WorldWideScience

Sample records for screening multi-electrode method

  1. Multi-Electrode Impedance Method for Detection of Regional Ventilation

    International Nuclear Information System (INIS)

    Furuya, Norio; Sakamoto, Katsuyuki

    2013-01-01

    By means of computer simulation and experiment, we investigated the feasibility of simultaneously measuring the transfer impedance changes in the right apex, left apex, right base and left base of the lungs using the multi-electrode impedance method. To obtain the transfer impedance in each region, while suppressing the effects of other regions, changing the amplitude and polarity of the applied current must localize the high sensitivity areas in the interest region. Twelve current and eight voltage electrodes were equidistantly arranged on the anterior and posterior chest walls. The amplitudes and polarities of the currents that were simultaneously applied to the current electrodes, and which provided the appropriate sensitivity distribution, were theoretically obtained. The effects of the localized sensitivity distribution were verified by comparing the simulation results of the investigated method with the results of the conventional four-electrode method. From the results of the computer simulation, we developed a multi-electrode impedance pneumography and applied it to healthy adult volunteers who were both in sitting position and in left decubitus. We found that the measurement results were physiologically reasonable.

  2. Recent progress in multi-electrode spike sorting methods.

    Science.gov (United States)

    Lefebvre, Baptiste; Yger, Pierre; Marre, Olivier

    2016-11-01

    In recent years, arrays of extracellular electrodes have been developed and manufactured to record simultaneously from hundreds of electrodes packed with a high density. These recordings should allow neuroscientists to reconstruct the individual activity of the neurons spiking in the vicinity of these electrodes, with the help of signal processing algorithms. Algorithms need to solve a source separation problem, also known as spike sorting. However, these new devices challenge the classical way to do spike sorting. Here we review different methods that have been developed to sort spikes from these large-scale recordings. We describe the common properties of these algorithms, as well as their main differences. Finally, we outline the issues that remain to be solved by future spike sorting algorithms. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Proposed method for reconstructing velocity profiles using a multi-electrode electromagnetic flow meter

    International Nuclear Information System (INIS)

    Kollár, László E; Lucas, Gary P; Zhang, Zhichao

    2014-01-01

    An analytical method is developed for the reconstruction of velocity profiles using measured potential distributions obtained around the boundary of a multi-electrode electromagnetic flow meter (EMFM). The method is based on the discrete Fourier transform (DFT), and is implemented in Matlab. The method assumes the velocity profile in a section of a pipe as a superposition of polynomials up to sixth order. Each polynomial component is defined along a specific direction in the plane of the pipe section. For a potential distribution obtained in a uniform magnetic field, this direction is not unique for quadratic and higher-order components; thus, multiple possible solutions exist for the reconstructed velocity profile. A procedure for choosing the optimum velocity profile is proposed. It is applicable for single-phase or two-phase flows, and requires measurement of the potential distribution in a non-uniform magnetic field. The potential distribution in this non-uniform magnetic field is also calculated for the possible solutions using weight values. Then, the velocity profile with the calculated potential distribution which is closest to the measured one provides the optimum solution. The reliability of the method is first demonstrated by reconstructing an artificial velocity profile defined by polynomial functions. Next, velocity profiles in different two-phase flows, based on results from the literature, are used to define the input velocity fields. In all cases, COMSOL Multiphysics is used to model the physical specifications of the EMFM and to simulate the measurements; thus, COMSOL simulations produce the potential distributions on the internal circumference of the flow pipe. These potential distributions serve as inputs for the analytical method. The reconstructed velocity profiles show satisfactory agreement with the input velocity profiles. The method described in this paper is most suitable for stratified flows and is not applicable to axisymmetric flows in

  4. An improved method of crafting a multi-electrode spiral cuff for the selective.

    Science.gov (United States)

    Rozman, Janez; Pečlin, Polona; Ribarič, Samo; Godec, Matjaž; Burja, Jaka

    2018-01-17

    This article reviews an improved methodology and technology for crafting a multi-electrode spiral cuff for the selective activation of nerve fibres in particular superficial regions of a peripheral nerve. The analysis, structural and mechanical properties of the spot welds used for the interconnections between the stimulating electrodes and stainless-steel lead wires are presented. The cuff consisted of 33 platinum electrodes embedded within a self-curling 17-mm-long silicone spiral sheet with a nominal internal diameter of 2.5 mm. The weld was analyzed using scanning electron microscopy and nanohardness tests, while the interconnection was investigated using destructive load tests. The functionality of the cuff was tested in an isolated porcine vagus nerve. The results of the scanning electron microscopy show good alloying and none of the typical welding defects that occur between the wire and the platinum foil. The results of the destructive load tests show that the breaking loads were between 3.22 and 5 N. The results of the nanohardness testing show that the hardness of the weld was different for the particular sites on the weld sample. Finally, the results of the functional testing show that for different stimulation intensities both the compound action potential deflection and the shape are modulated.

  5. Interpretation of field potentials measured on a multi electrode array in pharmacological toxicity screening on primary and human pluripotent stem cell-derived cardiomyocytes

    NARCIS (Netherlands)

    Tertoolen, L.G.J.; Braam, S. R.; van Meer, B.J.; Passier, R.; Mummery, C. L.

    2018-01-01

    Multi electrode arrays (MEAs) are increasingly used to detect external field potentials in electrically active cells. Recently, in combination with cardiomyocytes derived from human (induced) pluripotent stem cells they have started to become a preferred tool to examine newly developed drugs for

  6. Method of making a multi-electrode double layer capacitor having single electrolyte seal and aluminum-impregnated carbon cloth electrodes

    Science.gov (United States)

    Farahmandi, C. Joseph; Dispennette, John M.; Blank, Edward; Kolb, Alan C.

    2002-09-17

    A single cell, multi-electrode high performance double layer capacitor includes first and second flat stacks of electrodes adapted to be housed in a closeable two-part capacitor case which includes only a single electrolyte seal. Each electrode stack has a plurality of electrodes connected in parallel, with the electrodes of one stack being interleaved with the electrodes of the other stack to form an interleaved stack, and with the electrodes of each stack being electrically connected to respective capacitor terminals. A porous separator is positioned against the electrodes of one stack before interleaving to prevent electrical shorts between the electrodes. The electrodes are made by folding a compressible, low resistance, aluminum-impregnated carbon cloth, made from activated carbon fibers, around a current collector foil, with a tab of the foils of each electrode of each stack being connected in parallel and connected to the respective capacitor terminal. The height of the interleaved stack is somewhat greater than the inside height of the closed capacitor case, thereby requiring compression of the interleaved electrode stack when placed inside of the case, and thereby maintaining the interleaved electrode stack under modest constant pressure. The closed capacitor case is filled with an electrolytic solution and sealed. A preferred electrolytic solution is made by dissolving an appropriate salt into acetonitrile (CH.sub.3 CN). In one embodiment, the two parts of the capacitor case are conductive and function as the capacitor terminals.

  7. Conformally encapsulated multi-electrode arrays with seamless insulation

    Energy Technology Data Exchange (ETDEWEB)

    Tabada, Phillipe J.; Shah, Kedar G.; Tolosa, Vanessa; Pannu, Satinderall S.; Tooker, Angela; Delima, Terri; Sheth, Heeral; Felix, Sarah

    2016-11-22

    Thin-film multi-electrode arrays (MEA) having one or more electrically conductive beams conformally encapsulated in a seamless block of electrically insulating material, and methods of fabricating such MEAs using reproducible, microfabrication processes. One or more electrically conductive traces are formed on scaffold material that is subsequently removed to suspend the traces over a substrate by support portions of the trace beam in contact with the substrate. By encapsulating the suspended traces, either individually or together, with a single continuous layer of an electrically insulating material, a seamless block of electrically insulating material is formed that conforms to the shape of the trace beam structure, including any trace backings which provide suspension support. Electrical contacts, electrodes, or leads of the traces are exposed from the encapsulated trace beam structure by removing the substrate.

  8. Symplicity multi-electrode radiofrequency renal denervation system feasibility study.

    Science.gov (United States)

    Whitbourn, Robert; Harding, Scott A; Walton, Antony

    2015-05-01

    The aim of this study was to test the safety and performance of the Symplicity™ multi-electrode radio-frequency renal denervation system which was designed to reduce procedure time during renal denervation. The multi-electrode radiofrequency renal denervation system feasibility study is a prospective, non-randomised, open label, feasibility study that enrolled 50 subjects with hypertension. The study utilises a new renal denervation catheter which contains an array of four electrodes mounted in a helical configuration at 90 degrees from each other to deliver radiofrequency energy simultaneously to all four renal artery quadrants for 60 seconds. The protocol specified one renal denervation treatment towards the distal end of each main renal artery with radiofrequency energy delivered for 60 seconds per treatment. Total treatment time for both renal arteries was two minutes. The 12-month change in office systolic blood pressure (SBP) and 24-hour SBP was -19.2±25.2 mmHg, prenal artery stenosis or hypertensive emergencies occurred. The Symplicity multi-electrode radiofrequency renal denervation system was associated with a significant reduction in SBP at 12 months and minimal complications whilst it also reduced procedure time. NCT01699529.

  9. All-carbon multi-electrode array for real-time in vitro measurements of oxidizable neurotransmitters

    Science.gov (United States)

    Picollo, Federico; Battiato, Alfio; Bernardi, Ettore; Plaitano, Marilena; Franchino, Claudio; Gosso, Sara; Pasquarelli, Alberto; Carbone, Emilio; Olivero, Paolo; Carabelli, Valentina

    2016-02-01

    We report on the ion beam fabrication of all-carbon multi electrode arrays (MEAs) based on 16 graphitic micro-channels embedded in single-crystal diamond (SCD) substrates. The fabricated SCD-MEAs are systematically employed for the in vitro simultaneous amperometric detection of the secretory activity from populations of chromaffin cells, demonstrating a new sensing approach with respect to standard techniques. The biochemical stability and biocompatibility of the SCD-based device combined with the parallel recording of multi-electrodes array allow: i) a significant time saving in data collection during drug screening and/or pharmacological tests over a large number of cells, ii) the possibility of comparing altered cell functionality among cell populations, and iii) the repeatition of acquisition runs over many cycles with a fully non-toxic and chemically robust bio-sensitive substrate.

  10. Optogenetic Modulation and Multi-Electrode Analysis of Cerebellar Networks In Vivo

    Science.gov (United States)

    Kruse, Wolfgang; Krause, Martin; Aarse, Janna; Mark, Melanie D.; Manahan-Vaughan, Denise; Herlitze, Stefan

    2014-01-01

    The firing patterns of cerebellar Purkinje cells (PCs), as the sole output of the cerebellar cortex, determine and tune motor behavior. PC firing is modulated by various inputs from different brain regions and by cell-types including granule cells (GCs), climbing fibers and inhibitory interneurons. To understand how signal integration in PCs occurs and how subtle changes in the modulation of PC firing lead to adjustment of motor behaviors, it is important to precisely record PC firing in vivo and to control modulatory pathways in a spatio-temporal manner. Combining optogenetic and multi-electrode approaches, we established a new method to integrate light-guides into a multi-electrode system. With this method we are able to variably position the light-guide in defined regions relative to the recording electrode with micrometer precision. We show that PC firing can be precisely monitored and modulated by light-activation of channelrhodopsin-2 (ChR2) expressed in PCs, GCs and interneurons. Thus, this method is ideally suited to investigate the spatio/temporal modulation of PCs in anesthetized and in behaving mice. PMID:25144735

  11. Optogenetic modulation and multi-electrode analysis of cerebellar networks in vivo.

    Directory of Open Access Journals (Sweden)

    Wolfgang Kruse

    Full Text Available The firing patterns of cerebellar Purkinje cells (PCs, as the sole output of the cerebellar cortex, determine and tune motor behavior. PC firing is modulated by various inputs from different brain regions and by cell-types including granule cells (GCs, climbing fibers and inhibitory interneurons. To understand how signal integration in PCs occurs and how subtle changes in the modulation of PC firing lead to adjustment of motor behaviors, it is important to precisely record PC firing in vivo and to control modulatory pathways in a spatio-temporal manner. Combining optogenetic and multi-electrode approaches, we established a new method to integrate light-guides into a multi-electrode system. With this method we are able to variably position the light-guide in defined regions relative to the recording electrode with micrometer precision. We show that PC firing can be precisely monitored and modulated by light-activation of channelrhodopsin-2 (ChR2 expressed in PCs, GCs and interneurons. Thus, this method is ideally suited to investigate the spatio/temporal modulation of PCs in anesthetized and in behaving mice.

  12. Electrophysiological Analysis of human Pluripotent Stem Cell-derived Cardiomyocytes (hPSC-CMs) Using Multi-electrode Arrays (MEAs).

    Science.gov (United States)

    Sala, Luca; Ward-van Oostwaard, Dorien; Tertoolen, Leon G J; Mummery, Christine L; Bellin, Milena

    2017-05-12

    Cardiomyocytes can now be derived with high efficiency from both human embryonic and human induced-Pluripotent Stem Cells (hPSC). hPSC-derived cardiomyocytes (hPSC-CMs) are increasingly recognized as having great value for modeling cardiovascular diseases in humans, especially arrhythmia syndromes. They have also demonstrated relevance as in vitro systems for predicting drug responses, which makes them potentially useful for drug-screening and discovery, safety pharmacology and perhaps eventually for personalized medicine. This would be facilitated by deriving hPSC-CMs from patients or susceptible individuals as hiPSCs. For all applications, however, precise measurement and analysis of hPSC-CM electrical properties are essential for identifying changes due to cardiac ion channel mutations and/or drugs that target ion channels and can cause sudden cardiac death. Compared with manual patch-clamp, multi-electrode array (MEA) devices offer the advantage of allowing medium- to high-throughput recordings. This protocol describes how to dissociate 2D cell cultures of hPSC-CMs to small aggregates and single cells and plate them on MEAs to record their spontaneous electrical activity as field potential. Methods for analyzing the recorded data to extract specific parameters, such as the QT and the RR intervals, are also described here. Changes in these parameters would be expected in hPSC-CMs carrying mutations responsible for cardiac arrhythmias and following addition of specific drugs, allowing detection of those that carry a cardiotoxic risk.

  13. Electrical stimulus artifact cancellation and neural spike detection on large multi-electrode arrays.

    Science.gov (United States)

    Mena, Gonzalo E; Grosberg, Lauren E; Madugula, Sasidhar; Hottowy, Paweł; Litke, Alan; Cunningham, John; Chichilnisky, E J; Paninski, Liam

    2017-11-01

    Simultaneous electrical stimulation and recording using multi-electrode arrays can provide a valuable technique for studying circuit connectivity and engineering neural interfaces. However, interpreting these measurements is challenging because the spike sorting process (identifying and segregating action potentials arising from different neurons) is greatly complicated by electrical stimulation artifacts across the array, which can exhibit complex and nonlinear waveforms, and overlap temporarily with evoked spikes. Here we develop a scalable algorithm based on a structured Gaussian Process model to estimate the artifact and identify evoked spikes. The effectiveness of our methods is demonstrated in both real and simulated 512-electrode recordings in the peripheral primate retina with single-electrode and several types of multi-electrode stimulation. We establish small error rates in the identification of evoked spikes, with a computational complexity that is compatible with real-time data analysis. This technology may be helpful in the design of future high-resolution sensory prostheses based on tailored stimulation (e.g., retinal prostheses), and for closed-loop neural stimulation at a much larger scale than currently possible.

  14. Braided Multi-Electrode Probes (BMEPs) for Neural Interfaces

    Science.gov (United States)

    Kim, Tae Gyo

    Although clinical use of invasive neural interfaces is very limited, due to safety and reliability concerns, the potential benefits of their use in brain machine interfaces (BMIs) seem promising and so they have been widely used in the research field. Microelectrodes as invasive neural interfaces are the core tool to record neural activities and their failure is a critical issue for BMI systems. Possible sources of this failure are neural tissue motions and their interactions with stiff electrode arrays or probes fixed to the skull. To overcome these tissue motion problems, we have developed novel braided multi-electrode probes (BMEPs). By interweaving ultra-fine wires into a tubular braid structure, we obtained a highly flexible multi-electrode probe. In this thesis we described BMEP designs and how to fabricate BMEPs, and explore experiments to show the advantages of BMEPs through a mechanical compliance comparison and a chronic immunohistological comparison with single 50microm nichrome wires used as a reference electrode type. Results from the mechanical compliance test showed that the bodies of BMEPs have 4 to 21 times higher compliance than the single 50microm wire and the tethers of BMEPs were 6 to 96 times higher compliance, depending on combinations of the wire size (9.6microm or 12.7microm), the wire numbers (12 or 24), and the length of tether (3, 5 or 10 mm). Results from the immunohistological comparison showed that both BMEPs and 50microm wires anchored to the skull caused stronger tissue reactions than unanchored BMEPs and 50microm wires, and 50microm wires caused stronger tissue reactions than BMEPs. In in-vivo tests with BMEPs, we succeeded in chronic recordings from the spinal cord of freely jumping frogs and in acute recordings from the spinal cord of decerebrate rats during air stepping which was evoked by mesencephalic locomotor region (MLR) stimulation. This technology may provide a stable and reliable neural interface to spinal cord

  15. Cell growth characterization using multi-electrode bioimpedance spectroscopy

    International Nuclear Information System (INIS)

    Lu, Yi-Yu; Huang, Yu-Jie; Cheng, Kuo-Sheng; Huang, Ji-Jer

    2013-01-01

    Cell growth characterization during culturing is an important issue in a variety of biomedical applications. In this study an electrical bioimpedance spectroscopy-based multi-electrode culture monitoring system was developed to characterize cell growth. A PC12 cell line was cultured for the cell growth study. The bioimpedance variations for PC12 cell growth within the initial 12 h were measured over a range between 1 kHz and 4 MHz at three different medium concentrations. Within this frequency range, the largest bioimpedance value was 1.9 times the smallest bioimpedance value. The phase angle decreased over the range from 1 to 10 kHz when cells were growing. Then, the phase angle approached a constant over the frequency range between 10 kHz and 2 MHz. Thereafter, the phase angle increased rapidly from 20 to 52 degrees during cell culturing between 8 and 12 h at 4 MHz. The maximum cell number after culturing for 12 h increased by 25.8% for the control sites with poly-D-lysine (PDL) pastes. For the normal growth factor, the cell number increased up to 4.78 times from 8 to 12 h, but only 0.96 and 1.60 times for the other two medium growth factors. The correlation coefficients between impedance and cell number were 0.868 (coating with PDL), and 0.836 (without PDL) for the normal concentration medium. Thus, impedance may be used as an index for cell growth characterization. (paper)

  16. Improving Impedance of Implantable Microwire Multi-Electrode Arrays by Ultrasonic Electroplating of Durable Platinum Black

    Science.gov (United States)

    Desai, Sharanya Arcot; Rolston, John D.; Guo, Liang; Potter, Steve M.

    2010-01-01

    Implantable microelectrode arrays (MEAs) have been a boon for neural stimulation and recording experiments. Commercially available MEAs have high impedances, due to their low surface area and small tip diameters, which are suitable for recording single unit activity. Lowering the electrode impedance, but preserving the small diameter, would provide a number of advantages, including reduced stimulation voltages, reduced stimulation artifacts and improved signal-to-noise ratio. Impedance reductions can be achieved by electroplating the MEAs with platinum (Pt) black, which increases the surface area but has little effect on the physical extent of the electrodes. However, because of the low durability of Pt black plating, this method has not been popular for chronic use. Sonicoplating (i.e. electroplating under ultrasonic agitation) has been shown to improve the durability of Pt black on the base metals of macro-electrodes used for cyclic voltammetry. This method has not previously been characterized for MEAs used in chronic neural implants. We show here that sonicoplating can lower the impedances of microwire multi-electrode arrays (MMEA) by an order of magnitude or more (depending on the time and voltage of electroplating), with better durability compared to pulsed plating or traditional DC methods. We also show the improved stimulation and recording performance that can be achieved in an in vivo implantation study with the sonicoplated low-impedance MMEAs, compared to high-impedance unplated electrodes. PMID:20485478

  17. Methods for Cervical Cancer Screening

    Directory of Open Access Journals (Sweden)

    Tatiana Vargas-Revilla

    2014-12-01

    This article is divided in three sections: the first one focuses on the general impact of cervical cancer has hadin CostaRica, these condsection gathers information about different methodologies used around the world to detect this cancer and the third one makes reference to the current development of the screening devise in Mexico that works as a monitoring system and can used by women without external assistance.

  18. Methods for simulating turbulent phase screen

    International Nuclear Information System (INIS)

    Zhang Jianzhu; Zhang Feizhou; Wu Yi

    2012-01-01

    Some methods for simulating turbulent phase screen are summarized, and their characteristics are analyzed by calculating the phase structure function, decomposing phase screens into Zernike polynomials, and simulating laser propagation in the atmosphere. Through analyzing, it is found that, the turbulent high-frequency components are well contained by those phase screens simulated by the FFT method, but the low-frequency components are little contained. The low-frequency components are well contained by screens simulated by Zernike method, but the high-frequency components are not contained enough. The high frequency components contained will be improved by increasing the order of the Zernike polynomial, but they mainly lie in the edge-area. Compared with the two methods above, the fractal method is a better method to simulate turbulent phase screens. According to the radius of the focal spot and the variance of the focal spot jitter, there are limitations in the methods except the fractal method. Combining the FFT and Zernike method or combining the FFT method and self-similar theory to simulate turbulent phase screens is an effective and appropriate way. In general, the fractal method is probably the best way. (authors)

  19. LANL seismic screening method for existing buildings

    International Nuclear Information System (INIS)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O.

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method

  20. Unified selective sorting approach to analyse multi-electrode extracellular data

    Science.gov (United States)

    Veerabhadrappa, R.; Lim, C. P.; Nguyen, T. T.; Berk, M.; Tye, S. J.; Monaghan, P.; Nahavandi, S.; Bhatti, A.

    2016-01-01

    Extracellular data analysis has become a quintessential method for understanding the neurophysiological responses to stimuli. This demands stringent techniques owing to the complicated nature of the recording environment. In this paper, we highlight the challenges in extracellular multi-electrode recording and data analysis as well as the limitations pertaining to some of the currently employed methodologies. To address some of the challenges, we present a unified algorithm in the form of selective sorting. Selective sorting is modelled around hypothesized generative model, which addresses the natural phenomena of spikes triggered by an intricate neuronal population. The algorithm incorporates Cepstrum of Bispectrum, ad hoc clustering algorithms, wavelet transforms, least square and correlation concepts which strategically tailors a sequence to characterize and form distinctive clusters. Additionally, we demonstrate the influence of noise modelled wavelets to sort overlapping spikes. The algorithm is evaluated using both raw and synthesized data sets with different levels of complexity and the performances are tabulated for comparison using widely accepted qualitative and quantitative indicators. PMID:27339770

  1. Safety of atrial fibrillation ablation with novel multi-electrode array catheters on uninterrupted anticoagulation-a single-center experience.

    LENUS (Irish Health Repository)

    Hayes, Christopher Ruslan

    2012-02-01

    INTRODUCTION: A recent single-center report indicated that the performance of atrial fibrillation ablation in patients on uninterrupted warfarin using a conventional deflectable tip electrode ablation catheter may be as safe as periprocedural discontinuation of warfarin and bridging with heparin. Novel multi-electrode array catheters for atrial fibrillation ablation are currently undergoing clinical evaluation. While offering the possibility of more rapid atrial fibrillation ablation, they are stiffer and necessitate the deployment of larger deflectable transseptal sheaths, and it remains to be determined if they increase the risk of cardiac perforation and vascular injury. Such potential risks would have implications for a strategy of uninterrupted periprocedural anticoagulation. METHOD AND RESULTS: We audited the safety outcomes of our atrial fibrillation ablation procedures using multi-electrode array ablation catheters in patients on uninterrupted warfarin (CHADS2 score>or=2) and in patients not on warfarin (uninterrupted aspirin). Two bleeding complications occurred in 49 patients on uninterrupted warfarin, both of which were managed successfully without longterm sequelae, and no bleeding complication occurred in 32 patients not on warfarin (uninterrupted aspirin). There were no thromboembolic events or other complication with either anticoagulant regimen. CONCLUSION: Despite the larger diameter and increased stiffness of multi-electrode array catheters and their deflectable transseptal sheaths, their use for catheter ablation in patients with atrial fibrillation on uninterrupted warfarin in this single-center experience does not appear to be unsafe, and thus, an adequately powered multicenter prospective randomized controlled trial should be considered.

  2. Silicon/SU8 multi-electrode micro-needle for in vivo neurochemical monitoring.

    Science.gov (United States)

    Vasylieva, Natalia; Marinesco, Stéphane; Barbier, Daniel; Sabac, Andrei

    2015-10-15

    Simultaneous monitoring of glucose and lactate is an important challenge for understanding brain energetics in physiological or pathological states. We demonstrate here a versatile method based on a minimally invasive single implantation in the rat brain. A silicon/SU8-polymer multi-sensing needle-shaped biosensor, was fabricated and tested. The multi-electrode array design comprises three platinum planar microelectrodes with a surface area of 40 × 200 µm(2) and a spacing of 200 µm, which were micromachined on a single 3mm long micro-needle having a 100 × 50 µm(2) cross-section for reduced tissue damage during implantation. Platinum micro-electrodes were aligned at the bottom of micro-wells obtained by photolithography on a SU8 photoresist layer. After clean room processing, each micro-electrode was functionalized inside the micro-wells by means of a micro-dispensing device, either with glucose oxidase or with lactate oxidase, which were cross-linked on the platinum electrodes. The third electrode covered with Bovine Serum Albumin (BSA) was used for the control of non-specific currents. The thick SU8 photoresist layer has revealed excellent electrical insulation of the micro-electrodes and between interconnection lines, and ensured a precise localization and packaging of the sensing enzymes on platinum micro-electrodes. During in vitro calibration with concentrations of analytes in the mM range, the micro-wells patterned in the SU8 photoresist proved to be highly effective in eliminating cross-talk signals, caused by H2O2 diffusion from closely spaced micro-electrodes. Moreover, our biosensor was successfully assayed in the rat cortex for simultaneous monitoring of both glucose and lactate during insulin and glucose administration. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Genealogical series method. Hyperpolar points screen effect

    International Nuclear Information System (INIS)

    Gorbatov, A.M.

    1991-01-01

    The fundamental values of the genealogical series method -the genealogical integrals (sandwiches) have been investigated. The hyperpolar points screen effect has been found. It allows one to calculate the sandwiches for the Fermion systems with large number of particles and to ascertain the validity of the iterated-potential method as well. For the first time the genealogical-series method has been realized numerically for the central spin-independent potential

  4. Effects of grid potentials and geometric dimensions on the multi-electrode probe measurements

    International Nuclear Information System (INIS)

    Elakshar, F.F.; Abdul El-Raoof, W.S.

    1986-01-01

    A hollow anode plasma source is used to produce low temperature plasma which is injected into a magnetic field. The effects of the grid potentials, collector potential and geometric dimensions on multi-electrode probe measurements, in the presence of a magnetic field, are investigated. It is found that the collector potential plays a substantial role in the measurement of temperatures and densities. The finite-size of the geometric dimensions of the probe influences the data and high values of temperature are obtained when a small ratio of the discriminator grid radius to the separation distance is used, providing that the repeller grid potentials is low. Reliable measurements can only be obtained if the multi-electrode probe is used in the presence of a magnetic field strong enough to reduce electron Larmor radii to less than the grid mesh radius. (author)

  5. Ethylene Removal in Strong Electric Field Formed by Floating Multi-Electrode

    Science.gov (United States)

    Nagasawa, Takeshi

    Ethylene gas that contains the acetic acid ester element can be removed by applying the pulse voltage to the floating multi-electrode device. This phenomenon is caused in the weak discharge by the strong electric field between the narrow electrodes. This device is possible in very small electric power (apples, and 3.5ppm/30min for 2 melons. However, ethylene gas that doesn't contain the acetic acid ester cannot be removed (ex. ethylene pure gas and Japanese apricot).

  6. Integrated circuit amplifiers for multi-electrode intracortical recording.

    Science.gov (United States)

    Jochum, Thomas; Denison, Timothy; Wolf, Patrick

    2009-02-01

    Significant progress has been made in systems that interpret the electrical signals of the brain in order to control an actuator. One version of these systems senses neuronal extracellular action potentials with an array of up to 100 miniature probes inserted into the cortex. The impedance of each probe is high, so environmental electrical noise is readily coupled to the neuronal signal. To minimize this noise, an amplifier is placed close to each probe. Thus, the need has arisen for many amplifiers to be placed near the cortex. Commercially available integrated circuits do not satisfy the area, power and noise requirements of this application, so researchers have designed custom integrated-circuit amplifiers. This paper presents a comprehensive survey of the neural amplifiers described in publications prior to 2008. Methods to achieve high input impedance, low noise and a large time-constant high-pass filter are reviewed. A tutorial on the biological, electrochemical, mechanical and electromagnetic phenomena that influence amplifier design is provided. Areas for additional research, including sub-nanoampere electrolysis and chronic cortical heating, are discussed. Unresolved design concerns, including teraohm circuitry, electrical overstress and component failure, are identified.

  7. Tumour screening by means of tomography methods

    International Nuclear Information System (INIS)

    Diederich, S.

    2005-01-01

    Tomography methods such as computer tomography (CT), magnetic resonance tomography (MRT), and sonography/ultrasound examinations make it possible to detect small asymptomatic tumours, thus potentially preventing their manifestation at an advanced stage and improving survival prospects for the patients concerned. There are data available on various common tumours which show that modern tomography methods are capable of detecting not only small asymptomatic tumours but also their benign precursors (e.g. polyps of the large intestine). This has been demonstrated for lung cancer, colon cancer and breast cancer. However, it has not been possible to date to show for any tomography method or any type of tumour that the systematic use of such diagnostic procedures does anything to lower the mortality rate for that tumour. For other types of tumour (pancreatic cancer, kidney cancer, ovary cancer) the above named methods are either not sufficiently sensitive or the body of data that has accumulated on their respective use is too small to judge the benefit of tomography screenings. Current technical developments make it appear probable that for many types of cancer the reliability with which small tumours can be detected will improve in future. Studies aimed at clarifying the potential of screenings for reducing mortality rates are already underway for lung cancer and would be worthwhile performing for other tumour types

  8. QSAR Methods to Screen Endocrine Disruptors

    Directory of Open Access Journals (Sweden)

    Nicola Porta

    2016-08-01

    Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.

  9. Extraction of network topology from multi-electrode recordings: Is there a small-world effect?

    Directory of Open Access Journals (Sweden)

    Felipe eGerhard

    2011-02-01

    Full Text Available The simultaneous recording of the activity of many neurons poses challenges for multivariate data analysis. Here, we propose a general scheme of reconstruction of the functional network from spike train recordings. Effective, causal interactions are estimated by fitting Generalized Linear Models (GLMs on the neural responses, incorporating effects of the neurons' self-history, of input from other neurons in the recorded network and of modulation by an external stimulus. The coupling terms arising from synaptic input can be transformed by thresholding into a binary connectivity matrix which is directed. Each link between two neurons represents a causal influence from one neuron to the other, given the observation of all other neurons from the population. The resulting graph is analyzed with respect to small-world and scale-free properties using quantitative measures for directed networks. Such graph-theoretic analyses have been performed on many complex dynamic networks, including the connectivity structure between different brain areas. Only few studies have attempted to look at the structure of cortical neural networks on the level of individual neurons. Here, using multi-electrode recordings from the visual system of the awake monkey, we find that cortical networks lack scale-free behavior, but show a small, but significant small-world structure. Assuming a simple distance-dependent probabilistic wiring between neurons, we find that this connectivity structure can account for all of the networks' observed small-world-ness. Moreover, for multi-electrode recordings the sampling of neurons is not uniform across the population. We show that the small-world-ness obtained by such a localized sub-sampling overestimates the strength of the true small-world-structure of the network. This bias is likely to be present in all previous experiments based on multi-electrode recordings.

  10. An Investigation of Groundwater Flow on a Coastal Barrier using Multi Electrode Profiling

    DEFF Research Database (Denmark)

    Poulsen, Søren Erbs; Christensen, Steen; Rasmussen, Keld Rømer

    2008-01-01

    Preliminary geophysical and hydrogeological investigations indicate that multi-electrode profiling (MEP) can be used to monitor groundwater salinity on a coastal barrier where a shallow thin aquifer discharges to the North Sea. A monitoring system including five groups of piezometers and five MEP...... groundwater modeling we hope to be able to quantify how time varying recharge, tides, and storms hitting the barrier affect groundwater flow and discharge to the sea. At the conference we will present monitoring results from the winter and spring 2008....

  11. An automated online positioning system and simulation environment for multi-electrodes in extracellular recordings

    DEFF Research Database (Denmark)

    Franke, Felix; Natora, Michal; Meier, Philipp

    2010-01-01

    to tissue drifts and other sources of variability in the recording setup, the position of the electrodes with respect to the recorded neurons can change causing low recording quality. The contributions of this work are threefold. We introduce a quality measure for the recording position of the electrode...... which should be maximized during recordings and is especially suitable for the use of multi-electrodes. An automated positioning system based on this quality measure is proposed. The system is able to find favorable recording positions and adapts the electrode position smoothly to changes of the neuron...

  12. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    A new screening method for discovering antibacterial agents from filamentous fungi. ... African Journal of Biotechnology ... Keywords: Drug-resistant bacterial pathogens, novel antibiotics; screening method, filamentous fungi products ...

  13. Methods for Rapid Screening in Woody Plant Herbicide Development

    Directory of Open Access Journals (Sweden)

    William Stanley

    2014-07-01

    Full Text Available Methods for woody plant herbicide screening were assayed with the goal of reducing resources and time required to conduct preliminary screenings for new products. Rapid screening methods tested included greenhouse seedling screening, germinal screening, and seed screening. Triclopyr and eight experimental herbicides from Dow AgroSciences (DAS 313, 402, 534, 548, 602, 729, 779, and 896 were tested on black locust, loblolly pine, red maple, sweetgum, and water oak. Screening results detected differences in herbicide and species in all experiments in much less time (days to weeks than traditional field screenings and consumed significantly less resources (<500 mg acid equivalent per herbicide per screening. Using regression analysis, various rapid screening methods were linked into a system capable of rapidly and inexpensively assessing herbicide efficacy and spectrum of activity. Implementation of such a system could streamline early-stage herbicide development leading to field trials, potentially freeing resources for use in development of beneficial new herbicide products.

  14. Apparatus and method for radioactive waste screening

    Science.gov (United States)

    Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy

    2012-09-04

    An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.

  15. Binaural release from masking with single- and multi-electrode stimulation in children with cochlear implants.

    Science.gov (United States)

    Todd, Ann E; Goupell, Matthew J; Litovsky, Ruth Y

    2016-07-01

    Cochlear implants (CIs) provide children with access to speech information from a young age. Despite bilateral cochlear implantation becoming common, use of spatial cues in free field is smaller than in normal-hearing children. Clinically fit CIs are not synchronized across the ears; thus binaural experiments must utilize research processors that can control binaural cues with precision. Research to date has used single pairs of electrodes, which is insufficient for representing speech. Little is known about how children with bilateral CIs process binaural information with multi-electrode stimulation. Toward the goal of improving binaural unmasking of speech, this study evaluated binaural unmasking with multi- and single-electrode stimulation. Results showed that performance with multi-electrode stimulation was similar to the best performance with single-electrode stimulation. This was similar to the pattern of performance shown by normal-hearing adults when presented an acoustic CI simulation. Diotic and dichotic signal detection thresholds of the children with CIs were similar to those of normal-hearing children listening to a CI simulation. The magnitude of binaural unmasking was not related to whether the children with CIs had good interaural time difference sensitivity. Results support the potential for benefits from binaural hearing and speech unmasking in children with bilateral CIs.

  16. Binaural release from masking with single- and multi-electrode stimulation in children with cochlear implantsa)

    Science.gov (United States)

    Todd, Ann E.; Goupell, Matthew J.; Litovsky, Ruth Y.

    2016-01-01

    Cochlear implants (CIs) provide children with access to speech information from a young age. Despite bilateral cochlear implantation becoming common, use of spatial cues in free field is smaller than in normal-hearing children. Clinically fit CIs are not synchronized across the ears; thus binaural experiments must utilize research processors that can control binaural cues with precision. Research to date has used single pairs of electrodes, which is insufficient for representing speech. Little is known about how children with bilateral CIs process binaural information with multi-electrode stimulation. Toward the goal of improving binaural unmasking of speech, this study evaluated binaural unmasking with multi- and single-electrode stimulation. Results showed that performance with multi-electrode stimulation was similar to the best performance with single-electrode stimulation. This was similar to the pattern of performance shown by normal-hearing adults when presented an acoustic CI simulation. Diotic and dichotic signal detection thresholds of the children with CIs were similar to those of normal-hearing children listening to a CI simulation. The magnitude of binaural unmasking was not related to whether the children with CIs had good interaural time difference sensitivity. Results support the potential for benefits from binaural hearing and speech unmasking in children with bilateral CIs. PMID:27475132

  17. Braided multi-electrode probes: mechanical compliance characteristics and recordings from spinal cords

    Science.gov (United States)

    Kim, Taegyo; Branner, Almut; Gulati, Tanuj; Giszter, Simon F.

    2013-08-01

    Objective. To test a novel braided multi-electrode probe design with compliance exceeding that of a 50 µm microwire, thus reducing micromotion- and macromotion-induced tissue stress. Approach. We use up to 24 ultra-fine wires interwoven into a tubular braid to obtain a highly flexible multi-electrode probe. The tether-portion wires are simply non-braided extensions of the braid structure, allowing the microprobe to follow gross neural tissue movements. Mechanical calculation and direct measurements evaluated bending stiffness and axial compression forces in the probe and tether system. These were compared to 50 µm nichrome microwire standards. Recording tests were performed in decerebrate animals. Main results. Mechanical bending tests on braids comprising 9.6 or 12.7 µm nichrome wires showed that implants (braided portions) had 4 to 21 times better mechanical compliance than a single 50 µm wire and non-braided tethers were 6 to 96 times better. Braided microprobes yielded robust neural recordings from animals' spinal cords throughout cord motions. Significance. Microwire electrode arrays that can record and withstand tissue micro- and macromotion of spinal cord tissues are demonstrated. This technology may provide a stable chronic neural interface into spinal cords of freely moving animals, is extensible to various applications, and may reduce mechanical tissue stress.

  18. Clinical thermometry, using the 27 MHz multi-electrode current-source interstitial hyperthermia system in brain tumours

    International Nuclear Information System (INIS)

    Kaatee, Robert S.J.P.; Nowak, Peter C.J.M.; Zee, Jacoba van der; Bree, Jacob de; Kanis, Bart P.; Crezee, Hans; Levendag, Peter C.; Visser, Andries G.

    2001-01-01

    Background and purpose: In interstitial hyperthermia, temperature measurements are mainly performed inside heating applicators, and therefore, give the maximum temperatures of a rather heterogeneous temperature distribution. The problem of how to estimate lesion temperatures using the multi-electrode current-source interstitial hyperthermia (MECS-IHT) system in the brain was studied. Materials and methods: Temperatures were measured within the electrodes and in an extra catheter at the edge of a 4x4x4.5 cm 3 glioblastoma multiforme resection cavity. From the temperature decays during a power-off period, information was obtained about local maximum and minimum tissue temperatures. The significance of these data was examined through model calculations. Results: Maximum tissue temperatures could be estimated roughly by switching off all electrodes for about 5 s. Model calculations showed that the minimum tissue temperatures near a certain afterloading catheter correspond well with the temperature of the applicator inside, about 1 min after this applicator was switched off. Conclusions: Although the electrode temperatures read during heating are not suitable to assess the temperature distribution, it is feasible to heat the brain adequately using the MECS-IHT system with extra sensors outside the electrodes and/or application of decay methods

  19. A multi-electrode and pre-deformed bilayer spring structure electrostatic attractive MEMS actuator with large stroke at low actuation voltage

    International Nuclear Information System (INIS)

    Hu, Fangrong; Li, Zhi; Xiong, Xianming; Niu, Junhao; Peng, Zhiyong; Qian, Yixian; Yao, Jun

    2012-01-01

    This paper presents a multi-electrode and pre-deformed bilayer spring structure electrostatic attractive microelectromechanical systems (MEMS) actuator; it has large stroke at relatively low actuation voltage. Generally, electrostatic-attractive-force-based actuators have small stroke due to the instability resulted from the electrostatic ‘pull-in’ phenomenon. However, in many applications, the electrostatic micro-actuator with large stroke at low voltage is more preferred. By introducing a multi-electrode and a pre-deformed bilayer spring structure, an electrostatic attractive MEMS actuator with large stroke at very low actuation voltage has been successfully demonstrated in this paper. The actuator contains a central plate with a size of 300 µm × 300 µm × 1.5 µm and it is supported by four L-shaped bilayer springs which are pre-deformed due to residual stresses. Each bilayer spring is simultaneously attracted by three adjacent fixed electrodes, and the factors affecting the electrostatic attractive force are analyzed by a finite element analysis method. The prototype of the actuator is fabricated by poly-multi-user-MEMS-process (PolyMUMP) and the static performance is tested using a white light interferometer. The measured stroke of the actuator reaches 2 µm at 13 V dc, and it shows a good agreement with the simulation. (paper)

  20. Commercialisation of CMOS Integrated Circuit Technology in Multi-Electrode Arrays for Neuroscience and Cell-Based Biosensors

    Directory of Open Access Journals (Sweden)

    Chris R. Bowen

    2011-05-01

    Full Text Available The adaptation of standard integrated circuit (IC technology as a transducer in cell-based biosensors in drug discovery pharmacology, neural interface systems and electrophysiology requires electrodes that are electrochemically stable, biocompatible and affordable. Unfortunately, the ubiquitous Complementary Metal Oxide Semiconductor (CMOS IC technology does not meet the first of these requirements. For devices intended only for research, modification of CMOS by post-processing using cleanroom facilities has been achieved. However, to enable adoption of CMOS as a basis for commercial biosensors, the economies of scale of CMOS fabrication must be maintained by using only low-cost post-processing techniques. This review highlights the methodologies employed in cell-based biosensor design where CMOS-based integrated circuits (ICs form an integral part of the transducer system. Particular emphasis will be placed on the application of multi-electrode arrays for in vitro neuroscience applications. Identifying suitable IC packaging methods presents further significant challenges when considering specific applications. The various challenges and difficulties are reviewed and some potential solutions are presented.

  1. Design and manufacture of multi-electrode ion chamber for absolute photon-flux measurements of soft x-rays

    International Nuclear Information System (INIS)

    Yoshigoe, Akitaka; Teraoka, Yuden

    2001-03-01

    In order to measure the absolute photon-flux of soft x-rays at the photon energy region from 500 eV to 1500 eV, a sealed gas ion chamber with multi-electrodes was designed and manufactured. Actually we succeeded in measuring the photon-flux at the soft x-ray beamline, BL23SU, in the SPring-8. This report concretely describes the design and the adjustment of the sealed gas ion chamber with multi-electrodes. (author)

  2. A split microdrive for simultaneous multi-electrode recordings from two brain areas in awake small animals.

    NARCIS (Netherlands)

    Lansink, C.S.; Bakker, M.; Buster, W.; Lankelma, J.; van der Blom, R.; Westdorp, R.; Joosten, R.N.J.M.A.; Mc.Naughton, B.L.; Pennartz, C.M.A.

    2007-01-01

    Complex cognitive operations such as memory formation and decision-making are thought to be mediated not by single, isolated brain structures but by multiple, connected brain areas. To facilitate studies on the neural communication between connected brain structures, we developed a multi-electrode

  3. Solubility tests and the peripheral blood film method for screening ...

    African Journals Online (AJOL)

    Objective. To determine the cost benefit of screening for sicklecell disease among infants at district health centres in Uganda using sickling, solubility tests and the peripheral blood film method. Methods. Pilot screening services were established at district health centres. Cost benefit analysis (CBA) was performed in four ...

  4. High throughput screening method for assessing heterogeneity of microorganisms

    NARCIS (Netherlands)

    Ingham, C.J.; Sprenkels, A.J.; van Hylckama Vlieg, J.E.T.; Bomer, Johan G.; de Vos, W.M.; van den Berg, Albert

    2006-01-01

    The invention relates to the field of microbiology. Provided is a method which is particularly powerful for High Throughput Screening (HTS) purposes. More specific a high throughput method for determining heterogeneity or interactions of microorganisms is provided.

  5. Classification of functional interactions from multi-electrodes data using conditional modularity analysis

    Science.gov (United States)

    Makhtar, Siti Noormiza; Senik, Mohd Harizal

    2018-02-01

    The availability of massive amount of neuronal signals are attracting widespread interest in functional connectivity analysis. Functional interactions estimated by multivariate partial coherence analysis in the frequency domain represent the connectivity strength in this study. Modularity is a network measure for the detection of community structure in network analysis. The discovery of community structure for the functional neuronal network was implemented on multi-electrode array (MEA) signals recorded from hippocampal regions in isoflurane-anaesthetized Lister-hooded rats. The analysis is expected to show modularity changes before and after local unilateral kainic acid (KA)-induced epileptiform activity. The result is presented using color-coded graphic of conditional modularity measure for 19 MEA nodes. This network is separated into four sub-regions to show the community detection within each sub-region. The results show that classification of neuronal signals into the inter- and intra-modular nodes is feasible using conditional modularity analysis. Estimation of segregation properties using conditional modularity analysis may provide further information about functional connectivity from MEA data.

  6. A new screening method for selection of desired recombinant ...

    African Journals Online (AJOL)

    A new screening method for selection of desired recombinant plasmids in molecular cloning. ... African Journal of Biotechnology ... Regarding the facts of this study, after digestion process, the products directly were subjected to ligation. Due to ...

  7. The evolving role of new imaging methods in breast screening.

    Science.gov (United States)

    Houssami, Nehmat; Ciatto, Stefano

    2011-09-01

    The potential to avert breast cancer deaths through screening means that efforts continue to identify methods which may enhance early detection. While the role of most new imaging technologies remains in adjunct screening or in the work-up of mammography-detected abnormalities, some of the new breast imaging tests (such as MRI) have roles in screening groups of women defined by increased cancer risk. This paper highlights the evidence and the current role of new breast imaging technologies in screening, focusing on those that have broader application in population screening, including digital mammography, breast ultrasound in women with dense breasts, and computer-aided detection. It highlights that evidence on new imaging in screening comes mostly from non-randomised studies that have quantified test detection capability as adjunct to mammography, or have compared measures of screening performance for new technologies with that of conventional mammography. Two RCTs have provided high-quality evidence on the equivalence of digital and conventional mammography and on outcomes of screen-reading complemented by CAD. Many of these imaging technologies enhance cancer detection but also increase recall and false positives in screening. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. An alternative green screen keying method for film visual effects

    OpenAIRE

    Zhi, Jin

    2015-01-01

    This study focuses on a green screen keying method developed especially for film visual effects. There are a series of ways of using existing tools for creating mattes from green or blue screen plates. However, it is still a time-consuming process, and the results vary especially when it comes to retaining tiny details, such as hair and fur. This paper introduces an alternative concept and method for retaining edge details of characters on a green screen plate, also, a number of connected mat...

  9. Barbed channels enhance unidirectional connectivity between neuronal networks cultured on multi electrode arrays

    Science.gov (United States)

    le Feber, Joost; Postma, Wybren; de Weerd, Eddy; Weusthof, Marcel; Rutten, Wim L. C.

    2015-01-01

    Cultured neurons on multi electrode arrays (MEAs) have been widely used to study various aspects of neuronal (network) functioning. A possible drawback of this approach is the lack of structure in these networks. At the single cell level, several solutions have been proposed to enable directed connectivity, and promising results were obtained. At the level of connected sub-populations, a few attempts have been made with promising results. First assessment of the designs' functionality, however, suggested room for further improvement. We designed a two chamber MEA aiming to create a unidirectional connection between the networks in both chambers (“emitting” and “receiving”). To achieve this unidirectionality, all interconnecting channels contained barbs that hindered axon growth in the opposite direction (from receiving to emitting chamber). Visual inspection showed that axons predominantly grew through the channels in the promoted direction. This observation was confirmed by spontaneous activity recordings. Cross-correlation between the signals from two electrodes inside the channels suggested signal propagation at ≈2 m/s from emitting to receiving chamber. Cross-correlation between the firing patterns in both chambers indicated that most correlated activity was initiated in the emitting chamber, which was also reflected by a significantly lower fraction of partial bursts (i.e., a one-chamber-only burst) in the emitting chamber. Finally, electrical stimulation in the emitting chamber induced a fast response in that chamber, and a slower response in the receiving chamber. Stimulation in the receiving chamber evoked a fast response in that chamber, but no response in the emitting chamber. These results confirm the predominantly unidirectional nature of the connecting channels from emitting to receiving chamber. PMID:26578869

  10. Barbed channels enhance unidirectional connectivity between neuronal networks cultured on multi electrode arrays.

    Directory of Open Access Journals (Sweden)

    Joost eLe Feber

    2015-11-01

    Full Text Available Cultured neurons on multi electrode arrays (MEAs have been widely used to study various as-pects of neuronal (network functioning. A possible drawback of this approach is the lack of structure in these networks. At the single cell level, several solutions have been proposed to ena-ble directed connectivity, and promising results were obtained. At the level of connected sub-populations, a few attempts have been made with promising results. First assessment of the de-signs’ functionality, however, suggested room for further improvement.We designed a two chamber MEA aiming to create a unidirectional connection between the net-works in both chambers (‘emitting’ and ‘receiving’. To achieve this unidirectionality, all inter-connecting channels contained barbs that hindered axon growth in the opposite direction (from receiving to emitting chamber. Visual inspection showed that axons predominantly grew through the channels in the promoted direction . This observation was confirmed by spontaneous activity recordings. Cross-correlation between the signals from two electrodes inside the channels suggested signal propagation at ≈2 m/s from emitting to receiving chamber. Cross-correlation between the firing patterns in both chambers indicated that most correlated activity was initiated in the emitting chamber, which was also reflected by a significantly lower fraction of partial bursts (e. a one-chamber-only burst in the emitting chamber. Finally, electrical stimulation in the emitting chamber induced a fast response in that chamber, and a slower response in the receiving chamber. Stimulation in the receiving chamber evoked a fast response in that chamber, but no response in the emitting chamber. These results confirm the predominantly unidirectional nature of the connecting channels from emitting to receiving chamber.

  11. In vitro extracellular recording and stimulation performance of nanoporous gold-modified multi-electrode arrays

    Science.gov (United States)

    Kim, Yong Hee; Kim, Gook Hwa; Kim, Ah Young; Han, Young Hwan; Chung, Myung-Ae; Jung, Sang-Don

    2015-12-01

    Objective. Nanoporous gold (Au) structures can reduce the impedance and enhance the charge injection capability of multi-electrode arrays (MEAs) used for interfacing neuronal networks. Even though there are various nanoporous Au preparation techniques, fabrication of MEA based on low-cost electro-codeposition of Ag:Au has not been performed. In this work, we have modified a Au MEA via the electro-codeposition of Ag:Au alloy, followed by the chemical etching of Ag, and report on the in vitro extracellular recording and stimulation performance of the nanoporous Au-modified MEA. Approach. Ag:Au alloy was electro-codeposited on a bilayer lift-off resist sputter-deposition passivated Au MEA followed by chemical etching of Ag to form a porous Au structure. Main results. The porous Au structure was analyzed by scanning electron microscopy and tunneling electron microscopy and found to have an interconnected nanoporous Au structure. The impedance value of the nanoporous Au-modified MEA is 15.4 ± 0.55 kΩ at 1 kHz, accompanied by the base noise V rms of 2.4 ± 0.3 μV. The charge injection limit of the nanoporous Au-modified electrode estimated from voltage transient measurement is approximately 1 mC cm-2, which is comparable to roughened platinum and carbon nanotube electrodes. The charge injection capability of the nanoporous Au-modified MEA was confirmed by observing stimulus-induced spikes at above 0.2 V. The nanoporous Au-modified MEA showed mechanical durability upon ultrasonic treatment for up to an hour. Significance. Electro-codeposition of Ag:Au alloy combined with chemical etching Ag is a low-cost process for fabricating nanoporous Au-modified MEA suitable for establishing the stimulus-response relationship of cultured neuronal networks.

  12. In vitro extracellular recording and stimulation performance of nanoporous gold-modified multi-electrode arrays.

    Science.gov (United States)

    Kim, Yong Hee; Kim, Gook Hwa; Kim, Ah Young; Han, Young Hwan; Chung, Myung-Ae; Jung, Sang-Don

    2015-12-01

    Nanoporous gold (Au) structures can reduce the impedance and enhance the charge injection capability of multi-electrode arrays (MEAs) used for interfacing neuronal networks. Even though there are various nanoporous Au preparation techniques, fabrication of MEA based on low-cost electro-codeposition of Ag:Au has not been performed. In this work, we have modified a Au MEA via the electro-codeposition of Ag:Au alloy, followed by the chemical etching of Ag, and report on the in vitro extracellular recording and stimulation performance of the nanoporous Au-modified MEA. Ag:Au alloy was electro-codeposited on a bilayer lift-off resist sputter-deposition passivated Au MEA followed by chemical etching of Ag to form a porous Au structure. The porous Au structure was analyzed by scanning electron microscopy and tunneling electron microscopy and found to have an interconnected nanoporous Au structure. The impedance value of the nanoporous Au-modified MEA is 15.4 ± 0.55 kΩ at 1 kHz, accompanied by the base noise V rms of 2.4 ± 0.3 μV. The charge injection limit of the nanoporous Au-modified electrode estimated from voltage transient measurement is approximately 1 mC cm(-2), which is comparable to roughened platinum and carbon nanotube electrodes. The charge injection capability of the nanoporous Au-modified MEA was confirmed by observing stimulus-induced spikes at above 0.2 V. The nanoporous Au-modified MEA showed mechanical durability upon ultrasonic treatment for up to an hour. Electro-codeposition of Ag:Au alloy combined with chemical etching Ag is a low-cost process for fabricating nanoporous Au-modified MEA suitable for establishing the stimulus-response relationship of cultured neuronal networks.

  13. Carrier-interleaved orthogonal multi-electrode multi-carrier resistivity-measurement tool

    International Nuclear Information System (INIS)

    Cai, Yu; Sha, Shuang

    2016-01-01

    This paper proposes a new carrier-interleaved orthogonal multi-electrode multi-carrier resistivity-measurement tool used in a cylindrical borehole environment during oil-based mud drilling processes. The new tool is an orthogonal frequency division multiplexing access-based contactless multi-measurand detection tool. The tool can measure formation resistivity in different azimuthal angles and elevational depths. It can measure many more measurands simultaneously in a specified bandwidth than the legacy frequency division multiplexing multi-measurand tool without a channel-select filter while avoiding inter-carrier interference. The paper also shows that formation resistivity is not sensitive to frequency in certain frequency bands. The average resistivity collected from N subcarriers can increase the measurement of the signal-to-noise ratio (SNR) by N times given no amplitude clipping in the current-injection electrode. If the clipping limit is taken into account, with the phase rotation of each single carrier, the amplitude peak-to-average ratio can be reduced by 3 times, and the SNR can achieve a 9/ N times gain over the single-carrier system. The carrier-interleaving technique is also introduced to counter the carrier frequency offset (CFO) effect, where the CFO will cause inter-pad interference. A qualitative analysis and simulations demonstrate that block-interleaving performs better than tone-interleaving when coping with a large CFO. The theoretical analysis also suggests that increasing the subcarrier number can increase the measurement speed or enhance elevational resolution without sacrificing receiver performance. The complex orthogonal multi-pad multi-carrier resistivity logging tool, in which all subcarriers are complex signals, can provide a larger available subcarrier pool than other types of transceivers. (paper)

  14. Action potential propagation recorded from single axonal arbors using multi-electrode arrays.

    Science.gov (United States)

    Tovar, Kenneth R; Bridges, Daniel C; Wu, Bian; Randall, Connor; Audouard, Morgane; Jang, Jiwon; Hansma, Paul K; Kosik, Kenneth S

    2018-04-11

    We report the presence of co-occurring extracellular action potentials (eAPs) from cultured mouse hippocampal neurons among groups of planar electrodes on multi-electrode arrays (MEAs). The invariant sequences of eAPs among co-active electrode groups, repeated co-occurrences and short inter-electrode latencies are consistent with action potential propagation in unmyelinated axons. Repeated eAP co-detection by multiple electrodes was widespread in all our data records. Co-detection of eAPs confirms they result from the same neuron and allows these eAPs to be isolated from all other spikes independently of spike sorting algorithms. We averaged co-occurring events and revealed additional electrodes with eAPs that would otherwise be below detection threshold. We used these eAP cohorts to explore the temperature sensitivity of action potential propagation and the relationship between voltage-gated sodium channel density and propagation velocity. The sequence of eAPs among co-active electrodes 'fingerprints' neurons giving rise to these events and identifies them within neuronal ensembles. We used this property and the non-invasive nature of extracellular recording to monitor changes in excitability at multiple points in single axonal arbors simultaneously over several hours, demonstrating independence of axonal segments. Over several weeks, we recorded changes in inter-electrode propagation latencies and ongoing changes in excitability in different regions of single axonal arbors. Our work illustrates how repeated eAP co-occurrences can be used to extract physiological data from single axons with low electrode density MEAs. However, repeated eAP co-occurrences leads to over-sampling spikes from single neurons and thus can confound traditional spike-train analysis.

  15. Statistical methods for determining the effect of mammography screening

    DEFF Research Database (Denmark)

    Lophaven, Søren

    2016-01-01

    In an overview of five randomised controlled trials from Sweden, a reduction of 29% was found in breast cancer mortality in women aged 50-69 at randomisation after a follow up of 5-13 years. Organised, population based, mammography service screening was introduced on the basis of these resultsin...... in 2007-2008. Women aged 50-69 were invited to screening every second year. Taking advantage of the registers of population and health, we present statistical methods for evaluating the effect of mammography screening on breast cancer mortality (Olsen et al. 2005, Njor et al. 2015 and Weedon-Fekjær etal...

  16. SCREENING METHODS FOR THE DETECTION OF CARTELS

    Directory of Open Access Journals (Sweden)

    Mihail BUŞU

    2014-06-01

    Full Text Available During their everyday activities, the economic operators conclude a multitude of agreements in tacit or written form, such as: contracts or conventions. Some of these arrangements are absolutely necessary for the development of their current activities. These are agreements which, by respecting the rules of competition, are able to bring benefits to consumers and to the entire economy, as a whole. On the other hand, the economic operators often conclude agreements which are harmful to the economy as well as to the consumers, violating the competition rules. Some examples in this respect are: operators’ agreements on price fixing, on market or customers sharing. Before investigating the violation of competition rules, the relevant authorities should identify the possibility of the existence of such illegalities. The theoretical models for detecting the cartels do represent a proactive tool concerning the antitrust activity of competition authorities. The present paper furnishes a review of the methods for detecting cartels as well as a part of their practical application.

  17. A screening method for banana weevil ( Cosmopolites sordidus ...

    African Journals Online (AJOL)

    The banana weevil (Cosmopolites sordidus Germar) is a serious pest in most banana-growing areas of the world. Host-plant resistance is considered to be the most feasible and sustainable method for its control. However, a quick and effective method for screening banana genotypes for resistance against the banana ...

  18. Evaluation and use of regenerative multi electrode interfaces in peripheral nerves

    Science.gov (United States)

    Desai, Vidhi

    Peripheral nerves offer unique accessibility to the innate motor and sensory pathways that can be interfaced with high degree of selectivity for intuitive and bidirectional control of advanced upper extremity prosthetic limbs. Several peripheral nerve interfaces have been proposed and investigated over the last few decades with significant progress made in the area of sensory feedback. However, clinical translation still remains a formidable challenge due to the lack of long term recordings. Prominent causes include signal degradation, eventual interface failures, and lack of specificity in the low amplitude nerve signals. This dissertation evaluates the capabilities of the newly developed Regenerative Multi-electrode Interface (REMI) by the characterization of signal quality progression, the identification of interfaced axon types, and the demonstration of "functional linkage" between acquired signals and target organs. Chapter 2 details the chronic recording of high quality signals from REMI in sciatic nerve which remained stable over a 120 day implantation period indicative of minimal ongoing tissue response with no detrimental effects on the recording ability. The dominant cause of failures was attributable to abiotic factors pertaining to the connector/wire breakage, observed in 76% of REMI implants. Also, the REMI implants had 20% higher success rate and significantly larger Signal to Noise Ratio (SNR) in comparison to the Utah Slanted Electrode Array (USEA). Chapter 3 describes the successful feasibility of interfacing with motor and sensory axons by REMI implantation in the tibial and sural fascicles of the sciatic nerve. A characteristic sampling bias towards recording signals from medium-to-large diameter axons that are primarily involved in mechanoception and proprioception sensory functions was uncovered. Specific bursting units (Inter Spike Interval of 30-70ms) were observed most frequently from the tibial fascicle during bipedal locomotion. Chapter 4

  19. Screening-Level Ecological Risk Assessment Methods, Revision 3

    Energy Technology Data Exchange (ETDEWEB)

    Mirenda, Richard J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2012-08-16

    This document provides guidance for screening-level assessments of potential adverse impacts to ecological resources from release of environmental contaminants at the Los Alamos National Laboratory (LANL or the Laboratory). The methods presented are based on two objectives, namely: to provide a basis for reaching consensus with regulators, managers, and other interested parties on how to conduct screening-level ecological risk investigations at the Laboratory; and to provide guidance for ecological risk assessors under the Environmental Programs (EP) Directorate. This guidance promotes consistency, rigor, and defensibility in ecological screening investigations and in reporting those investigation results. The purpose of the screening assessment is to provide information to the risk managers so informed riskmanagement decisions can be made. This document provides examples of recommendations and possible risk-management strategies.

  20. Down syndrome screening methods in Iranian pregnant women

    Directory of Open Access Journals (Sweden)

    Azizeh Farshbaf Khalili

    2012-08-01

    Full Text Available Introduction: Down syndrome is one of the most prevalent genetic diseases. Screening methods for this syndrome are easy and safe and are recommended to all pregnant wom-en particularly mothers over 35 years of age. This study aimed to review the status of Down syndrome screening and related factors in Iranian pregnant women. Methods: This descriptive analytical study was carried out in 2011. It included 400 women who were randomly selected from those referring to Alzahra Hospital (Tabriz, Iran during their third trimester of pregnancy. Data was collected through a question-naire whose reliability and validity have been approved. The data was analyzed by chi-square test in SPSS13. Results: The results showed that while 28 and 26 women imple-mented screening tests during the first and second trimesters, respectively, only 5 sub-jects benefited from both (integrated test. Chi-square test showed significant correla-tions between the implementation of screening methods and age, education level, in-come, and the location of prenatal care (p < 0.05. Conclusion: The findings of the present study showed women to poorly implement Down syndrome screening methods. Therefore, the necessity of providing appropriate educational programs for health staff and mothers seems undeniable. Moreover, paying attention to the related factors such as income, educational level, and adequate training of mothers during pregnancy is essential.

  1. LC-MS (/MS) in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Hochstrasser, Denis; Fathi, Marc

    2012-01-01

    Toxicological screening is the analysis of biological samples to detect and identify unknown compounds. The high selectivity and sensitivity of liquid chromatography (LC) coupled to mass spectrometry (MS) or tandem mass spectrometry (MS/MS) technology provide an attractive alternative to the current methods (LC-UV, GC/MS, etc.). For these reasons, an increasing number of applications are being published. This paper is a brief overview of LC-MS(/MS) screening methods developed for clinical toxicology in recent years. Various sample treatments, chromatographic separations and detection by mass spectrometry can be combined to obtain screening methods adapted to the constraints and needs of clinical toxicology laboratories. Currently the techniques are in the hands of specialists, mainly in academic institutions. However, the evolution in technology should allow application of these techniques as a tool in toxicology laboratories, thus allowing a more widespread exploitation of their potential.

  2. Microfluidic in-channel multi-electrode platform for neurotransmitter sensing

    Science.gov (United States)

    Kara, A.; Mathault, J.; Reitz, A.; Boisvert, M.; Tessier, F.; Greener, J.; Miled, A.

    2016-03-01

    In this project we present a microfluidic platform with in-channel micro-electrodes for in situ screening of bio/chemical samples through a lab-on-chip system. We used a novel method to incorporate electrochemical sensors array (16x20) connected to a PCB, which opens the way for imaging applications. A 200 μm height microfluidic channel was bonded to electrochemical sensors. The micro-channel contains 3 inlets used to introduce phosphate buffer saline (PBS), ferrocynide and neurotransmitters. The flow rate was controlled through automated micro-pumps. A multiplexer was used to scan electrodes and perform individual cyclic voltammograms by a custom potentiostat. The behavior of the system was linear in terms of variation of current versus concentration. It was used to detect the neurotransmitters serotonin, dopamine and glutamate.

  3. Determination of bisphenol A in human serum by high-performance liquid chromatography with multi-electrode electrochemical detection.

    Science.gov (United States)

    Inoue, K; Kato, K; Yoshimura, Y; Makino, T; Nakazawa, H

    2000-11-10

    A simple and sensitive method using high-performance liquid chromatography with multi-electrode electrochemical detection (HPLC-ED) including a coulometric array of four electrochemical sensors has been developed for the determination of bisphenol A in water and human serum. For good separation and detection of bisphenol A, a CAPCELL PAK UG 120 C18 reversed-phase column and a mobile phase consisting of 0.3% phosphoric acid-acetonitrile (60:40) were used. The detection limit obtained by the HPLC-ED method was 0.01 ng/ml (0.5 pg), which was more than 3000-times higher than the detection limit obtained by the ultraviolet (UV) method, and more than 200-times higher than the detection limit obtained by the fluorescence (FL) method. Bisphenol A in water and serum samples was pretreated by solid-phase extraction (SPE) after removing possible contamination derived from a plastic SPE cartridges and water used for the pretreatment. A trace amount (ND approximately 0.013 ng/ml) of bisphenol A was detected from the parts of cartridges (filtration column, sorbent bed and frits) by extraction with methanol, and it was completely removed by washing with at least 15 ml of methanol in the operation process. The concentrations of bisphenol A in tap water and Milli-Q-purified water were found to be 0.01 and 0.02 ng/ml, respectively. For that reason, bisphenol A-free water was made to trap bisphenol A in water using an Empore disk. In every pretreatment, SPE methods using bisphenol A-free water and washing with 15 ml of methanol were done in water and serum samples. The yields obtained from the recovery tests using water to which 0.5 or 0.05 ng/ml of bisphenol A was added were 83.8 to 98.2%, and the RSDs were 3.4 to 6.1%, respectively. The yields obtained from the recovery tests by OASIS HLB using serum to which 1.0 ng/ml or 0.1 ng/ml of bisphenol A was added were 79.0% and 87.3%, and the RSDs were 5.1% and 13.5%, respectively. The limits of quantification in water and serum sample

  4. Using the Screened Coulomb Potential to Illustrate the Variational Method

    Science.gov (United States)

    Zuniga, Jose; Bastida, Adolfo; Requena, Alberto

    2012-01-01

    The screened Coulomb potential, or Yukawa potential, is used to illustrate the application of the single and linear variational methods. The trial variational functions are expressed in terms of Slater-type functions, for which the integrals needed to carry out the variational calculations are easily evaluated in closed form. The variational…

  5. Efficacy of screening methods used in breeding for black pod ...

    African Journals Online (AJOL)

    The disease affects the pods, beans, flower cushions, leaves, stems and roots. The objective of this study was to evaluate the efficacy of resistance screening methods used in breeding black pod disease resistance in cocoa. The resistance of cocoa leaves and pods to Phytophthora palmivora was investigated in twenty five ...

  6. In vitro screening methods for assessing plant disease resistance

    International Nuclear Information System (INIS)

    Lebeda, A.; Svabova, L.

    2010-01-01

    A combination of biotechnological and phytopathological techniques provides an alternative approach to classical resistance breeding methods. Such techniques have been increasingly used since the 1980s, in parallel with the progress in plant biotechnology. In the approach of resistance screening and selection in vitro, both experimental objects, i.e., the plant and the pathogen, must first be transferred to in vitro conditions, and finally, the plant material must be transferred back to in vivo conditions and adapted to the outside settings. Specific attention must be paid to the methods of pathogen preparation for use in screening and selection in vitro. The selection agents are classified according to their origin, the methods of preparation, nature and content of active substances, and effective utilisation for screening or selection in vitro. Basic principles and methodological aspects of the in vitro work (explant cultures, sources of in vitro variability, screening and selection methods, types of selection agents) as well as examples of practical applications in the breeding of different crops are critically reviewed in this chapter. (author)

  7. Complexity optimization and high-throughput low-latency hardware implementation of a multi-electrode spike-sorting algorithm.

    Science.gov (United States)

    Dragas, Jelena; Jackel, David; Hierlemann, Andreas; Franke, Felix

    2015-03-01

    Reliable real-time low-latency spike sorting with large data throughput is essential for studies of neural network dynamics and for brain-machine interfaces (BMIs), in which the stimulation of neural networks is based on the networks' most recent activity. However, the majority of existing multi-electrode spike-sorting algorithms are unsuited for processing high quantities of simultaneously recorded data. Recording from large neuronal networks using large high-density electrode sets (thousands of electrodes) imposes high demands on the data-processing hardware regarding computational complexity and data transmission bandwidth; this, in turn, entails demanding requirements in terms of chip area, memory resources and processing latency. This paper presents computational complexity optimization techniques, which facilitate the use of spike-sorting algorithms in large multi-electrode-based recording systems. The techniques are then applied to a previously published algorithm, on its own, unsuited for large electrode set recordings. Further, a real-time low-latency high-performance VLSI hardware architecture of the modified algorithm is presented, featuring a folded structure capable of processing the activity of hundreds of neurons simultaneously. The hardware is reconfigurable “on-the-fly” and adaptable to the nonstationarities of neuronal recordings. By transmitting exclusively spike time stamps and/or spike waveforms, its real-time processing offers the possibility of data bandwidth and data storage reduction.

  8. DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS

    International Nuclear Information System (INIS)

    HIGGINS, J.C.; O'HARA, J.M.; LEWIS, P.M.; PERSENSKY, J.; BONGARRA, J.

    2002-01-01

    DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS. THE U.S. NUCLEAR REGULATORY COMMISSION (NRC) REVIEWS THE HUMAN FACTORS ASPECTS OF PROPOSED LICENSE AMENDMENTS THAT IMPACT HUMAN ACTIONS THAT ARE CREDITED IN A PLANTS SAFETY ANALYSIS. THE STAFF IS COMMITTED TO A GRADED APPROACH TO THESE REVIEWS THAT FOCUS RESOURCES ON THE MOST RISK IMPORTANT CHANGES. THEREFORE, A RISK INFORMED SCREENING METHOD WAS DEVELOPED BASED ON AN ADAPTATION OF EXISTING GUIDANCE FOR RISK INFORMED REGULATION AND HUMAN FACTORS. THE METHOD USES BOTH QUANTITATIVE AND QUALITATIVE INFORMATION TO DIVIDE THE AMENDMENT REQUESTS INTO DIFFERENT LEVELS OF REVIEW. THE METHOD WAS EVALUATED USING A VARIETY OF TESTS. THIS PAPER WILL SUMMARIZE THE DEVELOPMENT OF THE METHODOLOGY AND THE EVALUATIONS THAT WERE PERFORMED TO VERIFY ITS USEFULNESS

  9. A deep learning method for early screening of lung cancer

    Science.gov (United States)

    Zhang, Kunpeng; Jiang, Huiqin; Ma, Ling; Gao, Jianbo; Yang, Xiaopeng

    2018-04-01

    Lung cancer is the leading cause of cancer-related deaths among men. In this paper, we propose a pulmonary nodule detection method for early screening of lung cancer based on the improved AlexNet model. In order to maintain the same image quality as the existing B/S architecture PACS system, we convert the original CT image into JPEG format image by analyzing the DICOM file firstly. Secondly, in view of the large size and complex background of CT chest images, we design the convolution neural network on basis of AlexNet model and sparse convolution structure. At last we train our models on the software named DIGITS which is provided by NVIDIA. The main contribution of this paper is to apply the convolutional neural network for the early screening of lung cancer and improve the screening accuracy by combining the AlexNet model with the sparse convolution structure. We make a series of experiments on the chest CT images using the proposed method, of which the sensitivity and specificity indicates that the method presented in this paper can effectively improve the accuracy of early screening of lung cancer and it has certain clinical significance at the same time.

  10. A novel test tube method of screening for hemoglobin E.

    Science.gov (United States)

    Tatu, T; Kasinrerk, W

    2012-02-01

    Hemoglobin (Hb) E is a β-structural variant common worldwide. This Hb disorder can form a compound heterozygous state with the β-thalassemia gene, leading to life-threatening hereditary hemolytic anemia, HbE/β-thalassemia. Screening of HbE has proven to be a challenging practice in prevention and control of the HbE/β-thalassemia. A novel test tube method for HbE screening using diethyl aminoethyl (DEAE)-cellulose resin was described. With the developed system, HbE/A(2) did not bind to the resin and remained dissolved in the supernatant, whereas other Hbs completely bound to the resin. The red color of the supernatant observed in the test tube indicated the presence of HbE. Colorless or markedly pale color of the supernatant indicates the absence of HbE. Accuracy and efficiency of the established method in detecting HbE was comparable with the standard cellulose acetate electrophoresis method. The developed method is cheap and simple with no requirement of sophisticated equipment. The reagent could be stored at 4 °C for up to 5 months. Hemolysate samples aged up to 5 months were still suitable for this test. The described novel test tube method could be an alternative method of mass population screening for HbE, particularly in small health care facilities. © 2011 Blackwell Publishing Ltd.

  11. Catheter-based renal denervation for resistant hypertension: Twenty-four month results of the EnligHTN I first-in-human study using a multi-electrode ablation system.

    Science.gov (United States)

    Tsioufis, Costas P; Papademetriou, Vasilios; Dimitriadis, Kyriakos S; Kasiakogias, Alexandros; Tsiachris, Dimitrios; Worthley, Matthew I; Sinhal, Ajay R; Chew, Derek P; Meredith, Ian T; Malaiapan, Yuvi; Thomopoulos, Costas; Kallikazaros, Ioannis; Tousoulis, Dimitrios; Worthley, Stephen G

    2015-12-15

    Long term safety and efficacy data of multi-electrode ablation system for renal denervation (RDN) in patients with drug resistant hypertension (dRHT) are limited. We studied 46 patients (age: 60 ± 10 years, 4.7 ± 1.0 antihypertensive drugs) with drug resistant hypertension (dRHT). Reduction in office BP at 24 months from baseline was -29/-13 mmHg, while the reduction in 24-hour ambulatory BP and in home BP at 24 months were -13/-7 mmHg and -11/-6 mmHg respectively (p<0.05 for all). A correlation analysis revealed that baseline office and ambulatory BP were related to the extent of office and ambulatory BP drop. Apart from higher body mass index (33.3 ± 4.7 vs 29.5 ± 6.2 kg/m(2), p<0.05), there were no differences in patients that were RDN responders defined as ≥10 mmHg decrease (74%, n=34) compared to non-responders. Stepwise logistic regression analysis revealed no prognosticators of RDN response (p=NS for all). At 24 months there were no new serious device or procedure related adverse events. The EnligHTN I study shows that the multi-electrode ablation system provides a safe method of RDN in dRHT accompanied by a clinically relevant and sustained BP reduction. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. Evaluating two methods of digital photography in retinopathy screening

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-02-01

    Full Text Available AIM:To evaluate the advantages of non-mydriatic fundus photography(NMFCSand mydriatic fundus photography(MFCSas eye-bottom screening and diagnosis methods in compared with gold standard fluorescein fundus angiography(FFA. METHODS: A total of 276 patients which involved in Chronic Diabetes Management Achieves within 4 streets of Pudong District Shanghai, were enrolled for diabetic retinopathy(DRexamination including NMFCS, MFCS and FFA. These DR examinations were proceeded after vision, slit-lamp and dioptroscopy tests, and reported by professionals. For those with suspicious fundus diseases, we would make appointments with specialist for further treatment. RESULTS: A total of 1104 colorful fundus images, and 1056 images(95.65%could be used to analyze. There were 408 appreciable images, 116 basically appreciable images and 28 unusable images in 552 NMFCS images. In addition, there were 432 appreciable images, 100 basically appreciable images and 20 unusable images in 552 MFCS images. There was no significant differences between NMFCS and MFCS(P>0.05. Compared with FFA with DRⅠ as the critical value, the specificity of digital photography for NMFCS was 95.71%, the sensitivity was 93.56%; however, MFCS are 95.43% and 98.02%. There was no statistically significant difference between the two screening methods(P>0.05. Compared with FFA with DRⅡ as the critical value, the specificity of digital photography for NMFCS was 95.35% and the sensitivity was 93.44%; however, for MFCS were 95.81% and 98.36%. There was no statistically significant difference between the two screening methods(P>0.05. CONCLUSION: Both NMFCS and MFCS could be used for the diagnosis and screening for eye diseases. NMFCS is easier and faster for digital photography, which is suitable for mass screening. MFCS is more likely to provide detailed information about the follow-up of the disease.

  13. Automatic teleaudiometry: a low cost method to auditory screening

    Directory of Open Access Journals (Sweden)

    Campelo, Victor Eulálio Sousa

    2010-03-01

    Full Text Available Introduction: The auditory screening' benefits has been demonstrated, however these programs has been restricted to the big centers. Objectives: (a Developing a auditory screening method to distance; (b Testing its accuracy and comparing to the screening audiometry test (AV. Method: The teleaudiometry (TA, consists in a developed software, installed in a computer with phone TDH39. It was realized a study in series in 73 individuals between 17 and 50 years, being 57,%% of the female sex, they were randomly selected between patients and companions of the Hospital das Clínicas. Before were subjected to a symptom questionnaire and otoscopy, the individuals realized the tests of TA AV, with scanning in 20dB in the frequencies of 1,2 and 4kHz following the ASHA (1997 protocol and to the gold standard test of audiometry of pure tones in soundproof booth in aleatory order. Results: the TA has lasted average 125+11s and the AV 65+18s. 69 individuals (94,5% declaring to be found difficult or very easy to performing the TA and 61 (83,6% have considered easy or very easy the AV. The accuracy results of TA and AV were respectively: sensibility (86,7% / 86,7%, specificity (75,9%/ 72,4% and negative predictive value (95,7% / 95,5%, positive predictive value (48,1% / 55,2%. Conclusion: The teleaudiometry has showed a good option as an auditory screening method, presenting accuracy next to screening audiometry. In comparison with this method, the teleaudiometry has presented a similar sensibility, major specificity, negative predictive value and endurance time and, under positive predictive value.

  14. [Screening methods for mild cognitive impairment in primary care].

    Science.gov (United States)

    Freire Pérez, Alberto

    2017-06-01

    Diagnosis of mild cognitive impairment (MCI) is always clinical and screening methods only indicate that the patient has a higher risk of this condition. In MCI, there is a slight decline in some cognitive abilities that does not affect activities of daily living and therefore does not produce social or occupational disability. The definitive diagnosis of MCI requires a considerable time investment that is very rarely possible to provide in primary care (PC) consultations. Hence the need for PC physicians to employ rapid and simple screening methods (brief cognitive assessment -BCA-) that allow objective identification of patients likely to have MCI in a few minutes. This article reviews the BCA tools that can truly be applied in less than 10 minutes. The phototest is a brief screening tool that is easy to use and interpret by physicians and is well accepted by patients. Consequently, it is one of the most useful tests in PC for screening of both MCI and dementia. In addition to BCA, instrumental activities of daily living scales should also be applied to differentiate MCI from dementia. Copyright © 2017 Sociedad Española de Geriatría y Gerontología. Publicado por Elsevier España, S.L.U. All rights reserved.

  15. Intravenous DSA as a screening method for cerebral aneurysms

    International Nuclear Information System (INIS)

    Fukaya, Hiroyuki; Sunami, Kaneo; Hoshi, Seiichiro; Komiya, Hirokazu; Saeki, Naokatsu.

    1990-01-01

    Intravenous DSA (IVDSA) was evaluated as a screening method for cerebral aneurysms. It was performed 390 times in 372 cases. Clinically useful images were obtained in 94.1% in all examinations. Nineteen aneurysms were visualized in cerebral angiography among 21 cases with SAH or 3rd nerve palsy, whereas in IVDSA 15 aneurysms were noted. Aneurysms not visualized in IVDSA were all 4 mm or less in size. Therefore, aneurysms, more than 4 mm in size, which have higher risks for rupture, were detectable in IVDSA. Based on these findings, IVDSA is considered to be clinically useful in screening for aneurysms. In all 372 cases, 33 aneurysms were suspected in IVDSA findings, whereas in cerebral angiography 21 of them turned to be aneurysms. Such 12 false positive cases were distributed mainly at anterior communicating and middle cerebral arteries. Improvement of image resolution, avoidance of vessel overlapping and proper selection of screened cases should be investigated for further development of this screening method. (author)

  16. Modeling granular phosphor screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, Panagiotis F.; Kandarakis, Ioannis S.; Cavouras, Dionisis A.; Delis, Harry B.; Panayiotakis, George S.

    2006-01-01

    The intrinsic phosphor properties are of significant importance for the performance of phosphor screens used in medical imaging systems. In previous analytical-theoretical and Monte Carlo studies on granular phosphor materials, values of optical properties, and light interaction cross sections were found by fitting to experimental data. These values were then employed for the assessment of phosphor screen imaging performance. However, it was found that, depending on the experimental technique and fitting methodology, the optical parameters of a specific phosphor material varied within a wide range of values, i.e., variations of light scattering with respect to light absorption coefficients were often observed for the same phosphor material. In this study, x-ray and light transport within granular phosphor materials was studied by developing a computational model using Monte Carlo methods. The model was based on the intrinsic physical characteristics of the phosphor. Input values required to feed the model can be easily obtained from tabulated data. The complex refractive index was introduced and microscopic probabilities for light interactions were produced, using Mie scattering theory. Model validation was carried out by comparing model results on x-ray and light parameters (x-ray absorption, statistical fluctuations in the x-ray to light conversion process, number of emitted light photons, output light spatial distribution) with previous published experimental data on Gd 2 O 2 S:Tb phosphor material (Kodak Min-R screen). Results showed the dependence of the modulation transfer function (MTF) on phosphor grain size and material packing density. It was predicted that granular Gd 2 O 2 S:Tb screens of high packing density and small grain size may exhibit considerably better resolution and light emission properties than the conventional Gd 2 O 2 S:Tb screens, under similar conditions (x-ray incident energy, screen thickness)

  17. Simple Screening Methods for Drought and Heat Tolerance in Cowpea

    International Nuclear Information System (INIS)

    Singh, B. B.

    2000-10-01

    Success in breeding for drought tolerance has not been as pronounced as for other traits. This is partly due to lack of simple, cheap and reliable screening methods to select drought tolerant plants/progenies from the segregating populations and partly due to complexity of factors involved in drought tolerance. Measuring drought tolerance through physiological parameters is expensive, time consuming and difficult to use for screening large numbers of lines and segregating populations. Since several factors/mechanisms (in shoot and root) operate independently and/or jointly to enable plants to cope with drought stress, drought tolerance appears as a complex trait. However, if these factors/mechanisms can be separated and studied individually, the components leading to drought tolerance will appear less complex and may be easy to manipulate by breeders. We have developed a simple box screening method for shoot drought tolerance in cowpea, which eliminates the effects of roots and permits non-destructive visual identification of shoot dehydration tolerance. We have also developed a 'root-box pin-board' method to study two dimensional root architecture of individual plants. Using these methods, we have identified two mechanisms of shoot drought tolerance in cowpea which are controlled by single dominant genes and major difference for root architecture among cowpea varieties. Combining deep and dense root system with shoot dehydration tolerance results into highly drought tolerant plants

  18. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    -based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...... of cervical precancerous lesions with liquid-based cytology. Follow-up histology showed no increase of false positive tests, whilst the share of tests which were "unsatisfactory for evaluation" decreased significantly. Overall, the liquid-based technique would seem to have several advantages compared...

  19. Performance assessments of vertically aligned carbon nanotubes multi-electrode arrays using Cath.a-differentiated (CAD) cells

    Science.gov (United States)

    Jeong, Du Won; Jung, Jongjin; Kim, Gook Hwa; Yang, Cheol-Soo; Kim, Ju Jin; Jung, Sang Don; Lee, Jeong-O.

    2015-08-01

    In this work, Cath.a-differentiated (CAD) cells were used in place of primary neuronal cells to assess the performance of vertically aligned carbon nanotubes (VACNTs) multi-electrode arrays (MEA). To fabricate high-performance MEA, VACNTs were directly grown on graphene/Pt electrodes via plasma enhanced chemical deposition technique. Here, graphene served as an intermediate layer lowering contact resistance between VACNTs and Pt electrode. In order to lower the electrode impedance and to enhance the cell adhesion, VACNTs-MEAs were treated with UV-ozone for 20 min. Impedance of VACNTs electrode at 1 kHz frequency exhibits a reasonable value (110 kΩ) for extracellular signal recording, and the signal to noise ratio the is good enough to measure low signal amplitude (15.7). Spontaneous firing events from CAD cells were successfully measured with VACNTs MEAs that were also found to be surprisingly robust toward the biological interactions.

  20. Performance assessments of vertically aligned carbon nanotubes multi-electrode arrays using Cath.a-differentiated (CAD) cells

    International Nuclear Information System (INIS)

    Jeong, Du Won; Jin Kim, Ju; Jung, Jongjin; Yang, Cheol-Soo; Lee, Jeong-O; Hwa Kim, Gook; Don Jung, Sang

    2015-01-01

    In this work, Cath.a-differentiated (CAD) cells were used in place of primary neuronal cells to assess the performance of vertically aligned carbon nanotubes (VACNTs) multi-electrode arrays (MEA). To fabricate high-performance MEA, VACNTs were directly grown on graphene/Pt electrodes via plasma enhanced chemical deposition technique. Here, graphene served as an intermediate layer lowering contact resistance between VACNTs and Pt electrode. In order to lower the electrode impedance and to enhance the cell adhesion, VACNTs-MEAs were treated with UV–ozone for 20 min. Impedance of VACNTs electrode at 1 kHz frequency exhibits a reasonable value (110 kΩ) for extracellular signal recording, and the signal to noise ratio the is good enough to measure low signal amplitude (15.7). Spontaneous firing events from CAD cells were successfully measured with VACNTs MEAs that were also found to be surprisingly robust toward the biological interactions. (paper)

  1. A novel accelerated oxidative stability screening method for pharmaceutical solids.

    Science.gov (United States)

    Zhu, Donghua Alan; Zhang, Geoff G Z; George, Karen L S T; Zhou, Deliang

    2011-08-01

    Despite the fact that oxidation is the second most frequent degradation pathway for pharmaceuticals, means of evaluating the oxidative stability of pharmaceutical solids, especially effective stress testing, are still lacking. This paper describes a novel experimental method for peroxide-mediated oxidative stress testing on pharmaceutical solids. The method utilizes urea-hydrogen peroxide, a molecular complex that undergoes solid-state decomposition and releases hydrogen peroxide vapor at elevated temperatures (e.g., 30°C), as a source of peroxide. The experimental setting for this method is simple, convenient, and can be operated routinely in most laboratories. The fundamental parameter of the system, that is, hydrogen peroxide vapor pressure, was determined using a modified spectrophotometric method. The feasibility and utility of the proposed method in solid form selection have been demonstrated using various solid forms of ephedrine. No degradation was detected for ephedrine hydrochloride after exposure to the hydrogen peroxide vapor for 2 weeks, whereas both anhydrate and hemihydrate free base forms degraded rapidly under the test conditions. In addition, both the anhydrate and the hemihydrate free base degraded faster when exposed to hydrogen peroxide vapor at 30°C under dry condition than at 30°C/75% relative humidity (RH). A new degradation product was also observed under the drier condition. The proposed method provides more relevant screening conditions for solid dosage forms, and is useful in selecting optimal solid form(s), determining potential degradation products, and formulation screening during development. Copyright © 2011 Wiley-Liss, Inc.

  2. Circling motion and screen edges as an alternative input method for on-screen target manipulation.

    Science.gov (United States)

    Ka, Hyun W; Simpson, Richard C

    2017-04-01

    To investigate a new alternative interaction method, called circling interface, for manipulating on-screen objects. To specify a target, the user makes a circling motion around the target. To specify a desired pointing command with the circling interface, each edge of the screen is used. The user selects a command before circling the target. To evaluate the circling interface, we conducted an experiment with 16 participants, comparing the performance on pointing tasks with different combinations of selection method (circling interface, physical mouse and dwelling interface) and input device (normal computer mouse, head pointer and joystick mouse emulator). A circling interface is compatible with many types of pointing devices, not requiring physical activation of mouse buttons, and is more efficient than dwell-clicking. Across all common pointing operations, the circling interface had a tendency to produce faster performance with a head-mounted mouse emulator than with a joystick mouse. The performance accuracy of the circling interface outperformed the dwelling interface. It was demonstrated that the circling interface has the potential as another alternative pointing method for selecting and manipulating objects in a graphical user interface. Implications for Rehabilitation A circling interface will improve clinical practice by providing an alternative pointing method that does not require physically activating mouse buttons and is more efficient than dwell-clicking. The Circling interface can also work with AAC devices.

  3. Trojan Horse Method: A tool to explore electron screening effect

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R G; Spitaleri, C; Cherubini, S; Cognata, M La; Lamia, L; Romano, S; Sergi, M L [Laboratori Nazionali del Sud-INFN, Catania (Italy) and Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Rolfs, C; Strieder, F [Ruhr Universitaet Bochum (Germany); Burjan, V; Kroha, V; Mrazek, J [Cyclotron Institute, Academy of Science, Rez (Czech Republic); Li, C; Wen, Q; Zhou, S [CIAE, Beijing (China); Tumino, A, E-mail: rgpizzone@lns.infn.i [Universita Kore, Erma (Italy)

    2010-01-01

    Owing the presence of the Coulomb barrier at astrophysically relevant energies, it is very difficult, or sometimes impossible to measure reaction rates for charged particle induced reactions. Moreover due to the presence of the electron screening effect in direct measurements, the relevant nuclear input for astrophysics, i.e. the bare nucleus S(E)-factor, can hardly be extracted. This is why different indirect techniques are being used along with direct measurements. The THM is an unique: indirect technique which allows one to measure reactions cross sections of astrophysical interest down the thermal energies typical of the different scenarios. The basic principle and a review of the main applications of the Trojan Horse Method are given. The applications aiming at the extraction of the bare S{sub b}(E) astrophysical factor and electron screening potentials U{sub e} for several two body processes are discussed.

  4. Screens

    OpenAIRE

    2016-01-01

    This Sixth volume in the series The Key Debates. Mutations and Appropriations in European Film Studies investigates the question of screens in the context both of the dematerialization due to digitalization and the multiplication of media screens. Scholars offer various infomations and theories of topics such as the archeology of screen, film and media theories, contemporary art, pragmatics of new ways of screening (from home video to street screening).

  5. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    International Nuclear Information System (INIS)

    Ravindra, M.K.; Banon, H.

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described

  6. Method for in vitro screening of aquatic fungicides

    Science.gov (United States)

    Bailey, T.A.

    1983-01-01

    Methods were developed for in vitro screening of candidate aquatic fungicides for efficacy against Achlya fiagellata, A. racemosa, Saprolegnia hypogyna and S. megasperma. Agar plugs containing fungal hyphae, removed from the edge of actively growing colonies, were placed in the depressions of spot plates containing 1a??0, 10a??0 and 100 mg/I of the candidate compounds for 15 or 60 min. After exposure, the plugs were transferred on to filter papers (0a??45-A?m pore) in a holder, rinsed, and then placed on cornmeal agar medium in tri-petri dishes. The plates were checked for mycelial growth after 48, 96 and 168 h of incubation in a lighted (400-800 A?m) environmental control chamber at 20A?2A?C. Criteria for the acceptance or rejection of candidate aquatic fungicides for further study were based on the antifungal spectrum index (ASI) comparisons between respective compounds and malachite green after 48 h and the concentration level producing complete growth inhibition. Candidate compounds whose ASI was less than 50% that of malachite green after 48 h or did not inhibit growth at levels less than 100 mg/l were rejected. This method provides a base from which in vivo and definitive test regimens can be developed. Preliminary in vitro screening of candidate fungicides reduces the need for costly in vivo tests on compounds that have low antifungal activity.

  7. The prevalence and screening methods of postpartum depression

    Directory of Open Access Journals (Sweden)

    Özgür Erdem

    2012-09-01

    Full Text Available Postpartum Depression is the most common complicationof the delivery and affects approximately 10%-15% ofwomen who had just gave birth. During a period in whichwomen believe that they should be happy, the depressivemood experienced by most women leads to feelings ofguilt, hiding the symptoms, and postpartum depressionto be overlooked. Although the incidence of serious psychiatricdisorders during pregnancy is low, it is reportedthat the incidence shows a dramatic increase during thepostpartum period and this risky period may continue upto six months, one year or even two years.As the onset of postpartum depression is insidious it caneasily be overlooked if the patient’s seeking help is notsupported, especially when the severity of postpartum depressionis mild or moderate. In these cases, postpartumdepression may persist for a long time and at last it can beso severe that hospitalization would be needed. Therefore,early diagnose is very important and primary carephysicians and other health care workers should be alert.Postpartum Depression should be diagnosed using reliabledescriptive methods in puerperant women. Thescales such as Postnatal Depression Screening Scale,Beck Depression Inventory, Edinburgh Postnatal DepressionScale and State-Trait Anxiety Inventory, all of whichwere tested for validity and reliability in our country can beused during follow-up of pregnant and puerperal women.Key words: Postpartum depression, screening methods,primary health care professionals

  8. Development and Characterization of a Diamond-Insulated Graphitic Multi Electrode Array Realized with Ion Beam Lithography

    Directory of Open Access Journals (Sweden)

    Federico Picollo

    2014-12-01

    Full Text Available The detection of quantal exocytic events from neurons and neuroendocrine cells is a challenging task in neuroscience. One of the most promising platforms for the development of a new generation of biosensors is diamond, due to its biocompatibility, transparency and chemical inertness. Moreover, the electrical properties of diamond can be turned from a perfect insulator into a conductive material (resistivity ~mΩ·cm by exploiting the metastable nature of this allotropic form of carbon. A 16‑channels MEA (Multi Electrode Array suitable for cell culture growing has been fabricated by means of ion implantation. A focused 1.2 MeV He+ beam was scanned on a IIa single-crystal diamond sample (4.5 × 4.5 × 0.5 mm3 to cause highly damaged sub-superficial structures that were defined with micrometric spatial resolution. After implantation, the sample was annealed. This process provides the conversion of the sub-superficial highly damaged regions to a graphitic phase embedded in a highly insulating diamond matrix. Thanks to a three-dimensional masking technique, the endpoints of the sub-superficial channels emerge in contact with the sample surface, therefore being available as sensing electrodes. Cyclic voltammetry and amperometry measurements of solutions with increasing concentrations of adrenaline were performed to characterize the biosensor sensitivity. The reported results demonstrate that this new type of biosensor is suitable for in vitro detection of catecholamine release.

  9. Multi-electrode double layer capacitor having single electrolyte seal and aluminum-impregnated carbon cloth electrodes

    Science.gov (United States)

    Farahmandi, C. Joseph; Dispennette, John M.; Blank, Edward; Kolb, Alan C.

    1999-01-19

    A single cell, multi-electrode high performance double layer capacitor includes first and second flat stacks of electrodes adapted to be housed in a closeable two-part capacitor case which includes only a single electrolyte seal. Each electrode stack has a plurality of electrodes connected in parallel, with the electrodes of one stack being interleaved with the electrodes of the other stack to form an interleaved stack, and with the electrodes of each stack being electrically connected to respective capacitor terminals. A porous separator sleeve is inserted over the electrodes of one stack before interleaving to prevent electrical shorts between the electrodes. The electrodes are made by folding a compressible, low resistance, aluminum-impregnated carbon cloth, made from activated carbon fibers, around a current collector foil, with a tab of the foils of each electrode of each stack being connected in parallel and connected to the respective capacitor terminal. The height of the interleaved stack is somewhat greater than the inside height of the closed capacitor case, thereby requiring compression of the interleaved electrode stack when placed inside of the case, and thereby maintaining the interleaved electrode stack under modest constant pressure. The closed capacitor case is filled with an electrolytic solution and sealed. A preferred electrolytic solution is made by dissolving an appropriate salt into acetonitrile (CH.sub.3 CN). In one embodiment, the two parts of the capacitor case are conductive and function as the capacitor terminals.

  10. Automatic monitoring of radial injection tracer tests using a novel multi-electrode resistivity system

    International Nuclear Information System (INIS)

    Ward, R.S.; Sen, M.A.; Williams, G.M.; Jackson, P.D.

    1990-01-01

    A radial injection tracer test has been carried out in an unconfined fluvial sand and gravel aquifer underlain by low permeability clay. Sodium chloride has been used as an electrolyte tracer and breakthrough has been monitored using a newly developed automatic resistivity system (RESCAN) incorporating six fully penetrating resistivity probes each having 80 electrodes spaced at 5 cm intervals along their length. Each electrode is individually addressable under computer control to either carry current or measure potential. Any four electrodes can be selected in the traditional Wenner configuration to measure formation resistivity. Rapid measurement of changes in resistivity allows a very detailed picture of tracer migration to be obtained. The resistivity probes were placed at 1 and 2 m radii from the central fully-screened tracer injection well along three limbs at 120 degrees. Resistivity measurements were compared with adjacent multi-level samplers. An 8 x 8 m grid of 140 surface electrodes centred on the central well was also installed. The resistivity profiles measured prior to tracer injection were used to infer lithology, particularly layering. Detailed breakthrough curves were obtained at 77 positions along each of the six probes and compared with adjacent multi-level sampler breakthrough curves. The results showed that the aquifer was extremely heterogeneous even on this small scale. Because the system operates automatically without the need to extract and analyse large numbers of water samples, it opens up the possibility of carrying out lots of small scale injection tests within a larger domain likely to be invaded by a tracer or pollution plume. Such detailed information for determining aquifer properties can provide the data set necessary for characterisation of the aquifer to predict dispersion parameters appropriate to the large scale. (Author) (6 refs., 9 figs., 2 tabs.)

  11. The Effect of a Short-term Glucose Deprivation on Neuron Net Functioning of Hippocampus Primary Culture on a Multi-electrode Matrix

    OpenAIRE

    Vedunova M.V.; Korotchenko S.A.; Balashova A.N.; Isakova A.O.; Khaspekov L.G.; Kazantsev V.B.; Mukhina I.V.

    2011-01-01

    There has been studied the effect of a short-term glucose deprivation on neuron net functioning of hippocampus primary culture developing within 32 days on a multi-electrode matrix MED64 (Alpha MED Sciences Company, Japan) in an early and remote periods after deprivation. A short-term glucose deprivation (20 min) has been shown to result in the increase of electrobiological activity of neuron net of hippocampus primary culture, with the cascade of metabolic reactions being activated leading t...

  12. A Desktop Screen Sharing System based on Various Connection Methods

    Science.gov (United States)

    Negishi, Yuya; Kawaguchi, Nobuo

    Recently it became very common to use information devices such as PCs during presentations and discussions. In these situations, a need arises for techniques that allow a smooth switch of presenters without changing cables, or an easy screen sharing in case of remote videoconferences. In this paper, we propose a desktop screen sharing system that can be used for such purposes and situations. For that, we designed an automatic control of connections in the VNC system that can be operated remotely over the network. We also suggested an interface that assigns a role such as “Screen sender" or “Screen receiver" to each terminal. In the proposed system, while sharing a screen between multiple terminals, one can easily display and browse the screen without having to understand how the others are connected. We also implemented a “role card" using contactless IC card, where roles are assigned only by placing the card in the IC reader.

  13. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  14. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, Kyung Ha; Hwang, Il Soon; Lee, Na Young; Oh, Young Jin; Kim, Ji Hyun; Park, Jin Ho; Sohn, Chang Ho

    2008-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by direct current potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by ultrasound technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts

  15. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, K.H.; Hwang, I.S.; Lee, N.Y.; Oh, Y.J.; Park, J.H.; Sohn, C.H.

    2007-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted in its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by a Direct Current Potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by Ultrasonic Technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts. (author)

  16. A novel method for screening the glutathione transferase inhibitors

    Directory of Open Access Journals (Sweden)

    Węgrzyn Grzegorz

    2009-03-01

    Full Text Available Abstract Background Glutathione transferases (GSTs belong to the family of Phase II detoxification enzymes. GSTs catalyze the conjugation of glutathione to different endogenous and exogenous electrophilic compounds. Over-expression of GSTs was demonstrated in a number of different human cancer cells. It has been found that the resistance to many anticancer chemotherapeutics is directly correlated with the over-expression of GSTs. Therefore, it appears to be important to find new GST inhibitors to prevent the resistance of cells to anticancer drugs. In order to search for glutathione transferase (GST inhibitors, a novel method was designed. Results Our results showed that two fragments of GST, named F1 peptide (GYWKIKGLV and F2 peptide (KWRNKKFELGLEFPNL, can significantly inhibit the GST activity. When these two fragments were compared with several known potent GST inhibitors, the order of inhibition efficiency (measured in reactions with 2,4-dinitrochlorobenzene (CDNB and glutathione as substrates was determined as follows: tannic acid > cibacron blue > F2 peptide > hematin > F1 peptide > ethacrynic acid. Moreover, the F1 peptide appeared to be a noncompetitive inhibitor of the GST-catalyzed reaction, while the F2 peptide was determined as a competitive inhibitor of this reaction. Conclusion It appears that the F2 peptide can be used as a new potent specific GST inhibitor. It is proposed that the novel method, described in this report, might be useful for screening the inhibitors of not only GST but also other enzymes.

  17. Display methods of electronic patient record screens: patient privacy concerns.

    Science.gov (United States)

    Niimi, Yukari; Ota, Katsumasa

    2013-01-01

    To provide adequate care, medical professionals have to collect not only medical information but also information that may be related to private aspects of the patient's life. With patients' increasing awareness of information privacy, healthcare providers have to pay attention to the patients' right of privacy. This study aimed to clarify the requirements of the display method of electronic patient record (EPR) screens in consideration of both patients' information privacy concerns and health professionals' information needs. For this purpose, semi-structured group interviews were conducted of 78 medical professionals. They pointed out that partial concealment of information to meet patients' requests for privacy could result in challenges in (1) safety in healthcare, (2) information sharing, (3) collaboration, (4) hospital management, and (5) communication. They believed that EPRs should (1) meet the requirements of the therapeutic process, (2) have restricted access, (3) provide convenient access to necessary information, and (4) facilitate interprofessional collaboration. This study provides direction for the development of display methods that balance the sharing of vital information and protection of patient privacy.

  18. [Use of Plusoptix as a screening method for refractive ambliopia].

    Science.gov (United States)

    Bogdănici, T; Tone, Silvia; Miron, Mihaela; Boboc, Mihaela; Bogdănici, Camelia

    2012-01-01

    Highlighting the differences in the objective refraction using the Plusoptix AO9 comparing them with the refraction performed with TOPCON KR-8900 autorefractor. Prospective study for 3 months held in the Ophthalmology Clinic in Iasi, Hospital Sf. Spiridon on a total of 39 children (21 girls and 18 boys) with mean age of 10.61 +/- 5.67 years. Clinical parameters: sex, age, objective refraction obtained with Plusoptix and with autorefractor corrected visual acuity (with different methods depending on each patient age), ortoptic examination (strabic deviation, binocular vision), the presence of symetry/asymetry while measuring with Plusoptix. The results were statistically processed by F-TEST calculating the correlation coefficient, standard deviation, significance level (using the spherical equivalent of the obtained values). Age limits of the studied cases ranged between 2-23 years. Visual acuity of children who had cooperate was between 0.2-1 with correction, achieving best values on right eye than left eye. 8 cases (20.51%) had large differences between measurements made with Plusoptix and autorefractor, half of that (4 cases) had strabismus. Three of these cases were with small hypermetropia and one with small myopia (Plusoptix shows a lower value). In 2 cases occurred higher differences (about 2-2,5D) between the 2 measurements, in patients with average hypermetropia. Plusoptix refraction was not possible at high hypermetropia or high myopia. This type of determining objective refraction using Plusoptix is a useful method of screening for discovery of refractive errors that can cause refractive amblyopia in young children and in those cases with a difficult collaboration. Because there are differences betweeti this 2 methods, for children with refractive errors are recommended further exploration to determine the appropriate optical correction. Plusoptix is a limited method because it cannot detect the exact values in those cases with high hypermetropia or high

  19. In situ detection of tree root distribution and biomass by multi-electrode resistivity imaging.

    Science.gov (United States)

    Amato, Mariana; Basso, Bruno; Celano, Giuseppe; Bitella, Giovanni; Morelli, Gianfranco; Rossi, Roberta

    2008-10-01

    Traditional methods for studying tree roots are destructive and labor intensive, but available nondestructive techniques are applicable only to small scale studies or are strongly limited by soil conditions and root size. Soil electrical resistivity measured by geoelectrical methods has the potential to detect belowground plant structures, but quantitative relationships of these measurements with root traits have not been assessed. We tested the ability of two-dimensional (2-D) DC resistivity tomography to detect the spatial variability of roots and to quantify their biomass in a tree stand. A high-resolution resistivity tomogram was generated along a 11.75 m transect under an Alnus glutinosa (L.) Gaertn. stand based on an alpha-Wenner configuration with 48 electrodes spaced 0.25 m apart. Data were processed by a 2-D finite-element inversion algorithm, and corrected for soil temperature. Data acquisition, inversion and imaging were completed in the field within 60 min. Root dry mass per unit soil volume (root mass density, RMD) was measured destructively on soil samples collected to a depth of 1.05 m. Soil sand, silt, clay and organic matter contents, electrical conductivity, water content and pH were measured on a subset of samples. The spatial pattern of soil resistivity closely matched the spatial distribution of RMD. Multiple linear regression showed that only RMD and soil water content were related to soil resistivity along the transect. Regression analysis of RMD against soil resistivity revealed a highly significant logistic relationship (n = 97), which was confirmed on a separate dataset (n = 67), showing that soil resistivity was quantitatively related to belowground tree root biomass. This relationship provides a basis for developing quick nondestructive methods for detecting root distribution and quantifying root biomass, as well as for optimizing sampling strategies for studying root-driven phenomena.

  20. Redo renal denervation using a multi-electrode radiofrequency system in patients with persistent therapy-resistant hypertension.

    Science.gov (United States)

    Daemen, J; Feyz, L; Van Zandvoort, L; Van Mieghem, N M

    2017-06-01

    Renal sympathetic denervation has been studied as a potential therapeutic option for patients with therapy-resistant hypertension; however, a significant proportion of patients do not show a significant reduction in blood pressure and are classified as non-responders. The objective of the present study was to assess whether a redo renal denervation procedure increases response rates. We present a case series of three consecutive renal denervation non-responders treated with the multi-electrode radiofrequency St. Jude EnligHTN catheter after an average of 22 months. Patients were followed for 6 months. Mean age was 66 years and two patients were male. Patients were previously treated using either ReCor's Paradise system, the Vessix V2 system or the Covidien OneShot system. Mean office blood pressure one year after the initial procedure was 187/102 mm Hg with a mean 24 h ambulatory blood pressure of 166/102 mm Hg. All patients underwent a successful redo procedure using the EnligHTN system because of persistent therapy-resistant hypertension. At 6 months a significant drop in both office and ambulatory blood pressure of -27/-6 mm Hg and -15/-13 mm Hg, respectively, was observed. No significant renal artery stenosis was observed at 6 months. In patients with therapy-resistant hypertension who do not respond to an initial renal denervation procedure, a redo procedure using the St. Jude EnligHTN system may help to significantly improve blood pressure control.

  1. A screening method for cardiovascular active compounds in marine algae.

    Science.gov (United States)

    Agatonovic-Kustrin, S; Kustrin, E; Angove, M J; Morton, D W

    2018-05-18

    The interaction of bioactive compounds from ethanolic extracts of selected marine algae samples, separated on chromatographic plates, with nitric/nitrous acid was investigated. The nature of bioactive compounds in the marine algae extracts was characterised using UV absorption spectra before and after reaction with diluted nitric acid, and from the characteristic colour reaction after derivatization with anisaldehyde. It was found that diterpenes from Dictyota dichotoma, an edible brown algae, and sterols from green algae Caulerpa brachypus, bind nitric oxide and may act as a nitric oxide carrier. Although the carotenoid fucoxanthin, found in all brown marine algae also binds nitric oxide, the bonds between nitrogen and the fucoxanthin molecule are much stronger. Further studies are required to evaluate the effects of diterpenes from Dictyota dichotoma and sterols from green algae Caulerpa brachypus to see if they have beneficial cardiovascular effects. The method reported here should prove useful in screening large numbers of algae species for compounds with cardiovascular activity. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Rapid screening method for plutonium in mixed waste samples

    International Nuclear Information System (INIS)

    Somers, W.; Culp, T.; Miller, R.

    1987-01-01

    A waste stream sampling program was undertaken to determine those waste streams which contained hazardous constituents, and would therefore be regulated as a hazardous waste under the Resource Conservation and Recovery Act. The waste streams also had the potential of containing radioactive material, either plutonium, americium, or depleted uranium. Because of the potential for contamination with radioactive material, a method of rapidly screening the liquid samples for radioactive material was required. A counting technique was devised to count a small aliquot of a sample, determine plutonium concentration, and allow the sample to be shipped the same day they were collected. This technique utilized the low energy photons (x-rays) that accompany α decay. This direct, non-destructive x-ray analysis was applied to quantitatively determine Pu-239 concentrations in industrial samples. Samples contained a Pu-239, Am-241 mixture; the ratio and/or concentrations of these two radionuclides was not constant. A computer program was designed and implemented to calculate Pu-239 activity and concentration (g/ml) using the 59.5 keV Am-241 peak to determine Am-241's contribution to the 17 keV region. Am's contribution was subtracted, yielding net counts in the 17 keV region due to Pu. 2 figs., 1 tab

  3. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  4. Establishment of screening method for effective vaccination using radiolabelled probe

    International Nuclear Information System (INIS)

    Nomaguchi, Hiroko; Yogi, Yasuko

    1998-01-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/ + and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, γ-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce γ-IFN in response to IL-12 were extremely limited in the nude mouse. On the contrary, for IL-18, γ-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of γ-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  5. Establishment of screening method for effective vaccination using radiolabelled probe

    Energy Technology Data Exchange (ETDEWEB)

    Nomaguchi, Hiroko; Yogi, Yasuko [National Inst. of Infectious Deseases, Tokyo (Japan)

    1998-02-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/{sup +} and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, {gamma}-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce {gamma}-IFN in response to IL-12 were extremely limited in the nude mouse. On the contray, for IL-18, {gamma}-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of {gamma}-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  6. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  7. Charge sharing in multi-electrode devices for deterministic doping studied by IBIC

    International Nuclear Information System (INIS)

    Jong, L.M.; Newnham, J.N.; Yang, C.; Van Donkelaar, J.A.; Hudson, F.E.; Dzurak, A.S.; Jamieson, D.N.

    2011-01-01

    Following a single ion strike in a semiconductor device the induced charge distribution changes rapidly with time and space. This phenomenon has important applications to the sensing of ionizing radiation with applications as diverse as deterministic doping in semiconductor devices to radiation dosimetry. We have developed a new method for the investigation of this phenomenon by using a nuclear microprobe and the technique of Ion Beam Induced Charge (IBIC) applied to a specially configured sub-100 μm scale silicon device fitted with two independent surface electrodes coupled to independent data acquisition systems. The separation between the electrodes is comparable to the range of the 2 MeV He ions used in our experiments. This system allows us to integrate the total charge induced in the device by summing the signals from the independent electrodes and to measure the sharing of charge between the electrodes as a function of the ion strike location as a nuclear microprobe beam is scanned over the sensitive region of the device. It was found that for a given ion strike location the charge sharing between the electrodes allowed the beam-strike location to be determined to higher precision than the probe resolution. This result has potential application to the development of a deterministic doping technique where counted ion implantation is used to fabricate devices that exploit the quantum mechanical attributes of the implanted ions.

  8. Virtual screening methods as tools for drug lead discovery from large chemical libraries.

    Science.gov (United States)

    Ma, X H; Zhu, F; Liu, X; Shi, Z; Zhang, J X; Yang, S Y; Wei, Y Q; Chen, Y Z

    2012-01-01

    Virtual screening methods have been developed and explored as useful tools for searching drug lead compounds from chemical libraries, including large libraries that have become publically available. In this review, we discussed the new developments in exploring virtual screening methods for enhanced performance in searching large chemical libraries, their applications in screening libraries of ~ 1 million or more compounds in the last five years, the difficulties in their applications, and the strategies for further improving these methods.

  9. Evaluation of Screening Methods for the Detection of Urinary Tract ...

    African Journals Online (AJOL)

    2000-05-30

    screening testsfor urinary tract infection was donefrom March 20 to May 30, 2000. A cross sectional study ... the diagnosis of urinary tract infection on the basis of pyuria alone. The minimum number of ..... infection Complicating. Pregnancy J.

  10. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  11. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  12. 77 FR 4544 - CPSC Symposium on Phthalates Screening and Testing Methods

    Science.gov (United States)

    2012-01-30

    ... Screening and Testing Methods AGENCY: Consumer Product Safety Commission. ACTION: Notice. SUMMARY: The... symposium on phthalates screening and testing methods. The symposium will be held at the CPSC's National... submit comments, identified by Docket No. CPSC-2012-0008, by any of the following methods: Electronic...

  13. Barriers to Breast and Cervical Cancer Screening in Singapore: a Mixed Methods Analysis.

    Science.gov (United States)

    Malhotra, Chetna; Bilger, Marcel; Liu, Joy; Finkelstein, Eric

    2016-01-01

    In order to increase breast and cervical cancer screening uptake in Singapore, women's perceived barriers to screening need to be identified and overcome. Using data from both focus groups and surveys, we aimed to assess perceived barriers and motivations for breast and cervical cancer screening. We conducted 8 focus groups with 64 women, using thematic analysis to identify overarching themes related to women's attitudes towards screening. Based on recurring themes from focus groups, several hypotheses regarding potential barriers and motivations to screen were generated and tested through a national survey of 801 women aged 25-64. Focus group participants had misconceptions related to screening, believing that the procedures were painful. Cost was an issue, as well as efficacy and fatalism. By identifying barriers to and motivators for screening through a mixed-method design that has both nuance and external validity, this study offers valuable suggestions to policymakers to improve breast and cervical cancer screening uptake in Singapore.

  14. Development of thermal stress screening method. Application of green function method

    International Nuclear Information System (INIS)

    Furuhashi, Ichiro; Shibamoto, Hiroshi; Kasahara, Naoto

    2004-01-01

    This work was achieved for the development of the screening method of thermal transient stresses in FBR components. We proposed an approximation method for evaluations of thermal stress under variable heat transfer coefficients (non-linear problems) using the Green functions of thermal stresses with constant heat transfer coefficients (linear problems). Detailed thermal stress analyses provided Green functions for a skirt structure and a tube-sheet of Intermediate Heat Exchanger. The upper bound Green functions were obtained by the analyses using those upper bound heat transfer coefficients. The medium and the lower bound Green functions were got by the analyses of those under medium and the lower bound heat transfer coefficients. Conventional evaluations utilized the upper bound Green functions. On the other hand, we proposed a new evaluation method by using the upper bound, medium and the lower bound Green functions. The comparison of above results gave the results as follows. The conventional evaluations were conservative and appropriate for the cases under one fluid thermal transient structure such as the skirt. The conventional evaluations were generally conservative for the complicated structures under two or more fluids thermal transients such as the tube-sheet. But the danger locations could exists for the complicated structures under two or more fluids transients, namely the conventional evaluations were non-conservative. The proposed evaluations gave good estimations for these complicated structures. Though above results, we have made the basic documents of the screening method of thermal transient stresses using the conventional method and the new method. (author)

  15. Multi electrode semiconductors detectors

    CERN Document Server

    Amendolia, S R; Bertolucci, Ennio; Bosisio, L; Bradaschia, C; Budinich, M; Fidecaro, F; Foà, L; Focardi, E; Giazotto, A; Giorgi, M A; Marrocchesi, P S; Menzione, A; Ristori, L; Rolandi, Luigi; Scribano, A; Stefanini, A; Vincelli, M L

    1981-01-01

    Detectors with very high space resolution have been built in this laboratory and tested at CERN in order to investigate their possible use in high energy physics experiments. These detectors consist of thin layers of silicon crystals acting as ionization chambers. Thin electrodes, structured in strips or in more fancy shapes are applied to their surfaces by metal coating. The space resolution which could be reached is of the order of a few microns. An interesting feature of these solid state detectors is that they can work under very high or low external pressure or at very low temperature. The use of these detectors would strongly reduce the dimensions and the cost of high energy experiments. (3 refs).

  16. Multi electrode semiconductor detectors

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Batignani, G.; Bertolucci, E.; Bosisio, L.; Budinich, M.; Bradaschia, C.; Fidecaro, F.; Foa, L.; Focardi, E.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Rolandi, L.; Scribano, A.; Stefanini, A.; Vincelli, M.L.

    1981-01-01

    Detectors with very high space resolution have been built in the laboratory and tested at CERN in order to investigate their possible use in high energy physics experiments. These detectors consist of thin layers of silicon crystals acting as ionization chambers. Thin electrodes, structured in strips or in more fancy shapes are applied to their surfaces by metal coating. The space resolution which could be reached is of the order of a few microns. An interesting feature of these solid state detectors is that they can work under very high or low external pressure or at very low temperature. The use of these detectors would strongly reduce the dimensions and the cost of high energy experiments. (Auth.)

  17. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23)

    DEFF Research Database (Denmark)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe

    2018-01-01

    arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. ANALYSES: The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study......INTRODUCTION: The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could...... vaccination as girls. METHODS: Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme...

  18. Screening of Potential Remediation Methods for the 200-ZP-1 Operable Unit at the Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Truex, Michael J.; Nimmons, Michael J.; Johnson, Christian D.; Dresel, P EVAN.; Murray, Christopher J.

    2006-08-07

    A screening-level evaluation of potential remediation methods for application to the contaminants of concern (COC) in the 200-ZP-1 Operable Unit at the Hanford Site was conducted based on the methods outlined in the Guidance for Conducting Remedial Investigations and Feasibility Studies under CERCLA Interim Final. The scope of this screening was to identify the most promising remediation methods for use in the more detailed analysis of remediation alternatives that will be conducted as part of the full feasibility study. The screening evaluation was conducted for the primary COC (potential major risk drivers). COC with similar properties were grouped for the screening evaluation. The screening evaluation was conducted in two primary steps. The initial screening step evaluated potential remediation methods based on whether they can be effectively applied within the environmental setting of the 200-ZP-1 Operable Unit for the specified contaminants. In the second step, potential remediation methods were screened using scoping calculations to estimate the scale of infrastructure, overall quantities of reagents, and conceptual approach for applying the method for each defined grouping of COC. Based on these estimates, each method was screened with respect to effectiveness, implementability, and relative cost categories of the CERCLA feasibility study screening process defined in EPA guidance.

  19. A comparison of two psychological screening methods currently used for inpatients in a UK burns service.

    Science.gov (United States)

    Shepherd, Laura; Tew, Victoria; Rai, Lovedeep

    2017-12-01

    Various types of psychological screening are currently used in the UK to identify burn patients who are experiencing psychological distress and may need additional support and intervention during their hospital admission. This audit compared two types of psychological screening in 40 burn inpatients. One screening method was an unpublished questionnaire designed to explore multiple areas of potential distress for those who have experienced burns. The other method was an indirect psychological screen via discussions within multi-disciplinary team (MDT) meetings where a Clinical Psychologist was present to guide and prompt psychological discussions. Data was collected between November 2012 and September 2016. Results suggested that both screening methods were similar in identifying patients who benefit from more formal psychological assessment. Indeed, statistical analysis reported no difference between the two screening methods (N=40, p=.424, two-tailed). In conclusion, measuring distress in burns inpatients using a burns-specific questionnaire and psychological discussions within MDT meetings are similar in their ability to identify patients in need of more thorough psychological assessment. However, both screening methods identified patients who were in need of psychological input when the other did not. This suggests that psychological screening of burns inpatients, and the psychological difficulties that they can present with, is complex. The advantages and disadvantages of both methods of screening are discussed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  20. A new promising screening method for cognitive functioning in elderly patients

    NARCIS (Netherlands)

    Kuin, Y.; Nijsten, J.M.H.; Stok-Koch, E.G.H.J.; Jansen, R.W.M.M.

    1996-01-01

    The Mini Mental State Examination (MMSE) is frequently used as a screening method to detect cognitive dysfunctioning. However, the MMSE has limited sensitivity to detect mild impairment. We aimed to develop a new screening method to discriminate between normal and mild cognitive functioning in older

  1. MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD

    Science.gov (United States)

    2017-06-01

    MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD ECBC-TR...TITLE AND SUBTITLE Mass Spectrometry Proteomics Method as a Rapid Screening Tool for Bacterial Contamination of Food 5a. CONTRACT NUMBER 5b...the MSPM to correctly classify whether or not food samples were contaminated with Salmonella enterica serotype Newport in this blinded pilot study

  2. Safety and efficacy of a multi-electrode renal sympathetic denervation system in resistant hypertension: the EnligHTN I trial.

    Science.gov (United States)

    Worthley, Stephen G; Tsioufis, Costas P; Worthley, Matthew I; Sinhal, Ajay; Chew, Derek P; Meredith, Ian T; Malaiapan, Yuvi; Papademetriou, Vasilios

    2013-07-01

    Catheter-based renal artery sympathetic denervation has emerged as a novel therapy for treatment of patients with drug-resistant hypertension. Initial studies were performed using a single electrode radiofrequency catheter, but recent advances in catheter design have allowed the development of multi-electrode systems that can deliver lesions with a pre-determined pattern. This study was designed to evaluate the safety and efficacy of the EnligHTN(™) multi-electrode system. We conducted the first-in-human, prospective, multi-centre, non-randomized study in 46 patients (67% male, mean age 60 years, and mean baseline office blood pressure 176/96 mmHg) with drug-resistant hypertension. The primary efficacy objective was change in office blood pressure from baseline to 6 months. Safety measures included all adverse events with a focus on the renal artery and other vascular complications and changes in renal function. Renal artery denervation, using the EnligHTN system significantly reduced the office blood pressure from baseline to 1, 3, and 6 months by -28/10, -27/10 and -26/10 mmHg, respectively (P renal artery injury or other serious vascular complications occurred. Small, non-clinically relevant, changes in average estimated glomerular filtration rate were reported from baseline (87 ± 19 mL/min/1.73 m2) to 6 months post-procedure (82 ± 20 mL/min/1.73 m2). Renal sympathetic denervation, using the EnligHTN multi-electrode catheter results in a rapid and significant office blood pressure reduction that was sustained through 6 months. The EnligHTN system delivers a promising therapy for the treatment of drug-resistant hypertension.

  3. A simple method to estimate the episode and programme sensitivity of breast cancer screening programmes.

    Science.gov (United States)

    Zorzi, Manuel; Guzzinati, Stefano; Puliti, Donella; Paci, Eugenio

    2010-01-01

    The estimation of breast cancer screening sensitivity is a major aim in the quality assessment of screening programmes. The proportional incidence method for the estimation of the sensitivity of breast cancer screening programmes is rarely used to estimate the underlying incidence rates. We present a method to estimate episode and programme sensitivity of screening programmes, based solely on cancers detected within screening cycles (excluding breast cancer cases at prevalent screening round) and on the number of incident cases in the total target population (steady state). The assumptions, strengths and limitations of the method are discussed. An example of calculation of episode and programme sensitivities is given, on the basis of the data from the IMPACT study, a large observational study of breast cancer screening programmes in Italy. The programme sensitivity from the fifth year of screening onwards ranged between 41% and 48% of the total number of cases in the target population. At steady state episode sensitivity was 0.70, with a trend across age groups, with lowest values in women aged 50-54 years (0.52) and highest in those 65-69 (0.77). The method is a very serviceable tool for estimating sensitivity in service screening programmes, and the results are comparable with those of other methods of estimation.

  4. Three screening methods for cognitive dysfunction using the Mini-Mental State Examination and Korean Dementia Screening Questionnaire.

    Science.gov (United States)

    Choi, Seong Hye; Park, Moon Ho

    2016-02-01

    To screen for and determine cognitive dysfunction, cognitive tests and/or informant reports are commonly used. However, these cognitive tests and informant reports are not always available. The present study investigated three screening methods using the Mini-Mental State Examination (MMSE) as the cognitive test, and the Korean dementia screening questionnaire (KDSQ) as the informant report. Participants were recruited from the Korea Clinical Research Center for Dementia of South Korea, and included 2861 patients with Alzheimer's disease (dementia), 3519 patients with mild cognitive impairment and 1375 controls with no cognitive dysfunction. Three screening methods were tested: (i) MMSE alone (MMSE(cut-off) ); (ii) a conventional combination of MMSE and KDSQ (MMSE+KDSQ(cut-off) ); and (iii) a decision tree with MMSE and KDSQ (MMSE+KDSQ(decision tree) ). For discriminating any cognitive dysfunction from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.784). For discriminating dementia from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.899). For discriminating mild cognitive impairment from controls, MMSE(cut-off) had the highest area under the receiver operating characteristic curve (0.683). MMSE+KDSQ(decision tree) showed the highest sensitivity for all discriminations. For overall classification accuracy, MMSE+KDSQ(decision tree) had the highest value (70.0%). These three methods had different advantageous properties for screening and staging cognitive dysfunction. As there might be different availability across clinical settings, these three methods can be selected and used according to situational needs. © 2015 Japan Geriatrics Society.

  5. A method for calculating effective lifetime risk of radiation-induced cancer from screening mammography

    International Nuclear Information System (INIS)

    Ali, R.M.; England, A.; McEntee, M.F.; Hogg, P.

    2015-01-01

    Purpose: To propose a method for evaluating the effective lifetime risk of radiation-induced cancer from screening mammography and to present initial data for the UK National Breast Screening Programme. Material and methods: The imaging was undertaken using a Hologic Selenia full field digital mammographic unit. The proposed method utilises an ATOM phantom containing thermoluminescent dosimeters and a perspex-polyethylene breast phantom to measure organ doses during a standard four view screening mammogram. Effective dose was calculated and effective risk was modelled for a range of client ages. The total lifetime effective risk was then calculated for the UK national screening programme. Calculation of effective risk includes the radiation dose to examined and contralateral breasts in addition to other body organs; this is an advantage over the mean glandular dose. Results: The contralateral breast, thyroid, thymus, brain, lung, salivary glands, and bone marrow all receive more than 1 μGy radiation dose during screening mammography. A major difference exists for total effective lifetime risk of radiation-induced cancer between clients with average and high breast cancer risk. Differences are attributed to the commencement age of screening and time interval between screens. Conclusion: This study proposes a method to evaluate effective lifetime risk of radiation-induced cancer from screening mammography in order to compare different mammography screening programmes. - Highlights: • We proposed a method for the calculation of radiation-induced cancer from screening mammography. • We measured the radiation absorbed dose of different organs during screening mammography. • There are major differences between mammography screening programme categories with regard to radiation effective risk.

  6. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  7. Performance of machine learning methods for ligand-based virtual screening.

    Science.gov (United States)

    Plewczynski, Dariusz; Spieser, Stéphane A H; Koch, Uwe

    2009-05-01

    Computational screening of compound databases has become increasingly popular in pharmaceutical research. This review focuses on the evaluation of ligand-based virtual screening using active compounds as templates in the context of drug discovery. Ligand-based screening techniques are based on comparative molecular similarity analysis of compounds with known and unknown activity. We provide an overview of publications that have evaluated different machine learning methods, such as support vector machines, decision trees, ensemble methods such as boosting, bagging and random forests, clustering methods, neuronal networks, naïve Bayesian, data fusion methods and others.

  8. High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

    Science.gov (United States)

    Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

    2012-01-31

    An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

  9. Evaluation of Quantitative Environmental Stress Screening (ESS) Methods. Volume 1

    Science.gov (United States)

    1991-11-01

    required information on screening strength from the curvefitting parameters. The underlying theory and approach taken are discussed in Appendix A. To...in field 1020 arm St.,Vas AJ Ptr 0.4i Currpnt. c- ugt ~ing DU?/SYS 2.7264 Wll/IY.3 at Factory Stress- NaxiLMw outgoing W?is’ys 0.288 DrW/5?S at Field...182 125 K.W.Fertig and V.X. Murthy, Models for Reliability Growth During Burn-in: Theory and Applicat’ons,Proceedings 1978 Annual Reliability and

  10. The measurement of gas–liquid two-phase flows in a small diameter pipe using a dual-sensor multi-electrode conductance probe

    International Nuclear Information System (INIS)

    Zhai, Lu-Sheng; Bian, Peng; Han, Yun-Feng; Gao, Zhong-Ke; Jin, Ning-De

    2016-01-01

    We design a dual-sensor multi-electrode conductance probe to measure the flow parameters of gas–liquid two-phase flows in a vertical pipe with an inner diameter of 20 mm. The designed conductance probe consists of a phase volume fraction sensor (PVFS) and a cross-correlation velocity sensor (CCVS). Through inserting an insulated flow deflector in the central part of the pipe, the gas–liquid two-phase flows are forced to pass through an annual space. The multiple electrodes of the PVFS and the CCVS are flush-mounted on the inside of the pipe wall and the outside of the flow deflector, respectively. The geometry dimension of the PVFS is optimized based on the distribution characteristics of the sensor sensitivity field. In the flow loop test of vertical upward gas–liquid two-phase flows, the output signals from the dual-sensor multi-electrode conductance probe are collected by a data acquisition device from the National Instruments (NI) Corporation. The information transferring characteristics of local flow structures in the annular space are investigated using the transfer entropy theory. Additionally, the kinematic wave velocity is measured based on the drift velocity model to investigate the propagation behavior of the stable kinematic wave in the annular space. Finally, according to the motion characteristics of the gas–liquid two-phase flows, the drift velocity model based on the flow patterns is constructed to measure the individual phase flow rate with higher accuracy. (paper)

  11. Comparative analysis of machine learning methods in ligand-based virtual screening of large compound libraries.

    Science.gov (United States)

    Ma, Xiao H; Jia, Jia; Zhu, Feng; Xue, Ying; Li, Ze R; Chen, Yu Z

    2009-05-01

    Machine learning methods have been explored as ligand-based virtual screening tools for facilitating drug lead discovery. These methods predict compounds of specific pharmacodynamic, pharmacokinetic or toxicological properties based on their structure-derived structural and physicochemical properties. Increasing attention has been directed at these methods because of their capability in predicting compounds of diverse structures and complex structure-activity relationships without requiring the knowledge of target 3D structure. This article reviews current progresses in using machine learning methods for virtual screening of pharmacodynamically active compounds from large compound libraries, and analyzes and compares the reported performances of machine learning tools with those of structure-based and other ligand-based (such as pharmacophore and clustering) virtual screening methods. The feasibility to improve the performance of machine learning methods in screening large libraries is discussed.

  12. Time-resolved luminescence screening method for enrofloxacin in beef serum

    Science.gov (United States)

    Enrofloxacin is one of only two fluoroquinolone antibiotics approved for use in cattle in the U.S. Microbial screening methods currently used in the U.S. for monitoring veterinary drug residues are not sensitive or selective for fluoroquinolones. In this work, a luminescence-based screening assay ...

  13. Comparison of screening methods for anaemia in pregnant women in Awassa, Ethiopia

    NARCIS (Netherlands)

    Gies, S.; Brabin, B. J.; Yassin, M. A.; Cuevas, L. E.

    2003-01-01

    Screening for anaemia in pregnancy is essential for implementing and monitoring effective antenatal programmes. We compared the diagnostic accuracy of invasive and non-invasive screening methods in a cross-sectional survey of 403 pregnant women attending an urban health centre in Awassa, southern

  14. Optical method for the screening of doping substances

    Science.gov (United States)

    Lademann, J.; Shevtsova, J.; Patzelt, A.; Richter, H.; Gladkowa, N. D.; Gelikonov, V. M.; Gonchukov, S. A.; Sterry, W.; Blume-Peytavi, U.

    2008-12-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients.

  15. Optical method for the screening of doping substances

    International Nuclear Information System (INIS)

    Lademann, J; Patzelt, A; Richter, H; Sterry, W; Shevtsova, J; Gladkowa, N D; Gelikonov, V M; Gonchukov, S A; Blume-Peytavi, U

    2008-01-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients

  16. Method for screening inhibitors of the toxicity of Bacillus anthracis

    Science.gov (United States)

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  17. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Science.gov (United States)

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities), calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR) of 0.48 (Confidence Interval (CI) 0.38 – 0.58; X2: 72.227; p.value learning disabilities. Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities. PMID:18218106

  18. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman; Ba Alawi, Wail; Afeef, Moataz A.; Essack, Magbubah; Kalnis, Panos; Bajic, Vladimir B.

    2016-01-01

    Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods

  19. Environmental Justice Screening Method (EJSM) Score, San Joaquin Valley CA, 2013, Occidental College and UC Berkeley

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Cumulative Impacts (CI) screening method is jointly being developed by Manuel Pastor, Jim Sadd (Occidental College), and Rachel Morello-Frosch (UC Berkeley) ....

  20. Method of evaluation of structural (screen) and quantum graininess of X-ray pictures

    Energy Technology Data Exchange (ETDEWEB)

    Gurvich, A M; Shamanov, A A; Erofeeva, N D [Nauchno-Issledovatel' skij Inst. Rentgenologii i Radiologii, Moscow (USSR)

    1979-03-01

    Proposed is a method for quantitative determination of graininess of X-ray pictures (gamma-ray images), the graininess being conditioned by the structure of amplifying screens and quantum fluctuations. The method is based on the determination of threshold brightness at which the picture graininess becomes obvious. It is shown that at low effective quantum energy (Esub(eff.) <= 50 keV) the graininess observed is for the most part structural (screen). Its growth is connected with quantum fluctuations when increasing Esub(eff.) up to 150 keV and using screens with high output values of X-ray luminescence and the coefficient of spectral accordance to the film.

  1. Development and evaluation of nursing user interface screens using multiple methods.

    Science.gov (United States)

    Hyun, Sookyung; Johnson, Stephen B; Stetson, Peter D; Bakken, Suzanne

    2009-12-01

    Building upon the foundation of the Structured Narrative Electronic Health Record (EHR) model, we applied theory-based (combined Technology Acceptance Model and Task-Technology Fit Model) and user-centered methods to explore nurses' perceptions of functional requirements for an electronic nursing documentation system, design user interface screens reflective of the nurses' perspectives, and assess nurses' perceptions of the usability of the prototype user interface screens. The methods resulted in user interface screens that were perceived to be easy to use, potentially useful, and well-matched to nursing documentation tasks associated with Nursing Admission Assessment, Blood Administration, and Nursing Discharge Summary. The methods applied in this research may serve as a guide for others wishing to implement user-centered processes to develop or extend EHR systems. In addition, some of the insights obtained in this study may be informative to the development of safe and efficient user interface screens for nursing document templates in EHRs.

  2. An efficient method for qualitative screening of phosphate-solubilizing bacteria.

    Science.gov (United States)

    Mehta, S; Nautiyal, C S

    2001-07-01

    An efficient protocol was developed for qualitative screening of phosphate-solubilizing bacteria, based upon visual observation. Our results indicate that, by using our formulation containing bromophenol blue, it is possible to quickly screen on a qualitative basis the phosphate-solubilizing bacteria. Qualitative analysis of the phosphate solubilized by various groups correlated well with grouping based upon quantitative analysis of bacteria isolated from soil, effect of carbon, nitrogen, salts, and phosphate solubilization-defective transposon mutants. However, unlike quantitative analysis methods that involve time-consuming biochemical procedures, the time for screening phosphate-solubilizing bacteria is significantly reduced by using our simple protocol. Therefore, it is envisaged that usage of this formulation based upon qualitative analysis will be salutary for the quick screening of phosphate-solubilizing bacteria. Our results indicate that the formulation can also be used as a quality control test for expeditiously screening the commercial bioinoculant preparations, based on phosphate solubilizers.

  3. Who Gets the Job? First-Generation College Students' Perceptions of Employer Screening Methods

    Science.gov (United States)

    Parks-Yancy, Rochelle; Cooley, Delonia

    2018-01-01

    What are first-generation college students' (FGCS) perspectives of employment screening methods? The authors investigate which methods FGCS believe are likely to cause an employer to extend a job offer and which methods yield the best pool of job applicants. Survey data were collected from undergraduate business majors. They were analyzed using…

  4. A simple method of screening for metabolic bone disease

    International Nuclear Information System (INIS)

    Broughton, R.B.K.; Evans, W.D.

    1982-01-01

    The purpose of this investigation was to find a simple method -to be used as an adjunct to the conventional bone scintigram- that could differentiate between decreased bone metabolism or mass, i.e., osteoporosis -normal bone- and the group of conditions of increased bone metabolism or mass namely, osteomalacia, renal osteodystrophy, hyperparathyroidism and Paget's disease. The Fogelman's method using the bone to soft tissue ratios from region of interest analysis at 4 hours post injection, was adopted. An initial experience in measuring a value for the count rate density in lumbar vertebrae at 1 hr post injection during conventional bone scintigraphy appears to give a clear indication of the overall rate of bone metabolism. The advantage over whole body retention methods is that the scan performed at the end of the metabolic study will reveal localized bone disease that may otherwise not be anticipated

  5. High throughput screening method for identification of new lipofection reagents.

    Science.gov (United States)

    Regelin, A E; Fernholz, E; Krug, H F; Massing, U

    2001-08-01

    Lipofection, the transfer of genetic material into cells by means of cationic lipids, is of growing interest for in vitro and in vivo approaches. In order to identify ideal lipofection reagents in a HTS, we have developed an automated lipofection method for the transfer of reporter genes into cells and for determination of the lipofection results. The method has specifically been designed and optimized for 96-well microtiter plates and can successfully be carried out by a pipetting robot with accessory equipment. It consists of two separate parts: (1) pretransfection (preparation of liposomes, formation of lipoplexes, and lipoplex transfer to the cells) and (2) posttransfection (determination of the reporter enzyme activity and the protein content of the transfected cells). Individual steps of the lipofection method were specifically optimized - for example, lipoplex formation and incubation time as well as cell lysis, cell cultivating, and the reporter gene assay. The HTS method facilitates characterization of the transfection properties (efficiency and cytotoxicity) of large numbers of (cationic) lipids in various adherent cell types.

  6. efficacy of screening methods used in breeding for black pod

    African Journals Online (AJOL)

    Administrator

    inoculation necessitates waiting until a tree bears pods before its level of resistance to black pod infection can be determined. These methods, therefore, do not offer a quick means of breeding for resistance. Consequently, tests at the seedling stage that provide information about pod resistance are earnestly needed to save ...

  7. METHOD FOR NUMERICAL MODELING OF UNSTEADY SEPARATED FLOW AROUND AIRFOILS MOVING CLOSE TO FLAT SCREEN

    Directory of Open Access Journals (Sweden)

    V. Pogrebnaya Tamara

    2017-01-01

    Full Text Available In this article an attempt is made to explain the nature of differences in measurements of forces and moments, which influence an aircraft at take-off and landing when testing on different types of stands. An algorithm for numerical simulation of unsteady separated flow around airfoil is given. The algorithm is based on the combination of discrete vortex method and turbulent boundary layer equations. An unsteady flow separation modeling has been used. At each interval vortex method was used to calculate the potential flow around airfoils located near a screen. Calculated pressures and velocities were then used in boundary layer calculations to determine flow separation points and separated vortex in- tensities. After that calculation were made to determine free vortex positions to next time step and the process was fulfilled for next time step. The proposed algorithm allows using numeric visualization to understand physical picture of flow around airfoil moving close to screen. Three different ways of flow modeling (mirror method, fixed or movable screens were tested. In each case the flow separation process, which determines pressure distribution over airfoil surface and influ- ences aerodynamic performance, was viewed. The results of the calculations showed that at low atitudes of airfoil over screen mirror method over predicts lift force compared with movable screen, while fixed screen under predicts it. The data obtained can be used when designing equipment for testing in wind tunnels.

  8. Pi sampling: a methodical and flexible approach to initial macromolecular crystallization screening

    International Nuclear Information System (INIS)

    Gorrec, Fabrice; Palmer, Colin M.; Lebon, Guillaume; Warne, Tony

    2011-01-01

    Pi sampling, derived from the incomplete factorial approach, is an effort to maximize the diversity of macromolecular crystallization conditions and to facilitate the preparation of 96-condition initial screens. The Pi sampling method is derived from the incomplete factorial approach to macromolecular crystallization screen design. The resulting ‘Pi screens’ have a modular distribution of a given set of up to 36 stock solutions. Maximally diverse conditions can be produced by taking into account the properties of the chemicals used in the formulation and the concentrations of the corresponding solutions. The Pi sampling method has been implemented in a web-based application that generates screen formulations and recipes. It is particularly adapted to screens consisting of 96 different conditions. The flexibility and efficiency of Pi sampling is demonstrated by the crystallization of soluble proteins and of an integral membrane-protein sample

  9. Methods for Factor Screening in Computer Simulation Experiments

    Science.gov (United States)

    1979-03-01

    of the dat-a In a-space, impacto the variable selection problem s ign if Lrast ly. S-arch-type variable selection methods include the all-po"sible...i.iv 41.1 ti * n wt- -iu’pt-v c C it st’vt’re mu It ico11 inear it v is pro-crtnt Lind. , ii;.qt4pai tlv * Iti’lt- c- j c. tic j icivnt, art, verv

  10. PATHOS: a quick screening method for assessing sexual addiction.

    Science.gov (United States)

    Johnson, Pennie; Cashwell, Craig S; Cress, Jim; Barber, Tim; Dunn, Mary Clayton

    2013-01-01

    Pastors may understand that sex addiction exists and are frequently faced with people who need non-clinical and clinical services for the addiction. However, the pastoral counselors have no quick reliable method of assessing them. The purpose of this article is to define sexual addiction and provide information about a tool called PATHOS that can be used in clinical and non-clinical settings to identify potential sex addicts.

  11. Studying Knowledge, Attitude and Behavior of Breast Cancer Screening Methods among Behshahr Dwelling Women

    Directory of Open Access Journals (Sweden)

    Abdolhasan Naghibi

    2013-09-01

    Full Text Available Background and purpose: Breast cancer is the most prevalent cancer among all widespread cancers worldwide. After lung cancer, breast cancer is the main cause of death among women. One of the best ways to detect this disease early is to do screening. This study has been done to analyze the knowledge, attitude, and behavior of women regarding the breast cancer screening methods. Materials & Methods: The study is of cross-sectional descriptive type. The participants were 500 Behshahr dwelling women above 20 years old selected based on cluster sampling. The instrument used was a 34-item questionnaire to investigate the knowledge, attitude, and behavior of the women. The data has been analyzed through inferential statistical methods. Results: The participants' age mean was 35.16. The average knowledge score of the disease and screening methods was 1.3 and 54.6. The average attitude score of was 82.5. Regarding behavior, 13.1 percent do regular self-examination, and 15.2 percent do regular clinical examination. 16.7 percent of women have one experience of doing mammography. In the present study, there was a significant relation among knowledge, attitude and behavior. Conclusion: Since the knowledge of women was at average level and the behavior of using the screening methods was weak, planning to enable and motivate women to use the screening methods is highly emphasized.

  12. Gastric Cancer Screening by Combined Determination of Serum Helicobacter pylori Antibody and Pepsinogen Concentrations: ABC Method for Gastric Cancer Screening.

    Science.gov (United States)

    Chen, Xian-Zhe; Huang, Cheng-Zhi; Hu, Wei-Xian; Liu, Ying; Yao, Xue-Qing

    2018-05-20

    Gastroscopy combined with gastric mucosa biopsies is currently regarded as a gold standard for diagnosis of gastric cancer. However, its application is restricted in clinical practice due to its invasive property. A new noninvasive population screening process combining the assay of anti-Helicobacter pylori antibody and serum pepsinogen (PG) (ABC method) is adopted to recognize the high-risk patients for further endoscopy examination, avoiding the unnecessary gastroscopy for most population and saving the cost consumption for mass screening annually. Nevertheless, controversies exist for the grouping of ABC method and the intervals of gastroscopy surveillance for each group. In this review, we summarized these popular concerned topics for providing useful references to the healthcare practitioner in clinical practice. The PubMed databases were systematically searched from the inception dates to November 22, 2017, using the keywords "Helicobacter pylori," "Pepsinogens," and "Stomach Neoplasms." Original articles and reviews on the topics were selected. Anti-H. pylori antibody and serum PG concentration showed significant changes under the different status of H. pylori infection and the progression of atrophic gastritis, which can be used for risk stratification of gastric cancer in clinic. In addition, anti-H. pylori antibody titer can be used for further risk stratification of gastric cancer contributing to determine better endoscopy surveillance interval. The early detection and diagnosis of gastric cancer benefit from the risk stratification, but the cutoff values for H. pylori antibody and serum PG concentration require further modification.

  13. Novel method for screening of enteric film coatings properties with magnetic resonance imaging.

    Science.gov (United States)

    Dorożyński, Przemysław; Jamróz, Witold; Niwiński, Krzysztof; Kurek, Mateusz; Węglarz, Władysław P; Jachowicz, Renata; Kulinowski, Piotr

    2013-11-18

    The aim of the study is to present the concept of novel method for fast screening of enteric coating compositions properties without the need of preparation of tablets batches for fluid bed coating. Proposed method involves evaluation of enteric coated model tablets in specially designed testing cell with application of MRI technique. The results obtained in the testing cell were compared with results of dissolution studies of mini-tablets coated in fluid bed apparatus. The method could be useful in early stage of formulation development for screening of film coating properties that will shorten and simplify the development works. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. A virtual screening method for inhibitory peptides of Angiotensin I-converting enzyme.

    Science.gov (United States)

    Wu, Hongxi; Liu, Yalan; Guo, Mingrong; Xie, Jingli; Jiang, XiaMin

    2014-09-01

    Natural small peptides from foods have been proven to be efficient inhibitors of Angiotensin I-converting enzyme (ACE) for the regulation of blood pressure. The traditional ACE inhibitory peptides screening method is both time consuming and money costing, to the contrary, virtual screening method by computation can break these limitations. We establish a virtual screening method to obtain ACE inhibitory peptides with the help of Libdock module of Discovery Studio 3.5 software. A significant relationship between Libdock score and experimental IC(50) was found, Libdock score = 10.063 log(1/IC(50)) + 68.08 (R(2) = 0.62). The credibility of the relationship was confirmed by testing the coincidence of the estimated log(1/IC(50)) and measured log(1/IC(50)) (IC(50) is 50% inhibitory concentration toward ACE, in μmol/L) of 5 synthetic ACE inhibitory peptides, which was virtual hydrolyzed and screened from a kind of seafood, Phascolosoma esculenta. Accordingly, Libdock method is a valid IC(50) estimation tool and virtual screening method for small ACE inhibitory peptides. © 2014 Institute of Food Technologists®

  15. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Directory of Open Access Journals (Sweden)

    Stanistreet Debbi

    2008-01-01

    Full Text Available Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities, calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR of 0.48 (Confidence Interval (CI 0.38 – 0.58; X2: 72.227; p.value X2: 24.236; p.value X2: 286.341; p.value Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities.

  16. Ionic Liquids for Absorption and Separation of Gases: An Extensive Database and a Systematic Screening Method

    DEFF Research Database (Denmark)

    Zhao, Yongsheng; Gani, Rafiqul; Afzal, Raja Muhammad

    2017-01-01

    requirements remains a challenging task. In this study, an extensive database of estimated Henry's law constants of twelve gases in more than ten thousand ILs at 313.15 K is established using the COSMO-RS method. Based on the database, a new systematic and efficient screening method for IL selection...

  17. Microbial screening methods for detection of antibiotic residues in slaughter animals

    NARCIS (Netherlands)

    Pikkemaat, M.G.

    2009-01-01

    Monitoring of food products from animal origin for the presence of antimicrobial residues is preferably done using microbial screening methods because of their high cost-effectiveness. Traditionally applied methods fail to detect the maximum residue limits which were established when EU Council

  18. Band structure engineering in van der Waals heterostructures via dielectric screening: the GΔW method

    DEFF Research Database (Denmark)

    Winther, Kirsten Trøstrup; Thygesen, Kristian Sommer

    2017-01-01

    precise magnitude is non-trivial to predict because of the non-local nature of the screening in quasi-2D crystals. Moreover, the effect is not captured by effective single-particle methods such as density functional theory. Here we present an efficient and general method for calculating the band gap...

  19. Comparison of a fluoroquinolone surface plasmon resonance biosensor screening assay with established methods

    NARCIS (Netherlands)

    Weigel, S.; Pikkemaat, M.G.; Elferink, J.W.A.; Mulder, P.P.J.; Huet, A.C.; Delahaut, P.; Schittko, S.; Flerus, R.; Nielen, M.W.F.

    2009-01-01

    The performance of a previously developed immunochemical biosensor screening method for fluoroquinolone (FQ) antibiotics in poultry muscle, fish and egg was compared with established methods. Blank sample material of the target matrices was individually spiked with the FQs at half maximum residue

  20. Screening of Plant Extracts for Antioxidant Activity: a Comparative Study on Three Testing Methods

    NARCIS (Netherlands)

    Koleva, I.; Beek, van T.A.; Linssen, J.P.H.; Groot, de Æ.; Evstatieva, L.N.

    2002-01-01

    Three methods widely employed in the evaluation of antioxidant activity, namely 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method, static headspace gas chromatography (HS-GC) and -carotene bleaching test (BCBT), have been compared with regard to their application in the screening of

  1. Application of EU guidelines for the validation of screening methods for veterinary drugs

    NARCIS (Netherlands)

    Stolker, A.A.M.

    2012-01-01

    Commission Decision (CD) 2002/657/EC describes detailed rules for method validation within the framework of residue monitoring programmes. The approach described in this CD is based on criteria. For (qualitative) screening methods, the most important criteria is that the CCß has to be below any

  2. Method for screening the Nevada Test Site and contiguous areas for nuclear waste repository locations

    International Nuclear Information System (INIS)

    Sinnock, S.; Fernandez, J.A.; Neal, J.T.; Stephens, H.P.; Hartway, B.L.; Los Alamos Technical Associates, Inc., NM)

    1982-01-01

    This paper outlines the general concepts of a technical method for systematic screening of the Nevada Test Site (NTS), Nye County, Nevada, for potentially suitable nuclear waste repository locations. After a general discussion of the organization and the purpose of the current screening activity, the paper addresses the steps of the screening method. These steps include: hierarchically organizing technical objectives for repository performance (an objectives tree); identifying and mapping pertinent physical characteristics of a site and its setting (physical attributes); relating the physical conditions to the objectives (favorability curves); identifying alternative locations and numerically evaluating their relative merits; investigating the effects of subjective judgments on the evaluations (sensitivity analyses); documenting the assumptions, logic, and results of the method. 19 references, 10 figures

  3. Validity and cost-effectiveness of methods for screening of primary open angle glaucoma

    Directory of Open Access Journals (Sweden)

    Fröschl, Barbara

    2007-02-01

    Full Text Available Health political background: About 950,000 people are affected by glaucoma in Germany, about 50% of which are undiagnosed. The German Ophthalmological Society and the German Association of Ophthalmologists recommend a screening for glaucoma according to their guidelines. The Federal Joint Committee disapproved a glaucoma-screening program on expense of the compulsory health insurance in 2004. Scientific background: Primary open angle glaucoma is diagnosed by evaluation of the optic disc, the retinal fibre layer and the visual field. The main examinations are ophthalmoscopy, scanning laser polarimetry, confocal scanning laser ophthalmoscopy, retinal thickness analysis and optical coherence tomography. Scotomas are diagnosed by perimetry (standard automated perimetry, short wavelength automated perimetry and frequency doubling perimetry. The intraocular pressure is the most important treatable risk factor and is measured by (contact or non-contact tonometry. Research questions: The aim of this HTA-report is to investigate the diagnostic validity and cost effectiveness of diagnostic techniques or combinations of these methods with respect to the use in a screening setting in Germany. Methods: A systematic literature research was performed in 35 international databases and yielded 2602 articles. Overall 57 publications were included for assessment, according to predefined selection criteria. Results: The 55 medical articles deal mainly with frequency doubling perimetry, confocal scanning laser ophthalmoscopy and scanning laser polarimetry. Few articles cover short wavelength automated perimetry, tonometry and ophalmocopic evaluations by ophthalmologists. The quality of the papers is generally low, as far as the evidence in respect of screening is concerned. No single method exists with both, high sensitivity and high specificity for screening purpose. Data are also not sufficient to recommend combinations of methods. Only two economic models on cost

  4. Reverse screening methods to search for the protein targets of chemopreventive compounds

    Science.gov (United States)

    Huang, Hongbin; Zhang, Guigui; Zhou, Yuquan; Lin, Chenru; Chen, Suling; Lin, Yutong; Mai, Shangkang; Huang, Zunnan

    2018-05-01

    This article is a systematic review of reverse screening methods used to search for the protein targets of chemopreventive compounds or drugs. Typical chemopreventive compounds include components of traditional Chinese medicine, natural compounds and Food and Drug Administration (FDA)-approved drugs. Such compounds are somewhat selective but are predisposed to bind multiple protein targets distributed throughout diverse signaling pathways in human cells. In contrast to conventional virtual screening, which identifies the ligands of a targeted protein from a compound database, reverse screening is used to identify the potential targets or unintended targets of a given compound from a large number of receptors by examining their known ligands or crystal structures. This method, also known as in silico or computational target fishing, is highly valuable for discovering the target receptors of query molecules from terrestrial or marine natural products, exploring the molecular mechanisms of chemopreventive compounds, finding alternative indications of existing drugs by drug repositioning, and detecting adverse drug reactions and drug toxicity. Reverse screening can be divided into three major groups: shape screening, pharmacophore screening and reverse docking. Several large software packages, such as Schrödinger and Discovery Studio; typical software/network services such as ChemMapper, PharmMapper, idTarget and INVDOCK; and practical databases of known target ligands and receptor crystal structures, such as ChEMBL, BindingDB and the Protein Data Bank (PDB), are available for use in these computational methods. Different programs, online services and databases have different applications and constraints. Here, we conducted a systematic analysis and multilevel classification of the computational programs, online services and compound libraries available for shape screening, pharmacophore screening and reverse docking to enable non-specialist users to quickly learn and

  5. Screening methods for post-stroke visual impairment: a systematic review.

    Science.gov (United States)

    Hanna, Kerry Louise; Hepworth, Lauren Rachel; Rowe, Fiona

    2017-12-01

    assess all potential post-stroke visual impairments. The current tools screen for only a number of potential stroke-related impairments, which means many visual defects may be missed. The sensitivity of those which screen for all impairments is significantly lowered when patients are unable to report their visual symptoms. Future research is required to develop a tool capable of assessing stroke patients which encompasses all potential visual deficits and can also be easily performed by both the patients and administered by health care professionals in order to ensure all stroke survivors with visual impairment are accurately identified and managed. Implications for Rehabilitation Over 65% of stroke survivors will suffer from a visual impairment, whereas 45% of stroke units do not assess vision. Visual impairment significantly reduces the quality of life, such as being unable to return to work, driving and depression. This review outlines the available screening methods to accurately identify stroke survivors with visual impairments. Identifying visual impairment after stroke can aid general rehabilitation and thus, improve the quality of life for these patients.

  6. Proposal of Screening Method of Sleep Disordered Breathing Using Fiber Grating Vision Sensor

    Science.gov (United States)

    Aoki, Hirooki; Nakamura, Hidetoshi; Nakajima, Masato

    Every conventional respiration monitoring technique requires at least one sensor to be attached to the body of the subject during measurement, thereby imposing a sense of restraint that results in aversion against measurements that would last over consecutive days. To solve this problem, we developed a respiration monitoring system for sleepers, and it uses a fiber-grating vision sensor, which is a type of active image sensor to achieve non-contact respiration monitoring. In this paper, we verified the effectiveness of the system, and proposed screening method of the sleep disordered breathing. It was shown that our system could equivalently measure the respiration with thermistor and accelerograph. And, the respiratory condition of sleepers can be grasped by our screening method in one look, and it seems to be useful for the support of the screening of sleep disordered breathing.

  7. Concurrent Driving Method with Fast Scan Rate for Large Mutual Capacitance Touch Screens

    Directory of Open Access Journals (Sweden)

    Mohamed Gamal Ahmed Mohamed

    2015-01-01

    Full Text Available A novel touch screen control technique is introduced, which scans each frame in two steps of concurrent multichannel driving and differential sensing. The proposed technique substantially increases the scan rate and reduces the ambient noise effectively. It is also extended to a multichip architecture to support excessively large touch screens with great scan rate improvement. The proposed method has been implemented using 0.18 μm CMOS TowerJazz process and tested with FPGA and AFE board connecting a 23-inch touch screen. Experimental results show a scan rate improvement of up to 23.8 times and an SNR improvement of 24.6 dB over the conventional method.

  8. A new screening method for amphetamine and methamphetamine using dansyl chloride derivatization and cartridge fluorescence.

    Science.gov (United States)

    Yamada, H; Ikeda-Wada, S; Oguri, K

    1998-07-01

    A new screening method for amphetamines was developed. It consists of derivatization with dansyl chloride, extraction of the derivative using a Sep-Pak C18 or a Bond Elut C18, solid phase extraction columns, and visualization of the fluorescence of the cartridge. A control test using drug-free urine showed no fluorescence. Amphetamine, methamphetamine and the methylenedioxy derivatives exhibited strong fluorescence, while related compounds, such as N-ethylamphetamine and fenetylline, were negative or weakly positive. The disadvantage of the present method is that it is a multi-step procedure and 20-30 min is required for screening. However, since it has a different specificity from the widely used immunochemical technique, it is suggested to be a useful screen for amphetamines.

  9. Current role of liquid chromatography coupled to mass spectrometry in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Fathi, Marc; Rudaz, Serge; Hochstrasser, Denis; Veuthey, Jean-Luc

    2011-07-01

    Abstract Toxicological screening is the analysis of a biological specimen to detect and identify compounds in patients admitted to the hospital with acute intoxication of unknown origin. The screening of a wide range of toxicologically relevant compounds in biological samples is a serious challenge for clinical laboratories. The high selectivity and sensitivity of liquid chromatography coupled to mass spectrometry or tandem mass spectrometry technology provides an attractive alternative to the current methods. For these reasons, an increasing number of applications for multi-target screening or general screening of unknown compounds in biological matrices are being published. This paper is an overview of sample clean-up, chromatographic separation and mass spectrometry detection procedures which can be combined to obtain screening methods adapted to the constraints and needs of various laboratories, and none specifically in clinical toxicology. Currently the techniques are in the hands of specialists, principally in academic institutes. However, the evolution in technology should allow application of the techniques as a tool in toxicology laboratories and thus more widespread exploitation of their potential.

  10. Rapid in vivo screening method for the evaluation of new anti ...

    African Journals Online (AJOL)

    Rapid in vivo screening method for the evaluation of new anti helicobacter ... Six to eight week-old mice pre-treated (7 days) with Amoxicillin/Metronidazole (25 ... These findings were used as a mouse model of Helicobacter pylori infection to ...

  11. Development of automatic image analysis methods for high-throughput and high-content screening

    NARCIS (Netherlands)

    Di, Zi

    2013-01-01

    This thesis focuses on the development of image analysis methods for ultra-high content analysis of high-throughput screens where cellular phenotype responses to various genetic or chemical perturbations that are under investigation. Our primary goal is to deliver efficient and robust image analysis

  12. Estimation of effectiveness of interventions for malaria control in pregnancy using the screening method

    NARCIS (Netherlands)

    Msyamboza, K.; Senga, E.; Tetteh-Ashong, E.; Kazembe, P.; Brabin, B. J.

    2007-01-01

    BACKGROUND: The evaluation of the effectiveness of antimalarial drugs and bed net use in pregnant women is an important aspect of monitoring and surveillance of malaria control in pregnancy. In principle the screening method for assessing vaccine efficacy can be applied in non-vaccine settings for

  13. Validation of cervical cancer screening methods in HIV positive women from Johannesburg South Africa.

    Directory of Open Access Journals (Sweden)

    Cynthia Firnhaber

    Full Text Available HIV-infected women are at increased risk for developing cervical cancer. Women living in resource-limited countries are especially at risk due to poor access to cervical cancer screening and treatment. We evaluated three cervical cancer screening methods to detect cervical intraepithelial neoplasia grade 2 and above (CIN 2+ in HIV-infected women in South Africa; Pap smear, visual inspection with 5% acetic acid (VIA and human papillomavirus detection (HPV.HIV-infected women aged 18-65 were recruited in Johannesburg. A cross-sectional study evaluating three screening methods for the detection of the histologically-defined gold standard CIN-2 + was performed. Women were screened for cervical abnormalities with the Digene HC2 assay (HPV, Pap smear and VIA. VIA was performed by clinic nurses, digital photographs taken and then later reviewed by specialist physicians. The sensitivity, specificity and predictive valves for CIN-2 + were calculated using maximum likelihood estimators.1,202 HIV-infected women participated, with a median age of 38 years and CD4 counts of 394 cells/mm(3. One third of women had a high grade lesion on cytology. VIA and HPV were positive in 45% and 61% of women respectively. Estimated sensitivity/specificity for HPV, Pap smear and VIA for CIN 2+ was 92%/51.4%, 75.8%/83.4% and 65.4/68.5% (nurse reading, respectively. Sensitivities were similar, and specificities appeared significantly lower for the HPV test, cytology and VIA among women with CD4 counts ≤200 cells/mm(3 as compared to CD4 counts >350 cells/mm(3.Although HPV was the most sensitive screening method for detecting CIN 2+, it was less specific than conventional cytology and VIA with digital imaging review. Screening programs may need to be individualized in context of the resources and capacity in each area.

  14. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Science.gov (United States)

    Vaiman, Michael; Eviatar, Ephraim

    2009-01-01

    Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG) to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007) and EMBASE (1975–2007). Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles), the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water) are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia. PMID:19232090

  15. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    Directory of Open Access Journals (Sweden)

    Cristina Portalés

    2017-06-01

    Full Text Available The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, where a sample is shown for a virtual reality Formula 1 simulator that has a cylindrical screen. The proposed method results from the combination of surveying, photogrammetry and image processing approaches, and has been designed by considering the spatial restrictions of virtual reality simulators. The method has been validated from a mathematical point of view, and the complete system—which is currently installed in a shopping mall in Spain—has been tested by different users.

  16. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  17. Study on a noninvasive method for rapid screening Human Serum albumin injectables by Raman spectroscopy

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2017-01-01

    Full Text Available Human serum albumin (HSA injectable product is a severely afflicted area on drug safety due to its high price and restricted supply. Raman spectroscopy performances high specificity on HSA detection and it is even possible to determine HSA injectable products noninvasively. In this study, we developed a noninvasive rapid screening method for of HSA injectable products by using portable Raman spectrometer. Qualitative models were established by using principal component analysis combined with classical least squares (PCA-CLS algorithm, while quantitative model was established by using partial least squares (PLS algorithm. Model transfer in different instruments of both the same and different apparatus modules was further discussed in this paper. A total of 34 HSA injectable samples collected from markets were used for verification. The identification results showed 100% accuracy and the predicted concentrations of those identified as true HSA were consistent with their labeled concentrations. The quantitative results also indicated that model transfer was excellent in the same apparatus modules of Raman spectrometer at all concentration levels, and still good enough in the different apparatus modules although the relative standard deviation (RSD value showed a little increasing trend at low HSA concentration level. In conclusion, the method was proved to be feasible and efficient for screening HSA injections, especially on its screening speed and the consideration of glass containers. Moreover, with inspiring results on the model transfer, the method could be used as a universal screening mean to different Raman instruments.

  18. The effectiveness of scoliosis screening programs: methods for systematic review and expert panel recommendations formulation

    Science.gov (United States)

    2013-01-01

    Background Literature on scoliosis screening is vast, however because of the observational nature of available data and methodological flaws, data interpretation is often complex, leading to incomplete and sometimes, somewhat misleading conclusions. The need to propose a set of methods for critical appraisal of the literature about scoliosis screening, a comprehensive summary and rating of the available evidence appeared essential. Methods To address these gaps, the study aims were: i) To propose a framework for the assessment of published studies on scoliosis screening effectiveness; ii) To suggest specific questions to be answered on screening effectiveness instead of trying to reach a global position for or against the programs; iii) To contextualize the knowledge through expert panel consultation and meaningful recommendations. The general methodological approach proceeds through the following steps: Elaboration of the conceptual framework; Formulation of the review questions; Identification of the criteria for the review; Selection of the studies; Critical assessment of the studies; Results synthesis; Formulation and grading of recommendations in response to the questions. This plan follows at best GRADE Group (Grades of Recommendation, Assessment, Development and Evaluation) requirements for systematic reviews, assessing quality of evidence and grading the strength of recommendations. Conclusions In this article, the methods developed in support of this work are presented since they may be of some interest for similar reviews in scoliosis and orthopaedic fields. PMID:23883346

  19. Screening, sensitivity, and uncertainty for the CREAM method of Human Reliability Analysis

    International Nuclear Information System (INIS)

    Bedford, Tim; Bayley, Clare; Revie, Matthew

    2013-01-01

    This paper reports a sensitivity analysis of the Cognitive Reliability and Error Analysis Method for Human Reliability Analysis. We consider three different aspects: the difference between the outputs of the Basic and Extended methods, on the same HRA scenario; the variability in outputs through the choices made for common performance conditions (CPCs); and the variability in outputs through the assignment of choices for cognitive function failures (CFFs). We discuss the problem of interpreting categories when applying the method, compare its quantitative structure to that of first generation methods and discuss also how dependence is modelled with the approach. We show that the control mode intervals used in the Basic method are too narrow to be consistent with the Extended method. This motivates a new screening method that gives improved accuracy with respect to the Basic method, in the sense that (on average) halves the uncertainty associated with the Basic method. We make some observations on the design of a screening method that are generally applicable in Risk Analysis. Finally, we propose a new method of combining CPC weights with nominal probabilities so that the calculated probabilities are always in range (i.e. between 0 and 1), while satisfying sensible properties that are consistent with the overall CREAM method

  20. Development of methods for screening pesticide residues in plant matrices in Ghana

    International Nuclear Information System (INIS)

    Lowor, Samuel Tetteh

    1999-12-01

    TLC has been used in combination with micro-extraction and clean-up methods to provide an alternative cost effective analytical procedure for screening pesticide residues in plant matrices. Thirty-five (35) agrochemicals, which are used in priority crops in Ghana, were used in this study. Ethylacetate extraction in the presence of anhydrous sodium sulphate, followed by gel permeation chromatographic clean up and additional purification on silica gel cartridges provided clean extracts enabling the application of 300mg sample equivalent on the TLC plates. Detection method involving the use of O-tolidine was found to be suitable for general screening of residues, having medium sensitivity for several compounds. The method involving the use of silver nitrate was the only one found to be most suitable for detecting the organo chlorine pesticides. Lindane was the most sensitive to this reagent and had a Minimum Detectable Quantity (MDQ) value of 5ng/5 uL. This method was suitable for use on only alumina plates and detection was also possible even under sunlight. The enzyme inhibition methods were very sensitive to the carbamate and phosphoric acid type insecticides with MDQ values between 0.2 and 2000ng. Other detection methods involving p-nitrobenzene, p-dimethylaminobenzaldehyde and photosynthesis inhibition were also tried and discussed. The database developed has been successfully used for screening and semiquantitative determination of some ranges of pesticide residue in soil and plant matrices. (au)

  1. Deactivation of Escherichia coli in a post-discharge chamber coupled to an atmospheric pressure multi-electrode DBD plasma source

    International Nuclear Information System (INIS)

    Pérez-Ruiz, V H; López-Callejas, R; De la Piedad Beneitez, A; Peña-Eguiluz, R; Mercado-Cabrera, A; Muñoz-Castro, A E; Barocio, S R; Valencia-Alvarado, R; Rodríguez-Méndez, B G

    2012-01-01

    Experimental results from applying a room pressure RF multi-electrode DBD plasma source to the inhibition of the population growth of Gram negative Escherichia coli (E. coli) within a post-discharge reactor are reported. The sample to be treated is deposited in the post-discharge chamber at about 50 mm from the plasma source outlet. Thus, the active species generated by the source are conveyed toward the chamber by the working gas flow. The plasma characterization included the measurement of the axial temperature at different distances from the reactor outlet by means of a K-type thermocouple. The resulting 294 K to 322 K temperature interval corresponded to distances between 10 mm to 1 mm respectively. As the material under treatment is placed further away, any thermal damage of the sample by the plasma is prevented. The measurement and optimization of the ozone O 3 concentration has also been carried out, provided that this is an active specie with particularly high germicide power. The effectiveness treatment of the E. coli bacteria growth inhibition by the proposed plasma source reached 99% when a 10 3 CFU/mL concentration on an agar plate had been exposed during ten minutes.

  2. Multi-Electrode Resistivity Probe for Investigation of Local Temperature Inside Metal Shell Battery Cells via Resistivity: Experiments and Evaluation of Electrical Resistance Tomography

    Directory of Open Access Journals (Sweden)

    Xiaobin Hong

    2015-01-01

    Full Text Available Direct Current (DC electrical resistivity is a material property that is sensitive to temperature changes. In this paper, the relationship between resistivity and local temperature inside steel shell battery cells (two commercial 10 Ah and 4.5 Ah lithium-ion cells is innovatively studied by Electrical Resistance Tomography (ERT. The Schlumberger configuration in ERT is applied to divide the cell body into several blocks distributed in different levels, where the apparent resistivities are measured by multi-electrode surface probes. The investigated temperature ranges from −20 to 80 °C. Experimental results have shown that the resistivities mainly depend on temperature changes in each block of the two cells used and the function of the resistivity and temperature can be fitted to the ERT-measurement results in the logistical-plot. Subsequently, the dependence of resistivity on the state of charge (SOC is investigated, and the SOC range of 70%–100% has a remarkable impact on the resistivity at low temperatures. The proposed approach under a thermal cool down regime is demonstrated to monitor the local transient temperature.

  3. Cost and effectiveness comparison of two methods for screening potential blood donors for anaemia in Vietnam.

    Science.gov (United States)

    Tyrrell, A; Worrall, E; Que, T N; Bates, I

    2011-06-01

    To compare the cost and effectiveness of Copper Sulphate (CS) and HemoCue (HC) methods for screening blood donors for anaemia. Robust information from developing countries about cost and effectiveness of anaemia screening methods for blood donors is scarce. In such countries there are widespread shortages of blood, so the most cost-effective method should maximise blood supply without compromising donor safety. Economic data (e.g. staff time, equipment and buildings) were collected from direct observation of procedures and purchase data from Hanoi's Central Blood Bank administrative department. A framework for comparing the cost and effectiveness of anaemia screening methods was developed and a cost per effective (i.e. usable and accurate) test was generated for each method. Samples from 100 potential donors from the Hanoi Central Blood Bank (static) and 198 from two mobile units were tested. The mean probability of an ineffective anaemia test was 0·1 (0·05-0·2). The average cost of an HC test was $0·75 (static $0·61 and mobile $0·89) and a CS test was $0·31 (static $0·17 and mobile $0·45). The difference between static and mobile units was predominantly due to transport costs; the difference between the two methods was predominantly due to the HC microcuvettes. In this setting the CS yields greater value for money than the HC method for screening blood donors. The relative cost and effectiveness of CS and HC may be different in places with higher staff turnover, lower test accuracy, higher anaemia prevalence or lower workload than in Vietnam. © 2010 Liverpool School of Tropical Medicine. Transfusion Medicine © 2010 British Blood Transfusion Society.

  4. A sensitive immunoblotting method for screening of microalbuminuria in diabetic patient's urine

    International Nuclear Information System (INIS)

    Abdolkhaleg, D.; Behrooz, S.

    2005-01-01

    Urinary albumin excretion is a useful marker in the prognosis of diabetic nephropathy and microvascular diseases. Methods such as enzyme linked immunosorbent assay (ELISA), radio immunoassay(RIA), radial immunodiffusion, albu screen, micro bumin and micral test are usually used for detection and screening of microalbuminuria in these patients. With consideration to the cost of an assay, methods such as ELISA and RIA are not suitable methods for screening purpose. Therefore, the aim of this work is to set a dot immunoblotting method for the measurement and screening of microalbumin in urine samples. The study was conducted during the period August 2001 to June 2003 at the National Research Center for Genetic Engineering and Biotechnology (NRCGEB) and Pars Hospital Laboratory of Tehran, Iran on 96 diabetic patients urine samples. First, anti human albumin antibodies (Abs) were produced in rabbit and immunoglobulin G (IgG) fraction was purified by protein-A affinity chromatography. Titer of Abs and optimum incubation conditions were tested by direct ELISA. Then different concentration of human albumin (0-300 mg/l) was loaded to nitrocellulose membranes and was assayed by dot immunoblotting method. The specificity and cross reactivity of Abs was tested by SDS-PAGE electrophoresis and western immunoblotting. The sensitivity of the method was calculated from human albumin calibration curve and compared with commercial immunoturbidimetric assays. Our results indicates that in using IgG with the concentrations 0.5-1 ug/ml (2 x 10-5 to 10-4 dilutions) the intensity of color directly increased with the increase of human albumin standards in blots. Western immunoblotting of urine samples did not show any cross reactivity with other urine proteins. Comparison of results of this method by commercial immunoturbidimetric methods indicates the correlation regression of approximately 0.979. The sensitivity of the method was approximately 5 mg/L of human albumin. This simple

  5. A new screening method to identify inhibitors of the Lol (localization of lipoproteins) system, a novel antibacterial target.

    Science.gov (United States)

    Ito, Hideaki; Ura, Atsushi; Oyamada, Yoshihiro; Yoshida, Hiroaki; Yamagishi, Jun-Ichi; Narita, Shin-Ichiro; Matsuyama, Shin-Ichi; Tokuda, Hajime

    2007-01-01

    As the Lol system, which is involved in localization of lipoproteins, is essential for Escherichia coli growth and widely conserved among gram-negative bacteria, it is considered to be a promising target for the development of anti-gram-negative bacterial agents. However, no high-throughput screening method has so far been developed to screen for Lol system inhibitors. By combining three assay systems (anucleate cell blue assay, Lpp assay, and LolA-dependent release inhibition assay) and a drug susceptibility test, we have successfully developed a new screening method for identification of compounds that inhibit the Lol system. Using this new screening method, we screened 23,600 in-house chemical compounds and found 2 Lol system inhibitors. We therefore conclude that our new screening method can efficiently identify new antibacterial agents that target the Lol system.

  6. A method to screen obstructive sleep apnea using multi-variable non-intrusive measurements

    International Nuclear Information System (INIS)

    De Silva, S; Abeyratne, U R; Hukins, C

    2011-01-01

    Obstructive sleep apnea (OSA) is a serious sleep disorder. The current standard OSA diagnosis method is polysomnography (PSG) testing. PSG requires an overnight hospital stay while physically connected to 10–15 channels of measurement. PSG is expensive, inconvenient and requires the extensive involvement of a sleep technologist. As such, it is not suitable for community screening. OSA is a widespread disease and more than 80% of sufferers remain undiagnosed. Simplified, unattended and cheap OSA screening methods are urgently needed. Snoring is commonly associated with OSA but is not fully utilized in clinical diagnosis. Snoring contains pseudo-periodic packets of energy that produce characteristic vibrating sounds familiar to humans. In this paper, we propose a multi-feature vector that represents pitch information, formant information, a measure of periodic structure existence in snore episodes and the neck circumference of the subject to characterize OSA condition. Snore features were estimated from snore signals recorded in a sleep laboratory. The multi-feature vector was applied to a neural network for OSA/non-OSA classification and K-fold cross-validated using a random sub-sampling technique. We also propose a simple method to remove a specific class of background interference. Our method resulted in a sensitivity of 91 ± 6% and a specificity of 89 ± 5% for test data for AHI THRESHOLD = 15 for a database consisting of 51 subjects. This method has the potential as a non-intrusive, unattended technique to screen OSA using snore sound as the primary signal

  7. Rapid screening of guar gum using portable Raman spectral identification methods.

    Science.gov (United States)

    Srivastava, Hirsch K; Wolfgang, Steven; Rodriguez, Jason D

    2016-01-25

    Guar gum is a well-known inactive ingredient (excipient) used in a variety of oral pharmaceutical dosage forms as a thickener and stabilizer of suspensions and as a binder of powders. It is also widely used as a food ingredient in which case alternatives with similar properties, including chemically similar gums, are readily available. Recent supply shortages and price fluctuations have caused guar gum to come under increasing scrutiny for possible adulteration by substitution of cheaper alternatives. One way that the U.S. FDA is attempting to screen pharmaceutical ingredients at risk for adulteration or substitution is through field-deployable spectroscopic screening. Here we report a comprehensive approach to evaluate two field-deployable Raman methods--spectral correlation and principal component analysis--to differentiate guar gum from other gums. We report a comparison of the sensitivity of the spectroscopic screening methods with current compendial identification tests. The ability of the spectroscopic methods to perform unambiguous identification of guar gum compared to other gums makes them an enhanced surveillance alternative to the current compendial identification tests, which are largely subjective in nature. Our findings indicate that Raman spectral identification methods perform better than compendial identification methods and are able to distinguish guar gum from other gums with 100% accuracy for samples tested by spectral correlation and principal component analysis. Published by Elsevier B.V.

  8. School Locations and Traffic Emissions — Environmental (InJustice Findings Using a New Screening Method

    Directory of Open Access Journals (Sweden)

    Philine Gaffron

    2015-02-01

    Full Text Available It has been shown that the location of schools near heavily trafficked roads can have detrimental effects on the health of children attending those schools. It is therefore desirable to screen both existing school locations and potential new school sites to assess either the need for remedial measures or suitability for the intended use. Current screening tools and public guidance on school siting are either too coarse in their spatial resolution for assessing individual sites or are highly resource intensive in their execution (e.g., through dispersion modeling. We propose a new method to help bridge the gap between these two approaches. Using this method, we also examine the public K-12 schools in the Sacramento Area Council of Governments Region, California (USA from an environmental justice perspective. We find that PM2.5 emissions from road traffic affecting a school site are significantly positively correlated with the following metrics: percent share of Black, Hispanic and multi-ethnic students, percent share of students eligible for subsidized meals. The emissions metric correlates negatively with the schools’ Academic Performance Index, the share of White students and average parental education levels. Our PM2.5 metric also correlates with the traffic related, census tract level screening indicators from the California Communities Environmental Health Screening Tool and the tool’s tract level rate of asthma related emergency department visits.

  9. Abdominal ultrasound-scanning versus non-contrast computed tomography as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Liisberg, Mads; Diederichsen, Axel C.; Lindholt, Jes S.

    2017-01-01

    Background: Validating non-contrast-enhanced computed tomography (nCT) compared to ultrasound sonography (US) as screening method for abdominal aortic aneurysm (AAA) screening. Methods: Consecutively attending men (n = 566) from the pilot study of the randomized Danish CardioVascular Screening......CT seems superior to US concerning sensitivity, and is able to detect aneurysmal lesions not detectable with US. Finally, the prevalence of AAA in Denmark seems to remain relatively high, in this small pilot study group....

  10. SCREENING METHODS FOR SELECTION OF SURFACTANT FORMULATIONS FOR IOR FROM FRACTURED CARBONATE RESERVOIRS

    Energy Technology Data Exchange (ETDEWEB)

    William A. Goddard III; Yongchun Tang; Patrick Shuler; Mario Blanco; Yongfu Wu; Seung Soon Jang

    2005-07-01

    This topical report presents details of the laboratory work performed to complete Task 1 of this project; developing rapid screening methods to assess surfactant performance for IOR (Improved Oil Recovery) from fractured carbonate reservoirs. The desired outcome is to identify surfactant formulations that increase the rate and amount of aqueous phase imbibition into oil-rich, oil-wet carbonate reservoir rock. Changing the wettability from oil-wet to water-wet is one key to enhancing this water-phase imbibition process that in turn recovers additional oil from the matrix portion of a carbonate reservoir. The common laboratory test to evaluate candidate surfactant formulations is to measure directly the aqueous imbibition rate and oil recovery from small outcrop or reservoir cores, but this procedure typically requires several weeks. Two methods are presented here for the rapid screening of candidate surfactant formulations for their potential IOR performance in carbonate reservoirs. One promising surfactant screening protocol is based on the ability of a surfactant solution to remove aged crude oil that coats a clear calcite crystal (Iceland Spar). Good surfactant candidate solutions remove the most oil the quickest from the chips, plus change the apparent contact angle of the remaining oil droplets on the surface that thereby indicate increased water-wetting. The other fast surfactant screening method is based on the flotation behavior of powdered calcite in water. In this test protocol, first the calcite power is pre-treated to make the surface oil-wet. The next step is to add the pre-treated powder to a test tube and add a candidate aqueous surfactant formulation; the greater the percentage of the calcite that now sinks to the bottom rather than floats, the more effective the surfactant is in changing the solids to become now preferentially water-wet. Results from the screening test generally are consistent with surfactant performance reported in the literature.

  11. Real-time and online screening method for materials emitting volatile organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Changhyuk [University of Minnesota, Department of Mechanical Engineering (United States); Sul, Yong Tae [Hoseo University (Korea, Republic of); Pui, David Y. H., E-mail: dyhpui@umn.edu [University of Minnesota, Department of Mechanical Engineering (United States)

    2016-09-15

    In the semiconductor industry, volatile organic compounds (VOCs) in the cleanroom air work as airborne molecular contamination, which reduce the production yield of semiconductor chips by forming nanoparticles and haze on silicon wafers and photomasks under ultraviolet irradiation during photolithography processes. Even though VOCs in outdoor air are removed by gas filters, VOCs can be emitted from many kinds of materials used in cleanrooms, such as organic solvents and construction materials (e.g., adhesives, flame retardants and sealants), threatening the production of semiconductors. Therefore, finding new replacements that emit lower VOCs is now essential in the semiconductor industry. In this study, we developed a real-time and online method to screen materials for developing the replacements by converting VOCs into nanoparticles under soft X-ray irradiation. This screening method was applied to measure VOCs emitted from different kinds of organic solvents and adhesives. Our results showed good repeatability and high sensitivity for VOCs, which come from aromatic compounds, some alcohols and all tested adhesives (Super glue and cleanroom-use adhesives). In addition, the overall trend of measured VOCs from cleanroom-use adhesives was well matched with those measured by a commercial thermal desorption–gas chromatography–mass spectrometry, which is a widely used off-line method for analyzing VOCs. Based on the results, this screening method can help accelerate the developing process for reducing VOCs in cleanrooms.

  12. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    Energy Technology Data Exchange (ETDEWEB)

    Li, Juan, E-mail: lijuan@craes.org.cn [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Yang, Yang [College of Environment, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Huan, Huan; Li, Mingxiao [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Xi, Beidou, E-mail: xibd413@yeah.net [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Lanzhou Jiaotong University, Lanzhou 730070 (China); Lv, Ningqing [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Wu, Yi [Guizhou Academy of Environmental Science and Designing, Guizhou 550000 (China); Xie, Yiwen, E-mail: qin3201@126.com [School of Chemical and Environmental Engineering, Dongguan University of Technology, Dongguan, 523808 (China); Li, Xiang; Yang, Jinjin [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China)

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  13. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    International Nuclear Information System (INIS)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-01-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  14. HIGH THROUGHPUT SCREENING METHOD AND APPARATUS FOR ANALYSING INTERACTIONS BETWEEN SURFACES WITH DIFFERENT TOPOGRAPHY AND THE ENVIRONMENT

    NARCIS (Netherlands)

    de Boer, Jan; van Blitterswijk, Clemens; Unadkat, H.V.; Stamatialis, Dimitrios; Papenburg, B.J.; Wessling, Matthias

    2009-01-01

    The invention is directed to a high throughput screening method for analysing and interaction between a surface of a material and an environment. The screening method of the invention comprises: providing a micro-array comprising said material and having a multitude of units at least part of which

  15. Optimal Methods to Screen Men and Women for Intimate Partner Violence: Results from an Internal Medicine Residency Continuity Clinic

    Science.gov (United States)

    Kapur, Nitin A.; Windish, Donna M.

    2011-01-01

    Contradictory data exist regarding optimal methods and instruments for intimate partner violence (IPV) screening in primary care settings. The purpose of this study was to determine the optimal method and screening instrument for IPV among men and women in a primary-care resident clinic. We conducted a cross-sectional study at an urban, academic,…

  16. A novel two-step method for screening shade tolerant mutant plants via dwarfism

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-10-01

    Full Text Available When subjected to shade, plants undergo rapid shoot elongation, which often makes them more prone to disease and mechanical damage. Shade-tolerant plants can be difficult to breed; however, they offer a substantial benefit over other varieties in low-light areas. Although perennial ryegrass (Lolium perenne L. is a popular species of turf grasses because of their good appearance and fast establishment, the plant normally does not perform well under shade conditions. It has been reported that, in turfgrass, induced dwarfism can enhance shade tolerance. Here we describe a two-step procedure for isolating shade tolerant mutants of perennial ryegrass by first screening for dominant dwarf mutants, and then screening dwarf plants for shade tolerance. The two-step screening process to isolate shade tolerant mutants can be done efficiently with limited space at early seedling stages, which enables quick and efficient isolation of shade tolerant mutants, and thus facilitates development of shade tolerant new cultivars of turfgrasses. Using the method, we isolated 136 dwarf mutants from 300,000 mutagenized seeds, with 65 being shade tolerant (0.022%. When screened directly for shade tolerance, we recovered only four mutants from a population of 150,000 (0.003% mutagenized seeds. One shade tolerant mutant, shadow-1, was characterized in detail. In addition to dwarfism, shadow-1 and its sexual progeny displayed high degrees of tolerance to both natural and artificial shade. We showed that endogenous gibberellin (GA content in shadow-1 was higher than wild-type controls, and shadow-1 was also partially GA insensitive. Our novel, simple and effective two-step screening method should be applicable to breeding shade tolerant cultivars of turfgrasses, ground covers, and other economically important crop plants that can be used under canopies of existing vegetation to increase productivity per unit area of land.

  17. Using stable isotopes to monitor forms of sulfur during desulfurization processes: A quick screening method

    Science.gov (United States)

    Liu, Chao-Li; Hackley, Keith C.; Coleman, D.D.; Kruse, C.W.

    1987-01-01

    A method using stable isotope ratio analysis to monitor the reactivity of sulfur forms in coal during thermal and chemical desulfurization processes has been developed at the Illinois State Geological Survey. The method is based upon the fact that a significant difference exists in some coals between the 34S/32S ratios of the pyritic and organic sulfur. A screening method for determining the suitability of coal samples for use in isotope ratio analysis is described. Making these special coals available from coal sample programs would assist research groups in sorting out the complex sulfur chemistry which accompanies thermal and chemical processing of high sulfur coals. ?? 1987.

  18. Ultra-high-throughput screening method for the directed evolution of glucose oxidase.

    Science.gov (United States)

    Ostafe, Raluca; Prodanovic, Radivoje; Nazor, Jovana; Fischer, Rainer

    2014-03-20

    Glucose oxidase (GOx) is used in many industrial processes that could benefit from improved versions of the enzyme. Some improvements like higher activity under physiological conditions and thermal stability could be useful for GOx applications in biosensors and biofuel cells. Directed evolution is one of the currently available methods to engineer improved GOx variants. Here, we describe an ultra-high-throughput screening system for sorting the best enzyme variants generated by directed evolution that incorporates several methodological refinements: flow cytometry, in vitro compartmentalization, yeast surface display, fluorescent labeling of the expressed enzyme, delivery of glucose substrate to the reaction mixture through the oil phase, and covalent labeling of the cells with fluorescein-tyramide. The method enables quantitative screening of gene libraries to identify clones with improved activity and it also allows cells to be selected based not only on the overall activity but also on the specific activity of the enzyme. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Methods for efficient high-throughput screening of protein expression in recombinant Pichia pastoris strains.

    Science.gov (United States)

    Camattari, Andrea; Weinhandl, Katrin; Gudiminchi, Rama K

    2014-01-01

    The methylotrophic yeast Pichia pastoris is becoming one of the favorite industrial workhorses for protein expression. Due to the widespread use of integration vectors, which generates significant clonal variability, screening methods allowing assaying hundreds of individual clones are of particular importance. Here we describe methods to detect and analyze protein expression, developed in a 96-well format for high-throughput screening of recombinant P. pastoris strains. The chapter covers essentially three common scenarios: (1) an enzymatic assay for proteins expressed in the cell cytoplasm, requiring cell lysis; (2) a whole-cell assay for a fungal cytochrome P450; and (3) a nonenzymatic assay for detection and quantification of tagged protein secreted into the supernatant.

  20. A method of measuring and correcting tilt of anti - vibration wind turbines based on screening algorithm

    Science.gov (United States)

    Xiao, Zhongxiu

    2018-04-01

    A Method of Measuring and Correcting Tilt of Anti - vibration Wind Turbines Based on Screening Algorithm is proposed in this paper. First of all, we design a device which the core is the acceleration sensor ADXL203, the inclination is measured by installing it on the tower of the wind turbine as well as the engine room. Next using the Kalman filter algorithm to filter effectively by establishing a state space model for signal and noise. Then we use matlab for simulation. Considering the impact of the tower and nacelle vibration on the collected data, the original data and the filtering data are classified and stored by the Screening algorithm, then filter the filtering data to make the output data more accurate. Finally, we eliminate installation errors by using algorithm to achieve the tilt correction. The device based on this method has high precision, low cost and anti-vibration advantages. It has a wide range of application and promotion value.

  1. Application of NMR Screening Methods with 19F Detection to Fluorinated Compounds Bound to Proteins

    Directory of Open Access Journals (Sweden)

    Kazuo Furihata

    2017-12-01

    Full Text Available The combinational use of one-dimensional (1D NMR-based screening techniques with 1H and 19F detections were applied to a human serum albumin–diflunisal complex. Since most NMR screening methods observe 1H spectra, the overlapped 1H signals were unavailable in the binding epitope mapping. However, the NMR experiments with 19F detection can be used as an effective complementary method. For the purpose of identifying the 1H and 19F binding epitopes of diflunisal, this paper carries out a combinatorial analysis using 1H{1H} and 19F{1H} saturation transfer difference experiments. The differences of the 1H-inversion recovery rates with and without target irradiation are also analyzed for a comprehensive interpretation of binding epitope mapping.

  2. Use of the blue cotton screen method with endoscopy to detect occult esophageal foreign bodies.

    Science.gov (United States)

    Xia, Yan; Zhang, Fan; Xu, Hong; Xu, Weiran

    2017-12-01

    More than 20,000 cases of upper gastrointestinal foreign bodies (FBs) have been reported in the last 5 years in China. Early detection and treatment is vital in these patients. Differential diagnosis of esophageal injury and occult esophageal foreign bodies is challenging, particularly in the case of non-radio-opaque foreign bodies. A diagnostic technique with high accuracy and low risk is needed for clinical practice. We describe successful use of the "blue cotton screen method" to detect esophageal foreign bodies in 2 patients. The advantages and disadvantages of various diagnostic modalities in the management of patients with foreign body ingestion are presented. This technique is safer and more effective than traditional methods for foreign body impaction in the esophageal cavity. It could be applied for screening and in the differential diagnosis of esophageal injury and FBs in the esophageal lumen.

  3. A study on asymptomatic bacteriuria in pregnancy: prevalence, etiology and comparison of screening methods

    OpenAIRE

    Kheya Mukherjee; Saroj Golia; Vasudha CL; Babita; Debojyoti Bhattacharjee; Goutam Chakroborti

    2014-01-01

    Background: Asymptomatic bacteriuria is common in women with prevalence of 4-7% in pregnancy. The traditional reference test for bacteriuria is quantitative culture of urine which is relatively expensive time consuming and laborious. The aim of this study was to know the prevalence of asymptomatic bacteriuria in pregnancy, to identify pathogens and their antibiotic susceptibility patterns and to device a single or combined rapid screening method as an acceptable alternative to urine culture. ...

  4. A rapid colorimetric screening method for vanillic acid and vanillin-producing bacterial strains.

    Science.gov (United States)

    Zamzuri, N A; Abd-Aziz, S; Rahim, R A; Phang, L Y; Alitheen, N B; Maeda, T

    2014-04-01

    To isolate a bacterial strain capable of biotransforming ferulic acid, a major component of lignin, into vanillin and vanillic acid by a rapid colorimetric screening method. For the production of vanillin, a natural aroma compound, we attempted to isolate a potential strain using a simple screening method based on pH change resulting from the degradation of ferulic acid. The strain Pseudomonas sp. AZ10 UPM exhibited a significant result because of colour changes observed on the assay plate on day 1 with a high intensity of yellow colour. The biotransformation of ferulic acid into vanillic acid by the AZ10 strain provided the yield (Yp/s ) and productivity (Pr ) of 1·08 mg mg(-1) and 53·1 mg L(-1) h(-1) , respectively. In fact, new investigations regarding lignin degradation revealed that the strain was not able to produce vanillin and vanillic acid directly from lignin; however, partially digested lignin by mixed enzymatic treatment allowed the strain to produce 30·7 mg l(-1) and 1·94 mg l(-1) of vanillic acid and biovanillin, respectively. (i) The rapid colorimetric screening method allowed the isolation of a biovanillin producer using ferulic acid as the sole carbon source. (ii) Enzymatic treatment partially digested lignin, which could then be utilized by the strain to produce biovanillin and vanillic acid. To the best of our knowledge, this is the first study reporting the use of a rapid colorimetric screening method for bacterial strains producing vanillin and vanillic acid from ferulic acid. © 2013 The Society for Applied Microbiology.

  5. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment.

    Science.gov (United States)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. Copyright © 2015

  6. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    International Nuclear Information System (INIS)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan; Durmus, Naside Gozde

    2011-01-01

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  7. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    Energy Technology Data Exchange (ETDEWEB)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan [Department of Medicine, Demirci Bio-Acoustic-MEMS in Medicine (BAMM) Laboratory, Center for Biomedical Engineering, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Durmus, Naside Gozde, E-mail: udemirci@rics.bwh.harvard.edu [School of Engineering and Division of Biology and Medicine, Brown University, Providence, RI (United States)

    2011-09-15

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  8. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  9. Comparison of different screening methods for blood pressure disorders in children and adolescents

    Directory of Open Access Journals (Sweden)

    Felipe Alves Mourato

    2015-06-01

    Full Text Available OBJECTIVE: To compare different methods of screening for blood pressure disorders in children and adolescents. METHOD: A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. RESULTS: The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. CONCLUSION: Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables.

  10. Comparison of three noninvasive methods for hemoglobin screening of blood donors.

    Science.gov (United States)

    Ardin, Sergey; Störmer, Melanie; Radojska, Stela; Oustianskaia, Larissa; Hahn, Moritz; Gathof, Birgit S

    2015-02-01

    To prevent phlebotomy of anemic individuals and to ensure hemoglobin (Hb) content of the blood units, Hb screening of blood donors before donation is essential. Hb values are mostly evaluated by measurement of capillary blood obtained from fingerstick. Rapid noninvasive methods have recently become available and may be preferred by donors and staff. The aim of this study was to evaluate for the first time all different noninvasive methods for Hb screening. Blood donors were screened for Hb levels in three different trials using three different noninvasive methods (Haemospect [MBR Optical Systems GmbH & Co. KG], NBM 200 [LMB Technology GmbH], Pronto-7 [Masimo Europe Ltd]) in comparison to the established fingerstick method (CompoLab Hb [Fresenius Kabi GmbH]) and to levels obtained from venous samples on a cell counter (Sysmex [Sysmex Europe GmbH]) as reference. The usability of the noninvasive methods was assessed with an especially developed survey. Technical failures occurred by using the Pronto-7 due to nail polish, skin color, or ambient light. The NBM 200 also showed a high sensitivity to ambient light and noticeably lower Hb levels for women than obtained from the Sysmex. The statistical analysis showed the following bias and standard deviation of differences of all methods in comparison to the venous results: Haemospect, -0.22 ± 1.24; NBM, 200 -0.12 ± 1.14; Pronto-7, -0.50 ± 0.99; and CompoLab Hb, -0.53 ± 0.81. Noninvasive Hb tests represent an attractive alternative by eliminating pain and reducing risks of blood contamination. The main problem for generating reliable results seems to be preanalytical variability in sampling. Despite the sensitivity to environmental stress, all methods are suitable for Hb measurement. © 2014 AABB.

  11. Performance Evaluation of a Novel Chemiluminescence Assay Detecting Treponema Pallidum Antibody as a Syphilis Screening Method.

    Science.gov (United States)

    Chen, Qixia; An, Jingna; Rao, Chenli; Wang, Tingting; Li, Dongdong; Feng, Shu; Tao, Chuanmin

    2016-01-01

    Syphilis is a major concern to global public health with increasing incidence. So its screening test should have sufficient sensitivity and specificity. We evaluated the performance of the Lumipulse G TP-N assay detection for syphilis screening and compared it with the InTec ELISA test kit for TP, which is widely used. Samples of several patient groups including 133 clinical and serologically characterized syphilitic sera, 175 samples containing potentially interfering agents, and 2290 unselected samples submitted for routine screening were detected by both the Lumipulse G TP-N assay and the InTec ELISA test kit for TP. Inconsistent samples were confirmed by RecomLine Treponema IgG, IgM immunoblot. Coefficient of variations of the Lumipulseo G TP-N assay at both levels were below 5% and of the InTec ELISA test kit for TP both over 5%. The sensitivity of the Lumipulse G TP-N assay and the InTec ELISA test kit for TP were 100% for all stages of syphilis. The two methods had consistent analytical specificity of 100% (95% CI: 97.21 - 100.00), while the clinical specificity was 100% (95% CI: 99.79 - 100.00) and 99.82% (95% CI: 99.51 - 99.94), respectively. Between them, Spearman's correlation coefficient was 0.455 and kappa value was 0.986. The overall sensitivity and specificity of the Lumipulse G TP-N assay was higher than the InTec ELISA test kit for TP (sensitivity: 100.0 versus 99.5, specificity: 100.0 versus 99.8). The automated Lumipulse G TP-N assay demonstrated excellent diagnostic sensitivity and specificity when evaluated as a screening test for syphilis. Thus, it can be an alternative to the treponemal screening test.

  12. Novel modulatory effects of neurosteroids and benzodiazepines on excitatory and inhibitory neurons excitability: a multi-electrode array (MEA recording study"

    Directory of Open Access Journals (Sweden)

    Giulia ePuia

    2012-11-01

    Full Text Available The balance between glutamate- and GABA-mediated neurotransmission in the brain is fundamental in the nervous system, but it is regulated by the ‘tonic’ release of a variety of endogenous factors. One such important group of molecules are the neurosteroids (NSs which, similarly to benzodiazepines (BDZs, enhance GABAergic neurotransmission. The purpose of our work was to investigate, at in-vivo physiologically relevant concentrations, the effects of NSs and BDZs as GABA modulators on dissociated neocortical neuron networks grown in long-term culture. We used a multi-electrode array (MEA recording technique and a novel analysis that was able to both identify the action potentials of engaged excitatory and inhibitory neurons and to detect drug-induced network up-states (burst. We found that the NSs tetrahydrodeoxycorticosterone (THDOC and allopregnanolone (ALLO applied at low nM concentrations, produced different modulatory effects on the two neuronal clusters. Conversely, at high concentrations (1 µM, both NSs, decreased excitatory and inhibitory neuron cluster excitability; however, even several hours after washout, the excitability of inhibitory neurons continued to be depressed, leading to a network long term depression (LTD. The BDZs clonazepam (CLZ and midazolam (MDZ also decreased the network excitability, but only MDZ caused LTD of inhibitory neuron cluster. To investigate the origin of the LTD after MDZ application, we tested finasteride (FIN, an inhibitor of endogenous NSs synthesis. FIN did not prevent the LTD induced by MDZ, but surprisingly induced it after application of CLZ. The significance and possible mechanisms underlying these LTD effects of NSs and BDZs are discussed. Taken together, our results not only demonstrate that ex-vivo networks show a sensitivity to NSs and BDZs comparable to that expressed in vivo, but also provide a new global in-vitro description that can help in understanding their activity in more complex

  13. Evaluation of a fluorescence-based method for antibabesial drug screening.

    Science.gov (United States)

    Guswanto, Azirwan; Sivakumar, Thillaiampalam; Rizk, Mohamed Abdo; Elsayed, Shimaa Abd Elsalam; Youssef, Mohamed Ahmed; ElSaid, ElSaid El Shirbini; Yokoyama, Naoaki; Igarashi, Ikuo

    2014-08-01

    In vitro evaluation of chemotherapeutic agents against Babesia and Theileria parasites has become routine, and the effectiveness of these chemicals is usually determined by comparing the parasitemia dynamics of untreated and treated parasites. Although microscopy is widely used to calculate parasitemia, several disadvantages are associated with this technique. The present study evaluated a fluorescence-based method using SYBR green I stain (SG I) to screen antibabesial agents in in vitro cultures of Babesia bovis. The linearity between relative fluorescence units (RFU) and parasitemia was found to be well correlated with a 0.9944 goodness-of-fit (r(2)) value. Subsequently, 50% inhibitory concentration (IC50) values were calculated for 3 antiprotozoan agents, diminazene aceturate, nimbolide, and gedunin, by this method. For diminazene aceturate and nimbolide, the IC(50)s determined by the fluorescence-based method (408 nM and 8.13 μM, respectively) and microscopy (400.3 nM and 9.4 μM, respectively) were in agreement. Furthermore, the IC50 of gedunin determined by the fluorescence-based method (19 μM) was similar to the recently described microscopy-based value (21.7 μM) for B. bovis. Additionally, the Z' factor (0.80 to 0.90), signal-to-noise (S/N) ratio (44.15 to 87.64), coefficient of variation at the maximum signal (%CVmax) (0.50 to 2.85), and coefficient of variation at the minimum signal (%CVmin) (1.23 to 2.21) calculated for the fluorescence method using diminazene aceturate were comparable to those previously determined in malaria research for this assay. These findings suggest that the fluorescence-based method might be useful for antibabesial drug screening and may have potential to be developed into a high-throughput screening (HTS) assay. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Determination of formation heterogeneity at a range of scales using novel multi-electrode resistivity scanning techniques

    International Nuclear Information System (INIS)

    Williams, G.M.; Jackson, P.D.; Ward, R.S.; Sen, M.A.; Meldrum, P.; Lovell, M.

    1991-01-01

    The traditional method of measuring ground resistivity involves passing a current through two outer electrodes, measuring the potential developed across two electrodes in between, and applying Ohm's Law. In the RESCAN system developed by the British Geological Survey, each electrode can be electronically selected and controlled by software to either pass current or measure potential. Thousands of electrodes can be attached to the system either in 2-D surface arrays or along special plastic covered probes driven vertically into the ground or emplaced in boreholes. Under computer control, the resistivity distribution within the emplaced array can be determined automatically with unprecedented detail and speed, and may be displayed as an image. So far, the RESCAN system has been applied at the meso-scale in monitoring the radial migration of an electrolyte introduced into a recharge well in an unconsolidated aquifer; and CORSCAN at the micro-scale on drill cores to evaluate spatial variability in physical properties. The RESCAN technique has considerable potential for determining formation heterogeneity at different scales and provides a basis for developing stochastic models of groundwater and solute flow in heterogeneous systems. 13 figs.; 1 tab.; 12 refs

  15. Benchmarking Data Sets for the Evaluation of Virtual Ligand Screening Methods: Review and Perspectives.

    Science.gov (United States)

    Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu

    2015-07-27

    Virtual screening methods are commonly used nowadays in drug discovery processes. However, to ensure their reliability, they have to be carefully evaluated. The evaluation of these methods is often realized in a retrospective way, notably by studying the enrichment of benchmarking data sets. To this purpose, numerous benchmarking data sets were developed over the years, and the resulting improvements led to the availability of high quality benchmarking data sets. However, some points still have to be considered in the selection of the active compounds, decoys, and protein structures to obtain optimal benchmarking data sets.

  16. Development of nondestructive screening methods for single kernel characterization of wheat

    DEFF Research Database (Denmark)

    Nielsen, J.P.; Pedersen, D.K.; Munck, L.

    2003-01-01

    predictability. However, by applying an averaging approach, in which single seed replicate measurements are mathematically simulated, a very good NIT prediction model was achieved. This suggests that the single seed NIT spectra contain hardness information, but that a single seed hardness method with higher......The development of nondestructive screening methods for single seed protein, vitreousness, density, and hardness index has been studied for single kernels of European wheat. A single kernel procedure was applied involving, image analysis, near-infrared transmittance (NIT) spectroscopy, laboratory...

  17. Comparison of different screening methods for blood pressure disorders in children and adolescents.

    Science.gov (United States)

    Mourato, Felipe Alves; Lima Filho, José Luiz; Mattos, Sandra da Silva

    2015-01-01

    To compare different methods of screening for blood pressure disorders in children and adolescents. A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  18. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  19. Survey of the Role of Combined Screening Method with Ultrasonography in the Diagnosis of Breast Cancer

    Directory of Open Access Journals (Sweden)

    F. Gharekhanloo

    2011-01-01

    Full Text Available Introduction & Objective: The breast cancer is the most common malignancy in women and in recent years it is seen in younger ages. Because of dense breast tissue in these ages, the mammography sensitivity for breast cancer detection is reduced, so high quality ultrasonography (US as a combined screening method is effective. The aim of this study is the evaluation of the mammographic finding with the positive finding of ultrasonogarphy.Materials & Methods: In this cross-sectional study 300 cases were referred to the Mehr Medical Imaging Center for breast US and sonography of breast and axilla was performed. Mammography before or after US was also performed by another radiologist. All suspicious patients were referred for biopsy or surgery.Results: Mean age of patients was 46 y/o with the range of 32-76 y/o. Pathologic specimens approved malignancy in 21 patients and abscess in 1 patient. The most frequent symptom was palpable breast mass with mean diameter of 29 mm. Mean diameter of lymph nodes was 17.3 mm. Positive mammographic findings were seen in 85.7%and negative findings or only an asymmetric density in 14.3%.Conclusion: According to dense breast tissue especially in young women sensitivity of single screening by mammography is reduced in breast cancer detection, so combined screening with sonography and mammography especially in younger women improves the detection rate of breast carcinoma. (Sci J Hamadan Univ Med Sci 2011;17(4:57-60

  20. Non-destructive screening method for radiation hardened performance of large scale integration

    International Nuclear Information System (INIS)

    Zhou Dong; Xi Shanbin; Guo Qi; Ren Diyuan; Li Yudong; Sun Jing; Wen Lin

    2013-01-01

    The space radiation environment could induce radiation damage on the electronic devices. As the performance of commercial devices is generally superior to that of radiation hardened devices, it is necessary to screen out the devices with good radiation hardened performance from the commercial devices and applying these devices to space systems could improve the reliability of the systems. Combining the mathematical regression analysis with the different physical stressing experiments, we investigated the non-destructive screening method for radiation hardened performance of the integrated circuit. The relationship between the change of typical parameters and the radiation performance of the circuit was discussed. The irradiation-sensitive parameters were confirmed. The pluralistic linear regression equation toward the prediction of the radiation performance was established. Finally, the regression equations under stress conditions were verified by practical irradiation. The results show that the reliability and accuracy of the non-destructive screening method can be elevated by combining the mathematical regression analysis with the practical stressing experiment. (authors)

  1. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  2. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome.

    Science.gov (United States)

    Gourgari, Evgenia; Spanakis, Elias; Dobs, Adrian Sandra

    2016-01-01

    Polycystic ovary syndrome (PCOS) is a syndrome associated with insulin resistance (IR), obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have.

  3. From Classical to High Throughput Screening Methods for Feruloyl Esterases: A Review.

    Science.gov (United States)

    Ramírez-Velasco, Lorena; Armendáriz-Ruiz, Mariana; Rodríguez-González, Jorge Alberto; Müller-Santos, Marcelo; Asaff-Torres, Ali; Mateos-Díaz, Juan Carlos

    2016-01-01

    Feruloyl esterases (FAEs) are a diverse group of hydrolases widely distributed in plants and microorganisms which catalyzes the cleavage and formation of ester bonds between plant cell wall polysaccharides and phenolic acids. FAEs have gained importance in biofuel, medicine and food industries due to their capability of acting on a large range of substrates for cleaving ester bonds and synthesizing highadded value molecules through esterification and transesterification reactions. During the past two decades extensive studies have been carried out on the production, characterization and classification of FAEs, however only a few reports of suitable High Throughput Screening assays for this kind of enzymes have been reported. This review is focused on a concise but complete revision of classical to High Throughput Screening methods for FAEs, highlighting its advantages and disadvantages, and finally suggesting future perspectives for this important research field.

  4. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23): a study protocol.

    Science.gov (United States)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe; Christensen, Jette; Johansen, Tonje; Hariri, Jalil; Christiansen, Sanne; Rygaard, Carsten; Lynge, Elsebeth

    2018-05-26

    The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could therefore be offered less intensive screening. Primary HPV testing is more sensitive than cytology, allowing for a longer screening interval. The aim of Trial23 is to investigate if primary HPV testing with cytology triage of HPV positive samples is a reasonable screening scheme for women offered HPV vaccination as girls. Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study including intention-to-treat and per-protocol analyses. The potential effect of primary HPV screening with a 6-year interval will be calculated from the observed data. The study protocol has been submitted to the ethical committee and deemed a method study. All women are screened according to routine guidelines. The study will contribute new evidence on the future screening of HPV vaccinated birth cohorts of women. All results will be published in open-access journal. NCT03049553; Pre-results. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  5. Survey of South African fruit juices using a fast screening HILIC-MS method.

    Science.gov (United States)

    Stander, Marietjie A; Kühn, Wernich; Hiten, Nicholas F

    2013-01-01

    Adulteration of fruit juices--by the addition of sugar or other less expensive fruit juices as well as preservatives, artificial sweeteners and colours--was tested for by using a developed screening method. The method employs hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS) using electrospray ionisation in the negative mode and ultraviolet light detection. Different fruit juices can be differentiated by the content of marker compounds like sorbitol, certain phenolic molecules and their saccharide profile. This method was used to test 46 fruit juice samples from the retail market as well as 12 control samples. The study focused on the main types of fruit juices consumed on the South African market including apple, orange, grape and blends of these juices with other fruits like mango, pear and guava. Overall, the 46 samples tested mostly agreed with label claims. One grape juice sample was adulterated, probably with apple juice. Natamycin above the legal limits was found in two samples. In addition, two samples contained natamycin and one sample benzoate without it being indicated on the label. The method is well suited as a quick screening method for fruit juice adulteration and if used routinely would reduce fruit juice adulteration without the cost of the current array of tests needed for authenticity testing.

  6. Screening of groundwater remedial alternatives for brownfield sites: a comprehensive method integrated MCDA with numerical simulation.

    Science.gov (United States)

    Li, Wei; Zhang, Min; Wang, Mingyu; Han, Zhantao; Liu, Jiankai; Chen, Zhezhou; Liu, Bo; Yan, Yan; Liu, Zhu

    2018-06-01

    Brownfield sites pollution and remediation is an urgent environmental issue worldwide. The screening and assessment of remedial alternatives is especially complex owing to its multiple criteria that involves technique, economy, and policy. To help the decision-makers selecting the remedial alternatives efficiently, the criteria framework conducted by the U.S. EPA is improved and a comprehensive method that integrates multiple criteria decision analysis (MCDA) with numerical simulation is conducted in this paper. The criteria framework is modified and classified into three categories: qualitative, semi-quantitative, and quantitative criteria, MCDA method, AHP-PROMETHEE (analytical hierarchy process-preference ranking organization method for enrichment evaluation) is used to determine the priority ranking of the remedial alternatives and the solute transport simulation is conducted to assess the remedial efficiency. A case study was present to demonstrate the screening method in a brownfield site in Cangzhou, northern China. The results show that the systematic method provides a reliable way to quantify the priority of the remedial alternatives.

  7. Spectroscopic and Spectrometric Methods Used for the Screening of Certain Herbal Food Supplements Suspected of Adulteration.

    Science.gov (United States)

    Mateescu, Cristina; Popescu, Anca Mihaela; Radu, Gabriel Lucian; Onisei, Tatiana; Raducanu, Adina Elena

    2017-06-01

    Purpose: This study was carried out in order to find a reliable method for the fast detection of adulterated herbal food supplements with sexual enhancement claims. As some herbal products are advertised as "all natural", their "efficiency" is often increased by addition of active pharmaceutical ingredients such as PDE-5 inhibitors, which can be a real health threat for the consumer. Methodes: Adulterants, potentially present in 50 herbal food supplements with sexual improvement claims, were detected using 2 spectroscopic methods - Raman and Fourier Transform Infrared - known for reliability, reproductibility, and an easy sample preparation. GC-MS technique was used to confirm the potential adulterants spectra. Results: About 22% (11 out of 50 samples) of herbal food supplements with sexual enhancement claims analyzed by spectroscopic and spectrometric methods proved to be "enriched" with active pharmaceutical compounds such as: sildenafil and two of its analogues, tadalafil and phenolphthalein. The occurence of phenolphthalein could be the reason for the non-relevant results obtained by FTIR method in some samples. 91% of the adulterated herbal food supplements were originating from China. Conclusion: The results of this screening highlighted the necessity for an accurate analysis of all alleged herbal aphrodisiacs on the Romanian market. This is a first such a screening analysis carried out on herbal food supplements with sexual enhancement claims.

  8. A Rapid and Efficient Screening Method for Antibacterial Compound-Producing Bacteria.

    Science.gov (United States)

    Hettiarachchi, Sachithra; Lee, Su-Jin; Lee, Youngdeuk; Kwon, Young-Kyung; De Zoysa, Mahanama; Moon, Song; Jo, Eunyoung; Kim, Taeho; Kang, Do-Hyung; Heo, Soo-Jin; Oh, Chulhong

    2017-08-28

    Antibacterial compounds are widely used in the treatment of human and animal diseases. The overuse of antibiotics has led to a rapid rise in the prevalence of drug-resistant bacteria, making the development of new antibacterial compounds essential. This study focused on developing a fast and easy method for identifying marine bacteria that produce antibiotic compounds. Eight randomly selected marine target bacterial species ( Agrococcus terreus, Bacillus algicola, Mesoflavibacter zeaxanthinifaciens, Pseudoalteromonas flavipulchra, P. peptidolytica, P. piscicida, P. rubra , and Zunongwangia atlantica ) were tested for production of antibacterial compounds against four strains of test bacteria ( B. cereus, B. subtilis, Halomonas smyrnensis , and Vibrio alginolyticus ). Colony picking was used as the primary screening method. Clear zones were observed around colonies of P. flavipulchra, P. peptidolytica, P. piscicida , and P. rubra tested against B. cereus, B. subtilis , and H. smyrnensis . The efficiency of colony scraping and broth culture methods for antimicrobial compound extraction was also compared using a disk diffusion assay. P. peptidolytica, P. piscicida , and P. rubra showed antagonistic activity against H. smyrnensis, B. cereus , and B. subtilis , respectively, only in the colony scraping method. Our results show that colony picking and colony scraping are effective, quick, and easy methods of screening for antibacterial compound-producing bacteria.

  9. Combining Pathway Identification and Breast Cancer Survival Prediction via Screening-Network Methods

    Directory of Open Access Journals (Sweden)

    Antonella Iuliano

    2018-06-01

    Full Text Available Breast cancer is one of the most common invasive tumors causing high mortality among women. It is characterized by high heterogeneity regarding its biological and clinical characteristics. Several high-throughput assays have been used to collect genome-wide information for many patients in large collaborative studies. This knowledge has improved our understanding of its biology and led to new methods of diagnosing and treating the disease. In particular, system biology has become a valid approach to obtain better insights into breast cancer biological mechanisms. A crucial component of current research lies in identifying novel biomarkers that can be predictive for breast cancer patient prognosis on the basis of the molecular signature of the tumor sample. However, the high dimension and low sample size of data greatly increase the difficulty of cancer survival analysis demanding for the development of ad-hoc statistical methods. In this work, we propose novel screening-network methods that predict patient survival outcome by screening key survival-related genes and we assess the capability of the proposed approaches using METABRIC dataset. In particular, we first identify a subset of genes by using variable screening techniques on gene expression data. Then, we perform Cox regression analysis by incorporating network information associated with the selected subset of genes. The novelty of this work consists in the improved prediction of survival responses due to the different types of screenings (i.e., a biomedical-driven, data-driven and a combination of the two before building the network-penalized model. Indeed, the combination of the two screening approaches allows us to use the available biological knowledge on breast cancer and complement it with additional information emerging from the data used for the analysis. Moreover, we also illustrate how to extend the proposed approaches to integrate an additional omic layer, such as copy number

  10. Development of a first-principles code based on the screened KKR method for large super-cells

    International Nuclear Information System (INIS)

    Doi, S; Ogura, M; Akai, H

    2013-01-01

    The procedures of performing first-principles electronic structure calculation using the Korringa-Kohn-Rostoker (KKR) and the screened KKR methods are reviewed with an emphasis put on their numerical efficiency. It is shown that an iterative matrix inversion combined with a suitable preconditioning greatly improves the computational time of screened KKR method. The method is well parallelized and also has an O(N) scaling property

  11. The minisequencing method: a simple strategy for genetic screening of MEN 2 families

    Directory of Open Access Journals (Sweden)

    Domingues Rita

    2002-05-01

    Full Text Available Abstract Background Multiple endocrine neoplasia type 2 is an autosomal dominant disorder. MEN 2A is characterized by medullary thyroid carcinoma, pheochromocytoma and hyperparathyroidism; MEN 2B by medullary thyroid carcinoma, pheochromocytoma and characteristic stigmata. Activating germline mutations of the RET proto oncogene are responsible for this hereditary syndrome. Codon 634 mutations are the most common mutations occurring in MEN 2A families whereas a specific mutation at codon 918 is observed in the great majority of MEN 2B families. Analysis of these codons will provide a final diagnosis in the great majority of affected families making unnecessary further studies. To specifically study the codons 634 and 918 we used a minisequencing method as an alternative method to complete sequencing. Results Using this mutation detection method we were able to reproduce in all cases, representative of 7 families, the information previously obtained by direct sequencing of PCR products. Depending on the number of primers used in the minisequencing reaction, we were able to interrogate either only one nucleotide of the target codon or the three nucleotides simultaneously. Conclusions This technique appears as a simple, rapid and efficient method for genetic screening of MEN 2 families. It can be utilized to seek for unknown mutations at specific codons or to screen for previously identified mutations and is therefore of interest to study index cases or individuals at risk. Results suggest that complete sequencing is unnecessary.

  12. Method for rapid screening analysis of Sr-90 in edible plant samples collected near Fukushima, Japan

    International Nuclear Information System (INIS)

    Amano, Hikaru; Sakamoto, Hideaki; Shiga, Norikatsu; Suzuki, Kaori

    2016-01-01

    A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. The dissolved oxalate precipitate was loaded on an extraction chromatography resin, and the 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. 90 Sr ( 90 Y) concentration was determined in plant samples collected near the damaged Fukushima Daiichi Nuclear Power Plants with this method. - Highlights: • A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. • 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. • The dissolved oxalate precipitate was loaded on an extraction chromatography resin. • 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. • 90 Sr ( 90 Y) concentration was determined in edible plant samples collected near the damaged Fukushima Daiichi NPPs with this method.

  13. Colorimetric method for enzymatic screening assay of ATP using Fe(III)-xylenol orange complex formation.

    Science.gov (United States)

    Ishida, Akihiko; Yamada, Yasuko; Kamidate, Tamio

    2008-11-01

    In hygiene management, recently there has been a significant need for screening methods for microbial contamination by visual observation or with commonly used colorimetric apparatus. The amount of adenosine triphosphate (ATP) can serve as the index of a microorganism. This paper describes the development of a colorimetric method for the assay of ATP, using enzymatic cycling and Fe(III)-xylenol orange (XO) complex formation. The color characteristics of the Fe(III)-XO complexes, which show a distinct color change from yellow to purple, assist the visual observation in screening work. In this method, a trace amount of ATP was converted to pyruvate, which was further amplified exponentially with coupled enzymatic reactions. Eventually, pyruvate was converted to the Fe(III)-XO complexes through pyruvate oxidase reaction and Fe(II) oxidation. As the assay result, yellow or purple color was observed: A yellow color indicates that the ATP concentration is lower than the criterion of the test, and a purple color indicates that the ATP concentration is higher than the criterion. The method was applied to the assay of ATP extracted from Escherichia coli cells added to cow milk.

  14. Carbamazepine-Fumaric Acid Co-Crystal Screening Using Solution Based Method

    Directory of Open Access Journals (Sweden)

    Abd Rahim Syarifah

    2016-01-01

    Full Text Available Co-crystals is a multi-component system which connected by non-covalent interactions, present physically as a solid form under ambient conditions. Nowadays, co-crystal has becoming as an alternative approach to improve the bioavailability of poor water soluble drugs especially for a weakly ionisable groups or neutral compounds. In this study the co-crystal screening was carried out for carbamazepine (CBZ and fumaric acid (FUM co-crystal former (CCF using non-stoichiometric method (addition of CBZ to CCF saturated solution and stoichiometric method (evaporation of 1:1 molar ratio of CBZ to CCF in acetonitrile, ethyl acetate, propanol, ethanol and formic acid solvent systems. The crystals produced from the screening were characterized using Powder X-ray Diffraction (PXRD, Differential Scanning Calorimetry (DSC and Fourier Transform Infrared (FT-IR. The PXRD analysis had confirmed that the co-crystal was successfully formed in both methods for all of the solvent system studied with an exception to formic acid in the stoichiometric method where no crystal was found precipitate. The findings from this study revealed that Form A and Form B of CBZ-FUM co-crystal had been successfully formed from different solvent systems.

  15. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  16. High prevalence of bacteriuria in pregnancy and its screening methods in north India.

    Science.gov (United States)

    Bandyopadhyay, Sutapa; Thakur, J S; Ray, Pallab; Kumar, Rajesh

    2005-05-01

    The study aims at finding out the prevalence of bacteruria in pregnancy in an urban setting and ascertaining methods to screen them in primary care clinics. A total of 1 61 pregnant ladies visiting a primary care clinic were screened for bacteriuria based on the symptomatology. Urine culture was done to know the prevalence of bacteriuria. Sensitivities and specificities were calculated for each symptom and risk assessment. A score card was developed based on combination of positive risk assessment and constellation of symptoms. Prevalence of symptomatic and asymptomatic bacteriuria was found to be 19.87% and 4.34% respectively. Prevalence of bacteriuria was significantly high among those who had intercourse more frequently and those with less water intake. Those with a score of more than or equal to 4, as per score card were 60% more likely to suffer from bacteriuria. When combined with microscopic examination for leucocytes on positively screened, the positive predictive value was found to be 89%. It is concluded that prevalence of symptomatic bacteriuria is common among pregnant women. Syndromic management of cases on the basis of score card is helpful in resource constraint areas. This may be combined with microscopic examination of urine to entail rational use of antibiotics.

  17. Trojan Horse Method: a useful tool for electron screening effect investigation

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R.G.; Spitaleri, C.; Cherubini, S.; La Cognata, M.; Lamia, L.; Romano, S.; Sergi, M.L. [Laboratori Nazionali del Sud-INFN and DMFCI Universita di Catania, Catania (Italy); Tumino, A. [Universita Kore, Enna (Italy); Li, C.; Wen, Q.; Zhou, S. [Department of Nuclear Physics, CIAE, Beijing (China); Burjan, V.; Kroha, V.; Mrazek, J. [Cyclotron Institute, Academy of Science, Rez, Czech Rep. (Czech Republic); Carlin, N.; Gimenez del Santo, M.; Szanto de Toledo, A. [Departamento de Fisica, Universidad de Sao Paulo (Brazil); Kubono, S.; Wakabayashi, T.; Yamaguchi, H. [CNS, University of Tokyo, Wako (Japan)

    2010-03-01

    Direct measurements in the last decades have highlighted a new problem related to the lowering of the Coulomb barrier between the interacting nuclei due to the presence of the 'electron screening' in the laboratory measurements. It was systematically observed that the presence of the electronic cloud around the interacting ions in measurements of nuclear reactions cross sections at astrophysical energies gives rise to an enhancement of the astrophysical S(E)-factor as lower and lower energies are explored [H. Assenbaum, K. Langanke, C. Rolfs, Z. Phys. 327 (1987) 461]. Moreover, at present such an effect is not well understood as the value of the potential for screening extracted from these measurements is higher than the upper limit of theoretical predictions (adiabatic limit). On the other hand, the electron screening potential in laboratory measurement is different from that occurring in stellar plasmas thus the quantity of interest in astrophysics is the so-called 'bare nucleus cross section'. This quantity can only be extrapolated in direct measurements. These are the reasons that led to a considerable growth on interest in indirect measurement techniques and in particular the Trojan Horse Method (THM) [G. Baur, Phys. Lett. B 178, (1986) 135; S. Cherubini et al. Ap. J. 457, (1996) 855] Results concerning the bare nucleus cross sections measurements will be shown in several cases of astrophysical interest. In those cases the screening potential evaluated by means of the THM will be compared with the adiabatic limit and results arising from extrapolation in direct measurements.

  18. Cost-effectiveness of lung cancer screening and treatment methods: a systematic review of systematic reviews.

    Science.gov (United States)

    Azar, Farbod Ebadifard; Azami-Aghdash, Saber; Pournaghi-Azar, Fatemeh; Mazdaki, Alireza; Rezapour, Aziz; Ebrahimi, Parvin; Yousefzadeh, Negar

    2017-06-19

    Due to extensive literature in the field of lung cancer and their heterogeneous results, the aim of this study was to systematically review of systematic reviews studies which reviewed the cost-effectiveness of various lung cancer screening and treatment methods. In this systematic review of systematic reviews study, required data were collected searching the following key words which selected from Mesh: "lung cancer", "lung oncology", "lung Carcinoma", "lung neoplasm", "lung tumors", "cost- effectiveness", "systematic review" and "Meta-analysis". The following databases were searched: PubMed, Cochrane Library electronic databases, Google Scholar, and Scopus. Two reviewers (RA and A-AS) evaluated the articles according to the checklist of "assessment of multiple systematic reviews" (AMSTAR) tool. Overall, information of 110 papers was discussed in eight systematic reviews. Authors focused on cost-effectiveness of lung cancer treatments in five systematic reviews. Targeted therapy options (bevacizumab, Erlotinib and Crizotinib) show an acceptable cost-effectiveness. Results of three studies failed to show cost-effectiveness of screening methods. None of the studies had used the meta-analysis method. The Quality of Health Economic Studies (QHES) tool and Drummond checklist were mostly used in assessing the quality of articles. Most perspective was related to the Payer (64 times) and the lowest was related to Social (11times). Most cases referred to Incremental analysis (82%) and also the lowest point of referral was related to Discounting (in 49% of the cases). The average quality score of included studies was calculated 9.2% from 11. Targeted therapy can be an option for the treatment of lung cancer. Evaluation of the cost-effectiveness of computerized tomographic colonography (CTC) in lung cancer screening is recommended. The perspective of the community should be more taken into consideration in studies of cost-effectiveness. Paying more attention to the topic of

  19. Non invasive diagnostic methods for better screening of peripheral arterial disease.

    Science.gov (United States)

    Nirala, Neelamshobha; Periyasamy, R; Kumar, Awanish

    2018-05-16

    Peripheral arterial disease (PAD) is a common circulatory problem in which narrowed arteries reduce blood flow to extremities usually legs. It does not receive enough blood flow to keep up with demand. This causes symptoms, most notably leg pain while walking which is known as claudication. It is a common manifestation of type II Diabetes, but the relationship between other vascular diseases and lower limb (LL)-PAD has been poorly understood and investigated. When assessing a patient with clinically LLPAD, two questions are in order to establish a diagnosis: one is non-invasive testing and other is invasive. Invasive methods are painful and get so bad that some people need to have a leg surgery. People with Diabetes are at increased risk for amputation and it is used only when the damage is very severe. Diagnosis of LLPAD begins with a physical examination, patient history, certain questionnaire and non invasive mode of diagnosis is started for the screening of patients. Clinicians check for weak pulses in the legs and then decide for further diagnosis. Paper discusses the prevalence of LLPAD worldwide and in India along with the clinical effectiveness and limitations of these methods in case of Diabetes. The focus of this review is to discuss only those non invasive methods which are widely used for screening of LLPAD like Ankle brachial index (ABI), Toe brachial Index (TBI), and use of photoplethysmogram (PPG) specially in case of Diabetic patients. Also, this paper gives an overview of the work done using ABI, TBI, and PPG for detection of LLPAD. These tests are not painful and could be performed in a cost-effective manner to avoid delays in screening/diagnosis and also reduce costs. Copyright © 2018. Published by Elsevier Inc.

  20. Screening method for Staphylococcus aureus identification in subclinical bovine mastitis from dairy farms

    Directory of Open Access Journals (Sweden)

    Natapol Pumipuntu

    2017-07-01

    Full Text Available Background: Staphylococcus aureus is one of the most important contagious bacteria causing subclinical bovine mastitis. This bacterial infection is commonly identified by determine the pathogen in bovine milk samples through conventional technique including coagulase test. However, this test has several disadvantages as low sensitivity, risk of biohazard, cost expensive, and limited preparation especially in local area. Aim: Aim of this study was to compare and assess the screening method, Mannitol fermentation test (Mannitol salt agar [MSA], and deoxyribonuclease (DNase test, for S. aureus identification in milk samples. Materials and Methods: A total of 224 subclinical bovine mastitis milk samples were collected from four provinces of Thailand and determined S. aureus using conventional method and also subjected to the screening test, MSA and DNase test. The sensitivity, specificity, positive predictive value (PPV, and negative predictive value (NPV among both tests were analyzed and compared to the tube coagulase test (TCT, as reference method. Immunological test by latex agglutination and molecular assay by determined spa gene were also used to identify and differentiate S. aureus. Results: A total of 130 staphylococci were isolated by selective media, Gram-stain, and catalase test. The number of S. aureus which identified using TCT, MSA and DNase test were 32, 102, and 74 isolates, respectively. All TCT results were correlated to results of latex agglutination and spa gene which were 32 S. aureus. MSA showed 100% sensitivity, 28.57% specificity, 31.37% PPV, and 100% NPV, whereas DNase showed 53.13% sensitivity, 41.84% specificity, 22.97% PPV, and 73.21% NPV. DNase test showed higher specificity value than MSA but the test presented 26.79% false negative results whereas no false-negative result from MSA when comparing to TCT. Conclusion: MSA had a tendency to be a good preference for screening S. aureus because of its high sensitivity and

  1. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  2. Gravimetric screening method for fungal decay of paper: inoculation with Trametes versicolor.

    Science.gov (United States)

    Råberg, Ulrika; Hafrén, Jonas

    2009-10-01

    The European standard test EN 113 for fungal degradation of solid wood has been adapted for degradation of paper by white rot fungus (Trametes versicolor). Fungal degradation of paper sheets may potentially be used for screening different wood preservatives on paper instead of solid wood. The paper samples showed higher relative mass losses compared to wood, and samples pretreated with boric acid, copper sulfate and polymerized linseed oil were successfully tested for biodegradation using the paper sheet method. The results on paper degradation were compared with wood, both as wood blocks (according to standard test) and wood cut in sections forming layered structures mimicking paper layers.

  3. The validity of ultrasonographic scanning as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Lindholt, Jes Sanddal; Vammen, Sten; Juul, Søren

    1999-01-01

    the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs.......the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs....

  4. Review of Dosimetric Methods for Mammography in the UK Breast Screening Programme

    International Nuclear Information System (INIS)

    Young, K.C.; Ramsdale, M.L.; Bignell, F.

    1998-01-01

    The two methods used to monitor dose in mammography in the UK Breast Screening Programme are reviewed. The first is the measurement of mean glandular dose to a standard breast. The second is the estimation of mean glandular dose for individual women using the X ray exposure factors. Neither method takes account of variations in breast composition and the effect of this on estimates of glandular dose are reported. Applying the standard breast model using PMMA resulted in substantial overestimates of breast doses for women with large compressed breast thicknesses because they tend to have low glandular content. Conversely the use of post-exposure data to estimate the MGDs in women attending screening with large breasts resulted in underestimates of their doses unless the relatively low levels of glandularity were taken into account. When estimating the MGDs for breasts of different sizes, it is important that the models and methods used take account of the strong variation in breast composition with compressed thickness. (author)

  5. Materials and methods for higher performance screen-printed flexible MRI receive coils.

    Science.gov (United States)

    Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C

    2017-08-01

    To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  6. The novel measuring method for screening and assessing chromium content in clothes and shoes materials

    Science.gov (United States)

    Salerno-Kochan, R.

    2017-10-01

    The aim of this paper is to propose the bioindicative measuring method for screening and assessing the safety of textile and leather materials in relation to chemical threats. This method is based on toxicological assay in which Tetrahymena pyriformis, unicellular organism belonging to protozoans, is used as a test organism. For the realization of the research goal the sensitivity threshold of test organisms to chromium(VI) solutions was identified. The changes in cell development of test organisms in chromium solutions were registered by colorimetric measurements in the presence of alamarBlue® cell viability reagent. Empirical data enabled to fit logistic curves on the base of which the level of chromium toxicity was estimated. In the second step, harmfulness of aqueous extracts obtained from textile and leather samples containing chromium in relation to test organisms was evaluated. The performed research confirmed the high efficiency of the proposed method in screening and assessing chromium content in clothes and shoes materials and showed possibilities of using it in safety assessment of products with regard to chemical risks.

  7. Intelligent screening of electrofusion-polyethylene joints based on a thermal NDT method

    Science.gov (United States)

    Doaei, Marjan; Tavallali, M. Sadegh

    2018-05-01

    The combinations of infrared thermal images and artificial intelligence methods have opened new avenues for pushing the boundaries of available testing methods. Hence, in the current study, a novel thermal non-destructive testing method for polyethylene electrofusion joints was combined with k-means clustering algorithms as an intelligent screening tool. The experiments focused on ovality of pipes in the coupler, as well as misalignment of pipes-couplers in 25 mm diameter joints. The temperature responses of each joint to an internal heat pulse were recorded by an IR thermal camera, and further processed to identify the faulty joints. The results represented clustering accuracy of 92%, as well as more than 90% abnormality detection capabilities.

  8. Validity of a method for the self-screening of cardiovascular risk

    Directory of Open Access Journals (Sweden)

    Barroso M

    2018-05-01

    Full Text Available María Barroso,1–3 Silvia Pérez-Fernández,1,4 M Mar Vila,1,4,5 M Dolors Zomeño,6,7 Ruth Martí-Lluch,8 Ferran Cordon,9 Rafel Ramos,8,10,11 Roberto Elosua,1,4 Irene R Degano,1,4 Montse Fitó,5,12 Carmen Cabezas,13 Gemma Salvador,13 Conxa Castell,13 María Grau1,4,14 1Cardiovascular Epidemiology and Genetics Research Group, IMIM-Hospital del Mar Research Institute, 2Centre d’Atenció Primària La Marina, Direcció d’Atenció Primària Barcelona, Institut Català de la Salut, 3Department of Pediatrics, Obstetrics, Gynecology and Preventive Medicine, School of Medicine, Autonomous University of Barcelona, 4Consortium for Biomedical Research in Cardiovascular Disease (CIBERCV, 5Department of Mathematics and Computer Science, University of Barcelona, 6Cardiovascular Risk and Nutrition, IMIM-Hospital del Mar Research Institute, 7School of Health Sciences, Blanquerna-Ramon Llull University, Barcelona, Spain; 8Unitat de Suport a la Recerca de Girona, Institut Universitari d’Investigació en Atenció Primària Jordi Gol, 9Centre d’Atenció Primària Montilivi, Direcció d’Atenció Primària Girona, Institut Català de la Salut, 10Department of Medical Sciences, School of Medicine, University of Girona, 11Girona Biomedical Research Institute, Girona, Spain; 12Consortium for Biomedical Research in Obesity and Nutrition (CIBEROBN, 13Catalan Agency of Public Health, 14Department of Medicine, University of Barcelona, Barcelona, Spain Background: The validity of a cardiovascular risk self-screening method was assessed. The results obtained for self-measurement of blood pressure, a point-of-care system’s assessment of lipid profile and glycated hemoglobin, and a self-administered questionnaire (sex, age, diabetes, tobacco consumption were compared with the standard screening (gold standard conducted by a health professional. Methods: Crossover clinical trial on a population-based sample from Girona (north-eastern Spain, aged 35–74, with no

  9. Chronic kidney disease screening methods and its implication for Malaysia: an in depth review.

    Science.gov (United States)

    Almualm, Yasmin; Zaman Huri, Hasniza

    2015-01-01

    Chronic Kidney Disease has become a public health problem, imposing heath, social and human cost on societies worldwide. Chronic Kidney Disease remains asymptomatic till late stage when intervention cannot stop the progression of the disease. Therefore, there is an urgent need to detect the disease early. Despite the high prevalence of Chronic Kidney Disease in Malaysia, screening is still lacking behind. This review discusses the strengths and limitations of current screening methods for Chronic Kidney Disease from a Malaysian point of view. Diabetic Kidney Disease was chosen as focal point as Diabetes is the leading cause of Chronic Kidney Disease in Malaysia. Screening for Chronic Kidney Disease in Malaysia includes a urine test for albuminuria and a blood test for serum creatinine. Recent literature indicates that albuminuria is not always present in Diabetic Kidney Disease patients and serum creatinine is only raised after substantial kidney damage has occurred.  Recently, cystatin C was proposed as a potential marker for kidney disease but this has not been studied thoroughly in Malaysia.  Glomerular Filtration Rate is the best method for measuring kidney function and is widely estimated using the Modification of Diet for Renal Disease equation. Another equation, the Chronic Kidney Disease Epidemiology Collaboration Creatinine equation was introduced in 2009. The new equation retained the precision and accuracy of the Modification of Diet for Renal Disease equation at GFR 60ml/min/1.73m2. In Asian countries, adding an ethnic coefficient to the equation enhanced its performance. In Malaysia, a multi-ethnic Asian population, the Chronic Kidney Disease Epidemiology Collaboration equation should be validated and the Glomerular Filtration Rate should be reported whenever serum creatinine is ordered. Reporting estimated Glomerular Filtration Rate will help diagnose patients who would have been otherwise missed if only albuminuria and serum creatinine are measured.

  10. A Study of Applications of Machine Learning Based Classification Methods for Virtual Screening of Lead Molecules.

    Science.gov (United States)

    Vyas, Renu; Bapat, Sanket; Jain, Esha; Tambe, Sanjeev S; Karthikeyan, Muthukumarasamy; Kulkarni, Bhaskar D

    2015-01-01

    The ligand-based virtual screening of combinatorial libraries employs a number of statistical modeling and machine learning methods. A comprehensive analysis of the application of these methods for the diversity oriented virtual screening of biological targets/drug classes is presented here. A number of classification models have been built using three types of inputs namely structure based descriptors, molecular fingerprints and therapeutic category for performing virtual screening. The activity and affinity descriptors of a set of inhibitors of four target classes DHFR, COX, LOX and NMDA have been utilized to train a total of six classifiers viz. Artificial Neural Network (ANN), k nearest neighbor (k-NN), Support Vector Machine (SVM), Naïve Bayes (NB), Decision Tree--(DT) and Random Forest--(RF). Among these classifiers, the ANN was found as the best classifier with an AUC of 0.9 irrespective of the target. New molecular fingerprints based on pharmacophore, toxicophore and chemophore (PTC), were used to build the ANN models for each dataset. A good accuracy of 87.27% was obtained using 296 chemophoric binary fingerprints for the COX-LOX inhibitors compared to pharmacophoric (67.82%) and toxicophoric (70.64%). The methodology was validated on the classical Ames mutagenecity dataset of 4337 molecules. To evaluate it further, selectivity and promiscuity of molecules from five drug classes viz. anti-anginal, anti-convulsant, anti-depressant, anti-arrhythmic and anti-diabetic were studied. The TPC fingerprints computed for each category were able to capture the drug-class specific features using the k-NN classifier. These models can be useful for selecting optimal molecules for drug design.

  11. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  12. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Gourgari E

    2016-08-01

    Full Text Available Evgenia Gourgari,1 Elias Spanakis,2 Adrian Sandra Dobs3 1Division of Pediatric Endocrinology, Georgetown University School of Medicine, Washington, DC, 2Division of Endocrinology, University of Maryland School of Medicine, 3Department of Endocrinology, Johns Hopkins University School of Medicine, Baltimore, MD, USA Abstract: Polycystic ovary syndrome (PCOS is a syndrome associated with insulin resistance (IR, obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have. Keywords: IR, OGTT, obesity, hyperandrogenism, anovulation, BMI, insulin resistance, PCOS

  13. Development of Efficient Screening Methods for Resistant Cucumber Plants to Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Sung Min Hwang

    2014-06-01

    Full Text Available Root-knot nematodes represent a significant problem in cucumber, causing reduction in yield and quality. To develop screening methods for resistance of cucumber to root-knot nematode Meloidogyne incognita, development of root-knot nematode of four cucumber cultivars (‘Dragonsamchuk’, ‘Asiastrike’, ‘Nebakja’ and ‘Hanelbakdadaki’ according to several conditions such as inoculum concentration, plant growth stage and transplanting period was investigated by the number of galls and egg masses produced in each seedling 45 days after inoculation. There was no difference in galls and egg masses according to the tested condition except for inoculum concentration. Reproduction of the nematode on all the tested cultivars according to inoculum concentration increased in a dose-dependent manner. On the basis of the result, the optimum conditions for root-knot development on the cultivars is to transplant period of 1 week, inoculum concentration of 5,000 eggs/plant and plant growth stage of 3-week-old in a greenhouse (25 ± 5°C. In addition, under optimum conditions, resistance of 45 commercial cucumber cultivars was evaluated. One rootstock cultivar, Union was moderately resistant to the root-knot nematode. However, no significant difference was in the resistance of the others cultivar. According to the result, we suggest an efficient screening method for new resistant cucumber to the root-knot nematode, M. incognita.

  14. Prospective memory tasks: a more sensitive method for screening cognitive impairment in ALS?

    Directory of Open Access Journals (Sweden)

    Ji Ying

    2012-11-01

    Full Text Available Abstract Background Cognitive change is prevalent in patients with amyotrophic lateral sclerosis (ALS, but still lack a widely accepted and sensitive screening method. In this study, we try to find a sensitive screening battery for detecting subtle cognitive deficits in patients with ALS. Methods Eighty consecutive ALS patients and 57 matched normal controls underwent the Mini-Mental Status Examination (MMSE, the verbal fluency test (VFT, the Stroop Color Word Interference Test (CWT, and the prospective memory (PM tests, including event-based (EBPM and time-based (TBPM. Results The patients did not differ from the controls in the MMSE, the VFT and the CWT. By contrast, statistically significant differences were found in the PM tests (EBPM: P=0.043; TBPM: P Conclusions Prefrontal lobar dysfunction does exist among ALS patients and may spread from the medial to the lateral region. The PM tests seem more sensitive in ALS patients with frontotemporal dysfunction than are the classical cognitive measures.

  15. Agreement Between Visual Inspection with Acetic Acid and Papanicolaous Smear as Screening Methods for Cervical Cancer

    International Nuclear Information System (INIS)

    Naz, U.; Hanif, S.

    2014-01-01

    Objective: To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaous (Pap) smear as screening methods for cervical cancer. Study Design: A cross-sectional study. Place and Duration of Study: Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Methodology: Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaous smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Results: Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. Conclusion: There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings. (author)

  16. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  17. Robust Microplate-Based Methods for Culturing and in Vivo Phenotypic Screening of Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Timothy C. Haire

    2018-03-01

    Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.

  18. Pharmacy diabetes care program: analysis of two screening methods for undiagnosed type 2 diabetes in Australian community pharmacy.

    Science.gov (United States)

    Krass, I; Mitchell, B; Clarke, P; Brillant, M; Dienaar, R; Hughes, J; Lau, P; Peterson, G; Stewart, K; Taylor, S; Wilkinson, J; Armour, C

    2007-03-01

    To compare the efficacy and cost-effectiveness of two methods of screening for undiagnosed type 2 diabetes in Australian community pharmacy. A random sample of 30 pharmacies were allocated into two groups: (i) tick test only (TTO); or (ii) sequential screening (SS) method. Both methods used the same initial risk assessment for type 2 diabetes. Subjects with one or more risk factors in the TTO group were offered a referral to their general practitioner (GP). Under the SS method, patients with risk factors were offered a capillary blood glucose test and those identified as being at risk referred to a GP. The effectiveness and cost-effectiveness of these approaches was assessed. A total of 1286 people were screened over a period of 3 months. The rate of diagnosis of diabetes was significantly higher for SS compared with the TTO method (1.7% versus 0.2%; p=0.008). The SS method resulted in fewer referrals to the GP and a higher uptake of referrals than the TTO method and so was the more cost-effective screening method. SS is the superior method from a cost and efficacy perspective. It should be considered as the preferred option for screening by community based pharmacists in Australia.

  19. A rapid screening method for heavy metals in biological materials by emission spectroscopy.

    Science.gov (United States)

    Blacklock, E C; Sadler, P A

    1981-06-02

    A semi-quantitative screening method for heavy metals in biological material is described. The metals are complexed with ammonium pyrrolidine dithiocarbamate, sodium diethyl dithiocarbamate and potassium sodium tartrate. The solutions are adjusted to pH 4 and then extracted into chloroform. The chloroform phase is evaporated onto a matrix mixture of lithium fluoride and graphite. The sample is analysed by direct current arc emission spectroscopy using a 3 metre grating spectrograph. The spectra are recorded on a photographic plate. The method is developed on aqueous and spiked samples and then applied to in vivo samples containing toxic levels of heavy metals. Atomic absorption spectroscopy is used to check standard concentrations and to monitor the efficiency of the extraction procedure.

  20. Research on atmospheric transmission distortion of Gauss laser using multiple phase screen method

    Science.gov (United States)

    Zhang, Yizhuo; Wang, Qiushi; Gu, Haidong

    2018-02-01

    The laser beam is attenuated, broadened, defocused and may even be deflected from its initial propagation direction as it propagates through the atmosphere. It leads to the decrease of the laser intensity of the receiving surface. Gauss beam is the fundamental components of all possible laser waveforms. Therefore, research on the transmission of the Gauss laser has far-reaching consequences in optical communication, weaponry, target designation, ranging, remote sensing and other applications that require transmission of laser beams through the atmosphere. In this paper, we propose a laboratory simulation method using multi-phase screen to calculate the effects of atmospheric turbulence. Theoretical analysis of Gauss laser transmission in the atmosphere is given. By calculating the propagation of the Gauss beam TEM00, the far field intensity and phase distribution is shown. By the given method, the optical setup is presented and used for optimizing the adaptive optics algorithm.

  1. Qualitative screening method for pesticide residues detection in fruits and vegetables

    Directory of Open Access Journals (Sweden)

    Iván Mauricio Huérfano Barco

    2018-01-01

    Full Text Available Because of the importance of developing methodologies that allow agricultural residues analysis, a rapid screening qualitative method for the determination of pesticides residues in fruits and vegetables was validated. The methodology was based on the European QuEChERS extraction method with an additional cleaning step by gel permeation chromatography (GPC, which helped to reduce the number of matrix components in the final extract. The analysis was carried out by gas chromatography coupled to mass spectrometry with a single quadrupole analyzer. The methodology was appropriate for the qualitative analysis of 31 pesticides at their respective maximum residue limits. Consistent results were obtained with respect to a quantitative routine methodology in the analysis of real samples, hence the methodology was proven to be a good alternative for the fast analysis of these contaminants in fruits and vegetables.

  2. Evaluation of Dried Urine Spot Method to Screen Cotinine among Tobacco Dependents: An Exploratory Study.

    Science.gov (United States)

    Jain, Raka; Quraishi, Rizwana; Verma, Arpita

    2017-01-01

    Assessment of cotinine, a metabolite of nicotine in body fluids, is an important approach for validating the self-report among tobacco users. Adaptation of assays on dried urine spots (DUSs) has advantages of ease of collection, transportation, minimal invasiveness, and requirement of small volume. The aim of the present study was to develop an efficient method for testing cotinine in DUSs and evaluating its clinical applicability. This involved optimization of conditions for detection, recovery, and stability of cotinine from dried urine, spotted on filter paper. Enzyme-linked immunosorbent assay was used for screening, whereas confirmation was done by gas chromatography. For clinical applicability, urine samples of tobacco users were tested. Water was found to be a suitable extracting solvent as compared to carbonate-bicarbonate buffer (pH 9.2) and saline. Screening was achieved by two punches taken from a 20 μl (diameter 1.3 cm) spotted urine samples, and confirmation was achieved by five complete circles each of 20 μl sample volume. The recovery was found to be 97% in water. Limit of detection for the method was found to be 100 ng/ml. No signs of significant degradation were found under all storage conditions. All the urine samples of tobacco users were found to be positive by a conventional method as well as DUSs, and the method proved to be efficient. DUS samples are a useful alternative for biological monitoring of recent nicotine use, especially in developing countries where sample logistics could be an important concern.

  3. Ultrasound surface probe as a screening method for evaluating the patients with blunt abdominal trauma

    Directory of Open Access Journals (Sweden)

    Mohammad Nasr-Esfahani

    2014-01-01

    Full Text Available Background: Blunt abdominal trauma is one of the causes of mortality in emergency department. Free fluid in the abdomen due to intra-abdominal blunt trauma can be determined by the surface probe of ultrasound. Since the importance of this free fluid in hemodynamic stable patients with blunt trauma is associated with the unknown outcome for surgeons, this study was performed to evaluate the role of ultrasound surface probe as a screening method in evaluating the patients with blunt abdominal trauma. Materials and Methods: A descriptive-analytical study was done on 45 patients with blunt abdominal trauma and hemodynamic stability. The patients were evaluated twice during the three-hours, including repeated ultrasound surface probe and clinical examinations. Computerized tomography was also performed. The patients were divided based on the amount of the free fluid in the abdomen during the evaluations into two groups: Fixed or increased, and decreased free fluid. The results of the different evaluated methods were compared using the sensitivity and specificity. Results: From 17 patients with CT abnormalities, free fluid increased in 14 patients (82.4%. Free fluid was decreased in three patients who were discharged well from the surgery service without any complication. Surface probe in prognosis detection had a sensitivity of 82.4% and specificity of 92.9%. The percentage of false positive and negative ultrasound compared with CT scan was 7.1% and 17.6%. Also, positive and negative predictive value of the ultrasound with surface probe was 87.5% and 89.7% respectively. Conclusion: The use of the ultrasound with surface probe in the diagnosis of free fluid in blunt abdominal trauma in hemodynamic stable patients can be considered as a useful screening method.

  4. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-11-10

    Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemann–Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between existing

  5. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D.; Smirnakis, Stelios; Aslanides, Ioannis M.

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  6. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D; Smirnakis, Stelios; Aslanides, Ioannis M

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  7. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Directory of Open Access Journals (Sweden)

    Ioannis Smyrnakis

    Full Text Available Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6% and 30 out of 32 readers with dyslexia (sensitivity 93.8% were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a

  8. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  9. An effective method to screen sodium-based layered materials for sodium ion batteries

    Science.gov (United States)

    Zhang, Xu; Zhang, Zihe; Yao, Sai; Chen, An; Zhao, Xudong; Zhou, Zhen

    2018-03-01

    Due to the high cost and insufficient resource of lithium, sodium-ion batteries are widely investigated for large-scale applications. Typically, insertion-type materials possess better cyclic stability than alloy-type and conversion-type ones. Therefore, in this work, we proposed a facile and effective method to screen sodium-based layered materials based on Materials Project database as potential candidate insertion-type materials for sodium ion batteries. The obtained Na-based layered materials contains 38 kinds of space group, which reveals that the credibility of our screening approach would not be affected by the space group. Then, some important indexes of the representative materials, including the average voltage, volume change and sodium ion mobility, were further studied by means of density functional theory computations. Some materials with extremely low volume changes and Na diffusion barriers are promising candidates for sodium ion batteries. We believe that our classification algorithm could also be used to search for other alkali and multivalent ion-based layered materials, to accelerate the development of battery materials.

  10. Benchmarking Methods and Data Sets for Ligand Enrichment Assessment in Virtual Screening

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2014-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. “analogue bias”, “artificial enrichment” and “false negative”. In addition, we introduced our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylase (HDAC) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The Leave-One-Out Cross-Validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased in terms of property matching, ROC curves and AUCs. PMID:25481478

  11. Benchmarking methods and data sets for ligand enrichment assessment in virtual screening.

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. "analogue bias", "artificial enrichment" and "false negative". In addition, we introduce our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylases (HDACs) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The leave-one-out cross-validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased as measured by property matching, ROC curves and AUCs. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Statistical methods for the analysis of a screening test for chronic beryllium disease

    Energy Technology Data Exchange (ETDEWEB)

    Frome, E.L.; Neubert, R.L. [Oak Ridge National Lab., TN (United States). Mathematical Sciences Section; Smith, M.H.; Littlefield, L.G.; Colyer, S.P. [Oak Ridge Inst. for Science and Education, TN (United States). Medical Sciences Div.

    1994-10-01

    The lymphocyte proliferation test (LPT) is a noninvasive screening procedure used to identify persons who may have chronic beryllium disease. A practical problem in the analysis of LPT well counts is the occurrence of outlying data values (approximately 7% of the time). A log-linear regression model is used to describe the expected well counts for each set of test conditions. The variance of the well counts is proportional to the square of the expected counts, and two resistant regression methods are used to estimate the parameters of interest. The first approach uses least absolute values (LAV) on the log of the well counts to estimate beryllium stimulation indices (SIs) and the coefficient of variation. The second approach uses a resistant regression version of maximum quasi-likelihood estimation. A major advantage of the resistant regression methods is that it is not necessary to identify and delete outliers. These two new methods for the statistical analysis of the LPT data and the outlier rejection method that is currently being used are applied to 173 LPT assays. The authors strongly recommend the LAV method for routine analysis of the LPT.

  13. A cost-effective screening method for pesticide residue analysis in fruits, vegetables, and cereal grains.

    Science.gov (United States)

    Ambrus, A; Füzesi, I; Susán, M; Dobi, D; Lantos, J; Zakar, F; Korsós, I; Oláh, J; Beke, B B; Katavics, L

    2005-01-01

    This paper reports the results of studies performed to investigate the potential of applying thin layer chromatography (TLC) detection in combination with selected extraction and cleanup methods, for providing an alternative cost-effective analytical procedure for screening and confirmation of pesticide residues in plant commodities. The extraction was carried out with ethyl acetate and an on-line extraction method applying an acetone-dichloromethane mixture. The extracts were cleaned up with SX-3 gel, an adsorbent mixture of active carbon, magnesia, and diatomaceous earth, and on silica micro cartridges. The Rf values of 118 pesticides were tested in eleven elution systems with UV, and eight biotest methods and chemical detection reagents. Cabbage, green peas, orange, and tomatoes were selected as representative sample matrices for fruits and vegetables, while maize, rice, and wheat represented cereal grains. As an internal quality control measure, marker compounds were applied on each plate to verify the proper elution and detection conditions. The Rf values varied in the different elution systems. The best separation (widest Rf range) was achieved with silica gel (SG)--ethyl acetate (0.05-0.7), SG--benzene, (0.02-0.7) and reverse phase RP-18 F-254S layer with acetone: methanol: water/30:30:30 (v/v) (0.1-0.8). The relative standard deviation of Rf values (CV(Rf)) within laboratory reproducibility was generally less than 20%, except below 0.2 Rf, where the CVRf rapidly increased with decreasing Rf values. The fungi spore inhibition, chloroplast inhibition, and enzyme inhibition were found most suitable for detection of pesticides primarily for confirming their identity or screening for known substances. Their use for determination of pesticide residues in samples of unknown origin is not recommended.

  14. An Improved Method for P2X7R Antagonist Screening.

    Directory of Open Access Journals (Sweden)

    Rômulo José Soares-Bezerra

    Full Text Available ATP physiologically activates the P2X7 receptor (P2X7R, a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites, this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG and oxidized ATP (OATP. The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  15. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  16. The use of graph theory in the sensitivity analysis of the model output: a second order screening method

    International Nuclear Information System (INIS)

    Campolongo, Francesca; Braddock, Roger

    1999-01-01

    Sensitivity analysis screening methods aim to isolate the most important factors in experiments involving a large number of significant factors and interactions. This paper extends the one-factor-at-a-time screening method proposed by Morris. The new method, in addition to the 'overall' sensitivity measures already provided by the traditional Morris method, offers estimates of the two-factor interaction effects. The number of model evaluations required is O(k 2 ), where k is the number of model input factors. The efficient sampling strategy in the parameter space is based on concepts of graph theory and on the solution of the 'handcuffed prisoner problem'

  17. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Avonto, Cristina; Chittiboyina, Amar G. [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Rua, Diego [The Center for Food Safety and Applied Nutrition, US Food and Drug Administration, College Park, MD 20740 (United States); Khan, Ikhlas A., E-mail: ikhan@olemiss.edu [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Division of Pharmacognosy, Department of BioMolecular Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States)

    2015-12-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  18. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    International Nuclear Information System (INIS)

    Avonto, Cristina; Chittiboyina, Amar G.; Rua, Diego; Khan, Ikhlas A.

    2015-01-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  19. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A.

    Science.gov (United States)

    Wu, Lin; Li, Huijun; Tang, Tianle

    2017-01-24

    Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence) protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21) and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris . Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C), induction time (4 h, 5 h, 6 h and 7 h) and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L). The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very suitable for

  20. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A

    Directory of Open Access Journals (Sweden)

    Lin Wu

    2017-01-01

    Full Text Available Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21 and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris. Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C, induction time (4 h, 5 h, 6 h and 7 h and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L. The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very

  1. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust

    International Nuclear Information System (INIS)

    Rosati, Jacky A.; Bern, Amy M.; Willis, Robert D.; Blanchard, Fredrick T.; Conner, Teri L.; Kahn, Henry D.; Friedman, David

    2008-01-01

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation

  2. Reconstruction of on-axis lensless Fourier transform digital hologram with the screen division method

    Science.gov (United States)

    Jiang, Hongzhen; Liu, Xu; Liu, Yong; Li, Dong; Chen, Zhu; Zheng, Fanglan; Yu, Deqiang

    2017-10-01

    An effective approach for reconstructing on-axis lensless Fourier Transform digital hologram by using the screen division method is proposed. Firstly, the on-axis Fourier Transform digital hologram is divided into sub-holograms. Then the reconstruction result of every sub-hologram is obtained according to the position of corresponding sub-hologram in the hologram reconstruction plane with Fourier transform operation. Finally, the reconstruction image of on-axis Fourier Transform digital hologram can be acquired by the superposition of the reconstruction result of sub-holograms. Compared with the traditional reconstruction method with the phase shifting technology, in which multiple digital holograms are required to record for obtaining the reconstruction image, this method can obtain the reconstruction image with only one digital hologram and therefore greatly simplify the recording and reconstruction process of on-axis lensless Fourier Transform digital holography. The effectiveness of the proposed method is well proved with the experimental results and it will have potential application foreground in the holographic measurement and display field.

  3. Establishment of cocrystal cocktail grinding method for rational screening of pharmaceutical cocrystals.

    Science.gov (United States)

    Yamamoto, Katsuhiko; Tsutsumi, Shunichirou; Ikeda, Yukihiro

    2012-11-01

    Cocrystals (CCs) used in the pharmaceutical industry are defined as complex crystals formed by reaction between an API and a cocrystal former (CCF); unlike salts, CCs do not show proton transfer. Recently, pharmaceutical CCs have been used to improve the drug-likeness of APIs, such as solubility and stability. Grinding is more effective for CC synthesis than crystallization from solution because in the former case, the API can predominantly interact with the CCF without being affected by solvents. However, this method is tedious because the API is ground with only one CCF at a time. We developed a cocktail cocrystal grinding (CCG) method, in which a mixture of CCFs having the same functional group was used. No false negatives/positives were observed in CCG when carbamazepine was used as the model compound. This method could be used to obtain CCs of piroxicam and spironolactone. False negatives were observed for only one compound from among three model compounds, indicating that CCG facilitates efficient CC detection and that it has higher throughput than does the conventional method. Further, CCG is fast and suitable for rational CC screening, and it helps identify the partial structure of CCFs that forms synthons with an API. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Gas evolution as a rapid screening method for detection of irradiated foods

    International Nuclear Information System (INIS)

    Roberts, P.B.; Chambers, D.M.; Brailsford, G.W.

    1996-01-01

    A number of detection methods for irradiated foods are in advanced state of development. No single method is likely to be universally applicable but a battery of tests such as thermoluminescence, electron spin resonance and analysis of lipid radiolytic products may soon be available for most foods and technical uses of irradiation. Most of these proposed tests require relatively sophisticated equipment or technical skills and are often time consuming and costly. There would be value in relatively simple tests which could be used as a rapid screening system or confirmatory method. The literature on the use of radiolytic gases as a detection method is limited and this paper extends the above studies. In particular, it extends the work to frozen shellfish, for which irradiation has been used as a commercial decontaminant technique for many years, and considers the effect of storage temperature. Work on poultry is also reported as a cross-reference to earlier work and because irradiated poultry has recently been released into the US retail trade. (author)

  5. A method for screening for the risk of chronic effects of surface water pollution.

    Science.gov (United States)

    Soldán, Přemysl; Badurová, Jana

    2013-01-01

    The article describes a method for screening for the risk of chronic surface water pollution which was developed at the T. G. Masaryk Water Research Institute. The approach, which is based on exotoxicological analyses, can be classed as a rapid method of assessment. The degree of risk of chronic effects surface water pollution is determined from an evaluation of two major parameters-toxicity and genotoxicity. As the method utilizes relative simple procedures for sample collection, pretreatment of the sample, chemical analyses, bioassays and results assessment, this approach is suitable for widespread practical use. Extensive utilization of this approach for assessing river basins in the Czech Republic has proved its suitability for a more sophisticated detection of the biological impact of surface water pollution. This is documented in the article where the method is used in a study of the Bílina River, and in the overview of the results of the risk assessment of chronic effects of surface water pollution in selected sections of three international river basins in the Czech Republic.

  6. Quick screening for new flux pinning materials in YBCO films with the combinatorial-PLD method

    International Nuclear Information System (INIS)

    Yoshimura, T.; Ichino, Y.; Yoshida, Y.; Takai, Y.; Kita, R.; Suzuki, K.; Takeuchi, T.

    2011-01-01

    An effective way to improve the superconducting properties in REBa 2 Cu 3 O y (REBCO) films under a magnetic field is to dope artificial pinning centers (APC). The pinning performance depends on the content of the APC materials. Usually, the optimal APC content is explored by preparing films one at a time from the REBCO target using different APC material content, which is an extremely time-consuming process. The combinatorial-PLD (C-PLD) method allowed us to prepare films that continuously changed in composition across a single substrate. In this study, we used the C-PLD method to prepare BaSnO 3 (BSO)-doped YBCO films. The films were deposited on SrTiO 3 substrate using a fourth-harmonic Nd:YAG laser. From the results of the J c -B curves at 77 K and B//c, the film that contained 3.2 vol.% of BSO exhibited the best pinning performance in this study. We showed that the C-PLD method was efficient for quick screening of the optimal APC content with only one deposition. We also used the C-PLD method to explore new APC materials, and proved that it can quickly evaluate the new APC materials Ba 3 Cu 3 In 4 O 12 and BaTbO 3 .

  7. Infrared thermography based on artificial intelligence as a screening method for carpal tunnel syndrome diagnosis.

    Science.gov (United States)

    Jesensek Papez, B; Palfy, M; Mertik, M; Turk, Z

    2009-01-01

    This study further evaluated a computer-based infrared thermography (IRT) system, which employs artificial neural networks for the diagnosis of carpal tunnel syndrome (CTS) using a large database of 502 thermal images of the dorsal and palmar side of 132 healthy and 119 pathological hands. It confirmed the hypothesis that the dorsal side of the hand is of greater importance than the palmar side when diagnosing CTS thermographically. Using this method it was possible correctly to classify 72.2% of all hands (healthy and pathological) based on dorsal images and > 80% of hands when only severely affected and healthy hands were considered. Compared with the gold standard electromyographic diagnosis of CTS, IRT cannot be recommended as an adequate diagnostic tool when exact severity level diagnosis is required, however we conclude that IRT could be used as a screening tool for severe cases in populations with high ergonomic risk factors of CTS.

  8. Fast method and ultra fast screening for determination of 90Sr in milk and dairy products

    International Nuclear Information System (INIS)

    Kabai, E.; Hornung, L.; Savkin, B.T.; Poppitz-Spuhler, A.; Hiersche, L.

    2011-01-01

    In emergency situation or in case of defence against nuclear hazards, the rapid analysis of radioisotopes in food products is essential. Radiostrontium is one of the most interesting isotopes in case of emergency. The determination of radiostrontium in milk and dairy products plays an important role especially for infants. The procedures described here were tested for fast determination of 90 Sr. The typical chemical recovery of the proposed fast procedure for determination of strontium from milk and dairy products was 90% and the time needed for analysis was one working day. The achieved detection limit for milk is 0.8 Bq/l. An ultra fast screening method allows the determination of radiostrontium with quantitative recovery within 1 hour. The minimum detectable activity in this case is 230 Bq/l.

  9. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  10. Noninvasive Assessment of Excessive Erythrocytosis as a Screening Method for Chronic Mountain Sickness at High Altitude.

    Science.gov (United States)

    Vyas, Kaetan J; Danz, David; Gilman, Robert H; Wise, Robert A; León-Velarde, Fabiola; Miranda, J Jaime; Checkley, William

    2015-06-01

    Vyas, Kaetan J., David Danz, Robert H. Gilman, Robert A. Wise, Fabiola León-Velarde, J. Jaime Miranda, and William Checkley. Noninvasive assessment of excessive erythrocytosis as a screening method for chronic mountain sickness at high altitude. High Alt Med Biol 16:162-168, 2015.--Globally, over 140 million people are at risk of developing chronic mountain sickness, a common maladaptation to life at high altitude (>2500 meters above sea level). The diagnosis is contingent upon the identification of excessive erythrocytosis (EE). Current best practices to identify EE require a venous blood draw, which is cumbersome for large-scale surveillance. We evaluated two point-of-care biomarkers to screen for EE: noninvasive spot-check tests of total hemoglobin and oxyhemoglobin saturation (Pronto-7, Masimo Corporation). We conducted paired evaluations of total serum hemoglobin from a venous blood draw and noninvasive, spot-check testing of total hemoglobin and oxyhemoglobin saturation with the Pronto-7 in 382 adults aged ≥35 years living in Puno, Peru (3825 meters above sea level). We used the Bland-Altman method to measure agreement between the noninvasive hemoglobin assessment and the gold standard lab hemoglobin analyzer. Mean age was 58.8 years and 47% were male. The Pronto-7 test was unsuccessful in 21 (5%) participants. Limits of agreement between total hemoglobin measured via venous blood draw and the noninvasive, spot-check test ranged from -2.8 g/dL (95% CI -3.0 to -2.5) to 2.5 g/dL (95% CI 2.2 to 2.7), with a bias of -0.2 g/dL (95% CI -0.3 to -0.02) for the difference between total hemoglobin and noninvasive hemoglobin concentrations. Overall, the noninvasive spot-check test of total hemoglobin had a better area under the receiver operating characteristic curve compared to oxyhemoglobin saturation for the identification of EE as measured by a gold standard laboratory hemoglobin analyzer (0.96 vs. 0.82; p<0.001). Best cut-off values to screen for EE with

  11. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    Science.gov (United States)

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

  12. Rapid, convenient method for screening imidazole-containing compounds for heme oxygenase inhibition.

    Science.gov (United States)

    Vlahakis, Jason Z; Rahman, Mona N; Roman, Gheorghe; Jia, Zongchao; Nakatsu, Kanji; Szarek, Walter A

    2011-01-01

    Sensitive assays for measuring heme oxygenase activity have been based on the gas-chromatographic detection of carbon monoxide using elaborate, expensive equipment. The present study describes a rapid and convenient method for screening imidazole-containing candidates for inhibitory activity against heme oxygenase using a plate reader, based on the spectroscopic evaluation of heme degradation. A PowerWave XS plate reader was used to monitor the absorbance (as a function of time) of heme bound to purified truncated human heme oxygenase-1 (hHO-1) in the individual wells of a standard 96-well plate (with or without the addition of a test compound). The degradation of heme by heme oxygenase-1 was initiated using l-ascorbic acid, and the collected relevant absorbance data were analyzed by three different methods to calculate the percent control activity occurring in wells containing test compounds relative to that occurring in control wells with no test compound present. In the cases of wells containing inhibitory compounds, significant shifts in λ(max) from 404 to near 412 nm were observed as well as a decrease in the rate of heme degradation relative to that of the control. Each of the three methods of data processing (overall percent drop in absorbance over 1.5h, initial rate of reaction determined over the first 5 min, and estimated pseudo first-order reaction rate constant determined over 1.5h) gave similar and reproducible results for percent control activity. The fastest and easiest method of data analysis was determined to be that using initial rates, involving data acquisition for only 5 min once reactions have been initiated using l-ascorbic acid. The results of the study demonstrate that this simple assay based on the spectroscopic detection of heme represents a rapid, convenient method to determine the relative inhibitory activity of candidate compounds, and is useful in quickly screening a series or library of compounds for heme oxygenase inhibition

  13. Development and exploitation of the slit method for the characterization of x-ray screen-film combinations

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    For the determination of the modulation transfer function (MTF) of screen-film combinations which are used in medical x-ray diagnostics a measuring method has been developed: the screen-film combination is exposed to x-rays behind a thin slit and the modulation transfer function is calculated from the resulting rather broad slit images on the film. After solving many technical and photographic problems, the slit method provides high precision in the MTF determination. The only objection against this method is the necessary high dose variation which has to be provided by the x-ray machine

  14. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  15. Screening possible solid electrolytes by calculating the conduction pathways using Bond Valence method

    Science.gov (United States)

    Gao, Jian; Chu, Geng; He, Meng; Zhang, Shu; Xiao, RuiJuan; Li, Hong; Chen, LiQuan

    2014-08-01

    Inorganic solid electrolytes have distinguished advantages in terms of safety and stability, and are promising to substitute for conventional organic liquid electrolytes. However, low ionic conductivity of typical candidates is the key problem. As connective diffusion path is the prerequisite for high performance, we screen for possible solid electrolytes from the 2004 International Centre for Diffraction Data (ICDD) database by calculating conduction pathways using Bond Valence (BV) method. There are 109846 inorganic crystals in the 2004 ICDD database, and 5295 of them contain lithium. Except for those with toxic, radioactive, rare, or variable valence elements, 1380 materials are candidates for solid electrolytes. The rationality of the BV method is approved by comparing the existing solid electrolytes' conduction pathways we had calculated with those from experiments or first principle calculations. The implication for doping and substitution, two important ways to improve the conductivity, is also discussed. Among them Li2CO3 is selected for a detailed comparison, and the pathway is reproduced well with that based on the density functional studies. To reveal the correlation between connectivity of pathways and conductivity, α/ γ-LiAlO2 and Li2CO3 are investigated by the impedance spectrum as an example, and many experimental and theoretical studies are in process to indicate the relationship between property and structure. The BV method can calculate one material within a few minutes, providing an efficient way to lock onto targets from abundant data, and to investigate the structure-property relationship systematically.

  16. Screening of alternative methods for the disposal of low-level radioactive wastes

    International Nuclear Information System (INIS)

    Macbeth, P.J.; Thamer, B.J.; Christensen, D.E.; Wehmann, G.

    1978-10-01

    A systematic method for categorizing these disposal alternatives which provides assurance that no viable alternatives are overlooked is reported. Alternatives are categorized by (1) the general media in which disposal occurs, (2) by whether the disposal method can be considered as dispersal, containment or elimination of the wastes, and (3) by the applicability of the disposal method to the possible physical waste forms. A literature survey was performed and pertinent references listed for the various alternatives discussed. A bibliography is given which provides coverage of published information on low-level radioactive waste management options. The extensive list of disposal alternatives identified was screened and the most viable choices were selected for further evaluation. A Technical Advisory Panel met and reviewed the results. Suggestions from that meeting and other comments are discussed. The most viable options selected for further evaluation are: (1) improving present shallow land burial practices; (2) deeper depth burial; (3) disposal in cavities; (4) disposal in exposed or buried structures; and (5) ocean disposal. 42 references

  17. Screening natural antioxidants in peanut shell using DPPH-HPLC-DAD-TOF/MS methods.

    Science.gov (United States)

    Qiu, Jiying; Chen, Leilei; Zhu, Qingjun; Wang, Daijie; Wang, Wenliang; Sun, Xin; Liu, Xiaoyong; Du, Fangling

    2012-12-15

    Peanut shell, a byproduct in oil production, is rich in natural antioxidants. Here, a rapid and efficient method using DPPH-HPLC-DAD-TOF/MS was used for the first time to screen antioxidants in peanut shell. The method is based on the hypothesis that upon reaction with 1, 1-diphenyl-2-picrylhydrazyl (DPPH), the peak areas of compounds with potential antioxidant activities in the HPLC chromatogram will be significantly reduced or disappeared, and the identity confirmation could be achieved by HPLC-DAD-TOF/MS technique. With this method, three compounds possessing potential antioxidant activities were found abundantly in the methanolic extract of peanut shell. They were identified as 5,7-dihydroxychromone, eriodictyol, and luteolin. The contents of these compounds were 0.59, 0.92, and 2.36 mg/g, respectively, and luteolin possessed the strongest radical scavenging capacity. DPPH-HPLC-DAD-TOF/MS assay facilitated rapid identification and determination of natural antioxidants in peanut shell, which may be helpful for value-added utilization of peanut processing byproducts. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. A human reliability assessment screening method for the NRU upgrade project

    International Nuclear Information System (INIS)

    Bremner, F.M.; Alsop, C.J.

    1997-01-01

    The National Research Universal (NRU) reactor is a 130MW, low pressure, heavy water cooled and moderated research reactor. The reactor is used for research, both in support of Canada's CANDU development program, and for a wide variety of other research applications. In addition, NRU plays an important part in the production of medical isotopes, e.g., generating 80% of worldwide supplies of Molybdenum-99. NRU is owned and operated by Atomic Energy of Canada Ltd. (AECL), and is currently undergoing upgrading as part of AECL's continuing commitment to operate their facilities in a safe manner. As part of these upgrades both deterministic and probabilistic safety assessments are being carried out. It was recognized that the assignment of Human Error Probabilities (HEPs) is an important part of the Probabilistic Safety Assessment (PSA) studies, particularly for a facility whose design predates modern ergonomic practices, and which will undergo a series of backfitted modifications whilst continuing to operate. A simple Human Reliability Assessment (HRA) screening method, looking at both pre- and post-accident errors, was used in the initial safety studies. However, following review of this method within AECL and externally by the regulator, it was judged that benefits could be gained for future error reduction by including additional features, as later described in this document. The HRA development project consisted of several stages; needs analysis, literature review, development of method (including testing and evaluation), and implementation. This paper discusses each of these stages in further detail. (author)

  19. Confidence from uncertainty - A multi-target drug screening method from robust control theory

    Directory of Open Access Journals (Sweden)

    Petzold Linda R

    2010-11-01

    Full Text Available Abstract Background Robustness is a recognized feature of biological systems that evolved as a defence to environmental variability. Complex diseases such as diabetes, cancer, bacterial and viral infections, exploit the same mechanisms that allow for robust behaviour in healthy conditions to ensure their own continuance. Single drug therapies, while generally potent regulators of their specific protein/gene targets, often fail to counter the robustness of the disease in question. Multi-drug therapies offer a powerful means to restore disrupted biological networks, by targeting the subsystem of interest while preventing the diseased network from reconciling through available, redundant mechanisms. Modelling techniques are needed to manage the high number of combinatorial possibilities arising in multi-drug therapeutic design, and identify synergistic targets that are robust to system uncertainty. Results We present the application of a method from robust control theory, Structured Singular Value or μ- analysis, to identify highly effective multi-drug therapies by using robustness in the face of uncertainty as a new means of target discrimination. We illustrate the method by means of a case study of a negative feedback network motif subject to parametric uncertainty. Conclusions The paper contributes to the development of effective methods for drug screening in the context of network modelling affected by parametric uncertainty. The results have wide applicability for the analysis of different sources of uncertainty like noise experienced in the data, neglected dynamics, or intrinsic biological variability.

  20. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Science.gov (United States)

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  1. Screening method for the detection of a range of nitrofurans in avian eyes by optical biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Colin S., E-mail: colin.thompson@afbini.gov.uk [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom); Traynor, Imelda M.; Fodey, Terence L.; Crooks, Steven R.H.; Kennedy, D. Glenn [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom)

    2011-08-26

    An immunobiosensor assay was developed for the multi-residue screening of a range of nitrofuran compounds in avian eyes. A polyclonal antibody which binds at least 5 of the major parent nitrofurans was raised in a rabbit after inoculation with a nitrofuran mimic-protein conjugate. Sample homogenates were extracted into 0.1 M hydrochloric acid and subjected to clean-up by solid phase extraction and micro-centrifugation prior to biosensor analysis. Validation data obtained from the analysis of 21 fortified samples has shown that the method has a detection capability (CC{beta}) of less than 1 ng eye{sup -1} for nitrofurazone (NFZ). In addition, cross-reactivity data and the analysis of a smaller number of fortified samples have shown that the method will also detect a range of other major parent nitrofurans including furazolidone (FZD), furaltadone (FTD), nitrofurantoin (NFA) and nifursol (NFS). Intra-assay variation (n = 10) was calculated at 12.9% and 10.1% at concentrations of 1 ng eye{sup -1} and 2 ng eye{sup -1} NFZ respectively. Inter-assay variation (n = 3) was determined to be 10.8% and 4.7% at the same NFZ concentrations respectively. The cross-reactivity profile and validation data for the detection of these nitrofurans are presented together with the results obtained following the analysis of a small number of incurred samples using the developed method.

  2. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM-IV Diagnoses Using CBCL Data

    Science.gov (United States)

    Krol, Nicole P. C. M.; De Bruyn, Eric E. J.; Coolen, Jolanda C.; van Aarle, Edward J. M.

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input data directly into DSM-IV symptom criteria. The…

  3. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM–IV Diagnoses Using CBCL Data

    NARCIS (Netherlands)

    Krol, N.P.C.M.; Bruyn, E.E.J. De; Coolen, J.C.; Aarle, E.J.M. van

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input

  4. Screening for Microalbuminuria in the early detection of diabetic nephropathy: A cheap and simple method

    Directory of Open Access Journals (Sweden)

    "Larijani B

    2002-06-01

    Full Text Available Prompt detection of renal involvement through evaluation of microalbuminuria can both reduce mortality in diabetic patients and significantly reduce the cost of managing these patients. To this end, Micral test strips have been used as a screeing tool in this group of patients though not yet in our country. The present study aimed to evaluate this test and to abtain a simpler and less expensive method of screening for microlbuminuria. In this study, 200 type 1 and type 2 diabetic patients referred to the Endocrine & Metabolims Research Center of the Tehran university of medical Sciences were evaluated for microabluminuria. Entry criteria consisted of a history of recognized diabetes longer than or equal to 5 years. Exclusion criteria included development of urinary tract infection, pyrexia, and a history of uncontrolled hypertension. Every patient first completed a data questionnaire and then provided a first-void urine sample, which was tested for microalbuminuria with a urinary protein test strip (an Iranian-made Uri-Yab and a German-made BM-test-GP strip and the sulphasalicylic acid chemical method. Negative samples were tested further using Micral test strips (based on gold-lable immunochromatograpy and the microalbumin measurement kit manufactured by Dako. Germany (based on turbidometry using a Hitachi autoanalyser. 126 women and 74 men were recruited into the study. The average age of the sample was 40.7 years (range=16 to 63 years; 17 patients had IDDM and 173, NIDDM. Average duration of recognized diabetes was 8.75 years. Based on results obtained using chemical analysis and foreign-made tests strips, 46 patients (23% had macroalbuminuria, though the detection rate using Iranian-made test strips was 18 percent (36 patients. A further 16.2 percent of patients had microalbuminuria, with an average urinary albumin excertion of 28.7 mg per liter. Compared with colorimetric methos, the Micral test yieled a sensitivity of 93% and a specificity

  5. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    OpenAIRE

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning ...

  6. How to benchmark methods for structure-based virtual screening of large compound libraries.

    Science.gov (United States)

    Christofferson, Andrew J; Huang, Niu

    2012-01-01

    Structure-based virtual screening is a useful computational technique for ligand discovery. To systematically evaluate different docking approaches, it is important to have a consistent benchmarking protocol that is both relevant and unbiased. Here, we describe the designing of a benchmarking data set for docking screen assessment, a standard docking screening process, and the analysis and presentation of the enrichment of annotated ligands among a background decoy database.

  7. Assessment of Sediment Heavy Metals Pollution Using Screening Methods (XRF, TGA/MS, XRPD and Earthworms Bioassay)

    Science.gov (United States)

    Findoráková, Lenka; Šestinová, Ol'ga; Hančul'ák, Jozef; Fedorová, Erika; Zorkovská, Anna

    2016-10-01

    The aim of this study is focused on the use of screening methods (TG/DTA coupled with MS, XRF, AAS, XRPD and earthworm bioassay) for sediments pollution assessing by heavy metals (Cu, Zn, Pb, Hg) coming from the former mining workloads in the central Spis, Eastern Slovakia. The screening methods (XRF, AAS) indicated pollution of studied sediments by Cu, Zn, Pb, Hg. The earthworms Dendrobaena veneta caused in some studied samples decrease of heavy metals concentration after their 7 days’ exposure in sediments. The other screening methods such as thermal analysis and XRPD analysis, does not confirm the specifically changes in physicochemical properties comparing the properties before and after 7 days’ earthworm's exposure.

  8. Developing the clinical components of a complex intervention for a glaucoma screening trial: a mixed methods study

    Directory of Open Access Journals (Sweden)

    2011-04-01

    Full Text Available Abstract Background Glaucoma is a leading cause of avoidable blindness worldwide. Open angle glaucoma is the most common type of glaucoma. No randomised controlled trials have been conducted evaluating the effectiveness of glaucoma screening for reducing sight loss. It is unclear what the most appropriate intervention to be evaluated in any glaucoma screening trial would be. The purpose of this study was to develop the clinical components of an intervention for evaluation in a glaucoma (open angle screening trial that would be feasible and acceptable in a UK eye-care service. Methods A mixed-methods study, based on the Medical Research Council (MRC framework for complex interventions, integrating qualitative (semi-structured interviews with 46 UK eye-care providers, policy makers and health service commissioners, and quantitative (economic modelling methods. Interview data were synthesised and used to revise the screening interventions compared within an existing economic model. Results The qualitative data indicated broad based support for a glaucoma screening trial to take place in primary care, using ophthalmic trained technical assistants supported by optometry input. The precise location should be tailored to local circumstances. There was variability in opinion around the choice of screening test and target population. Integrating the interview findings with cost-effectiveness criteria reduced 189 potential components to a two test intervention including either optic nerve photography or screening mode perimetry (a measure of visual field sensitivity with or without tonometry (a measure of intraocular pressure. It would be more cost-effective, and thus acceptable in a policy context, to target screening for open angle glaucoma to those at highest risk but for both practicality and equity arguments the optimal strategy was screening a general population cohort beginning at age forty. Conclusions Interventions for screening for open angle

  9. A screening method for the optimal selection of plate heat exchanger configurations

    Directory of Open Access Journals (Sweden)

    Pinto J.M.

    2002-01-01

    Full Text Available An optimization method for determining the best configuration(s of gasketed plate heat exchangers is presented. The objective is to select the configuration(s with the minimum heat transfer area that still satisfies constraints on the number of channels, the pressure drop of both fluids, the channel flow velocities and the exchanger thermal effectiveness. The configuration of the exchanger is defined by six parameters, which are as follows: the number of channels, the numbers of passes on each side, the fluid locations, the feed positions and the type of flow in the channels. The resulting configuration optimization problem is formulated as the minimization of the exchanger heat transfer area and a screening procedure is proposed for its solution. In this procedure, subsets of constraints are successively applied to eliminate infeasible and nonoptimal solutions. Examples show that the optimization method is able to successfully determine a set of optimal configurations with a minimum number of exchanger evaluations. Approximately 5 % of the pressure drop and channel velocity calculations and 1 % of the thermal simulations are required for the solution.

  10. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    International Nuclear Information System (INIS)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah; Lee, Sang Hoon

    2004-01-01

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding

  11. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah [Sungkyunkwan University, Seoul (Korea, Republic of); Lee, Sang Hoon [University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    2004-03-15

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding.

  12. A rapid sample screening method for authenticity control of whiskey using capillary electrophoresis with online preconcentration.

    Science.gov (United States)

    Heller, Melina; Vitali, Luciano; Oliveira, Marcone Augusto Leal; Costa, Ana Carolina O; Micke, Gustavo Amadeu

    2011-07-13

    The present study aimed to develop a methodology using capillary electrophoresis for the determination of sinapaldehyde, syringaldehyde, coniferaldehyde, and vanillin in whiskey samples. The main objective was to obtain a screening method to differentiate authentic samples from seized samples suspected of being false using the phenolic aldehydes as chemical markers. The optimized background electrolyte was composed of 20 mmol L(-1) sodium tetraborate with 10% MeOH at pH 9.3. The study examined two kinds of sample stacking, using a long-end injection mode: normal sample stacking (NSM) and sample stacking with matrix removal (SWMR). In SWMR, the optimized injection time of the samples was 42 s (SWMR42); at this time, no matrix effects were observed. Values of r were >0.99 for the both methods. The LOD and LOQ were better than 100 and 330 mg mL(-1) for NSM and better than 22 and 73 mg L(-1) for SWMR. The CE-UV reliability in the aldehyde analysis in the real sample was compared statistically with LC-MS/MS methodology, and no significant differences were found, with a 95% confidence interval between the methodologies.

  13. Spatial screening methods for evaluating environmental contaminant hazards and exposure vulnerability

    Science.gov (United States)

    Jones, D. K.

    2016-12-01

    Human and biotic communities are becoming increasingly vulnerable to sea-level rise and severe storms due to climate change. These events enhance the dispersion and concentration of natural and anthropogenic chemicals and pathogenic microorganisms, which could adversely impact the health and resilience of coastal communities and ecosystems in coming years. The U.S. Geological Survey (USGS) has developed spatial screening methods to identify and map contaminant sources and potential exposure pathways for human and ecological receptors. These methods have been applied within the northeastern U.S. to document contaminants of emerging concern, highlight vulnerable communities, and prioritize locations for future sampling campaigns. Integration of this information provides a means to better assess the baseline status of a complex system and the significance of changes in contaminant hazards due to storm-induced (episodic) and sea-level rise (incremental) disturbances. This presentation will provide an overview of a decision support tool developed by the USGS to document contaminants in the environment relative to key receptor populations and historic storm vulnerabilities. The support tool is designed to accommodate a broad array of geologic, land-use, and climatic variables and utilizes public, nationally available data sources to define contaminant sources and storm vulnerabilities. By employing a flexible and adaptable strategy built upon publicly available data, the method can readily be applied to other site selection or landscape evaluation efforts. Examples will be presented including the Sediment-bound Contaminant Resiliency and Response pilot study (see http://toxics.usgs.gov/scorr/), and investigations of endocrine disruption in the Chesapeake Bay. Key limitations and future applications will be discussed in addition to ongoing method developments to accommodate non-coastal disaster scenarios and more refined contaminant definitions.

  14. School-Based BMI and Body Composition Screening and Parent Notification in California: Methods and Messages

    Science.gov (United States)

    Madsen, Kristine A.; Linchey, Jennifer

    2012-01-01

    Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…

  15. Current and emerging screening methods to identify post-head-emergence frost adaptation in wheat and barley.

    Science.gov (United States)

    Frederiks, T M; Christopher, J T; Harvey, G L; Sutherland, M W; Borrell, A K

    2012-09-01

    Cereal crops can suffer substantial damage if frosts occur at heading. Identification of post-head-emergence frost (PHEF) resistance in cereals poses a number of unique and difficult challenges. Many decades of research have failed to identify genotypes with PHEF resistance that could offer economically significant benefit to growers. Research and breeding gains have been limited by the available screening systems. Using traditional frost screening systems, genotypes that escape frost injury in trials due to spatial temperature differences and/or small differences in phenology can be misidentified as resistant. We believe that by improving techniques to minimize frost escapes, such 'false-positive' results can be confidently identified and eliminated. Artificial freezing chambers or manipulated natural frost treatments offer many potential advantages but are not yet at the stage where they can be reliably used for frost screening in breeding programmes. Here we describe the development of a novel photoperiod gradient method (PGM) that facilitates screening of genotypes of different phenology under natural field frosts at matched developmental stages. By identifying frost escapes and increasing the efficiency of field screening, the PGM ensures that research effort can be focused on finding genotypes with improved PHEF resistance. To maximize the likelihood of identifying PHEF resistance, we propose that the PGM form part of an integrated strategy to (i) source germplasm;(ii) facilitate high throughput screening; and (iii) permit detailed validation. PGM may also be useful in other studies where either a range of developmental stages and/or synchronized development are desired.

  16. The Importance of Context in Screening in Occupational Health Interventions in Organizations: A Mixed Methods Study

    Directory of Open Access Journals (Sweden)

    Michela Vignoli

    2017-08-01

    Full Text Available In occupational health interventions, there is a debate as to whether standardized or tailored measures should be used to identify which aspects of the psychosocial work environment should be targeted in order to improve employees’ well-being. Using the Job Demands-Resources model, the main aim of the present study is to demonstrate how a mixed methods approach to conducting screening enables the identification of potential context-dependent demands and resources in the workplace, which should to be targeted by the intervention. Specifically, we used a mixed methods exploratory sequential research design. First, we conducted four focus groups (N = 37 in a sample of employees working in grocery stores in Italy. The qualitative results allowed to identify one possible context-specific job demand: the use of a work scheduling IT software, whose implementation resulted in a high rotation between different market’s departments. From the qualitative results, this context-specific demand seemed to be related to workers’ well-being. Thus, in a subsequent questionnaire survey (N = 288, we included this demand together with generic measures of social support and psychological well-being. Results confirmed that this context-specific job demand was related to emotional exhaustion. Furthermore, it was found that social support moderated the relationship between this specific job demand and emotional exhaustion showing among employees whose activities depended on the IT software, employees that perceived higher levels of social support from colleagues experienced lower levels of emotional exhaustion with respect to their colleagues who perceived lower levels of social support. The present study confirms that mixed methods approach is useful in occupational health intervention research and offers a way forward on helping organizations prioritize their intervention activities.

  17. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background......, to minimize the contribution of unpredicted recessive genetic factors present in the individual library strains. We utilize a set of strains where each contains a conditional centromere construct on one of the 16 yeast chromosomes that allows the destabilization and selectable loss of that chromosome. After...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  18. Is preimplantation genetic diagnosis the ideal embryo selection method in aneuploidy screening?

    Directory of Open Access Journals (Sweden)

    Levent Sahin

    2014-10-01

    Full Text Available To select cytogenetically normal embryos, preimplantation genetic diagnosis (PGD aneuploidy screening (AS is used in numerous centers around the world. Chromosomal abnormalities lead to developmental problems, implantation failure, and early abortion of embryos. The usefulness of PGD in identifying single-gene diseases, human leukocyte antigen typing, X-linked diseases, and specific genetic diseases is well-known. In this review, preimplantation embryo genetics, PGD research studies, and the European Society of Human Reproduction and Embryology PGD Consortium studies and reports are examined. In addition, criteria for embryo selection, technical aspects of PGD-AS, and potential noninvasive embryo selection methods are described. Indications for PGD and possible causes of discordant PGD results between the centers are discussed. The limitations of fluorescence in situ hybridization, and the advantages of the array comparative genomic hybridization are included in this review. Although PGD-AS for patients of advanced maternal age has been shown to improve in vitro fertilization outcomes in some studies, to our knowledge, there is not sufficient evidence to use advanced maternal age as the sole indication for PGD-AS. PGD-AS might be harmful and may not increase the success rates of in vitro fertilization. At the same time PGD, is not recommended for recurrent implantation failure and unexplained recurrent pregnancy loss.

  19. Photoionization study of the F2+ ion via the screening constant by unit nuclear charge method

    Science.gov (United States)

    Dieng, M.; Tine, M.; Sow, M.; Diop, B.; Guèye, M.; Faye, M.; Sakho, I.; Biaye, M.; Wagué, A.

    2014-03-01

    In this paper, we have tabulated energy resonances of the 2s22p2 (1D)nd (2L), 2s22p2 (1S)nd (2L) and 2s22p3 (3D)np Rydberg series originating from the 2s22p3(2Po) and from the 2s22p3 (2Do) metastable states of F2+. In addition, energy resonances of the 2s2p3(5So)np (4P) Rydberg series originating from the 2s22p3 (4So) ground-state of F2+are also reported. Calculations are performed using the Screening constant by unit nuclear charge (SCUNC) method. Analysis of the present data is achieved by calculating the quantum defects and the effective nuclear charges for each series. The present results agree very well with the Advanced Light Source experiments on F2+ (Aguilar et al., 2005). Upto n=30, the present quantum defects are almost constant and the effective charge decreases regularly toward the electric charge of the F3+ core ion along each series.

  20. Optimization of Biochemical Screening Methods for Volatile and Unstable Sesquiterpenoids Using HS-SPME-GC-MS

    Directory of Open Access Journals (Sweden)

    Trine Bundgaard Andersen

    2015-06-01

    Full Text Available HS-SPME-GC-MS has been suggested as a fast and robust analytical platform for the product characterization of sesquiterpene synthases. The choice of fiber and injection temperature can have a significant effect on the observed product profile, due to the chemical rearrangements that can occur on the fiber material. Here we present a systematic study on the effects of fiber choice and injection port temperature on the observed sesquiterpenoid profile of four sesquiterpene synthases expressed in Nicotiana benthamiana. We found that the absorbent material PDMS was much less likely to support acid-induced rearrangement of sesquiterpenoids when compared to the adsorbent materials PDMS/DVB, PDMS/CAR, and PDMS/CAR/DVB. Furthermore, utilizing an injection port temperature at 160 °C almost eliminated the inherent thermal instability of germacrene sesquiterpenoids. Thus, for fast screening of sesquiterpene synthases, the results suggest that PDMS fibers and an injection temperature of 160 °C provide a fast and reproducible HS-SPME GC-MS method when using H2 as carrier gas.

  1. IN SEARCH OF A FAST SCREENING METHOD FOR DETECTING THE MALINGERING OF COGNITIVE IMPAIRMENT

    Directory of Open Access Journals (Sweden)

    Amada Ampudia

    2012-07-01

    Full Text Available Forensic settings demand expedient and conclusive forensic psychological assessment. The aim of this study was to design a simple and fast, but reliable psychometric instrument for detecting the malingering of cognitive impairment. In a quasi-experimental design, 156 individuals were divided into three groups: a normal group with no cognitive impairment; a Mild Cognitive Impairment (MCI group; and a group of informed malingerers with no MCI who feigned cognitive impairment. Receiver Operating Curve (ROC analysis of the Test of Memory Malingering (TOMM, and of several subtests of the Wechsler Memory Scale (WMS-III revealed that the WMS-III was as reliable and accurate as the TOMM in discriminating malingerers from the honest. The results revealed that the diagnostic accuracy, sensitivity and specificity of the WMS-III Auditory Recognition Delayed of Verbal Paired Associates subtest was similar to the TOMM in discriminating malingering from genuine memory impairment. In conclusion, the WMS-III Recognition of Verbal Paired Associates subtest and the TOMM provide a fast, valid and reliable screening method for detecting the malingering of cognitive impairment.

  2. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  3. Screening method for detection of immediate amino acid decarboxylases--producing bacteria implicated in food poisoning.

    Science.gov (United States)

    Hussain, Husniza; Mohd Fuat, A R; Vimala, B; Ghazali, H M

    2011-08-01

    Assessment of amino acid decarboxylase activity can be conducted using tubed broth or plated agar. In this study, the test was carried out in microtitre plates containing lysine, ornithine, arginine, tyrosine, tryptophan, phenylalanine or histidine as biogenic amine precursors. Møller decarboxylase base broth (MDB) with or without 1% of a known amino acid were added to wells of a 96 well-microtitre plate. The wells were inoculated with Escherichia coli, Klebsiella pneumoniae, Acinetobacter anitratus or Staphylococcus aureus to the final concentration of 6.0 x 10(7) cfu/ml and incubated at 35ºC. The absorbance of the culture broth was read at 570 nm at 0, 1.0, 2.0, 3.0, 4.0, 5.5, 6.5 and 7.5 hour. Comparison of means of A'(570) between 0 hour and a specified incubation time was determined statistically. Positive decarboxylase activities were detected in the media inoculated with E. coli and K. pneumoniae in less than 6 hours. The current method is suitable for immediate producers of amino acid decarboxylase enzymes. It costs less as it uses less amino acid and it has the potential to be used for screening aliquots of food materials for amino acid decarboxylase activities.

  4. Robust high-throughput batch screening method in 384-well format with optical in-line resin quantification.

    Science.gov (United States)

    Kittelmann, Jörg; Ottens, Marcel; Hubbuch, Jürgen

    2015-04-15

    High-throughput batch screening technologies have become an important tool in downstream process development. Although continuative miniaturization saves time and sample consumption, there is yet no screening process described in the 384-well microplate format. Several processes are established in the 96-well dimension to investigate protein-adsorbent interactions, utilizing between 6.8 and 50 μL resin per well. However, as sample consumption scales with resin volumes and throughput scales with experiments per microplate, they are limited in costs and saved time. In this work, a new method for in-well resin quantification by optical means, applicable in the 384-well format, and resin volumes as small as 0.1 μL is introduced. A HTS batch isotherm process is described, utilizing this new method in combination with optical sample volume quantification for screening of isotherm parameters in 384-well microplates. Results are qualified by confidence bounds determined by bootstrap analysis and a comprehensive Monte Carlo study of error propagation. This new approach opens the door to a variety of screening processes in the 384-well format on HTS stations, higher quality screening data and an increase in throughput. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Portable non-destructive assay methods for screening and segregation of radioactive waste

    International Nuclear Information System (INIS)

    Simpson, Alan; Jones, Stephanie; Clapham, Martin; Lucero, Randy

    2011-01-01

    Significant cost-savings and operational efficiency may be realised by performing rapid non-destructive classification of radioactive waste at or near its point of retrieval or generation. There is often a need to quickly categorize and segregate bulk containers (drums, crates etc.) into waste streams defined at various boundary levels (based on its radioactive hazard) in order to meet disposal regulations and consignor waste acceptance criteria. Recent improvements in gamma spectroscopy technologies have provided the capability to perform rapid in-situ analysis using portable and hand-held devices such as battery-operated medium and high resolution detectors including lanthanum halide and high purity germanium (HPGe). Instruments and technologies that were previously the domain of complex lab systems are now widely available as touch-screen 'off-the-shelf' units. Despite such advances, the task of waste stream screening and segregation remains a complex exercise requiring a detailed understanding of programmatic requirements and, in particular, the capability to ensure data quality when operating in the field. This is particularly so when surveying historical waste drums and crates containing heterogeneous debris of unknown composition. The most widely used portable assay method is based upon far-field High Resolution Gamma Spectroscopy (HRGS) assay using HPGe detectors together with a well engineered deployment cart (such as the PSC TechniCART TM technology). Hand-held Sodium Iodide (NaI) detectors are often also deployed and may also be used to supplement the HPGe measurements in locating hot spots. Portable neutron slab monitors may also be utilised in cases where gamma measurements alone are not suitable. Several case histories are discussed at various sites where this equipment has been used for in-situ characterization of debris waste, sludge, soil, high activity waste, depleted and enriched uranium, heat source and weapons grade plutonium, fission products

  6. Alternative global goodness metrics and sensitivity analysis: heuristics to check the robustness of conclusions from studies comparing virtual screening methods.

    Science.gov (United States)

    Sheridan, Robert P

    2008-02-01

    We introduce two ways of testing the robustness of conclusions from studies comparing virtual screening methods: alternative "global goodness" metrics and sensitivity analysis. While the robustness tests cannot eliminate all biases in virtual screening comparisons, they are useful as a "reality check" for any given study. To illustrate this, we apply them to a set of enrichments published in McGaughey et al. (J. Chem. Inf. Model. 2007, 47, 1504-1519) where 11 target protein/ligand combinations are tested on 2D and 3D similarity methods, plus docking. The major conclusions in that paper, for instance, that ligand-based methods are better than docking methods, hold up. However, some minor conclusions, such as Glide being the best docking method, do not.

  7. Oscillometric blood pressure measurement: a simple method in screening for peripheral arterial disease

    DEFF Research Database (Denmark)

    Mehlsen, Jesper; Wiinberg, Niels; Bruce, Christopher

    2008-01-01

    Blood pressure at the ankle level is a reliable indicator of peripheral arterial disease (PAD) and the ankle brachial index (ABI) is a useful non-invasive screening tool for the early detection of atherosclerosis. In the first part of the study, systolic blood pressures obtained by oscillometry...... of PAD was sufficiently high in subjects over the age of 60 years to warrant screening. The ankle brachial index based on measurements with an oscillometric device was shown reliable in the exclusion of PAD, thereby fulfilling an important criterion for the use in screening....

  8. A streamlined risk screening method for managing reutilization of abandoned factories in Taiwan

    Directory of Open Access Journals (Sweden)

    I-Chun Chen

    2017-05-01

    Full Text Available An integrated management strategy that considers the competing relationships between land values and associated risks in the process of land-use conversion is needed to assess and manage the reutilization of brownfields. However, the often large number of individual brownfields renders it difficult to conduct a completed risk assessment for all sites, and a streamlined risk screening method would facilitate prioritization of the redevelopment of those factories. This methodology takes into account the spatial heterogeneity of contaminated lands and produces risk mapping that compiles complex risk-related information. Using abandoned factories in Taiwan as a case study, the method considers 40 points (50% accumulated probability as the threshold of acceptable risk. Emergency risk should be over 90% of accumulated probability. For the sustainability of brownfield reutilization in Taiwan, this research uses a risk matrix to identify the low, middle, and high risk for brownfield reutilization. It can indicate zones with a high risk level or low economic incentive as areas of concern for future decision making. In Taiwan, high-risk sites with high incentive account for only 21.3% of the sites. In contrast, the sites with the lowest incentive and low risk account for 57.6% of the sites. To avoid failure in the brownfield market, three strategies are suggested: (1 flexible land management with urban planning is a feasible option for protecting the receptor's health; (2 the government could provide the tool or brownfield funds to reduce the uncertainty of investment risk; and (3 risk monitoring and management can reduce the possible pitfalls associated with brownfield reutilization.

  9. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    Science.gov (United States)

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  10. A simple phenotypic method for screening of MCR-1-mediated colistin resistance.

    Science.gov (United States)

    Coppi, M; Cannatelli, A; Antonelli, A; Baccani, I; Di Pilato, V; Sennati, S; Giani, T; Rossolini, G M

    2018-02-01

    To evaluate a novel method, the colistin-MAC test, for phenotypic screening of acquired colistin resistance mediated by transferable mcr-1 resistance determinants, based on colistin MIC reduction in the presence of dipicolinic acid (DPA). The colistin-MAC test consists in a broth microdilution method, in which colistin MIC is tested in the absence or presence of DPA (900 μg/mL). Overall, 74 colistin-resistant strains of Enterobacteriaceae (65 Escherichia coli and nine other species), including 61 strains carrying mcr-1-like genes and 13 strains negative for mcr genes, were evaluated with the colistin-MAC test. The presence of mcr-1-like and mcr-2-like genes was assessed by real-time PCR and end-point PCR. For 20 strains, whole-genome sequencing data were also available. A ≥8-fold reduction of colistin MIC in the presence of DPA was observed with 59 mcr-1-positive strains, including 53 E. coli of clinical origin, three E. coli transconjugants carrying MCR-1-encoding plasmids, one Enterobacter cloacae complex and two Citrobacter spp. Colistin MICs were unchanged, increased or at most reduced by twofold with the 13 mcr-negative colistin-resistant strains (nine E. coli and four Klebsiella pneumoniae), but also with two mcr-1-like-positive K. pneumoniae strains. The colistin-MAC test could be a simple phenotypic test for presumptive identification of mcr-1-positive strains among isolates of colistin-resistant E. coli, based on a ≥8-fold reduction of colistin MIC in the presence of DPA. Evaluation of the test with a larger number of strains, species and mcr-type resistance determinants would be of interest. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  11. A Quantitative Method to Screen Common Bean Plants for Resistance to Bean common mosaic necrosis virus.

    Science.gov (United States)

    Strausbaugh, C A; Myers, J R; Forster, R L; McClean, P E

    2003-11-01

    ABSTRACT A quantitative method to screen common bean (Phaseolus vulgaris) plants for resistance to Bean common mosaic necrosis virus (BCMNV) is described. Four parameters were assessed in developing the quantitative method: symptoms associated with systemic virus movement, plant vigor, virus titer, and plant dry weight. Based on these parameters, two rating systems (V and VV rating) were established. Plants from 21 recombinant inbred lines (RILs) from a Sierra (susceptible) x Olathe (partially resistant) cross inoculated with the BCMNV-NL-3 K strain were used to evaluate this quantitative approach. In all, 11 RILs exhibited very susceptible reactions and 10 RILs expressed partially resistant reactions, thus fitting a 1:1 susceptible/partially resistant ratio (chi(2) = 0.048, P = 0.827) and suggesting that the response is mediated by a single gene. Using the classical qualitative approach based only on symptom expression, the RILs were difficult to separate into phenotypic groups because of a continuum of responses. By plotting mean percent reduction in either V (based on visual symptoms) or VV (based on visual symptoms and vigor) rating versus enzyme-linked immunosorbent assay (ELISA) absorbance values, RILs could be separated clearly into different phenotypic groups. The utility of this quantitative approach also was evaluated on plants from 12 cultivars or pure lines inoculated with one of three strains of BCMNV. Using the mean VV rating and ELISA absorbance values, significant differences were established not only in cultivar and pure line comparisons but also in virus strain comparisons. This quantitative system should be particularly useful for the evaluation of the independent action of bc genes, the discovery of new genes associated with partial resistance, and assessing virulence of virus strains.

  12. Electrostatic Dust Cloth: A Passive Screening Method to Assess Occupational Exposure to Organic Dust in Bakeries

    Directory of Open Access Journals (Sweden)

    Carla Viegas

    2018-02-01

    Full Text Available Organic dust is widespread in the environment including occupational settings, such as bakeries. Recently, a new collection device—the electrostatic dust cloth (EDC—has been described for the assessment of occupational exposures. The aim of this study was to investigate the suitability of EDC for identifying the distribution patterns and exposure concentrations of particulate matter and microbial contaminants such as fungi and bacteria in bakeries. Twelve bakeries were selected, and dust was allowed to settle for 13 to 16 days on EDCs (a total of 33 samples. Particle counts and size distribution (0.3 µm, 0.5 µm, 1 µm, 2.5 µm, 5 µm and 10 µm were measured with direct-reading equipment. Higher EDC mass was significantly correlated (p values < 0.05 with higher fungal load on dichloran glycerol (DG18 and with particle size distribution in the 0.3 µm, 0.5 µm, 1.0 µm and 10.0 µm range. Fungal levels on malt extract agar (MEA ranged from 0 to 2886 CFU/m2 EDC in the warehouse setting, 0 to 500 CFU/m2 EDC in the production setting, and 0 to 3135 CFU/m2 EDC in the store. Penicillium sp. (42.56% was the most frequent fungi. Total bacterial load ranged from 0 to 18,859 CFU/m2 EDC in the warehouse, 0 to 71,656 CFU/m2 EDC in production, and 0 to 21,746 CFU/m2 EDC in the store. EDC assessment provided a longer-term integrated sample of organic dust, useful for identifying critical worksites in which particulate matter and bio-burden exposures are elevated. These findings suggest that EDC can be applied as a screening method for particulate matter-exposure assessment and as a complementary method to quantify exposures in occupational environments.

  13. LC-ESI/MS/MS method for rapid screening and confirmation of 44 exogenous anabolic steroids in human urine.

    Science.gov (United States)

    Jeon, Byoung Wook; Yoo, Hye Hyun; Jeong, Eun Sook; Kim, Ho Jun; Jin, Changbae; Kim, Dong Hyun; Lee, Jaeick

    2011-09-01

    A sensitive and rapid method based on liquid chromatography-triple-quadrupole tandem mass spectrometry (LC-MS/MS) with electrospray ionization (ESI) has been developed and validated for the screening and confirmation of 44 exogenous anabolic steroids (29 parent steroids and 15 metabolites) in human urine. The method involves an enzymatic hydrolysis, liquid-liquid extraction, and detection by LC-MS/MS. A triple-quadrupole mass spectrometer was operated in positive ESI mode with selected reaction monitoring (SRM) mode for the screening and product ion scan mode for the confirmation. The protonated molecular ions were used as precursor ions for the SRM analysis and product ion scan. The intraday and interday precisions of the target analytes at concentrations of the minimum required performance levels for the screening were 2-14% and 2-15%, respectively. The limits of detection for the screening and confirmation method were 0.1-10 ng/mL and 0.2-10 ng/mL, respectively, for 44 steroids. This method was successfully applied to analysis of urine samples from suspected anabolic steroid abusers.

  14. A new microplate screening method for the simultaneous activity quantification of feruloyl esterases, tannases, and chlorogenate esterases.

    Science.gov (United States)

    Ramírez, L; Arrizon, J; Sandoval, G; Cardador, A; Bello-Mendoza, R; Lappe, P; Mateos-Díaz, J C

    2008-12-01

    Feruloyl, chlorogenate esterases, and tannases are enzymes useful in phenolic modifications of pharmaceutical relevance as protectors against several degenerative human diseases. Therefore, there is a growing interest in discovering new sources of these enzymes. However, traditional methods for their activity measurements are time-consuming and poorly adapted for high-throughput screening. In this study, a successful new microplate high-throughput screening method for the simultaneous quantification of all mentioned activities is demonstrated. This method allows the detection of activities as low as 1.7 mU ml(-1). Furthermore, reaction rates increased proportionally with the amount of enzyme added, and no interferences with the other commercial hydrolases tested were found. The utility of the method was demonstrated after simultaneously screening feruloyl, chlorogenate esterase, and tannase activities in solid state fermentation extracts obtained during the kinetics of production of 20 fungal strains. Among these, seven strains were positive for at least one of the esterase activities tested. This result shows the potential for the rapid routine screening assays for multiple samples of moderate low to high enzymatic levels.

  15. Development of a multi-electrode extrapolation chamber as a prototype of a primary standard for the realization of the unit of the absorbed dose to water for beta brachytherapy sources

    CERN Document Server

    Bambynek, M

    2002-01-01

    The prototype of a primary standard has been developed, built and tested, which enables the realization of the unit of the absorbed dose to water for beta brachytherapy sources. In the course of the development of the prototype, the recommendations of the American Association of Physicists in Medicine (AAPM) Task Group 60 (TG60) and the Deutsche Gesellschaft fuer Medizinische Physik (DGMP) Arbeitskreis 18 (AK18) were taken into account. The prototype is based on a new multi-electrode extrapolation chamber (MEC) which meets, in particular, the requirements on high spatial resolution and small uncertainty. The central part of the MEC is a segmented collecting electrode which was manufactured in the clean room center of PTB by means of electron beam lithography on a wafer. A precise displacement device consisting of three piezoelectric macrotranslators has been incorporated to move the wafer collecting electrode against the entrance window. For adjustment of the wafer collecting electrode parallel to the entranc...

  16. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman

    2016-01-01

    compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training

  17. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman M.

    2016-11-23

    Drug discovery is a process that takes many years and hundreds of millions of dollars to reveal a confident conclusion about a specific treatment. Part of this sophisticated process is based on preliminary investigations to suggest a set of chemical compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training prediction models. Yet, the difficulties imposed by big expansion in data and its dimensionality are inevitable. In this thesis, I address the main challenges that come when data mining techniques are used for virtual screening. In order to achieve an efficient virtual screening using data mining, I start by addressing the problem of feature selection and provide analysis of best ways to describe a chemical compound for an enhanced screening performance. High-throughput screening (HTS) assays data used for virtual screening are characterized by a great class imbalance. To handle this problem of class imbalance, I suggest using a novel algorithm called DRAMOTE to narrow down promising candidate chemicals aimed at interaction with specific molecular targets before they are experimentally evaluated. Existing works are mostly proposed for small-scale virtual screening based on making use of few thousands of interactions. Thus, I propose enabling large-scale (or big) virtual screening through learning millions of interaction while exploiting any relevant dependency for a better accuracy. A novel solution called DRABAL that incorporates structure learning of a Bayesian Network as a step to model dependency between the HTS assays, is showed to achieve significant improvements over existing state-of-the-art approaches.

  18. Analysis of errors in the measurement of unattached fractions of radon and thoron progeny in a Canadian uranium mine using wire screen methods

    International Nuclear Information System (INIS)

    Khan, A.; Phillips, C.R.

    1987-01-01

    The unattached fraction of radon/thoron progeny in uranium mines is generally small and therefore difficult to measure accurately. The simple wire screen method provides a direct estimate of the unattached fraction from the screen count, or an indirect estimate from the difference between the reference and back-up filter counts. Wire screen method results are often difficult to analyse, especially when the unattached activity is small. Experimental data obtained in Canadian uranium mines are presented here, together with a detailed error analysis. The method consisting of counting the wire screen and the back-up filter is found to be the most precise method for unattached fraction determination. (author)

  19. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  20. CALF CIRCUMFERENCE AT BIRTH: A SCREENING METHOD FOR DETECTION OF LOW BIRTH WEIGHT

    Directory of Open Access Journals (Sweden)

    Sandip Kumar

    2012-12-01

    Full Text Available Background: Low Birth Weight (LBW babies run a higher risk of morbidity and mortality in the perinatal period. However, in our country where almost 70-80% births take place at home and peripheral hospitals, taking accurate weight is a problem due to unavailability of weighing scale and trained personnel. Hence there is a constant search for newer methods to detect LBW babies so that early interventions can be instituted. Various authors have used different surrogate anthropometric measurements from different parts of our country. In the present study, an attempt was made to validate the feasibility of using calf circumference as a predictor of LBW babies that can be used by a trained or untrained person. Objectives: To study various anthropometric measurements including calf circumference in newborns and to correlate various measurements with birth weight. Methods: The present study was conducted in the department of Social & Preventive Medicine, MLB Medical College, Jhansi (UP for a period of one year. The study included 1100 consecutively delivered neonates in the maternity ward of MLB Medical College Hospital, Jhansi (UP. The birth weight (Wt, crown heel length (CHL, crown rump length (CRL, head circumference (HC, chest circumference (CC, mid arm circumference (MAC, thigh circumference (TC and calf circumference (CC by standard techniques. All the measurements were taken by a single person throughout the study period with in 24 hours of delivery. Standard statistical methods were adopted for determination of critical limit, sensitivity, specificity and correlation coefficient of different anthropometric measurements in relation to birth weight. Results: Analysis of data indicates that out of 1100 newborns, 55.64% were low birth weight. The percentage of newborns > 2500gm was 44.36. Overall average birth weight was 2348 ± 505gm. Out of 1100 newborns, 608 (55.27% were males and 492 (44.73% were females. Average birth weight for males was 2412

  1. Development of a cloud-screening method for MAX-DOAS measurements

    Science.gov (United States)

    Gielen, Clio; Van Roozendael, Michel; Hendrik, Francois; Fayt, Caroline; Hermans, Christian; Pinardi, Gaia; Vlemmix, Tim

    2013-04-01

    is easily detectable. Additional information is derived from the O4 DSCD measurements, since they are quite sensitive to the change of the light paths due to scattering at different altitudes. For example, thick clouds at low altitude show a very strong increase in the DSCD values due to scattering, combined with a low colour index value due to the intensity screening. In general, our method shows promising results to qualify the sky and cloud conditions of MAX- DOAS measurements, without the need for other external cloud-detection systems such as Brewer instruments or pyrheliometers.

  2. A method of simultaneous no-screen X-ray film taking with direct twofold magnification of hands and feet

    International Nuclear Information System (INIS)

    Zajgner, J.; Szymanska-Prach, H.

    1978-01-01

    The authors propose an original method of X-ray examination of hands and feet which makes possible simultaneous radiography without screen and direct twofold magnified film taking. The method is not connected with the necessity of exposing the patient to an additional dose of X-rays. It has been tried in 20 patients with suspected rheumatoid arthritis. It requires an X-ray tube with 0.3 x 0.3 mm microfocus. (author)

  3. A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

    Science.gov (United States)

    Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

    2013-03-11

    Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

  4. Investigation of toxigenic potential of fungal species by the use of simple screening method

    Directory of Open Access Journals (Sweden)

    Bočarov-Stančić Aleksandra S.

    2009-01-01

    Full Text Available Potential for the biosynthesis of aflatoxin B1 (AFLB1, ochratoxin A (OTA, diacetoxyscirpenol (DAS, T-2 toxin (T2, and zearalenone (ZON was investigated in different fungal species belonging to the genera: Aspergillus, Fusarium and Penicillium. The majority of investigated isolates originated from cereal grains, crushed oil soybean seed and fodder mixtures. The simple screening method developed by Filtenborg et al. (1983 was applied with few modifications concerning the type of the medium and cultivation temperature. In order to optimise the biosynthetic conditions for different mycotoxins, the following control cultures, known as mycotin producers were used: OTA - A. ochraceus CBS 108.08, DAS - F. semitectum (SL-B i SL-C, T2 - F. sporotrichioides (ITM-391, M-1-1, R-2301 and ZON - F. graminearum (GZ-LES. The fungi were cultivated on the standard medium (YESA - 2% yeast extract, 15% sucrose and 2% agar, pH 6.5, three modifications of the basic medium (YESAZn - the standard medium supplemented with 0.23 mg/l ZnSO4 x 5 H2O; PPSA - the medium in which yeast extract was replaced with peptone-1; PPSAZn - the medium in which yeast extract was replaced with peptone-1 and supplemented with 0.23 mg/l ZnSO4 x 5 H2O, and the potato-dextrose agar (PDA. The earlier biosynthesis of tested mycotoxins was recorded under the following cultivation conditions of fungal species: AFLB1 - after 14 days on PDA at 27±1°C, OTA - after 10 days on YESA and YESAZn at 27±1°C, DAS - after 10 days on PPSA and PPSAZn at 27±1°C, T2 - after 7 days on PPSAZn and PPSA at room temperature (20-24°C, and ZON - after 1 week on YESA and YESAZn at room temperature (21-24°C.

  5. An approximate-reasoning-based method for screening high-level waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at Hanford have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. AR models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. The authors performed a pilot study to investigate the utility of AR for flammable gas screening. They found that the effort to implement such a model was acceptable and that computational requirements were reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  6. An approximate reasoning-based method for screening high-level-waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    2000-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop and improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  7. An Approximate Reasoning-Based Method for Screening High-Level-Waste Tanks for Flammable Gas

    International Nuclear Information System (INIS)

    Eisenhawer, Stephen W.; Bott, Terry F.; Smith, Ronald E.

    2000-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  8. An approximate reasoning-based method for screening high-level-waste tanks for flammable gas

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    2000-06-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop and improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts.

  9. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, P.; Kandarakis, I.; Cavouras, D.; Kalivas, N.; Delis, H.; Panayiotakis, G.

    2007-01-01

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd 2 O 2 S:Tb phosphor material with packing density of 70% and grain size of 7 μm and (c) phosphor thickness ranging between 30 and 70 mg/cm 2 . The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm 2 phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems

  10. Comparison of Cardiovascular Risk Screening Methods and Mortality Data among Hungarian Primary Care Population: Preliminary Results of the First Government-Financed Managed Care Program.

    Science.gov (United States)

    Móczár, Csaba; Rurik, Imre

    2015-09-01

    Besides participation in the primary prevention, screening as secondary prevention is an important requirement for primary care services. The effect of this work is influenced by the characteristics of individual primary care practices and doctors' screening habits, as well as by the regulation of screening processes and available financial resources. Between 1999 and 2009, a managed care program was introduced and carried out in Hungary, financed by the government. This financial support and motivation gave the opportunity to increase the number of screenings. 4,462 patients of 40 primary care practices were screened on the basis of SCORE risk assessment. The results of the screening were compared on the basis of two groups of patients, namely: those who had been pre-screened (pre-screening method) for known risk factors in their medical history (smoking, BMI, age, family cardiovascular history), and those randomly screened. The authors also compared the mortality data of participating primary care practices with the regional and national data. The average score was significantly higher in the pre-screened group of patients, regardless of whether the risk factors were considered one by one or in combination. Mortality was significantly lower in the participating primary practices than had been expected on the basis of the national mortality data. This government-financed program was a big step forward to establish a proper screening method within Hungarian primary care. Performing cardiovascular screening of a selected target group is presumably more appropriate than screening within a randomly selected population. Both methods resulted in a visible improvement in regional mortality data, though it is very likely that with pre-screening a more cost-effective selection for screening may be obtained.

  11. Development of a method for efficient cost-effective screening of Aspergillus niger mutants having increased production of glucoamylase.

    Science.gov (United States)

    Zhu, Xudong; Arman, Bessembayev; Chu, Ju; Wang, Yonghong; Zhuang, Yingping

    2017-05-01

    To develop an efficient cost-effective screening process to improve production of glucoamylase in Aspergillus niger. The cultivation of A. niger was achieved with well-dispersed morphology in 48-deep-well microtiter plates, which increased the throughput of the samples compared to traditional flask cultivation. There was a close negative correlation between glucoamylase and its pH of the fermentation broth. A novel high-throughput analysis method using Methyl Orange was developed. When compared to the conventional analysis method using 4-nitrophenyl α-D-glucopyranoside as substrate, a correlation coefficient of 0.96 by statistical analysis was obtained. Using this novel screening method, we acquired a strain with an activity of 2.2 × 10 3  U ml -1 , a 70% higher yield of glucoamylase than its parent strain.

  12. Overview of a workshop on screening methods for detecting potential (anti-) estrogenic/androgenic chemicals in wildlife

    Science.gov (United States)

    Ankley, Gerald T.; Mihaich, Ellen; Stahl, Ralph G.; Tillitt, Donald E.; Colborn, Theo; McMaster, Suzzanne; Miller, Ron; Bantle, John; Campbell, Pamela; Denslow, Nancy; Dickerson, Richard L.; Folmar, Leroy C.; Fry, Michael; Giesy, John P.; Gray, L. Earl; Guiney, Patrick; Hutchinson, Thomas; Kennedy, Sean W.; Kramer, Vincent; LeBlanc, Gerald A.; Mayes, Monte; Nimrod, Alison; Patino, Reynaldo; Peterson, Richard; Purdy, Richard; Ringer, Robert; Thomas, Peter C.; Touart, Les; Van Der Kraak, Glen; Zacharewski, Tim

    1998-01-01

    The U.S. Congress has passed legislation requiring the U.S. Environmental Protection Agency (U.S. EPA) to develop, validate, and implement screening tests for identifying potential endocrine-disrupting chemicals within 3 years. To aid in the identification of methods suitable for this purpose, the U.S. EPA, the Chemical Manufacturers Association, and the World Wildlife Fund sponsored several workshops, including the present one, which dealt with wildlife species. This workshop was convened with 30 international scientists representing multiple disciplines in March 1997 in Kansas City, Missouri, USA. Participants at the meeting identified methods in terms of their ability to indicate (anti-) estrogenic/androgenic effects, particularly in the context of developmental and reproductive processes. Data derived from structure-activity relationship models and in vitro test systems, although useful in certain contexts, cannot at present replace in vivo tests as the sole basis for screening. A consensus was reached that existing mammalian test methods (e.g., with rats or mice) generally are suitable as screens for assessing potential (anti-) estrogenic/ androgenic effects in mammalian wildlife. However, due to factors such as among-class variation in receptor structure and endocrine function, it is uncertain if these mammalian assays would be of broad utility as screens for other classes of vertebrate wildlife. Existing full and partial life-cycle tests with some avian and fish species could successfully identify chemicals causing endocrine disruption; however, these long-term tests are not suitable for routine screening. However, a number of short-term tests with species from these two classes exist that could serve as effective screening tools for chemicals inducing (anti-) estrogenic/androgenic effects. Existing methods suitable for identifying chemicals with these mechanisms of action in reptiles and amphibians are limited, but in the future, tests with species from

  13. Measuring background by the DIN-1M spectrometer using the oscillating absorbing screen method

    International Nuclear Information System (INIS)

    Glazkov, Yu.Yu.; Liforov, V.G.; Novikov, A.G.; Parfenov, V.A.; Semenov, V.A.

    1982-01-01

    Technique for measuring background by a double pulse slow neutron spectrometer is described. To measure the background on oscillating absorbing screen (OAS) periodically overlapping primary neutron beam at the input of a mechanical interrupter was used. During the overlapping monochromatic neutrons conditioned the effect are removed out of the beam and general background conditions are not practically applied. Screen oscillation permits to realize the condition of simultaneous measurement of effect and background neutrons. The optimal period of oscillations amounts to approximately 3 min. Analysis of neutron spectra scattered with different materials and corresponding background curves measured by means of the OAS technique shows that the share of monochromatic neutrons passing through the screen constitutes less than 1% of elastic peak and relative decrease of the total background level doesn't exceed 1.5-2%

  14. Virtual screening applications: a study of ligand-based methods and different structure representations in four different scenarios.

    Science.gov (United States)

    Hristozov, Dimitar P; Oprea, Tudor I; Gasteiger, Johann

    2007-01-01

    Four different ligand-based virtual screening scenarios are studied: (1) prioritizing compounds for subsequent high-throughput screening (HTS); (2) selecting a predefined (small) number of potentially active compounds from a large chemical database; (3) assessing the probability that a given structure will exhibit a given activity; (4) selecting the most active structure(s) for a biological assay. Each of the four scenarios is exemplified by performing retrospective ligand-based virtual screening for eight different biological targets using two large databases--MDDR and WOMBAT. A comparison between the chemical spaces covered by these two databases is presented. The performance of two techniques for ligand--based virtual screening--similarity search with subsequent data fusion (SSDF) and novelty detection with Self-Organizing Maps (ndSOM) is investigated. Three different structure representations--2,048-dimensional Daylight fingerprints, topological autocorrelation weighted by atomic physicochemical properties (sigma electronegativity, polarizability, partial charge, and identity) and radial distribution functions weighted by the same atomic physicochemical properties--are compared. Both methods were found applicable in scenario one. The similarity search was found to perform slightly better in scenario two while the SOM novelty detection is preferred in scenario three. No method/descriptor combination achieved significant success in scenario four.

  15. Estimation of Pap-test coverage in an area with an organised screening program: challenges for survey methods

    Directory of Open Access Journals (Sweden)

    Raggi Patrizio

    2006-03-01

    Full Text Available Abstract Background The cytological screening programme of Viterbo has completed the second round of invitations to the entire target population (age 25–64. From a public health perspective, it is important to know the Pap-test coverage rate and the use of opportunistic screening. The most commonly used study design is the survey, but the validity of self-reports and the assumptions made about non respondents are often questioned. Methods From the target population, 940 women were sampled, and responded to a telephone interview about Pap-test utilisation. The answers were compared with the screening program registry; comparing the dates of Pap-tests reported by both sources. Sensitivity analyses were performed for coverage over a 36-month period, according to various assumptions regarding non respondents. Results The response rate was 68%. The coverage over 36 months was 86.4% if we assume that non respondents had the same coverage as respondents, 66% if we assume they were not covered at all, and 74.6% if we adjust for screening compliance in the non respondents. The sensitivity and specificity of the question, "have you ever had a Pap test with the screening programme" were 84.5% and 82.2% respectively. The test dates reported in the interview tended to be more recent than those reported in the registry, but 68% were within 12 months of each other. Conclusion Surveys are useful tools to understand the effectiveness of a screening programme and women's self-report was sufficiently reliable in our setting, but the coverage estimates were strongly influenced by the assumptions we made regarding non respondents.

  16. Revision of FMM-Yukawa: An adaptive fast multipole method for screened Coulomb interactions

    Science.gov (United States)

    Zhang, Bo; Huang, Jingfang; Pitsianis, Nikos P.; Sun, Xiaobai

    2010-12-01

    FMM-YUKAWA is a mathematical software package primarily for rapid evaluation of the screened Coulomb interactions of N particles in three dimensional space. Since its release, we have revised and re-organized the data structure, software architecture, and user interface, for the purpose of enabling more flexible, broader and easier use of the package. The package and its documentation are available at http://www.fastmultipole.org/, along with a few other closely related mathematical software packages. New version program summaryProgram title: FMM-Yukawa Catalogue identifier: AEEQ_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEQ_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU GPL 2.0 No. of lines in distributed program, including test data, etc.: 78 704 No. of bytes in distributed program, including test data, etc.: 854 265 Distribution format: tar.gz Programming language: FORTRAN 77, FORTRAN 90, and C. Requires gcc and gfortran version 4.4.3 or later Computer: All Operating system: Any Classification: 4.8, 4.12 Catalogue identifier of previous version: AEEQ_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2331 Does the new version supersede the previous version?: Yes Nature of problem: To evaluate the screened Coulomb potential and force field of N charged particles, and to evaluate a convolution type integral where the Green's function is the fundamental solution of the modified Helmholtz equation. Solution method: The new version of fast multipole method (FMM) that diagonalizes the multipole-to-local translation operator is applied with the tree structure adaptive to sample particle locations. Reasons for new version: To handle much larger particle ensembles, to enable the iterative use of the subroutines in a solver, and to remove potential contention in assignments for parallelization. Summary of revisions: The software package FMM-Yukawa has been

  17. A novel automatic quantification method for high-content screening analysis of DNA double strand-break response.

    Science.gov (United States)

    Feng, Jingwen; Lin, Jie; Zhang, Pengquan; Yang, Songnan; Sa, Yu; Feng, Yuanming

    2017-08-29

    High-content screening is commonly used in studies of the DNA damage response. The double-strand break (DSB) is one of the most harmful types of DNA damage lesions. The conventional method used to quantify DSBs is γH2AX foci counting, which requires manual adjustment and preset parameters and is usually regarded as imprecise, time-consuming, poorly reproducible, and inaccurate. Therefore, a robust automatic alternative method is highly desired. In this manuscript, we present a new method for quantifying DSBs which involves automatic image cropping, automatic foci-segmentation and fluorescent intensity measurement. Furthermore, an additional function was added for standardizing the measurement of DSB response inhibition based on co-localization analysis. We tested the method with a well-known inhibitor of DSB response. The new method requires only one preset parameter, which effectively minimizes operator-dependent variations. Compared with conventional methods, the new method detected a higher percentage difference of foci formation between different cells, which can improve measurement accuracy. The effects of the inhibitor on DSB response were successfully quantified with the new method (p = 0.000). The advantages of this method in terms of reliability, automation and simplicity show its potential in quantitative fluorescence imaging studies and high-content screening for compounds and factors involved in DSB response.

  18. An analysis of normalization methods for Drosophila RNAi genomic screens and development of a robust validation scheme

    Science.gov (United States)

    Wiles, Amy M.; Ravi, Dashnamoorthy; Bhavani, Selvaraj; Bishop, Alexander J.R.

    2010-01-01

    Genome-wide RNAi screening is a powerful, yet relatively immature technology that allows investigation into the role of individual genes in a process of choice. Most RNAi screens identify a large number of genes with a continuous gradient in the assessed phenotype. Screeners must then decide whether to examine just those genes with the most robust phenotype or to examine the full gradient of genes that cause an effect and how to identify the candidate genes to be validated. We have used RNAi in Drosophila cells to examine viability in a 384-well plate format and compare two screens, untreated control and treatment. We compare multiple normalization methods, which take advantage of different features within the data, including quantile normalization, background subtraction, scaling, cellHTS2 1, and interquartile range measurement. Considering the false-positive potential that arises from RNAi technology, a robust validation method was designed for the purpose of gene selection for future investigations. In a retrospective analysis, we describe the use of validation data to evaluate each normalization method. While no normalization method worked ideally, we found that a combination of two methods, background subtraction followed by quantile normalization and cellHTS2, at different thresholds, captures the most dependable and diverse candidate genes. Thresholds are suggested depending on whether a few candidate genes are desired or a more extensive systems level analysis is sought. In summary, our normalization approaches and experimental design to perform validation experiments are likely to apply to those high-throughput screening systems attempting to identify genes for systems level analysis. PMID:18753689

  19. Wastewater screening method for evaluating applicability of zero-valent iron to industrial wastewater

    International Nuclear Information System (INIS)

    Lee, J.W.; Cha, D.K.; Oh, Y.K.; Ko, K.B.; Jin, S.H.

    2010-01-01

    This study presents a screening protocol to evaluate the applicability of the ZVI pretreatment to various industrial wastewaters of which major constituents are not identified. The screening protocol consisted of a sequential analysis of UV-vis spectrophotometry, high-performance liquid chromatograph (HPLC), and bioassay. The UV-vis and HPLC analyses represented the potential reductive transformation of unknown constituents in wastewater by the ZVI. The UV-vis and HPLC results were quantified using principal component analysis (PCA) and Euclidian distance (ED). The short-term bioassay was used to assess the increased biodegradability of wastewater constituents after ZVI treatment. The screening protocol was applied to seven different types of real industrial wastewaters. After identifying one wastewater as the best candidate for the ZVI treatment, the benefit of ZVI pretreatment was verified through continuous operation of an integrated iron-sequencing batch reactor (SBR) resulting in the increased organic removal efficiency compared to the control. The iron pretreatment was suggested as an economical option to modify some costly physico-chemical processes in the existing wastewater treatment facility. The screening protocol could be used as a robust strategy to estimate the applicability of ZVI pretreatment to a certain wastewater with unknown composition.

  20. A high-throughput screening method for determining the substrate scope of nitrilases.

    Science.gov (United States)

    Black, Gary W; Brown, Nicola L; Perry, Justin J B; Randall, P David; Turnbull, Graeme; Zhang, Meng

    2015-02-14

    Nitrile compounds are intermediates in the synthesis of pharmaceuticals such as atorvastatin. We have developed a chromogenic reagent to screen for nitrilase activity as an alternative to Nessler's reagent. It produces a semi-quantifiable blue colour and hydrolysis of 38 nitrile substrates by 23 nitrilases as cell-free extracts has been shown.

  1. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    The generation of genetically engineered mouse models (GEMMs), including knock-out (KO) and knock-in (KI) models, often requires genomic screening of many mouse ES cell (mESC) clones by Southern blot. The use of large targeting constructs facilitates the recombination of exogenous DNA in a specific...

  2. New methods for the screening of antioxidants in three Sideritis species

    NARCIS (Netherlands)

    Koleva, I.

    2007-01-01

    This thesis describes the rapid and robust evaluation of antioxidant activity of complex mixtures such as plant extracts. The study was directed to establish the best screening and isolation procedures for components with antioxidative properties to ensure the development of an “algorithm” for

  3. Using pre-screening methods for an effective and reliable site characterization at megasites

    DEFF Research Database (Denmark)

    Nielsen, Mette Algreen; Kalisz, Mariusz; Stalder, Marcel

    2015-01-01

    also expanded the applicabilityof tree coring to BTEX compounds and tested the use ofhigh-resolution direct-push sensors for light hydrocarbons.Comparison of screening results to results from conventionalsoil and groundwater sampling yielded in most cases high rankcorrelation and confirmed the findings...

  4. Developing and validating a perinatal depression screening tool in Kenya blending Western criteria with local idioms: A mixed methods study.

    Science.gov (United States)

    Green, Eric P; Tuli, Hawa; Kwobah, Edith; Menya, D; Chesire, Irene; Schmidt, Christina

    2018-03-01

    Routine screening for perinatal depression is not common in most primary health care settings. The U.S. Preventive Services Task Force only recently updated their recommendation on depression screening to specifically recommend screening during the pre- and postpartum periods. While practitioners in high-income countries can respond to this new recommendation by implementing one of several existing depression screening tools developed in Western contexts, such as the Edinburgh Postnatal Depression Scale (EPDS) or the Patient Health Questionnaire-9 (PHQ-9), these tools lack strong evidence of cross-cultural equivalence, validity for case finding, and precision in measuring response to treatment in developing countries. Thus, there is a critical need to develop and validate new screening tools for perinatal depression that can be used by lay health workers, primary health care personnel, and patients. Working in rural Kenya, we used free listing, card sorting, and item analysis methods to develop a locally-relevant screening tool that blended Western psychiatric concepts with local idioms of distress. We conducted a validation study with a random sample of 193 pregnant women and new mothers to test the diagnostic accuracy of this scale along with the EPDS and PHQ-9. The sensitivity/specificity of the EPDS and PHQ-9 was estimated to be 0.70/0.72 and 0.70/0.73, respectively. This compared to sensitivity/specificity of 0.90/0.90 for a new 9-item locally-developed tool called the Perinatal Depression Screening (PDEPS). Across these three tools, internal consistency reliability ranged from 0.77 to 0.81 and test-retest reliability ranged from 0.57 to 0.67. The prevalence of depression ranges from 5.2% to 6.2% depending on the clinical reference standard. The EPDS and PHQ-9 are valid and reliable screening tools for perinatal depression in rural Western Kenya, the PDEPS may be a more useful alternative. At less than 10%, the prevalence of depression in this region appears

  5. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  6. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    Science.gov (United States)

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Development and implementation of a screening method to categorise the greenhouse gas mitigation potential of 91 landfills

    DEFF Research Database (Denmark)

    Fredenslund, Anders Michael; Mønster, Jacob; Kjeldsen, Peter

    2018-01-01

    A cost-effective screening method for assessing methane emissions was developed and employed to categorise 91 older Danish landfills into three categories defined by the magnitude of their emissions. The overall aim was to assess whether these landfills were relevant or irrelevant with respect...... to variations in input parameters. Of the 91 landfills in the survey, 25 were found to be relevant for biocover construction when the methane emission threshold was set at 2 kg CH4 h−1....

  8. Determination of the Modulation Transfer Function of Screen-Film Combinations in X-ray photography by the grating method

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    An intercomparison experiment concerning the determination of the Modulation Transfer Function (MTF) of Screen-Film Combinations in x-ray photography by the grating method was made. Six laboratories located in four countries participated. Each laboratory has used its own, individually developed measurement procedure. The results have shown a surprisingly good agreement, the standard deviation (1 σ value) of MTF values reported by the different laboratories was about ± 0.02

  9. High Throughput Screening Method for Systematic Surveillance of Drugs of Abuse by Multisegment Injection-Capillary Electrophoresis-Mass Spectrometry.

    Science.gov (United States)

    DiBattista, Alicia; Rampersaud, Dianne; Lee, Howard; Kim, Marcus; Britz-McKibbin, Philip

    2017-11-07

    New technologies are urgently required for reliable drug screening given a worldwide epidemic of prescription drug abuse and its devastating socioeconomic impacts on public health. Primary screening of drugs of abuse (DoA) currently relies on immunoassays that are prone to bias and are not applicable to detect an alarming array of psychoactive stimulants, tranquilizers, and synthetic opioids. These limitations impact patient safety when monitoring for medication compliance, drug substitution, or misuse/abuse and require follow-up confirmatory testing by more specific yet lower throughput instrumental methods. Herein, we introduce a high throughput platform for nontargeted screening of a broad spectrum of DoA and their metabolites based on multisegment injection-capillary electrophoresis-mass spectrometry (MSI-CE-MS). We demonstrate that MSI-CE-MS enables serial injections of 10 samples within a single run (high resolution MS with full-scan data acquisition. Unambiguous drug identification was achieved by four or more independent parameters, including comigration with a deuterated internal standard or in silico prediction of electromigration behavior together with accurate mass, most likely molecular formula, as well as MS/MS as required for confirmation testing. Acceptable precision was demonstrated for over 50 DoA at 3 concentration levels over 4 days (median coefficient of variance = 13%, n = 117) with minimal ion suppression, isobaric interferences, and sample carry-over (screening cutoff levels in human urine while allowing for systematic surveillance, specimen verification, and retrospective testing of designer drugs that elude conventional drug tests.

  10. A Systematic Protein Refolding Screen Method using the DGR Approach Reveals that Time and Secondary TSA are Essential Variables.

    Science.gov (United States)

    Wang, Yuanze; van Oosterwijk, Niels; Ali, Ameena M; Adawy, Alaa; Anindya, Atsarina L; Dömling, Alexander S S; Groves, Matthew R

    2017-08-24

    Refolding of proteins derived from inclusion bodies is very promising as it can provide a reliable source of target proteins of high purity. However, inclusion body-based protein production is often limited by the lack of techniques for the detection of correctly refolded protein. Thus, the selection of the refolding conditions is mostly achieved using trial and error approaches and is thus a time-consuming process. In this study, we use the latest developments in the differential scanning fluorimetry guided refolding approach as an analytical method to detect correctly refolded protein. We describe a systematic buffer screen that contains a 96-well primary pH-refolding screen in conjunction with a secondary additive screen. Our research demonstrates that this approach could be applied for determining refolding conditions for several proteins. In addition, it revealed which "helper" molecules, such as arginine and additives are essential. Four different proteins: HA-RBD, MDM2, IL-17A and PD-L1 were used to validate our refolding approach. Our systematic protocol evaluates the impact of the "helper" molecules, the pH, buffer system and time on the protein refolding process in a high-throughput fashion. Finally, we demonstrate that refolding time and a secondary thermal shift assay buffer screen are critical factors for improving refolding efficiency.

  11. Large-scale systematic analysis of 2D fingerprint methods and parameters to improve virtual screening enrichments.

    Science.gov (United States)

    Sastry, Madhavi; Lowrie, Jeffrey F; Dixon, Steven L; Sherman, Woody

    2010-05-24

    A systematic virtual screening study on 11 pharmaceutically relevant targets has been conducted to investigate the interrelation between 8 two-dimensional (2D) fingerprinting methods, 13 atom-typing schemes, 13 bit scaling rules, and 12 similarity metrics using the new cheminformatics package Canvas. In total, 157 872 virtual screens were performed to assess the ability of each combination of parameters to identify actives in a database screen. In general, fingerprint methods, such as MOLPRINT2D, Radial, and Dendritic that encode information about local environment beyond simple linear paths outperformed other fingerprint methods. Atom-typing schemes with more specific information, such as Daylight, Mol2, and Carhart were generally superior to more generic atom-typing schemes. Enrichment factors across all targets were improved considerably with the best settings, although no single set of parameters performed optimally on all targets. The size of the addressable bit space for the fingerprints was also explored, and it was found to have a substantial impact on enrichments. Small bit spaces, such as 1024, resulted in many collisions and in a significant degradation in enrichments compared to larger bit spaces that avoid collisions.

  12. Evaluation of the usefulness of visceral fat area measurement by the bioelectrical impedance method during workplace health screening

    International Nuclear Information System (INIS)

    Igarashi, Chiyo

    2008-01-01

    In the field of occupational health, health guidance concerning obesity is often conducted in order to prevent lifestyle-related diseases. With recent awareness of the concept of metabolic syndrome, measurement of the visceral fat area (VFA) by CT has been useful for health guidance, but it is difficult in workplace health screening. Presently, the BMI (Body Mass Index), body fat percentage measured by the bioelectrical impedance method, and waist girth at the umbilical level (abdominal girth) are practical indices of obesity used in such health screening. In this study, VAF was measured in 590 clerical or sales workers in the manufacturing industry using a body fat meter capable of a visceral fat measurement by the bioelectrical impedance method. The relationship of this value to the results of biochemical tests and lifestyle was then evaluated using analysis of covariance structures. Analysis indicated that the risk of lifestyle-related disease was closely related to the degree of obesity. Among indices of the degree of obesity, VFA was more closely related than BMI or body fat percentage, and only slightly less closely related than abdominal girth to the risk of lifestyle-related diseases. Since VFA is effective in screening for latent obesity, health guidance based on digital data, and the subjects' body imaging, its measurement by the bioelectrical impedance method is considered useful for workplace health management. (author)

  13. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening.

    Science.gov (United States)

    Köferle, Anna; Worf, Karolina; Breunig, Christopher; Baumann, Valentin; Herrero, Javier; Wiesbeck, Maximilian; Hutter, Lukas H; Götz, Magdalena; Fuchs, Christiane; Beck, Stephan; Stricker, Stefan H

    2016-11-14

    The bacterial CRISPR system is fast becoming the most popular genetic and epigenetic engineering tool due to its universal applicability and adaptability. The desire to deploy CRISPR-based methods in a large variety of species and contexts has created an urgent need for the development of easy, time- and cost-effective methods enabling large-scale screening approaches. Here we describe CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a method for the generation of comprehensive gRNA libraries for CRISPR-based screens. CORALINA gRNA libraries can be derived from any source of DNA without the need of complex oligonucleotide synthesis. We show the utility of CORALINA for human and mouse genomic DNA, its reproducibility in covering the most relevant genomic features including regulatory, coding and non-coding sequences and confirm the functionality of CORALINA generated gRNAs. The simplicity and cost-effectiveness make CORALINA suitable for any experimental system. The unprecedented sequence complexities obtainable with CORALINA libraries are a necessary pre-requisite for less biased large scale genomic and epigenomic screens.

  14. Comparison of three radiographic methods in screening of temporomandibular joint involvement in patients with psoriatic arthritis

    International Nuclear Information System (INIS)

    Koenoenen, M.; Kilpinen, E.

    1990-01-01

    Fifty-three randomly selected subjects with psoriatic arthritis (PA) were examined radiographically by means of orthopantomography, transcranial radiography, and transmaxillary radiography. Two examiners graded the radiographic signs of flattening, osteophytes, erosion, and sclerosis. The findings obtained were then compared to determine the best technique for screening of temporomandibular joint (TMJ) bone changes. Together the techniques showed definite (24%) and possible (6%) changes, suggesting TMJ involvement in 31 of 106 joints. In all projections, radiographic signs suggesting TMJ involvement were most frequent in the condyle. Erosion in the condyle was the most frequent finding. Agreement with regard to definite changes in the condyle was found in only one-third to half of the cases. It is concluded that in radiography of the TMJ in subjects with PA, a combination of radiographic techniques should be used to obtain maximum information. However, orthopantomography is well suited for screening of TMJ involvement in subjects with PA. 30 refs., 2 figs., 3 tabs

  15. Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

    2010-01-01

    We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

  16. Multiparameter telemetry as a sensitive screening method to detect vaccine reactogenicity in mice.

    Directory of Open Access Journals (Sweden)

    Margarete Arras

    Full Text Available Refined vaccines and adjuvants are urgently needed to advance immunization against global infectious challenges such as HIV, hepatitis C, tuberculosis and malaria. Large-scale screening efforts are ongoing to identify adjuvants with improved efficacy profiles. Reactogenicity often represents a major hurdle to the clinical use of new substances. Yet, irrespective of its importance, this parameter has remained difficult to screen for, owing to a lack of sensitive small animal models with a capacity for high throughput testing. Here we report that continuous telemetric measurements of heart rate, heart rate variability, body core temperature and locomotor activity in laboratory mice readily unmasked systemic side-effects of vaccination, which went undetected by conventional observational assessment and clinical scoring. Even minor aberrations in homeostasis were readily detected, ranging from sympathetic activation over transient pyrogenic effects to reduced physical activity and apathy. Results in real-time combined with the potential of scalability and partial automation in the industrial context suggest multiparameter telemetry in laboratory mice as a first-line screen for vaccine reactogenicity. This may accelerate vaccine discovery in general and may further the success of vaccines in combating infectious disease and cancer.

  17. The SOBANE risk management strategy and the Déparis method for the participatory screening of the risks.

    Science.gov (United States)

    Malchaire, J B

    2004-08-01

    The first section of the document describes a risk-prevention strategy, called SOBANE, in four levels: screening, observation, analysis and expertise. The aim is to make risk prevention faster, more cost effective, and more effective in coordinating the contributions of the workers themselves, their management, the internal and external occupational health (OH) practitioners and the experts. These four levels are: screening, where the risk factors are detected by the workers and their management, and obvious solutions are implemented; observation, where the remaining problems are studied in more detail, one by one, and the reasons and the solutions are discussed in detail; analysis, where, when necessary, an OH practitioner is called upon to carry out appropriate measurements to develop specific solutions; expertise, where, in very sophisticated and rare cases, the assistance of an expert is called upon to solve a particular problem. The method for the participatory screening of the risks (in French: Dépistage Participatif des Risques), Déparis, is proposed for the first level screening of the SOBANE strategy. The work situation is systematically reviewed and all the aspects conditioning the easiness, the effectiveness and the satisfaction at work are discussed, in search of practical prevention measures. The points to be studied more in detail at level 2, observation, are identified. The method is carried out during a meeting of key workers and technical staff. The method proves to be simple, sparing in time and means and playing a significant role in the development of a dynamic plan of risk management and of a culture of dialogue in the company.

  18. Measurement and account method for the available standing time of a smoke screen applying the diffusion equation

    Energy Technology Data Exchange (ETDEWEB)

    Chen-Guang, Zhu; Gong-Pei, Pan; Xiao-Yun, Wu; Hua, Guan [308, School of Chemical Engineering, Nanjing University of Science and Technology, 210094 (China)

    2006-06-15

    The available shielding area of a smoke screen is an important parameter to evaluate its protection capability. It varies with time according to a parabola equation, which could be obtained by the diffusion equation and a few measured data. The available standing time which could satisfy the request of rating area can be calculated. The process of deriving the equation, the experimental procedure and the method of data collecting and processing is presented in detail in this paper. The calculated result is compared with engineering experience to verify the method. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  19. Radioimmunoassay of alpha-foetoprotein in the eluate of dried blood. A method for antenatal screening of neural tube defects

    International Nuclear Information System (INIS)

    Travert, G.; Herlicoviez, M.; Laroche, D.

    1979-01-01

    A radioimmunoassay for alpha-foetoprotein (AFP) in dried blood spots is reported. The main technical characteristics (reproducibility, sensitivity, recovery of exogenous AFP added and AFP stability in dried blood) are evaluated. They indicate that this method is feasible and well adapted to AFP measurement during pregnancy. AFP determination in maternal serum allows early detection of at least 80% of neural tube defects. The use of dried blood spots as samples for AFP assay makes our method a possible mass screening test for these malformations, which occur with an incidence of 12 for 10,000 [fr

  20. Optimization of TRPV6 Calcium Channel Inhibitors Using a 3D Ligand-Based Virtual Screening Method.

    OpenAIRE

    Simonin Céline; Awale Mahendra; Brand Michael; van Deursen Ruud; Schwartz Julian; Fine Michael; Kovacs Gergely; Häfliger Pascal; Gyimesi Gergely; Sithampari Abilashan; Charles Roch-Philippe; Hediger Matthias A; Reymond Jean-Louis

    2015-01-01

    Herein we report the discovery of the first potent and selective inhibitor of TRPV6 a calcium channel overexpressed in breast and prostate cancer and its use to test the effect of blocking TRPV6 mediated Ca(2+) influx on cell growth. The inhibitor was discovered through a computational method xLOS a 3D shape and pharmacophore similarity algorithm a type of ligand based virtual screening (LBVS) method described briefly here. Starting with a single weakly active seed molecule two successive rou...

  1. A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

    Science.gov (United States)

    Zhang, Qingyang

    2018-05-16

    Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

  2. Electron screening effects in (p,α) reactions induced on boron isotopes studied via the Trojan Horse Method

    International Nuclear Information System (INIS)

    Lamia, L; Spitaleri, C; Cherubini, S; Gulino, M; Puglia, S M R; Rapisarda, G G; Romano, S; Sergi, M L; Carlin, N; Gameiro Munhoz, M; Gimenez Del Santo, M; Kiss, G G; Somorjai, E; Kroha, V; Kubono, S; La Cognata, M; Pizzone, R G; Li, C; Wen, Qungang; Mukhamedzhanov, A

    2013-01-01

    The Trojan Horse Method is a powerful indirect technique allowing one to measure the bare nucleus S(E)-factor and the electron screening potential for astrophysically relevant reactions without the needs of extrapolations. The case of the (p,α) reactions induced on the two boron isotopes 10,11 B is here discussed in view of the recent Trojan Horse (TH) applications to the quasi-free 10,11 B+ 2 H reactions. The comparison between the TH and the low-energy direct data allowed us to determine the electron screening potential for the 11 B(p,α) reaction, while preliminary results on the 10 B(p,α) reaction have been extracted.

  3. DETECTION OF MICROVASCULAR COMPLICATIONS OF TYPE 2 DIABETES BY EZSCAN AND ITS COMPARISON WITH STANDARD SCREENING METHODS

    Directory of Open Access Journals (Sweden)

    Sarita Bajaj

    2016-08-01

    Full Text Available BACKGROUND EZSCAN is a new, noninvasive technique to detect sudomotor dysfunction and thus neuropathy in diabetes patients at an early stage. It further predicts chances of development of other microvascular complications. In this study, we evaluated EZSCAN for detection of microvascular complications in Type 2 diabetes patients and compared accuracy of EZSCAN with standard screening methods. MATERIALS AND METHODS 104 known diabetes patients, 56 males and 48 females, were studied. All cases underwent the EZSCAN test, Nerve Conduction Study (NCS test, Vibration perception threshold test (VPT, Monofilament test, Fundus examination and Urine micral test. The results of EZSCAN were compared with standard screening methods. The data has been analysed and assessed by applying appropriate statistical tests within different groups. RESULTS Mean age of the subjects was 53.5 ± 11.4 years. For detection of diabetic neuropathy, sensitivity and specificity of EZSCAN was found to be 77.0 % and 95.3%, respectively. Odd’s ratio (OR was 68.82 with p < 0.0001. AUC in ROC curve was 0.930. Sensitivity and specificity of EZSCAN for detection of nephropathy were 67.1% and 94.1%, respectively. OR = 32.69 with p < 0.0001. AUC was 0.926. Sensitivity of EZSCAN for detection of retinopathy was 90% while specificity is 70.3%. OR = 21.27; p< 0.0001. AUC came out to be 0.920. CONCLUSION Results of EZSCAN test compared significantly to the standard screening methods for the detection of microvascular complications of diabetes and can be used as a simple, noninvasive and quick method to detect microvascular complications of diabetes.

  4. A combined enrichment/polymerase chain reaction based method for the routine screening of Streptococcus agalactiae in pregnant women

    Directory of Open Access Journals (Sweden)

    F.M. Munari

    2012-03-01

    Full Text Available Group B Streptococcus (GBS is the most common cause of life-threatening infection in neonates. Guidelines from CDC recommend universal screening of pregnant women for rectovaginal GBS colonization. The objective of this study was to compare the performance of a combined enrichment/PCR based method targeting the atr gene in relation to culture using enrichment with selective broth medium (standard method to identify the presence of GBS in pregnant women. Rectovaginal GBS samples from women at ≥36 weeks of pregnancy were obtained with a swab and analyzed by the two methods. A total of 89 samples were evaluated. The prevalence of positive results for GBS detection was considerable higher when assessed by the combined enrichment/PCR method than with the standard method (35.9% versus 22.5%, respectively. The results demonstrated that the use of selective enrichment broth followed by PCR targeting the atr gene is a highly sensitive, specific and accurate test for GBS screening in pregnant women, allowing the detection of the bacteria even in lightly colonized patients. This PCR methodology may provide a useful diagnostic tool for GBS detection and contributes for a more accurate and effective intrapartum antibiotic and lower newborn mortality and morbidity.

  5. Pre-screening method for somatic cell contamination in human sperm epigenetic studies.

    Science.gov (United States)

    Jenkins, Timothy G; Liu, Lihua; Aston, Kenneth I; Carrell, Douglas T

    2018-04-01

    Sperm epigenetic profiles are frequently studied and are of great interest in many fields. One major technical concern when assessing these marks is the potential for somatic cell contamination. Because somatic cells have dramatically different epigenetic signatures, even small levels of contamination can result in significant problems in analysis and interpretation of data. In this study we evaluate an assay, which we designed to offer a reliable 'pre-screen' for somatic cell contamination that directly assesses the DNA being used in the study to determine tissue purity. In brief, we designed an inexpensive and simple assay that utilizes the strong differential methylation between sperm and somatic cells at four genomic loci to assess the general purity of samples prior to performing expensive and time intensive assays. The assay is able to reliably detect contamination qualitatively by running the sample on an agarose gel, or quantitatively with the use of a bioanalyzer. With this technique we have found that we can detect potentially contaminating signals in samples of many different types, including those from patients with poor sperm phenotypes (oligozoospermia, asthenozoospermia, and teratozoospermia). We also have found that the use of multiple sites to determine potential contamination is key, as some conditions (asthenozoospermia specifically) appear at one site to reflect a somatic-like profile, while at all other sites it appears to have very typical sperm DNA methylation signatures. Taken together, the use of the assay described herein was effective at identifying contamination and could be implemented in many labs to quickly and inexpensively pre-screen samples prior to performing far more expensive and labor intensive procedures. Additionally, the principles applied to the development of this assay could be easily adapted for the development of other assays to pre-screen different tissue/cell types or model organisms.

  6. Cost comparison of laboratory methods and four field screening technologies for uranium-contaminated soil

    International Nuclear Information System (INIS)

    Douthat, D.M.; Armstrong, A.Q.

    1994-01-01

    To address the problem of characterizing uranium-contaminated surface soil at federal facilities, the Department of Energy has the development of four uranium field screening technologies, under the direction of the Uranium-in-Soils Integrated Demonstration (USID) Program. These four technologies include: a long-range alpha detector a beta scintillation detector, an in situ gamma detector, and a mobile laser ablation-inductively coupled plasma/atomic emission spectrometry (LA-ICP/AES) laboratory. As part of the performance assessment for these field screening technologies, cost estimates for the development and operation of each technology were created. A cost study was conducted to compare three of the USID field screening technologies to the use of traditional field surveying equipment to adequately characterize surface soils of a one-acre site. The results indicate that the use of traditional equipment costs more than the in situ gamma detector, but less than the beta scintillation detector and LRAD. The use of traditional field surveying equipment results in cost savings of 4% and 34% over the use of the beta scintillation and LRAD technologies, respectively. A study of single-point surface soil sampling and laboratory analysis costs was also conducted. Operational costs of the mobile LA-ICP/AES laboratory were compared with operational costs of traditional sampling and analysis, which consists of collecting soil samples and conducting analysis in a radiochemical laboratory. The cost study indicates that the use of the mobile LA-ICP/AES laboratory results in cost savings of 23% and 40% over traditional field sampling and laboratory analysis conducted by characterization groups at two DOE facilities

  7. An improved single cell ultrahigh throughput screening method based on in vitro compartmentalization.

    Directory of Open Access Journals (Sweden)

    Fuqiang Ma

    Full Text Available High-throughput screening is a key technique in discovery and engineering of enzymes. In vitro compartmentalization based fluorescence-activated cell sorting (IVC-FACS has recently emerged as a powerful tool for ultrahigh-throughput screening of biocatalysts. However, the accuracy of current IVC-FACS assays is severely limited by the wide polydispersity of micro-reactors generated by homogenizing. Here, an improved protocol based on membrane-extrusion technique was reported to generate the micro-reactors in a more uniform manner. This crucial improvement enables ultrahigh-throughput screening of enzymatic activity at a speed of >10⁸ clones/day with an accuracy that could discriminate as low as two-fold differences in enzymatic activity inside the micro-reactors, which is higher than similar IVC-FACS systems ever have reported. The enzymatic reaction in the micro-reactors has very similar kinetic behavior compared to the bulk reaction system and shows wide dynamic range. By using the modified IVC-FACS, E. coli cells with esterase activity could be enriched 330-fold from large excesses of background cells through a single round of sorting. The utility of this new IVC-FACS system was further illustrated by the directed evolution of thermophilic esterase AFEST. The catalytic activity of the very efficient esterase was further improved by ∼2-fold, resulting in several improved mutants with k(cat/K(M values approaching the diffusion-limited efficiency of ∼10⁸ M⁻¹s⁻¹.

  8. A tree based method for the rapid screening of chemical fingerprints

    DEFF Research Database (Denmark)

    Kristensen, Thomas Greve; Nielsen, Jesper; Pedersen, Christian Nørgaard Storm

    2009-01-01

    The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules......: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds...

  9. Screening of various botanical extracts for antioxidant activity using DPPH free radical method.

    Science.gov (United States)

    Waqas, Muhammad Khurram; Saqib, Najam-Us; Rashid, Saeed-Ur; Shah, Pervaiz Akhtar; Akhtar, Naveed; Murtaza, Ghulam

    2013-01-01

    Aiming at the exploration of herbal use by society, crude extracts of the seeds of some commonly used medicinal plants (Vitis vinifera, Tamarindus indica and Glycin max) were screened for their free radical scavenging properties using ascorbic acid as standard antioxidant. Free radical scavenging activity was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical. The overall antioxidant activity of grape seeds (Vitis vinifera) was the strongest, followed in descending order by soybean (Glycin max) and tamarind (Tamarindus indica). The seeds extract of Vitis vinifera, Glycin max and Tamarindus indica showed 85.61%, 83.45% and 79.26%, DPPH scavenging activity respectively.

  10. On the Evaluation Overlap Integrals with the Same and Different Screening Parameters Over Slater Type Orbitals via the Fourier-Transform Method

    International Nuclear Information System (INIS)

    Yavuz, M.; Yuekcue, N.; Oeztekin, E.; Yilmaz, H.; Doenduer, S.

    2005-01-01

    In this paper, derivation of analytical expressions for overlap integrals with the same and different screening parameters of Slater type orbitals (STOs) via the Fourier-transform method is presented. Consequently, it is relatively easy to express the Fourier integral representations of the overlap integrals with same and different screening parameters mentioned as finite sums of Gegenbauer, Gaunt, binomial coefficients, and STOs.

  11. A rapid screening-level method to optimize location of infiltration ponds.

    Science.gov (United States)

    Fennemore, G G; Davis, A; Goss, L; Warrick, A W

    2001-01-01

    A rapid-screening technique was developed to identify lithologies that best disperse artificial recharge via surface infiltration and minimize effects on ground water chemistry. The technique prospectively evaluates basin infiltration rates and water chemistry influences by integrating geotechnical, hydraulic, and water quality data with column test data and numerical modeling. The technique was validated using field data collected from surface infiltration basins designed to recharge ground water pumped from the Pipeline pit gold mine in Nevada. Observed recharge rates at these infiltration sites correlated most significantly with depth to groundwater, with basins in coarse-grained lithologies performing better (0.45 to 0.85 m/day) than those with fine-grained layers ( 2000 mg/L) than coarse-grained soils (infiltration basins for a variety of lithologies. Sites for infiltration basins can be rapidly screened to include areas with greatest depth to groundwater and in coarsest alluvial sediments, and impact to ground water chemistry can be reliably predicted using computer modeling and column test results.

  12. An unbiased method to build benchmarking sets for ligand-based virtual screening and its application to GPCRs.

    Science.gov (United States)

    Xia, Jie; Jin, Hongwei; Liu, Zhenming; Zhang, Liangren; Wang, Xiang Simon

    2014-05-27

    Benchmarking data sets have become common in recent years for the purpose of virtual screening, though the main focus had been placed on the structure-based virtual screening (SBVS) approaches. Due to the lack of crystal structures, there is great need for unbiased benchmarking sets to evaluate various ligand-based virtual screening (LBVS) methods for important drug targets such as G protein-coupled receptors (GPCRs). To date these ready-to-apply data sets for LBVS are fairly limited, and the direct usage of benchmarking sets designed for SBVS could bring the biases to the evaluation of LBVS. Herein, we propose an unbiased method to build benchmarking sets for LBVS and validate it on a multitude of GPCRs targets. To be more specific, our methods can (1) ensure chemical diversity of ligands, (2) maintain the physicochemical similarity between ligands and decoys, (3) make the decoys dissimilar in chemical topology to all ligands to avoid false negatives, and (4) maximize spatial random distribution of ligands and decoys. We evaluated the quality of our Unbiased Ligand Set (ULS) and Unbiased Decoy Set (UDS) using three common LBVS approaches, with Leave-One-Out (LOO) Cross-Validation (CV) and a metric of average AUC of the ROC curves. Our method has greatly reduced the "artificial enrichment" and "analogue bias" of a published GPCRs benchmarking set, i.e., GPCR Ligand Library (GLL)/GPCR Decoy Database (GDD). In addition, we addressed an important issue about the ratio of decoys per ligand and found that for a range of 30 to 100 it does not affect the quality of the benchmarking set, so we kept the original ratio of 39 from the GLL/GDD.

  13. Comparing different methods for fast screening of microbiological quality of beach sand aimed at rapid-response remediation.

    Science.gov (United States)

    Testolin, Renan C; Almeida, Tito C M; Polette, Marcus; Branco, Joaquim O; Fischer, Larissa L; Niero, Guilherme; Poyer-Radetski, Gabriel; Silva, Valéria C; Somensi, Cleder A; Corrêa, Albertina X R; Corrêa, Rogério; Rörig, Leonardo R; Itokazu, Ana Gabriela; Férard, Jean-François; Cotelle, Sylvie; Radetski, Claudemir M

    2017-05-15

    There is scientific evidence that beach sands are a significant contributor to the pathogen load to which visitors are exposed. To develop beach quality guidelines all beach zones must be included in microbiological evaluations, but monitoring methods for beach sand quality are relatively longstanding, expensive, laborious and require moderate laboratory infrastructure. This paper aimed to evaluate the microorganism activity in different beach zones applying and comparing a classical method of membrane filtration (MF) with two colorimetric screening methods based on fluorescein (FDA) and tetrazolium (TTC) salt biotransformation to evaluate a new rapid and low-cost method for beach sand microbiological contamination assessments. The colorimetric results can help beach managers to evaluate rapidly and at low cost the microbiological quality of different beach zones in order to decide whether remedial actions need to be adopted to prevent exposure of the public to microbes due to beach sand and/or water contamination. Copyright © 2017. Published by Elsevier Ltd.

  14. Toxic Cyanobacteria in Svalbard: Chemical Diversity of Microcystins Detected Using a Liquid Chromatography Mass Spectrometry Precursor Ion Screening Method

    Directory of Open Access Journals (Sweden)

    Julia Kleinteich

    2018-04-01

    Full Text Available Cyanobacteria synthesize a large variety of secondary metabolites including toxins. Microcystins (MCs with hepato- and neurotoxic potential are well studied in bloom-forming planktonic species of temperate and tropical regions. Cyanobacterial biofilms thriving in the polar regions have recently emerged as a rich source for cyanobacterial secondary metabolites including previously undescribed congeners of microcystin. However, detection and detailed identification of these compounds is difficult due to unusual sample matrices and structural congeners produced. We here report a time-efficient liquid chromatography-mass spectrometry (LC-MS precursor ion screening method that facilitates microcystin detection and identification. We applied this method to detect six different MC congeners in 8 out of 26 microbial mat samples of the Svalbard Archipelago in the Arctic. The congeners, of which [Asp3, ADMAdda5, Dhb7] MC-LR was most abundant, were similar to those reported in other polar habitats. Microcystins were also determined using an Adda-specific enzyme-linked immunosorbent assay (Adda-ELISA. Nostoc sp. was identified as a putative toxin producer using molecular methods that targeted 16S rRNA genes and genes involved in microcystin production. The mcy genes detected showed highest similarities to other Arctic or Antarctic sequences. The LC-MS precursor ion screening method could be useful for microcystin detection in unusual matrices such as benthic biofilms or lichen.

  15. [Multi-residue method for screening of pesticides in crops by liquid chromatography with tandem mass spectrometry].

    Science.gov (United States)

    Tanizawa, Haruna; Shima, Mikie; Ikehara, Chieko; Kobata, Masakazu; Sato, Motoaki

    2005-10-01

    A simple and rapid method was developed for the screening of 82 pesticides/metabolites in a wide variety of crops, using solid-phase extraction and liquid chromatography with tandem mass spectrometry (LC/MS/MS). After extraction with methanol, the filtered extracts were made up to 100 mL and a 2 mL aliquot was subjected to solid-phase extraction. Co-extractives were removed with a C18 mini-column, while pesticides were retained on 3 kinds of mini-columns (HLB, SAX, activated carbon), and then eluted with acetonitrile. Analysis was performed by LC/MS/MS, and MS acquisition parameters were established in positive and negative ESI modes. The utility of the method was demonstrated by the analysis of 6 crops (carrot, cabbage, onion, spinach, lemon, brown rice) and one mixed vegetable juice. Of 82 compounds tested, 75 in carrot and 62 in lemon were obtained with recoveries ranging from 70-120%. For all samples tested, 75 compounds could be obtained with recoveries of over 50%, and the detection limits of most compounds were lower than 0.01 microg/g. This method provides acceptable performance for analysis of these 75 compounds. Further, by using aliquots of the extracts with small-scale mini-columns, purified samples could be obtained. This proposed method with small matrix effects, is effective and suitable for screening of multiple residual pesticides by using LC/MS/MS.

  16. A gas/liquid chromatographic-mass spectrometric method for the rapid screening of 250 pesticides in aqueous matrices

    Energy Technology Data Exchange (ETDEWEB)

    Chandramouli, B.; Harvan, D.; Brittain, S.; Hass, R. [Eno River Labs, LLC. Durham, NC (United States)

    2004-09-15

    Pesticide residues in food present a potentially serious and significant cause for concern. Many pesticides have been associated with significant health effects to the nervous and endocrine systems and some have been deemed carcinogenic. There are many well-established techniques for pesticide analysis. However, commercial pesticide methods have traditionally only been available for specific pesticide families, such as chlorinated pesticides or herbicides, and at detection limits ranging from 0.05 ppb to 1 ppm in aqueous matrices. Techniques that can quickly screen for the presence/absence of pesticide residues in food matrices are critical in ensuring the safety of food and water. This paper outlines a combined Gas Chromatographic-High Resolution Mass Spectrometric (GC-HRMS) and Liquid Chromatographic Tandem Mass Spectrometric (LC-MS/MS) screening assay for 250 pesticides that was developed for use in water, and soda samples at screening levels ranging from 0.1-5 ppb. The pesticides selected have been identified by the European Union as being of concern and the target of possible legislation. The list encompasses a variety of pesticide classes and compound groupings.

  17. Nontargeted Screening Method for Illegal Additives Based on Ultrahigh-Performance Liquid Chromatography-High-Resolution Mass Spectrometry.

    Science.gov (United States)

    Fu, Yanqing; Zhou, Zhihui; Kong, Hongwei; Lu, Xin; Zhao, Xinjie; Chen, Yihui; Chen, Jia; Wu, Zeming; Xu, Zhiliang; Zhao, Chunxia; Xu, Guowang

    2016-09-06

    Identification of illegal additives in complex matrixes is important in the food safety field. In this study a nontargeted screening strategy was developed to find illegal additives based on ultrahigh-performance liquid chromatography-high-resolution mass spectrometry (UHPLC-HRMS). First, an analytical method for possible illegal additives in complex matrixes was established including fast sample pretreatment, accurate UHPLC separation, and HRMS detection. Second, efficient data processing and differential analysis workflow were suggested and applied to find potential risk compounds. Third, structure elucidation of risk compounds was performed by (1) searching online databases [Metlin and the Human Metabolome Database (HMDB)] and an in-house database which was established at the above-defined conditions of UHPLC-HRMS analysis and contains information on retention time, mass spectra (MS), and tandem mass spectra (MS/MS) of 475 illegal additives, (2) analyzing fragment ions, and (3) referring to fragmentation rules. Fish was taken as an example to show the usefulness of the nontargeted screening strategy, and six additives were found in suspected fish samples. Quantitative analysis was further carried out to determine the contents of these compounds. The satisfactory application of this strategy in fish samples means that it can also be used in the screening of illegal additives in other kinds of food samples.

  18. Development of a test of suprathreshold acuity in noise in Brazilian Portuguese: a new method for hearing screening and surveillance.

    Science.gov (United States)

    Vaez, Nara; Desgualdo-Pereira, Liliane; Paglialonga, Alessia

    2014-01-01

    This paper describes the development of a speech-in-noise test for hearing screening and surveillance in Brazilian Portuguese based on the evaluation of suprathreshold acuity performances. The SUN test (Speech Understanding in Noise) consists of a list of intervocalic consonants in noise presented in a multiple-choice paradigm by means of a touch screen. The test provides one out of three possible results: "a hearing check is recommended" (red light), "a hearing check would be advisable" (yellow light), and "no hearing difficulties" (green light) (Paglialonga et al., Comput. Biol. Med. 2014). This novel test was developed in a population of 30 normal hearing young adults and 101 adults with varying degrees of hearing impairment and handicap, including normal hearing. The test had 84% sensitivity and 76% specificity compared to conventional pure-tone screening and 83% sensitivity and 86% specificity to detect disabling hearing impairment. The test outcomes were in line with the degree of self-perceived hearing handicap. The results found here paralleled those reported in the literature for the SUN test and for conventional speech-in-noise measures. This study showed that the proposed test might be a viable method to identify individuals with hearing problems to be referred to further audiological assessment and intervention.

  19. Development of a Test of Suprathreshold Acuity in Noise in Brazilian Portuguese: A New Method for Hearing Screening and Surveillance

    Directory of Open Access Journals (Sweden)

    Nara Vaez

    2014-01-01

    Full Text Available This paper describes the development of a speech-in-noise test for hearing screening and surveillance in Brazilian Portuguese based on the evaluation of suprathreshold acuity performances. The SUN test (Speech Understanding in Noise consists of a list of intervocalic consonants in noise presented in a multiple-choice paradigm by means of a touch screen. The test provides one out of three possible results: “a hearing check is recommended” (red light, “a hearing check would be advisable” (yellow light, and “no hearing difficulties” (green light (Paglialonga et al., Comput. Biol. Med. 2014. This novel test was developed in a population of 30 normal hearing young adults and 101 adults with varying degrees of hearing impairment and handicap, including normal hearing. The test had 84% sensitivity and 76% specificity compared to conventional pure-tone screening and 83% sensitivity and 86% specificity to detect disabling hearing impairment. The test outcomes were in line with the degree of self-perceived hearing handicap. The results found here paralleled those reported in the literature for the SUN test and for conventional speech-in-noise measures. This study showed that the proposed test might be a viable method to identify individuals with hearing problems to be referred to further audiological assessment and intervention.

  20. Non-invasive method for screening and early detection of breast tumors using thermal field analysis

    Directory of Open Access Journals (Sweden)

    O. Drosu

    2009-10-01

    Full Text Available The paper refers to general presentation of international and European evaluation regarding breast cancer incidence and mortality as well as recommendations for prevention, screening, detection and treatment.The past years international research development in biomedical engineering has put a particular emphasis on the thermography use in breast pathology diagnosis and its main advantages, such as: an early diagnose of the breast cancer, in that stage when the mammography or ultrasounds can not easily detect the changes of the tissue; a totally non-invasive interaction with human body; very low costs and possibilities for the women to do a self thermographic test.We also present some important results of our research within the field of breast tumor detection using the numerical analysis of the thermal inverse problem.

  1. Buccal swab, a minimally invasive method for the screening of oral cancer in active smokers

    Science.gov (United States)

    Suyatmi; Subiyantoro, P.; Indrakila, S.

    2018-05-01

    Smoking is the main risk factor for developing oral cancer. The previous study showed that there was a strong correlation between the length of smoking with the risk to develop oral cancer. Early detection of epithelial changes of oral mucosa will be a good prevention of the incidence of oral cancer among active smokers. This study evaluated the potential use of buccal swab for the screening of early signs of malignancy in active smokers. This study involved 80 participants including those who were smokers and non smokers. The buccal swab was conducted using sterile cytobrush. An epithelial smear was made from the buccal swab and stained with Papanicolaou’s technique. An cytomorphometric analysis was conducted by comparing the ratio of nuclear cell to cytoplasmic diameter (ND/CD) between the two groups. The mean of ND observed in this study were 8.963µ for active smokers and 7.991µ for non smokers groups. While the mean of CD were 58.249µ and 63.473µ for active smoker and non-smoker respectively. The mean of ND/CD ratio were 0.156 for active smokers and 0.129 for non smokers groups. This study detected a significant difference on the ND/CD ratio among active smokers vs non smokers (p<0.0001 95% CI = -0.040 – -0.014). In conclusion buccal swab could be a routine procedure to obtain sample for identification of changes in cells morphology to screen an early development of oral cancer.

  2. An approximate-reasoning-based method for screening flammable gas tanks

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-03-01

    High-level waste (HLW) produces flammable gases as a result of radiolysis and thermal decomposition of organics. Under certain conditions, these gases can accumulate within the waste for extended periods and then be released quickly into the dome space of the storage tank. As part of the effort to reduce the safety concerns associated with flammable gas in HLW tanks at Hanford, a flammable gas watch list (FGWL) has been established. Inclusion on the FGWL is based on criteria intended to measure the risk associated with the presence of flammable gas. It is important that all high-risk tanks be identified with high confidence so that they may be controlled. Conversely, to minimize operational complexity, the number of tanks on the watchlist should be reduced as near to the true number of flammable risk tanks as the current state of knowledge will support. This report presents an alternative to existing approaches for FGWL screening based on the theory of approximate reasoning (AR) (Zadeh 1976). The AR-based model emulates the inference process used by an expert when asked to make an evaluation. The FGWL model described here was exercised by performing two evaluations. (1) A complete tank evaluation where the entire algorithm is used. This was done for two tanks, U-106 and AW-104. U-106 is a single shell tank with large sludge and saltcake layers. AW-104 is a double shell tank with over one million gallons of supernate. Both of these tanks had failed the screening performed by Hodgson et al. (2) Partial evaluations using a submodule for the predictor likelihood for all of the tanks on the FGWL that had been flagged previously by Whitney (1995)

  3. Screen printing as a holistic manufacturing method for multifunctional microsystems and microreactors

    International Nuclear Information System (INIS)

    Bejarano, D; Lozano, P; Mata, D; Cito, S; Constantí, M; Katakis, I

    2009-01-01

    Microsystems are commonly manufactured by photolithographic or injection moulding techniques in a variety of realizations and on almost any material. A perennial problem in the manufacturing of microsystems is the difficulty to obtain hybrid devices that incorporate distinct materials with different functionalities. In most of the cases, cumbersome prototyping and high investment needed for manufacturing are additional problems that add to the cost of the final product. Such drawbacks are true not only for lab-on-a-chip but also for certain microreactor applications. Most importantly, in many commercial applications where an intermediate product between full fluidics control and a 'strip' is needed, such restraints prohibit the feasibility of reduction to practice. Screen printing on the other hand is a low cost technique that has been used for years in mass producing two-dimensional low cost reproductions of a mask pattern for circuits and art incorporates prototyping in production and allows the use of an almost limitless variety of materials as 'inks'. In this work it is demonstrated that taking advantage of the deposited ink's three-dimensional nature, screen printing can be used as a versatile and low cost technique for the fabrication of microchannels. Microchannels with dimensions in the order of 100 µm were fabricated that could readily incorporate functionalities through the choice of the materials used to create the microstructure. Variables have been investigated through a factorial experimental design as important process parameters that affect the resolution and print thickness of the resulting microchannels that incorporate electroactive elements. Such studies can lead to the optimization of the process for custom applications

  4. Photochemical binding of photoallergens to human serum albumin: a simple in vitro method for screening potential photoallergens

    International Nuclear Information System (INIS)

    Barratt, M.D.; Brown, K.R.

    1985-01-01

    A simple procedure employing UV spectroscopy is described for testing the ability of chemicals to form covalent conjugates with proteins after irradiation with the appropriate wavelength of light. A range of known photoallergens of widely differing structure has been tested using this procedure; results of these experiments, together with evidence from the scientific literature, provide a correlation between compounds known to be photoallergens and their ability to form covalent conjugates with proteins on irradiation with the appropriate wavelength of light. The method is proposed as an in vitro screening procedure for potential photoallergens. (Auth.)

  5. Screening of a new cadmium hyperaccumulator, Galinsoga parviflora, from winter farmland weeds using the artificially high soil cadmium concentration method.

    Science.gov (United States)

    Lin, Lijin; Jin, Qian; Liu, Yingjie; Ning, Bo; Liao, Ming'an; Luo, Li

    2014-11-01

    A new method, the artificially high soil cadmium (Cd) concentration method, was used to screen for Cd hyperaccumulators among winter farmland weeds. Galinsoga parviflora was the most promising remedial plant among 5 Cd accumulators or hyperaccumulators. In Cd concentration gradient experiments, as soil Cd concentration increased, root and shoot biomass decreased, and their Cd contents increased. In additional concentration gradient experiments, superoxide dismutase and peroxidase activities increased with soil Cd concentrations up to 75 mg kg(-1) , while expression of their isoenzymes strengthened. Catalase (CAT) activity declined and CAT isoenzyme expression weakened at soil Cd concentrations less than 50 mg kg(-1) . The maxima of Cd contents in shoots and roots were 137.63 mg kg(-1) and 105.70 mg kg(-1) , respectively, at 100 mg kg(-1) Cd in soil. The root and shoot bioconcentration factors exceeded 1.0, as did the translocation factor. In a field experiment, total extraction of Cd by shoots was 1.35 mg m(-2) to 1.43 mg m(-2) at soil Cd levels of 2.04 mg kg(-1) to 2.89 mg kg(-1) . Therefore, the artificially high soil Cd concentration method was effective for screening Cd hyperaccumulators. Galinsoga parviflora is a Cd hyperaccumulator that could be used to efficiently remediate Cd-contaminated farmland soil. © 2014 SETAC.

  6. FSH to estradiol ratio can be used as screening method for mild cognitive impairment in postmenopausal women.

    Science.gov (United States)

    Hestiantoro, A; Wiwie, M; Shadrina, A; Ibrahim, N; Purba, J S

    2017-12-01

    To determine the role of anthropometric measurement, menopausal symptoms and biochemical marker changes as screening methods for mild cognitive impairment (MCI) in postmenopausal women Methods: A cross-sectional study included 282 postmenopausal women in Jakarta, further classified into two groups, with and without MCI. Some related variables such as age, body mass index (BMI), duration of menopause, vasomotor symptoms, hormone levels such as follicle stimulating hormone (FSH), luteinizing hormone, leptin, estradiol, and cognitive status, were assessed and analyzed. The FSH levels significantly correlated with MCI incidence (p = 0.018), along with the ratio of FSH/estradiol levels (p = 0.029) and ratio of FSH/soluble leptin receptor (p = 0.011), while other variables did not. By multivariate analysis, the ratio of FSH/estradiol was known as the most significant factor with a probability of having MCI in menopausal women of 1.15. Using the ROC curve, the threshold of the ratio FSH/estradiol to predict MCI was 1.94, with sensitivity 66.5% and specificity 46.8%. The ratio of FSH to estradiol (>1.94) can be used as a screening method for the occurrence of MCI in postmenopausal women.

  7. Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

    Science.gov (United States)

    Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

  8. A rapid fluorimetric screening method for the 1,4-benzodiazepines: Determination of their metabolite oxazepam in urine

    Energy Technology Data Exchange (ETDEWEB)

    Gil Tejedor, A.M. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain); Fernandez Hernando, P. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain)]. E-mail: pfhernando@ccia.uned.es; Durand Alegria, J.S. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain)

    2007-05-15

    Oxazepam is the major metabolite screened in urine samples for the evidence of the use of benzodiazepine drugs. The methods currently used, however, are laborious and time consuming. This paper proposes an oxazepam detection method based on its hydrolysis and cyclization - a reaction catalysed by cerium (IV) in an ortho-phosphoric acid-containing medium - to form 2-chloro-9(10H)-acridinone, a strongly fluorescent molecule. The variables involved in the hydrolysis and cyclization stages were optimised. Oxazepam was detectable in the 5-900 ng mL{sup -1} range, with a detection limit of 4.15 ng mL{sup -1} for k = 3. The method was successfully used for the determination of oxazepam in urine samples collected at different times after the oral administration of Valium[reg] and Tranxilium[reg].

  9. A rapid fluorimetric screening method for the 1,4-benzodiazepines: Determination of their metabolite oxazepam in urine

    International Nuclear Information System (INIS)

    Gil Tejedor, A.M.; Fernandez Hernando, P.; Durand Alegria, J.S.

    2007-01-01

    Oxazepam is the major metabolite screened in urine samples for the evidence of the use of benzodiazepine drugs. The methods currently used, however, are laborious and time consuming. This paper proposes an oxazepam detection method based on its hydrolysis and cyclization - a reaction catalysed by cerium (IV) in an ortho-phosphoric acid-containing medium - to form 2-chloro-9(10H)-acridinone, a strongly fluorescent molecule. The variables involved in the hydrolysis and cyclization stages were optimised. Oxazepam was detectable in the 5-900 ng mL -1 range, with a detection limit of 4.15 ng mL -1 for k = 3. The method was successfully used for the determination of oxazepam in urine samples collected at different times after the oral administration of Valium[reg] and Tranxilium[reg

  10. Application of Sweat Patch Screening for 16 Drugs and Metabolites Using a Fast and Highly Selective LC-MS/MS Method

    NARCIS (Netherlands)

    Koster, Remco A.; Alffenaar, Jan-Willem C.; Greijdanus, Ben; VanDerNagel, Joanneke E. L.; Uges, Donald R. A.

    Background: To facilitate the monitoring of drug abuse by patients, a method was developed and validated for fast and highly selective screening for amphetamine, methamphetamine, 3,4-methylenedioxymethamphetamine, methylenedioxyamphetamine, methylenedioxyethylamphetamine, methylphenidate, cocaine,

  11. A rapid quantification method for the screening indicator for β-thalassemia with near-infrared spectroscopy

    Science.gov (United States)

    Chen, Jiemei; Peng, Lijun; Han, Yun; Yao, Lijun; Zhang, Jing; Pan, Tao

    2018-03-01

    Near-infrared (NIR) spectroscopy combined with chemometrics was applied to rapidly analyse haemoglobin A2 (HbA2) for β-thalassemia screening in human haemolysate samples. The relative content indicator HbA2 was indirectly quantified by simultaneous analysis of two absolute content indicators (Hb and Hb • HbA2). According to the comprehensive prediction effect of the multiple partitioning of calibration and prediction sets, the parameters were optimized to achieve modelling stability, and the preferred models were validated using the samples not involved in modelling. Savitzky-Golay smoothing was firstly used for the spectral pretreatment. The absorbance optimization partial least squares (AO-PLS) was used to eliminate high-absorption wave-bands appropriately. The equidistant combination PLS (EC-PLS) was further used to optimize wavelength models. The selected optimal models were I = 856 nm, N = 16, G = 1 and F = 6 for Hb and I = 988 nm, N = 12, G = 2 and F = 5 for Hb • HbA2. Through independent validation, the root-mean-square errors and correlation coefficients for prediction (RMSEP, RP) were 3.50 g L- 1 and 0.977 for Hb and 0.38 g L- 1 and 0.917 for Hb • HbA2, respectively. The predicted values of relative percentage HbA2 were further calculated, and the calculated RMSEP and RP were 0.31% and 0.965, respectively. The sensitivity and specificity for β-thalassemia both reached 100%. Therefore, the prediction of HbA2 achieved high accuracy for distinguishing β-thalassemia. The local optimal models for single parameter and the optimal equivalent model sets were proposed, providing more models to match possible constraints in practical applications. The NIR analysis method for the screening indicator of β-thalassemia was successfully established. The proposed method was rapid, simple and promising for thalassemia screening in a large population.

  12. Q Sepharose micro-column chromatography: A simple screening method for identifying beta thalassemia traits and hemoglobin E carriers.

    Science.gov (United States)

    Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong

    2016-11-01

    For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  13. DEPIVIH 2: Use of three HIV testing methods in French primary care settings - ELISA laboratory screening versus two rapid point-of-care HIV tests.

    Science.gov (United States)

    Papadima, D; Gauthier, R; Prévoteau du Clary, F; Bouée, S; Conort, G; Livrozet, J-M; Taulera, O; Wajsbrot, A; Majerholc, C; Peter, J-M; Aubert, J-P

    2018-03-01

    The primary endpoint was to evaluate the use of HIV testing methods by French primary care providers: Elisa laboratory screening, instant result HIV diagnostic test and rapid result HIV diagnostic test. The secondary endpoints were the population screening rate of unknown HIV status consulting during the study period, reasons for screening and for choosing the specific screening method, the investigators' satisfaction with the rapid diagnostic test (RDT) and problems encountered. National prospective interventional study with French family physicians (FP) from December 2013 to December 2014. FPs enrolled all consenting adults consulting for an HIV screening test during a 6-month period: the choice was an Elisa laboratory test or one of the two RDTs. During the study period, 43 FPs included 981 patients. HIV screening was performed for the first time for 31.6% of patients; 767 (78.2%) Elisa laboratory test prescriptions and 214 (21.8%) RDTs were performed, leading to a screening rate of 1.3%. For 120 (15.7%) of the Elisa laboratory tests, the result was not reported and six RDTs were not valid. Nine patients were diagnosed as HIV-infected (0.9%): five with Elisa laboratory test and four with RDT. Almost 90% of FPs were willing to keep on using RDTs in their daily practice. In general practice, RDTs may be an important additional tool to traditional HIV screening. They could account for one in five tests prescribed in this context. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. A robust method to screen detergents for membrane protein stabilization, revisited.

    Science.gov (United States)

    Champeil, Philippe; Orlowski, Stéphane; Babin, Simon; Lund, Sten; le Maire, Marc; Møller, Jesper; Lenoir, Guillaume; Montigny, Cédric

    2016-10-15

    This report is a follow up of our previous paper (Lund, Orlowski, de Foresta, Champeil, le Maire and Møller (1989), J Biol Chem 264:4907-4915) showing that solubilization in detergent of a membrane protein may interfere with its long-term stability, and proposing a protocol to reveal the kinetics of such irreversible inactivation. We here clarify the fact that when various detergents are tested for their effects, special attention has of course to be paid to their critical micelle concentration. We also investigate the effects of a few more detergents, some of which have been recently advertised in the literature, and emphasize the role of lipids together with detergents. Among these detergents, lauryl maltose neopentyl glycol (LMNG) exerts a remarkable ability, even higher than that of β-dodecylmaltoside (DDM), to protect our test enzyme, the paradigmatic P-type ATPase SERCA1a from sarcoplasmic reticulum. Performing such experiments for one's favourite protein probably remains useful in pre-screening assays testing various detergents. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Materials Screening for the Discovery of New Half-Heuslers: Machine Learning versus ab Initio Methods.

    Science.gov (United States)

    Legrain, Fleur; Carrete, Jesús; van Roekeghem, Ambroise; Madsen, Georg K H; Mingo, Natalio

    2018-01-18

    Machine learning (ML) is increasingly becoming a helpful tool in the search for novel functional compounds. Here we use classification via random forests to predict the stability of half-Heusler (HH) compounds, using only experimentally reported compounds as a training set. Cross-validation yields an excellent agreement between the fraction of compounds classified as stable and the actual fraction of truly stable compounds in the ICSD. The ML model is then employed to screen 71 178 different 1:1:1 compositions, yielding 481 likely stable candidates. The predicted stability of HH compounds from three previous high-throughput ab initio studies is critically analyzed from the perspective of the alternative ML approach. The incomplete consistency among the three separate ab initio studies and between them and the ML predictions suggests that additional factors beyond those considered by ab initio phase stability calculations might be determinant to the stability of the compounds. Such factors can include configurational entropies and quasiharmonic contributions.

  16. Bioprospecting of Thermostable Cellulolytic Enzymes through Modeling and Virtual Screening Method

    Directory of Open Access Journals (Sweden)

    R. Navanietha Krishnaraj

    2017-04-01

    Full Text Available Cellulolytic enzymes are promising candidates for the use of cellulose in any bioprocess operations and for the disposal of the cellulosic wastes in an environmentally benign manner. Cellulases from thermophiles have the advantage of hydrolyzing cellulose at wider range of operating conditions unlike the normal enzymes. Herein we report the modeled structures of cellulolytic enzymes (endoglucanase, cellobiohydrolase and ß-glucosidase from a thermophilic bacterium,Clostridium thermocellumand their validation using Root Mean Square Deviation (RMSD and Ramachandran plot analyses. Further, the molecular interactions of the modeled enzyme with cellulose were analyzed using molecular docking technique. The results of molecular docking showed that the endoglucanase, cellobiohydrolase and ß-glucosidase had the binding affinities of -10.7, -9.0 and -10.8 kcal/mol, respectively. A correlation between the binding affinity of the endoglucanase with cellulose and the enzyme activity was also demonstrated. The results showed that the binding affinities of cellulases with cellulose could be used as a tool to assess the hydrolytic activity of cellulases. The results obtained could be used in virtual screening of cellulolytic enzymes based on the molecular interactions with the substrate, and aid in developing systems biology models of thermophiles for industrial biotechnology applications.

  17. vSDC: a method to improve early recognition in virtual screening when limited experimental resources are available.

    Science.gov (United States)

    Chaput, Ludovic; Martinez-Sanz, Juan; Quiniou, Eric; Rigolet, Pascal; Saettel, Nicolas; Mouawad, Liliane

    2016-01-01

    In drug design, one may be confronted to the problem of finding hits for targets for which no small inhibiting molecules are known and only low-throughput experiments are available (like ITC or NMR studies), two common difficulties encountered in a typical academic setting. Using a virtual screening strategy like docking can alleviate some of the problems and save a considerable amount of time by selecting only top-ranking molecules, but only if the method is very efficient, i.e. when a good proportion of actives are found in the 1-10 % best ranked molecules. The use of several programs (in our study, Gold, Surflex, FlexX and Glide were considered) shows a divergence of the results, which presents a difficulty in guiding the experiments. To overcome this divergence and increase the yield of the virtual screening, we created the standard deviation consensus (SDC) and variable SDC (vSDC) methods, consisting of the intersection of molecule sets from several virtual screening programs, based on the standard deviations of their ranking distributions. SDC allowed us to find hits for two new protein targets by testing only 9 and 11 small molecules from a chemical library of circa 15,000 compounds. Furthermore, vSDC, when applied to the 102 proteins of the DUD-E benchmarking database, succeeded in finding more hits than any of the four isolated programs for 13-60 % of the targets. In addition, when only 10 molecules of each of the 102 chemical libraries were considered, vSDC performed better in the number of hits found, with an improvement of 6-24 % over the 10 best-ranked molecules given by the individual docking programs.Graphical abstractIn drug design, for a given target and a given chemical library, the results obtained with different virtual screening programs are divergent. So how to rationally guide the experimental tests, especially when only a few number of experiments can be made? The variable Standard Deviation Consensus (vSDC) method was developed to

  18. Biomarkers and bioassays as alternative screening methods for the presence and effects of PCDD, PCDF and PCB

    International Nuclear Information System (INIS)

    Bosveld, A.T.C.B.; Berg, M.V.

    1994-01-01

    Polyhalogenated aromatic hydrocarbons (PHAH) are wide spread, highly toxic, environmental contaminants. As such they pose risks for both humans and wildlife. For risk assessment purposes, concentrations are generally analyzed by HRGC-HR/LRMS. With the analytical data, mixture toxicity is calculated using the TEF concept. With this method only the defined congeners are taken into account and additivity for all congeners is assumed, whereas synergistic and antagonistic effects for several PCDD/F in combination with PCB have also been reported. To avoid these problems and high analytical costs, bioassays can be used for screening purposes. Cytochrome P 450 1 A 1 induction and vitamin A and thyroid hormone levels are shown to be useful markers for PHAH exposure. When bioassays based on cytochrome P 450 1 A 1 induction, in cultured cells, in multi-well culturing plates, are used, 2,3,7,8-TCDD detection limits <0.2 pg are possible. As such these bioassays are highly sensitive, cost effective and time saving. This application can be used as a pre-screening method to determine total ''dioxin'' content of environmental samples. (orig.)

  19. Use of 15N dilution method for screening soybean lines with high yield and high nitrogen fixation ability

    International Nuclear Information System (INIS)

    Li Haixian; Li Xinmin; Danso, S.K.A.

    1998-01-01

    15 N dilution method was used for screening soybean lines with high nitrogen fixation ability. Screened lines 1005, 8502, 2096, 943, 1454 and Dongnong-42 have high nitrogen fixation ability with their % Ndfa of about 70%. 1454 and 1555 are both high yield and high nitrogen fixation lines. The ability of nitrogen fixation was not related to the yield, but related to maturing time. The cultivars with different maturing time have different levels of nitrogen fixation ability. The longer the maturing period is, the greater the ability of nitrogen fixation it has. There were ten cultivars or lines used in the test of 1992 and 1994. Although the weather condition were greatly different between the two years the results of seven cultivars or lines were the same, indicating that nitrogen fixation ability of the soybean is stable with years. Using 15 N dilution method to estimate nitrogen fixation ability of soybean is reliable, however, the % Ndfa of lines 8502 and 2096 increased by 19% in 1994, a rainy year, indicating that a change in % Ndfa with a few varieties maybe caused by weather

  20. A sediment extraction and cleanup method for wide-scope multitarget screening by liquid chromatography-high-resolution mass spectrometry.

    Science.gov (United States)

    Massei, Riccardo; Byers, Harry; Beckers, Liza-Marie; Prothmann, Jens; Brack, Werner; Schulze, Tobias; Krauss, Martin

    2018-01-01

    Previous studies on organic sediment contaminants focused mainly on a limited number of highly hydrophobic micropollutants accessible to gas chromatography using nonpolar, aprotic extraction solvents. The development of liquid chromatography-high-resolution mass spectrometry (LC-HRMS) permits the spectrum of analysis to be expanded to a wider range of more polar and ionic compounds present in sediments and allows target, suspect, and nontarget screening to be conducted with high sensitivity and selectivity. In this study, we propose a comprehensive multitarget extraction and sample preparation method for characterization of sediment pollution covering a broad range of physicochemical properties that is suitable for LC-HRMS screening analysis. We optimized pressurized liquid extraction, cleanup, and sample dilution for a target list of 310 compounds. Finally, the method was tested on sediment samples from a small river and its tributaries. The results show that the combination of 100 °C for ethyl acetate-acetone (50:50, neutral extract) followed by 80 °C for acetone-formic acid (100:1, acidic extract) and methanol-10 mM sodium tetraborate in water (90:10, basic extract) offered the best extraction recoveries for 287 of 310 compounds. At a spiking level of 1 μg mL -1 , we obtained satisfactory cleanup recoveries for the neutral extract-(93 ± 23)%-and for the combined acidic/basic extracts-(42 ± 16)%-after solvent exchange. Among the 69 compounds detected in environmental samples, we successfully quantified several pharmaceuticals and polar pesticides.

  1. Significance tests in mutagen screening: another method considering historical control frequencies

    International Nuclear Information System (INIS)

    Traut, H.

    1983-01-01

    Recently a method has been devised for testing the significance of the difference between a mutation frequency observed after chemical treatment or iradiation and the historical ('stable') control frequency. Another test is proposed serving the same purpose. Both methods are applied to several examples (experimental frequency versus historical control frequency). The results (P values) obtained agree well. (author)

  2. Evaluating user preferences for video transfer methods from a mobile device to a TV screen

    DEFF Research Database (Denmark)

    Fleury, Alexandre; Pedersen, Jakob Schou; Larsen, Lars Bo

    2013-01-01

    This article reports on the evaluation of four methods for transferring video content from a mobile device to a fixed television. The methods have been investigated in a Wizard-of-Oz approach through two consecutive studies. The first experiment aimed at collecting general opinions toward such a ...

  3. Prediction of Phase Behavior of Spray-Dried Amorphous Solid Dispersions: Assessment of Thermodynamic Models, Standard Screening Methods and a Novel Atomization Screening Device with Regard to Prediction Accuracy

    Directory of Open Access Journals (Sweden)

    Aymeric Ousset

    2018-03-01

    Full Text Available The evaluation of drug–polymer miscibility in the early phase of drug development is essential to ensure successful amorphous solid dispersion (ASD manufacturing. This work investigates the comparison of thermodynamic models, conventional experimental screening methods (solvent casting, quench cooling, and a novel atomization screening device based on their ability to predict drug–polymer miscibility, solid state properties (Tg value and width, and adequate polymer selection during the development of spray-dried amorphous solid dispersions (SDASDs. Binary ASDs of four drugs and seven polymers were produced at 20:80, 40:60, 60:40, and 80:20 (w/w. Samples were systematically analyzed using modulated differential scanning calorimetry (mDSC and X-ray powder diffraction (XRPD. Principal component analysis (PCA was used to qualitatively assess the predictability of screening methods with regards to SDASD development. Poor correlation was found between theoretical models and experimentally-obtained results. Additionally, the limited ability of usual screening methods to predict the miscibility of SDASDs did not guarantee the appropriate selection of lead excipient for the manufacturing of robust SDASDs. Contrary to standard approaches, our novel screening device allowed the selection of optimal polymer and drug loading and established insight into the final properties and performance of SDASDs at an early stage, therefore enabling the optimization of the scaled-up late-stage development.

  4. Shortened screening method for phosphorus fractionation in sediments A complementary approach to the standards, measurements and testing harmonised protocol

    International Nuclear Information System (INIS)

    Pardo, Patricia; Rauret, Gemma; Lopez-Sanchez, Jose Fermin

    2004-01-01

    The SMT protocol, a sediment phosphorus fractionation method harmonised and validated in the frame of the standards, measurements and testing (SMT) programme (European Commission), establishes five fractions of phosphorus according to their extractability. The determination of phosphate extracted is carried out spectrophotometrically. This protocol has been applied to 11 sediments of different origin and characteristics and the phosphorus extracted in each fraction was determined not only by UV-Vis spectrophotometry, but also by inductively coupled plasma-atomic emission spectrometry. The use of these two determination techniques allowed the differentiation between phosphorus that was present in the extracts as soluble reactive phosphorus and as total phosphorus. From the comparison of data obtained with both determination techniques a shortened screening method, for a quick evaluation of the magnitude and importance of the fractions given by the SMT protocol, is proposed and validated using two certified reference materials

  5. pd Scattering Using a Rigorous Coulomb Treatment: Reliability of the Renormalization Method for Screened-Coulomb Potentials

    International Nuclear Information System (INIS)

    Hiratsuka, Y.; Oryu, S.; Gojuki, S.

    2011-01-01

    Reliability of the screened Coulomb renormalization method, which was proposed in an elegant way by Alt-Sandhas-Zankel-Ziegelmann (ASZZ), is discussed on the basis of 'two-potential theory' for the three-body AGS equations with the Coulomb potential. In order to obtain ASZZ's formula, we define the on-shell Moller function, and calculate it by using the Haeringen criterion, i. e. 'the half-shell Coulomb amplitude is zero'. By these two steps, we can finally obtain the ASZZ formula for a small Coulomb phase shift. Furthermore, the reliability of the Haeringen criterion is thoroughly checked by a numerically rigorous calculation for the Coulomb LS-type equation. We find that the Haeringen criterion can be satisfied only in the higher energy region. We conclude that the ASZZ method can be verified in the case that the on-shell approximation to the Moller function is reasonable, and the Haeringen criterion is reliable. (author)

  6. Accreditation of a screening method for non-dioxin-like polychlorinated biphenyl detection in fishery products according to European legislation.

    Science.gov (United States)

    Serpe, F P; Russo, R; Ambrosio, L; Esposito, M; Severino, L

    2013-06-01

    European Commission Regulation 882/2004/EC requires that official control laboratories for foodstuffs in the member states are certified according to UNI EN ISO/IEC 17025:2005 (general requirement for the competence of calibration and testing laboratories). This mandatory requirement has resulted in a continuous adaptation and development of analytical procedures. The aim of this study was to develop a method for semiquantitative screening of polychlorinated biphenyls in fish for human consumption. According to the Commission Decision 657/2002/CE, the detection capability, the precision, the selectivity-specificity, and applicability-ruggedness-stability were determined to validate the method. Moreover, trueness was verified. This procedure resulted in rapid execution, which allowed immediate and effective intervention by the local health authorities to protect the health of consumers. Finally, the procedure has been recognized by the Italian accrediting body, ACCREDIA.

  7. Meta-analysis of two computer-assisted screening methods for diagnosing oral precancer and cancer.

    Science.gov (United States)

    Ye, Xiaojing; Zhang, Jing; Tan, Yaqin; Chen, Guanying; Zhou, Gang

    2015-11-01

    The early diagnosis of oral precancer and cancer is crucial and could have the highest impact on improving survival rates. A meta-analysis was conducted to compare the accuracy between the OralCDx brush biopsy and DNA-image cytometry in diagnosing both conditions. Bibliographic databases were systematically searched for original relevant studies on the early diagnosis of oral precancer and oral cancer. Study characteristics were evaluated to determine the accuracy of the two screening strategies. Thirteen studies (eight of OralCDx brush biopsy and five of DNA-image cytometry) were identified as having reported on 1981 oral mucosa lesions. The meta-analysis found that the area under the summary receiver operating characteristic curves of the OralCDx brush biopsy and DNA-image cytometry were 0.8879 and 0.9885, respectively. The pooled sensitivity, specificity, and diagnostic odds ratio of the OralCDx brush biopsy were 86% (95% CI 81-90), 81% (95% CI 78-85), and 20.36 (95% CI 2.72-152.67), respectively, while these modalities of DNA-image cytometry were 89% (95% CI 83-94), 99% (95% CI 97-100), and 446.08 (95% CI 73.36-2712.43), respectively. Results of a pairwise comparison between each modality demonstrated that specificity, area under the curve (AUC), and Q(∗) index of DNA-image cytometry was significantly higher than that of the OralCDx brush biopsy (Z=2.821, p0.05). In conclusion, the meta-analysis of the published studies indicated that DNA-image cytometry is more accurate than the OralCDx brush biopsy in diagnosing oral precancer and oral cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Screening of various low-grade biomass materials for low temperature gasification: Method development and application

    DEFF Research Database (Denmark)

    Thomsen, Tobias Pape; Ravenni, Giulia; Holm, Jens Kai

    2015-01-01

    references. The technical assessment is supplemented by an evaluation of practical application and overall energy balance. Applying the developed method to 4 references and 18 unproven low-grade potential fuels, indicated that one of these unproven candidates was most likely unsuited for Pyroneer...... method and the subsequent use of the method to identify promising e but currently unproven, low-grade biomass resources for conversion in Pyroneer systems. The technical assessment is conducted by comparing the results from a series of physical-mechanical and thermochemical experiments to a set of proven...

  10. Strategies for the screening of antibiotic residues in eggs: comparison of the validation of the classical microbiological method with an immunobiosensor method.

    Science.gov (United States)

    Gaudin, Valérie; Rault, Annie; Hedou, Celine; Soumet, Christophe; Verdon, Eric

    2017-09-01

    Efficient screening methods are needed to control antibiotic residues in eggs. A microbiological kit (Explorer® 2.0 test (Zeu Inmunotech, Spain)) and an immunobiosensor kit (Microarray II (AM® II) on Evidence Investigator™ system (Randox, UK)) have been evaluated and validated for screening of antibiotic residues in eggs, according to the European decision EC/2002/657 and to the European guideline for the validation of screening methods. The e-reader™ system, a new automatic incubator/reading system, was coupled to the Explorer 2.0 test. The AM II kit can detect residues of six different families of antibiotics in different matrices including eggs. For both tests, a different liquid/liquid extraction of eggs had to be developed. Specificities of the Explorer 2.0 and AM II kit were equal to 8% and 0% respectively. The detection capabilities were determined for 19 antibiotics, with representatives from different families, for Explorer 2.0 and 12 antibiotics for the AM II kit. For the nine antibiotics having a maximum residue limit (MRL) in eggs, the detection capabilities CCβ of Explorer 2.0 were below the MRL for four antibiotics, equal to the MRL for two antibiotics and between 1 and 1.5 MRLs for the three remaining antibiotics (tetracyclines). For the antibiotics from other families, the detection capabilities were low for beta-lactams and sulfonamides and satisfactory for dihydrostreptomycin (DHS) and fluoroquinolones, which are usually difficult to detect with microbiological tests. The CCβ values of the AM II kit were much lower than the respective MRLs for three detected antibiotics (tetracycline, oxytetracycline, tylosin). Concerning the nine other antibiotics, the detection capabilities determined were low. The highest CCβ was obtained for streptomycin (100 µg kg -1 ).

  11. Fast methods for screening of trichothecenes in fungal cultures using gas chromatography-tandem mass spectrometry

    DEFF Research Database (Denmark)

    Nielsen, Kristian Fog; Thrane, Ulf

    2001-01-01

    The paper presents a fast method for trichothecene profiling and chemotaxonomic studies in species of Fusarium, Stachybotrys, Trichoderma and Memnoniella. Micro scale extracted crude Fusarium extracts were derivatised using pentafluoropropionic anhydride and analysed by gas chromatography...

  12. An integrated miRNA functional screening and target validation method for organ morphogenesis.

    Science.gov (United States)

    Rebustini, Ivan T; Vlahos, Maryann; Packer, Trevor; Kukuruzinska, Maria A; Maas, Richard L

    2016-03-16

    The relative ease of identifying microRNAs and their increasing recognition as important regulators of organogenesis motivate the development of methods to efficiently assess microRNA function during organ morphogenesis. In this context, embryonic organ explants provide a reliable and reproducible system that recapitulates some of the important early morphogenetic processes during organ development. Here we present a method to target microRNA function in explanted mouse embryonic organs. Our method combines the use of peptide-based nanoparticles to transfect specific microRNA inhibitors or activators into embryonic organ explants, with a microRNA pulldown assay that allows direct identification of microRNA targets. This method provides effective assessment of microRNA function during organ morphogenesis, allows prioritization of multiple microRNAs in parallel for subsequent genetic approaches, and can be applied to a variety of embryonic organs.

  13. High Quantile of Environmental Screening Methods, San Joaquin Valley CA, 2013, Occidental College of Los Angeles

    Data.gov (United States)

    U.S. Environmental Protection Agency — This layer combines the high quantiles of the CES, CEVA, and EJSM layers so that viewers can see the overlap of â??hot spotsâ?? for each method. This layer was...

  14. Approach suitable for screening estimation methods for critical properties of heavy compounds

    DEFF Research Database (Denmark)

    Zbogar, A.; vidal da Silva Lopes, F.; Kontogeorgis, Georgios

    2006-01-01

    ) is in agreement with their validation via the proposed equation. Similar results have been obtained for other compounds. Both group-contribution methods are of equal accuracy for heavy alkenes and acids, provided that experimental boiling point temperatures are available for the Joback method. If such data...... the very heavy and complex ones, follow the trend suggested by this equation. This equation can be used for testing existing group-contribution estimation methods. It is shown here that direct comparison of the Joback and Constantinou-Gani methods for two families of compounds (alkenes and carboxylic acids......- and diacids, alkenes, cyclo/phenylalkanes, and squalane). This and previous validations verify that this correlation has a much broader application range, up to (T-c/p(c)) ratios of 200, than the data used in its development (compounds with ratios up to 100). it seems that most organic compounds, including...

  15. Screening of clonal chromosome aberrations present in A-bomb survivors by FISH method

    International Nuclear Information System (INIS)

    Nakano, Mimako; Kodama, Yoshiaki; Ito, Masahiro; Otaki, Kazuo; Nakamura, Nori

    1997-01-01

    Significance of FISH method for detection of clonal chromosome aberration was reviewed. A clonal chromosome aberration is derived from one abnormal cell clone and gives the influence on the frequency of the aberration. As well, the size and frequency of the aberration give an important information concerning lymphocyte kinetics. FISH method is meaningful for detection of the clonal aberration. Fifteen kinds of clonal aberrations were detected in A-bomb survivors, of which 10 were specifically detected by the method, indicating that its detection rate was 2-3 time as high as the ordinary method. The results were those on the DNA probe on no.1, no.2 and no.3 chromosomes, which consisting of about 23% of the genome. (K.H.)

  16. Depression Screening

    Science.gov (United States)

    ... Depression Screening Substance Abuse Screening Alcohol Use Screening Depression Screening (PHQ-9) - Instructions The following questions are ... this tool, there is also text-only version . Depression Screening - Manual Instructions The following questions are a ...

  17. Using network screening methods to determine locations with specific safety issues: A design consistency case study.

    Science.gov (United States)

    Butsick, Andrew J; Wood, Jonathan S; Jovanis, Paul P

    2017-09-01

    The Highway Safety Manual provides multiple methods that can be used to identify sites with promise (SWiPs) for safety improvement. However, most of these methods cannot be used to identify sites with specific problems. Furthermore, given that infrastructure funding is often specified for use related to specific problems/programs, a method for identifying SWiPs related to those programs would be very useful. This research establishes a method for Identifying SWiPs with specific issues. This is accomplished using two safety performance functions (SPFs). This method is applied to identifying SWiPs with geometric design consistency issues. Mixed effects negative binomial regression was used to develop two SPFs using 5 years of crash data and over 8754km of two-lane rural roadway. The first SPF contained typical roadway elements while the second contained additional geometric design consistency parameters. After empirical Bayes adjustments, sites with promise (SWiPs) were identified. The disparity between SWiPs identified by the two SPFs was evident; 40 unique sites were identified by each model out of the top 220 segments. By comparing sites across the two models, candidate road segments can be identified where a lack design consistency may be contributing to an increase in expected crashes. Practitioners can use this method to more effectively identify roadway segments suffering from reduced safety performance due to geometric design inconsistency, with detailed engineering studies of identified sites required to confirm the initial assessment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Supplementary Material for: DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-01-01

    Abstract Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemannâ Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between

  19. HAMS: High-Affinity Mass Spectrometry Screening. A High-Throughput Screening Method for Identifying the Tightest-Binding Lead Compounds for Target Proteins with No False Positive Identifications.

    Science.gov (United States)

    Imaduwage, Kasun P; Go, Eden P; Zhu, Zhikai; Desaire, Heather

    2016-11-01

    A major challenge in drug discovery is the identification of high affinity lead compounds that bind a particular target protein; these leads are typically identified by high throughput screens. Mass spectrometry has become a detection method of choice in drug screening assays because the target and the ligand need not be modified. Label-free assays are advantageous because they can be developed more rapidly than assays requiring labels, and they eliminate the risk of the label interfering with the binding event. However, in commonly used MS-based screening methods, detection of false positives is a major challenge. Here, we describe a detection strategy designed to eliminate false positives. In this approach, the protein and the ligands are incubated together, and the non-binders are separated for detection. Hits (protein binders) are not detectable by MS after incubation with the protein, but readily identifiable by MS when the target protein is not present in the incubation media. The assay was demonstrated using three different proteins and hundreds of non-inhibitors; no false positive hits were identified in any experiment. The assay can be tuned to select for ligands of a particular binding affinity by varying the quantity of protein used and the immobilization method. As examples, the method selectively detected inhibitors that have K i values of 0.2 μM, 50 pM, and 700 pM. These findings demonstrate that the approach described here compares favorably with traditional MS-based screening methods. Graphical Abstract ᅟ.

  20. Neurotoxicity screening of (illicit) drugs using novel methods for analysis of microelectrode array (MEA) recordings.

    Science.gov (United States)

    Hondebrink, L; Verboven, A H A; Drega, W S; Schmeink, S; de Groot, M W G D M; van Kleef, R G D M; Wijnolts, F M J; de Groot, A; Meulenbelt, J; Westerink, R H S

    2016-07-01

    Annual prevalence of the use of common illicit drugs and new psychoactive substances (NPS) is high, despite the often limited knowledge on the health risks of these substances. Recently, cortical cultures grown on multi-well microelectrode arrays (mwMEAs) have been used for neurotoxicity screening of chemicals, pharmaceuticals, and toxins with a high sensitivity and specificity. However, the use of mwMEAs to investigate the effects of illicit drugs on neuronal activity is largely unexplored. We therefore first characterised the cortical cultures using immunocytochemistry and show the presence of astrocytes, glutamatergic and GABAergic neurons. Neuronal activity is concentration-dependently affected following exposure to six neurotransmitters (glutamate, GABA, serotonin, dopamine, acetylcholine and nicotine). Most neurotransmitters inhibit neuronal activity, although glutamate and acetylcholine transiently increase activity at specific concentrations. These transient effects are not detected when activity is determined during the entire 30min exposure window, potentially resulting in false-negative results. As expected, exposure to the GABAA-receptor antagonist bicuculline increases neuronal activity. Exposure to a positive allosteric modulator of the GABAA-receptor (diazepam) or to glutamate receptor antagonists (CNQX and MK-801) reduces neuronal activity. Further, we demonstrate that exposure to common drugs (3,4-methylenedioxymethamphetamine (MDMA) and amphetamine) and NPS (1-(3-chlorophenyl)piperazine (mCPP), 4-fluoroamphetamine (4-FA) and methoxetamine (MXE)) decreases neuronal activity. MXE most potently inhibits neuronal activity with an IC50 of 0.5μM, whereas 4-FA is least potent with an IC50 of 113μM. Our data demonstrate the importance of analysing neuronal activity within different time windows during exposure to prevent false-negative results. We also show that cortical cultures grown on mwMEAs can successfully be applied to investigate the effects of

  1. Barriers to uptake among high-risk individuals declining participation in lung cancer screening: a mixed methods analysis of the UK Lung Cancer Screening (UKLS) trial.

    Science.gov (United States)

    Ali, Noor; Lifford, Kate J; Carter, Ben; McRonald, Fiona; Yadegarfar, Ghasem; Baldwin, David R; Weller, David; Hansell, David M; Duffy, Stephen W; Field, John K; Brain, Kate

    2015-07-14

    The current study aimed to identify the barriers to participation among high-risk individuals in the UK Lung Cancer Screening (UKLS) pilot trial. The UKLS pilot trial is a randomised controlled trial of low-dose CT (LDCT) screening that has recruited high-risk people using a population approach in the Cambridge and Liverpool areas. High-risk individuals aged 50-75 years were invited to participate in UKLS. Individuals were excluded if a LDCT scan was performed within the last year, if they were unable to provide consent, or if LDCT screening was unable to be carried out due to coexisting comorbidities. Statistical associations between individual characteristics and UKLS uptake were examined using multivariable regression modelling. In those who completed a non-participation questionnaire (NPQ), thematic analysis of free-text data was undertaken to identify reasons for not taking part, with subsequent exploratory linkage of key themes to risk factors for non-uptake. Comparative data were available from 4061 high-risk individuals who consented to participate in the trial and 2756 who declined participation. Of those declining participation, 748 (27.1%) completed a NPQ. Factors associated with non-uptake included: female gender (OR=0.64, pemotional barriers. Smokers were more likely to report emotional barriers to participation. A profile of risk factors for non-participation in lung screening has emerged, with underlying reasons largely relating to practical and emotional barriers. Strategies for engaging high-risk, hard-to-reach groups are critical for the equitable uptake of a potential future lung cancer screening programme. The UKLS trial was registered with the International Standard Randomised Controlled Trial Register under the reference 78513845. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. Multimodal Examination of Atrial Fibrillation Substrate: Correlation of Left Atrial Bipolar Voltage Using Multi-Electrode Fast Automated Mapping, Point-by-Point Mapping, and Magnetic Resonance Image Intensity Ratio.

    Science.gov (United States)

    Zghaib, Tarek; Keramati, Ali; Chrispin, Jonathan; Huang, Dong; Balouch, Muhammad A; Ciuffo, Luisa; Berger, Ronald D; Marine, Joseph E; Ashikaga, Hiroshi; Calkins, Hugh; Nazarian, Saman; Spragg, David D

    2018-01-01

    Bipolar voltage mapping, as part of atrial fibrillation (AF) ablation, is traditionally performed in a point-by-point (PBP) approach using single-tip ablation catheters. Alternative techniques for fibrosis-delineation include fast-anatomical mapping (FAM) with multi-electrode circular catheters, and late gadolinium-enhanced magnetic-resonance imaging (LGE-MRI). The correlation between PBP, FAM, and LGE-MRI fibrosis assessment is unknown. In this study, we examined AF substrate using different modalities (PBP, FAM, and LGE-MRI mapping) in patients presenting for an AF ablation. LGE-MRI was performed pre-ablation in 26 patients (73% males, age 63±8years). Local image-intensity ratio (IIR) was used to normalize myocardial intensities. PBP- and FAM-voltage maps were acquired, in sinus rhythm, prior to ablation and co-registered to LGE-MRI. Mean bipolar voltage for all 19,087 FAM voltage points was 0.88±1.27mV and average IIR was 1.08±0.18. In an adjusted mixed-effects model, each unit increase in local IIR was associated with 57% decrease in bipolar voltage (p0.74 corresponded to bipolar voltage voltage was significantly associated with log-PBP bipolar voltage (ß=0.36, pvoltages, FAM-mapping distribution was shifted to the left compared to PBP-mapping; at intermediate voltages, FAM and PBP voltages were overlapping; and at high voltages, FAM exceeded PBP-voltages. LGE-MRI, FAM and PBP-mapping show good correlation in delineating electro-anatomical AF substrate. Each approach has fundamental technical characteristics, the awareness of which allows proper assessment of atrial fibrosis.

  3. Improving Patient-Centered Care for Young People in General Practice With a Codesigned Screening App: Mixed Methods Study.

    Science.gov (United States)

    Webb, Marianne Julie; Wadley, Greg; Sanci, Lena Amanda

    2017-08-11

    Despite experiencing a high prevalence and co-occurrence of mental health disorders and health-compromising behaviors, young people tend not to seek professional help for these concerns. However, they do regularly attend primary care, making primary care providers ideally situated to identify and discuss mental health and lifestyle issues as part of young people's routine health care. The aim was to investigate whether using a codesigned health and lifestyle-screening app, Check Up GP, in general practice influenced young people's assessment of the quality of their care (measures of patient-centered care and youth friendliness), and their disclosure of sensitive issues. In addition, this study aimed to explore young people's acceptance and experience of using a screening app during regular health care. This was a mixed methods implementation study of Check Up GP with young people aged 14 to 25 years attending a general practice clinic in urban Melbourne, Australia. A 1-month treatment-as-usual group was compared to a 2-month intervention group in which young people and their general practitioners (GPs) used Check Up GP. Young people in both groups completed an exit survey immediately after their consultation about disclosure, patient-centered and youth-friendly care, and judgment. In addition, participants in the intervention group were surveyed about app acceptability and usability and their willingness to use it again. Semistructured interviews with participants in the intervention group expanded on themes covered in the survey. The exit survey was completed by 30 young people in the treatment-as-usual group and 85 young people in the intervention group. Young people using Check Up GP reported greater disclosure of health issues (Ptime to ask questions. In all, 86% (73/85) of young people felt the app was a "good idea" and only 1% (1/85) thought it a "bad idea." Thematic analysis of qualitative interviews with 14 participants found that Check Up GP created scope

  4. A comparison of screening methods to identify waterlogging tolerance in the field in Brassica napus L. during plant ontogeny.

    Directory of Open Access Journals (Sweden)

    Xiling Zou

    Full Text Available Waterlogging tolerance is typically evaluated at a specific development stage, with an implicit assumption that differences in waterlogging tolerance expressed in these systems will result in improved yield performance in fields. It is necessary to examine these criteria in fields. In the present study, three experiments were conducted to screen waterlogging tolerance in 25 rapeseed (Brassica napus L. varieties at different developmental stages, such as seedling establishment stage and seedling stage at controlled environment, and maturity stage in the fields. The assessments for physiological parameters at three growth stages suggest that there were difference of waterlogging tolerance at all the development stages, providing an important basis for further development of breeding more tolerant materials. The results indicated that flash waterlogging restricts plant growth and growth is still restored after removal of the stress. Correlation analysis between waterlogging tolerance coefficient (WTC of yield and other traits revealed that there was consistency in waterlogging tolerance of the genotypes until maturity, and good tolerance at seedling establishment stage and seedling stage can guarantee tolerance in later stages. The waterlogging-tolerant plants could be selected using some specific traits at any stage, and selections would be more effective at the seedling establishment stage. Thus, our study provides a method for screening waterlogging tolerance, which would enable the suitable basis for initial selection of a large number of germplasm or breeding populations for waterlogging tolerance and help for verifying their potential utility in crop-improvement.

  5. An Efficient Implementation of the Nwat-MMGBSA Method to Rescore Docking Results in Medium-Throughput Virtual Screenings

    Directory of Open Access Journals (Sweden)

    Irene Maffucci

    2018-03-01

    Full Text Available Nwat-MMGBSA is a variant of MM-PB/GBSA based on the inclusion of a number of explicit water molecules that are the closest to the ligand in each frame of a molecular dynamics trajectory. This method demonstrated improved correlations between calculated and experimental binding energies in both protein-protein interactions and ligand-receptor complexes, in comparison to the standard MM-GBSA. A protocol optimization, aimed to maximize efficacy and efficiency, is discussed here considering penicillopepsin, HIV1-protease, and BCL-XL as test cases. Calculations were performed in triplicates on both classic HPC environments and on standard workstations equipped by a GPU card, evidencing no statistical differences in the results. No relevant differences in correlation to experiments were also observed when performing Nwat-MMGBSA calculations on 4 or 1 ns long trajectories. A fully automatic workflow for structure-based virtual screening, performing from library set-up to docking and Nwat-MMGBSA rescoring, has then been developed. The protocol has been tested against no rescoring or standard MM-GBSA rescoring within a retrospective virtual screening of inhibitors of AmpC β-lactamase and of the Rac1-Tiam1 protein-protein interaction. In both cases, Nwat-MMGBSA rescoring provided a statistically significant increase in the ROC AUCs of between 20 and 30%, compared to docking scoring or to standard MM-GBSA rescoring.

  6. An Efficient Implementation of the Nwat-MMGBSA Method to Rescore Docking Results in Medium-Throughput Virtual Screenings

    Science.gov (United States)

    Maffucci, Irene; Hu, Xiao; Fumagalli, Valentina; Contini, Alessandro

    2018-03-01

    Nwat-MMGBSA is a variant of MM-PB/GBSA based on the inclusion of a number of explicit water molecules that are the closest to the ligand in each frame of a molecular dynamics trajectory. This method demonstrated improved correlations between calculated and experimental binding energies in both protein-protein interactions and ligand-receptor complexes, in comparison to the standard MM-GBSA. A protocol optimization, aimed to maximize efficacy and efficiency, is discussed here considering penicillopepsin, HIV1-protease, and BCL-XL as test cases. Calculations were performed in triplicates on both classic HPC environments and on standard workstations equipped by a GPU card, evidencing no statistical differences in the results. No relevant differences in correlation to experiments were also observed when performing Nwat-MMGBSA calculations on 4 ns or 1 ns long trajectories. A fully automatic workflow for structure-based virtual screening, performing from library set-up to docking and Nwat-MMGBSA rescoring, has then been developed. The protocol has been tested against no rescoring or standard MM-GBSA rescoring within a retrospective virtual screening of inhibitors of AmpC β-lactamase and of the Rac1-Tiam1 protein-protein interaction. In both cases, Nwat-MMGBSA rescoring provided a statistically significant increase in the ROC AUCs of between 20% and 30%, compared to docking scoring or to standard MM-GBSA rescoring.

  7. The sky blue method as a screening test to detect misplacement of percutaneous endoscopic gastrostomy tube at exchange.

    Science.gov (United States)

    Suzuki, Yutaka; Urashima, Mitsuyoshi; Yoshida, Hideki; Iwase, Tsuyoshi; Kura, Toshiroh; Imazato, Shin; Kudo, Michiaki; Ohta, Tomoyuki; Mizuhara, Akihiro; Tamamori, Yutaka; Muramatsu, Hirohito; Nishiguchi, Yukio; Nishiyama, Yorihiro; Takahashi, Mikako; Nishiwaki, Shinji; Matsumoto, Masami; Goshi, Satoshi; Sakamoto, Shigeo; Uchida, Nobuyuki; Ijima, Masashi; Ogawa, Tetsushi; Shimazaki, Makoto; Takei, Shinichi; Kimura, Chikou; Yamashita, Satoyoshi; Endo, Takao; Nakahori, Masato; Itoh, Akihiko; Kusakabe, Toshiro; Ishizuka, Izumi; Iiri, Takao; Fukasawa, Shingo; Arimoto, Yukitsugu; Kajitani, Nobuaki; Ishida, Kazuhiko; Onishi, Koji; Taira, Akihiko; Kobayashi, Makoto; Itano, Yasuto; Kobuke, Toshiya

    2009-01-01

    During tube exchange for percutaneous endoscopic gastrostomy (PEG), a misplaced tube can cause peritonitis and death. Thus, endoscopic or radiologic observation is required at tube exchange to make sure the tube is placed correctly. However, these procedures cost extensive time and money to perform in all patients at the time of tube exchange. Therefore, we developed the "sky blue method" as a screening test to detect misplacement of the PEG tube during tube exchange. First, sky blue solution consisting of indigocarmine diluted with saline was injected into the gastric space via the old PEG tube just before the tube exchange. Next, the tube was exchanged using a standard method. Then, we checked whether the sky blue solution could be collected through the new tube or not. Finally, we confirmed correct placement of the tube by endoscopic or radiologic observation for all patients. A total of 961 patients were enrolled. Each tube exchange took 1 to 3 minutes, and there were no adverse effects. Four patients experienced a misplaced tube, all of which were detectable with the sky blue method. Diagnostic parameters of the sky blue method were as follows: sensitivity, 94% (95%CI: 92-95%); specificity, 100% (95%CI: 40-100%); positive predictive value, 100% (95%CI: 100-100%); negative predictive value, 6% (95%CI: 2-16%). These results suggest that the number of endoscopic or radiologic observations to confirm correct replacement of the PEG tube may be reduced to one fifteenth using the sky blue method.

  8. Validity of autorefractor based screening method for irregular astigmatism compared to the corneal topography- a cross sectional study

    Directory of Open Access Journals (Sweden)

    Alicia Galindo-Ferreiro

    2017-09-01

    Full Text Available AIM: To present a method of screening for irregular astigmatism with an autorefractor and its determinants compared to corneal topography. METHODS: This cross-sectional validity study was conducted in 2013 at an eye hospital in Spain. A tabletop autorefractor (test 1 was used to measure the refractive status of the anterior surface of the cornea at two corneal meridians of each eye. Then corneal topography (test 2 and Bogan’s classification was used to group eyes into those with regular or no astigmatism (GRI and irregular astigmatism (GRII. Test 1 provided a single absolute value for the greatest cylinder difference (Vr. The receiver operating characteristic (ROC were plotted for the Vr values measured by test 1 for GRI and GRII eyes. On the basis a Vr value of 1.25 D as cut off, sensitivity, specificity were also calculated. RESULTS: The study sample was comprised of 260 eyes (135 patients. The prevalence of irregular astigmatism was 42% [95% confidence interval (CI: 36, 48]. Based on test 2, there were 151 eyes in GRI and 109 eyes in GRII. The median Vr was 0.75 D (25% quartile, 0.5 D for GRI and 1.75 D (25% quartile, 1.25 D for GRII. The area under curve was 0.171 for GRI and 0.83 for GRII. The sensitivity of test I was 78.1% and the specificity was 76.1%. CONCLUSION: A conventional autorefractor can be effective as a first level screening method to detect irregular corneal astigmatism in places where corneal topography facilities are not available.

  9. Cyquant cell proliferation assay as a fluorescence-based method for in vitro screening of antimalarial activity.

    Science.gov (United States)

    Sriwilaijaroen, Nongluk; Kelly, Jane Xu; Riscoe, Michael; Wilairat, Prapon

    2004-12-01

    The appearance of drug resistant parasites and the absence of an effective vaccine have resulted in the need for new effective antimalarial drugs. Consequently, a convenient method for in vitro screening of large numbers of antimalarial drug candidates has become apparent. The CyQUANT cell proliferation assay is a highly sensitive fluorescence-based method for quantitation of cell number by measuring the strong fluorescence produced when green GR dye binds to nucleic acids. We have applied the CyQUANT assay method to evaluate the growth of Plasmodium falciparum D6 strain in culture. The GR-nucleic acid fluorescence linearly correlated with percent parasitemia at both 0.75 or 1 percent hematocrit with the same correlation coefficient of r2 = 0.99. The sensitivity of P. falciparum D6 strain to chloroquine and to 3,6-bis-omega-diethylaminoamyloxyxanthone, a novel antimalarial, determined by the CyQUANT assay were comparable to those obtained by the traditional [3H]-ethanolamine assay: IC50 value of chloroquine was 54 nM and 51 nM by the CyQUANT and [3H]-ethanolamine assay, respectively; IC50 value for 3,6-bis-omega-diethylaminoamyloxyxanthone was 254 nM and 223 nM by the CyQUANT and [3H]-ethanolamine assay, respectively. This procedure requires no radioisotope, uses simple equipment, and is an easy and convenient procedure, with no washing and harvesting steps. Moreover, all procedures can be set up continuously and thus, the CyQUANT assay is suitable in automatic high through-put drug screening of antimalarial drugs.

  10. A note on the catch-up time method for estimating lead or sojourn time in prostate cancer screening

    NARCIS (Netherlands)

    G. Draisma (Gerrit); J.M. van Rosmalen (Joost)

    2013-01-01

    textabstractModels of cancer screening assume that cancers are detectable by screening before being diagnosed clinically through symptoms. The duration of this preclinical phase is called sojourn time, and it determines how much diagnosis might be advanced in time by the screening test (lead time).

  11. A Monte-Carlo method which is not based on Markov chain algorithm, used to study electrostatic screening of ion potential

    Science.gov (United States)

    Šantić, Branko; Gracin, Davor

    2017-12-01

    A new simple Monte Carlo method is introduced for the study of electrostatic screening by surrounding ions. The proposed method is not based on the generally used Markov chain method for sample generation. Each sample is pristine and there is no correlation with other samples. As the main novelty, the pairs of ions are gradually added to a sample provided that the energy of each ion is within the boundaries determined by the temperature and the size of ions. The proposed method provides reliable results, as demonstrated by the screening of ion in plasma and in water.

  12. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    Science.gov (United States)

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization integrated approaches combining different chemical, biological and in silico methods are recommended to r...

  13. Screening method for detecting cross-contamination residues of tiamulin in swine feeds.

    Science.gov (United States)

    Rodríguez-Comesaña, Mirian; Cancho-Grande, Beatriz; Simal-Gándara, Jesús

    2003-01-01

    A method was developed for the determination of tiamulin (TML), 14-deoxy-14-[(2-diethylaminoethyl)mercaptoacetoxy]mutilin hydrogen fumarate, a semisynthetic derivative of the naturally occurring antibiotic pleuromutilin produced by the fungus Pleurotus mutilis. This drug, with high activity against Gram-positive bacteria, some Gram-negative bacteria, and several strains of mycoplasms is administered to animals in food, drinking water, or by injection; however, its chemical structure causes problems in analysis of feeds. Although the molecule is charged below pH 8, attempts to analyze TML-containing extracts on ion-exchange columns or other polar stationary phases have failed. Additionally, TML shows no fluorescence activity and only poor UV activity. The present method consists of organic solvent extraction followed by liquid chromatography with UV detection. A low wavelength (208 nm) was used for detection. Limits of detection and quantitation, as well as data for recovery and repeatability obtained during characterization of the method, are described. The applicability of the optimized method was tested by analyzing commercial blank feeds processed after TML-medicated feeds.

  14. Screening for microplastics in sediment, water, marine invertebrates and fish: method development and microplastic accumulation

    NARCIS (Netherlands)

    Karlsson, Therese; Vethaak, A.D.; Carney Almroth, Bethany; Ariese, Freek; van Velzen, M.J.M.; Hassellöv, Martin; Leslie, H.A.

    2017-01-01

    Measurements of microplastics in biota and abiotic matrices are key elements of exposure and risk assessments for this emerging environmental pollutant. We investigated the abundance of microplastics in field-collected biota, sediment and water. An improved sediment extraction method, based on

  15. Susceptibility screening of hyphae-forming fungi with a new, easy, and fast inoculum preparation method.

    Science.gov (United States)

    Schmalreck, Arno; Willinger, Birgit; Czaika, Viktor; Fegeler, Wolfgang; Becker, Karsten; Blum, Gerhard; Lass-Flörl, Cornelia

    2012-12-01

    In vitro susceptibility testing of clinically important fungi becomes more and more essential due to the rising number of fungal infections in patients with impaired immune system. Existing standardized microbroth dilution methods for in vitro testing of molds (CLSI, EUCAST) are not intended for routine testing. These methods are very time-consuming and dependent on sporulating of hyphomycetes. In this multicentre study, a new (independent of sporulation) inoculum preparation method (containing a mixture of vegetative cells, hyphae, and conidia) was evaluated. Minimal inhibitory concentrations (MIC) of amphotericin B, posaconazole, and voriconazole of 180 molds were determined with two different culture media (YST and RPMI 1640) according to the DIN (Deutsches Institut für Normung) microdilution assay. 24 and 48 h MIC of quality control strains, tested per each test run, prepared with the new inoculum method were in the range of DIN. YST and RPMI 1640 media showed similar MIC distributions for all molds tested. MIC readings at 48 versus 24 h yield 1 log(2) higher MIC values and more than 90 % of the MICs read at 24 and 48 h were within ± 2 log(2) dilution. MIC end point reading (log(2 MIC-RPMI 1640)-log(2 MIC-YST)) of both media demonstrated a tendency to slightly lower MICs with RPMI 1640 medium. This study reports the results of a new, time-saving, and easy-to-perform method for inoculum preparation for routine susceptibility testing that can be applied for all types of spore-/non-spore and hyphae-forming fungi.

  16. On the Salt Water Intrusion into the Durusu Lake, Istanbul: A Joint Central Loop TEM And Multi-Electrode ERT Field Survey

    Science.gov (United States)

    Ardali, Ayça Sultan; Tezkan, Bülent; Gürer, Aysan

    2018-02-01

    Durusu Lake is the biggest and most important freshwater source supplying drinking water to the European side of Istanbul. In this study, electrical resistivity tomography (ERT) and transient electromagnetic (TEM) measurements were applied to detect a possible salt water intrusion into the lake and to delineate the subsurface structure in the north of Durusu Lake. The ERT and TEM measurements were carried out along six parallel profiles extending from the sea coast to the lake shore on the dune barrier. TEM data were interpreted using different 1-D inversion methods such as Occam, Marquardt, and laterally constrained inversion (LCI). ERT data were interpreted using 2-D inversion techniques. The inversion results of ERT and TEM data were shown as resistivity depth sections including topography. The sand layer spreading over the basin has a resistivity of 150-400 Ωm with a thickness of 5-10 m. The sandy layer with clay, silt, and gravel has a resistivity of 15-100 Ωm and a thickness of 10-40 m followed by a clay layer of a resistivity below 10 Ωm. When the inversion of these data is interpreted along with the hydrogeology of the area, it is concluded that the salt water intrusion along the dune barrier is not common and occurs at a particular area where the distance between lake and sea is very close. Using information from boreholes around the lake, it was verified that the common conductive region at depths of 30 m or more consists of clay layers and clay lenses.

  17. Comparative Analysis of 3D Bladder Tumor Spheroids Obtained by Forced Floating and Hanging Drop Methods for Drug Screening

    Directory of Open Access Journals (Sweden)

    Robson L. F. Amaral

    2017-08-01

    Full Text Available Introduction: Cell-based assays using three-dimensional (3D cell cultures may reflect the antitumor activity of compounds more accurately, since these models reproduce the tumor microenvironment better.Methods: Here, we report a comparative analysis of cell behavior in the two most widely employed methods for 3D spheroid culture, forced floating (Ultra-low Attachment, ULA, plates, and hanging drop (HD methods, using the RT4 human bladder cancer cell line as a model. The morphology parameters and growth/metabolism of the spheroids generated were first characterized, using four different cell-seeding concentrations (0.5, 1.25, 2.5, and 3.75 × 104 cells/mL, and then, subjected to drug resistance evaluation.Results: Both methods generated spheroids with a smooth surface and round shape in a spheroidization time of about 48 h, regardless of the cell-seeding concentration used. Reduced cell growth and metabolism was observed in 3D cultures compared to two-dimensional (2D cultures. The optimal range of spheroid diameter (300–500 μm was obtained using cultures initiated with 0.5 and 1.25 × 104 cells/mL for the ULA method and 2.5 and 3.75 × 104 cells/mL for the HD method. RT4 cells cultured under 3D conditions also exhibited a higher resistance to doxorubicin (IC50 of 1.00 and 0.83 μg/mL for the ULA and HD methods, respectively compared to 2D cultures (IC50 ranging from 0.39 to 0.43.Conclusions: Comparing the results, we concluded that the forced floating method using ULA plates was considered more suitable and straightforward to generate RT4 spheroids for drug screening/cytotoxicity assays. The results presented here also contribute to the improvement in the standardization of the 3D cultures required for widespread application.

  18. Comparative Analysis of 3D Bladder Tumor Spheroids Obtained by Forced Floating and Hanging Drop Methods for Drug Screening.

    Science.gov (United States)

    Amaral, Robson L F; Miranda, Mariza; Marcato, Priscyla D; Swiech, Kamilla

    2017-01-01

    Introduction: Cell-based assays using three-dimensional (3D) cell cultures may reflect the antitumor activity of compounds more accurately, since these models reproduce the tumor microenvironment better. Methods: Here, we report a comparative analysis of cell behavior in the two most widely employed methods for 3D spheroid culture, forced floating (Ultra-low Attachment, ULA, plates), and hanging drop (HD) methods, using the RT4 human bladder cancer cell line as a model. The morphology parameters and growth/metabolism of the spheroids generated were first characterized, using four different cell-seeding concentrations (0.5, 1.25, 2.5, and 3.75 × 10 4 cells/mL), and then, subjected to drug resistance evaluation. Results: Both methods generated spheroids with a smooth surface and round shape in a spheroidization time of about 48 h, regardless of the cell-seeding concentration used. Reduced cell growth and metabolism was observed in 3D cultures compared to two-dimensional (2D) cultures. The optimal range of spheroid diameter (300-500 μm) was obtained using cultures initiated with 0.5 and 1.25 × 10 4 cells/mL for the ULA method and 2.5 and 3.75 × 10 4 cells/mL for the HD method. RT4 cells cultured under 3D conditions also exhibited a higher resistance to doxorubicin (IC 50 of 1.00 and 0.83 μg/mL for the ULA and HD methods, respectively) compared to 2D cultures (IC 50 ranging from 0.39 to 0.43). Conclusions: Comparing the results, we concluded that the forced floating method using ULA plates was considered more suitable and straightforward to generate RT4 spheroids for drug screening/cytotoxicity assays. The results presented here also contribute to the improvement in the standardization of the 3D cultures required for widespread application.

  19. Standard test method for initial screening of corrosion inhibiting admixtures for steel in concrete

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2007-01-01

    1.1 This test method covers a procedure for determining the effects of chemical admixtures on the corrosion of metals in concrete. This test method can be used to evaluate materials intended to inhibit chloride-induced corrosion of steel in concrete. It can also be used to evaluate the corrosivity of admixtures by themselves or in a chloride environment. This test is not applicable for emulsions. 1.2 &solely-SI-units; 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  20. A simple, rapid and inexpensive screening method for the identification of Pythium insidiosum.

    Science.gov (United States)

    Tondolo, Juliana Simoni Moraes; Loreto, Erico Silva; Denardi, Laura Bedin; Mario, Débora Alves Nunes; Alves, Sydney Hartz; Santurio, Janio Morais

    2013-04-01

    Growth of Pythium insidiosum mycelia around minocycline disks (30μg) did not occur within 7days of incubation at 35°C when the isolates were grown on Sabouraud, corn meal, Muller-Hinton or RPMI agar. This technique offers a simple and rapid method for the differentiation of P. insidiosum from true filamentous fungi. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. SERS-based detection methods for screening of genetically modified bacterial strains

    DEFF Research Database (Denmark)

    Morelli, Lidia

    factories vary largely, including industrial production of valuable compounds for biofuels, polymer synthesis and food, cosmetic and pharmaceutical industry. The improvement of computational and biochemical tools has revolutionized the synthesis of novel modified microbial strains, opening up new......The importance of metabolic engineering has been growing over the last decades, establishing the use of genetically modified microbial strains for overproduction of metabolites at industrial scale as an innovative, convenient and biosustainable method. Nowadays, application areas of microbial...

  2. Cocrystal Screening of Ibuprofen with Oxalic Acid and Citric Acid via Grinding Method

    Science.gov (United States)

    Othman, M. F.; Anuar, N.; Rahman, S. Ad; Taifuddin, N. A. Ahmad

    2018-05-01

    Ibuprofen is a Class II Biological Safety Class (BSC) drugs used for relief of arthritis, as an analgesic and possesses the effect of antiplatelet. The major problem involves in ibuprofen is it has a low solubility and high permeability thus causes an unsatisfactory therapeutic effect to humans. Thus, in this work, alteration of ibuprofen’s physicochemical properties is conducted by means of cocrystallization technique. Co-crystallizations of ibuprofen were prepared with selected coformers using dry grinding and liquid assisted grinding (LAG) techniques in different molar ratios while ethanol and propanol were used as a solvent. The new crystalline forms were identified and characterized by differential scanning calorimetry (DSC), powder X-ray diffraction (PXRD) and fourier transform infrared spectroscopy (FTIR). Analysis for Ibuprofen-Citric acid (IBP-CA) system, co-crystal was successfully formed in 1:2, 1:3, 2:1 and 3:1 molar ratios for neat grinding method although the co-crystal produced is unstable. Meanwhile, for Ibuprofen-Oxalic acid (IBP-OA) system, the co-crystal formation was identified only in 1:1, 1:2 and 1:3 molar ratios for the neat grinding method. LAG method shows that co-crystal formation was unsuccessful in both solvents for IBP-CA, while IBP-OA co-crystal was formed in the molar ratio 1:1, 2:1 and 3:1 in ethanol, and 2:1 and 3:1 in propanol.

  3. Vision Screening

    Science.gov (United States)

    ... an efficient and cost-effective method to identify children with visual impairment or eye conditions that are likely to lead ... main goal of vision screening is to identify children who have or are at ... visual impairment unless treated in early childhood. Other problems that ...

  4. A rapid and simple chemiluminescence method for screening levels of inosine and hypoxanthine in non-traumatic chest pain patients.

    Science.gov (United States)

    Farthing, Don E; Sica, Domenic; Hindle, Michael; Edinboro, Les; Xi, Lei; Gehr, Todd W B; Gehr, Lynne; Farthing, Christine A; Larus, Terri L; Fakhry, Itaf; Karnes, H Thomas

    2011-01-01

    A rapid and simple chemiluminescence method was developed for detection of inosine and hypoxanthine in human plasma. The method utilized a microplate luminometer with direct injectors to automatically dispense reagents during sample analysis. Enzymatic conversions of inosine to hypoxanthine, followed by hypoxanthine to xanthine to uric acid, generated superoxide anion radicals as a useful metabolic by-product. The free radicals react with Pholasin(®) , a sensitive photoprotein used for chemiluminescence detection, to produce measurable blue-green light. The use of Pholasin(®) and a chemiluminescence signal enhancer, Adjuvant-K™, eliminated the need for plasma clean-up steps prior to analysis. The method used 20 μL of heparinized plasma, with complete analysis of total hypoxanthine levels (inosine is metabolized to hypoxanthine using purine nucleoside phosphorylase) in approximately 3.7 min. The rapid chemiluminescence method demonstrated the capability of differentiating total hypoxanthine levels between healthy individuals, and patients presenting with non-traumatic chest pain and potential acute cardiac ischemia. The results support the potential use of chemiluminescence methodology as a diagnostic tool to rapidly screen for elevated levels of inosine and hypoxanthine in human plasma, potential biomarkers of acute cardiac ischemia. Copyright © 2009 John Wiley & Sons, Ltd.

  5. Further Validation of a Rapid Screening Semiquantitative Thin-Layer Chromatographic Method for Marketed Antimalarial Medicines for Adoption in Malawi

    Directory of Open Access Journals (Sweden)

    Dorcas Osei-Safo

    2018-01-01

    Full Text Available A recently developed semiquantitative thin-layer chromatographic (SQ-TLC assay has been employed in postmarketing surveillance of antimalarial medicines used in Malawi prior to HPLC assay. Both methods gave analogous results in a significant majority of the samples, with a good correlation (r = 0.9012 for the active pharmaceutical ingredients of the dosage forms assayed. Artemether-containing medicines had the highest percentage (92.67% of samples with comparable results for both assays. The lowest percentage (66.67% was observed in artesunate-containing medicines. The SQ-TLC method was validated for specificity, accuracy, precision, linearity, and stability according to the International Conference on Harmonisation guidelines, with the results falling within acceptable limits. For specificity, retention factor values of the test samples and reference standards were comparable, while accuracy and precision of 91.1 ± 5.7% were obtained for all samples. The method was linear in the range 1.0–2.0 µg/spot with a correlation coefficient of r = 0.9783. Stability tests also fell within acceptable limits. In this study, we present the validation of the SQ-TLC method and propose its adoption as a rapid screening tool for field estimation of the quality of antimalarial and other essential medicines in Malawi and other parts of the developing world prior to a more accurate HPLC assay.

  6. A rapid and simple screening method for methamphetamine in urine by radioimmunoassay using a 125I-labeled metahmphetamine derivative

    International Nuclear Information System (INIS)

    Inayama, Seiichi; Tokunaga, Yukiko; Hosoya, Eikichi; Nakadate, Teruo; Niwaguchi, Tetsukichi.

    1980-01-01

    N-Carboxymethylmethamphetamine, a derivative of methamphetamine, was prepared through a new synthetic pathway from ephedrine. Specific antiserum was obtained by immunization of rabbits with the conjugate of N-carboxymethylmethamphetamine with bovine serum albumin. A radioimmunoassay procedure was established using this antibody (specific for methamphetamine) and a 125 I-methamphetamine derivative. A high degree of specificity of the antibody was confirmed by testing for cross-reaction with several methamphetamine analogs, and the sensitivity was found to be 1 ng/tube. The present micro method using radioimmunoassay is highly sensitive, rapid, simple and may be useful as a micro-scale primary screening test for methamphetamine excreted in human urine, for forensic and medical purposes. (author)

  7. Comparison of real-time PCR with disk diffusion, agar screen and E-test methods for detection of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Shariati, Laleh; Validi, Majid; Tabatabaiefar, Mohammad Amin; Karimi, Ali; Nafisi, Mohammad Reza

    2010-12-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a nosocomial pathogen. Our main objective was to compare oxacillin disk test, oxacillin E-test, and oxacillin agar screen for detection of methicillin resistance in S. aureus, using real-time PCR for mecA as the "gold standard" comparison assay. 196 S. aureus isolates were identified out of 284 Staphylococcus isolates. These isolates were screened for MRSA with several methods: disk diffusion, agar screen (6.0 μg/ml), oxacillin E-test, and real-time PCR for detection of mecA gene. Of the 196 S. aureus isolates tested, 96 isolates (49%) were mecA-positive and 100 isolates (51%) mecA-negative. All methods tested had a statistically significant agreement with real-time PCR. E-test was 100% sensitive and specific for mecA presence. The sensitivity and specificity of oxacillin agar screen method were 98 and 99%, respectively and sensitivity and specificity of oxacillin disk diffusion method were 95 and 93%, respectively. In the present study, oxacillin E-test is proposed as the best phenotypic method. For economic reasons, the oxacillin agar screen method (6.0 μg/ml), which is suitable for the detection of MRSA, is recommended due to its accuracy and low cost.

  8. Establish an automated flow injection ESI-MS method for the screening of fragment based libraries: Application to Hsp90.

    Science.gov (United States)

    Riccardi Sirtori, Federico; Caronni, Dannica; Colombo, Maristella; Dalvit, Claudio; Paolucci, Mauro; Regazzoni, Luca; Visco, Carlo; Fogliatto, Gianpaolo

    2015-08-30

    ESI-MS is a well established technique for the study of biopolymers (nucleic acids, proteins) and their non covalent adducts, due to its capacity to detect ligand-target complexes in the gas phase and allows inference of ligand-target binding in solution. In this article we used this approach to investigate the interaction of ligands to the Heat Shock Protein 90 (Hsp90). This enzyme is a molecular chaperone involved in the folding and maturation of several proteins which has been subjected in the last years to intensive drug discovery efforts due to its key role in cancer. In particular, reference compounds, with a broad range of dissociation constants from 40pM to 100μM, were tested to assess the reliability of ESI-MS for the study of protein-ligand complexes. A good agreement was found between the values measured with a fluorescence polarization displacement assay and those determined by mass spectrometry. After this validation step we describe the setup of a medium throughput screening method, based on ESI-MS, suitable to explore interactions of therapeutic relevance biopolymers with chemical libraries. Our approach is based on an automated flow injection ESI-MS method (AFI-MS) and has been applied to screen the Nerviano Medical Sciences proprietary fragment library of about 2000 fragments against Hsp90. In order to discard false positive hits and to discriminate those of them interacting with the N-terminal ATP binding site, competition experiments were performed using a reference inhibitor. Gratifyingly, this group of hits matches with the ligands previously identified by NMR FAXS techniques and confirmed by X-ray co-crystallization experiments. These results support the use of AFI-MS for the screening of medium size libraries, including libraries of small molecules with low affinity typically used in fragment based drug discovery. AFI-MS is a valid alternative to other techniques with the additional opportunities to identify compounds interacting with

  9. Application of a microbiological screening method for the indication of irradiation of poultry meat

    International Nuclear Information System (INIS)

    Wirtanen, G.; Karwoski, M.; Sjoberg, A.-M.; Salo, S.

    1996-01-01

    The FDA (Food and Drug Administration of the Department of Health and Human Services, USA) ruling of May 1990 permits the use of irradiation of fresh or frozen poultry and poultry parts, including ground and mechanically separated poultry products, at absorbed doses of 1.5 to 3 kGy to control foodborne pathogens and bacteria. The aim of this study was to apply a microbiological method (DEFT/APC) to assess the possible irradiation treatment of samples of frozen poultry meat. (author)

  10. Automated Segmentation Methods of Drusen to Diagnose Age-Related Macular Degeneration Screening in Retinal Images

    OpenAIRE

    Kim, Young Jae; Kim, Kwang Gi

    2018-01-01

    Existing drusen measurement is difficult to use in clinic because it requires a lot of time and effort for visual inspection. In order to resolve this problem, we propose an automatic drusen detection method to help clinical diagnosis of age-related macular degeneration. First, we changed the fundus image to a green channel and extracted the ROI of the macular area based on the optic disk. Next, we detected the candidate group using the difference image of the median filter within the ROI. We...

  11. Screening tests for hazard classification of complex waste materials – Selection of methods

    International Nuclear Information System (INIS)

    Weltens, R.; Vanermen, G.; Tirez, K.; Robbens, J.; Deprez, K.; Michiels, L.

    2012-01-01

    In this study we describe the development of an alternative methodology for hazard characterization of waste materials. Such an alternative methodology for hazard assessment of complex waste materials is urgently needed, because the lack of a validated instrument leads to arbitrary hazard classification of such complex waste materials. False classification can lead to human and environmental health risks and also has important financial consequences for the waste owner. The Hazardous Waste Directive (HWD) describes the methodology for hazard classification of waste materials. For mirror entries the HWD classification is based upon the hazardous properties (H1–15) of the waste which can be assessed from the hazardous properties of individual identified waste compounds or – if not all compounds are identified – from test results of hazard assessment tests performed on the waste material itself. For the latter the HWD recommends toxicity tests that were initially designed for risk assessment of chemicals in consumer products (pharmaceuticals, cosmetics, biocides, food, etc.). These tests (often using mammals) are not designed nor suitable for the hazard characterization of waste materials. With the present study we want to contribute to the development of an alternative and transparent test strategy for hazard assessment of complex wastes that is in line with the HWD principles for waste classification. It is necessary to cope with this important shortcoming in hazardous waste classification and to demonstrate that alternative methods are available that can be used for hazard assessment of waste materials. Next, by describing the pros and cons of the available methods, and by identifying the needs for additional or further development of test methods, we hope to stimulate research efforts and development in this direction. In this paper we describe promising techniques and argument on the test selection for the pilot study that we have performed on different

  12. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Mancini-Filho, J.; Delincee, H.

    2000-01-01

    Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionising radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enabled a rapid identification of the radiation treatment

  13. Group B streptococcus detection in China: comparison of different screening methods and different sampling sites

    Directory of Open Access Journals (Sweden)

    Xi Wang, Yingna Song, Liangkun Ma, Juntao Liu, Yingchun Xu, Jie Yi

    2016-12-01

    Full Text Available Objectives: To evaluate the use of real-time polymerase chain reaction (RT-PCR and bacterial culture methods to detect group B streptococcus (GBS in Chinese pregnant women in the third trimester; to separately assess the prevalence of rectal and vaginal GBS colonization ; and to determine the antimicrobial susceptibility pattern of the isolates. Methodology: Samples were collected from 505 women at 35 and 37 weeks gestation at the Peking Union Medical College Hospital. Bacterial culture and RT-PCR were performed. Antimicrobial susceptibility to commonly used antibiotics was also analyzed. Results: The overall GBS colonization rate was 7.5%. The colonization rate, sensitivity, and negative predictive value of the bacterial culture method were 2.8%, 36.8%, and 95.1%, respectively, and these values were 7.3%, 97.4%, and 99.8%, respectively, for PCR (p<0.001. The GBS colonization rate of the rectum (6.7% was higher than that of the vagina (2.8% (p=0.005. Antimicrobial susceptibility testing showed that 100% were sensitive to penicillin, cephalosporin and vancomycin. Conclusions: RT-PCR was found to be a rapid and sensitive test for the detection of GBS colonization in Chinese pregnant women. Rectal swabbing was also important for detecting GBS colonization. β-lactams are the first-line antibiotics used for the treatment of GBS. J Microbiol Infect Dis 2016;6(4: 179-183

  14. Automated Segmentation Methods of Drusen to Diagnose Age-Related Macular Degeneration Screening in Retinal Images

    Directory of Open Access Journals (Sweden)

    Young Jae Kim

    2018-01-01

    Full Text Available Existing drusen measurement is difficult to use in clinic because it requires a lot of time and effort for visual inspection. In order to resolve this problem, we propose an automatic drusen detection method to help clinical diagnosis of age-related macular degeneration. First, we changed the fundus image to a green channel and extracted the ROI of the macular area based on the optic disk. Next, we detected the candidate group using the difference image of the median filter within the ROI. We also segmented vessels and removed them from the image. Finally, we detected the drusen through Renyi’s entropy threshold algorithm. We performed comparisons and statistical analysis between the manual detection results and automatic detection results for 30 cases in order to verify validity. As a result, the average sensitivity was 93.37% (80.95%~100% and the average DSC was 0.73 (0.3~0.98. In addition, the value of the ICC was 0.984 (CI: 0.967~0.993, p<0.01, showing the high reliability of the proposed automatic method. We expect that the automatic drusen detection helps clinicians to improve the diagnostic performance in the detection of drusen on fundus image.

  15. Screening Internet forum participants for depression symptoms by assembling and enhancing multiple NLP methods.

    Science.gov (United States)

    Karmen, Christian; Hsiung, Robert C; Wetter, Thomas

    2015-06-01

    Depression is a disease that can dramatically lower quality of life. Symptoms of depression can range from temporary sadness to suicide. Embarrassment, shyness, and the stigma of depression are some of the factors preventing people from getting help for their problems. Contemporary social media technologies like Internet forums or micro-blogs give people the opportunity to talk about their feelings in a confidential anonymous environment. However, many participants in such networks may not recognize the severity of their depression and their need for professional help. Our approach is to develop a method that detects symptoms of depression in free text, such as posts in Internet forums, chat rooms and the like. This could help people appreciate the significance of their depression and realize they need to seek help. In this work Natural Language Processing methods are used to break the textual information into its grammatical units. Further analysis involves detection of depression symptoms and their frequency with the help of words known as indicators of depression and their synonyms. Finally, similar to common paper-based depression scales, e.g., the CES-D, that information is incorporated into a single depression score. In this evaluation study, our depressive mood detection system, DepreSD (Depression Symptom Detection), had an average precision of 0.84 (range 0.72-1.0 depending on the specific measure) and an average F measure of 0.79 (range 0.72-0.9). Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Delincee, H.

    1998-01-01

    Complete text of publication follows. Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionizing radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In fact, DNA fragmentation measured in single cells by agarose gel electrophoresis - DNA Comet Assay - has shown to offer great potential as a rapid tool to detect whether a wide variety of foodstuffs has been radiation processed. However, more work is needed to exploit the full potential of this promising technique. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma-rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enable a rapid identification of the radiation treatment

  17. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

    Science.gov (United States)

    2009-01-01

    and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method was found to perform well. The test is currently being implemented for screening of several hundred thousand samples per year at a number of major Danish slaughterhouses to shorten the post-slaughter storage time and facilitate the swift export of fresh meat. PMID:19422711

  18. Large Scale Screening of Southern African Plant Extracts for the Green Synthesis of Gold Nanoparticles Using Microtitre-Plate Method

    Directory of Open Access Journals (Sweden)

    Abdulrahman M. Elbagory

    2016-11-01

    Full Text Available The preparation of gold nanoparticles (AuNPs involves a variety of chemical and physical methods. These methods use toxic and environmentally harmful chemicals. Consequently, the synthesis of AuNPs using green chemistry has been under investigation to develop eco-friendly nanoparticles. One approach to achieve this is the use of plant-derived phytochemicals that are capable of reducing gold ions to produce AuNPs. The aim of this study was to implement a facile microtitre-plate method to screen a large number of aqueous plant extracts to determine the optimum concentration (OC for the bio-synthesis of the AuNPs. Several AuNPs of different sizes and shapes were successfully synthesized and characterized from 17 South African plants. The characterization was done using Ultra Violet-Visible Spectroscopy, Dynamic Light Scattering, High Resolution Transmission Electron Microscopy and Energy-Dispersive X-ray Spectroscopy. We also studied the effects of temperature on the synthesis of the AuNPs and showed that changes in temperatures affect the size and dispersity of the generated AuNPs. We also evaluated the stability of the synthesized AuNPs and showed that some of them are stable in biological buffer solutions.

  19. Development of a loop-mediated isothermal amplification method for rapid mass-screening of sand flies for Leishmania infection.

    Science.gov (United States)

    Nzelu, Chukwunonso O; Gomez, Eduardo A; Cáceres, Abraham G; Sakurai, Tatsuya; Martini-Robles, Luiggi; Uezato, Hiroshi; Mimori, Tatsuyuki; Katakura, Ken; Hashiguchi, Yoshihisa; Kato, Hirotomo

    2014-04-01

    Entomological monitoring of Leishmania infection in leishmaniasis endemic areas offers epidemiologic advantages for predicting the risk and expansion of the disease, as well as evaluation of the effectiveness of control programs. In this study, we developed a highly sensitive loop-mediated isothermal amplification (LAMP) method for the mass screening of sand flies for Leishmania infection based on the 18S rRNA gene. The LAMP technique could detect 0.01 parasites, which was more sensitive than classical PCR. The method was robust and could amplify the target DNA within 1h from a crude sand fly template without DNA purification. Amplicon detection could be accomplished by the newly developed colorimetric malachite green (MG)--mediated naked eye visualization. Pre-addition of MG to the LAMP reaction solution did not inhibit amplification efficiency. The field applicability of the colorimetric MG-based LAMP assay was demonstrated with 397 field-caught samples from the endemic areas of Ecuador and eight positive sand flies were detected. The robustness, superior sensitivity, and ability to produce better visual discriminatory reaction products than existing LAMP fluorescence and turbidity assays indicated the field potential usefulness of this new method for surveillance and epidemiological studies of leishmaniasis in developing countries. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants.

    Science.gov (United States)

    Chen, Longzheng; Li, Wei; Katin-Grazzini, Lorenzo; Ding, Jing; Gu, Xianbin; Li, Yanjun; Gu, Tingting; Wang, Ren; Lin, Xinchun; Deng, Ziniu; McAvoy, Richard J; Gmitter, Frederick G; Deng, Zhanao; Zhao, Yunde; Li, Yi

    2018-01-01

    Developing CRISPR/Cas9-mediated non-transgenic mutants in asexually propagated perennial crop plants is challenging but highly desirable. Here, we report a highly useful method using an Agrobacterium -mediated transient CRISPR/Cas9 gene expression system to create non-transgenic mutant plants without the need for sexual segregation. We have also developed a rapid, cost-effective, and high-throughput mutant screening protocol based on Illumina sequencing followed by high-resolution melting (HRM) analysis. Using tetraploid tobacco as a model species and the phytoene desaturase ( PDS ) gene as a target, we successfully created and expediently identified mutant plants, which were verified as tetra-allelic mutants. We produced pds mutant shoots at a rate of 47.5% from tobacco leaf explants, without the use of antibiotic selection. Among these pds plants, 17.2% were confirmed to be non-transgenic, for an overall non-transgenic mutation rate of 8.2%. Our method is reliable and effective in creating non-transgenic mutant plants without the need to segregate out transgenes through sexual reproduction. This method should be applicable to many economically important, heterozygous, perennial crop species that are more difficult to regenerate.

  1. Footboards: Indigenous and novel method of screening for diabetes peripheral neuropathy – A pilot study

    Directory of Open Access Journals (Sweden)

    Akram Hussain Bijli

    2017-01-01

    Full Text Available Background: To validate the effectiveness of indigenously designed “footboard (FB” in early diagnosis of diabetic peripheral neuropathy (PNP by comparing it with Semmes–Weinstein monofilament (SWM and vibration perception (VP. Materials and Methods: Two hundred and forty-four patients with diabetes were examined for PNP using SWM and 128 Hz tuning fork. The findings were compared with indigenously designed FBs with 1, 2, and 3 mm elevations. Results: Out of 108 patients who did not have protective sensation as per SWM, only 10 (9.2% felt 1 mm board bearings, and out of 72 patients who did not feel vibration, only 8 (11.1% felt 1 mm board bearings. Out of 136 patients who had protective sensation, 128 (94.11% felt 2 mm elevated board bearings, and out of 172 patients who had VP, only 152 patients (88.3% felt 2 mm board bearings. With SWM as standard, the sensitivities and specificities, respectively, were 63% and 90% (1 mm board, and 94% and 60% (2 mm board. With VP, the sensitivities and specificities, respectively, were 59% and 90% (1 mm board, and 88% and 61% (2 mm board. Conclusions: FB, which simultaneously tests touch and pressure sensation, shows a high level of performance in detecting at-risk feet. FB may be simple, time-efficient, and inexpensive test for detection of neuropathy and needs further validation in a larger study.

  2. False positive results using calcitonin as a screening method for medullary thyroid carcinoma

    Directory of Open Access Journals (Sweden)

    Rafael Loch Batista

    2013-01-01

    Full Text Available The role of serum calcitonin as part of the evaluation of thyroid nodules has been widely discussed in literature. However there still is no consensus of measurement of calcitonin in the initial evaluation of a patient with thyroid nodule. Problems concerning cost-benefit, lab methods, false positive and low prevalence of medullary thyroid carcinoma (MTC are factors that limit this approach. We have illustrated two cases where serum calcitonin was used in the evaluation of thyroid nodule and rates proved to be high. A stimulation test was performed, using calcium as secretagogue, and calcitonin hyper-stimulation was confirmed, but anatomopathologic examination did not evidence medullar neoplasia. Anatomopathologic diagnosis detected Hashimoto thyroiditis in one case and adenomatous goiter plus an occult papillary thyroid carcinoma in the other one. Recommendation for routine use of serum calcitonin in the initial diagnostic evaluation of a thyroid nodule, followed by a confirming stimulation test if basal serum calcitonin is showed to be high, is the most currently recommended approach, but questions concerning cost-benefit and possibility of diagnosis error make the validity of this recommendation discussible.

  3. Development of a targeted GC/MS screening method and validation of an HPLC/DAD quantification method for piperazines–amphetamines mixtures in seized material

    Directory of Open Access Journals (Sweden)

    Yacine Boumrah

    2014-09-01

    Full Text Available Piperazine-related drugs are sold as party pills in the form of tablets, capsules, liquids or powders. These party pills can contain several piperazine derivatives, or even a mixture of piperazines and amphetamine derivatives. This paper describes a screening method using a gas chromatography–mass spectrometry technique allowing the separation and the identification of active components within these mixtures by a combined silylation and acylation derivatization procedure. The studied substances–namely: 1-benzylpiperazine (BZP, 1-(3,4-methylenedioxyben-zylpiperazine (MDBP, 1-(3-trifluoromethylphenylpiperazine (TFMPP, 1-(3-chlorophenyl piperazine (mCPP, 1-(4-methoxyphenyl piperazine (MeOPP, amphetamine, methamphetamine, ephedrine, pseudoephedrine, 3,4-methylenedioxy-N-methamphetamine (MDMA, 3,4-methylenedi-oxyamphetamine (MDA, 3,4-methylenedioxy-N-ethylamphetamine (MDEA and N-methyl-1,3-benzodioxolylbutanamine (MBDB–are separated.

  4. A comparison of hydroponic and soil-based screening methods to identify salt tolerance in the field in barley

    Science.gov (United States)

    Tavakkoli, Ehsan; Fatehi, Foad; Rengasamy, Pichu; McDonald, Glenn K.

    2012-01-01

    Success in breeding crops for yield and other quantitative traits depends on the use of methods to evaluate genotypes accurately under field conditions. Although many screening criteria have been suggested to distinguish between genotypes for their salt tolerance under controlled environmental conditions, there is a need to test these criteria in the field. In this study, the salt tolerance, ion concentrations, and accumulation of compatible solutes of genotypes of barley with a range of putative salt tolerance were investigated using three growing conditions (hydroponics, soil in pots, and natural saline field). Initially, 60 genotypes of barley were screened for their salt tolerance and uptake of Na+, Cl–, and K+ at 150 mM NaCl and, based on this, a subset of 15 genotypes was selected for testing in pots and in the field. Expression of salt tolerance in saline solution culture was not a reliable indicator of the differences in salt tolerance between barley plants that were evident in saline soil-based comparisons. Significant correlations were observed in the rankings of genotypes on the basis of their grain yield production at a moderately saline field site and their relative shoot growth in pots at ECe 7.2 [Spearman’s rank correlation (rs)=0.79] and ECe 15.3 (rs=0.82) and the crucial parameter of leaf Na+ (rs=0.72) and Cl– (rs=0.82) concentrations at ECe 7.2 dS m−1. This work has established screening procedures that correlated well with grain yield at sites with moderate levels of soil salinity. This study also showed that both salt exclusion and osmotic tolerance are involved in salt tolerance and that the relative importance of these traits may differ with the severity of the salt stress. In soil, ion exclusion tended to be more important at low to moderate levels of stress but osmotic stress became more important at higher stress levels. Salt exclusion coupled with a synthesis of organic solutes were shown to be important components of salt

  5. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  6. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  7. Evaluation of radiography as a screening method for detection and characterisation of congenital vertebral malformations in dogs.

    Science.gov (United States)

    Brocal, Josep; De Decker, Steven; José-López, Roberto; Guevar, Julien; Ortega, Maria; Parkin, Tim; Ter Haar, Gert; Gutierrez-Quintana, Rodrigo

    2018-05-19

    Congenital vertebral malformations (CVM) are common in brachycephalic 'screw-tailed' dogs; they can be associated with neurological deficits and a genetic predisposition has been suggested. The purpose of this study was to evaluate radiography as a screening method for congenital thoracic vertebral malformations in brachycephalic 'screw-tailed' dogs by comparing it with CT. Forty-nine dogs that had both radiographic and CT evaluations of the thoracic vertebral column were included. Three observers retrospectively reviewed the images independently to detect CVMs. When identified, they were classified according to a previously published radiographic classification scheme. A CT consensus was then reached. All observers identified significantly more affected vertebrae when evaluating orthogonal radiographic views compared with lateral views alone; and more affected vertebrae with the CT consensus compared with orthogonal radiographic views. Given the high number of CVMs per dog, the number of dogs classified as being CVM free was not significantly different between CT and radiography. Significantly more midline closure defects were also identified with CT compared with radiography. Malformations classified as symmetrical or ventral hypoplasias on radiography were frequently classified as ventral and medial aplasias on CT images. Our results support that CT is better than radiography for the classification of CVMs and this will be important when further evidence of which are the most clinically relevant CVMs is identified. These findings are of particular importance for designing screening schemes of CVMs that could help selective breeding programmes based on phenotype and future studies. © British Veterinary Association (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  8. A mix-and-read drop-based in vitro two-hybrid method for screening high-affinity peptide binders

    Science.gov (United States)

    Cui, Naiwen; Zhang, Huidan; Schneider, Nils; Tao, Ye; Asahara, Haruichi; Sun, Zhiyi; Cai, Yamei; Koehler, Stephan A.; de Greef, Tom F. A.; Abbaspourrad, Alireza; Weitz, David A.; Chong, Shaorong

    2016-01-01

    Drop-based microfluidics have recently become a novel tool by providing a stable linkage between phenotype and genotype for high throughput screening. However, use of drop-based microfluidics for screening high-affinity peptide binders has not been demonstrated due to the lack of a sensitive functional assay that can detect single DNA molecules in drops. To address this sensitivity issue, we introduced in vitro two-hybrid system (IVT2H) into microfluidic drops and developed a streamlined mix-and-read drop-IVT2H method to screen a random DNA library. Drop-IVT2H was based on the correlation between the binding affinity of two interacting protein domains and transcriptional activation of a fluorescent reporter. A DNA library encoding potential peptide binders was encapsulated with IVT2H such that single DNA molecules were distributed in individual drops. We validated drop-IVT2H by screening a three-random-residue library derived from a high-affinity MDM2 inhibitor PMI. The current drop-IVT2H platform is ideally suited for affinity screening of small-to-medium-sized libraries (103–106). It can obtain hits within a single day while consuming minimal amounts of reagents. Drop-IVT2H simplifies and accelerates the drop-based microfluidics workflow for screening random DNA libraries, and represents a novel alternative method for protein engineering and in vitro directed protein evolution. PMID:26940078

  9. Screening of pollution control and clean-up materials for river chemical spills using the multiple case-based reasoning method with a difference-driven revision strategy.

    Science.gov (United States)

    Liu, Rentao; Jiang, Jiping; Guo, Liang; Shi, Bin; Liu, Jie; Du, Zhaolin; Wang, Peng

    2016-06-01

    In-depth filtering of emergency disposal technology (EDT) and materials has been required in the process of environmental pollution emergency disposal. However, an urgent problem that must be solved is how to quickly and accurately select the most appropriate materials for treating a pollution event from the existing spill control and clean-up materials (SCCM). To meet this need, the following objectives were addressed in this study. First, the material base and a case base for environment pollution emergency disposal were established to build a foundation and provide material for SCCM screening. Second, the multiple case-based reasoning model method with a difference-driven revision strategy (DDRS-MCBR) was applied to improve the original dual case-based reasoning model method system, and screening and decision-making was performed for SCCM using this model. Third, an actual environmental pollution accident from 2012 was used as a case study to verify the material base, case base, and screening model. The results demonstrated that the DDRS-MCBR method was fast, efficient, and practical. The DDRS-MCBR method changes the passive situation in which the choice of SCCM screening depends only on the subjective experience of the decision maker and offers a new approach to screening SCCM.