 MeV/u, and 018 + Be at 45 and 65 MeV/u. Partial results were also obtained for the system Ne22 + Ta at 45 MeV/u. Experiments using secondary beams are classified into two categories: those which correspond to fast transfer of nuclei from the production target to a well shielded observation point; and those in which the radioactive beam interacts with a secondary target

  14. Polarized secondary radioactive beams

    International Nuclear Information System (INIS)

    Zaika, N.I.

    1992-01-01

    Three methods of polarized radioactive nuclei beam production: a) a method nuclear interaction of the non-polarized or polarized charged projectiles with target nuclei; b) a method of polarization of stopped reaction radioactive products in a special polarized ion source with than following acceleration; c) a polarization of radioactive nuclei circulating in a storage ring are considered. Possible life times of the radioactive ions for these methods are determined. General schemes of the polarization method realizations and depolarization problems are discussed

  15. Overview of factors influencing the secondary market

    International Nuclear Information System (INIS)

    Bleistine, P.A.

    1982-01-01

    The major factor influencing secondary trading for the last few years has been the large contractural commitments built up by consumers for reactor programs which have proven to be unrealistic. The situation has intensified as a result of utilities needing to generate capital through inventory liquidation or reductions. The flexibilities in most contracts are inadequate to match the types of external and/or internal factors faced by the industry. This situation also suggests the need for secondary markets to help the industry adjust to unforeseen difficulties. They are very active markets at this time, but their influence in relation to the long-term method of doing business should not be exaggerated

  16. Development of methodics for the characterization of the composition of the ion-collision-induced secondary-particle flux by comparison of the yield contributions of photoinduced ion formation processes; Entwicklung einer Methodik zur Charakterisierung der Zusammensetzung des ionenbeschussinduzierten Sekundaerteilchenflusses durch Vergleich der Ausbeuteanteile photoinduzierter Ionenbildungsprozesse

    Energy Technology Data Exchange (ETDEWEB)

    Vering, Guido

    2008-10-13

    The aim of this work was to develop a method to distinguish between different ion formation processes and to determine the influence of these processes on the total number of detected monatomic ions of a certain element. A vector/matrix-formalism was developed, which describes the physical processes of sputtering, ion formation, mass separation and detection in laser-SNMS. In the framework of the method developed, based on this theoretic formalism, changes in the secondary flux contribution of the respective element were observed by comparing the detected monatomic ion yield obtained in specifically aligned (SIMS and) laser-SNMS experiments. The yields resulting from these experiments were used to calculate characteristic numbers to compare the flux composition from different surfaces. The potential of the method was demonstrated for the elements boron, iron and gadolinium by investigating the changes in the flux composition of secondary particles sputtered from metallic surfaces, as a function of the oxygen concentration at the surface. Finally, combined laser-SNMS depth profiles and images, obtained with both laser systems, were presented to demonstrate how the parallel detection of the three differently originated ion signals of the same element can be used to get additional information about the composition of the flux of secondary particles synchronously during the analysis of elemental distributions. In this respect the presented method can be a very helpful tool to prevent misleading interpretations of SIMS or laser-SNMS data. (orig.)

  17. A Kernel for Protein Secondary Structure Prediction

    OpenAIRE

    Guermeur , Yann; Lifchitz , Alain; Vert , Régis

    2004-01-01

    http://mitpress.mit.edu/catalog/item/default.asp?ttype=2&tid=10338&mode=toc; International audience; Multi-class support vector machines have already proved efficient in protein secondary structure prediction as ensemble methods, to combine the outputs of sets of classifiers based on different principles. In this chapter, their implementation as basic prediction methods, processing the primary structure or the profile of multiple alignments, is investigated. A kernel devoted to the task is in...

  18. [Secondary orbital lymphoma].

    Science.gov (United States)

    Basanta, I; Sevillano, C; Álvarez, M D

    2015-09-01

    A case is presented of an 85 year-old Caucasian female with lymphoma that recurred in the orbit (secondary ocular adnexal lymphoma). The orbital tumour was a diffuse large B-cell lymphoma according to the REAL classification (Revised European-American Lymphoma Classification). Orbital lymphomas are predominantly B-cell proliferations of a variety of histological types, and most are low-grade tumours. Patients are usually middle-aged or elderly, and it is slightly more common in women. A palpable mass, proptosis and blepharoptosis are the most common signs of presentation. Copyright © 2011 Sociedad Española de Oftalmología. Published by Elsevier España, S.L.U. All rights reserved.

  19. HANARO secondary coolant management

    International Nuclear Information System (INIS)

    Kim, Seon Duk.

    1998-02-01

    In this report, the basic theory for management of water quality, environmental factors influencing to the coolant, chemicals and its usage for quality control of coolant are mentioned, and water balance including the loss rate by evaporation (34.3 m 3 /hr), discharge rate (12.665 m 3 /hr), concentration ratio and feed rate (54.1 m 3 /hr) are calculated at 20 MW operation. Also, the analysis data of HANSU Limited for HANARO secondary coolant (feed water and circulating coolant) - turbidity, pH, conductivity, M-alkalinity, Ca-hardness, chloride ion, total iron ion, phosphoric ion and conversion rate are reviewed. It is confirmed that the feed water has good quality and the circulating coolant has been maintained within the control specification in general, but some items exceeded the control specification occasionally. Therefore it is judged that more regular discharge of coolant is needed. (author). 6 refs., 17 tabs., 18 figs

  20. New secondary energy systems

    International Nuclear Information System (INIS)

    Schulten, R.

    1977-01-01

    As an introduction, the FRG's energy industry situation is described, secondary energy systems to be taken into consideration are classified, and appropriate market requirements are analyzed. Dealt with is district heating, i.e. the direct transport of heat by means of circulating media, and long-distance energy, i.e. the long-distance energy transport by means of chemical conversion in closed- or open-cycle systems. In closed-cycle systems heat is transported in the form of chemical latent energy. In contrast to this, chemical energy is transported in open-cycle systems in the form of fuel gases produced by coal gasification or by thermochemical water splitting. (GG) [de

  1. Numerical study of jets secondary instabilities

    International Nuclear Information System (INIS)

    Brancher, Pierre

    1996-01-01

    The work presented in this dissertation is a contribution to the study of the transition to turbulence in open shear flows. Results from direct numerical simulations are interpreted within the framework of hydrodynamic stability theory. The first chapter is an introduction to the primary and secondary instabilities observed in jets and mixing layers. The numerical method used in the present study is detailed in the second chapter. The dynamics of homogeneous circular jets subjected to stream wise and azimuthal perturbations are investigated in the third chapter. A complete scenario describing the evolution of the jet is proposed with emphasis on the dynamics of vorticity within the flow. In the fourth chapter a parametric study reveals a three-dimensional secondary instability mainly controlled in the linear regime by the Strouhal number of the primary instability. In the nonlinear regime the dynamics of the azimuthal harmonies are described by means of model equations and are linked to the formation of stream wise vortices in the braid. The fifth chapter is dedicated to the convective or absolute nature of the secondary instabilities in plane shear layers. It is shown that there are flow configurations for which the two-dimensional secondary instability (pairing) is absolute even though the primary instability (Kelvin-Helmholtz) is convective. Some preliminary results concerning the three-dimensional secondary instabilities arc presented at the end of this chapter. The last chapter summarizes the main results and examines possible extensions of this work. (author) [fr

  2. Organic particulate matter formation at varying relative humidity using surrogate secondary and primary organic compounds with activity corrections in the condensed phase obtained using a method based on the Wilson equation

    Directory of Open Access Journals (Sweden)

    E. I. Chang

    2010-06-01

    Full Text Available Secondary organic aerosol (SOA formation in the atmosphere is currently often modeled using a multiple lumped "two-product" (N·2p approach. The N·2p approach neglects: 1 variation of activity coefficient (ζi values and mean molecular weight MW in the particulate matter (PM phase; 2 water uptake into the PM; and 3 the possibility of phase separation in the PM. This study considers these effects by adopting an (N·2pζpMW,ζ approach (θ is a phase index. Specific chemical structures are assigned to 25 lumped SOA compounds and to 15 representative primary organic aerosol (POA compounds to allow calculation of ζi and MW values. The SOA structure assignments are based on chamber-derived 2p gas/particle partition coefficient values coupled with known effects of structure on vapor pressure pL,io (atm. To facilitate adoption of the (N·2pζpMW,θ approach in large-scale models, this study also develops CP-Wilson.1 (Chang-Pankow-Wilson.1, a group-contribution ζi-prediction method that is more computationally economical than the UNIFAC model of Fredenslund et al. (1975. Group parameter values required by CP-Wilson.1 are obtained by fitting ζi values to predictions from UNIFAC. The (N·2pζpMW,θ approach is applied (using CP-Wilson.1 to several real α-pinene/O3 chamber cases for high reacted hydrocarbon levels (ΔHC≈400 to 1000 μg m−3 when relative humidity (RH ≈50%. Good agreement between the chamber and predicted results is

  3. Nutritional environment at secondary schools in Bloemfontein, South ...

    African Journals Online (AJOL)

    Objective: The objective was to determine the nutritional environment at secondary schools in Bloemfontein, Free State province. Design: This was a cross-sectional, descriptive study. Subjects and setting: The subjects were secondary school principals in Bloemfontein, Free State province, in 2006. Method: Principals of 10 ...

  4. Impact of secondary cardiovascular events on health status

    NARCIS (Netherlands)

    van Stel, Henk F.; Busschbach, Jan J. V.; Hunink, M. G. Myriam; Buskens, Erik

    2012-01-01

    Objectives: Estimates regarding the impact of secondary cardiovascular events on health status in patients treated for cardiovascular disease are scarce and of limited accuracy. Methods: We obtained individual patient data on health status (EuroQol five-dimensional questionnaire) and secondary

  5. Knowledge and attitude of secondary school teachers in Enugu to ...

    African Journals Online (AJOL)

    Objective: To assess the knowledge and attitude to sex education among secondary school teachers in Enugu. Materials and Methods: A cross sectional study of 300 teachers drawn from nine randomly selected secondary schools in Enugu metropolis was carried out. Pre-tested self administered structured questionnaire ...

  6. Secondary Analysis of National Longitudinal Transition Study 2 Data

    Science.gov (United States)

    Hicks, Tyler A.; Knollman, Greg A.

    2015-01-01

    This review examines published secondary analyses of National Longitudinal Transition Study 2 (NLTS2) data, with a primary focus upon statistical objectives, paradigms, inferences, and methods. Its primary purpose was to determine which statistical techniques have been common in secondary analyses of NLTS2 data. The review begins with an…

  7. Millennial Instructional Preferences in Post-Secondary Business Programs

    Science.gov (United States)

    West, Cynthia Elaine

    2017-01-01

    The purpose of this mixed method study was to examine the instructional preferences of millennial learners and how their instructional preferences affect their choice in post-secondary business programs. The instructional preferences of millennial learners are an important question for post-secondary business programs enrolling learners from…

  8. RNA-SSPT: RNA Secondary Structure Prediction Tools.

    Science.gov (United States)

    Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; Din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad

    2013-01-01

    The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes.

  9. RNA Secondary Structure Prediction by Using Discrete Mathematics: An Interdisciplinary Research Experience for Undergraduate Students

    Science.gov (United States)

    Ellington, Roni; Wachira, James; Nkwanta, Asamoah

    2010-01-01

    The focus of this Research Experience for Undergraduates (REU) project was on RNA secondary structure prediction by using a lattice walk approach. The lattice walk approach is a combinatorial and computational biology method used to enumerate possible secondary structures and predict RNA secondary structure from RNA sequences. The method uses…

  10. Computed secondary-particle energy spectra following nonelastic neutron interactions with 12C for En between 15 and 60 MeV: Comparisons of results from two calculational methods

    International Nuclear Information System (INIS)

    Dickens, J.K.

    1991-04-01

    The organic scintillation detector response code SCINFUL has been used to compute secondary-particle energy spectra, dσ/dE, following nonelastic neutron interactions with 12 C for incident neutron energies between 15 and 60 MeV. The resulting spectra are compared with published similar spectra computed by Brenner and Prael who used an intranuclear cascade code, including alpha clustering, a particle pickup mechanism, and a theoretical approach to sequential decay via intermediate particle-unstable states. The similarities of and the differences between the results of the two approaches are discussed. 16 refs., 44 figs., 2 tabs

  11. Secondary interactions in HIJET

    International Nuclear Information System (INIS)

    Longacre, R.S.

    1990-01-01

    This talk deals with the investigation of secondary interactions in proton-nucleus and nucleus-nucleus collisions using the Monte Carlo event generator HIJET. The HIJET generator considers p-A and A-A collisions to be a sum of independent N-N collisions, with the N-N cross section and scattering dynamics not dependent on whether the nucleon has previously participated in an interaction. It is very reasonable to assume that each collision should be well represented by an independent N-N collision, however the cross section for the forward going struck nucleon may be different. For each primary N-N interaction, a call is made to the MINBIAS routine of the program ISAJET - an event generator for high energy N-N interactions. MINBIAS computes the energy loss of the colliding nucleons and production of particles. MINBIAS is based on inclusive high energy N-N interactions forming multi-pomeron chains, with each chain fragmenting according to the Field-Feynman algorithm

  12. [Uveitic Secondary Glaucoma].

    Science.gov (United States)

    Lommatzsch, Claudia; Heinz, Carsten

    2018-05-01

    An intraocular pressure increase with development of glaucomatous damage is a common complication of uveitis. The prevalence has a wide range depending on various factors such as the underlying uveitis type and the duration of the disease. Pathogenetically, a distinction must be made between a secondary angle closure component and the more frequently occurring open-angle glaucoma. In diagnostics, in addition to the clinical optic nerve head assessment, perimetry and tonometry, the use of imaging examination equipment, such as OCT and HRT, are recommended. In the context of uveitic glaucoma, it must be considered in the evaluation, because the glaucoma-typical changes are generally less pronounced or can be concealed by retinal swelling in comparison with other forms of glaucoma. Therapeutically, drug therapy in the form of eye drops continues to be a first-line recommendation, with the use of topical carbonic anhydrase inhibitors or beta-blockers primarily preferred, depending on the contraindications. An operative therapy follows after unsuccessful or inadequate conservative therapy: the adequate surgical technique depends on the respective finding and includes actually techniques such as filtering procedures and glaucoma drainage devices. Georg Thieme Verlag KG Stuttgart · New York.

  13. Secondary bone grafting for alveolar cleft in children with cleft lip or cleft lip and palate

    NARCIS (Netherlands)

    Guo, J.; Li, C.; Zhang, Q.; Wu, G.; Deacon, S.A.; Chen, J.; Hu, H.; Zou, S.; Ye, Q.

    2011-01-01

    BACKGROUND: Secondary alveolar bone grafting has been widely used to reconstruct alveolar cleft. However, there is still some controversy. OBJECTIVES: To compare the effectiveness and safety of different secondary bone grafting methods. SEARCH STRATEGY: The final electronic and handsearches were

  14. Experimental study on secondary electron emission characteristics of Cu

    Science.gov (United States)

    Liu, Shenghua; Liu, Yudong; Wang, Pengcheng; Liu, Weibin; Pei, Guoxi; Zeng, Lei; Sun, Xiaoyang

    2018-02-01

    Secondary electron emission (SEE) of a surface is the origin of the multipacting effect which could seriously deteriorate beam quality and even perturb the normal operation of particle accelerators. Experimental measurements on secondary electron yield (SEY) for different materials and coatings have been developed in many accelerator laboratories. In fact, the SEY is just one parameter of secondary electron emission characteristics which include spatial and energy distribution of emitted electrons. A novel experimental apparatus was set up in China Spallation Neutron Source, and an innovative method was applied to obtain the whole characteristics of SEE. Taking Cu as the sample, secondary electron yield, its dependence on beam injection angle, and the spatial and energy distribution of secondary electrons were achieved with this measurement device. The method for spatial distribution measurement was first proposed and verified experimentally. This contribution also tries to give all the experimental results a reasonable theoretical analysis and explanation.

  15. Performance Art at Secondary Level

    Science.gov (United States)

    Horn, Sheridan

    2009-01-01

    This article considers the far-reaching potential and the particular characteristics of performance art within the secondary art curriculum. It discusses the means by which an art department has incorporated it into their teaching curriculum at a state secondary school with reference to installations and the work of different performance artists…

  16. Secondary standard dosimetry laboratory (SSDL)

    International Nuclear Information System (INIS)

    Md Saion bin Salikin.

    1983-01-01

    A secondary Standard Dosimetry Laboratory has been established in the Tun Ismail Research Centre, Malaysia as a national laboratory for reference and standardization purposes in the field of radiation dosimetry. This article gives brief accounts on the general information, development of the facility, programmes to be carried out as well as other information on the relevant aspects of the secondary standard dosimetry laboratory. (author)

  17. [Preventive dentistry 5. Secondary caries].

    NARCIS (Netherlands)

    Hollanders, A.C.C.; Kuper, N.K.; Opdam, N.J.M.; Huysmans, M.C.D.N.J.M.

    2017-01-01

    Secondary caries is reported as one of the most important reasons for replacing restorations. The patient's general caries risk plays an important role in the development of secondary caries. The connection, at the patient level, between various factors, the risk of caries and restoration factors,

  18. Adolescent low back pain among secondary school students in ...

    African Journals Online (AJOL)

    ary school students in Ibadan, Nigeria and the prevalence's association with some socio-demographic variables. Methods: Participants were adolescent students from 15 secondary schools in Ibadan. Data was ..... Applied Ergonomics 1987;.

  19. marijuana smoking among secondary school students in zaria

    African Journals Online (AJOL)

    Emmanuel Ameh

    students in Zaria LGA to smoke and the effects on academic performance. Methods: A ... psychological correlates associated with cannabis ... The study was conducted among secondary school .... psychotropic drugs and illegal drugs in high.

  20. Learners' experiences of teachers' aggression in a secondary ...

    African Journals Online (AJOL)

    2014-10-17

    Oct 17, 2014 ... to one or more types of aggression. It has been observed ... Method: The population consisted of school learners at a secondary school. Inclusion .... qualitative research who analysed the data independently. The researcher ...

  1. Particle Physics Outreach to Secondary Education

    Energy Technology Data Exchange (ETDEWEB)

    Bardeen, Marjorie G.; /Fermilab; Johansson, K.Erik; /Stockholm U.; Young, M.Jean

    2011-11-21

    This review summarizes exemplary secondary education and outreach programs of the particle physics community. We examine programs from the following areas: research experiences, high-energy physics data for students, informal learning for students, instructional resources, and professional development. We report findings about these programs' impact on students and teachers and provide suggestions for practices that create effective programs from those findings. We also include some methods for assessing programs.

  2. Particle Physics Outreach to Secondary Education

    International Nuclear Information System (INIS)

    Bardeen, Marjorie G.; Johansson, K. Erik; Young, M. Jean

    2011-01-01

    This review summarizes exemplary secondary education and outreach programs of the particle physics community. We examine programs from the following areas: research experiences, high-energy physics data for students, informal learning for students, instructional resources, and professional development. We report findings about these programs' impact on students and teachers and provide suggestions for practices that create effective programs from those findings. We also include some methods for assessing programs.

  3. Preservice Secondary Mathematics Teachers’ Knowledge of Students

    OpenAIRE

    Kılıç, Hülya

    2011-01-01

    The aim of this paper is to present the nature of preservice secondary mathematics teachers’ knowledge of students as emerged from a study investigating the development of their pedagogical content knowledge in a methods course and its associated field experience. Six preservice teachers participated in the study and the data were collected in the forms of observations, interviews and written documents. Knowledge of students is defined as teachers’ knowledge of what mathematical concepts are ...

  4. Secondary School Mathematics Teachers' Attitude in Teaching Mathematics

    OpenAIRE

    Mulugeta Atnafu

    2014-01-01

    The purpose of this study was to examine Addis Ababa secondary school mathematics teachers’ attitude in teaching mathematics. 148 mathematics teachers were selected using cluster sampling from Addis Ababa administration region. The study used survey method of data collection and it includes both quantitative and qualitative research methods. From the independent t-test, ANOVA, tukey test and regression analysis, some of the results obtained were: the majority of the secondary school mathemati...

  5. Nickel-Catalyzed Reductive Transamidation of Secondary Amides with Nitroarenes

    OpenAIRE

    Cheung, Chi Wai; Ploeger, Marten Leendert; Hu, Xile

    2017-01-01

    Transmidation is an attractive method for amide synthesis. However, transamidation of secondary amides is challenging. Here, we describe a reductive transamidation method that employs readily available nitro(hetero)arenes as the nitrogen sources, zinc or manganese as reductant, and simple nickel salt and ligand as a catalyst system. The scope of amides includes both alkyl and aryl secondary amides, with high functional group compatibility.

  6. SECONDARY SCHOOL STUDENTS' PERCEPTIONS AND ATTITUDES ABOUT SCIENTISTS

    OpenAIRE

    Muhammed Doğukan Balçın; Ayşegül Ergün

    2018-01-01

    This research was carried out to determine secondary school students’ perceptions and attitudes towards scientists. The study group consists of 53 fifth and sixth grade students receiving education in a state secondary school in Turkey. Convergent parallel design among mixed research methods was used during the research. Research data were collected using “Questionnaire on attitudes towards scientists” and “Draw A Scientist (DAS)” forms. Descriptive and inferential statistical methods and con...

  7. Secondary reactions as a tool to produce exotic nuclei

    International Nuclear Information System (INIS)

    Dufour, J.P.; Fleury, A.; Bimbot, R.

    1980-01-01

    The possibility of using secondary reactions as tool to produce new isotopes is considered. This question is renewed with the emergence of intense beams of energetic heavy ions in the range of 20 to 100 MeV/nucleon. Three different methods are considered. They involve either the 'in situ' production of a secondary radioactive target, which interacts with the primary beam, or the production of a radioactive secondary beam by an inverse fusion or a fragmentation process. Very heavy or very neutron deficient isotopes can be produced by these methods

  8. Teaching Secondary Social Studies

    Directory of Open Access Journals (Sweden)

    Colin Everett

    2018-03-01

    Full Text Available Review of the book, instructional strategies for middle and high school social studies: Methods, assessment, and classroom management, by Bruce E. Larson. The book has two goals: It situates the learning of social studies within the broader developmental context of learning and also focuses on “Instructional Strategies.” “Instructional Strategies for Middle and High School Social Studies: Methods, Assessment, and Classroom Management.” 2nd Edition. By Bruce E. Larson. New York: Routledge, 2017. ISBN: 978-1-138-84678-4

  9. Wound infection secondary to snakebite

    Directory of Open Access Journals (Sweden)

    M Wagener

    2017-04-01

    Full Text Available Background. Snakebites can produce severe local and systemic septic complications as well as being associated with significant overall morbidity and even mortality. Objective. A prospective audit was undertaken to determine the bacterial causation of wound infection secondary to snakebite, and attempt to quantify the burden of disease. Methods. The audit was undertaken at Ngwelezane Hospital, which provides both regional and tertiary services for north-eastern KwaZulu-Natal Province, South Africa, over a 4-month period. Records of patients who required surgical debridement for extensive skin and soft-tissue necrosis were analysed. At the time of debridement, tissue samples of necrotic or infected tissue were sent for bacteriological analysis as standard of care. Microbiology results were analysed. Results. A total of 164 patients were admitted to hospital for management of snakebite, of whom 57 required surgical debridement and 42 were included in the final microbiological analysis. Children were found to be the most frequent victims of snakebite; 57.8% of patients in this study were aged ≤10 years and 73.7% ≤15 years. Culture showed a single organism in 32/42 cases, two organisms in 8 and no growth in 2. Eight different types of organisms were cultured, five of them more than once. Thirty-five specimens (83.3% grew Gram-negative Enterobacteriaceae, the most frequent being Morganella morganii and Proteus species. Thirteen specimens (31.0% grew Enterococcus faecalis. Gram-negative Enterobacteriaceae showed 31.4% sensitivity to ampicillin, 40.0% sensitivity to amoxicillin plus clavulanic acid, 34.3% sensitivity to cefuroxime, 97.1% sensitivity to ceftriaxone, and 100% sensitivity to ciprofloxacin, gentamicin and amikacin. E. faecalis was 92.3% sensitive to amoxicillin, 92.3% sensitive to amoxicillin plus clavulanic acid, 100% sensitive to ciprofloxacin, 92.3% resistant to erythromycin and 100% resistant to ceftriaxone. Conclusion. Children are

  10. An analysis model of the secondary tunnel lining considering ground-primary support-secondary lining interaction

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Seong-Ho; Chang, Seok-Bue [Yooshin Engineering Corporation, Seoul(Korea); Lee, Sang-Duk [Ajou University, Suwon(Korea)

    2002-06-30

    It is the common practice to over design the reinforcement for the secondary tunnel lining due to the lack of rational insight into the ground loosening loads, and due to the conservative application of the empirical design methods. The main loads of the secondary lining are the ground loosening loads and the ground water pressure, and the ground load is critical in the reinforcement design of the secondary lining in the case of drained tunnel. If the external load is absent around a tunnel. the reasons of the load for secondary tunnel lining are the deterioration of the primary supports such as shotcrete, steel rib, and rock bolts. Accordingly, the analysis method considering the ground-primary supports-secondary lining interaction should be required for the rational design of the secondary tunnel lining. In this paper, the interaction was conceptually described by the simple mass-spring model and the load transfer from the ground and primary supports to the secondary lining is showed by the ground-primary supports-secondary lining reaction curves for the theoretical solution of a circular tunnel, And also, the application of this proposed model to numerical analysis is verified in order to check the potential for the tunnel with the complex analysis conditions. (author). 8 refs., 2 tabs., 7 figs.

  11. Secondary maxima in ozone profiles

    Directory of Open Access Journals (Sweden)

    R. Lemoine

    2004-01-01

    Full Text Available Ozone profiles from balloon soundings as well as SAGEII ozone profiles were used to detect anomalous large ozone concentrations of ozone in the lower stratosphere. These secondary ozone maxima are found to be the result of differential advection of ozone-poor and ozone-rich air associated with Rossby wave breaking events. The frequency and intensity of secondary ozone maxima and their geographical distribution is presented. The occurrence and amplitude of ozone secondary maxima is connected to ozone variability and trend at Uccle and account for a large part of the total ozone and lower stratospheric ozone variability.

  12. Secondary abdominal appendicular ectopic pregnancy.

    Science.gov (United States)

    Nama, Vivek; Gyampoh, Bright; Karoshi, Mahantesh; McRae, Reynold; Opemuyi, Isaac

    2007-01-01

    Although the case fatality rate for ectopic pregnancies has decreased to 0.08% in industrialized countries, it still represents 3.8% of maternal mortality in the United States alone. In developing countries, the case fatality rate varies from 3% to 27%. Laparoscopic management of tubal pregnancies is now the standard form of treatment where this technology is available. Abdominal pregnancies are rare, and secondary implantation of tubal ectopic pregnancies is the most common cause of abdominal gestations. We present an interesting case of secondary implantation of a tubal ectopic pregnancy to highlight the appendix as a possible secondary implantation site after a tubal ectopic pregnancy.

  13. Secondary Flow in Cascades.

    Science.gov (United States)

    1984-06-01

    Int. .7. Neat adMs rnfr 9 the auction Vo1. iS. p. 1.157, 12 1.7r aeTase WOW ugte 0In the comuted 2. Briley# V.R., umenrical Method for AW16 wereo at...S. ft, C.R., -A General Theory of Three saemnit u thecsg the rotation Dimensional Flow in subsonic -a super- injoes Wer sonic Turhasachines of Axial

  14. Bilateral pneumothoraces secondary to acupuncture therapy.

    Science.gov (United States)

    Nguyen, Theresa M; Roy, Neil K; Zlupko, George R

    2011-09-01

    Acupuncture is becoming increasingly popular in the United States for a wide variety of uses, ranging from the treatment of chronic back pain to aiding in addiction therapy. As this form of complementary and alternative medicine becomes more prevalent in certain areas of the country, it is of paramount importance that the emergency physician be familiar with its methods and potential complications. In general, acupuncture is perceived as fairly safe. However, it is not without risks or side effects. In this case report, we discuss the history, methods, and common complications of acupuncture in the context of a patient who presented to the Emergency Department (ED) with bilateral pneumothoraces secondary to acupuncture therapy.

  15. Biochemistry of plant secondary metabolism

    National Research Council Canada - National Science Library

    Wink, Michael

    2010-01-01

    ... (monoterpenes, sesquiterpenes, sterols, cardiac glycosides and steroid saponins). A chapter is also included covering the importance of secondary metabolites in taxonomy, as viewed from the perspective of molecular systematics...

  16. MARIJUANA SMOKING AMONG SECONDARY SCHOOL ...

    African Journals Online (AJOL)

    MARIJUANA SMOKING AMONG SECONDARY SCHOOL STUDENTS IN ZARIA, NIGERIA: FACTORS RESPONSIBLE AND ... Its medico-social effects could ruin the life and future of our youths. ... A comprehensive school health education

  17. Learning Strategies: Secondary LD Students in the Mainstream.

    Science.gov (United States)

    D'Antoni, Alice; And Others

    The paper presents four learning strategy techniques--the SQ3R method of study, the Multipass Strategy, the Advanced Study Guide Technique, and Cognitive Mapping--for use with secondary level learning disabled students. The SQ3R method involves the five steps of survey, question, read, recite, and review. An adaption of the SQ3R method, the…

  18. Hormonal changes in secondary impotence

    International Nuclear Information System (INIS)

    Salama, F.M.; El-Shabrawy, N.O.; Nosseir, S.A.; Abo El-Azayem, Naglaa.

    1985-01-01

    Impotence is one of the problems which is still obscure both in its aetiology and treatment. The present study deals with the possible hormonal changes in cases of secondary infertility. The study involved 25 patients diagnosed as secondary impotence. Hormonal assay was performed for the following hormones: 1. Prolaction hormone. 2. Luteinising hormone (L.H.). 3. Testosterone. 4. Follicle stimulating hormone (F.S.H.). The assay was carried out by radioimmunoassay using double antibody technique. Results are discussed

  19. Secondary electron emission from insulators

    International Nuclear Information System (INIS)

    Kanaya, K.; Ono, S.; Ishigaki, F.

    1978-01-01

    The high yield of secondary electron emission from insulators due to electron bombardment may be the result of an increase of the depth of escape. The free-electron scattering theory is applied to the high energy of primary beams, but cannot be applied to the low energy of secondary escaping beams because of the large energy gap of the insulators. The plasmon loss with the valence electron is considered when the secondary electrons escape. Based on the energy retardation power formula of the penetration and energy loss of an electron probe into solid targets, secondary electron emissions from insulators are calculated from the assumptions that the distribution of the secondary electrons due to both incident and back-scattered electrons within the target is isotropic and that it follows the absorption law of the Lenard type. The universal yield-energy curve of the secondary electron emission, which is deduced as a function of three parameters such as ionisation potential, valence electron and the back-scattered coefficient in addition to the free-electron density effect, is found to be in good agreement with the experimental results. (author)

  20. Secondary reconstruction of maxillofacial trauma.

    Science.gov (United States)

    Castro-Núñez, Jaime; Van Sickels, Joseph E

    2017-08-01

    Craniomaxillofacial trauma is one of the most complex clinical conditions in contemporary maxillofacial surgery. Vital structures and possible functional and esthetic sequelae are important considerations following this type of trauma and intervention. Despite the best efforts of the primary surgery, there are a group of patients that will have poor outcomes requiring secondary reconstruction to restore form and function. The purpose of this study is to review current concepts on secondary reconstruction to the maxillofacial complex. The evaluation of a posttraumatic patient for a secondary reconstruction must include an assessment of the different subunits of the upper face, middle face, and lower face. Virtual surgical planning and surgical guides represent the most important innovations in secondary reconstruction over the past few years. Intraoperative navigational surgery/computed-assisted navigation is used in complex cases. Facial asymmetry can be corrected or significantly improved by segmentation of the computerized tomography dataset and mirroring of the unaffected side by means of virtual surgical planning. Navigational surgery/computed-assisted navigation allows for a more precise surgical correction when secondary reconstruction involves the replacement of extensive anatomical areas. The use of technology can result in custom-made replacements and prebent plates, which are more stable and resistant to fracture because of metal fatigue. Careful perioperative evaluation is the key to positive outcomes of secondary reconstruction after trauma. The advent of technological tools has played a capital role in helping the surgical team perform a given treatment plan in a more precise and predictable manner.

  1. Adrenal Mass Causing Secondary Hypertension.

    Science.gov (United States)

    Robinson, Darlene Y

    2015-11-01

    Most hypertensive patients have essential (primary) hypertension; only 5% to 10% have a secondary cause. Two clinical characteristics suggestive of secondary hypertension are early onset (hypertension (>180/110 mm Hg). When faced with these findings, clinicians should consider a secondary cause of hypertension. A 22-year-old woman being evaluated for asthma exacerbation in the emergency department was noted to have severe persistent hypertension. Additional evaluation revealed severe hypokalemia, metabolic alkalosis, and hypernatremia. The patient was admitted to the hospital for blood pressure management, electrolyte replacement, and further evaluation of presumed hyperaldosteronism. Diagnostic imaging revealed a large adrenal mass. Surgical resection was performed, leading to a diagnosis of hyperaldosteronism caused by adrenal carcinoma. WHY SHOULD AN EMERGENCY PHYSICIAN BE AWARE OF THIS?: Secondary hypertension is far less common than essential hypertension; however, considering the large volume of patients seen in emergency departments, it is likely that some will have secondary hypertension. Emergency physicians should be aware of the clinical characteristics that suggest secondary hypertension so that the appropriate diagnostic and treatment pathways can be pursued. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. A Study on Primary and Secondary School Students' Misconceptions about Greenhouse Effect (Erzurum Sampling)

    Science.gov (United States)

    Gul, Seyda; Yesilyurt, Selami

    2011-01-01

    The aim of this study is to determine what level of primary and secondary school students' misconceptions related to greenhouse effect is. Study group consists of totally 280 students attended to totally 8 primary and secondary schools (4 primary school, 4 secondary school) which were determined with convenient sampling method from center of…

  3. Accurate prediction of secondary metabolite gene clusters in filamentous fungi

    DEFF Research Database (Denmark)

    Andersen, Mikael Rørdam; Nielsen, Jakob Blæsbjerg; Klitgaard, Andreas

    2013-01-01

    Biosynthetic pathways of secondary metabolites from fungi are currently subject to an intense effort to elucidate the genetic basis for these compounds due to their large potential within pharmaceutics and synthetic biochemistry. The preferred method is methodical gene deletions to identify...... used A. nidulans for our method development and validation due to the wealth of available biochemical data, but the method can be applied to any fungus with a sequenced and assembled genome, thus supporting further secondary metabolite pathway elucidation in the fungal kingdom....

  4. Alopecia secondary to mesotherapy.

    Science.gov (United States)

    Duque-Estrada, Bruna; Vincenzi, Colombina; Misciali, Cosimo; Tosti, Antonella

    2009-10-01

    Mesotherapy has recently become an advertised method for the treatment of different types of alopecia despite the lack of any data regarding its efficacy and possible side effects. The substances injected into the scalp include "cocktails" of natural plant extracts, homoeopathic agents, vitamins, vasodilators, and drugs that may stimulate hair growth, such as finasteride and minoxidil. We report two cases of patchy alopecia that developed after mesotherapy for the treatment of androgenetic alopecia. In the first patient, alopecia developed after injections of the heparinoid vasodilator mesoglycan; the 3-month follow-up examination revealed a small residual area of cicatricial alopecia. The second patient developed reversible alopecia after multiple scalp injections of homeopathic agents. These cases underline the possible risks of mesotherapy as a therapeutic technique for hair loss.

  5. Nonlinear Finite Strain Consolidation Analysis with Secondary Consolidation Behavior

    Directory of Open Access Journals (Sweden)

    Jieqing Huang

    2014-01-01

    Full Text Available This paper aims to analyze nonlinear finite strain consolidation with secondary consolidation behavior. On the basis of some assumptions about the secondary consolidation behavior, the continuity equation of pore water in Gibson’s consolidation theory is modified. Taking the nonlinear compressibility and nonlinear permeability of soils into consideration, the governing equation for finite strain consolidation analysis is derived. Based on the experimental data of Hangzhou soft clay samples, the new governing equation is solved with the finite element method. Afterwards, the calculation results of this new method and other two methods are compared. It can be found that Gibson’s method may underestimate the excess pore water pressure during primary consolidation. The new method which takes the secondary consolidation behavior, the nonlinear compressibility, and nonlinear permeability of soils into consideration can precisely estimate the settlement rate and the final settlement of Hangzhou soft clay sample.

  6. Secondary Analysis under Cohort Sampling Designs Using Conditional Likelihood

    Directory of Open Access Journals (Sweden)

    Olli Saarela

    2012-01-01

    Full Text Available Under cohort sampling designs, additional covariate data are collected on cases of a specific type and a randomly selected subset of noncases, primarily for the purpose of studying associations with a time-to-event response of interest. With such data available, an interest may arise to reuse them for studying associations between the additional covariate data and a secondary non-time-to-event response variable, usually collected for the whole study cohort at the outset of the study. Following earlier literature, we refer to such a situation as secondary analysis. We outline a general conditional likelihood approach for secondary analysis under cohort sampling designs and discuss the specific situations of case-cohort and nested case-control designs. We also review alternative methods based on full likelihood and inverse probability weighting. We compare the alternative methods for secondary analysis in two simulated settings and apply them in a real-data example.

  7. Secondary School Student's Attitude towards Consumer

    African Journals Online (AJOL)

    FIRST LADY

    Keywords: Consumer Education, Attitude, Home Economics, Secondary. School Students. ... Home Management taught at Senior Secondary School level. Today ..... indicate that facilities for teaching Consumer Education especially textbooks.

  8. Secondary lead production

    Energy Technology Data Exchange (ETDEWEB)

    Hollis, R.G.

    1990-10-16

    This invention is concerned with the efficient recovery of soft lead from the paste component of used automobile lead-acid storage batteries. According to the invention, a scrap which contains lead oxide, lead sulfate, and antimony in an oxidized state is processed in the following steps to recover lead. A refractory lined reaction vessel is continuously charged with the scrap, along with a reductant effective for reducing lead oxide. The charged material is melted and agitated by means of a submerged lance at 900-1150{degree}C whereby some of the lead oxide of the scrap is reduced to form molten lead. A slag layer is then formed above the molten lead, and an amount of lead oxide is maintained in the slag layer. The molten lead, now containing under 0.5 wt % of antimony, is removed, and the antimony oxide in the scrap is concentrated as oxide in the slag layer. Preferred embodiments of the invention result in the production, in a single step, of a soft lead substantially free of antimony. The slag may be subsequently treated to reduce the antimony oxide and produce a valuable antimony-lead product. Further advantages of the process are that a wet battery paste may be used as the feed without prior drying, and the process can be conducted at a temperature 100-150{degree}C lower than in previously known methods. In addition, a smaller reactor can be employed which reduces both capital cost and fuel costs. The process of the invention is illustrated by descriptions of pilot plant tests. 1 fig.

  9. Athletic Trainer Services in US Private Secondary Schools.

    Science.gov (United States)

    Pike, Alicia; Pryor, Riana R; Mazerolle, Stephanie M; Stearns, Rebecca L; Casa, Douglas J

    2016-09-01

    Availability of athletic trainer (AT) services in US secondary schools has recently been reported to be as high as 70%, but this only describes the public sector. The extent of AT coverage in private secondary school settings has yet to be investigated and may differ from the public secondary school setting for several reasons, including differences in funding sources. To determine the level of AT services in US private secondary schools and identify the reasons why some schools did not employ ATs. Concurrent mixed-methods study. Private secondary schools in the United States. Of 5414 private secondary schools, 2044 (38%) responded to the survey. School administrators responded to the survey via telephone or e-mail. This instrument was previously used in a study examining AT services among public secondary schools. Descriptive statistics provided national data. Open-ended questions were evaluated through content analysis. Of the 2044 schools that responded, 58% (1176/2044) offered AT services, including 28% (574/2040) full time, 25% (501/2042) part time, 4% (78/1918) per diem, and 20% (409/2042) from a hospital or clinic. A total of 84% (281 285/336 165) of athletes had access to AT services. Larger private secondary schools were more likely to have AT services available. Barriers to providing AT services in the private sector were budgetary constraints, school size and sports, and lack of awareness of the role of an AT. More than half of the surveyed private secondary schools in the United States had AT services available; however, only 28% had a full-time AT. This demonstrates the need for increased medical coverage to provide athletes in this setting the appropriate level of care. Budgetary concerns, size of the school and sport offerings, and lack of awareness of the role of the AT continued to be barriers in the secondary school setting.

  10. Primary versus secondary achalasia: New signs on barium esophagogram

    Science.gov (United States)

    Gupta, Pankaj; Debi, Uma; Sinha, Saroj Kant; Prasad, Kaushal Kishor

    2015-01-01

    Aim: To investigate new signs on barium swallow that can differentiate primary from secondary achalasia. Materials and Methods: Records of 30 patients with primary achalasia and 17 patients with secondary achalasia were reviewed. Clinical, endoscopic, and manometric data was recorded. Barium esophagograms were evaluated for peristalsis and morphology of distal esophageal segment (length, symmetry, nodularity, shouldering, filling defects, and “tram-track sign”). Results: Mean age at presentation was 39 years in primary achalasia and 49 years in secondary achalasia. The mean duration of symptoms was 3.5 years in primary achalasia and 3 months in secondary achalasia. False-negative endoscopic results were noted in the first instance in five patients. In the secondary achalasia group, five patients had distal esophageal segment morphology indistinguishable from that of primary achalasia. None of the patients with primary achalasia and 35% patients with secondary achalasia had a length of the distal segment approaching combined height of two vertebral bodies. None of the patients with secondary achalasia and 34% patients with primary achalasia had maximum caliber of esophagus approaching combined height of two vertebral bodies. Tertiary contractions were noted in 90% patients with primary achalasia and 24% patients with secondary achalasia. Tram-track sign was found in 55% patients with primary achalasia. Filling defects in the distal esophageal segment were noted in 94% patients with secondary achalasia. Conclusion: Length of distal esophageal segment, tertiary contractions, tram-track sign, and filling defects in distal esophageal segment are useful esophagographic features distinguishing primary from secondary achalasia. PMID:26288525

  11. Secondary control for microgrids using potential functions

    Energy Technology Data Exchange (ETDEWEB)

    Mehrizi-Sani, A.; Iravani, R. [Toronto Univ., ON (Canada)

    2009-07-01

    Issues with power grids include reliability, aging infrastructure, limited use of communications, efficiency, and low asset utilization. The smart grid involves a vision of the future electric system. Core elements of the smart grid include information technology, communication, and power electronic devices. This presentation discussed and compared the current grid with the smart grid and presented operational requirements of the microgrid. The concept of potential functions for secondary control based on availability of communication within the microgrid was introduced. The smart grid vision requires the microgrid to remain in operation even when islanded. The existing primary control does not guarantee stable islanded operation. Other topics that were discussed included primary and secondary control; proposed secondary control; the control hierarchy; and advantages and differences over conventional methods. A case study involving different scenarios was presented. It was concluded that the microgrid central controller minimizes each potential function to determine the set points of the corresponding distributed energy resources unit associated with the minimum of the potential function. tabs., figs.

  12. Modeling secondary accidents identified by traffic shock waves.

    Science.gov (United States)

    Junhua, Wang; Boya, Liu; Lanfang, Zhang; Ragland, David R

    2016-02-01

    The high potential for occurrence and the negative consequences of secondary accidents make them an issue of great concern affecting freeway safety. Using accident records from a three-year period together with California interstate freeway loop data, a dynamic method for more accurate classification based on the traffic shock wave detecting method was used to identify secondary accidents. Spatio-temporal gaps between the primary and secondary accident were proven be fit via a mixture of Weibull and normal distribution. A logistic regression model was developed to investigate major factors contributing to secondary accident occurrence. Traffic shock wave speed and volume at the occurrence of a primary accident were explicitly considered in the model, as a secondary accident is defined as an accident that occurs within the spatio-temporal impact scope of the primary accident. Results show that the shock waves originating in the wake of a primary accident have a more significant impact on the likelihood of a secondary accident occurrence than the effects of traffic volume. Primary accidents with long durations can significantly increase the possibility of secondary accidents. Unsafe speed and weather are other factors contributing to secondary crash occurrence. It is strongly suggested that when police or rescue personnel arrive at the scene of an accident, they should not suddenly block, decrease, or unblock the traffic flow, but instead endeavor to control traffic in a smooth and controlled manner. Also it is important to reduce accident processing time to reduce the risk of secondary accident. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Cancer as secondary immunodeficiency. Review

    Directory of Open Access Journals (Sweden)

    María Eugenia Vargas-Camaño

    2016-05-01

    Full Text Available The secondary immunodeficiency’s, previously presented in immunocompetent individuals. The lack of primary or secondary response to the presence of a foreign antigen, in the case of infections is a sentinel data in the diagnosis of immunodeficiency (can be primary or secondary, in the case of a self antigen may generate the presence of Cancer. Cancer has shown an increase in the prevalence and incidence globally. Most current medical treatments in cancer are focused primarily on immunomodulatory actions (immunosuppression / immune stimulation or both. Knowledge of key concepts from the perspective of innate and acquired immunity lead to cancer development, engaging immune surveillance and escape mechanisms of this that contribute to better understand the origin, behavior and treatment of neoplasm’s. These treatments can cause immunological disorders such as allergy, anaphylaxis, lack of response immunogenicity care fields specialist in Allergy and Clinical Immunology.

  14. Lipopolysaccharide (LPS) stimulation of fungal secondary metabolism

    Science.gov (United States)

    Khalil, Zeinab G.; Kalansuriya, Pabasara; Capon, Robert J.

    2014-01-01

    We report on a preliminary investigation of the use the Gram-negative bacterial cell wall constituent lipopolysaccharide (LPS) as a natural chemical cue to stimulate and alter the expression of fungal secondary metabolism. Integrated high-throughput micro-cultivation and micro-analysis methods determined that 6 of 40 (15%) of fungi tested responded to an optimal exposure to LPS (0.6 ng/mL) by activating, enhancing or accelerating secondary metabolite production. To explore the possible mechanisms behind this effect, we employed light and fluorescent microscopy in conjunction with a nitric oxide (NO)-sensitive fluorescent dye and an NO scavenger to provide evidence that LPS stimulation of fungal secondary metabolism coincided with LPS activation of NO. Several case studies demonstrated that LPS stimulation can be scaled from single microplate well (1.5 mL) to preparative (>400 mL) scale cultures. For example, LPS treatment of Penicillium sp. (ACM-4616) enhanced pseurotin A and activated pseurotin A1 and pseurotin A2 biosynthesis, whereas LPS treatment of Aspergillus sp. (CMB-M81F) substantially accelerated and enhanced the biosynthesis of shornephine A and a series of biosynthetically related ardeemins and activated production of neoasterriquinone. As an indication of broader potential, we provide evidence that cultures of Penicillium sp. (CMB-TF0411), Aspergillus niger (ACM-4993F), Rhizopus oryzae (ACM-165F) and Thanatephorus cucumeris (ACM-194F) were responsive to LPS stimulation, the latter two examples being particular noteworthy as neither are known to produce secondary metabolites. Our results encourage the view that LPS stimulation can be used as a valuable tool to expand the molecular discovery potential of fungal strains that either have been exhaustively studied by or are unresponsive to traditional culture methodology. PMID:25379339

  15. Function-related Secondary User Needs and Secondary Data

    African Journals Online (AJOL)

    Riette Ruthven

    basis of both a critical analysis of the theory and an examination of selected data types .... (2) "Secondary needs related to the user's linguistic and subject-specific ... understand the Afrikaans word skepe needs to know that skepe is the plural.

  16. Dynamic decoupling of secondary systems

    International Nuclear Information System (INIS)

    Gupta, A.K.; Tembulkar, J.M.

    1984-01-01

    The dynamic analysis of primary systems must often be performed decoupled from the secondary system. In doing so, one should assure that the decoupling does not significantly affect the frequencies and the response of the primary systems. The practice consists of heuristic algorithms intended to limit changes in the frequencies. The change in response is not considered. In this paper, changes in both the frequencies and the response are considered. Rational, but simple algorithms are derived to make accurate predictions. Material up to MDOF primary-SDOF secondary system is presented in this paper. MDOF-MDOF systems are treated in a companion paper. (orig.)

  17. Localized lesions in secondary syphillis

    International Nuclear Information System (INIS)

    Rasid, N.; Syphilis, S.

    2008-01-01

    The clinical manifestations of secondary syphilis are variable and can mimic many skin diseases, mostly being generalized and symmetrical in distribution. Localized lesions of secondary syphilis are rarely seen in dermatology clinics. We report an unusual presentation wherein a patient had localized lesions over face and soles only. There is a need for increased awareness on the part of physicians to recognize new patterns of syphilitic infection, together with a willingness to consider the diagnosis of syphilis in patients with unusual clinical features. (author)

  18. Depth resolution of secondary ion mass spectrometry

    International Nuclear Information System (INIS)

    Pustovit, A.N.

    2004-01-01

    The effect of the solid body discreteness in the direction of the normal to the sample surface on the depth resolution of the secondary ion mass spectrometry method is analyzed. It is shown that for this case the dependence of the width at the semi-height of the delta profiles of the studied elements depth distribution on the energy and angle of incidence of the initial ions should have the form of the stepwise function. This is experimentally proved by the silicon-germanium delta-layers in the silicon samples [ru

  19. Predicting Protein Secondary Structure with Markov Models

    DEFF Research Database (Denmark)

    Fischer, Paul; Larsen, Simon; Thomsen, Claus

    2004-01-01

    we are considering here, is to predict the secondary structure from the primary one. To this end we train a Markov model on training data and then use it to classify parts of unknown protein sequences as sheets, helices or coils. We show how to exploit the directional information contained...... in the Markov model for this task. Classifications that are purely based on statistical models might not always be biologically meaningful. We present combinatorial methods to incorporate biological background knowledge to enhance the prediction performance....

  20. Secondary Intracranial Hypotension: A Case Report

    Directory of Open Access Journals (Sweden)

    Pinar Gundogan Bozdag

    2014-04-01

    Full Text Available Intracranial hypotension is a clinical condition that characterized by postural (orthostatic headache and low pressure. It apperas with cerebrospinal fluid leak which occurs spontaneous or depending on the secondary attempts. 31 years old female patient which has diagnosis of acute appendicitis and underwent appendectomy under spinal anesthesia. postoperative 5.day she admitted with a postural headache, diplopia. Patient was treated with conservative methods after diagnosed with magnetic resonance imaging. We aim to asses an encountered complication after spinal anesthesia which widely applied for surgical procedures with imaging findings and literature.

  1. Review of RSG-GAS secondary cooling pump performance

    International Nuclear Information System (INIS)

    Marsahala, Y.B.

    1999-01-01

    The control system of RSG-GAS secondary pump is the study for the operation existence of RSG-GAS secondary pump. The research is about characteristic of the secondary pump and its control system. The measuring of characteristic parameter of secondary cooling pump was being done while the pump running. The pump was loading with capacity 1950 m3/hr. with ambient temperature 28.5 oC. The fault effect of public grid (PLN) such as the fluctuation of both voltage and frequency likes voltage drops (dip). Supply block out that effect of the electric motor performances directly will be analyzed. How far those faults will effect the overall performance of secondary cooling system. Analyzing. Will be done according to the control system was installed. Has be done to find the direct effects of the motor performances against the motor rotation fluctuation which run from 1450 rpm to 1475 rpm. The using of start-delta starting method with delay time about 6 seconds, is enough or not to reduce the inrush starting current also analyzed in this paper. From the research can be obtained that in the steady state condition , the electric motor runs with both power and current are still under tolerances permitted. According to the analyzed data above, it will be consider that the control system of secondary pump would be modified or not. Therefore the analyzed data can show the characteristic curve of the secondary cooling system performance

  2. Direct laser initiation of open secondary explosives

    International Nuclear Information System (INIS)

    Assovskiy, I G; Melik-Gaikazov, G V; Kuznetsov, G P

    2015-01-01

    The goal of this paper is experimental study of the mechanism of initiation of secondary explosives (SE) by short laser pulse. Laser initiation of SE is much more difficult in comparison with initiation of primary explosives. Using of some special methods is typically requested to realize laser initiation of SE: using of porous SE, putting it in a closed envelope, and using some optically dense additives. In this paper we consider interaction of laser pulse with open surface of non-porous, optically uniform SE. Only pure chemical methods were used to control the light sensitivity of SE. Implementation of the method of laser initiation is reduced to the optimization of composition and molecular structure of the explosives, along with the optimization of the laser pulse (its duration, energy density and wavelength). (paper)

  3. Guidelines for secondary analysis in search of response shift

    NARCIS (Netherlands)

    Schwartz, Carolyn E.; Ahmed, Sara; Sawatzky, Richard; Sajobi, Tolulope; Mayo, Nancy; Finkelstein, Joel; Lix, Lisa; Verdam, Mathilde G. E.; Oort, Frans J.; Sprangers, Mirjam A. G.

    2013-01-01

    Response shift methods have developed substantially in the past decade, with a notable emphasis on model-based methods for response shift detection that are appropriate for the analysis of existing data sets. These secondary data analyses have yielded useful insights and motivated the continued

  4. Guidelines for secondary analysis in search of response shift

    NARCIS (Netherlands)

    Schwartz, C.E.; Ahmed, S.; Sawatzky, R.; Sajobi, T.; Mayo, N.; Finkelstein, J.; Verdam, M.G.E.; Oort, F.J.; Sprangers, M.A.G.

    2013-01-01

    Objective: Response shift methods have developed substantially in the past decade, with a notable emphasis on model-based methods for response shift detection that are appropriate for the analysis of existing data sets. These secondary data analyses have yielded useful insights and motivated the

  5. 34 CFR 300.36 - Secondary school.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 2 2010-07-01 2010-07-01 false Secondary school. 300.36 Section 300.36 Education... DISABILITIES General Definitions Used in This Part § 300.36 Secondary school. Secondary school means a nonprofit institutional day or residential school, including a public secondary charter school that provides...

  6. Evaluation of an Improved Branch-Site Likelihood Method for Detecting Positive Selection at the Molecular Level

    DEFF Research Database (Denmark)

    Zhang, Jianzhi; Nielsen, Rasmus; Yang, Ziheng

    2005-01-01

    of interest, while test 2 had acceptable false-positive rates and appeared robust against violations of model assumptions. As test 2 is a direct test of positive selection on the lineages of interest, it is referred to as the branch-site test of positive selection and is recommended for use in real data......Detecting positive Darwinian selection at the DNA sequence level has been a subject of considerable interest. However, positive selection is difficult to detect because it often operates episodically on a few amino acid sites, and the signal may be masked by negative selection. Several methods have...... been developed to test positive selection that acts on given branches (branch methods) or on a subset of sites (site methods). Recently, Yang, Z., and R. Nielsen (2002. Codon-substitution models for detecting molecular adaptation at individual sites along specific lineages. Mol. Biol. Evol. 19...

  7. Primary expectations of secondary metabolites

    Science.gov (United States)

    My program examines the plant secondary metabolites (i.e. phenolics) important for human health, and which impart the organoleptic properties that are quality indicators for fresh and processed foods. Consumer expectations such as appearance, taste, or texture influence their purchasing decisions; a...

  8. Secondary syphilis presenting as vertigo

    International Nuclear Information System (INIS)

    Bari, A.U.; Mehmood, T.; Khan, B.; Malik, N.; Malik, K.Z.; Sukhera, A.M.

    2006-01-01

    Syphilis is a chronic, systemic and sexually transmitted infectious disease affecting most of the organs in the body. A young African man presented with vertigo, unsteadiness of gait and a skin rash suggestive of secondary syphilis. Diagnosis was confirmed on serology and was treated with two shots of long-acting penicillin, following which his symptoms settled. (author)

  9. Hydrocephalus secondary to subarachnoid hemorrhage

    International Nuclear Information System (INIS)

    Koga, Nobunori; Nakamura, Saburo; Kushi, Hidehiko; Yamamoto, Takamitsu; Tsubokawa, Takashi; Moriyasu, Nobuo

    1982-01-01

    The relationship between the extension and severity of subarachnoid hemorrhage, as demonstrated by computed tomography (CT), and hydrocephalus secondary to subarachnoid hemorrhage was studied. In 94 cases with subarachnoid hemorrhage, as analyzed by CT scan performed within 7 days after onset, high-density areas in the subarachnoid space were recognized in 61 cases (64%) and secondary hydrocephalus occurred in 22 cases (23%). 17 cases died within 2 weeks, before the occurrence of the hydrocephalus. The CT findings of subarachnoid hemorrhage was classified into 5 types, according to its severity and extension; especially the degree of high density in the basal cistern and/or cisterns around the brain stem was remarked. Secondary hydrocephalus after subarachnoid hemorrhage was observed in 90% of the cases; they had a density higher than a CT number of 60 in the basal cistern and/or cisterns around the brain stem (Type V). The mean interval between the onset of subarachnoid hemorrhage and the appearance of hydrocephalus was 20.6 days. We conclude that a significantly high density of extravasated blood in the subarachnoid space, especially in the basal cistern and/or the cisterns around the brain stem, can be predictive of secondary hydrocephalus after subarachnoid hemorrhage. (author)

  10. Teacher's Guide to Secondary Mathematics.

    Science.gov (United States)

    Duval County Schools, Jacksonville, FL.

    This is a teacher's guide to secondary school mathematics. Developed for use in the Duval County Public Schools, Jacksonville, Florida. Areas of mathematics covered are algebra, analysis, calculus, computer literacy, computer science, geometry, analytic geometry, general mathematics, consumer mathematics, pre-algebra, probability and statistics,…

  11. Portugal's Secondary School Modernisation Programme

    Science.gov (United States)

    Heitor, Teresa V.; Freire da Silva, Jose M. R.

    2009-01-01

    The aim of the Secondary School Modernisation Programme, being implemented in Portugal by "Parque Escolar, EPE", is based on the pursuit of quality and makes Portuguese education a potential international benchmark. This paper discusses the strategies adopted to reorganise school spaces. It describes the conceptual model and highlights…

  12. The Global Contribution of Secondary Craters on the Icy Satellites

    Science.gov (United States)

    Hoogenboom, T.; Johnson, K. E.; Schenk, P.

    2014-12-01

    At present, surface ages of bodies in the Outer Solar System are determined only from crater size-frequency distributions (a method dependent on an understanding of the projectile populations responsible for impact craters in these planetary systems). To derive accurate ages using impact craters, the impactor population must be understood. Impact craters in the Outer Solar System can be primary, secondary or sesquinary. The contribution of secondary craters to the overall population has recently become a "topic of interest." Our objective is to better understand the contribution of dispersed secondary craters to the small crater populations, and ultimately that of small comets to the projectile flux on icy satellites in general. We measure the diameters of obvious secondary craters (determined by e.g. irregular crater shape, small size, clustering) formed by all primary craters on Ganymede for which we have sufficiently high resolution data to map secondary craters. Primary craters mapped range from approximately 40 km to 210 km. Image resolution ranges from 45 to 440 m/pixel. Bright terrain on Ganymede is our primary focus. These resurfaced terrains have relatively low crater densities and serve as a basis for characterizing secondary populations as a function of primary size on an icy body for the first time. Although focusing on Ganymede, we also investigate secondary crater size, frequency, distribution, and formation, as well as secondary crater chain formation on icy satellites throughout the Saturnian and Jovian systems principally Rhea. We compare our results to similar studies of secondary cratering on the Moon and Mercury. Using Galileo and Voyager data, we have identified approximately 3,400 secondary craters on Ganymede. In some cases, we measured crater density as a function of distance from a primary crater. Because of the limitations of the Galileo data, it is necessary to extrapolate from small data sets to the global population of secondary craters

  13. SECONDARY OSTEOARTHRITIS IN RHEUMATOID ARTHRITIS

    Directory of Open Access Journals (Sweden)

    I. A. Starodubtseva

    2015-01-01

    Full Text Available The paper considers the problems of comorbidities in patients with rheumatoid arthritis (RA. Two or more RA-related conditions were diagnosed according to the results of the QUEST-RA program implemented in 34 countries. Osteoarthritis along with hypertension, hyperlipidemia, and osteoporosis was detected among the most commonly diseases. Owing to expanded diagnostic capabilities, the recognition and treatment of the comorbidities have recently received much attention, as embodied in the draft Association of Rheumatologists of Russia Guidelines for RA management (2014; Part 1. The concept and major characteristics of secondary osteoarthritis in RA are analyzed. It is precisely the inflammatory process and underlying disease-related risk factors, including treatment, that have impact on the development of secondary osteoarthritis and patients’ quality of life as a whole. All this allows an inference about the mechanisms closely intertwined with the underlying disease for the development of secondary osteoarthritis, which initiates cartilage damage and further remodeling. Primary and secondary osteoarthritis was comparatively analyzed. Particular emphasis is placed on current cartilage biomarkers, their diagnostic value and role in monitoring the efficiency of treatment in clinical trials. The paper provides a comparative analysis of detectable serum and urine biomarkers according to the results of the complex analysis made by the National Institutes of Health. Particular attention is given to cartilage oligomeric matrix protein (COMP. Foreign authors’ investigations suggest that there is a relationship between serum COMP levels and disease severity and joint X-ray changes. There is evidence for the efficacy of hyaluronic acid used in the treatment of secondary osteoarthritis in patients with RA. 

  14. Flash Points of Secondary Alcohol and n-Alkane Mixtures.

    Science.gov (United States)

    Esina, Zoya N; Miroshnikov, Alexander M; Korchuganova, Margarita R

    2015-11-19

    The flash point is one of the most important characteristics used to assess the ignition hazard of mixtures of flammable liquids. To determine the flash points of mixtures of secondary alcohols with n-alkanes, it is necessary to calculate the activity coefficients. In this paper, we use a model that allows us to obtain enthalpy of fusion and enthalpy of vaporization data of the pure components to calculate the liquid-solid equilibrium (LSE) and vapor-liquid equilibrium (VLE). Enthalpy of fusion and enthalpy of vaporization data of secondary alcohols in the literature are limited; thus, the prediction of these characteristics was performed using the method of thermodynamic similarity. Additionally, the empirical models provided the critical temperatures and boiling temperatures of the secondary alcohols. The modeled melting enthalpy and enthalpy of vaporization as well as the calculated LSE and VLE flash points were determined for the secondary alcohol and n-alkane mixtures.

  15. LOCAL SITE CONDITIONS INFLUENCING EARTHQUAKE INTENSITIES AND SECONDARY COLLATERAL IMPACTS IN THE SEA OF MARMARA REGION - Application of Standardized Remote Sensing and GIS-Methods in Detecting Potentially Vulnerable Areas to Earthquakes, Tsunamis and Other Hazards.

    Directory of Open Access Journals (Sweden)

    George Pararas-Carayannis

    2011-01-01

    Full Text Available The destructive earthquake that struck near the Gulf of Izmit along the North Anatolian fault in Northwest Turkey on August 17, 1999, not only generated a local tsunami that was destructive at Golcuk and other coastal cities in the eastern portion of the enclosed Sea of Marmara, but was also responsible for extensive damage from collateral hazards such as subsidence, landslides, ground liquefaction, soil amplifications, compaction and underwater slumping of unconsolidated sediments. This disaster brought attention in the need to identify in this highly populated region, local conditions that enhance earthquake intensities, tsunami run-up and other collateral disaster impacts. The focus of the present study is to illustrate briefly how standardized remote sensing techniques and GIS-methods can help detect areas that are potentially vulnerable, so that disaster mitigation strategies can be implemented more effectively. Apparently, local site conditions exacerbate earthquake intensities and collateral disaster destruction in the Marmara Sea region. However, using remote sensing data, the causal factors can be determined systematically. With proper evaluation of satellite imageries and digital topographic data, specific geomorphologic/topographic settings that enhance disaster impacts can be identified. With a systematic GIS approach - based on Digital Elevation Model (DEM data - geomorphometric parameters that influence the local site conditions can be determined. Digital elevation data, such as SRTM (Shuttle Radar Topography Mission, with 90m spatial resolution and ASTER-data with 30m resolution, interpolated up to 15 m is readily available. Areas with the steepest slopes can be identified from slope gradient maps. Areas with highest curvatures susceptible to landslides can be identified from curvature maps. Coastal areas below the 10 m elevation susceptible to tsunami inundation can be clearly delineated. Height level maps can also help locate

  16. Building a secondary containment system

    Energy Technology Data Exchange (ETDEWEB)

    Broder, M.F.

    1994-10-01

    Retail fertilizer and pesticide dealers across the United States are installing secondary containment at their facilities or are seriously considering it. Much of this work is in response to new state regulations; however, many dealers not facing new regulations are upgrading their facilities to reduce their liability, lower their insurance costs, or comply with anticipated regulations. The Tennessee Valley Authority`s (TVA) National Fertilizer and Environmental Research Center (NFERC) has assisted dealers in 22 states in retrofitting containment to their facilities. Simultaneous improvements in the operational efficiency of the facilities have been achieved at many of the sites. This paper is based on experience gained in that work and details the rationale used in planning secondary containment and facility modifications.

  17. Racemization of enantiopure secondary alcohols by Thermoanaerobacter ethanolicus secondary alcohol dehydrogenase

    KAUST Repository

    Musa, Musa M.

    2013-01-01

    Controlled racemization of enantiopure phenyl-ring-containing secondary alcohols is achieved in this study using W110A secondary alcohol dehydrogenase from Thermoanaerobacter ethanolicus (W110A TeSADH) and in the presence of the reduced and oxidized forms of its cofactor nicotinamide-adenine dinucleotide. Racemization of both enantiomers of alcohols accepted by W110A TeSADH, not only with low, but also with reasonably high, enantiomeric discrimination is achieved by this method. Furthermore, the high tolerance of TeSADH to organic solvents allows TeSADH-catalyzed racemization to be conducted in media containing up to 50% (v/v) of organic solvents. © 2013 The Royal Society of Chemistry.

  18. Uranium resource processing. Secondary resources

    International Nuclear Information System (INIS)

    Gupta, C.K.; Singh, H.

    2003-01-01

    This book concentrates on the processing of secondary sources for recovering uranium, a field which has gained in importance in recent years as it is environmental-friendly and economically in tune with the philosophy of sustainable development. Special mention is made of rock phosphate, copper and gold tailings, uranium scrap materials (both natural and enriched) and sea water. This volume includes related area of ore mineralogy, resource classification, processing principles involved in solubilization followed by separation and safety aspects

  19. Secondary middle turbinate: case report

    Energy Technology Data Exchange (ETDEWEB)

    Aburjeli, Bruna de Oliveira Melim; Avila, Ana Flavia Assis de; Diniz, Renata Lopes Furletti Caldeira; Motta, Emilia Guerra Pinto Coelho; Ribeiro, Marcelo Almeida; Moreira, Wanderval, E-mail: bruninha86@hotmail.com [Radiology and Imaging Diagnosis, Hospital Mater Dei, Belo Horizonte, MG (Brazil)

    2012-11-15

    Secondary middle turbinate is an anatomical variant rarely observed in the nasal cavity, firstly described by Khanobthamchai et al. as a bone structure originating from the lateral nasal wall and covered by soft tissue. In most cases reported in the literature, this variant is bilateral, occurring without associated complications. In the present report, the authors describe the case of patient of their institution with such anatomical variation. (author)

  20. Monoparesis secondary to herpes zoster.

    LENUS (Irish Health Repository)

    Bilal, S

    2011-06-01

    We describe a 90-year-old woman with right upper limb monoparesis secondary to varicella zoster virus infection as a result of extensive inflammatory involvement of the entire brachial plexus at root level. To our knowledge, this is the first report of entire brachial plexus involvement in a living patient of such advanced age. Despite a delay in presentation and thus initiation of treatment, a favourable clinical response was observed.

  1. Linear morphea with secondary mucinosis

    Directory of Open Access Journals (Sweden)

    Khandpur Sujay

    2009-01-01

    Full Text Available Secondary mucin deposition in the skin is a common feature of lupus erythematosus and dermatomyositis. In scleroderma, it occurs uncommonly or in small amount. We describe a 7-year-old boy with progressive, linear, bound-down plaques involving the thighs, lower abdomen and back with no systemic involvement. Histopathology showed features of scleroderma with abundant mucin deposition in the reticular dermis. This report highlights excessive mucin deposition in lesions of morphea.

  2. Secondary middle turbinate: case report

    International Nuclear Information System (INIS)

    Aburjeli, Bruna de Oliveira Melim; Avila, Ana Flavia Assis de; Diniz, Renata Lopes Furletti Caldeira; Motta, Emilia Guerra Pinto Coelho; Ribeiro, Marcelo Almeida; Moreira, Wanderval

    2012-01-01

    Secondary middle turbinate is an anatomical variant rarely observed in the nasal cavity, firstly described by Khanobthamchai et al. as a bone structure originating from the lateral nasal wall and covered by soft tissue. In most cases reported in the literature, this variant is bilateral, occurring without associated complications. In the present report, the authors describe the case of patient of their institution with such anatomical variation. (author)

  3. EELV Secondary Payload Adapter (ESPA)

    Science.gov (United States)

    Haskett, Scott A.; Weis, Steven C.; Doggrell, Leslie J.; Sciulli, Dino; Meink, Troy E.; Ganley, Jeff T.; Maly, Joseph R.; Jurisson, Karl

    2000-11-01

    Despite growing international interest in small satellites, high dedicated expendable launch vehicle costs and the lack of secondary launch opportunities continue to hinder the full exploitation of small satellite technology. In the United States, the Department of Defense (DoD), NASA, other government agencies, commercial companies, and many universities use small satellites to perform space experiments, demonstrate new technology, and test operational prototype hardware. In addition, the DoD continues to study the role of small satellites in fulfilling operational mission requirements. However, the US lacks sufficient small satellite launch capacity. Furthermore, US government agencies are restricted to the use of US launch vehicles, which eliminates many affordable launch opportunities. In an effort to increase the number of space experiments that can be flown with a small, fixed budget, the DoD Space Test Program (STP) has teamed with the Air Force Research Laboratory Space Vehicles Directorate (AFRL/VS) to develop a low-cost solution for the small satellite launch program. Our solution, which can be implemented on both Boeing and Lockheed-Martin Evolved Expendable Launch Vehicle-Medium (EELV-M) boosters, is called the EELV Secondary Payload Adaptor (ESPA). ESPA will increase the number of launch opportunities for 180kg-class (or smaller) satellites at prices highly competitive with other secondary launch services worldwide.

  4. Advances in ambient temperature secondary lithium cells

    Science.gov (United States)

    Subbarao, S.; Shen, D. H.; Deligiannis, F.; Huang, C-K.; Halpert, G.

    1989-01-01

    The Jet Propulsion Laboratory is involved in a Research and Development program sponsored by NASA/OAST on the development of ambient temperature secondary lithium cells for future space applications. Some of the projected applications are planetary spacecraft, planetary rovers, and astronaut equipment. The main objective is to develop secondary lithium cells with greater than 100 Wh/kg specific energy while delivering 1000 cycles at 50 percent Depth of Discharge (DOD). To realize these ambitious goals, the work was initially focused on several important basic issues related to the cell chemistry, selection of cathode materials and electrolytes, and component development. The performance potential of Li-TiS2, Li-MoS3, Li-V6O13 and Li-NbSe3 electrochemical systems was examined. Among these four, the Li-TiS2 system was found to be the most promising system in terms of realizable specific energy and cycle life. Some of the major advancements made so far in the development of Li-TiS2 cells are in the areas of cathode processing technology, mixed solvent electrolytes, and cell assembly. Methods were developed for the fabrication of large size high performance TiS2 cathodes. Among the various electrolytes examined, 1.5M LiAsF6/EC + 2-MeTHF mixed solvent electrolyte was found to be more stable towards lithium. Experimental cells activated with this electrolyte exhibited more than 300 cycles at 100 percent Depth of Discharge. Work is in progress in other areas such as selection of lithium alloys as candidate anode materials, optimization of cell design, and development of 5 Ah cells. The advances made at the Jet Propulsion Laboratory on the development of secondary lithium cells are summarized.

  5. Spitzer secondary eclipses of Qatar-1b

    Science.gov (United States)

    Garhart, Emily; Deming, Drake; Mandell, Avi; Knutson, Heather; Fortney, Jonathan J.

    2018-02-01

    Aims: Previous secondary eclipse observations of the hot Jupiter Qatar-1b in the Ks band suggest that it may have an unusually high day side temperature, indicative of minimal heat redistribution. There have also been indications that the orbit may be slightly eccentric, possibly forced by another planet in the system. We investigate the day side temperature and orbital eccentricity using secondary eclipse observations with Spitzer. Methods: We observed the secondary eclipse with Spitzer/IRAC in subarray mode, in both 3.6 and 4.5 μm wavelengths. We used pixel-level decorrelation to correct for Spitzer's intra-pixel sensitivity variations and thereby obtain accurate eclipse depths and central phases. Results: Our 3.6 μm eclipse depth is 0.149 ± 0.051% and the 4.5 μm depth is 0.273 ± 0.049%. Fitting a blackbody planet to our data and two recent Ks band eclipse depths indicates a brightness temperature of 1506 ± 71 K. Comparison to model atmospheres for the planet indicates that its degree of longitudinal heat redistribution is intermediate between fully uniform and day-side only. The day side temperature of the planet is unlikely to be as high (1885 K) as indicated by the ground-based eclipses in the Ks band, unless the planet's emergent spectrum deviates strongly from model atmosphere predictions. The average central phase for our Spitzer eclipses is 0.4984 ± 0.0017, yielding e cos ω = -0.0028 ± 0.0027. Our results are consistent with a circular orbit, and we constrain e cos ω much more strongly than has been possible with previous observations. Tables of the lightcurve data are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/610/A55

  6. ncRNA consensus secondary structure derivation using grammar strings.

    Science.gov (United States)

    Achawanantakun, Rujira; Sun, Yanni; Takyar, Seyedeh Shohreh

    2011-04-01

    Many noncoding RNAs (ncRNAs) function through both their sequences and secondary structures. Thus, secondary structure derivation is an important issue in today's RNA research. The state-of-the-art structure annotation tools are based on comparative analysis, which derives consensus structure of homologous ncRNAs. Despite promising results from existing ncRNA aligning and consensus structure derivation tools, there is a need for more efficient and accurate ncRNA secondary structure modeling and alignment methods. In this work, we introduce a consensus structure derivation approach based on grammar string, a novel ncRNA secondary structure representation that encodes an ncRNA's sequence and secondary structure in the parameter space of a context-free grammar (CFG) and a full RNA grammar including pseudoknots. Being a string defined on a special alphabet constructed from a grammar, grammar string converts ncRNA alignment into sequence alignment. We derive consensus secondary structures from hundreds of ncRNA families from BraliBase 2.1 and 25 families containing pseudoknots using grammar string alignment. Our experiments have shown that grammar string-based structure derivation competes favorably in consensus structure quality with Murlet and RNASampler. Source code and experimental data are available at http://www.cse.msu.edu/~yannisun/grammar-string.

  7. Clinical presentation and treatment of primary and secondary paranasal mucoceles

    Directory of Open Access Journals (Sweden)

    Jih-Chin Lee

    2014-01-01

    Full Text Available Background: This retrospective study was conducted to describe and compare the clinical characteristics of primary mucoceles occurring in patients without a previous history of sinus surgery, the cause of mucoceles and secondary mucoceles resulting as a complication following endoscopic sinus surgery, and the Caldwell-Luc operation. Materials and Methods: This study reviewed 18 cases of primary mucoceles and 21 cases of secondary mucoceles, who were diagnosed and had received surgical intervention between 1995 and 2012. Results: The most common presenting symptoms in primary mucoceles were: Visual disturbance (18.6%, nasal obstruction (12.5%, and headache (12.5%. In secondary mucoceles, the most common symptoms were: Nasal obstruction (27.5%, rhinorrhea (15%, and postnasal drip (12.5%. The most common sites of origin for primary mucoceles were the ethmoid sinus (31.5% and sphenoid sinus (31.5%. In secondary mucoceles, the maxillary sinus was the most common site of origin (40.7%, followed by the ethmoid sinus (29.6%. All patients with secondary mucoceles had a history of sinus surgery. Conclusions: Mucoceles are benign lesions of the paranasal sinus. Cases of secondary mucoceles that occur following sinus endoscopic surgery develop more frequently in the ethmoid sinus compared to those following the Caldwell-Luc procedure. Endoscopic intranasal surgery of mucoceles is a reliable therapeutic measure with a favorable long-term outcome.

  8. Shroud cutting techniques and collection systems for secondary radioactivity release

    International Nuclear Information System (INIS)

    Yokoi, H.; Watanabe, A.; Uetake, N.; Shimura, T.; Omote, T.; Adachi, H.; Murakami, S.; Kobayashi, H.; Gotoh, M.

    2001-01-01

    Replacement of in-core shroud has been conducted as part of the preventive maintenance program in Tsuruga-1. The EDM (electric discharged machining) and plasma cutting methods were applied to in-core shroud cutting and secondary cutting in the DSP (dryer/separator pool), respectively. The cutting systems were improved in order to decrease radioactive secondary products. 1) Fundamental EDM cutting tests: fundamental EDM cutting tests were carried out in order to study secondary products. It could be presumed that volatile Co-carbonyl compound was generated by using a carbon electrode. The Ag/W electrode was effective as EDM electrode for in-core shroud cutting to prevent generation of Co-carbonyl compound and to decrease the total amount of secondary products. 2) In-core shroud cutting in RPV (reactor pressure vessel): EDM cutting system with the Ag/W electrode and collection system could keep a good environment during in-core shroud cutting in Tsuruga-1. Activity concentration was lower value than limitation of mask charge level, 4E-6 Bq/cm 3 , even near the water surface. 3) Secondary plasma cutting in DSP: the secondary cutting work was successful in the point of reduction of working period and radiation exposure. The amount of radiation exposure was reduced to 60% of the planned value, because of adequate decontamination of the working environment and reduction of number of torch maintenance tasks by improvements of the underwater cutting device

  9. [Thinking of study on secondary development of major traditional Chinese medicine varieties based on system theory].

    Science.gov (United States)

    Cheng, Xu-Dong; Jia, Xiao-Bin; Feng, Liang; Jiang, Jun

    2013-12-01

    The secondary development of traditional Chinese medicines (TCMs) is an important content of TCM modernization process, as well as an important path for developing new TCM drugs. Under the guidance of the system theory, in response to the lack of the overall guideline and practical methods for the secondary development of TCMs at present, we introduced the overall thought of the secondary development of major TCM varieties, as well as the roles and contents of clinical research, pharmacology and pharmaceutics in the process of the secondary development of major TCM varieties, so as to provide systematic strategies and methods for the development of major TCM varieties.

  10. Secondary effects of glyphosate on plants

    Science.gov (United States)

    Glyphosate is a unique herbicide with interesting secondary effects. Unfortunately, some have assumed that the secondary effects that occur in glyphosate-susceptible plants treated with glyphosate, such as altered mineral nutrition, reduced phenolic compound production and pathogen resistance, also ...

  11. Secondary Containers and Service Containers for Pesticides

    Science.gov (United States)

    Secondary containers and service containers are used by pesticide applicators in the process of applying a pesticide. EPA does not require secondary containers or service containers to be labeled or to meet particular construction standards. Learn more.

  12. Secondary Analysis for Results Tracking Database

    Data.gov (United States)

    US Agency for International Development — The Secondary Analysis and Results Tracking (SART) activity provides support for the development of two databases to manage secondary and third-party data, data...

  13. Ergonomics and safety in secondary wood processing

    Science.gov (United States)

    Rado Gazo; James D. McGlothlin; Yuehwern, Wiedenbeck, Jan Yih; Yuehwern Yih

    2002-01-01

    The main goal of the project was to initiate a pilot program in ergonomics for the secondary wood products industry. Case studies were conducted at three Midwest secondary wood product companies in 2000 and 2001.

  14. Secondary Highway Lines, US, 2015, NAVTEQ

    Data.gov (United States)

    U.S. Environmental Protection Agency — NAVTEQ Secondary Highways for the United States. The Secondary Highways layer contains Road Network features based on the Functional Class value on each link present...

  15. Obesity among secondary school students in Bahrain.

    Science.gov (United States)

    Musaiger, A O; Matter, A M; Alekri, S A; Mahdi, A R

    1993-01-01

    The aim of this study is to estimate the prevalence of obesity and factors associated with it in Bahraini secondary school students. A cross-sectional study involving a sample of 825 students (417 boys and 408 girls) aged 15 to 21 years was obtained from secondary schools. Obesity was determined using body mass index (BMI = Wt/Ht2). The findings revealed that 15.6% of boys and 17.4% of girls were either overweight or obese (BMI > or = 25). Family size, parents education, and family history of obesity were significantly associated with obesity among boys, while family history was the only socio-economic factors statistically associated with obesity among girls. Meal patterns such as eating between meals, number of meals per day, and method of eating were not associated with obesity in students. Boys who ate alone were 3 times more likely to be obese than those who ate with family members (odd ratio = 3.4). Measures to prevent and control obesity among children are suggested.

  16. An Inclusive Secondary School in Bratislava

    Directory of Open Access Journals (Sweden)

    Gajdošová Eva

    2016-12-01

    Full Text Available The study presents a characterization of an inclusive secondary school in Bratislava and provides information about the forms and methods used in the work of the teachers, school psychologists, special teachers with regard to students with special needs (students with Attention and Hyperactivity Disorder, i.e. ADHD, with learning difficulties, with emotional and behaviour difficulties, etc., who are educated together with mainstream students. It also provides information on the first results of the measurements of the socio-emotional health of the students in the inclusive school, both as to its overall level (covitality index and as to the level of the four psychological dimensions of mental health. The pilot project of the inclusive school confirms that inclusive secondary schools and inclusive education operating within the intentions of positive psychology help the students to develop their cognitive and socio-emotional competences, to create favourable attitudes to diversity, to form the students’ scale of positive values and to encourage positive interpersonal relationships, social cohesion and social classroom climate.

  17. Primary and secondary prevention of breast cancer.

    Science.gov (United States)

    Kolak, Agnieszka; Kamińska, Marzena; Sygit, Katarzyna; Budny, Agnieszka; Surdyka, Dariusz; Kukiełka-Budny, Bożena; Burdan, Franciszek

    2017-12-23

    Breast cancer is the most common cancer among women and is the second cancer frequently occurring worldwide of newly-diagnosed cancers. There is much evidence showing the influence of life style and environmental factors on the development of mammary gland cancer (high-fat diet, alcohol consumption, lack of physical exercise), the elimination of which (primary prevention) may contribute to a decrease in morbidity and mortality. Secondary prevention, comprising diagnostic tests (e.g. mammography, ultrasonography, magnetic resonance imaging, breast self-examination, as well as modern and more precise imaging methods) help the early detection of tumours or lesions predisposing to tumours. The aim of this study paper is to review current knowledge and reports regarding primary and secondary prevention of breast cancer. It is estimated that nearly 70% of malign tumours are caused by environmental factors, whereas in breast cancer this percentage reaches 90-95%. There are national programmes established in many countries to fight cancer, where both types of prevention are stressed as serving to decrease morbidity and mortality due to cancers. Cancer prevention is currently playing a key role in the fight against the disease. Behaviour modification, as well as greater awareness among women regarding breast cancer, may significantly contribute towards reducing the incidence of this cancer. Another important aspect is the number of women undergoing diagnostic tests, which still remains at an unsatisfactory level.

  18. Secondary Syphilis: Uncommon Manifestations a Common Disease

    OpenAIRE

    McPhee, Stephen J.

    1984-01-01

    Reports of cases of primary and secondary syphilis are increasing in the United States, particularly in urban areas and among homosexual men. While primary syphilis poses little diagnostic difficulty, many physicians are unfamiliar with the multisystem nature of secondary lues. Patients who have secondary syphilis commonly present with systemic signs, skin rash, mucous membrane lesions and generalized adenopathy. Less commonly, secondary syphilis may occur as acute meningitis, sensorineural h...

  19. Prediction of RNA secondary structure using generalized centroid estimators.

    Science.gov (United States)

    Hamada, Michiaki; Kiryu, Hisanori; Sato, Kengo; Mituyama, Toutai; Asai, Kiyoshi

    2009-02-15

    Recent studies have shown that the methods for predicting secondary structures of RNAs on the basis of posterior decoding of the base-pairing probabilities has an advantage with respect to prediction accuracy over the conventionally utilized minimum free energy methods. However, there is room for improvement in the objective functions presented in previous studies, which are maximized in the posterior decoding with respect to the accuracy measures for secondary structures. We propose novel estimators which improve the accuracy of secondary structure prediction of RNAs. The proposed estimators maximize an objective function which is the weighted sum of the expected number of the true positives and that of the true negatives of the base pairs. The proposed estimators are also improved versions of the ones used in previous works, namely CONTRAfold for secondary structure prediction from a single RNA sequence and McCaskill-MEA for common secondary structure prediction from multiple alignments of RNA sequences. We clarify the relations between the proposed estimators and the estimators presented in previous works, and theoretically show that the previous estimators include additional unnecessary terms in the evaluation measures with respect to the accuracy. Furthermore, computational experiments confirm the theoretical analysis by indicating improvement in the empirical accuracy. The proposed estimators represent extensions of the centroid estimators proposed in Ding et al. and Carvalho and Lawrence, and are applicable to a wide variety of problems in bioinformatics. Supporting information and the CentroidFold software are available online at: http://www.ncrna.org/software/centroidfold/.

  20. Secondary Emission Calorimeter Sensor Development

    Science.gov (United States)

    Winn, David R.; Onel, Yasar

    2012-12-01

    In a Secondary Emission electron(SEe) detector module, Secondary Emission electrons (SEe) are generated from an SE surface/cathode, when charged hadronic or electromagnetic particles, particularly shower particles, penetrate an SE sampling module placed between absorber materials (Fe, Cu, Pb, W etc) in calorimeters. The SE cathode is a thin (10-50 nm thick) film (simple metal-oxides, or other higher yield materials) on the surface of a metal plate, which serves as the entrance “window” to a compact vacuum vessel (metal or metal-ceramic); this SE film cathode is analogous to a photocathode, and the SEe are similar to p.e., which are then amplified by dynodes, also is in a PMT. SE sensor modules can make use of electrochemically etched/machined or laser-cut metal mesh dynode sheets, as large as ~30 cm square, to amplify the Secondary Emission Electrons (SEe), much like those that compact metal mesh or mesh dynode PMT's use to amplify p.e.'s. The construction requirements easier than a PMT, since the entire final assembly can be done in air; there are no critical controlled thin film depositions, cesiation or other oxygen-excluded processes or other required vacuum activation, and consequently bake-out can be a refractory temperatures; the module is sealed by normal vacuum techniques (welding or brazing or other high temperature joinings), with a simple final heated vacuum pump-out and tip-off. The modules envisioned are compact, high gain, high speed, exceptionally radiation damage resistant, rugged, and cost effective, and can be fabricated in arbitrary tileable shapes. The SE sensor module anodes can be segmented transversely to sizes appropriate to reconstruct electromagnetic cores with high precision. The GEANT4 and existing calorimeter data estimated calorimeter response performance is between 35-50 Secondary Emission electrons per GeV, in a 1 cm thick Cu absorber calorimeter, with a gain per SEe > 105 per SEe, and an e/pi<1.2. The calorimeter pulse width is

  1. Intestinal Lymphangiectasia Secondary to Neuroblastoma

    Directory of Open Access Journals (Sweden)

    RM Reifen

    1994-01-01

    Full Text Available An eight month-old infant presented with a 10-day history of vomiting and diarrhea, and a one-week history of swelling of the lower extremities. Laboratory evaluations revealed hypoproteinemia and lymphocytopenia due to protein-losing enteropathy. Peroral small bowel biopsy showed intestinal lymphangiectasia. Subsequent onset of unexplained ecchymosis and obstructive jaundice resulted in additional studies which revealed an omental neuroblastoma as the underlying etiology of the infant’s symptoms. This report emphasizes the importance of considering secondary, obstructive causes for lymphangiectasia and protein-losing enteropathy.

  2. Fahr's Syndrome and Secondary Hypoparathyroidism.

    Science.gov (United States)

    Dos Santos, Vitorino Modesta; Da Mata, Ana Medeiros De Farias; Ribeiro, Kelle Regina Alves; Calvo, Isadora Cartaxo De Sousa

    2016-01-01

    A typical case of Fahr's syndrome is described in a 76-year-old Brazilian female who underwent a total thyroidectomy three decades ago. Six years before the current admission, she started with generalized tonic-clonic seizures. Associated disorders involved extra-pyramidal, cognitive, nocturnal terror and mood changes. With suspicion of hypocalcemia due to secondary hypoparathyroidism, laboratory determinations confirmed the diagnoses. Furthermore, imaging studies of the central nervous system detected multiple calcifications, with characteristic distribution of Fahr's syndrome. Clinical management was successful.

  3. Atoms in the secondary school

    International Nuclear Information System (INIS)

    Marx, G.

    1976-01-01

    A basic nuclear physics teaching programme, at present being used in a number of Hungarian secondary schools, is described in this and a previous article (Marx. Phys. Educ.; 11: 409 (1976)). Simple notions of quantum theory and general principles of superposition and de Broglie wavelength, the uncertainty relation and the exclusion principle are used. Using these principles, teaching of concepts concerning the excited states of the hydrogen atom, Pauli's exclusion principle, ion formation, covariant bonding and the shape of molecules, are discussed. (U.K.)

  4. Secondary emission monitor (SEM) grids.

    CERN Multimedia

    Patrice Loïez

    2002-01-01

    A great variety of Secondary Emission Monitors (SEM) are used all over the PS Complex. At other accelerators they are also called wire-grids, harps, etc. They are used to measure beam density profiles (from which beam size and emittance can be derived) in single-pass locations (not on circulating beams). Top left: two individual wire-planes. Top right: a combination of a horizontal and a vertical wire plane. Bottom left: a ribbon grid in its frame, with connecting wires. Bottom right: a SEM-grid with its insertion/retraction mechanism.

  5. [Inherited primitive and secondary polycythemia].

    Science.gov (United States)

    Barba, T; Boileau, J-C; Pasquet, F; Hot, A; Pavic, M

    2016-07-01

    Myeloproliferative disorders and secondary polycythemia cover most of the polycythemia cases encountered in daily practice. Inherited polycythemias are rare entities that have to be suspected when the classical causes of acquired polycythemia have been ruled out. Recent advances were made in the understanding of these pathologies, which are still little known to the physicians. This review reports the state of knowledge and proposes an algorithm to follow when confronted to a possible case of inherited polycythemia. Copyright © 2015 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  6. NPP Krsko secondary side analysis

    International Nuclear Information System (INIS)

    Fabijan, Lj.

    1987-01-01

    The purpose of this work is to analyze secondary side thermohydraulics response on steam generator tube plugging in order to ensure nominal NPP power. We had established that the additional opening of the governing valve No. 3 and 4 can compensate pressure drop caused by steam generator tube plugging. Two main steam flows with four governing valves were simulated. Steam expansion in turbine and feed water system was modeled separately. All important process point and steam moisture changes impact on nominal NPP power were analysed. (author)

  7. Secondary Hyperparathyroidism in Heart Failure.

    Science.gov (United States)

    Morsy, Mohamed S; Dishmon, Dwight A; Garg, Nadish; Weber, Karl T

    2017-10-01

    Secondary hyperparathyroidism (SHPT) is a well-known pathophysiologic feature of chronic renal failure. In recent years, SHPT has become recognized as a complication of the aldosteronism associated with congestive heart failure and where excretory Ca 2+ and Mg 2+ wasting results in plasma-ionized hypocalcemia and hypomagnesemia. Elevations in plasma parathyroid hormone have adverse systemic consequences, including intracellular Ca 2+ overloading of myocytes and vascular smooth muscle with the induction of oxidative stress. Herein, we briefly review the presence and adverse outcomes of SHPT in persons with heart failure. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

  8. 40 CFR 133.102 - Secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Secondary treatment. 133.102 Section... TREATMENT REGULATION § 133.102 Secondary treatment. The following paragraphs describe the minimum level of effluent quality attainable by secondary treatment in terms of the parameters—BOD5, SS and pH. All...

  9. Rheumatic Heart Disease Associated with Secondary Renal ...

    African Journals Online (AJOL)

    ... non-specific chronic inflammatory changes. The patient's secondary amyloidosis was presumed to be related to the long standing RHD after exclusion of other causes of secondary amyloidosis. The patient finally died due to heart failure and acute pulmonary edema. Conclusion: Long standing RHD can lead to secondary ...

  10. Job Satisfaction of Secondary Content Area Leaders

    Science.gov (United States)

    Roberts, Christine K.

    2012-01-01

    Educational researchers have examined both observed and perceived influences of the job satisfaction levels of secondary teachers and post-secondary department chairs. However, researchers have largely ignored a third group of educators: secondary Content Area Leaders (CALs). The overall satisfaction levels and the potentially influencing factors…

  11. Simple Method for Enhanced Production of Secondary Metabolites ...

    African Journals Online (AJOL)

    iict

    2013-04-10

    Apr 10, 2013 ... 2Department of Biochemistry and Biotechnology, Aurora's Degree & PG College, Chikkadpally, Hyderabad .... HPTLC is a major instrumental innovation in the field of separation .... European Communities Research Project:.

  12. Methods and compositions for improving secondary recovery of oil

    Energy Technology Data Exchange (ETDEWEB)

    Marlowe, B.; Raymond, R.L.; Douros, J.D. Jr.

    1964-12-22

    In a waterflood process, the waterflood is improved by incorporating with it a microorganism growth-inhibiting amount of a di-substituted naphthalene of the structure: wherein R and R's are substituents selected from the group consisting of (1) hydroxy, (2) hydroxyalkyl, (3) carboxy, (4) the salts of carboxy, and (5) the oxides of hydroxynaphthalene (the hydroxyalkyl and carboxy substituents each having from 1 to 6 carbon atoms). (7 claims)

  13. Porous carbonaceous electrode structure and method for secondary electrochemical cell

    Science.gov (United States)

    Kaun, Thomas D.

    1977-03-08

    Positive and negative electrodes are provided as rigid, porous carbonaceous matrices with particulate active material fixedly embedded. Active material such as metal chalcogenides, solid alloys of alkali metal or alkaline earth metals along with other metals and their oxides in particulate form are blended with a thermosetting resin and a solid volatile to form a paste mixture. Various electrically conductive powders or current collector structures can be blended or embedded into the paste mixture which can be molded to the desired electrode shape. The molded paste is heated to a temperature at which the volatile transforms into vapor to impart porosity as the resin begins to cure into a rigid solid structure.

  14. Innovative Methods of Teaching Science and Engineering in Secondary Schools

    Directory of Open Access Journals (Sweden)

    Nathan BALASUBRAMANIAN

    2006-12-01

    Full Text Available This article describes the design of an interactive learning environment to increase student achievement in middle schools by addressing students' preconceptions, and promoting purposeful social collaboration, distributed cognition, and contextual learning. The paper presents the framework that guided our design efforts to immerse all students in a progression of guided-inquiry hands-on activities. Students find compelling reasons to learn by responding to authentic science-based challenges, both in simulations and hands-on activities, based on specific instructional objectives from the national standards.

  15. The effect of reseeding methods on secondary succession during ...

    African Journals Online (AJOL)

    The Grassland biome is the most transformed biome in South Africa, with cultivation and other human impacts having the largest effect on pristine grasslands. Conversion of natural grassland to cropland agriculture destroys natural vegetation seed banks. When croplands on the South African Highveld are abandoned, ...

  16. Sexual Abuse among Female Secondary School Students in Jos ...

    African Journals Online (AJOL)

    Background: Female sexual abuse is one of the most stressful life events and is associated with many adverse consequences including physical and mental health problems, substance abuse and criminality Methods: This study was a cross sectional study that was conducted among female secondary school students in ...

  17. Emotional Intelligence in Secondary Education Students in Multicultural Contexts

    Science.gov (United States)

    Pegalajar-Palomino, Ma. del Carmen; Colmenero-Ruiz, Ma. Jesus

    2014-01-01

    Introduction: The study analyzes the level of development in emotional intelligence of Secondary Education students. It also checks for statistically significant differences in educational level between Spanish and immigrant students, under the integration program "Intercultural Open Classrooms". Method: 94 students of Secondary…

  18. Body Mass Index Of Nigerian Adolescent Urban Secondary School Girls

    Directory of Open Access Journals (Sweden)

    Onyiriuka Alphonsus N.

    2015-06-01

    Full Text Available Background and Aims: Body mass index (BMI is an inexpensive and easy-to-perform method of screening for weight status, which may have detrimental health consequences. The aim of our study was to assess the pattern of BMI among Nigerian adolescent secondary school girls and determine the prevalence of underweight, overweight and obesity among them.

  19. Enhancing chemistry teaching in secondary schools: An alternative ...

    African Journals Online (AJOL)

    This study adopted the quasi-experimental research design to examine the alterative teaching methods in secondary chemistry using the cooperative instructional strategy ... Some recommendations were also made among which were that the current prevailing teaching and learning approach should be restructured.

  20. Secondary School Teachers' Beliefs, Attitudes, and Reactions to Stuttering

    Science.gov (United States)

    Adriaensens, Stefanie; Struyf, Elke

    2016-01-01

    Purpose: The study identifies teachers' beliefs about and attitudes toward stuttering and explores to what extent these beliefs and attitudes prompt specific teachers' reactions to the stuttering of a student. Method: Participants were teachers in secondary education in Flanders (Belgium), currently teaching an adolescent who stutters. They were…

  1. Antibiotic control measures in Dutch secondary care hospitals.

    NARCIS (Netherlands)

    Schouten, J.A.; Hulscher, M.E.J.L.; Natsch, S.S.; Grol, R.P.T.M.; Meer, J.W.M. van der

    2005-01-01

    Control measures for the use of antibiotics are essential because of the potential harmful consequences of side effects. Various methods have been developed to help curb undesirable antibiotic prescription. We performed a survey in Dutch secondary care hospitals (response rate 73%) to make an

  2. School climate as correlate of bullying behaviour among secondary ...

    African Journals Online (AJOL)

    Bullying is the most common form of violence in schools. The current study examined the relationship between school climate and bullying behaviour among secondary school students in Yagba West, Kogi State, Nigeria. The research design employed for this study was a descriptive research method of the correlational ...

  3. Language Genre Transitions in a Secondary School Physics Classroom

    Science.gov (United States)

    Bower, M. W.; Ellerton, N. F.

    2007-01-01

    The research reported in this paper addressed the nature of transitions between language genres in school physics. In this qualitative study, quasi-ethnographic methods were employed to understand the culture of one secondary school physics classroom in the USA. One teacher and his physics students were the participants. The teacher was…

  4. Alpha spectrometry and secondary ion mass spectrometry of thorium

    International Nuclear Information System (INIS)

    Strisovska, Jana; Kuruc, Jozef; Galanda, Dusan; Matel, Lubomir; Velic, Dusan; Aranyosiova, Monika

    2009-01-01

    A sample of thorium content on steel discs was prepared by electrodeposition with a view to determining the natural thorium isotope. Thorium was determined by alpha spectrometry and by secondary ion mass spectrometry and the results of the two methods were compared

  5. Reading Strategies among ESL Malaysian Secondary School Students

    Science.gov (United States)

    Semtin, Semry Anak; Maniam, Mahendran

    2015-01-01

    This study aimed to investigate the types of cognitive and metacognitive reading strategies employed by secondary school students in Malaysia to improve their comprehension. The study employed a mixed-method approach which involves the instruments of a questionnaire and an interview. This study was conducted at SMK Kapit, involving ninety Form 4…

  6. Repositioning teaching in Nigerian secondary schools using media ...

    African Journals Online (AJOL)

    Repositioning teaching in Nigerian secondary schools using media resources in a digital age. ... Lagos Journal of Library and Information Science ... that the new tools served as an added advantage on the traditional method of teaching and learning, especially in information delivery; channelled through media resources.

  7. Perception of Rape Amongst Secondary School Students In Port ...

    African Journals Online (AJOL)

    Methods: This study was conducted among secondary school students during a series of debates organised by the Medical Women Association of Nigeria in Port Harcourt. Using a structured, anonymous and self-administered questionnaire, data collected included bio data, awareness information, response and practices.

  8. Missed vaccination opportunities at a secondary health facility in ...

    African Journals Online (AJOL)

    The study aimed to identify missed vaccination visits and the associated factors in children presenting at the general out-patient clinic of a secondary health facility in Ilorin, Nigeria. Method: Through a descriptive cross-sectional study, the vaccination data of all children seen at the out-patient clinic were critically reviewed ...

  9. Treatment duration of topics in senior secondary school core ...

    African Journals Online (AJOL)

    The purpose of the study was to investigate whether the intended time of 160 minutes per week for 96 weeks was adequate for the treatment of the SSS Core Mathematics. The study used simple random sampling method to select two mixed, two single-sex female and two single-sex male Senior Secondary Schools in the ...

  10. On Secondary Control Approaches for Voltage Regulation in DC Microgrids

    DEFF Research Database (Denmark)

    Peyghami, Saeed; Mokhtari, Hossein; Davari, Pooya

    2017-01-01

    Centralized or decentralized secondary controller is commonly employed to regulate the voltage drop raised by the primary controller. However, in the case of high capacity MGs and long feeders with much voltage drop on the line resistances, the conventional methods may not guarantee the voltage r...

  11. On Secondary Control Approaches for Voltage Regulation in DC Microgrids

    DEFF Research Database (Denmark)

    Peyghami Akhuleh, Saeed; Mokhtari, Hossein; Davari, Pooya

    2017-01-01

    Centralized or decentralized secondary controller is commonly employed to regulate the voltage drop raised by the primary controller. However, in the case of high capacity MGs and long feeders with much voltage drop on the line resistances, the conventional methods may not guarantee the voltage...

  12. Effect of Team Teaching on Secondary School Students ...

    African Journals Online (AJOL)

    FIRST LADY

    students' achievement in Secondary School Business Studies in Onitsha. North Local Government ... research hypotheses were tested using t-test. ... It is not easy for one teacher in the conventional method to teach it to a group of student in ...

  13. Secondary School Science and Mathematics Teachers, Characteristics and Service Loads.

    Science.gov (United States)

    Mills, Thomas J.

    Determined were the educational and professional backgrounds, and some aspects of the operational environment of teachers of secondary school science and mathematics (Grades 7-12) in the public and private schools of the United States during the school year 1960-61. A stratified random sampling method was used to ensure proportional representation…

  14. Ensemble-based prediction of RNA secondary structures.

    Science.gov (United States)

    Aghaeepour, Nima; Hoos, Holger H

    2013-04-24

    Accurate structure prediction methods play an important role for the understanding of RNA function. Energy-based, pseudoknot-free secondary structure prediction is one of the most widely used and versatile approaches, and improved methods for this task have received much attention over the past five years. Despite the impressive progress that as been achieved in this area, existing evaluations of the prediction accuracy achieved by various algorithms do not provide a comprehensive, statistically sound assessment. Furthermore, while there is increasing evidence that no prediction algorithm consistently outperforms all others, no work has been done to exploit the complementary strengths of multiple approaches. In this work, we present two contributions to the area of RNA secondary structure prediction. Firstly, we use state-of-the-art, resampling-based statistical methods together with a previously published and increasingly widely used dataset of high-quality RNA structures to conduct a comprehensive evaluation of existing RNA secondary structure prediction procedures. The results from this evaluation clarify the performance relationship between ten well-known existing energy-based pseudoknot-free RNA secondary structure prediction methods and clearly demonstrate the progress that has been achieved in recent years. Secondly, we introduce AveRNA, a generic and powerful method for combining a set of existing secondary structure prediction procedures into an ensemble-based method that achieves significantly higher prediction accuracies than obtained from any of its component procedures. Our new, ensemble-based method, AveRNA, improves the state of the art for energy-based, pseudoknot-free RNA secondary structure prediction by exploiting the complementary strengths of multiple existing prediction procedures, as demonstrated using a state-of-the-art statistical resampling approach. In addition, AveRNA allows an intuitive and effective control of the trade-off between

  15. Secondary Vocational Education in Working Environment

    Directory of Open Access Journals (Sweden)

    Gvido Melink

    2001-12-01

    Full Text Available The authors present a successful project of secondary vocational education carried out by our school for the occupation of a toolmaker and a machinist for the companies Domel, Indramat and Niko in Železniki, considering the modern methods of teaching adults and having consistently adjusted timetable of the lectures in accordance with the working hours of the candidates and the production process respectively. Lectures, training and practical work in the workshop were performed in the company and school's workshops and laboratories. In the additional chapter the authors draw attention to the problems of payment for the teachers of technical s ubjects, who enter the education process with great working experience from companies but start here as beginners since the school regulations do not define such cases.

  16. Breast cancer literacy among higher secondary students

    DEFF Research Database (Denmark)

    Bhandari, Parash Mani; Thapa, Kiran; Dhakal, Sarmila

    2016-01-01

    Background: Being the most common cancer among women worldwide, it is vital to be well-aware of breast cancer risk factors, symptoms and curability. However, few studies have reported breast cancer literacy in students using a validated instrument. Methods: A cross-sectional study was conducted...... among students of grades 11 and 12 from eleven higher secondary schools, one selected randomly from each ilaka of Parbat district. Questionnaire with modified Comprehensive Breast Cancer Knowledge Test was self-administered to 516 students. Knowledge score was categorized into two categories: 'good...... knowledge' and 'poor knowledge' taking median score as the cut-off. Chi-square test was used to determine difference in knowledge by socio-demographic factors, including gender. Results: Only 4.8 % of the students responded correctly to at least half of the items, and 1.4 % did not respond correctly to any...

  17. Engineering of secondary metabolite production in streptomycetes

    DEFF Research Database (Denmark)

    Robertsen, Helene Lunde; Gram, Lone

    Streptomycetes are known for their ability to produce a range of different secondary metabolites, including antibiotics, immunosuppressive, anti-fungals, and anti-cancer compounds. Of these compounds, antibiotics play an important role in the clinics for treatment of both mild and severe bacterial...... the computational prediction of suitable 20 bp protospacers for the single guide RNAs and a USER-cloning method for construction of the CRISPR plasmids. Additional improvement to the system was achieved through the development of an optimised USER assembly workflow for cheaper and faster plasmid construction....... The workflow was verified by manual knock-down of two biosynthetic gene clusters in model organism Streptomyces coelicolor A3(2), which confirmed the applicability of the system. A second part of the thesis was devoted to engineering of Streptomyces collinus Tü 365, which is a known producer of the narrow...

  18. PWR secondary water chemistry guidelines: Revision 3

    International Nuclear Information System (INIS)

    Lurie, S.; Bucci, G.; Johnson, L.; King, M.; Lamanna, L.; Morgan, E.; Bates, J.; Burns, R.; Eaker, R.; Ward, G.; Linnenbom, V.; Millet, P.; Paine, J.P.; Wood, C.J.; Gatten, T.; Meatheany, D.; Seager, J.; Thompson, R.; Brobst, G.; Connor, W.; Lewis, G.; Shirmer, R.; Gillen, J.; Kerns, M.; Jones, V.; Lappegaard, S.; Sawochka, S.; Smith, F.; Spires, D.; Pagan, S.; Gardner, J.; Polidoroff, T.; Lambert, S.; Dahl, B.; Hundley, F.; Miller, B.; Andersson, P.; Briden, D.; Fellers, B.; Harvey, S.; Polchow, J.; Rootham, M.; Fredrichs, T.; Flint, W.

    1993-05-01

    An effective, state-of-the art secondary water chemistry control program is essential to maximize the availability and operating life of major PWR components. Furthermore, the costs related to maintaining secondary water chemistry will likely be less than the repair or replacement of steam generators or large turbine rotors, with resulting outages taken into account. The revised PWR secondary water chemistry guidelines in this report represent the latest field and laboratory data on steam generator corrosion phenomena. This document supersedes Interim PWR Secondary Water Chemistry Recommendations for IGA/SCC Control (EPRI report TR-101230) as well as PWR Secondary Water Chemistry Guidelines--Revision 2 (NP-6239)

  19. On the prediction of turbulent secondary flows

    Science.gov (United States)

    Speziale, C. G.; So, R. M. C.; Younis, B. A.

    1992-01-01

    The prediction of turbulent secondary flows, with Reynolds stress models, in circular pipes and non-circular ducts is reviewed. Turbulence-driven secondary flows in straight non-circular ducts are considered along with turbulent secondary flows in pipes and ducts that arise from curvature or a system rotation. The physical mechanisms that generate these different kinds of secondary flows are outlined and the level of turbulence closure required to properly compute each type is discussed in detail. Illustrative computations of a variety of different secondary flows obtained from two-equation turbulence models and second-order closures are provided to amplify these points.

  20. MULTIPLE INTELLIGENCES PRACTICE OF HIGHER SECONDARY SCHOOL TEACHERS OF THIRUVANANTHAPURAM DISTRICT: A STATUS RESEARCH.

    OpenAIRE

    Pooja. S.

    2018-01-01

    The present study aims to find out the awareness of Higher Secondary School English teachers on Multiple Intelligences. Each teacher needs to be aware of different forms of intelligences. The objectives of the study are to find out the level of awareness of Higher Secondary School teachers on Multiple Intelligences and to compare the awareness on Multiple Intelligences among Higher Secondary School teachers based on gender and locality. Survey method is used for collecting data from 150 highe...

  1. Perspectives of pupils, parents, and teachers on mental health problems among Vietnamese secondary school pupils

    OpenAIRE

    Nguyen, Dat Tan; Dedding, Christine; Pham, Tam Thi; Bunders-Aelen, J.G.F.

    2013-01-01

    Background: Secondary school can be a stressful period for adolescents, having to cope with many life changes. Very little research has been conducted on the mental health status of secondary school pupils in South East Asian countries, such as Vietnam.The study aimed to explore perceptions of mental health status, risk factors for mental health problems and strategies to improve mental health among Vietnamese secondary school students. Methods. A qualitative design was used to address the ma...

  2. Strategic Planning and Values in Secondary School

    Directory of Open Access Journals (Sweden)

    Damjana Gruden

    2012-06-01

    Full Text Available RQ: Which factors have a decisive influence on a school’s strategic development?Purpose: The purpose of this research is the improvement of school development and the goal of this research study was to prepare a draft for strategic planning.Method: Qualitative method is used in the first phase of the research study. An annual interview was conducted with secondary technical and vocational school teaching staff. In the second phase of this research study, a survey with one question was distributed to the teaching staff. The question on the survey referred to teachersvalues that stemmed from the interviews. The directed question was on the values that that should be emphasized in assisting the school to prepare a strategic development plan.Results: The results of this research study showed that strategic development of the school is based on values and activities that provide for quality education,professional and practical knowledge, strengthen and develop interpersonal relations and provide good connections between schools, craftsmen, and the economy.Organization: By defining the school’s priorities, it will become easier for the staff to prepare the school’s development strategy and action plans for individual tasks.Society: Awareness and developing values through activities at school provides support to adolescents and young adults in developing their life style. Values lead the behavior of individuals and consequently,are very important for society.Originality: Through the research study the school obtained thebasic values that will be used in drafting a development plan. This will be the first such document for the school. Up until now planning has been performed only in terms of short-term planning within the annual work plan.Limitations: The survey was conducted among the staff of one vocational and technical secondary school. Further research would be required to include parents and students and to start introducing evaluation and

  3. 基于模拟的中小学教学楼绿色设计方法研究——以寒冷地区为例%Green Design Method of Primary and Secondary School Teaching Buildings Based on Simulation:Taking Teaching Buildings in Cold Region for Example

    Institute of Scientific and Technical Information of China (English)

    贾佳; 刘丛红; 杨鸿玮

    2017-01-01

    optimization and various important technical strategies can be applied in the whole process.In the stage of overall control,reducing energy consumption is mainly by building shape,building layout and material selection;In the stage of plan organization,reducing energy consumption is mainly through the thermal buffer set to minimize the winter heat loss,as well as setting atrium to improve indoor comfort;Considering the comfort needs of classroom space and public space on space-optimization level,shading design and natural ventilation optimization are taken into account.Computer simulation technologies such as Phoenics which can simulate wind environment,Design Builder which can simulate buildings' energy consumption and Ecotect which can simulate the natural lighting condition are used.Various stages of the architectural design process are optimized according to the physical environmental simulation results.At the end of the paper,the green design method is applied to the design practice of a primary school building in Tianjin,China,to verify the effect of the methods.The weather conditions of Tianjin were set up by Weather tool software.The research result can be directly applied to the green design practice of the teaching buildings in primary and secondary school in cold areas,which is of great value to create a green,comfortable and educational environment and it could be reference to the design of teaching buildings in other climatic areas.

  4. Irradiation of the Bulgarian population with secondary cosmic radiation

    International Nuclear Information System (INIS)

    Vasilev, G.

    1983-01-01

    The radiation of the Bulgarian population was estimated, the former being due to secondary space radiation. A method of calculation was applied using the values for dose powers at different heights, proposed by the Research Committee on Atomic Radiation Action (UNO, 1976). Parallelly with that comparative measurements were taken using counters for space radiation VA-Z-232. The stay of the population in different type buildings was taken into account. The mean annual dose of radiation of the Bulgarian population from the secondary space radiation is 245μGy, and the collective effective equivalent dose is 2, 2.10 3 hum sv. (authors)

  5. Deep recurrent conditional random field network for protein secondary prediction

    DEFF Research Database (Denmark)

    Johansen, Alexander Rosenberg; Sønderby, Søren Kaae; Sønderby, Casper Kaae

    2017-01-01

    Deep learning has become the state-of-the-art method for predicting protein secondary structure from only its amino acid residues and sequence profile. Building upon these results, we propose to combine a bi-directional recurrent neural network (biRNN) with a conditional random field (CRF), which...... of the labels for all time-steps. We condition the CRF on the output of biRNN, which learns a distributed representation based on the entire sequence. The biRNN-CRF is therefore close to ideally suited for the secondary structure task because a high degree of cross-talk between neighboring elements can...

  6. [Diagnostics and treatment of primary and secondary hyperparathyroidism].

    Science.gov (United States)

    Zarivchatskiĭ, M F; Denisov, S A; Blinov, S A; Kolevatov, A P; Teplykh, N S

    2013-01-01

    The experience of treatment of 41 patients (aged 32-67 years) was presented in the article. The duration of disease was 2-5 years. Primary hyperparathyroidism was diagnosed in 16 patients and secondary--in 25. Diagnostics of the disease included clinical methods of treatment; studying levels of general and ionized calcium, phosphorus, parathormone; an ultrasound of thyroid and parathyroid glands, the substratum scintigraphy. All patients were undergone the operation. Adenomas of parathyroid glands were removed in the case of primary hyperparathyroidism including mini-access. Hyperplastic parathyroid glands (31/2) were disposed in the case of secondary hyperparathyroidism. Good immediate and long-term results were obtained.

  7. Secondary production in shallow marine environments

    International Nuclear Information System (INIS)

    Pomeroy, L.R.

    1976-01-01

    Recommendations are discussed with regard to population ecology, microbial food webs, marine ecosystems, improved instrumentation, and effects of land and sea on shallow marine systems. The control of secondary production is discussed with regard to present status of knowledge; research needs for studies on dominant secondary producers, food webs that lead to commercial species, and significant features of the trophic structure of shallow water marine communities. Secondary production at the land-water interface is discussed with regard to present status of knowledge; importance of macrophytes to secondary production; export to secondary consumers; utilization of macrophyte primary production; and correlations between secondary production and river discharge. The role of microorganisms in secondary production is also discussed

  8. Secondary emission electron gun using external primaries

    Science.gov (United States)

    Srinivasan-Rao, Triveni [Shoreham, NY; Ben-Zvi, Ilan [Setauket, NY

    2009-10-13

    An electron gun for generating an electron beam is provided, which includes a secondary emitter. The secondary emitter includes a non-contaminating negative-electron-affinity (NEA) material and emitting surface. The gun includes an accelerating region which accelerates the secondaries from the emitting surface. The secondaries are emitted in response to a primary beam generated external to the accelerating region. The accelerating region may include a superconducting radio frequency (RF) cavity, and the gun may be operated in a continuous wave (CW) mode. The secondary emitter includes hydrogenated diamond. A uniform electrically conductive layer is superposed on the emitter to replenish the extracted current, preventing charging of the emitter. An encapsulated secondary emission enhanced cathode device, useful in a superconducting RF cavity, includes a housing for maintaining vacuum, a cathode, e.g., a photocathode, and the non-contaminating NEA secondary emitter with the uniform electrically conductive layer superposed thereon.

  9. Secondary Education in Argentina during the 1990s

    Directory of Open Access Journals (Sweden)

    Jorge M. Gorostiaga

    2003-05-01

    Full Text Available The reform of secondary education has been a fundamental part of national educational policy in Argentina since the beginning of the 1990s. Along with the decentralization of responsibilities to provinces and a new structure of primary and secondary education, changes have affected the areas of curriculum design, teaching methods, teacher training, school management, and information and evaluation systems. This study describes the main policies on secondary education implemented during the last decade, including their objectives and rationales. Focusing on how the reform can be seen to relate to issues of access, quality and equity, the study presents an analysis of its implementation, and discusses some of its effects. We argue that political, economic and technical factors as well as the strategies chosen by the national government resulted in a limited implementation, and we highlight the need for considering more focused reform strategies, alternative models of teacher training, and a more active involvement of teachers.

  10. On the secondary instability of three-dimensional boundary layers

    Energy Technology Data Exchange (ETDEWEB)

    Janke, E. [DLR Deutsches Zentrum fuer Luft- und Raumfahrt e.V., Goettingen (Germany). Inst. fuer Stroemungsmechanik; Balakumar, P. [Department of Aerospace Engineering, Old Dominion University, Norfolk, VA 23529 (United States)

    2000-09-01

    One of the possible transition scenarios in three-dimensional boundary layers, the saturation of stationary crossflow vortices and their secondary instability to high-frequency disturbances, is studied using the parabolized stability equations (PSE) and Floquet theory. Starting from nonlinear PSE solutions, we investigate the region where a purely stationary crossflow disturbance saturates for its secondary instability characteristics utilizing global and local eigenvalue solvers that are based on the implicitly restarted Arnoldi method and a Newton-Raphson technique, respectively. Results are presented for swept Hiemenz flow and the DLR swept flat plate experiment. The main focuses of this study are on the existence of multiple roots in the eigenvalue spectrum that could explain experimental observations of time-dependent occurrences of an explosive growth of traveling disturbances, on the origin of high-frequency disturbances, as well as on gaining more information about threshold amplitudes of primary disturbances necessary for the growth of secondary disturbances. (orig.)

  11. Visualization of hydrogen in steels by secondary ion mass spectrometry

    International Nuclear Information System (INIS)

    Takai, Kenichi

    2000-01-01

    Secondary ion mass spectrometry (SIMS) enables us to visualize hydrogen trapping sites in steels. Information about the hydrogen trapping sites in high-strength steels by SIMS is very important to discuss environmental embrittlement mechanism for developing steels with a high resistance to the environmental embrittlement. Secondary ion image analysis by SIMS has made possible to visualize the hydrogen and deuterium trapping sites in the steels. Hydrogen in tempered martensite steels containing Ca tends to accumulate on inclusions, at grain boundaries, and in segregation bands. Visualization of hydrogen desorption process by secondary ion image analysis confirms that the bonding between the inclusions and the hydrogen is strong. Cold-drawn pearlite steels trap hydrogen along cold-drawing direction. Pearlite phase absorbs the hydrogen more than ferrite phase does. This article introduces the principle of SIMS, its feature, analysis method, and results of hydrogen visualization in steels. (author)

  12. Study of thin insulating films using secondary ion emission

    International Nuclear Information System (INIS)

    Hilleret, Noel

    1973-01-01

    Secondary ion emission from insulating films was investigated using a CASTAING-SLODZIAN ion analyzer. Various different aspects of the problem were studied: charge flow across a silica film; the mobilization of sodium during ion bombardment; consequences of the introduction of oxygen on the emission of secondary ions from some solids; determination of the various characteristics of secondary ion emission from silica, silicon nitride and silicon. An example of measurements made using this type of operation is presented: profiles (concentration as a function of depth) of boron introduced by diffusion or implantation in thin films of silica on silicon or silicon nitride. Such measurements have applications in microelectronics. The same method of operation was extended to other types of insulating film, and in particular, to the metallurgical study of passivation films formed on the surface of stainless steels. (author) [fr

  13. Portal hydatid with secondary cavernomatosis.

    Science.gov (United States)

    Rodríguez Sanz, Mª Belén; Roldán Cuena, Mª Del Mar; Blanco Álvarez, Carlos Alberto; Sánchez Jiménez, Raúl

    2017-03-01

    The hydatid cyst is a parasitic infection included within the category of zoonoses, in which there exists a direct or indirect relation with animals, particularly with dogs. We report a clinical case of a patient who has undergone surgery of hydatid cyst in the right hepatic lobe. Seven years later the patient presents hydatid cyst in portal vein with secondary cavernomatosis, which is a rare complication. There are few cases described in the literature. The symtomatology presented by hydatid cyst is variable and the diagnosis is made by ultrasonography, TC and/or RNM. The treatment of choice is the surgical removal of the cyst, prior to surgery Albendazol must be administered for 1-2 weeks and be maintained for 4 more weeks after surgery.

  14. Pulmonary involvement of secondary syphilis.

    Science.gov (United States)

    Ogawa, Yoshihiko; Imai, Yuichiro; Yoshihara, Shingo; Fujikura, Hiroyuki; Hirai, Nobuyasu; Sato, Masatoshi; Ogawa, Taku; Uno, Kenji; Kasahara, Kei; Yano, Hisakazu; Mikasa, Keiichi

    2018-01-01

    Pulmonary involvement in secondary syphilis is considered a rare occurrence; however, the number of cases has increased in the 2000s. This is likely due to the increased use of computed tomography scans and molecular diagnostic testing. We report a case of an HIV-positive man with pleural chest pain and bilateral subpleural nodules on chest computed tomography. His rapid plasma reagin and Treponema pallidum hemagglutination tests were positive, and the specimen of one of the pulmonary nodules obtained by transthoracic biopsy was positive for the polA gene of Treponema pallidum. Since clinical manifestations of syphilis are highly variable, clinicians should bear in mind that pleural chest pain with bilateral subpleural nodules can be caused by pulmonary syphilis.

  15. PWR secondary water chemistry study

    International Nuclear Information System (INIS)

    Pearl, W.L.; Sawochka, S.G.; Copley, S.E.; Siegwarth, D.P.

    1981-01-01

    Secondary water chemistry studies have been performed at ten operating PWRs for the past several years. The program includes seven PWRs with recirculating U-tube steam generators, and three once-through steam generator (OTSG) PWRs. Program results indicate that during periods of minimal condenser inleakage, condensate polishers do not remove significant quantities of sodium, chloride and sulfate. At higher inlet impurity levels, demineralizer removal efficiencies improve markedly. Corrosion product removal efficiencies generally are 60 to 95% depending on system design and operating practices. Significant quantities of sodium and chloride 'hide out' in steam generators with a portion returning during transients, particularly during plant shutdowns. In OTSG PWRs, a significant portion of the total sodium and chloride transported via the steam is removed with the moisture separator drains (MSD) and returned to the OTSG when MSDs are pumped forward. Partial return of MSDs to the condenser would result in reduced feedwater and steam impurity levels. (author)

  16. LEISURE TIME FOR SECONDARY SCHOOL STUDENTS

    Directory of Open Access Journals (Sweden)

    Besa Havziu

    2015-06-01

    Full Text Available Today, in education prevails the paradigm that is geared towards the complete and varied development of a person. This implies the development of the students ability for self-determination towards various other perspective offered by contemporary social residence. Meanwhile in the time of adolescence, the youth experience serious crises regarding their identity, in which the free time and the activities during the free time can be positively used with a cause to be interrupted unconstructive and chaotic use of the free time by the youth. In this thesis are being analyzed the contents and the ways with what the secondary school students in the Republic of Macedonia fulfill their free time outside the school, specifically there will be an examination about the gender differences i.e. the amount and manner of spending their free time. In the approach to the study of the problem of research, we decided to apply: inductive method, deductive method and the method of comparison. 

  17. Design Secondary Optical System Applied in White-LED General Illumination

    International Nuclear Information System (INIS)

    Chen Chen; Zhang Xianhui

    2011-01-01

    As a new generation of light source, LED has many advantages that other light sources do not have. However, due to the nonuniform lighting of LED, secondary LED optical system design is particularly important. Freeform surface tailoring method, an important method of lighting design, establishes a light intensity change model after smooth surface refraction (reflection) of the light and simplifies the solution process for more complex issues of solution using the free surface tailoring method. Based on this method, secondary LED optical system is designed, and the light intensity distribution is simulated after LED light passes through the secondary optical system. The results show that the method has not only simplified the calculation process of the free surface tailoring method, but also the designed LED secondary optical system has achieved the purpose of uniform lighting to a certain degree.

  18. Primary and secondary cases in Escherichia coli O157 outbreaks: a statistical analysis.

    LENUS (Irish Health Repository)

    Snedeker, Kate G

    2009-01-01

    BACKGROUND: Within outbreaks of Escherichia coli O157 (E. coli O157), at least 10-15% of cases are thought to have been acquired by secondary transmission. However, there has been little systematic quantification or characterisation of secondary outbreak cases worldwide. The aim of this study was to characterise secondary outbreak cases, estimate the overall proportion of outbreak cases that were the result of secondary transmission and to analyse the relationships between primary and secondary outbreak cases by mode of transmission, country and median age. METHODS: Published data was obtained from 90 confirmed Escherichia coli O157 outbreaks in Great Britain, Ireland, Scandinavia, Canada, the United States and Japan, and the outbreaks were described in terms of modes of primary and secondary transmission, country, case numbers and median case age. Outbreaks were tested for statistically significant differences in the number of ill, confirmed, primary and secondary cases (analysis of variance and Kruskal-Wallis) and in the rate of secondary cases between these variables (Generalised Linear Models). RESULTS: The outbreaks had a median of 13.5 confirmed cases, and mean proportion of 0.195 secondary cases. There were statistically significant differences in the numbers of ill, confirmed, primary and secondary cases between modes of primary transmission (p < 0.021), and in primary and secondary cases between median age categories (p < 0.039) and modes of secondary transmission (p < 0.001).Secondary case rates differed statistically significantly between modes of secondary and primary transmission and median age categories (all p < 0.001), but not between countries (p = 0.23). Statistically significantly higher rates of secondary transmission were found in outbreaks with a median age <6 years and those with secondary transmission via person to person spread in nurseries. No statistically significant interactions were found between country, mode of transmission and age

  19. Working at a Different Level? Curriculum Differentiation in Irish Lower Secondary Education

    Science.gov (United States)

    Smyth, Emer

    2018-01-01

    Young people in Irish schools are required to choose whether to sit secondary exam subjects at higher or ordinary level. This paper draws on a mixed methods longitudinal study of students in 12 case-study schools to trace the factors influencing take-up of higher level subjects within lower secondary education. School organisation and process are…

  20. An Insight into Secondary School Students' Beliefs Regarding Learning English Language

    Science.gov (United States)

    Aziz, Fakhra; Quraishi, Uzma

    2017-01-01

    The present descriptive study aimed to get an insight into secondary school students' beliefs regarding English language learning. The survey method was employed for obtaining data from the secondary school students (N = 664). A modified version of "beliefs about language learning inventory" was used to collect data. Five out of nine…

  1. Teacher's Professional Use of Information and Communication Technology in Secondary Schools in Tamil Nadu, India

    Science.gov (United States)

    Nagamani, Deepa; Muthuswamy, Prema

    2013-01-01

    The purpose of the study is to evaluate secondary school teachers' abilities to use Information and Communication Technology (ICT) in schools in Tamil Nadu, India. Questionnaires method was used for data collection. Around 200 questionnaires were distributed to secondary school teachers and headmasters, in which 157 were completed and returned.…

  2. Comparison between Emotional Intelligence and Aggression among Student Teachers at Secondary Level

    Science.gov (United States)

    Jaleel, Sajna; Verghis, Alie Molly

    2017-01-01

    The study explored the relationship between emotional intelligence and aggression among teacher trainees at secondary level. The hypothesis formulated for the study was, there is no significant relationship between Emotional Intelligence and aggression of teacher trainees at secondary level. The method adopted for the study was descriptive survey,…

  3. Testing Mediation Using Multiple Regression and Structural Equation Modeling Analyses in Secondary Data

    Science.gov (United States)

    Li, Spencer D.

    2011-01-01

    Mediation analysis in child and adolescent development research is possible using large secondary data sets. This article provides an overview of two statistical methods commonly used to test mediated effects in secondary analysis: multiple regression and structural equation modeling (SEM). Two empirical studies are presented to illustrate the…

  4. Assessing Knowledge Levels of Secondary School Physical Education and Sports Teachers about Inclusive Education

    Science.gov (United States)

    Aydin, Mensure

    2014-01-01

    The purpose of the research is to assess knowledge levels of physical education teachers in inclusive education in secondary schools. For the research, the survey method was employed. It consisted of 55 physical education teachers employed in 47 secondary schools included in inclusive education program under Kocaeli Provincial Directorate of…

  5. Utility of an intraoperabive gamma probe in the surgical management of secondary or tertiary hyperparathyroidism

    NARCIS (Netherlands)

    Jorna, Francisca H.; Jager, Pieter L.; Lemstra, Clara; Wiggers, Theo; Stegeman, Coen A.; Plukker, John T. M.

    BACKGROUND: In primary hyperparathyroidism the gamma probe is effective, but its role in secondary hyperparathyroidism is unclear. We investigated the utility of the probe in the surgical management of secondary and tertiary hyperparathyroidism. METHODS: The value of the probe in guiding resection

  6. Darwinian sex roles confirmed across the animal kingdom.

    Science.gov (United States)

    Janicke, Tim; Häderer, Ines K; Lajeunesse, Marc J; Anthes, Nils

    2016-02-01

    Since Darwin's conception of sexual selection theory, scientists have struggled to identify the evolutionary forces underlying the pervasive differences between male and female behavior, morphology, and physiology. The Darwin-Bateman paradigm predicts that anisogamy imposes stronger sexual selection on males, which, in turn, drives the evolution of conventional sex roles in terms of female-biased parental care and male-biased sexual dimorphism. Although this paradigm forms the cornerstone of modern sexual selection theory, it still remains untested across the animal tree of life. This lack of evidence has promoted the rise of alternative hypotheses arguing that sex differences are entirely driven by environmental factors or chance. We demonstrate that, across the animal kingdom, sexual selection, as captured by standard Bateman metrics, is indeed stronger in males than in females and that it is evolutionarily tied to sex biases in parental care and sexual dimorphism. Our findings provide the first comprehensive evidence that Darwin's concept of conventional sex roles is accurate and refute recent criticism of sexual selection theory.

  7. Interpreting South African cultural clashes through Darwinian eyes ...

    African Journals Online (AJOL)

    ... an acceptance of what would soon be known as Afrikaans culture as no less worthy and civilised than that of the British and for the application of a radically adapted version of social Darwinism to conflicts between white and black South Africans. Key words: Balmforth, Darwin, Darwinism, eugenics, evolution, Kant, social

  8. Bridging Emergent Attributes and Darwinian Principles in Teaching Natural Selection

    Science.gov (United States)

    Xu, Dongchen; Chi, Michelene T. H.

    2016-01-01

    Students often have misconceptions about natural selection as they misuse a direct causal schema to explain the process. Natural selection is in fact an emergent process where random interactions lead to changes in a population. The misconceptions stem from students' lack of emergent schema for natural selection. In order to help students…

  9. Darwinian sex roles confirmed across the animal kingdom

    OpenAIRE

    Janicke Tim; Häderer Ines; Lajeunesse Marc J; Anthes Nils

    2016-01-01

    Since Darwin?s conception of sexual selection theory, scientists have struggled to identify the evolutionary forces underlying the pervasive differences between male and female behavior, morphology, and physiology. The Darwin-Bateman paradigm predicts that anisogamy imposes stronger sexual selection on males, which, in turn, drives the evolution of conventional sex roles in terms of female-biased parental care and male-biased sexual dimorphism. Although this paradigm forms the cornerstone of ...

  10. Warfare, genocide, and ethnic conflict: a Darwinian approach

    OpenAIRE

    Dimijian, Gregory G.

    2010-01-01

    As the 21st century dawns, I reflect on the history of humankind with growing concern about the need to understand the underlying biological and cultural roots of ethnic conflict and warfare. In the many studies of human conflict, innate biological predispositions have been neglected. This article is the third part of a series of seminars for medical residents at the University of Texas Southwestern Medical School at Dallas (see http://adarwinstudygroup.org/). The series starts with in-depth ...

  11. Darwinian Evolution of Mutualistic RNA Replicators with Different Genes

    Science.gov (United States)

    Mizuuchi, R.; Ichihashi, N.

    2017-07-01

    We report a sustainable long-term replication and evolution of two distinct cooperative RNA replicators encoding different genes. One of the RNAs evolved to maintain or increase the cooperativity, despite selective advantage of selfish mutations.

  12. Handgrip Strength as a Darwinian Fitness Indicator in Men

    Directory of Open Access Journals (Sweden)

    Andrew C. Gallup

    2018-04-01

    Full Text Available Handgrip strength (HGS is a robust measure of overall muscular strength and function, and has long been predictive of a multitude of health factors and physical outcomes for both men and women. The fact that HGS represents such a ubiquitous measure of health and vitality may reflect the significance of this trait during human evolution. This trait is also highly sexually dimorphic due to influences of androgenic hormones and fat-free body mass, suggesting that it has been further elaborated through sexual selection. Consistent with this view, research within evolutionary psychology and related fields has documented distinct relationships between HGS and measures of social and sexual behavior, especially in men. Here, we review studies across different societies and cultural contexts showing that male HGS predicts measures of aggression and social dominance, perceived formidability, male-typical body morphology and movement, courtship display, physical attractiveness, and sexual behavior and reproductive fitness. These findings underscore the value of including HGS as an independent measure within studies examining human sexual selection, and corroborate existing research suggesting that specific features of physical strength have and continue to be under positive directional selection in men.

  13. Handgrip Strength as a Darwinian Fitness Indicator in Men.

    Science.gov (United States)

    Gallup, Andrew C; Fink, Bernhard

    2018-01-01

    Handgrip strength (HGS) is a robust measure of overall muscular strength and function, and has long been predictive of a multitude of health factors and physical outcomes for both men and women. The fact that HGS represents such a ubiquitous measure of health and vitality may reflect the significance of this trait during human evolution. This trait is also highly sexually dimorphic due to influences of androgenic hormones and fat-free body mass, suggesting that it has been further elaborated through sexual selection. Consistent with this view, research within evolutionary psychology and related fields has documented distinct relationships between HGS and measures of social and sexual behavior, especially in men. Here, we review studies across different societies and cultural contexts showing that male HGS predicts measures of aggression and social dominance, perceived formidability, male-typical body morphology and movement, courtship display, physical attractiveness, and sexual behavior and reproductive fitness. These findings underscore the value of including HGS as an independent measure within studies examining human sexual selection, and corroborate existing research suggesting that specific features of physical strength have and continue to be under positive directional selection in men.

  14. Darwinian Theory, Functionalism, and the First American Psychological Revolution

    Science.gov (United States)

    Green, Christopher D.

    2009-01-01

    American functionalist psychology constituted an effort to model scientific psychology on the successes of English evolutionary theory. In part it was a response to the stagnation of Wundt's psychological research program, which had been grounded in German experimental physiology. In part it was an attempt to make psychology more appealing within…

  15. Implications of a fossil stickleback assemblage for Darwinian gradualism.

    Science.gov (United States)

    Bell, M A

    2009-11-01

    Darwin postulated that a complete fossil record would contain numerous gradual transitions between ancestral and descendant species, but 150 years after publication of The Origin of Species, few such transitions have materialized. The fossil stickleback Gasterosteus doryssus and the deposit in which it occurs provide excellent conditions to detect such transitions. Abundant, well-preserved fossils occur in a stratigraphic setting with fine temporal resolution. The paleoecology of G. doryssus resembles the ecology of modern lakes that harbour the phenotypically similar three-spined stickleback Gasterosteus aculeatus. Gasterosteus aculeatus are primitively highly armoured, but G. doryssus comprised two contemporaneous biological species with relatively weak armour, including a near-shore, benthic feeder (benthic) and an offshore planktivore (limnetic). The benthic species expanded its range into the limnetic zone of the lake, where it apparently switched to planktivory and evolved reduced armour within c. 5000 years in response to directional selection. Although gradual evolution of mean phenotypes occurred, a single major gene caused much of evolutionary change of the pelvic skeleton. Thus, Darwin's expectation that transitions between species in the fossil record would be gradual was met at a fine time scale, but for pelvic structure, a well-studied trait, his expectation that gradual change would depend entirely on numerous, small, heritable differences among individuals was incorrect.

  16. From Darwinian to technological evolution: forgetting the human lottery.

    Science.gov (United States)

    Tintino, Giorgio

    2014-01-01

    The GRIN technologies (-geno, -robo, -info, -nano) promise to change the inner constitution of human body and its own existence. This transformation involves the structure of our lives and represent a brave new world that we have to explore and to manage. In this sense, the traditional tools of humanism seems very inadequate to think the biotech century and there is a strong demand of a new thought for the evolution and the concrete history of life. The posthuman philosophy tries to take this new path of human existence in all of its novelty since GRIN technologies seem to promise new and unexpected paths of evolution to living beings and, above all, man. For this, the post-human thought, as we see, is a new anthropological overview on the concrete evolution of human being, an overview that involves an epistemological revolution of the categories that humanism uses to conceptualize the journey that divides the Homo sapiens from the man. But, is this right?

  17. Darwinian Spacecraft: Soft Computing Strategies Breeding Better, Faster Cheaper

    Science.gov (United States)

    Noever, David A.; Baskaran, Subbiah

    1999-01-01

    Computers can create infinite lists of combinations to try to solve a particular problem, a process called "soft-computing." This process uses statistical comparables, neural networks, genetic algorithms, fuzzy variables in uncertain environments, and flexible machine learning to create a system which will allow spacecraft to increase robustness, and metric evaluation. These concepts will allow for the development of a spacecraft which will allow missions to be performed at lower costs.

  18. Indirect selection in Darwinian evolution : mechanisms and implications

    OpenAIRE

    Parsons, David

    2011-01-01

    The Aevol model is an in silico experimental evolution model that was specifically developped by Carole Knibbe to study the evolution of the structure of the genome. Using Aevol, a very strong second-order selective pressure towards a specific level of mutational variability of the phenotype was revealed: it was shown that since the survival of a lineage on the long term is conditionned to its ability to produce beneficial mutations while not loosing those previously found, a specific trade-o...

  19. Unfinished stories on viral quasispecies and Darwinian views of evolution.

    Science.gov (United States)

    Más, Antonio; López-Galíndez, Cecilio; Cacho, Isabel; Gómez, Jordi; Martínez, Miguel Angel

    2010-04-09

    Experimental evidence that RNA virus populations consist of distributions of mutant genomes, termed quasispecies, was first published 31 years ago. This work provided the earliest experimental support for a theory to explain a system that replicated with limited fidelity and to understand the self-organization and adaptability of early life forms on Earth. High mutation rates and quasispecies dynamics of RNA viruses are intimately related to both viral disease and antiviral treatment strategies. Moreover, the quasispecies concept is being applied to other biological systems such as cancer research in which cellular mutant spectra can be also detected. This review addresses some of the unanswered questions regarding viral and theoretical quasispecies concepts as well as more practical aspects concerning resistance to antiviral treatments and pathogenesis. (c) 2010 Elsevier Ltd. All rights reserved.

  20. Capitalist contexts for Darwinian theory: land, finance, industry and empire.

    Science.gov (United States)

    Hodge, M J S

    2009-01-01

    When socio-economic contexts are sought for Darwin's science, it is customary to turn to the Industrial Revolution. However, important issues about the long run of England's capitalisms can only be recognised by taking a wider view than Industrial Revolution historiographies tend to engage. The role of land and finance capitalisms in the development of the empire is one such issue. If we historians of Darwin's science allow ourselves a distinction between land and finance capitalisms on the one hand and industrial capitalism on the other; and if we ask with which side of this divide were Darwin and his theory of branching descent by natural selection aligned, then reflection on leading features of that theory, including its Malthusian elements, suggests that the answer is often and largely, though not exclusively: on the land side. The case of Wallace, socialist opponent of land capitalism, may not be as anomalous for this suggestion as one might at first think. Social and economic historians have reached no settled consensuses on the long-run of England's capitalisms. We historians of Darwin's science would do well to import some of these unsettled states of discussion into our own work over the years to come.